Datasets:

LA1512

/

pubmed-val-1K

like 0

about 30 years ago , methyldopa and penicillin were the two medications most commonly associated with drug - induced autoimmune hemolytic anemia ( diiha ) . methyldopa and intravenous penicillin accounted for 67% and 25% , of all drug - induced immune hemolytic anemia , respectively . currently , most cases of diiha are attributed to second- and third - generation cephalosporins , most commonly ceftriaxone , and this drug has become the most common cause of antibiotic - induced hemolysis . we present a case of diiha following ceftriaxone use , managed successfully with withdrawal of the drug and supportive measures . since this antibiotic is widely used by clinicians across all specialties , it is important to be aware of this possibility to enable us to make an early diagnosis . a 60-years - old lady , with no past history of any drug allergies , presented with fever and productive cough of five days duration . clinically , she had fever , tachycardia , tachypnea with crackles in the right mammary area . x - ray chest confirmed pneumonia in the right middle zone [ figure 1 ] . on admission , her investigation were as in [ table 1 ] x - ray chest of the patient showing consolidation in right middle zone laboratory parameters of the patient suffering from ceftrixone - induced hemolysis a diagnosis of community - acquired pneumonia was made , and patient was started on intravenous ceftriaxone one gram 12 hourly . her hemoglobin dropped down to 7.5 g / dl within 24 hrs and further to 5.5 g / dl after 72 hrs , with peripheral blood smear showing marked polychromasia with three nucleated red cells per 100 white blood cells , schistocytes , a corrected reticulocyte count of 4.0% and ldh of 1221 units / l . serum bilirubin rose to 2 mg / dl with indirect of 1.5 mg / dl . a diagnosis of ceftriaxone - induced aiha was made , and the drug was stopped immediately . two units of packed red blood cells were transfused as she had symptomatic anemia , her hemoglobin increased to 8.6 g / dl and thereafter to 9.8 g / dl at discharge , after two weeks with no further deterioration . ceftriaxone - induced urticaria , rash , exanthem , and pruritus are the most common adverse effects and occur in about three percent of patients . the first case of hemolysis induced by ceftriaxone was reported in 1991 by garratty et al . in a 52-year - old woman who was treated with ceftriaxone . this was the first case of immune hemolytic anemia associated with ceftriaxone , and also the first case of fatal cephalosporin - induced hemolytic anemia . thereafter , in 1995 , a case report of a 24-month - old boy with sickle cell disease who had cardiac arrest and died 36 hours later from multiple organ failure after starting ceftriaxone . another case of a 16-year - old girl was reported in 1999 who had developed ceftriaxone - induced intravascular hemolysis leading to acute renal failure and death . drug - dependent antibodies ( antibodies react in vitro with rbc 's , only in presence of drug ) are produced by antibiotics like ceftriaxone and pipercillin . these drugs attach to rbc , but do not bind covalently to rbc membrane proteins . combination of drug and antibody creates an immunogen , which activates complement and results in acute intravascular hemolysis . drug - independent antibodies ( drug not required to be present to detect antibodies in vitro ) are produced by drugs as fludarabine , methyldopa , and penicillins . these drugs combine covalently with rbc membrane proteins , and the antibody - coated rbc are taken up by macrophages . ceftriaxone - induced aiha , though rare , can be fatal if not thought of . it needs high index of clinical suspicion in patients treated with ceftriaxone who develop sudden drop in hemoglobin , hemoglobinuria , and evidence of hemolysis in peripheral blood smear . beta lactam antibiotics should be used with caution in patients who have history of adverse effects to ceftriaxone because of cross reactivity . according to the world health organization ( who ) system of causality definitions , the adr ( adverse drug reaction ) in this reported case is categorized as probable with naranjp algorithm score of six , as the patient developed hemolysis after intravenous administration of ceftriaxone . there was no other possible cause of hemolysis as no other drug was used with ceftriaxone . rechallenge was not done due to inherent risk involved , but the patient showed improvement after stopping the drug . though drug - induced autoimmune hemolytic anemia is a rare adverse reaction , they may be fatal in some cases .

immune hemolytic anemia is a rare adverse effect of ceftriaxone , a third - generation cephalosporin , which is a commonly used antibiotic . we describe a 60-years - old lady , a case of community - acquired pneumonia , who developed severe hemolysis after the first dose of ceftriaxone . her hemoglobin dropped from 9.6 g /dl to 5.5 g /dl . however , she improved after discontinuation of the drug and blood transfusion . this report serves as a reminder to medical fraternity that life - threatening hemolysis can rarely follow administration of ceftriaxone .

Introduction Case Report Discussion Conclusion

prostate cancer ( pca ) may be present , but undetectable , for several decades before finally being diagnosed by a clinician . despite improvements in screening and early diagnosis , approximately one third of men whose cancer is detected early will still develop pca metastases . for men with metastatic pca , there are few alternatives and the front - line treatment is androgen ablation or surgical castration resulting in a favorable clinical response and a dramatic regression of pca as a result of apoptotic cell death . most of these patients , however , will experience a recurrence within 5 years and no effective alternative therapies are currently available . therefore , there is an urgent need to develop progression - associated markers for pca that will allow for a more aggressive treatment approach in patients likely to develop recurrent tumors and that may also facilitate the treatment of patients unlikely to have a recurrence . homeobox proteins are generally considered as modulators for growth and differentiation , and their loss or gain of expression is increasingly reported in human tumors ( 1 ) . most notably , nkx3.1 , a prostate - specific non - hox homeodomain protein , functions as a tumor suppressor and its loss has been observed in early - phase prostate tumors , while its overexpression has also been reported in advanced pca ( 24 ) . homeobox protein shares a similar function to nkx3.1 , and there is evidence to suggest the link between the role of hoxb13 and the malignant progression of pca . notably , the highly prostate - specific expression pattern of hoxb13 is involved in the proper formation and maintenance of this hormone - dependent organ ( 58 ) . hoxb13 loss - of - function mice have been shown to manifest abnormal prostate ( 9 ) . hoxb13 suppresses androgen - stimulated androgen receptor ( ar ) activity through interaction with ar and subsequently inhibits the growth - regulatory function of ar ( 7,10 ) . however , hoxb13 is overexpressed in most androgen - refractory pcas ( 11 ) . in breast cancers possessing similar biological behavior to pca , the overexpression of hoxb13 predicts tamoxifen - resistant tumors ( 12 ) . in the present study , we investigated the value of hoxb13 as a molecular marker for pca progression and malignancy . paraffin - embedded human primary pcas were acquired from patients at the chonnam national university hospital between 1995 and 2007 . specimens from 57 pca patients were obtained by radical prostatectomy with various treatment regimes , as shown in table i. pre- and post - operative prostate specific antigen ( psa ) levels were available for all patients . biochemical failure was defined when psa levels bounced back to > 0.2 ng / ml following radical prostatectomy . benign prostate tissues obtained from radical prostatectomy were used for the baseline expression of hoxb13 . immunostaining was performed according to the method described by komuves et al ( 13 ) . after non - specific reactivity was sequentially blocked by avidin - biotin blocking reagent and 10% normal goat serum , tissues were incubated with anti - hoxb13 antibodies and then with donkey anti - rabbit igg ( fab fragment ) conjugated to peroxidase ( jackson laboratories , bar harbor , me , usa ) . anti - hoxb13 antibodies were produced under contractual agreement by sigma genosys ( st . louis , mo , usa ) , as described by komuves et al ( 13 ) . antibodies were purified by affinity chromatography against immobilized hoxb13 synthetic peptides . in a previous study , we showed that these antibodies were specific to hoxb13 ( 11 ) . anti - ar antibodies ( upstate ) were used to confirm tissue integrity . for the negative control slide , non - immune rabbit igg was used . immunostained slides were evaluated by 2 different investigators , including a pathologist , blinded to the patient clinical features . the intensity of hoxb13 staining was classified into 1 of 4 grades ( 0 , absent ; 1 , weak ; 2 , intermediate ; and 3 , strong ) . tumors with < 5% of hoxb13 expression were considered negative , irrespective of the intensity ( 5,17 ) . the spearman s correlation co - efficienct test ( two - tailed ) was used to estimate the correlation with clinicopathological factors . paraffin - embedded human primary pcas were acquired from patients at the chonnam national university hospital between 1995 and 2007 . specimens from 57 pca patients were obtained by radical prostatectomy with various treatment regimes , as shown in table i. pre- and post - operative prostate specific antigen ( psa ) levels were available for all patients . biochemical failure was defined when psa levels bounced back to > 0.2 ng / ml following radical prostatectomy . benign prostate tissues obtained from radical prostatectomy were used for the baseline expression of hoxb13 . immunostaining was performed according to the method described by komuves et al ( 13 ) . after non - specific reactivity was sequentially blocked by avidin - biotin blocking reagent and 10% normal goat serum , tissues were incubated with anti - hoxb13 antibodies and then with donkey anti - rabbit igg ( fab fragment ) conjugated to peroxidase ( jackson laboratories , bar harbor , me , usa ) . anti - hoxb13 antibodies were produced under contractual agreement by sigma genosys ( st . louis , mo , usa ) , as described by komuves et al ( 13 ) . antibodies were purified by affinity chromatography against immobilized hoxb13 synthetic peptides . in a previous study , we showed that these antibodies were specific to hoxb13 ( 11 ) . anti - ar antibodies ( upstate ) were used to confirm tissue integrity . for the negative control slide , immunostained slides were evaluated by 2 different investigators , including a pathologist , blinded to the patient clinical features . the intensity of hoxb13 staining was classified into 1 of 4 grades ( 0 , absent ; 1 , weak ; 2 , intermediate ; and 3 , strong ) . tumors with < 5% of hoxb13 expression were considered negative , irrespective of the intensity ( 5,17 ) . the spearman s correlation co - efficienct test ( two - tailed ) was used to estimate the correlation with clinicopathological factors . in the present study , we evaluated hoxb13 as a molecular marker to increase the preditability of pre - existing clinicopathological parameters . 1a , hoxb13 was mildly expressed in normal prostatic epithelial cells ( left panel ) , while there were both hoxb13-underexpressed tumors ( middle panel ) and hoxb13-overexpressed tumors ( right panel ) . the expression of hoxb13 was also verified in pca culture cells by western blot analysis ( fig . 1b ) , whose expression patterns were identical to the hoxb13 transcript , as previously shown ( 10 ) . we assessed the correlation between hoxb13 expression and clinicopathological parameters available for the patients : age , pre - operative psa levels , tumor margin , seminar vesicle invasion , pelvic lymph node invasion , angiolymphatic invasion , perineural invasion , gleason score , pathological stage and risk level , using the two - tailed spearman s correlation test ( table ii ) . hoxb13 expression was not correlated with age , tumor margin , invasion or pathological stage . hoxb13 expression was positively correlated with pre - operative psa levels ( r=0.298 , p=0.064 ) . there was a significant positive correlation between hoxb13 staining intensity and the gleason score ( r=0.286 , p=0.031 ) . there was also a significant difference in hoxb13 expression with a gleason score between 7 and 9 ( student s t - test , p=0.017 ) . however , no correlation was observed between hoxb13 and grouping of the gleason score into 6 , 3 + 4 , 4 + 3 , 8 and 9 ( r=0.167 , p=0.261 ) . to further validate hoxb13 as a marker of progression , patients were divided according to risk groups , as recommended by the clinical practice guidelines in oncology 2009 from the national comprehensive cancer network ( nccn ) : high risk , psa > 20 ng / ml or gleason score 8 or t3a ; intermediate risk , psa 1020 ng / ml or gleason score 7 or t2b and t2c ; low risk , psa<10 ng / ml and gleason score 26 and t1-t2a . although 3 patients were considered as high risk and 1 as intermediate risk , all 4 patients showed the highest expression levels of hoxb13 ( score 3 ) . the patient with intermediate risk level was relatively young ( 50 years of age ) and showed no extraprostatic and seminar vesicle invasion with clean surgical margin . these results suggest that the evaluation of hoxb13 expression in addition to pre - existing clinicopathological factors , including gleason score and pre - operative psa , may increase the predictability of patients at risk of biochemical failure . pca may be present , but undetectable , for several decades before being diagnosed by a clinician . the long latency period of pca results in the lack of overt symptoms in most men . the multifocal nature of pca also makes it difficult to diagnose and treat pca patients . despite improvements in screening and early diagnosis patients with these tumors become refractory to hormonal ablation , resulting in rapid tumor progression and ultimately death . therefore , there is an urgent need to define the fraction of pca cells that differ with respect to clinical and pathological outcome . based on several clinicopathological features , including the pre - operative psa levels , pathological stage and tumor differentiation status , patients are stratified into subgroups , according to outcome after surgery , that are widely used to guide clinical decision making ( 18 ) . the identification of progression - associated markers for pca will allow for a more aggressive treatment approach in patients likely to develop recurrent tumors , and may also facilitate the treatment of those patients unlikely to have a recurrence . furthermore , the markers used to identify the aggressive from the indolent disease could potentially be used as therapeutic targets for aggressive disease management . in this study , we demonstrate that the expression of hoxb13 is positively correlated with the gleason score , and , to a lesser extent , with pre - operative psa levels . hoxb13 has previously been shown to be overexpressed in hormone - refractory breast tumors as opposed to hormone - responsive tumors , further demonstrating that hoxb13 is a useful prognostic marker of hormone - refractory breast cancers ( 12 ) . in addition , the forced expression of hoxb13 promoted the growth of mcf10a estrogen receptor ( er)-negative breast cells along with increased migration and invasion . in pca , we also observed that hoxb13 is overexpressed in most androgen - refractory tumors and its expression confers a positive growth signal on pca cells in the absence of androgen ( 11 ) . increasing numbers of studies are being published , linking hoxb13 with several solid tumors , including breast , cervical and skin cancer ( 12,13,1922 ) . therefore , hoxb13 may be used as a marker to discriminate between aggressive and indolent prostate tumor cells as : i ) hoxb13 is highly prostate - specific and is involved in the proper formation and maintenance of this hormone - dominant organ ( 7,9,23 ) ; ii ) alteration of hoxb13 expression modulates the growth of pca cells ; iii ) hoxb13 is generally overexpressed in androgen - refractory pca , in which circumstance pca cells grow better ( 11 ) . our current study also demonstrates that hoxb13 is positively correlated with cell differentiation , as shown by the gleason score , suggesting that hoxb13 may be required for undifferentiated cells to survive in a low or no androgen environment . risk level is established by several factors , including pre - operative psa levels , the gleason score and t stage . in this study , hoxb13 expression was not correlated with risk level ; however , samples from all 4 patients whose psa levels bounced back to > 0.2 ng / ml after radical prostatectomy showed the highest expression levels of hoxb13 . these results suggest that hoxb13 may be of significant prognostic value ( supporting the incumbent gleason score ) for predicting recurrent pca patients . however , this study was restricted due to the limited availability of recurrent tumors . therefore , a larger scale study needs to be conducted to test its clinical value . this study demonstrates that hoxb13 may be a potentially valuable molecular marker of recurrent pca . hoxb13 was positively correlated with the gleason score and pre - operative psa levels ; moreover , hoxb13 increased the predictive value of the incumbent gleason score by predicting the progress of a patient with an intermediate recurrent risk . hoxb13 may be a good addition to pre - existing clinicopathological parameters , including the gleason score , tumor margin , t stage and other genetic markers , to identify high - risk patients . therefore , hoxb13 may aid in the development of a more aggressive treatment for patients with a high risk of recurrent pca .

many patients with prostate cancer have disease recurrence following surgical removal of tumors and fail to respond to androgen ablation therapy . despite the existence of a number of clinical / pathological factors , it is not possible to predict which patients will fall into this category . the results of our previous studies demonstrated that the hoxb13 homeodomain protein plays a key role in the development of prostate cancer and the progression of this malignancy . in addition , hoxb13 has been reported to predict estrogen - resistant breast cancer tumors . the purpose of this study was to investigate whether hoxb13 could be used as a molecular marker to predict prostate cancer recurrence . to examine the role of hoxb13 as a molecular marker with clinical / pathological data , the expression of hoxb13 was compared using immunohistochemistry in 57 organ - confined prostate cancer tumors obtained by radical prostatectomy . there was no significant correlation between the expression of hoxb13 and most clinical / pathological parameters , including tumor margin , invasion , pathological stage and risk level . the hoxb13 expression levels correlated with the gleason score and there was a positive correlation with the pre - operative prostate specific antigen ( psa ) levels . accordingly , the tumor specimens from 4 patients who ultimately had biochemical failure ( psa > 0.2 ng / ml ) , all showed a high expression of hoxb13 , while their risk levels were either intermediate or high . this is the first study to report that hoxb13 , together with other clinical / pathological factors , can be used as a molecular marker to predict the progression of prostate cancer .

Introduction Materials and methods Patient cohort Immunohistochemistry and scoring Statistical analysis Results Discussion

the identification and appropriate treatment of subaxial cervical - spine injuries is essential to optimize outcomes . injuries to the cervical spine are present in only 1%3% of people who sustain blunt trauma ; however , the morbidity and mortality associated with these injuries can be devastating 1,2 . numerous classification systems have been proposed to describe these injuries , predict stability , and dictate treatment ; still , none of them are universally accepted 3,4,5,6,7,8,9,10,11,12,13,14,15,16,17 . ideal classification system must have excellent interobserver and intraobserver reliability , quantify stability , predict prognosis , and dictate treatment . we rely on a universal classification system as a prerequisite for comparison of clinical outcomes across different techniques and researchers . newer systems have started to attempt to quantify injuries on a continuum in the form of objectively obtainable injury severity scales instead of differentiating injuries into various subtypes . to date , no studies have simultaneously evaluated the csiss and the slic as two examples of a severity scale for cervical - spine injuries , and the allen - ferguson system as the most representative example of a typical classification system with a phylogeny of injury categories . to measure and compare the interobserver and intraobserver reliability of csiss , slic and the allen - ferguson system in patients with subaxial cervical - spine injuries . inclusion criteria : patients seen in the emergency department with significant subaxial cervical injury with adequate imaging showing the morphology on computed tomography ( ct ) and/or magnetic resonance imaging ( mri ) . patient population : fifty consecutive patients seen in the emergency department at harborview medical center ( seattle , wa ) from april 2007 to august 2007 meeting the inclusion criteria . ct was available for 100% of patients and mri was available for 70% of patients . classification systems evaluated : ( please see web appendix at www.aospine.org/ebsj for additional details ) csiss is an ordinal score which divides the subaxial cervical spine into four columns : anterior , posterior , right pillar ( right lateral column ) , and left pillar ( left lateral column ) and takes into account fractures as well as ligamentous injuries . each column is given a score from zero ( no injury ) to five ( most significant injury possible to that column ) based on the severity of injury ( fig 1 ) . the total quantitative scored is determined by adding the scores for each column at a given level of injury for a maximum score of 20 . if there are multiple levels of injury , the highest quantitative score is used after determining the score for each individual level of injury ( figs 2a b ) 4,14 . slic and severity scale is an ordinal score comprised of three components : ( 1 ) injury morphology as determined by the pattern of spinal column disruption on available imaging studies ; ( 2 ) integrity of the discoligamentous complex ( dlc ) represented by both anterior and posterior ligamentous structures as well as the intervertebral disc , and ( 3 ) neurological status of the patient 16 . higher scores represent more severe injuries ( table 1 , figs 2a b ) . although both csiss and slic are based on injury morphology and the integrity of the dlc , only slic takes into account neurological status . six different phylogenies ( compressive flexion , vertical compression , distractive flexion , compressive extension , distractive extension , and lateral flexion ) are evaluated . there are different stages , based on severity , within each phylogeny for a total of 21 different possible classification types . assessment process : patient studies were de - identified and a new identity number randomly assigned to facilitate reviewer blinding . original papers and quick reference guides describing each classification system were provided to five spine surgeons who independently reviewed cervical spine radiographs ( ct and mri ) . to determine neurological status for the slic , reviewers were provided documented physical examinations from each patient s chart . the reviewers independently classified each patient s injuries for all three classification systems and recorded whether surgery was indicated . at least 6 weeks after the interobserver data were collected , 10 of the original 50 cases were randomly chosen for the intraobserver results . analysis : interobserver reliability for both csiss and slic and severity scale was determined with intraclass correlation coefficient ( icc ) using two - way random effects . icc was used since we had more than two raters and because these systems are ordinal with higher scores representing more severe injuries . interobserver reliability was calculated for the allen - ferguson system as well as for management of these injuries using kappa ( inter_rater.mac in sas version 9.1.3 for windows ) . we used kappa for the allen - ferguson classification since this is a nominal system with no natural ordering to the different phylogenies . cohen s kappa was not used since it determines agreement between two raters only 18,19,20 . we considered icc and kappa scores > 0.75 as excellent , 0.40.75 as moderate , and scores < 0.4 as poor 21 . the linear graph represent a 0 - 5 points severity of injury scale for bony cervical - spine injuries ( top half ) and ligamentous injuries ( bottom half ) . there are general descriptors added to aid the clinician in attributing the most fitting point scale to the injury present . reprinted with permission from anderson pa , moore ta , davis kw , et al ( 2007 ) cervical spine injury severity score : assessment of reliability . j bone joint surg am ; 89(5):10571065 . an axial image of a c7 burst fracture . a sagittal view of c7 from the same patient interobserver variability : icc values for csiss and slic suggest excellent reliability ; however , the kappa scores for the allen - ferguson system and management decisions were within the range of moderate to poor reliability . for csiss , the iccs were 0.92 , 0.94 , 0.92 , and 0.93 for the anterior column , posterior column , right pillar , and left pillar , respectively ; with icc for the total csiss of 0.96 . for slic , the icc values for injury morphology , dlc , and neurological status were 0.86 , 0.90 , and 0.98 , respectively ; and 0.79 for the total score . for the allen - ferguson system , the overall kappa values for each of the six phylogenies are listed in table 2 . when a total kappa score was calculated using all 21 groups the value was 0.34 . when it was determined from only the six main phylogenies it increased to 0.50 . the interobserver kappa agreement for management of the 50 cases was 0.55 . intraobserver variability : icc and kappa values all suggested excellent intrarater reliability . for csiss , the iccs were 0.94 , 0.98 , 0.92 , and 0.98 for the anterior column , posterior column , right pillar , and left pillar , respectively ; and 0.98 for the total csiss . for slic , the icc values for injury morphology , dlc , and neurological status were 0.94 , 0.94 , and 0.99 , respectively ; and 0.98 for the total slic score . using all 21 groups for the allen - ferguson system , the intraobserver kappa agreement for management of the 50 cases was 0.91 ( table 3 ) . slic = subaxial injury classification mri = magnetic resonance imaging dlc = discoligamentous complex na = indicates not available dlc = discoligamentous complex the images in figs 2a and b demonstrate how the csiss and slic scores are calculated . the anterior column of this patient is displaced more than 5 mm , so according to the analog scale of the csiss it would receive a score of 5 . both the right and lateral pillars have no injuries so they are assigned a score of 0 . the posterior column has mild displacement ( ~2 mm ) , scoring a value of 2 . if there were multiple levels of injury within the subaxial cervical spine , the level with the highest total csiss score would be used . with respect to the slic scale theit would receive a score of 2 for morphology , since it is a burst - type fracture . the discoligamentous complex is intact ( this was confirmed also on mri ) , scoring 0 for that component . the examinations from the patient s chart show that the patient had 0/5 strength in the lower extremities and no sensation below t2 including absent perianal sensation . based on these clinical findings the score for neurological status would be a 2 as the patient has a complete cord injury . reliability has been independently reported for both csiss and slic and severity scale ; however , these two classification systems have not been compared in the same study 4,14,16 . 14 determined the interobserver and intraobserver reliability , reporting a mean icc for interobserver reliability of 0.88 for all four columns and the total csiss . the icc for intraobserver reliability was equal to or greater than 0.97 for all cases . 4 calculated an icc of 0.82 for the anterior column ; 0.76 , for the posterior column ; 0.79 , for the right pillar ; 0.74 for the left pillar ; and 0.88 for the total csiss . our results showed superior interobserver reliability with a calculated icc of 0.92 for the anterior column ; 0.94 , for the posterior column ; 0.92 , for the right pillar ; 0.93 , for the left pillar ; and 0.96 for the total csiss . they reported a mean intraobserver icc of 0.98 for the total csiss , which is identical to the score we obtained . studies of slic : vaccaro et al . evaluated the interobserver and intraobserver reliability of the slic severity scale and compared them with both the harris and allen - ferguson system using both ct and mri images 16 . they calculated an interobserver icc of 0.57 for injury morphology ; 0.49 for the dlc ; 0.87 for neurological status ; and 0.71 for total slic . they calculated an intraobserver icc of 0.75 for injury morphology ; 0.66 , dlc ; 0.90 , neurological status ; and 0.83 , total slic . our study had an intraobserver icc of more than 0.93 for all three categories and the total slic score . allen - ferguson system evaluation : vaccaro et al . determined the interobserver and intraobserver reliability and reported a total interobserver cohen kappa of 0.53 ( moderate interobserver agreement ) 16 . our total kappa score for the six phylogenies was 0.50 ( moderate agreement ) , when all 21 stages were considered the interobserver rating dropped to 0.34 ( poor agreement ) . strengths : five surgeons reviewed more cases than reported in previous studies , which may have increased our statistical power . use of two different methods to determine the interobserver and intraobserver reliability of the allen - ferguson system allowed us to evaluate the interobserver reliability of both the 21 stages and six main phylogenies , the results of which suggest better agreement when the later approach is taken . unlike the moore et al and anderson et al studies , where mris were not given to the reviewers , our reviewers were able to review mris for 70% of the cases which may have improved interobserver and intraobserver reliability . finally , we calculated kappa from inter_rater.mac in sas because this algorithm has been shown to be superior when there are more than two raters 18,19,21 . the extent to which this would influence classification is not clear and further study may be warranted . another limitation of this study is that the reviewers were from institutions that treat a high volume of spine trauma . the reliability obtained among observers with less experience in evaluating and treating spine trauma may not be consistent with our findings . clinical relevance and impact : csiss and slic and severity scale have excellent interobserver and intraobserver reliability . ideal classification system must have excellent interobserver and intraobserver reliability , quantify stability , predict prognosis , and dictate treatment . future studies : the next step is to determine if the quantitative scores of csiss and slic correlate with management of subaxial cervical - spine injuries and clinical outcomes . currently , there is no universally accepted and reproducible classification system for subaxial cervical - spine injuries . we report excellent interobserver and intraobserver reliability with use of csiss and the slic and severity scale . based on all 21 stages of the allen - ferguson system , the interobserver reliability is poor and the intraobserver reliability is excellent . there is moderate interobserver reliability and excellent intraobserver reliability with respect to management of subaxial cervical - spine injuries . editorial staff perspective as the authors point out , in order for any type of classification scheme to be useful , in addition to measuring what it is intended to measure ( validity ) , the measurements need to be reproducible ( reliability ) . this well done study does a thorough and thoughtful job of evaluating interobserver and intraobserver variability of the measures in a consecutive group of patients presenting to a regional tertiary care trauma center . the primary methodological strengths of this study include attention to details of study blinding , random selection of cases for second review , interpretation of the second review for intrarater reliability without prior knowledge of the previous reading , and ensuring that sufficient time had elapsed between reviews to avoid influence of the first interpretation on the results of the second . classification systems. these severity scales emphasize the continuum of any given disease by using a point system rather than attempting to separate disorders into artificially created categories ( phylogenies ) . the reviewers applaud the authors in taking an important step beyond comparing traditional classification systems and looking into the potential applications of severity scales for everyday use . methods : an important question that needs to be addressed in reliability studies is : will these measures be reproducible across a range of severity conditions and among reviewers of different experience levels or schooled in different assessment strategies ? for reliability studies , the study population generally should comprise those with a broad spectrum of the suspected condition who are likely to have the measure applied now or in the future . for instance , differences of body habitus and condition characteristics may influence measurements and the ability to reproduce the results . if conducted in a population primarily composed of those with known or severe disease , a classification scheme may give different results compared with studies on a group of more healthy individuals / less severe disease and may not give an accurate picture of overall reproducibility across condition severity . if patients with less severe disease image differently than those with more severe disease , this could affect the interpretation of x - rays and classification . the fact that the authors used selected consecutive patients somewhat increases the possibility that those with less severe as well as more severe injury are included . however , the authors also point out that the 70% of patients who had mri were more likely to have had neurological deficits . the range of severity conditions is not described in this study , so the extent to which these scales are reproducible across ranges of severity is not clear . some indication of the breadth of condition severity in study populations provides important information regarding generalizing the results to other settings as well . one could ask : in my setting , with the range of patients i see ( outside of a regional trauma center ) will i have the same reproducibility in applying these measures ? answering these questions may be a helpful step in further establishing these as the appropriate measures for assessing patients with subaxial cervical - spineinjuries in addition to the next steps the authors suggest , namely evaluating the correlation of quantitative csiss and slic scores with management decision and clinical outcomes . this study takes a big step forward in supporting the use of severity scales over the more traditional classification systems , such as the allen - ferguson system for the challenging topic of subaxial cervical - spine trauma .

study design : interobserver and intraobserver reliabilityobjective : to measure and compare the interobserver and intraobserver reliability of the cervical spine injury severity score ( csiss ) , the subaxial injury classification ( slic ) and severity scale , and the allen - ferguson system in patients with subaxial cervical spine injuries presenting to the emergency department.methods : five examiners independently reviewed c - spine x - rays ( ct / mri ) of 50 consecutive patients with subaxial cervical - spine injuries . they classified each case using csiss , slic , and the allen - ferguson system . examiners also documented if they believed the case required surgical management . at least 6 weeks later , the above steps were repeated for ten randomly chosen cases.results : the interobserver and intraobserver reliability for the total csiss and total slic score are excellent . there is poor interobserver reliability and excellent intraobserver reliability when a total kappa score is calculated using all 21 groups for the allen - ferguson system . with respect to surgical management decisions , the interobserver agreement is moderate and the intraobserver agreement is excellent.conclusions : there is no universally accepted classification scheme for subaxial cervical - spine injuries . a useful classification system must have excellent reliability to consistently and accurately describe injury patterns between different observers and allow for comparison across systems or cohorts . both the csiss and the slic and severity scale are promising classification systems with excellent interobserver and intraobserver reliability . future studies will need to determine if their quantitative scores correlate with management and clinical outcomes .

STUDY RATIONALE AND CONTEXT OBJECTIVE METHODS RESULTS AN ILLUSTRATIVE CASE DISCUSSION SUMMARY AND CONCLUSIONS

from may 2007 to february 2009 , all of 132 patients with refractory epilepsy who were referred to ayatollah kashani comprehensive epilepsy program , isfahan university of medical sciences ( isfahan , iran ) , were evaluated to establish tle based on eeg and mri findings . the inclusion criteria were age between 15 and 40 , full scale intelligence quotient ( fsiq ) more than 70 , at least elementary school education and absence of major mental or neurological disorders except for epilepsy . the exclusion criteria were informed consent withdrawal and exacerbation of seizures that led to invalid neuropsychological test performance . control subjects who were matched for age and education , were selected from the patients accompanying persons . finally , 29 right tle , 31 left tle , and 32 control subjects were recruited in this study . this checklist included questions about age , education , seizure duration , handedness and marital status . the wms - iii was used to assess auditory and visual declarative memory and working abilities in adults and adolescents . primary subtests must be given to obtain index scores and optional subtests can be given to obtain supplementary information . in this study , primary subtests were used including logical memory i and ii , face i and ii , verbal paired associates i and ii , family picture i and ii , letter - number sequencing and spatial span . the index scores are obtained by summing these primary subtests.33 one study in iran revealed internal consistency of 0.65 to 0.85 for wms - iii subtests and 0.76 to 0.83 for wms - iii indexes by cronbach 's alpha coefficient.34 wms - iii was administered by a student of phd in psychology . measures of full scale , verbal , and performance intelligence quotient ( iq ) were obtained using wechsler adult intelligence scale - r ( wais - r ) . in one iranian study , reliability and validity of wais - r were studied.35 the wais - r subscales showed reliability from 0.69 to 0.87 on test retest stability and their internal consistency was 0.77 to 0.88 with split - half coefficient.36 wais - r was administered by a student of phd in psychology . all data were compared between patients ( right tle and left tle ) and controls . the multivariate analyses of variance ( manova ) was used to analyze the data of wms - iii and wais - r between groups . from may 2007 to february 2009 , all of 132 patients with refractory epilepsy who were referred to ayatollah kashani comprehensive epilepsy program , isfahan university of medical sciences ( isfahan , iran ) , were evaluated to establish tle based on eeg and mri findings . the inclusion criteria were age between 15 and 40 , full scale intelligence quotient ( fsiq ) more than 70 , at least elementary school education and absence of major mental or neurological disorders except for epilepsy . the exclusion criteria were informed consent withdrawal and exacerbation of seizures that led to invalid neuropsychological test performance . control subjects who were matched for age and education , were selected from the patients accompanying persons . finally , 29 right tle , 31 left tle , and 32 control subjects were recruited in this study . this checklist included questions about age , education , seizure duration , handedness and marital status . the wms - iii was used to assess auditory and visual declarative memory and working abilities in adults and adolescents . primary subtests must be given to obtain index scores and optional subtests can be given to obtain supplementary information . in this study , primary subtests were used including logical memory i and ii , face i and ii , verbal paired associates i and ii , family picture i and ii , letter - number sequencing and spatial span . the index scores are obtained by summing these primary subtests.33 one study in iran revealed internal consistency of 0.65 to 0.85 for wms - iii subtests and 0.76 to 0.83 for wms - iii indexes by cronbach 's alpha coefficient.34 wms - iii was administered by a student of phd in psychology . measures of full scale , verbal , and performance intelligence quotient ( iq ) were obtained using wechsler adult intelligence scale - r ( wais - r ) . in one iranian study , reliability and validity of wais - r were studied.35 the wais - r subscales showed reliability from 0.69 to 0.87 on test retest stability and their internal consistency was 0.77 to 0.88 with split - half coefficient.36 wais - r was administered by a student of phd in psychology . all data were compared between patients ( right tle and left tle ) and controls . the multivariate analyses of variance ( manova ) was used to analyze the data of wms - iii and wais - r between groups . from may 2007 to february 2009 , all of 132 patients with refractory epilepsy who were referred to ayatollah kashani comprehensive epilepsy program , isfahan university of medical sciences ( isfahan , iran ) , were evaluated to establish tle based on eeg and mri findings . the inclusion criteria were age between 15 and 40 , full scale intelligence quotient ( fsiq ) more than 70 , at least elementary school education and absence of major mental or neurological disorders except for epilepsy . the exclusion criteria were informed consent withdrawal and exacerbation of seizures that led to invalid neuropsychological test performance . control subjects who were matched for age and education , were selected from the patients accompanying persons . finally , 29 right tle , 31 left tle , and 32 control subjects were recruited in this study . this checklist included questions about age , education , seizure duration , handedness and marital status . the wms - iii was used to assess auditory and visual declarative memory and working abilities in adults and adolescents . primary subtests must be given to obtain index scores and optional subtests can be given to obtain supplementary information . in this study , primary subtests were used including logical memory i and ii , face i and ii , verbal paired associates i and ii , family picture i and ii , letter - number sequencing and spatial span . the index scores are obtained by summing these primary subtests.33 one study in iran revealed internal consistency of 0.65 to 0.85 for wms - iii subtests and 0.76 to 0.83 for wms - iii indexes by cronbach 's alpha coefficient.34 wms - iii was administered by a student of phd in psychology . measures of full scale , verbal , and performance intelligence quotient ( iq ) were obtained using wechsler adult intelligence scale - r ( wais - r ) . in one iranian study , reliability and validity of wais - r were studied.35 the wais - r subscales showed reliability from 0.69 to 0.87 on test retest stability and their internal consistency was 0.77 to 0.88 with split - half coefficient.36 wais - r was administered by a student of phd in psychology . all data were compared between patients ( right tle and left tle ) and controls . the multivariate analyses of variance ( manova ) was used to analyze the data of wms - iii and wais - r between groups . the demographic characteristics of right tle patients , left tle patients and the control subjects were summarized in table 1 . the results of manova revealed a significant difference between groups [ pillai 's trace f ( 12,170 ) = 6.57 , p < 0.001 ] . demographic characteristics by group as shown in table 2 , results of manova revealed significant differences between the groups for mean scores on piq subscale of wais - r ( p < 0.001 ) , fsiq subscale of wais - r ( p < 0.002 ) and all primary indexes of wms - iii ( p < 0.001 ) . there were no significant differences between right and left tle regarding mean scores of wais - r and wms - iii . wechsler adult intelligence scale - r and wechsler memory scale - iii primary indexes and their subscale scores and comparisons by group although the verbal intelligence quotient ( viq ) mean scores were significantly different between the left tle and the control group ( p = 0.037 ) , there were not any significant differences between the right and the control group . many investigators have reported specific cognitive deficits that differentiate tle from the other types of epilepsy . problems in memory have been the most shared cognitive deficit in patients with tle.37 early neuropsychological studies indicated that resection of the left temporal lobe may impair the ability to learn verbal materials while right temporal resection can produce a deficit in learning of nonverbal and visuospatial information.2438 these phenomena were also found in patients with unilateral temporal lobe seizures with less power.3940 however , there were other studies that failed to show material specific of memory impairment to lateralize right or left tle.4142 in our study , patients with tle as a single group , had significant lower scores in all of the memory indexes and in the most subscales in comparison with control subject . in addition , a comparison of the iq scores between patients with epilepsy and subjects in control group showed significantly higher scores in fsiq and piq scores . this findings were consistent with those studies that showed cognitive dysfunction in temporal lobe epilepsy.3032 in patients with the right tle or the left tle as two different groups , there were no significant differences between the two groups regarding scores of wais - r and wms - iii indexes and subscales . these results were not consistent with findings of doss et al.23 and wilde et al.29 that showed material - specific dichotomized deficits in tle patients who were undergone anterior temporal lobectomy . however , some researchers have reported non - specific memory deficits in right or left tle . baker et al.32 and vannucci31 found that there were no significant disparities between auditory and visual scores of patients with left temporal focal epilepsy group . bachtler and dodrill showed that no significant group differences were found for visual immediate or delayed or auditory immediate indexes.43 these results were consistent with our finding . first , most of the findings that revealed material - specific memory problems were based on patients who were undergone anterior temporal lobectomy . second , wilde et al . reported that the ability of the wms - iii to predict lateralization was particularly weak for those with left temporal dysfunction.29 finally , although many of the neuropsychological tests possessed face validity , their genuine capabilities to assess what was prepared for them were in doubt . in wms - iii , the visual memory items invite verbal encoding during inspection , thus contralateral temporal lobe may have alternative or supplementary strategy for encoding of seemingly visual items in non - dominant hemisphere temporal lobe epilepsy . the results of this study showed ability of the wms - iii to find cognitive decline in patients with tle . although the sample size had enough power to reveal difference between patients with tle and control group , it was not able to differentiate right versus left epileptogenic zone . the wms - iii has multiple subscales but it would have been better if more cognitive assessment tools had been used to raise validity of the findings . mb was the main designer of this study and involved in all clinical and neuropsychological evaluations .

background : cognitive impairment associated with temporal lobe epilepsy ( tle ) has been recognized in multiple studies . we designed this study to find a specific cognitive profile in patients with tle who were candidates for epilepsy surgery . we also sought to find if neuropsychological assessment could differentiate left tle , right tle and normal subjects.methods:the sample of this study consisted of 29 patients with right tle , 31 with left tle , and 32 subjects without history of seizure as the control group . for all recruited patients and controls , demographic questionnaire , wechsler memory scale - iii ( wms - iii ) and wechsler adult intelligence scale - r ( wais - r ) were administered . multivariate analysis of variance was carried out to reveal differences in memory and intelligence performance between the three groups.results:all of the mean scores of the wms - iii indexes were significantly higher in the control group in comparison with the right or the left tle groups ( p < 0.001 ) . there were not any significant differences between mean scores of wms - iii indexes of the right and the left . the wais - r also showed significantly better mean scores of full scale intelligence quotient ( fsiq ) and performance intelligence quotient ( piq ) in the control groups than both of the right and left tle patients ( p < 0.001 ) . although the verbal intelligence quotient ( viq ) mean scores were significantly different between the left tle and the control group ( p = 0.037 ) , there were not any significant differences between the right tle patients and the control group.conclusions:these findings indicated that wms - iii and wais - r can differentiate patients with refractory temporal lobe epilepsy from normal subjects . however , the obtained cognitive profile could not differentiate between the right and the left tle .

Methods None Participants Measures Statistical Analysis Results Discussion Authors Contributions

a 70-year - old woman ( height : 156 cm , body weight : 48 kg ) with lower abdominal pain was admitted and associated symptoms were fever , nausea , vomiting and diaphoresis which started from the day previous to her admission . on abdominal computed tomography ( ct ) , right ovarian cyst in size of 2.5 cm was found , and an acute appendicitis was diagnosed by an abdominal ultrasonography . an elective operation was scheduled under the collaboration of gynecology and general surgery . in the patient 's past medical history , she had taken digoxin , dilatrend , nitrate , telmisartan , and thiazide for 5 years because of hypertension , congestive heart failure , af , and right coronary artery 90% stenosis on coronary angiography . an electrocardiogram before operation showed af with ventricular response 90 - 100 times / min , left ventricular hypertrophy . cardiomegaly and pleural effusion were found on chest x - ray . on transthoracic echocardiography ( tte ) , ejection fraction was 55% and left atrial enlargement , right atrial enlargement and eccentric hypertrophy with decreased mobility of the inferior wall of the left ventricle were shown . a moderate aortic valve insufficiency , aortic valve sclerosis , mild aortic stenosis , and severe posterior mitral valve leaflet calcification were also found and the width of mitral valve measured by pressure half - time was 1.92 cm . a chronic cerebral infarction in the right posterior cerebral artery was found on brain ct with symptoms of dysarthria . signs of dehydration on physical examinations with prerenal azotemia of fena 0.1% and serum creatinine of 1.7 mg / dl on blood test led us to start an fluid therapy . glycopyrrolate 0.2 mg i m was premedicated at 30 minutes pre - operation . the patient 's blood pressure ( bp ) was 130/50 mmhg , ventricular response 90 - 100 times / min , and arterial oxygen saturation 97% when she arrived at the operation room . the induction of anesthesia was initiated with injecting 2 ml of 2% lidocaine to reduce injection pain and propofol ( diprivan astrazeneca , uk ) and remifentanil ( ultiva glaxosmithkline , uk ) were injected using a target - controlled infuser ( orchestra fresenius vial , france ) . after confirming the patient 's being unconscious , rocuronium 40 mg was injected and then endotracheal intubation was performed with close monitoring of arterial blood pressure . ventilation with 100% o2 was given while central venous catheterization was placed in right jugular vein . after the induction of anesthesia , the patient 's vital sign showed no hemodynamic disorder with systolic bp 130 - 150 mmhg , diastolic bp 40 - 60 mmhg , ventricular response approximately 100 - 110 times / min , and central venous pressure ( cvp ) 8 - 9 mmhg . the effect site concentration was injected as 2.5 - 3.0 g / ml of propofol and and 2.0 ng / ml of remifentanil . after the lower abdomen laparotomy at obstetrics and gynecology for the right ovary cystectomy , a small bowel infarction from jejunum to ileum was detected . the authors suspected a mesenteric arterial embolism based on the patient 's previous medical history . a transesophageal echocardiology ( sonosite micromaxx , bothell , usa ) probe was immediately inserted and a spontaneous echo contrast ( sec or " smoke " ) in the left atrium ( la ) and a 13 18 mm size thrombus in the laa was detected ( fig . the findings in tee made a mesenteric arterial embolism highly suspicious for the cause of the small bowel infarction . no hemodynamic instability was observed through whole procedure of operation and the patient was transferred to the intensive care unit with endotracheal tube inserted . after confirming her awareness and the absence of any neurologic disorder , extubation was performed in intensive care unit . to minimize the risk of hemorrhage of the anastomosis site it was started with low molecular weight heparin 3 days after the operation and oral warfarin was added 5 days after the operation . mesenteric infarction is induced by the embolism in the left atrium , left ventricle , and heart valves ; the superior mesenteric artery is anatomically the most vulnerable to infarction due to its large diameter and the acute angle takeoff from the aorta , but the inferior mesenteric artery is rarely vulnerable due to its small diameter . for preventing injury from ischemia , the main mesenteric blood vessels have extensive collateral circulation ; however , when the mesenteric arterial embolism occurs , the mid - segment of the jejunum , which is the farthest from the collateral circulation of the celiac artery and inferior mesenteric artery , becomes most vulnerable to ischemia . an acute hypoperfusion state induced by mesenteric arterial vascular disorder forms 60 - 70% of the total mesenteric ischemia with mortality rate exceeding 60% . symptoms can vary from acute severe , nonremitting abdominal pain to vague abdominal pain . and associated symptoms may include nausea and vomiting , transient diarrhea , and bloody stools . however the absence of any specific clinical symptom and no indicator shown in blood test or plain x - ray make early diagnosis challenging which may end up in delayed treatment . it is highly suspicious in aged patients with af and a previous history of cardiac and vascular disease like recent myocardial infarction , rheumatic heart disease , and recent cardiac catheterization . mesenteric angiography is the most reliable diagnostic tool and also helps locating exact site of blockage . an early angiography on a patient suspected of arterial ischemia is widely accepted to decrease the mortality rate of mesenteric ischemia patients . there was no comment about the thrombus in the la and the laa on the pre - operative tte examination ; it is difficult to observe a laa by tte , so the sensitivity of the tte of the la or laa is known as 39 - 63% . in contrast , by tee , observing the posterior structures of the heart , such as the la and laa is much easier , the sensitivity and the specificity of thrombus in the la was reported as 93 - 100% and 99 - 100% , respectively . tee of patients with af shows a sec in the la or laa , which is known to increase the risk of thromboembolism . estimation of blood flow velocity in the left or right atrium and left and right atrial appendage permits a more quantifiable measure of stasis . the risk of stroke increases sharply with marked reductions in blood flow velocity ( < 15 cm / sec ) , particularly in the laa or posterior left atrium . sec refers to the presence of dynamic , smoke - like echoes seen during echocardiogram in the la or laa ; it is known that sec is formed by a red blood cell rouleaux formation on stagnant flow condition . difficulty to quantificate sec by identifyimg as a fluid whirlwind of smoke is due to differences between the frequency and the gain of an echocardiogram probe . sec may be missed in the case where the gain is too low or the test room is too bright . sec should be observed under high gain with a high - frequency probe over 5 mhz which a uniform noise is seen in the la . the laa peak outflow velocity can be estimated by tee and sec semiquantitatively graded as marked or dense if present throughout the entire cardiac cycle , or faint when intermittent . the goal of treating af include maintaining sinus rhythm , controlling heart rate , and preventing thromboembolism by using anticoagulant therapy ; the risk stratification of thromboembolism is most important for anticoagulant therapy . the high risk factors of thromboembolism include a previous history of thromboembolism , mitral valve stenosis , and a mechanical valve ; moderate risk factors are ages over 75 , hypertension , heart failure , left ventricular ejection fraction less than 35% , and diabetes . females , ages from 65 to 74 , coronary arterial diseases , and thyrotoxicosis correspond to low risk factors . during anticoagulation therapy , aspirin 81 - 325 mg / day should be taken in the case where there are no risk factors or only low risk factors ; aspirin or warfarin ( inr 2 - 3 ) should be taken in case of 1 moderate risk factor . warfarin should be taken in case of 2 or more moderate risk factors or the existence of a high risk factor in case of a mechanical valve , inr should be maintained more than 2.5 at minimum . chads2 ( cardiac failure , hypertension , age , diabetes , stroke [ doubled ] ) , another stroke risk stratification , scores 1 for heart failure , hypertension , ages over 75 , and diabetes and scores 2 for a previous history of a stroke or transient ischemic attack and adds the scores , and then classifies score 0 as a low risk group , scores 1 as a moderate risk group and scores over 2 as a high risk group . aspirin is used for the low risk group , aspirin or warfarin is selectively used for the moderate risk group , and the high risk group with scores over 2 should be performed with anticoagulant therapy . in this case , the patient should have been initiated an anticoagulant therapy considering her high blood pressure , congestive heart failure , and chronic cerebral infarction detected by the brain ct . in addition , aged patients with af showing mitral annular calcification on echocardiography , there is a high potency of thromboembolism , even without mitral stenosis , mitral regurgitation , or prolapsed leaflet . the authors suggest that risk stratification before operation should be performed on af patients with thromboebolism risk factors ; hemodynamic and neurologic observation are needed on the induction , maintenance , and emergence period of anesthesia ; tee during operation can be helpful for these patients .

acute mesenteric ischemia and infarction is an emergent situation associated with high mortality , commonly due to emboli or thrombosis of the mesenteric arteries . embolism to the mesenteric arteries is most frequently due to a dislodged thrombus from the left atrium , left ventricle , or cardiac valves . we report a case of 70-year - old female patient with an acute small bowel infarction due to a mesenteric artery embolism dislodged from a left atrial appendage detected by intraoperative transesophageal echocardiography and followed by anticoagulation therapy .

Case Report Discussion

a 5-year - old male patient of 111 cm and 19 kg , who experienced an osteosarcoma in the left fibula was to go undergo insertion of a totally implantable central venous access device for chemotherapy . hence , the patient was admitted for surgery for the removal of the infected catheter and for left totally implantable subclavian central venous catheterization . the patient underwent numerous chemotherapy treatments ( cddp , adriamycin , methotrexate , ifofamide , vp-16 ) . he had been on antibiotics for over 3 weeks due to an infection at the ticvad site . in the blood test before surgery , the platelet level had decreased to 64,000/mm . while the patient was on the or table , a very severe infectious ulcer and abscess of 5 cm in diameter was observable to the human eye on the skin and the tissue below the skin at the right ticvad site . on the operating table , the ekg , pulse oximeter , and a noninvasive blood pressure cuff were attached . the measured systolic / diastolic blood pressure was 100/50 mmhg , and heart rate was 90 . glycopyrrolate ( 0.06 mg ) and thiopental ( 100 mg ) were administered to induce loss of consciousness . after adequate muscle relaxation , a noncuffed endotracheal tube ( i.d . 5.0 mm ) was inserted . after endotracheal intubation , n2o and oxygen were used to maintain the inspired oxygenconcentration at 0.5 . sevoflurane 1.5 - 3 vol% was used for anesthesia during manual ventilation . for the end - tidal co2 concentration to be 35 mmhg , the tidal volume and the respiratory rate were controlled . the thoracic surgeon used a 21 g. introducer needle to puncture the left subclavian vein . for this procedure , we reduced the manual ventilation to prevent the occurrence of pneumothorax . when the left vessel was punctured , the beat of the arterial blood was not found in the small amount of aspired blood . so the blood was assumed to be venous . while inserting a guide wire and a 6.5 fr . afterwards , puncture of the left subclavian vein was attempted again , but the introducer needle was removed after repeated arterial puncture , and pressure was applied for hemostasis . venous puncture was attempted 2 or 3 times , but it failed . then puncture of the left internal jugular vein , the puncture of the left femoral vein was attempted successfully . a 6 fr . ticvad ( x - port bard access systems , usa ) was inserted . during the venous puncture so a plasma expander ( hes - plazma6% , choongwae , korea ) 200 ml was infused . during the central venous catheterization , curettage of the tissue near the infection was performed , and then the site was closed , ending the surgery . after the surgery , the patient was completely awake , could open his eyes , and move his arms and legs . a vasopressor , ephedrine 2.5 mg and packed rbc 1u were administered . then the arterial hematocrit rose to 28% . because of a continuous drop in blood pressure ( 60 - 90/30 - 40 mmhg ) and acute acidemia , dopamine hcl ( dopamine free mix 80 mg , cj , korea 10 - 20 g / kg / min ) was continuously administered , and bicarbonate was intermittently administered . then midazolam ( 1 mg)and rocuronium ( 5 mg ) were administered . in the first chest x - ray ( fig . immediately , the thoracic surgeon inserted a chest tube and 500 ml of blood was drained . packed rbc were continuously administered , which helped maintain the arterial hematocrit level at 33 - 35% . continuous low blood pressure ( 60 - 90/30 - 40 mmhg ) and tachycardia ( 140 - 150 bpm ) were observed . mmol / l ) were found , so bicarbonate , calcium gluconate , and diuretics were intermittently administered . midazolam and vecuronium were used for maintaining anesthesia . when 3u of packed rbc were administered , the airway pressure started to slowly increase . when 24 - 26 cm h2o was measured , the tidal volume was decreased and the respiratory rate was increased . in a retaken chest x - ray ( fig . 2 ) , a large amount of blood had not been drained from the right chest area , so a second tube was inserted in the chest . afterwards , over 2,000 ml of blood was drained . using a stethoscope , we found that the left pulmonary sound was reduced . 3 ) , the right hemothorax was almost all gone , but a pneumothorax on the left - side was discovered . thus , a third chest tube was inserted . however , the first and second chest tubes on the right - side continuously drained blood , and the blood pressure was not maintainable at 40 - 70 mmhg/20 - 40 mmhg . so , after discussions with the thoracic surgeon , a median sternotomy was done for hemostasis . a mid - surgery increase in hemorrhaging was predicted , so an 18 g intravenous catheter was inserted into the right external jugular vein . the drop in blood pressure could not be corrected , so a large amount of epinephrine 0.5 - 1.0 g / kg / min was continuously administered . epinephrine ( 10 - 100 g ) , bicarbonate , calcium gluconate , and diuretics were intermittently administered . in the sternotomy , damage to the main blood vessels ( the subclavian vein , the subclavian artery , and the pulmonary artery and vein ) was not discovered . however , a severe bulging of the parietal pleura in the upper portion of the right chest , a dissection between the parietal pleura and visceral pleura , and a hematoma between the 2 pleurae were observed ( fig . , there was an abscess pocket , which burst and leaked abscess in mid - surgery . the patient was assumed to be in a septic state , so the pediatrician administered dexamethazone 5 mg . however , the patient continued to have low blood pressure . the thoracic surgeon could not find the exact hemorrhage site on the right - side of the chest . because of the progression of the disseminated coagulation disorder , it was deemed not viable to continue with the surgery , so the surgery was ended . while closing up the patient 's chest , 900 cc of blood was drained from the chest tube . packed rbc and fresh frozen plasma 3u were administered . a continuous high concentration of epinephrine and dopamine , intermittent epinephrine , calcium gluconate , and bicarbonate were administered . in the or , the administered amount of fluid and blood amounted to packed rbc 10 u , fresh frozen plasma 3 u , and fluid 3,000 ml . after surgery , the patient was moved to the icu and connected to an ekg when bradycardia was observed . atropine and epinephrine were administered , and blood pressure was reduced ( 60/30 mmhg ) . in the icu , blood continued to drain from the chest tube . so packed rbc were continuously administered , but the hematocrit level was 24% . within 20 minutes of arriving at the icu , the patient experienced cardiac arrest . thus , cardiopulmonary resuscitation was immediately performed . a cardiac beat and a measurable blood pressure however , 15 minutes later , cardiac arrest was again observed , so cardiopulmonary resuscitation was attempted . the use of a totally implantable central venous access port provides long - term central venous access and thus simplifies the administration of chemotherapy , parenteral nutrition , and the repeated collection of blood samples . in contrast to the percutaneous central venous catheterization , dilators and peel - away sheaths are used to insert the catheter . two small skin incisions are required : one at the guide wire exit site and a second for the implantation of the port reservoir ( 4 cm ) . in most cases , catheterization is done in the subclavian vein , but it can be done in the internal jugular vein , the external jugular vein , and the common femoral vein . during subclavian venous catheterization , . hemorrhage usually occurs as a result of the puncture of the subclavian artery , the pulmonary artery and other adjacent vessels such as the intercostal artery and the internal mammary artery . moreover , such hemorrhages are easily concealed due to blood tracking in the pleural cavity . the artery is in an anatomically non - compressible location , which means that local pressure is ineffectual . in the present case , the first time , a vessel dilator was also inserted , which may have caused damage to the left subclavian artery and hemorrhage and triggered the hemothorax . however , this can not explain why repeated x - rays showed no hemorrhage at all in the left chest - area and only found that the opposite side had a massive hemothorax . hemothorax occurring from a subclavian venous cannulation can cause an acute loss of blood and circulatory collapse . in such cases , with the use of an angiogram , stent implantation or surgical treatment but then it becomes difficult to reach the hemorrhage site of the thoracic apex . in the case of our pediatric patient , the first chest tube was inserted in the lower part of the right thorax . so , a chest tube was inserted into the upper portion of the thorax and 2,000 ml of blood was drained . the amount of hemorrhaging did not decrease , so a median sternotomy was considered for hemostasis . however , a large amount of hemorrhaging and transfusion had caused a disseminated coagulation dysfunction and a platelet reduction . a definite diagnosis of right - side hemorrhage could not be made , so both sides of the thorax were checked during the median sternotomy . the cause of the hemothorax in our patient could not be found without an autopsy . nevertheless , the authors attempted to find the cause by considering the events before and after the occurrence of the hemothorax and by weighing the information from other reported cases . hemothorax is a common sequela of chest trauma , an underlying malignancy , a ruptured aortic aneurysm , and inadvertent vessel injury in a central venous cannulation or a tube thoracostomy . when hemothorax is noted without any obvious trauma , it is called spontaneous hemothorax or non - traumatic hemothorax . causes implicated in the etiology of the spontaneous hemothorax include neoplasms , coagulation disorders , av malformations , ruptured aneurysms , endometriosis , and pulmonary vasculature malformations . a few cases of pseudoaneurysm of the subclavian artery , the internal mammary artery , the intercostal artery , the brachiocephalic trunk , the thyrocervical trunk and the innominate artery following subclavian vein catheterization attempts have been reported as the cause of spontaneous hemothorax . some have reported internal mammary artery pseudoaneurysms that complicated severe chest wall infection in children . therefore , anterior chest wall abscesses should be treated aggressively to prevent the transthoracic spread of an infection leading to vascular complications . in the present case , our patient had the subclavian venous port removed . within a few minutes , a severe drop in blood pressure was noted . an inflammatory ulcer and an abscess at the insertion point of the port may have caused the vascular abnormalities in the thorax . or the catheter itself may have caused mechanical irritation causing vascular abnormalities in the area . also , in the process of removing the catheter , the rupture of the vascular abnormalities may have caused the hemothorax . during the sternotomy pseudoaneurysms in adjacent nearby vessels , such as the intercostal artery , the intermammary artery , or the brachiocephalic trunk could have ruptured and caused the hemothorax . the formation of pseudoaneurysms can be diagnosed on contrast angiography , contrast computed tomography , and pulmonary arterial angiography . methods of treatment are endoscopic coagulation , angiographic embolization , surgical resection , or repair [ 7 - 9 ] . pseudoaneurysm can not be discovered from a simple thoracic x - ray , so a definite diagnosis could not be made . the median sternotomy showed the right upper pleural apex drooping to the lower part , where the acute infection was seen . kim et al . reported that spontaneous hemothorax is caused by a small vascular rupture of adhesions between the visceral pleura and parietal pleura , which is caused by pulmonary collapse from damage to vascular pulmonary bullae or other factors . bleeding adhesions are identified as the cause of hemothorax in up to 53% cases of spontaneous hemopneumothorax . the adhesions are commonly found near the apex and can also be found near the aorta , the subclavian vessels , and the pericardium . explanations for the substantial bleeding from these torn adhesions include absence of a tamponade effect , lung movement impeding clot formation , and defective muscle components in the vessel wall . for hemostasis in a pediatric patient , median sternotomy was performed , which led to us finding a severe bulging of the parietal pleura in the upper portion of the right chest , dissection between the parietal pleura and visceral pleura , and a large hematoma between the 2 pleurae . considering that pneumothorax occurred on the left side and hemothorax on the right , it can not be diagnosed as spontaneous hemopneumothorax . the cause of the pneumothorax on the opposite side may be from pulmonary penetration by the introducer needle or dilator . or it could be from barotrauma caused by continuous elevation of air pressure due to the hemothorax or the infusion of a large amount of blood and fluid . many authors have reported on ipsilateral hemothorax from a central venous catheterization . however , hemothorax on the opposite side has rarely been reported ( 0.4 - 0.7% ) . one case was reported where , during placement , the subclavian vein , the pleura , and the pulmonary tissue were punctured and the result was contralateral tension pneumo- and hemo - thorax . one case of acute contralateral hemothorax due to the puncture of the superior vena cava during the left subclavian vein cannulation for hemodialysis was reported . in the present case , when the central venous catheter was inserted on the left , the deep insertion of the dilator could have caused damage to either the subclavian vein or other vessels and caused a large hemothorax . however , the thoracic surgeon discovered during the sternotomy that there was no significant damage to the vessels . the reports of complications after the removal of a central venous catheter are rare , and hemothorax after the removal of central venous catheter is also very rare . a case of massive hemothorax developing a few minutes after the removal of a central venous catheter was reported in a patient who had an arteriovenous fistula for hemodialysis on the same side as the arm arteriovenous fistula . the investigators recommended avoiding positioning the central catheter on the same side as an arm arteriovenous fistula . they emphasized that it was necessary to monitor patients after the removal of the subclavian vein catheter to detect this potentially fatal complication . some postulated that it was likely that damage to the arterial adventitia had occurred during catheter insertion or use , which was not apparent as long as the catheter had remained in situ because of the " tamponading " effect by the catheter on the damaged artery . only upon removal of the catheter and release of the " tamponade " does the integrity of the arterial wall fail , resulting in formation of an aneurysm . such damage to the adventitia is not apparent at the time of the implantation because the arterial lumen is not entered . it can occur either from grazing of the artery by the implantation needle or guide wire , or from rubbing of the catheter on the arterial adventitia during its use . to date , reports on hemothorax are rare when a central venous catheter is removed from a child . we found just one precedent , a 2 year old male patient who had a serious hemothorax when the central venous catheter was removed from the right jugular vein . complications with central venous cannulation must be looked for , and a routine chest x - ray must be performed . it is interesting that complications after the removal of central venous catheters are infrequently , if ever reported . when fusing medical knowledge of reported cases with the physical condition of our patient , we came up with the following list of possible causes of the hemothorax . ( 1 ) a complication from the left subclavian venous catheter puncture . in other words , when the left subclavian vein was punctured , the right subclavian vein or other blood vessels could have been damaged . however , there was no damage of the right vessels found in the sternotomy , so this possibility is not likely . ( 2 ) the hemothorax might have occurred from a torn vessel located in the dissection between the right parietal and visceral pleurae . ( 3 ) the hemothorax could have been caused after the removal of the infected right subclavian venous catheter . a great amount of blood may have flown from the subclavian vein where the subclavian venous catheter was removed . but we did not find serious hemorrhaging near the right subclavian vein during the sternotomy . ( 4 ) given that we found a lot of blood between right parietal pleura and viscerial pleura during the sternotomy , the parietal pleura drooped to a lower portion , and an abscess pocket developed in the right thorax , it is possible that a pseudoaneurysm near the blood vessels could have formed . in the process of removing the infected subclavian venous catheter , drainage near the pseudoaneurysm the most likely possibility of vascular findings are intercostal arterial- and internal mammary pseudoaneurysms . however , during the sternotomy , the pseudoaneurysm had already ruptured . because the patient experienced septicemia and disseminated coagulation dysfunction , his thoracic region experienced hemorrhaging . therefore , the exact location of the hemorrhage could not be found . nevertheless , since a simple surgery such as a ticvad catheterization can lead to critical conditions or even death , we emphasize the dangers and complications of central venous catheterization in the field of anesthesia . hence , we emphasize the great value patient observations . in both the insertion and the removal of the catheter , serious complications can occur . when an infected central venous catheter is removed , because the adjacent blood vessels can have complications , careful patient observation is always required .

the percutaneous placement of a totally implantable vascular access port via the subclavian vein is commonly used in patients with a need for multiple intravenous infusions such as administration of chemotherapy . unfortunately , the use of central venous ports have been associated with adverse events that are hazardous to patients . here we report the case of a 5-year - old child who died of catastrophic hemothorax after several attempts at insertion of an implantable subclavian venous access device and removal of an infected port . massive hemothorax occurred on the side contralateral to unsuccessful attempts at insertion of a new port and ipsilateral to the removal of an infected port . we could not confirm the cause of death and hemothorax without autopsy , but we discuss several possible causes of massive hemothorax .

Case Report Discussion

rotator cuff tear is a frequent cause of shoulder pain and can result in weakness , alterations in glenohumeral kinematics , and shoulder instability1 . arthroscopic surgery is a less - invasive approach to treatment of rotator cuff tears4 . classical teaching has advocated for passive range of motion exercises in the early postoperative period in an effort to minimize adhesions and stiffness . mobilization of the joint during the early period of recovery helps to prevent adhesions and reduces the frequency of complications . recent retrospective studies have shown that patients who received no formal physical therapy or limited physical therapy regained their range of motion and demonstrated no significant restrictions at 1 year after surgery . however , no studies have yet evaluated functional outcomes and daily - living activities within the first six months following surgery5,6,7,8,9 . this study evaluated short - term patient outcomes after arthroscopic rotator cuff repair multiple times at 1 week intervals using a postoperative rehabilitation protocol with early passive motion . an 82-year - old male fell during a walk , resulting in an inability to raise his right upper limb and pain in his right shoulder . he was subsequently diagnosed with a supraspinatus tear with fatty infiltration of the muscle belly by magnetic resonance imaging ( fig . 1.magnetic resonance imaging on the left demonstrates the supraspinatus muscle tear where it attaches to the humerus ( white arrow in a)on the right , the same muscle is torn ( white arrow in b ) ) . the patient had no history of neurological problems , cervical spine disc herniation , or psychological problems and was amenable to therapy . he was instructed to wear an abduction brace for the first 6 weeks after surgery . from day 1 after surgery , gradually increasing passive range of motion ( rom ) exercises including forward flexion and internal and external rotation were performed twice a day with the support of a therapist ( fig . 2fig . finally at 12 weeks after surgery , gradually increasing muscle strengthening exercises were introduced . after discharge , the patient continued this rehabilitation program 23 times per week until 20 weeks after surgery . the patient was examined using several standardized rom assessments such as forward flexion and abduction every week until 20 weeks after surgery , and the results were recorded . magnetic resonance imaging on the left demonstrates the supraspinatus muscle tear where it attaches to the humerus ( white arrow in a ) on the right , the same muscle is torn ( white arrow in b ) early rehabilitation protocol following arthroscopic rotator cuff repair active rom ( forward flexion , extension , internal and external rotation and abduction ) , the ucla shoulder rating scale ( ucla scale ) , and the quick disabilities of the arm , shoulder , and hand ( quickdash ) questionnaire assessments were performed and recorded every week after surgery except for weeks 13 , 15 , and 16 , due to patient scheduling variables . the ucla scale has been used to describe the outcome of interventions for many shoulder conditions , including rotator cuff tears . activities of daily living ( adl ) were assessed with the quickdash10 , 11 . the quickdash questionnaire is a self - reported questionnaire that reflects the functional state and symptoms from the patient s perspective . furthermore , the quickdash evaluates disability due to upper extremity injury ( quickdash disability / symptom ) as well as the limitations of work - related activities ( quickdash work ) and leisure ( quickdash sports / music ) . the subject provided written informed consent to take part in the study prior to its commencement , and the study conformed to the principles of the declaration of helsinki . this study was conducted with the approval of the research ethics committee of health science university ( approval number : 30 ) . until 6 weeks after surgery , the primary goals were to decrease pain , improve healing , and restore normal joint motion ( fig . , the rehabilitation goals included weaning off the abduction brace and increasing active rom . rehabilitation criteria included adequate passive rom for advancement , minimal substitution patterns with passive rom exercises , and minimal pain with passive rom ( fig . 2 , phase ii ) . at 6 weeks after surgery , pain had nearly disappeared . active forward flexion , internal rotation , and external rotation were 150 , 70 , and 60 , respectively ( fig 3fig . 3.range of motion during the early rehabilitation protocol after arthroscopic rotator cuff repair ) . the ucla scale score and quickdash disability / symptom score were 34 and 36 points , respectively ( fig 4fig . 4.ucla scale and quickdash questionnaire scores during the early rehabilitation protocol after arthroscopic rotator cuff repairucla scale : ucla shoulder scoring scale ; dash - d : quickdash disability / symptom module ; dash - w : quickdash work module ; dash - s / m : quickdash sports / music module ) . at 10 weeks after surgery , the patient was discharged and able to resume work and sports ( quickdash work and sports / music scores of 44 and 31 points , respectively ) . subsequently , rom and quickdash scores regressed ( active forward flexion , 120 ; quickdash disability / symptom score , 25 points ) compared with at 710 weeks after surgery ( fig 3 and 4 ) . from 20 weeks after surgery , the advanced strengthening phase can typically be initiated ( fig . active rom values were higher compared with at 10 weeks after surgery , and active internal rotation , external rotation , and abduction were 80 , 80 , and 160 , respectively ( fig . 3 ) . the quickdash disability / symptom and sport / music scores were both 0 points . furthermore , his disability related to difficult housework improved , so all disability parts of the quickdash became 0 points ( fig . range of motion during the early rehabilitation protocol after arthroscopic rotator cuff repair ucla scale and quickdash questionnaire scores during the early rehabilitation protocol after arthroscopic rotator cuff repair ucla scale : ucla shoulder scoring scale ; dash - d : quickdash disability / symptom module ; dash - w : quickdash work module ; dash - s / m : quickdash sports / music module rehabilitation is an important component in the postoperative recovery of patients after rotator cuff repair . although patient age , activity level , and tear size influence surgical decision - making , nonsurgical management is frequently the preferred method of initial treatment after a rotator cuff tear12 . recently , rehabilitation protocols have varied considerably among providers with respect to both timing of progression and application of therapeutic exercise13 . conducted a retrospective review of 43 patients in which no formal physical therapy was started until 6 weeks after surgery . in an examination at 6 weeks after surgery , they noted that 23% of their patients had residual stiffness ; however , at 1 year after surgery , the patients had regained their range of motion , with no significant restrictions at the final follow - up assessment14 . in a prospective randomized study , cuff et al . determined that both early and delayed range of motion groups had similar clinical outcomes at 1 year after arthroscopic repair of a full - thickness supraspinatus tear the early range of motion group regained a greater average forward elevation ( 172 ) compared with the delayed group ( 165 ; p<0.0001 ) at 6 months . however , their values had equalized by 1 year , and rom tests revealed similarly improved results in both groups . forward elevation was 174 in the early group and 173 in the delayed group . external rotation was 46 in the early group and 45 in the delayed group , with no statistical differences between the two groups15 . this study evaluated short - term patient outcomes after arthroscopic rotator cuff repair using a postoperative rehabilitation protocol with early passive rom exercises . at 6 weeks after surgery , pain almost disappeared and rom was high . active forward flexion , internal rotation , and external rotation were 150 , 70 , and 60 , respectively . particularly after arthroscopic rotator cuff repair , an early rehabilitation protocol must be carefully administered until 6 weeks after surgery because the first 6 weeks after surgery represent an important period for ingrowth of the tendon to the bone surface16 . this phase typically lasts for 48 weeks after surgery , but may be delayed , depending on the age of the patient and quality and size of the repair . cellular proliferation and matrix deposition during this phase are thought to be regulated by several growth factors and initially yield primarily type iii collagen17 . the patient was discharged at 10 weeks after surgery , and his rom and quickdash scores regressed ( active forward flexion , 120 ; quickdash disability / symptom score , 25 points ) compared with at 710 weeks after surgery ( figs . 2 and 3 ) . at discharge , the adl of this patient greatly changed , as he resumed work and leisure18 . it is imperative that the therapist watch for increases in adls and modify the home exercise program at the time of discharge to account for increases in stress on the shoulder . return to work should occur only after the patient has been cleared by the therapist , has achieved symmetric motion and strength and a normalized scapulohumeral rhythm , and has no complaints of pain at rest or during activities19 . this study demonstrates that there may be advantages to prescribing formal physical therapy that includes early passive range of motion exercise for patients undergoing arthroscopic repair for a full - thickness supraspinatus tear . early rehabilitation protocols are recommended to physical therapists during rehabilitation for arthroscopic rotator cuff repair to support rapid reintegration into daily - living activities . early rehabilitation after rotator cuff repair resulted in greater recovery in a shorter time span , which in turn is related to adl and convenience for the patient . this study was only one case , and comparisons with gentle rehabilitation have not been done . in the future , further studies are needed that compare the effectiveness of early rehabilitation compared with conventional rehabilitation for short - term outcomes after arthroscopic rotator cuff repair .

[ purpose ] the effect of early rehabilitation protocols after arthroscopic rotator cuff repair is currently unknown . we examined short - term effects of early rehabilitation on functional outcomes and activities of daily living after arthroscopic rotator cuff repair . [ subject and methods ] an 82-year - old male fell during a walk , resulting in a supraspinatus tear . arthroscopic rotator cuff repair was performed using a single - row technique . he wore an abduction brace for 6 weeks after surgery . [ results ] from day 1 after surgery , passive range of motion exercises , including forward flexion and internal and external rotation were performed twice per day . starting at 6 weeks after surgery , active range of motion exercises and muscle strengthening exercises were introduced gradually . at 6 weeks after surgery , his active forward flexion was 150 , ucla shoulder rating scale score was 34 points , and quick disabilities of the arm , shoulder , and hand questionnaire disability / symptom score was 36 points . at 20 weeks after surgery , his active forward flexion was 120 , ucla shoulder rating scale score was 34 points , and quick disabilities of the arm , shoulder , and hand questionnaire disability / symptom score was 0 points . [ conclusion ] these protocols are recommended to physical therapists during rehabilitation for arthroscopic rotator cuff repair to support rapid reintegration into activities of daily living .

INTRODUCTION SUBJECT AND METHODS RESULTS DISCUSSION

numerous studies over the last two decades , in other countries as well as in the united states , have found wide variations in the per capita utilization rates of many medical and surgical procedures . though many have contributed , this variations phenomenon has come to be most closely associated with the work of wennberg and his coinvestigators ( wennberg and gittlesohn , 1980 ; wennberg and gittlesohn , 1982 ; mcpherson et al . , 1982 ) . wennberg has argued that the substantial variations can not be adequately explained by differences in population characteristics such as age or morbidity ( wennberg , 1987 ) and has proposed that the most important factor is the style of medical practice ( wennberg and gittlesohn , 1982 ) . a wide variety of acceptable practice style is made possible by the substantial uncertainty physicians face in diagnosing disease and prescribing appropriate treatment ( wennberg , barnes , and zubkoff , 1982 ) . the proposition that variations in per capita utilization are important because of such factors may be referred to as the practice style hypothesis . in a recent article , stano examined wennberg 's practice style hypothesis by analyzing not only intermarket variations in per capita utilization , the standard measure in studies of this kind , but also variations in the intensity with which physicians treat their patients ( stano , 1986 ) . for a large sample of procedures provided to regular michigan blue shield subscribers in 1980 , it confirmed the wide intermarket differences in per capita utilization rates that were expected on the basis of previous research . however , the study also revealed substantial intramarket variations in the intensity of care rendered by physicians to their patients . more important , no clear relationships were found between per capita utilization and either the average intensity at which physicians treat their patients or the degree of intramarket variation in this intensity . this evidence suggests that practice style may not be as important in explaining the variations phenomenon as has been advanced in the literature . the article also suggests that patients in high - care areas tend to see a higher number of providers , a potentially significant alternative factor in explaining differences in per capita utilization . the present study applies the stano ( 1986 ) methodology to data for michigan 's medicare enrollees and further investigates the practice style hypothesis in the medicare context . this analysis both illuminates the practice style issue and bears on public policy concerns over medicare cost containment . with especially rapid rates of increase in health care spending by the elderly ( waldo and lazenby , 1984 ) and the consequent budgetary pressures on the medicare program , the search for cost - saving strategies has led to a growing concern over the extent to which the variations phenomenon also applies to medical services provided to medicare beneficiaries . for example , a recent contribution on medicare part b utilization ( chassin et al . , 1986 ) found wide variation between markets in the per capita utilization rates of many procedures . across 13 large areas of 8 states , the per capita utilization rate in the highest use area was at least three times the rate in the lowest area for 67 of the 123 medical and surgical procedures that were examined . not surprisingly , the variation between areas , as measured by the coefficient of variation , was high for many procedures . the value of this index was greater than 30 for 76 of the 123 procedures , and averaged 44 for the set of 117 procedures that excluded physician office visits . it uses geographic areas of analysis designed to represent physician market areas as opposed to the larger areas used in the chassin et al . the per capita utilization variable is an aggregate across 311 procedures based on a relative value scale , which not only standardizes heterogeneous procedures into a single scale but also permits an assessment of the degree to which variations in individual procedures wash out in the aggregate . more importantly , in addition to per capita utilization , it presents direct evidence on variations in a practice style indicator intensity of patient care . this intensity is measured by the average number of relative value units a physician provided per patient for those patients treated in 1980 . this measure permits an assessment of the degree to which practice style accounts for variations in per capita utilization . the results show that per capita utilization rates for medicare part b , when aggregated through a relative value scale , are more uniform than one might expect from the existing literature . the medicare utilization rates are considerably more uniform than a comparable index of use by regular blue shield members . moreover , as is the case for blue shield beneficiaries , there are substantial within - market variations in intensity of care . finally , unlike the suggestions by wennberg and others , we find that the relationship between intensity of care and per capita utilization is weak to insignificant . to permit comparisons with the data reported in the michigan blue shield study , we identified 311 medicare procedures as being comparable in scope to the 424 high - frequency or high - charge procedures used in that analysis . the medicare files define groups of procedures somewhat differently from the blue shield files so that the 311 medicare procedures represent the same set of procedures as the 424 blue shield procedures . thus , the utilization rates for medicare can be directly compared with those for blue shield . the 311 procedures were dominated by surgical procedures and accounted for 35 percent of all medicare part b charges in michigan in 1980 . to standardize the heterogeneous services into a single measure , the 311 procedures were aggregated on the basis of relative value units ( rvu 's ) . by this method , an office visit for an established patient - brief service was chosen as the base unit and was arbitrarily assigned the value of 1 . then the weight for the ith procedure was taken as the statewide relative charge for the ith procedure . for example , a procedure whose average statewide charge was 10 times the charge for a brief office visit was given the weight of 10 . thus , the total rvu 's in each utilization measure represents the total brief office visit equivalents . we examine this rvu aggregate , not because it is inherently always superior to analysis of individual procedures , but because it complements previous research in several useful ways . first , by reducing the data to a single measure , the data become easily understood and the index is readily applied to various analyses . second , the data provide a basis for assessing the average cost implications of inter - area variations . finally , if an area tends to have higher than average utilization for one set of procedures but lower for another , the variation in rvu 's ( and consequently in expenditures ) will be less than that reported for many individual procedures . thus , the rvu measure permits some assessment of the tendency for variation in practice style to wash out . two measures of utilization were derived using the 1980 rvu data . one measure , the per capita utilization , is defined as the total number of rvu 's generated by physicians in an area for that year divided by the area 's effective eligible population . it is defined as the total number of rvu 's the physician provided divided by the total number of different patients seen by the physician in that year . this figure represents the average number of rvu 's provided by physicians to their patients in 1980 . by computing this value for every physician in the sample , both the average intensity with which physicians render care in each area as well as the intensity measure is used in this study as an index of the standard of practice . its intramarket variation is taken as an indicator of the extent to which that standard varies . we stress that , although the two utilization measures derive from the same rvu data , they are not equivalent measures . ceteris paribus , the per capita utilization rate will be a direct function of the average intensity of care , but it will also vary directly with the proportion of eligible enrollees that visit physicians and the average number of physicians that treat those patients who have sought care . thus , when all things are considered , per capita utilization and intensity are not necessarily positively correlated . the data for both measures are presented by physician market areas derived on the basis of the economics of location and adjusted for patient bordercrossing . to devise the market areas , data on patient origin and place of service were arrayed for each of michigan 's 83 counties forming an 83 83 matrix . the matrix recorded the percentage of relative value units the residents of each county received from every other county . the major weight in determining central places was placed on the ability of the county to serve its own patients . in most cases , the central place counties were those that provided at least 75 percent of the care received by patients originating from that county . noncentral place counties were then assigned to contiguous central places based on the percentage of care provided in a manner that generated groups of counties identified as physician market areas . each market area formed provided at least 80 percent of the patient visits originating from its own population . in addition , a correction for patient bordercrossing was made by reassigning population to calculate each area 's effective population . with this adjustment , if , for example , residents of market a received 10 percent of their rvu 's in market b , the latter 's effective population was increased by 10 percent of market a 's population , and market a 's population was correspondingly reduced . thus , each market received 14 adjustments to account for net export ( import ) of services to the other market areas . although there are exceptions , high - unadjusted - use areas tend to be net exporters of patient services . a method that ignores bordercrossing would seriously distort the utilization rates and indicate greater intermarket variation than actually exists . however , we did find that medicare patients received a greater portion of their care in their own market areas than blue shield patients . in each of the following analyses , we have also scaled the coefficient by multiplying the ratio by 100 . in dividing by the mean , the coefficient standardizes the measure of variation to account for the scale of the series ; thus , two series with different means may be compared . however , most area studies have reported the cv and that evidence offers some basis for comparison . presented in table 1 are the 15 market areas , their physician and medicare populations , and their utilization rates for both blue shield subscribers and medicare eligibles . the coefficient of variation for the two utilization series is also discussed in table 1 . as one would expect , medicare utilization is substantially higher , 134 percent higher for the state , than the blue shield utilization . however , the patterns for both populations are similar , with the contiguous detroit , flint , pontiac , and warren markets showing substantially higher utilization than the rest of the state . the populations in these market areas have the highest per capita incomes and are among the most comprehensively insured in michigan . other medical resources , such as hospitals and physician specialists , are also concentrated in these areas . the data also suggest that there are roughly two groups of utilization rates across the state . one is the approximately 19 rvu 's per medicare enrollee found in the high - use areas noted earlier . the other is the approximately 12 - 15 rvu range found for most of the remaining markets . however , these two small population areas are probably anomalies in that they are the two areas in the state that are most sensitive to uncaptured out - of - state service . most noteworthy , the variation among the medicare population is much smaller than the variation among the blue shield population . the coefficient of variation ( cv ) for medicare is 30 percent lower than that for blue shield , i.e. , 21.3 versus 30.3 . the difference in variation shows up in the difference between the higher - and lower - use area . joseph areas , medicare utilization in the highest area ( detroit ) is 62 percent higher than the utilization in the lowest area ( petoskey ) . by comparison , blue shield utilization in the highest area ( pontiac ) is 86 percent higher than utilization in the lowest area ( kalamazoo ) . the result for michigan suggests that the variations phenomenon may be less of a concern for the medicare population than for the non - medicare population . the relatively lower level of variation for medicare utilization also suggests that michigan 's medicare enrollees have not been greatly disadvantaged by uneven access to care . it was possible that variations in medicare utilization could be exacerbated by variations in the rates at which physicians accept assignment and variations in financial abilities of those patients whose physicians do not accept assignment . however , the relatively low coefficient of variation for medicare utilization suggests this is not a problem . physicians accepted assignment on claims accounting for 73 percent of medicare part b charges in 1980 , a figure that was much higher than the rates in most other states as well as the national average . in 1978 , we estimated that blue cross payments per rvu were only 9 percent higher than medicare payments per rvu . this figure is considerably less than the 20 to 30 percent differences found in one national study ( cromwell and burstein , 1985 ) . so the relative financial difference to physicians of treating medicare versus blue shield patients was small . secondly , the coefficient of variation for the medicare population appears relatively low in comparison to other reported figures . as noted previously , the coefficients of variation reported by chassin et al . although the differences could result from underlying differences in the populations and the physicians , another plausible explanation is at hand in the process of aggregation . if levels of utilization of individual procedures are not highly correlated , the variations will tend to be dampened in an aggregate measure . it has been reported elsewhere that areas that are high in one set of procedures tend to be low in others ( chassin et al . , 1986 ) . thus , the aggregate rvu measure will be less volatile . in consequence , and to this degree , variations in average costs will tend to be less than might have been expected based on previous reports for individual procedures . this result for rvu 's helps to illuminate one aspect of the variations phenomenon , but it does not invalidate wennberg 's ( 1984 ) policy proposals aimed at curbing the degree of variation in individual procedures . if some procedures are indeed excessively used in some areas , a reduction in their utilization could be important for cost savings . however , we underscore chassin 's ( 1986 ) warning that the variations phenomenon is easily misinterpreted in this regard . it is too tempting to conclude that inappropriately high levels of care are being rendered in high - use markets . the observed differences might be explained by insufficient use in some markets , differences in the incidence of illness , or other unknown effects . a unique feature of this data set is that it contains a direct indicator of practice style . as previously defined , intensity of care measures the number of rvu 's provided to an average patient over a period of time by each physician . variations in intensity may be interpreted as reflecting variations in a physician 's propensity to utilize various medical procedures for a given set of indications , hence practice style . because intensity is calculated for each physician intensity data for the 15 markets for both primary care physicians and general surgeons are reported in table 2 . the variation in intensity is measured by the coefficient of variation and is reported for both within markets ( note the cv columns ) and between markets ( note the cv row ) . the physician samples consist of all physicians and doctors of osteopathy who had practiced in the same market area from 1975 to 1980 , provided at least 25 rvu 's each year , and treated at least 5 different medicare patients per year . as is apparent in table 2 , variations in intensity within markets are quite substantial . coefficients of variation for primary care range from a low of 18.1 to a high of 76.0 . variation in intensity between markets is relatively low , 14.8 and 18.9 for primary care physicians and general surgeons , respectively . that these coefficients of variation are lower than those for within market variation is to be expected because the market intensity values are themselves sample means the more important issue examined here is whether the differences in physician practice style account significantly for the observed intermarket variations in per capita utilization rates . this issue is pursued by conducting simple bivariate regressions with the dependent variable taken as the medicare per capita utilization rate and the independent variable the intensity level . these estimates and regressions of intensity level on the respective intramarket coefficient of variation are reported in table 3 . for primary care physicians , the coefficient of the intensity variable is positive but the equation overall is not significant at the 5-percent level . likewise , in the third regression , the primary care intensity level is not significantly related to the primary care intramarket coefficient of variation . therefore , there is no clear evidence that a more intense style of practice by primary care physicians , the dominant specialty in terms of size , is associated with higher per capita utilization . as argued elsewhere , higher per capita utilization rates must result from a higher proportion of beneficiaries who seek care , or larger numbers of physicians seen by a typical patient ( stano , 1985 ) . the insignificance of primary care intensity suggests a simple but clear warning that these other sources of variation should not be overlooked . furthermore , these other sources of variation are not in any obvious sense physician - caused or practice style phenomena , and consequently suggest very different policy responses . because many variations studies have focused on surgical procedures , the results for general surgeons are of special interest . for general surgeons , furthermore , the coefficient for general surgeon intensity ( gsint ) is positive and significant as is suggested by the practice style hypothesis . second , and more important , the significance of the general surgeon equations is largely the result of two outlier observations , pontiac and warren . both pontiac and warren have high per capita utilization that are not only the highest rvu 's per patient , but also have higher values for the coefficient of variation of the intensity variable . without these two observations , the f value for the regression of utilization on general surgeon intensity is only 0.26 and insignificant . although there is no reason to exclude these observations , the dependence on so few observations for significance indicates that the relationship is tenuous . when the two outliers are excluded , the equation f value drops from 15.14 to 0.70 . finally , though not reported in table 3 , we also developed equations to predict the individual physician values of the intensity variable for both primary care and general surgeons . independent variables included medicare fees , a large set of market and economic and demographic variables , indicators of the health status of the population , the availability of physicians , and the availability of hospital beds . in particular , the average intensity with which general surgeons practiced was not related to the availability of general surgeons or hospital beds . the average intensity for primary care physicians also was unrelated to their availability or to the availability of other specialists and hospital beds . we have examined the extent of intermarket variations in per capita utilization of physician services by michigan 's medicare population . the analysis employed an aggregation of individual procedures by a relative value unit index that reflects relative costs . in addition , the analysis employs physician market areas devised through the economics of location with populations adjusted to reflect patient bordercrossing . the results indicate that intermarket variation in utilization for medicare is substantially less than that for blue shield . this suggests , for michigan at least , that the variations phenomenon is less of a public policy worry for the medicare population than for the non - medicare population . in addition , the level of variation in medicare utilization is found to be relatively low . the coefficient of variation value of 21 for our aggregate of 311 procedures is less than one - half of the average value reported by chassin et al . if utilization in an area is high for one set of procedures but low for others , the variations phenomenon will tend to wash out in the aggregate . our result indicates that substantial washing out occurs so that variations in average costs will tend to be less than is suggested by reports on individual procedures . this result does not in itself invalidate policy designed to save costs by curbing variation . if in fact high utilization for some procedures in some areas is unnecessary , then substantial costs may be saved by curbing variation in individual procedures . a relatively unique feature of our data set is that it contains a direct indicator of practice style . the indicator of practice style is the intensity with which physicians treat their patients , here measured as the number of relative value units each physician delivers to an average patient over a year . there are wide variations within markets in intensity for both primary care physicians and general surgeons . the within - market - area coefficients of variation for the two groups , respectively , had average values of 55 and 64 ( although in each case it was less than its previously reported blue shield counterpart ) . the across - market - area coefficients of variation , in contrast , were relatively low , 15 and 19 , respectively . perhaps the most wide - ranging issue addressed in this article is the relationship between intensity and per capita utilization . we found that primary care physician intensity is not significantly related to medicare per capita utilization in michigan . furthermore , the relationship between general surgeons ' intensity and medicare utilization is only weakly significant and depends critically on two outlier observations . these results present the warning that the practice style hypothesis does not adequately account for the variations phenomenon , at least in michigan . thus , the higher utilization of some market areas must be attributable to other factors , namely a higher proportion of eligible users who seek care or a larger number of physicians who provide care to patients who seek care . because there is no way of determining from these data whether these factors are physician influenced or originate largely with patients , one can not conclude that the practice style factor accounts for much of the observed per capita variations . one major influence on patients ' decisions to seek care or to seek out more sources of care is likely to be the extent of the availability of medical resources . this accounts for the significant availability effects found in most aggregated studies of per capita utilization , e.g. , the classic study by fuchs and kramer ( 1972 ) . although the practice style factor may be an element of treatment decisions that increase the number of sources of care , as manifested by greater use of referrals to specialists , laboratories , and other diagnostic tests , this is distinct from wennberg 's concept of a largely random phenomenon where physicians have a predilection to practice more intensively in one market , and less so elsewhere . it is also distinct from the positive relationships between per capita rates of surgery and the availability of surgeons and hospital beds that wennberg and others have found . our results do not imply that variations in physician utilization are unimportant . to the extent that one would expect higher per capita utilization of physician care , for whatever reason , to be accompanied by increases in the use of other medical resources , although physician care may substitute for other forms of care , hospital utilization and physician utilization are likely to be related . with hospital costs for the elderly more than twice the expenditures on physician care ( waldo and lazenby , 1984 ) , variations in hospital costs resulting from variations in physician care will be magnified . the importance of this magnification is illustrated , for example , in one study of hospital utilization and costs that documented over threefold differences in contiguous markets in 1983 ( schramm , 1985 ) . many , however , interpret the variations in per capita utilization as strong evidence of unnecessary utilization . we believe that those who have reached this conclusion , or use the evidence to support a policy of controls that would impose the standards found in the more moderate use markets to other areas , are ignoring the complexity of the issue . in particular , the evidence we have provided indicates that the variations in per capita use in a set consisting of a large number of procedures are not closely related to an index of the practice style factor that was introduced here . elsewhere , the practice style concept is itself not well defined so that it appears as a catchall for the residual variation in per capita use rates that has not been explained . these alternatives could include the number and types of providers seen , differences in consumer preferences with respect to physician and other forms of care , an uneven diffusion of medical technology , and the structure of public and private insurance programs . controlling health care expenditures and reducing unnecessary utilization are legitimate priorities , but the focus on local medical standards , physician training , and other dimensions of practice style to explain the disparities in use rates has obscured the role of these potentially important factors .

variations in the utilization of physicians ' services by medicare enrollees in michigan are examined in this article . two measures of market - area utilization are estimated . one is the standard per capita utilization rate , which has been the common focus of many small area variation studies . the second measures the intensity with which physicians treat their patients and can be taken as an indicator of the so - called practice - style phenomenon . the results show that , although substantial intermarket variation in per capita utilization is found , the variations are not as large as one might expect and are considerably less than the variations in per capita utilization for michigan 's blue shield population . more important , the relationship between a market 's per capita utilization and intensity of care of primary care physicians is insignificant . the relevance of these findings , especially within the context of the practice style hypothesis and policy proposals that would establish physician practice norms , are discussed .

Introduction Data and methods Variations in per capita utilization Variations in intensity of care Intensity and per capita utilization Conclusions

the brfss is a standardized telephone survey that assesses key behavioral risk factors , lifestyle habits , and chronic illnesses and conditions among adults aged 18 years in all u.s . the brfss collected data using a landline sampling frame , and the median cooperation rate and response rate among states were 75.0 and 52.5% , respectively ( 10 ) . brfss data have consistently been found to provide valid and reliable estimates compared with results from other national household surveys ( 11 ) . diabetes status was ascertained by asking participants , have you ever been told by a doctor that you have diabetes ? participants who had an affirmative answer to this question were considered to have diagnosed diabetes ; however , gestational diabetes mellitus was coded as no diabetes . thirty - eight states / district of columbia / u.s . territories collected data on diabetes - related information using the diabetes module in 2009 : alabama , alaska , arizona , connecticut , delaware , the district of columbia , florida , georgia , guam , illinois , indiana , iowa , kentucky , louisiana , massachusetts , minnesota , missouri , montana , nevada , new hampshire , new jersey , new mexico , north carolina , north dakota , ohio , pennsylvania , puerto rico , south carolina , tennessee , texas , utah , vermont , the u.s . age at diabetes diagnosis ( years ) and current insulin use were determined by participants self - report . duration of diagnosed diabetes ( years ) was calculated by subtracting age at diabetes diagnosis from current age . respondents were classified as having type 1 diabetes if their age at diagnosis was < 30 years and they used insulin currently . persons were classified as having type 2 diabetes if their age at diagnosis was 30 years or if their age at diagnosis was < 30 years and they did not use insulin currently ( 12 ) . cancer status was ascertained by asking participants , have you ever been told by a doctor , nurse , or other health professional that you had cancer ? yes were asked the following question : with your most recent diagnoses of cancer , what type of cancer was it ? a total of 10 major cancer sites / tracts and 29 cancer types were included in the survey : cancer of the breast , the female reproductive tract ( cervix , endometrium , and ovary ) , the male reproductive tract ( prostate and testicles ) , the head / neck ( head and neck , oral cavity , pharynx , and thyroid ) , the gastrointestinal tract ( colon , esophagus , liver , pancreas , rectum , and stomach ) , leukemia / lymphoma ( hodgkin 's lymphoma , leukemia , and non - hodgkin 's lymphoma ) , skin ( melanoma and other skin cancer ) , lungs , the urinary tract ( bladder and kidney ) , and other sites ( heart , bone , brain , neuroblastoma , and other ) . age at cancer diagnosis was determined by participants self - report . participants who had a cancer diagnosis prior to a diabetes diagnosis were excluded from this study . to examine the potential confounding effects for the association between duration of diagnosed diabetes and cancer , we selected the following variables as covariates : demographic characteristics included sex , age ( years ) , race / ethnicity ( non - hispanic [ nh ] white , nh black , hispanic , and nh other ) , and educational attainment ( less than high school , high school , or some college or above ) . health insurance coverage at the time of survey ( any kind of health care coverage vs. none ) was ascertained by participants self - report . smoking status was classified as current smokers ( have smoked at least 100 cigarettes during their entire life and smoked in the past month ) , former smokers ( have smoked at least 100 cigarettes during their entire life but did not smoke in the past month ) , and never smoked . heavy drinking was defined , for adult men , as consuming on average more than two drinks per day . for adult women , heavy drinking was defined as consuming more than one drink per day . bmi ( weight in kilograms divided by the square of height in meters ) was calculated by using self - reported weight and height . leisure - time physical activity ( any vs. none ) was ascertained by asking the question , during the past month , other than your regular job , did you participate in any physical activity or exercise such as running , calisthenics , golf , gardening , or walking for exercise ? work - related physical activity was determined by asking employed or self - employed participants , when you are at work , which of the following best describes what you do ? would you say : 1 = mostly sitting or standing , 2 = mostly walking , and 3 = mostly heavy labor or physically demanding work ? we generated a new variable by combining the employment status and work - related physical activity as follows : 1 , employed at a job spent mostly sitting or standing ; 2 , employed at a job spent mostly walking , performing heavy labor , or doing physically demanding tasks ; and 3 , not employed ( including those who were unemployed , homemakers , students , those who were retired , and those who were unable to work ) . we reported the demographic characteristics , distribution of behavioral risk factors and lifestyle habits , diabetes - related characteristics , and cancer prevalence according to duration of diagnosed diabetes . prevalence ratios ( prs ) for cancers of all sites were estimated according to duration of diagnosed diabetes adjusting for selected covariates . to account for the possible nonlinear association between duration of diagnosed diabetes and prevalence of cancer , we conducted log linear regression analyses using a cubic spline with four knots at duration of diagnosed diabetes : p5 , p25 , p75 , and p95 . the unadjusted prevalence , age - adjusted prevalence , and multiple variable adjusted prevalence for cancers of all sites were estimated by type of diabetes . secondary analyses were conducted among men and women with type 2 diabetes to estimate unadjusted prevalence and adjusted prs ( 95% ci ) for cancers of all sites and cancer of specific sites / tracts in relation to duration of diagnosed diabetes ( < 15 vs. 15 years ) and current insulin use ( use vs. no use ) . the prs and 95% cis were estimated using log linear regression models with a robust variance estimator among men and women adjusted for selected covariates . the linear trends in the means , percentages , or prevalences by duration of diagnosed diabetes in the total sample or differences in prevalences by type of diabetes and current insulin use among men and women with type 2 diabetes were tested by using orthogonal polynomial contrasts . we conducted all analyses using sas ( version 9.2 ) and sudaan software ( release 10.0 ; research triangle institute , research triangle park , nc ) . sample weights were used to account for the varying probabilities of complex sampling design and nonresponse . we considered results with a two - tailed p value < 0.05 or an estimate of pr to be significantly different from 1 if the 95% ci did not include 1 . the p value of bonferroni correction for multiple comparisons was set at 0.017 ( i.e. , 0.05/3 ) . diabetes status was ascertained by asking participants , have you ever been told by a doctor that you have diabetes ? yes , but female told only during pregnancy , no , no , pre - diabetes or borderline diabetes , do nt know / not sure , and refused . participants who had an affirmative answer to this question were considered to have diagnosed diabetes ; however , gestational diabetes mellitus was coded as no diabetes . territories collected data on diabetes - related information using the diabetes module in 2009 : alabama , alaska , arizona , connecticut , delaware , the district of columbia , florida , georgia , guam , illinois , indiana , iowa , kentucky , louisiana , massachusetts , minnesota , missouri , montana , nevada , new hampshire , new jersey , new mexico , north carolina , north dakota , ohio , pennsylvania , puerto rico , south carolina , tennessee , texas , utah , vermont , the u.s . age at diabetes diagnosis ( years ) and current insulin use were determined by participants self - report . duration of diagnosed diabetes ( years ) was calculated by subtracting age at diabetes diagnosis from current age . respondents were classified as having type 1 diabetes if their age at diagnosis was < 30 years and they used insulin currently . persons were classified as having type 2 diabetes if their age at diagnosis was 30 years or if their age at diagnosis was < 30 years and they did not use insulin currently ( 12 ) . cancer status was ascertained by asking participants , have you ever been told by a doctor , nurse , or other health professional that you had cancer ? yes were asked the following question : with your most recent diagnoses of cancer , what type of cancer was it ? a total of 10 major cancer sites / tracts and 29 cancer types were included in the survey : cancer of the breast , the female reproductive tract ( cervix , endometrium , and ovary ) , the male reproductive tract ( prostate and testicles ) , the head / neck ( head and neck , oral cavity , pharynx , and thyroid ) , the gastrointestinal tract ( colon , esophagus , liver , pancreas , rectum , and stomach ) , leukemia / lymphoma ( hodgkin 's lymphoma , leukemia , and non - hodgkin 's lymphoma ) , skin ( melanoma and other skin cancer ) , lungs , the urinary tract ( bladder and kidney ) , and other sites ( heart , bone , brain , neuroblastoma , and other ) . participants who had a cancer diagnosis prior to a diabetes diagnosis were excluded from this study . to examine the potential confounding effects for the association between duration of diagnosed diabetes and cancer , we selected the following variables as covariates : demographic characteristics included sex , age ( years ) , race / ethnicity ( non - hispanic [ nh ] white , nh black , hispanic , and nh other ) , and educational attainment ( less than high school , high school , or some college or above ) . health insurance coverage at the time of survey ( any kind of health care coverage vs. none ) was ascertained by participants self - report . smoking status was classified as current smokers ( have smoked at least 100 cigarettes during their entire life and smoked in the past month ) , former smokers ( have smoked at least 100 cigarettes during their entire life but did not smoke in the past month ) , and never smoked . heavy drinking was defined , for adult men , as consuming on average more than two drinks per day . for adult women , heavy drinking bmi ( weight in kilograms divided by the square of height in meters ) was calculated by using self - reported weight and height . leisure - time physical activity ( any vs. none ) was ascertained by asking the question , during the past month , other than your regular job , did you participate in any physical activity or exercise such as running , calisthenics , golf , gardening , or walking for exercise ? work - related physical activity was determined by asking employed or self - employed participants , when you are at work , which of the following best describes what you do ? would you say : 1 = mostly sitting or standing , 2 = mostly walking , and 3 = mostly heavy labor or physically demanding work ? we generated a new variable by combining the employment status and work - related physical activity as follows : 1 , employed at a job spent mostly sitting or standing ; 2 , employed at a job spent mostly walking , performing heavy labor , or doing physically demanding tasks ; and 3 , not employed ( including those who were unemployed , homemakers , students , those who were retired , and those who were unable to work ) . we reported the demographic characteristics , distribution of behavioral risk factors and lifestyle habits , diabetes - related characteristics , and cancer prevalence according to duration of diagnosed diabetes . prevalence ratios ( prs ) for cancers of all sites were estimated according to duration of diagnosed diabetes adjusting for selected covariates . to account for the possible nonlinear association between duration of diagnosed diabetes and prevalence of cancer , we conducted log linear regression analyses using a cubic spline with four knots at duration of diagnosed diabetes : p5 , p25 , p75 , and p95 . the unadjusted prevalence , age - adjusted prevalence , and multiple variable adjusted prevalence for cancers of all sites were estimated by type of diabetes . secondary analyses were conducted among men and women with type 2 diabetes to estimate unadjusted prevalence and adjusted prs ( 95% ci ) for cancers of all sites and cancer of specific sites / tracts in relation to duration of diagnosed diabetes ( < 15 vs. 15 years ) and current insulin use ( use vs. no use ) . the prs and 95% cis were estimated using log linear regression models with a robust variance estimator among men and women adjusted for selected covariates . the linear trends in the means , percentages , or prevalences by duration of diagnosed diabetes in the total sample or differences in prevalences by type of diabetes and current insulin use among men and women with type 2 diabetes were tested by using orthogonal polynomial contrasts . we conducted all analyses using sas ( version 9.2 ) and sudaan software ( release 10.0 ; research triangle institute , research triangle park , nc ) . sample weights were used to account for the varying probabilities of complex sampling design and nonresponse . we considered results with a two - tailed p value < 0.05 or an estimate of pr to be significantly different from 1 if the 95% ci did not include 1 . the p value of bonferroni correction for multiple comparisons was set at 0.017 ( i.e. , 0.05/3 ) . there were a total of 34,424 adults with diagnosed diabetes participating in the survey with the diabetes module . of them , the demographic characteristics of participants in the analytic sample were similar to those with missing data . among adults with diagnosed diabetes and with complete data on cancer and diabetes - related covariates ( n = 25,964 ) , there were 11,165 men ( weighted percentage , 52.8% ) , 18,673 nh whites ( 65.3% ) , 3,575 nh blacks ( 16.0% ) , 2,348 hispanics ( 13.1% ) , and 1,368 participants with nh other race / ethnicity ( 5.6% ) . approximately 4.7% of adults with diagnosed diabetes were estimated to have type 1 diabetes ( n = 491 men and 721 women ) , 70.5% were type 2 diabetic without current insulin use ( n = 7,820 men and 10,475 women ) , and 24.8% were type 2 diabetic with current insulin use ( n = 2,854 men and 3,603 women ) . the population distribution of age at diabetes diagnosis was approximately symmetric around its median . among adults with diagnosed diabetes and cancer , after adjustment for selected covariates , there was an increasing trend in the adjusted prs for cancers of all sites by duration of diagnosed diabetes among men ( p < 0.0001 for linear trend ) ( fig . the results of spline regression analyses indicated that the adjusted prs of cancer increased among men with a diabetes diagnosis > 1 and < 15 years and leveled off or slightly decreased among men with a diabetes diagnosis > 15 years compared with those with a diabetes diagnosis < 1 year ( fig . similarly , the adjusted prs of cancer increased among women with a diabetes diagnosis > 1 year and < 15 years and leveled off or slightly increased among women with a diabetes diagnosis > 15 years ( fig . . adjusted prs ( aprs ) of diagnosed cancer in relation to duration of diagnosed diabetes among men ( a and c ) and women ( b and d ) with diagnosed diabetes ( brfss 2009 ) . a and b : duration of diagnosed diabetes is categorized into 04 , 59 , 1014 , and 15 years . , point estimates of prevalence ratios ; , referent groups , which are participants with duration of diagnosed diabetes < 1 year . estimates were obtained from log linear regression analyses using a cubic spline with four knots at duration of diagnosed diabetes 0 , 3 , 15 , and 30 years among men and 0 , 3 , 16 , and 33 years among women . adjusted for age ( continuous , year , centered at mean age of 58 years for men and 59 years for women ) , age squared , race / ethnicity ( nh white , nh black , hispanic , or nh other ) , educational attainment ( less than high school , high school , or some college or above ) , health insurance ( any vs. none ) , smoking status ( current smoker , former smoker , or never smoked ) , heavy drinking ( yes or no ) , obesity ( yes or no ) , leisure - time physical activity ( any vs. none ) , a combination of employment status and work - related physical activity ( employed at a job spent mostly sitting or standing , employed at a job spent mostly walking or performing heavy labor or doing physically demanding tasks , or not employed ) , current insulin use ( yes or no ) , and state code . the unadjusted prevalence for cancers of all sites among men with type 2 diabetes and current insulin use was higher than those with either type 1 diabetes ( p < 0.001 ) or those with type 2 diabetes and no current insulin use ( p < 0.001 ) among both men and women ( fig . the difference in the prevalence estimates for cancers of all sites remained between adults with type 2 diabetes with current insulin use and those with type 2 diabetes with no current insulin use among men ( p < 0.001 ) and women ( p < 0.001 ) . after adjustment for age and all other selected covariates , the difference in the prevalence estimates for diagnosed cancers of all sites among adults with different types of diabetes was attenuated . there was no statistically significant difference in prevalence estimates for diagnosed cancers of all sites across diabetes types ( all p values > 0.017 after bonferroni correction for multiple comparisons ) . unadjusted and adjusted prevalence estimates of self - reported cancer according to diabetes types among men ( a ) and women ( b ) ( brfss 2009 ) . prevalence and 95% cis were adjusted for age ( continuous , year , centered at mean age of 58 years for men and 59 years for women ) , age squared , race / ethnicity ( nh white , nh black , hispanic , or nh other ) , educational attainment ( less than high school , high school , or some college or above ) , health insurance ( any vs. none ) , smoking status ( current smoker , former smoker , or never smoked ) , heavy drinking ( yes vs. no ) , obesity ( yes vs. no ) , leisure - time physical activity ( any vs. none ) , a combination of employment status and work - related physical activity ( employed for a job mostly sitting or standing , employed for a job mostly walking or heavy labor or physically demanding , or not employed ) , duration of diagnosed diabetes ( years ) , and state code . p value of bonferroni correction for multiple comparisons among diabetes types is set at 0.05/3 = 0.017 . among both men and women with type 2 diabetes , the prevalence estimates for cancers of all sites were significantly higher among those who had diabetes 15 years than among those who had diabetes < 15 years after adjustment for all selected covariates ( table 1 ) . specifically , the prevalence was estimated to be significantly higher among adults who had diabetes 15 years for colon cancer , melanoma , nonmelanoma skin cancer , and cancer of urinary tract among men and the cancers of the breast , female reproductive tract , and skin among women than those who had diabetes < 15 years . unadjusted prevalences and adjusted prs for cancers of all sites according to duration of diagnosed diabetes among men and women with type 2 diabetes among both men and women with type 2 diabetes , the prevalence estimate for cancers of all sites was ~1.5 times higher among those who used insulin than those who did not use insulin after adjustment for demographic characteristics and selected health risk factors ( model 1 [ table 2 ] ) . the associations between current insulin use and cancers of all sites and cancers of specific sites or tracts appear to attenuate after further adjustment for duration of diagnosed diabetes ( model 2 [ table 2 ] ) . however , current insulin use remained significantly associated with increased prevalence of cancers of all sites among both men and women and increased prevalence of skin cancer ( both melanoma and nonmelanoma ) among men and cancer of the reproductive tract among women ( all p values < 0.05 ) . unadjusted prevalences and adjusted prs for cancers of all sites according to current insulin use status among men and women with type 2 diabetes adults with self - reported diagnosed diabetes , and our results indicate that duration of diagnosed diabetes was significantly associated with self - reported cancers of all sites in both men and women . analyses of adults with type 2 diabetes found an estimated 1.6-fold increased prevalence for cancers of all sites among men 15 years after diabetes diagnosis compared with men who had received a diabetes diagnosis within the past 15 years . similarly , we found an estimated 1.8-fold increased prevalence for cancers of all sites among women with type 2 diabetes who had lived 15 years since receiving a diabetes diagnosis compared with women who received a diabetes diagnosis within the past 15 years . we found a 1.3-fold increased prevalence of cancers of all sites among both men and women with type 2 diabetes who currently used insulin compared with those who did not currently use insulin ; the association between current insulin use and cancer appeared to be confounded , in part , by duration of diagnosed diabetes . it is worth commenting on the differences between the findings of prevalence or prs in our cross - sectional study and that of incidence , incidence rate ratios , or hazard ratios in two recent longitudinal studies ( 14,15 ) . carstensen and colleagues ( 14 ) and johnson and colleagues ( 15 ) have shown that cancer incidence ratios or hazard ratios are highest among patients within 1 year of diabetes diagnosis and decreasing or leveling off after 2 years of diagnosis compared with persons without diabetes . those results based on longitudinal data are useful in the assessment of new cancer events and temporal relations between diabetes and cancer ( 16 ) . in contrast , our results based on cross - sectional data are useful in the assessment of existing cancer state ( newly diagnosed , in active treatment , have completed active treatment , and living with progressive symptoms ) , cancer burden , or cancer survivorship according to duration of diagnosed diabetes and current insulin use . these cross - sectional findings may also be helpful in hypothesis screening for the possible association between diabetes and cancer ( 16 ) . our population - based study focusing on the prevalence estimates of self - reported diagnosed cancer according to duration of diagnosed diabetes may provide additional support for a possible link between diabetes and cancer . duration of diagnosed diabetes may represent a composite surrogate of the cumulative mixed effects related to underlying causes and treatment of diabetes and exposures to environmental hazards and health risk factors . a recent study has shown that diabetes duration is related to ~40% increased risk of all - cause mortality among diabetic men aged 6079 years ( 17 ) . the significant dose - response relationship between duration of diagnosed diabetes and cancer prevalence as shown in our study suggests that long - term exposure to diabetes - specific factors ( e.g. , hyperglycemia or hba1c levels , insulin resistance , use of antidiabetes medications , health and behavioral risk factors , worsening lipid and lipoprotein profiles , and chronic complications ) and possible synergistic effects among these factors may provide further support for the association between diabetes and cancer ( 1,2 ) . in addition , it is possible that certain environmental factors ( e.g. , pesticides ) may be related to both diabetes and cancer ( 18,19 ) . moreover , findings of animal studies suggest some possible genetic links between type 2 diabetes and cancer ( 20 ) . although studies have shown that people with type 1 diabetes have increased incidence for cancers of the pancreas , stomach , cervix , endometrium , skin , and leukemia ( 21,22 ) , relatively little is known about the association of type 1 diabetes with cancer compared with type 2 diabetes . the higher prevalence of cancer among people with type 2 diabetes , particularly those who use insulin , compared with those with type 1 diabetes suggests that insulin resistance and unhealthy lifestyle habits may play a role in these associations ( 23 ) . there are distinct etiologies and some differences in lifestyle factors between persons with type 1 and type 2 diabetes ( 24 ) . further research may be warranted on the association between diabetes types and cancer , since persons with type 1 diabetes and persons with type 2 diabetes share many similarities in clinical manifestations , medical treatment , and health outcomes despite differences in the etiology and lifestyle factors ( 24 ) . previous meta - analyses have shown that the risk of colorectal cancer is ~30% higher and the risk of bladder cancer is ~24% higher in people with diabetes than those without diabetes ( 25,26 ) . our results provide insight into the association between duration of diagnosed diabetes and diagnosed cancer in type 2 diabetes such that men who had type 2 diabetes diagnosis for 15 years had more than threefold higher prevalence for colon cancer and nearly threefold higher prevalence for cancer of urinary tract ( including both bladder and kidney ) than men who had type 2 diabetes diagnosis < 15 years . however , the association between duration of diagnosed diabetes and cancers of the colon and the urinary tract was weak among women with type 2 diabetes . it is unknown why the association between duration of diagnosed diabetes and colon cancer and urinary tract cancer prevalence differed between men and women ; however , previous studies have suggested that there are differences between men and women in colon cancer and bladder cancer survival and health - related risk factors ( 2731 ) , which may in part contribute to the sex differences in the association between duration of diagnosed diabetes and cancers of the colon and urinary tract . as shown in meta - analyses ( 32 ) , there is ~20% increased risk of breast cancer and a nearly twofold increased risk of endometrial cancer among women with diabetes compared with women without diabetes . our results provide insight by showing an approximately twofold higher prevalence of cancers of the breast and the reproductive tract among women 15 years post diagnosis of type 2 diabetes compared with women still in the first 15 years since type 2 diabetes diagnosis . these results support the notion that exposure to a high circulating concentration of insulin might result in mitogenic effects on breast tissue that stimulate the growth of endometrial stromal cells ( 33,34 ) . one of the unique findings in our study was the strong association of duration of diagnosed diabetes with skin cancer among men and women with type 2 diabetes . a previous study on patients hospitalized for type 1 diabetes in sweden noted a fivefold increased risk of squamous cell skin cancer among persons with type 1 diabetes compared with those without diabetes ( 22 ) . a recent study reported a risk of malignant melanoma in persons with diabetes compared with those without the disease ( 35 ) . clinical studies have shown that cutaneous manifestations are common among people with diabetes ( 36 ) . future research is warranted to determine whether there are biological mechanisms linking cutaneous manifestations of diabetes and development of skin cancers or whether the cutaneous manifestations of diabetes increase the probabilities of early clinical detections for skin cancers . inconsistent findings on the association between insulin use and risk of cancer in type 2 diabetes have been reported in recent clinical trials ( 4,5,79 ) . a german cohort study suggested a dose - response relation such that those taking higher doses of insulin glargine ( lantus ) had an increased risk for cancer incidence compared with those prescribed human insulin and that both insulin glargine and human insulin were related to an increased risk of cancer incidence and mortality ( 4 ) . study suggested that insulin - based regimens may be associated with ~40% higher risk of all cancers , 70% higher risk of colorectal cancer , and fivefold higher risk of pancreatic cancer compared with metformin monotherapy ( 5 ) . swedish and scottish studies did not detect a significant association between insulin glargine alone or insulin glargine in combination with other insulin and cancer incidence compared with treatment with nonglargine insulin ( 7,8 ) . in contrast , researchers reported that insulin use was associated with reduced cancer risk among chinese patients with type 2 diabetes ( 9 ) . our results showing ~30% elevated cancer prevalence in both men and women who were currently treated with insulin compared with those who were not currently treated with insulin , even after adjustment for duration of diagnosed diabetes , are similar to some findings from previous studies and suggest a need for further research into a possible link between insulin use , particularly insulin analogs , and increased risk of cancer . the major strength of our study was the use of a large population - based sample , which enabled us to provide stable estimates of cancer prevalence among adults with diabetes in the general population . first , in this cross - sectional study persons who self - reported diagnosed cancer were cancer survivors and included those who were newly diagnosed and those who had a preexisting condition . persons who died of cancer were excluded in this self - reported cross - sectional survey . therefore , these results based on the prevalence of diagnosed cancer suggest cross - sectional associations and preclude causal associations between duration of diagnosed diabetes or current insulin use and cancer . available information on the age at diabetes diagnosis and age at cancer diagnosis in our study was useful for identifying participants who had cancer prior to diabetes and , hence , excluding them from the analyses . second , diagnosed diabetes , age at diagnosis of diabetes or cancer , current insulin use , and cancer types were self - reported by survey participants ; thus , recall bias may be possible . although there is substantial agreement in the determinations of diabetes and cancer status based on self - reports and physician diagnoses ( 37,38 ) , misclassification bias of the diabetes and cancer status could have resulted in the underestimation of our results . third , duration of diagnosed diabetes may not represent actual duration of exposure to diabetes because people may be asymptomatic for many years before medical diagnosis . in addition , recall bias on duration of diagnosed diabetes may also be possible because persons with a recent diagnosis of diabetes probably remembered the year of diagnosis better than those with an earlier diagnosis . fourth , information on the type , dosage , and duration of using insulin and other medications ( e.g. , oral agents ) was unavailable in our data ; therefore , we were unable to identify their possible confounding effects for the associations between insulin use and cancer prevalence . drug use indication bias and prevalent user bias may be possible when assessing these associations using cross - sectional health survey data ( 40 ) . fifth , because weight , height , smoking , drinking , and physical activity were also self - reported by participants at the time of interview , they may not reflect the status at the time when diabetes or cancer was diagnosed and may be subject to possible social desirability bias . sixth , the brfss survey excludes adults who have been institutionalized or are hospitalized and those with only mobile telephones . because these adults are more likely to be of low socioeconomic status or to have severe physical or mental illness , this exclusion may have led us to underestimate the true prevalence of cancer among u.s . approximately one - fourth of adults with diagnosed diabetes had missing data , which may potentially introduce bias to our estimates . since subpopulation analyses ( or domain analyses ) take the variability due to missing data into account by using the entire sample in estimating the variance of domain estimates , this bias could be minimal . in conclusion , using data from a large population - based survey we found that duration of diagnosed diabetes was significantly and positively associated with the prevalence of cancers of all sites and of some specific sites . furthermore , current insulin use was also significantly associated with elevated prevalence of cancers of all sites and some specific sites . these findings provide support for a possible relationship between diabetes and cancer . while our cross - sectional results provide useful information for an association between duration of diagnosed diabetes or current insulin use and cancer prevalence , further clinical research with a longitudinal design is warranted to confirm a possible causal link between diabetes and cancer .

objectiveto estimate the prevalence of diagnosed cancer according to duration of diagnosed diabetes and current insulin use among u.s . adults with diagnosed diabetes.research design and methodswe analyzed data from 25,964 adults aged 18 years with diagnosed diabetes who participated in the 2009 behavioral risk factor surveillance system.resultsafter adjustment for potential confounders , we found that the greater the duration of diagnosed diabetes , the higher the prevalence of diagnosed cancers ( p < 0.0001 for linear trend ) . among adults with diagnosed type 2 diabetes , the prevalence estimate for cancers of all sites was significantly higher among men ( adjusted prevalence ratio 1.6 [ 95% ci 1.31.9 ] ) and women ( 1.8 [ 1.52.1 ] ) who reported being diagnosed with diabetes 15 years ago than among those reporting diabetes diagnosis < 15 years ago . the prevalence estimate for cancers of all sites was ~1.3 times higher among type 2 diabetic adults who currently used insulin than among those who did not use insulin among both men ( 1.3 [ 1.11.6 ] ) and women ( 1.3 [ 1.11.5]).conclusionsour results suggest that there is an increased burden of diagnosed cancer among adults with a longer duration of diagnosed diabetes and among type 2 diabetic adults who currently use insulin .

RESEARCH DESIGN AND METHODS Assessment of diagnosed diabetes Assessment of diagnosed cancer Assessment of covariates Statistical analysis RESULTS CONCLUSIONS

the etiology of ischemic stroke remains unidentified despite standard diagnostic work - ups , and in 30.6 - 42.1% of patients the cause is recorded as cryptogenic stroke . patent foramen ovale ( pfo ) is a hemodynamically insignificant inter - atrial communication which has been suggested to be the cause of emboli and cryptogenic stroke . however , the causal relationship of pfo with cryptogenic stroke is still a matter of debate , and pfo can be found incidentally without any clinical implication in this situation . the best preventive medical treatment for co - occurrence of pfo with cryptogenic stroke remains to be elucidated . previous studies failed to show any superiority for any drug in the treatment of this situation . to our knowledge no such study had been conducted to evaluate iranian patients with cryptogenic stroke and pfo . stroke is a major health issue in iran . according to one population - based study , the incidence of stroke ( particularly ischemic stroke ) in iran is greater than in most western countries . in addition , there are important inter - ethnic differences in the metabolic capacity to clear aspirin and warfarin between iranian people and people in other countries.- these considerations led us to evaluate the effects of two medical treatments in a sample of iranian patients and to compare them to the results in industrialized countries . here we studied the rate of stroke or transient ischemic attack recurrence , or death , in cryptogenic stroke patients with pfo with regard to the treatment in a single - blind design in an iranian population . we hypothesized that the rates of death or recurrence of stroke and transient ischemic attack would be different in the two groups . this single - center , single - blind , non - placebo - controlled , two parallel - group , prospective study was conducted at the neurology and cardiology departments of nemazee hospital , a tertiary hospital affiliated to the shiraz university of medical sciences in shiraz , iran , from july 2007 to june 2010 . inclusion criteria were adult age ( 18 years ) , single recent ( within 30 days of enrollment ) transient ischemic attack or stroke which fulfilled the criteria for unknown subgroup of undetermined causes of stroke according to the causative classification of stroke modified trial of org 10172 in acute stroke treatment criteria ( ccs - toast ) classification , and presence of pfo confirmed by both transesophageal echocardiographic ( tee ) and contrast - transcranial doppler sonography ( c - tcd ) examination . the main criterion for exclusion was the presence of any determined cause for ischemic stroke according to the ccs - toast classification . these included : ( 1 ) evident large - artery atherosclerosis defined as > 50% stenosis or occlusion of a major brain artery or branch cortical artery ; ( 2 ) unequivocal cardiac source of embolism defined as chronic or paroxysmal atrial fibrillation , mitral stenosis , mechanical heart valve , endocarditis , intracardiac clot or vegetation , myocardial infarction within 3 months , dilated cardiomyopathy , and ejection fraction less than 30% ; ( 3 ) small - vessel disease defined as cortical , cerebellar , brainstem or subcortical infarct < 1.5 cm ; ( 4 ) other determined cause of stroke defined as any known vasculitis , any known thrombophilic disease , any infectious vasculopathy , arterial dissection , moya moya disease , radiation - induced vasculopathy , fibromuscular dysplasia , sickle cell disease , neurofibromatosis , reversible cerebral vasoconstriction syndrome , vasospasm after subarachnoid hemorrhage , and cerebral sinus venous thrombosis . patients without a suitable temporal window for performance of c - tcd or with poor clinical condition were excluded . in addition , patients with severe aphasia ( impaired comprehension ) , severe disabling stroke ( score of 4 or 5 on the modified rankin scale ) , and known dementia were excluded . the study was approved by the institutional review board of the shiraz university of medical sciences ( no . 88 - 4639 ) and is registered with the iranian registry for clinical trials ( www.irct.ir , registration number : irct138805192323n1 ) . the study and possible outcomes were explained to all participants or their first - degree relatives and written informed consent was obtained for each participant . eligible patients who agreed to participate in the study were randomized to two treatment groups according to a computer - generated random number list and simple randomization procedure [ figure 1 ] . eligible patients were referred by the principal investigators to a research assistant for randomization and allocation . the principal investigators and statistician were blind to the therapeutic interventions , but patients and the research assistant who allocated the patients and monitored the drug effects and adverse drug reactions were not blinded . flowchart for a single - center , single - blind , non - placebo - controlled , parallel - group randomized trial of aspirin versus warfarin in patients with cryptogenic stroke and patent foramen ovale in iran , 2007 - 2010 for each participant a questionnaire was completed that included items on demographic characteristics , a checklist of inclusion and exclusion criteria , the results of basic laboratory tests and findings on neurological imaging studies . a vivid 3 echo machine with a 5-mhz tee probe was used ( ge medical systems , oslo , norway ) . contrast ( agitated saline ) was injected in mid - esophageal four - chamber view during the valsalva maneuver to detect any inter - atrial right - to - left shunt across the pfo . agitated saline was generated by agitating a mixture of 9 ml normal saline and 1 ml air in two 10-ml syringes connected by a 3-way stopcock . once the contrast became milky , 10 ml of the contrast was rapidly injected as a bolus into a cubital vein that had previously been cannulated with a large - gauge indwelling intravenous catheter . the diagnosis of pfo was based on the appearance of bubbles in the left atrium during five cardiac cycles after opacification of the right atrium with contrast bubbles . pfos with a diameter < 4 mm were considered small and those 4 mm were considered large . a sunray version fd - t98ii transcranial doppler ultrasound device ( guangzhou doppler electronic technologies , guangzhou , china ) was used for c - tcd examinations . while the patient was lying supine , both middle cerebral arteries were insonated simultaneously . the device was set to a small sample volume of 10 mm in length and minimum possible gain to provide an optimal setting for microembolic signal discrimination from the background spectrum . we defined microembolic signal as a typical visible and audible signal ( click , chirp or whistle ) of short duration and high intensity within the doppler flow spectrum . the same protocol was used for contrast preparation and injection and the valsalva maneuver as for tee . patients were randomly assigned to aspirin ( acetylsalicylic acid , jalinous , teheran , iran ) , 80 mg orally 3 times daily , or warfarin ( marevan , orion pharma , espoo , finland ) , started at 2.5 mg orally once daily , and then adjusted to achieve an international normalized ratio target of 2 to 3 . the interventions lasted for 18 months , after which the patients were free to select any therapeutic option . in the case of adverse drug reactions , the study drug was withheld temporarily and the patient was encouraged to consult a relevant specialist . suspected adverse drug reactions of aspirin and warfarin were followed up scrupulously by phone calls ( weekly during the first month and monthly thereafter ) . the patients were specifically questioned regarding major hemorrhage ( gastrointestinal bleeding or intracranial hemorrhage ) . in the warfarin - treated group , international normalized ratio was evaluated weekly during the first month , biweekly during months 2 and 3 , and monthly thereafter . patients who did not have regular blood tests for international normalized ratio for any reason during the study period were excluded from the final analysis . the primary endpoint was recurrence of ischemic event ( transient ischemic attack or stroke ) or death due to any cause . the secondary endpoints were recurrence of myocardial infarction , and death due to vascular causes ( stroke , myocardial infarction , and intracranial hemorrhages ) . information about the occurrence of endpoints was sought monthly by phone , and the research assistant visited the patient ( or next of kin ) if an endpoint occurred . all statistical analyses were done with spss v. 15.0 software ( spss , chicago , il , usa ) . the population comprised all patients admitted to our hospital during one year with cryptogenic stroke . the chi - square test and mann - whitney u test were used to compare variables between groups . kaplan - meier survival analysis was used to compare cumulative survival in the treatment groups . patients were censored if they were lost to follow - up , in the case of pfo closure and at the end of follow - up . the log - rank and cox proportional - hazards models were used to assess the predictive value of treatment with respect to primary and secondary endpoints , and the models were adjusted for age , sex , hypertension , diabetes mellitus , hyperlipidemia and smoking . a p value < 0.05 was considered as significant . of the 440 patients with ischemic stroke or transient ischemic attack admitted to our stroke center during july 2007 to january 2009 , 29.1% ( 128/440 ) had stroke of undetermined cause according to the ccs - toast classification . based on the tee and c - tcd examinations , 19.3% ( 85/440 ) of patients were diagnosed as having a pfo . of these , 44.7% ( 38/85 ) were excluded due to the presence of at least one exclusion criterion or because they declined to participate in the study . of the intent - to - treat population ( 47 patients ) , 23 patients were initially treated with warfarin and 24 patients with aspirin . of these , 52.3% ( 23/44 ) received aspirin and 47.7% ( 21/44 ) received warfarin . the demographic and clinical characteristics of the per - protocol patients are shown in table 1 . most patients ( 84.0% , 37/44 ) had an ischemic stroke and 15.9% ( 7/44 ) had a transient ischemic attack . the mean duration of follow - up was 14.6 3.7 months in the aspirin group and 13.5 4.0 months in the warfarin group ( p = 0.220 ) . fourteen patients ( 31.7% ) had large pfos , of which 6 were in the aspirin group and 8 were in the warfarin group . there were no significant differences between the size of pfo between the two groups ( p = 0.398 ) . demographic and clinical characteristics of patients with cryptogenic stroke and patent foramen ovale in iran , 2007 - 2010 the patients were followed until june 2010 . in this study , none of the patients had a myocardial infarction or died due to vascular causes during follow - up ; therefore , only recurrence of ischemic events was included in the analysis as a secondary endpoint . the incidence of the overall primary endpoint was 20.5% ( 9/44 ) : 11.4% ( 5/44 ) patients had a stroke , 4.5% ( 2/44 ) had a transient ischemic attack and 4.5% ( 2/44 ) died . both deaths were unrelated to vascular causes ( multiple myeloma and renal failure ) . of the patients who were treated with aspirin , 8.7% ( 2/23 ) had an ischemic event and 4.3% ( 1/23 ) died . in the warfarin group , there were no significant differences in the time to primary endpoint ( hazard ratio : 0.45 ; 95% ci : 0.1 - 1.8 ; p = 0.259 ) and ischemic event recurrence ( hazard ratio : 0.33 ; 95% ci : 0.06 - 1.7 ; p = 0.183 ) between patients treated with aspirin vs. warfarin . the mean event - free time to death or ischemic event was 17.0 months ( 95% ci : 15.8 - 18.2 ) in the aspirin group and 14.8 months ( 95% ci : 12.4 - 17.3 ) in the warfarin group . figures 2 and 3 show the probability of an ischemic event or death in the two treatment groups . kaplan - meier cumulative survival curve for ischemic event or death in patients treated with warfarin or aspirin in iran , 2007 - 2010 kaplan - meier cumulative survival curve for ischemic event in patients treated with warfarin or aspirin in iran , 2007 - 2010 major bleeding ( upper gastrointestinal hemorrhage ) occurred in 4.3% ( 1/23 ) of the patients in the aspirin group and in 9.5% ( 2/21 ) of those in the warfarin group ( p = 0.501 ) . the medication was withheld temporarily and the patients were seen by a gastroenterologist . among the patients who were taking aspirin , one developed melena ( 4.3% ) and one developed epistaxis ( 4.3% ) . dyspepsia occurred in 26.1% ( 6/23 ) of the patients in the aspirin group and 14.3% ( 3/21 ) of those in the warfarin group ( p = 0.338 ) . we found no significant difference in the time to recurrence of ischemic event or time to death between patients with cryptogenic stroke and pfo treated with aspirin vs. warfarin . in addition , these treatments did not show any difference regarding their complications . previous studies which had been conducted in the industrialized countries showed the same results . in the patent foramen ovale in cryptogenic stroke study ( picss ) , 630 patients with stroke were randomly assigned to aspirin or warfarin , and pfo was present in 33.8% of the sample . as in the present study , there was no difference in the time to stroke or death between patients who received aspirin or warfarin . according to some reports , some morphological features of pfo and the co - occurrence of pfo with atrial septal aneurysm substantially increased the risk of further stroke other prospective studies likewise failed to document an association between risk of stroke and these clinical characteristics . in a multicenter study of right to left in cryptogenic stroke ( codicia ) , 486 patients with cryptogenic stroke were treated with either aspirin or warfarin , and the effects of treatment on stroke recurrence were compared . like us , these authors found no statistically significant treatment - related difference in stroke recurrence in their patients . in our study , although there was no difference in the rate of complications between the aspirin and warfarin groups , we noted a non - significantly lower rate of recurrence in patients who received aspirin . considering the potential costs and risks of anticoagulation , which requires regular laboratory checks and involves an increased probability of intracranial hemorrhage , we propose that anticoagulation has no benefits over antiplatelet therapy in patients with cryptogenic stroke and pfo . this is consistent with american heart association / american stroke association guidelines , which state that antiplatelet therapy seems to be reasonable in patients with an ischemic stroke or transient ischemic attack with a pfo . the indifference between medical treatments in cryptogenic stroke with pfo may be due to the fact that pfo may be the cause of first stroke but does not have any causal role in stroke recurrence . we evaluated a limited number of cryptogenic stroke patients with pfo at a single center with a relatively short follow - up period and with a relatively high number of missing cases . the main advantage of our study is the purity of our per - protocol population . unlike the piccs study , our patients had exclusively cryptogenic stroke and unlike both the previous studies , all the patients had pfo . there was no difference in the rate of ischemic event recurrence or death in a sample of iranian patients with cryptogenic stroke and pfo who were treated with either aspirin or warfarin . the prescription of more vigorous treatments seems to be not necessary in the co - occurrence of pfo with cryptogenic stroke .

background : this randomized clinical trial compared rates of stroke or transient ischemic attack recurrence or death in patients with cryptogenic stroke and patent foramen ovale ( pfo ) who received medical treatment with aspirin or warfarin.materials and methods : forty - four iranian patients with cryptogenic stroke and patent foramen ovale participated in this randomized , single - blind trial between july 2007 and june 2010 . all patients underwent transesophageal echocardiography and contrast - transcranial doppler sonography to confirm the presence of patent foramen ovale . the patients were randomly assigned to receive aspirin or warfarin and were followed for 18 months for the recurrence of ischemic events or death . the principal investigator was blind to the group assignment . this trial is registered under number irct138805192323n1.results:five ( 11.4% ) patients had a stroke , 2 ( 4.5% ) had a transient ischemic attack and 2 ( 4.5% ) died . there was no difference in the rate of ischemic events or death between the aspirin- and warfarin - treated groups ( hazard ratio : 0.45 ; 95% ci : 0.1 - 1.8 ; p = 0.259).conclusion : there was no difference in ischemic event recurrence , death rates or side - effects between patients with cryptogenic stroke and patent foramen ovale who were treated with aspirin vs. warfarin .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION

we defined broad consent as a process in which participants agree prospectively to have their samples , genomic data , and health information retained for use in any future research deemed appropriate by a biobank and/or relevant oversight bodies . studies of broad consent may use an opt - in or an opt - out model . categorical consent , by contrast , is a process in which participants agree prospectively to future use of their samples and data for particular types of research , usually by categories of disease ( e.g. , cardiac diseases , diabetes ) . refers to the transfer of biospecimens with their associated genotypic and/or phenotypic information , data derived from biospecimens , and/or health information to researchers at institutions that are not directly affiliated with the biobanks or to other biorepositories . we systematically searched the literature on broad consent and data sharing for biobank research using the following databases : medline via the pubmed interface , web of science , national reference center for bioethics literature databases ( ethxweb , genethx ) , and dissertation abstracts international . search strategies used subject heading terms appropriate for each database and key words relevant to biobanking , consent , and data sharing ( supplementary table s1 online ) . searches were limited to the literature published since 1990 to capture current views about biobanking . we also manually searched the reference lists of included studies and of recent narrative and systematic reviews addressing the topic . our initial searches were done between october and december 2013 and were updated in march 2015 . two reviewers ( n.a.s . and a colleague ) initially screened titles and abstracts , and two investigators ( n.a.g . and e.w.c . ) reviewed the full text of the included articles . articles were included if they reported empirical data with sufficient detail to enable use and aggregation of the data and results about individuals in the united states regarding one or more of the following : participant perceptions of broad consent or data sharing for biobank research , preferences for different consent models for biobank research , information about people 's opinions about participating in biobank research , or providing broad consent for biobank research . disagreements between reviewers were resolved by discussion that included a third reviewer ( a.h.m.a . ) to reach consensus . we identified and screened a total of 3,205 citations and abstracts through the electronic database searches and manual review of articles and bibliographies ( figure 1 ) . after reviewing titles and abstracts , we excluded 2,714 studies that did not meet our criteria . we assessed the full text of the 491 remaining studies and excluded another 440 articles because they ( i ) did not address biobanking , consent , or data sharing ( n = 403 ) ; ( ii ) were not conducted in the united states ( n = 206 ) ; or ( iii ) were not obtainable ( n = 1 ) . two investigators ( n.a.g . and e.w.c . ) assessed the quality of studies using questions adapted from published criteria for the quality assessment of survey and focus group studies . scoring criteria fell into the following broad domains : ( i ) description of the methods , ( ii ) participant recruitment from a representative pool and response rates , ( iii ) appropriateness of objective study questions , and ( iv ) data analysis lending to reproducible results . articles that adequately defined criteria in all four domains were rated as good . articles containing information that had adequate descriptions of the methods but did not fulfill the criteria for all of the other domains received a rating of fair . articles that failed to adequately define their methods , thus preventing an evaluation of representativeness , bias , or reproducibility , received a rating of poor . two investigators ( n.a.g . and e.w.c . ) also characterized the studies as conducted in urban , rural , or combined settings . data were extracted into summary tables ( supplementary table s3 online ) by outlining the study population and biobank focus , methods , quality assessment , urban / rural residency , and key outcomes related to consent and data sharing . we report the relevant findings based on the terminology , percentages , and number of significant digits as presented in the publications . we defined broad consent as a process in which participants agree prospectively to have their samples , genomic data , and health information retained for use in any future research deemed appropriate by a biobank and/or relevant oversight bodies . studies of broad consent may use an opt - in or an opt - out model . categorical consent , by contrast , is a process in which participants agree prospectively to future use of their samples and data for particular types of research , usually by categories of disease ( e.g. , cardiac diseases , diabetes ) . refers to the transfer of biospecimens with their associated genotypic and/or phenotypic information , data derived from biospecimens , and/or health information to researchers at institutions that are not directly affiliated with the biobanks or to other biorepositories . we systematically searched the literature on broad consent and data sharing for biobank research using the following databases : medline via the pubmed interface , web of science , national reference center for bioethics literature databases ( ethxweb , genethx ) , and dissertation abstracts international . search strategies used subject heading terms appropriate for each database and key words relevant to biobanking , consent , and data sharing ( supplementary table s1 online ) . searches were limited to the literature published since 1990 to capture current views about biobanking . we also manually searched the reference lists of included studies and of recent narrative and systematic reviews addressing the topic . our initial searches were done between october and december 2013 and were updated in march 2015 . two reviewers ( n.a.s . and a colleague ) initially screened titles and abstracts , and two investigators ( n.a.g . and e.w.c . ) reviewed the full text of the included articles . articles were included if they reported empirical data with sufficient detail to enable use and aggregation of the data and results about individuals in the united states regarding one or more of the following : participant perceptions of broad consent or data sharing for biobank research , preferences for different consent models for biobank research , information about people 's opinions about participating in biobank research , or providing broad consent for biobank research . disagreements between reviewers were resolved by discussion that included a third reviewer ( a.h.m.a . ) to reach consensus . we identified and screened a total of 3,205 citations and abstracts through the electronic database searches and manual review of articles and bibliographies ( figure 1 ) . after reviewing titles and abstracts , we excluded 2,714 studies that did not meet our criteria . we assessed the full text of the 491 remaining studies and excluded another 440 articles because they ( i ) did not address biobanking , consent , or data sharing ( n = 403 ) ; ( ii ) were not conducted in the united states ( n = 206 ) ; or ( iii ) were not obtainable ( n = 1 ) . two investigators ( n.a.g . and e.w.c . ) assessed the quality of studies using questions adapted from published criteria for the quality assessment of survey and focus group studies . scoring criteria fell into the following broad domains : ( i ) description of the methods , ( ii ) participant recruitment from a representative pool and response rates , ( iii ) appropriateness of objective study questions , and ( iv ) data analysis lending to reproducible results . articles containing information that had adequate descriptions of the methods but did not fulfill the criteria for all of the other domains received a rating of fair . articles that failed to adequately define their methods , thus preventing an evaluation of representativeness , bias , or reproducibility , received a rating of poor . two investigators ( n.a.g . and e.w.c . ) also characterized the studies as conducted in urban , rural , or combined settings . data were extracted into summary tables ( supplementary table s3 online ) by outlining the study population and biobank focus , methods , quality assessment , urban / rural residency , and key outcomes related to consent and data sharing . we report the relevant findings based on the terminology , percentages , and number of significant digits as presented in the publications . a total of 51 publications comprising 48 studies were included in this review . most studies involved surveys ( n = 23 ) , followed by focus groups ( n = 8) , mixed methods ( n = 14 ) , interviews ( n = 1 ) , and analyses of consent forms ( n = 2 ) ( supplementary table s3 online ) . two publications used a mixed - methods approach that included qualitative studies that informed the development and implementation of a survey . nineteen studies were of good quality , 27 of fair quality , and 2 of poor quality . roughly one - third of the studies ( n = 20 ) were written and published after the office of human research protections issued the anprm in july 2011 . the number of studies published per year from 2008 to 2014 ranged from five to seven , with no notable difference after the anprm was issued . some of the studies published after 2011 mention the anprm . although we examined studies published since 1990 , no studies that met our inclusion criteria were published before 2001 . of these , just over half ( 51.3% ) of participants identified as white , and native - american , alaska native , native hawaiian , and pacific islander participants made up 2.2% of the sample . twenty - eight studies were conducted primarily in urban settings , two were conducted in rural settings , nine were conducted in both urban and rural settings , and nine studies were conducted nationwide . three papers each reported two unique studies ; other studies were reported in multiple papers . for example , a retrospective analysis of signed informed consent forms found that 87.1% of 1,298 research participants at the nih authorized all future research . in a different large national study , the national health and nutrition examination survey ( nhanes ) , 84.8% of 4,480 overall participants recruited in 1999 and 2000 agreed to dna specimen collection for inclusion in a national repository for genetic research . many studies asked participants hypothetical questions about their willingness to provide broad consent for research . in indiana , 88.4% of 273 cancer patients agreed that they would be willing to permit their tissue sample to be used in research on any condition . after time for deliberation , 85% of 40 focus group participants in north carolina reported that they would agree to have blood and information stored indefinitely in a biorepository for future research . similarly , 78% of 49 focus group participants in chicago were interested in participating in a biobank , and the majority stated they would give broad consent . of 30 patients who were interviewed at a hawaiian cancer center , 77% endorsed broad consent . one representative nationwide survey found that 68% of 1,593 respondents were willing to give broad consent for research , although their enthusiasm waned if they had a moral objection to certain types of studies for which their samples might be used . two studies examined patients ' willingness to participate in biobanks managed by kaiser permanente : 69% of 500 kaiser patients in the northwest and 69% of 203 in colorado agreed to participate in a biobank . in a focus group study in boston , patients with breast cancer were generally positive about having their samples used for secondary studies that were not planned at the time they gave consent . scott et al . reported the results of a 1998 survey of blood donors that asked about their views regarding storage and use of the blood for research . of the 49,775 respondents , 60.3% said that testing stored blood for any research was acceptable with the donor 's permission , and 35.5% would not require permission for research use . these studies reported substantial acceptance for broad consent . asking participants for their preference among different types of consent broad , study - by - study , or categorical consent revealed more mixed support for broad consent . for example , 47% of 931 veterans preferred to give broad consent over other types of consent for all research approved by an oversight board . after adjusting for missing data , a national survey of 4,569 adults found that 52% preferred broad consent , whereas 48% preferred study - by - study consent . in a survey of 751 iowans , 42% preferred broad consent and 29% favored study - specific consent , compared with 25% who favored categorical consent . in another study of 315 cancer patients at two hospitals in atlanta , 92 and 97% were willing to allow their samples to be used for research on other diseases ; when asked to specify a preference , 56% preferred one - time broad consent and 11% preferred study - by - study consent over no consent or no preference . in a 2001 nationwide survey , 43% of 2,621 participants were willing to donate blood for genetic research and to allow it to be stored for future research . similarly , only 39.3% of 30 patients who had already donated samples preferred broad consent over consent for specific studies . by contrast , 77.7% of 1,276 people recruited through a crowd - sourced internet marketplace were willing to donate to biobanks , even after receiving disclosures about potentially objectionable research ; however , 40.8% of participants still felt that specific consent was necessary , even if it might inhibit research progress . a similar nationwide survey of 1,599 individuals conducted through a probability - based online panel of adults found a wide range of opinions , with broad consent and real - time study - by - study consent considered the several studies showed that participants preferred to give informed consent for each study rather than a broad consent , with preferences ranging from 42 to 72% : 42% of a national sample of 4,700 us adults ( which rose to 48% after adjusting for missing data ) , 43 to 50% of 931 veterans nationwide , and 60.7% of adults recruited in new york . of 393 parents , 72% reported that they would want to consent each time to allow their child 's dried bloodspots to be used for research . in focus groups of 92 native hawaiians , respondents repeatedly expressed desire to re - consent , although some stated that they would be content if they trusted the researcher or the biobank 's governance . in one study of 273 jewish individuals , 6075% believed that consent should be required regardless of whether the dna was collected in a research or clinical setting . in a focus group study of 178 alaska native participants , some indicated a preference to have consent options for a variety of specimen uses , storage duration , and destruction of the sample at the completion of the study . in the same group , some wanted re - contact each time , whereas others felt that a one - time consent was appropriate for new studies . in chicago , 239 postpartum women were asked about their willingness to enroll their children into a pediatric biobank : 48% of women would enroll their child , but 24% would not ; of the latter , 82% of the participants were african american . in another focus group study , 11 of 15 participants preferred tiered consent over other methods to exert the greatest level of control regarding how they wanted their data to be shared ; however , participants who were willing to provide broad consent also appreciated the option to opt in or opt out of dna data sharing . some studies reported that most respondents favored an opt - in approach , whereas others found that opt - out was acceptable or even preferred by the majority . a majority of participants67% of 751 survey respondents and 63% of 57 focus group participants who were asked about biobank participation in iowa preferred opt - in , whereas 18% of survey respondents and 25% of focus group participants in the same study preferred opt - out . in a study of 451 nonactive military veterans , 82% thought it would be acceptable for the proposed million veterans biobank to use an opt - in approach , and 75% thought that an opt - out approach was acceptable ; 80% said that they would take part if the biobank were opt - in as opposed to 69% who would participate if it were an opt - out approach . when asked to choose which option they would prefer , 29% of respondents chose the opt - in method , 14% chose opt - out , 50% said either would be acceptable , and 7% would not want to participate . in some cases , biobank participants were re - contacted to inquire about their thoughts regarding proposed changes to the biobank in which they participated . thirty - two biobank participants who attended focus groups in wisconsin regarding proposed minimal - risk protocol changes were comfortable with using an opt - out model for future studies because of the initial broad consent given at the beginning of the study and their trust in the institution . a study of 365 participants who were re - contacted about their ongoing participation in a biobank in seattle showed that 55% thought that opt - out would be acceptable , compared with 40% who thought it would be unacceptable . similarly , several studies explored perspectives on the acceptability of an opt - out biobank at vanderbilt university . first , 91% of 1,003 participants surveyed in the community thought leftover blood and tissues should be used for anonymous medical research under an opt - out model ; these preferences varied by population , with 76% of african americans supporting this model compared with 93% of whites . in later studies of community members , approval rates for the opt - out biobank were generally high ( around 90% or more ) in all demographic groups surveyed , including university employees , adult cohorts , and parents of pediatric patients . three studies explored community perspectives on using newborn screening blood spots for research through the michigan biotrust for health program . first , 77% of 393 parents agreed that parents should be able to opt out of having their child 's blood stored for research . second , 87 participants were asked to indicate a preference : 55% preferred an opt - out model , 29% preferred to opt - in , and 16% felt that either option was acceptable . finally , 39% of 856 college students reported that they would give broad consent to research with their newborn blood spots , whereas 39% would want to give consent for each use for research . in a nationwide telephone survey regarding the use of samples collected from newborns , 46% of 1,186 adults believed that researchers should re - consent participants when they turn 18 years old . some studies examined the differences in participants ' willingness to provide broad consent for samples that were de - identified or anonymous as compared with identifiable . respondents generally preferred to give consent if their samples were identifiable . in two studies involving 429 primarily native hawaiian participants , 78% of native hawaiians and 66% of whites indicated that they would require consent for research if the specimens were identifiable and collected in the clinical setting . for genetics research , 81% native hawaiians and 78% of whites indicated that they would require consent if the specimens were identifiable . in a us - wide telephone survey , 81% of 1,193 respondents stated that they would want to be informed about research being done with their sample if it were identifiable ; additionally , 57% said they would require permission to use their samples if they were identifiable . for example , 65.8% of 504 adults who participated in a telephone survey across the united states reported that they would require consent for samples collected in the clinic if they were identifiable , compared with 27.3% who reported they would require consent if samples were anonymized . in the research setting , fewer people thought consent was required for identifiable ( 29.0% ) or anonymized ( 12.1% ) samples . in a study utilizing a hypothetical biobank scenario , 43% of 565 government and medical employees in new mexico indicated that they would donate their sample for future genetic testing if it could not be traced to them . not all studies found that people were worried about identifiability . in one survey of 144 clinicians , 86% said that they would donate a dna sample to a hypothetical biobank in new york regardless of whether it was linked to or unlinked from their identity . in the study in new mexico , 36% of 565 respondents found it acceptable for broadly consented samples to be used by their local university , even if the samples were linked to them . characteristics associated with favoring broad consent included being male , white / caucasian , older , and more affluent . by contrast , asians , black non - hispanics , african americans , and others ( who represented 14.3% of the total ) were less likely than whites to believe that research without explicit permission was acceptable . one study of consent forms showed that 75.0% of african americans gave broad consent compared with 88.4% of whites ( p = 0.002 ) . similarly , in the nhanes data , 78.7% of african americans and 87.1% of whites consented to genetics research . one study reported that participants who were significantly more likely to prefer broad consent also believed that participating would make me feel like i was contributing to society ( odds ratio = 1.85 ; p = 0.001 ) , that the study would accelerate medical treatments and cures ( odds ratio = 2.20 ; p = 0.001 ) , and that participating in the cohort study would be easy ( odds ratio = 1.59 ; p < 0.001 ) . other investigators reported that the large majority ( 97.7% ) of respondents said yes or maybe to the idea that it is a gift to society when an individual takes part in medical research . many other studies cited the benefit of research to improve health as a reason to favor broad consent . most studies of data sharing were conducted with studies of consent preferences ; however , six studies were conducted with the primary goal of eliciting preferences on data sharing . participants were generally willing to have their samples and information shared with other academic institutions . willingness to share data with academic and medical researchers was acceptable for 92% of 4,659 us adults generally , and 80% of 931 us veterans specifically . more than 70% of 100 young adults in baltimore who were enrolled in a longitudinal study of prevention were willing to share results arising from their dna . nearly three fourths of 40 community members in a focus group study in north carolina were comfortable with academic researchers having access to their samples . many of 79 focus group participants in seattle endorsed the value of sharing , agreed that sharing locally and with close collaborators was acceptable , and were comfortable with nonprofit and public - interest organizations using data from their samples . in one focus group study of 48 primarily white and female participants in iowa , the majority cited positive reasons for donating their samples to help and to contribute to advancements in research , and that data sharing would not affect their decision to enroll in a biobank . in another focus group study of 100 african americans in north carolina , many recognized the benefits of data sharing but wanted the potential risks to be disclosed , and some wanted the data to be restricted . in another study of patients with inflammatory bowel diseases , 97.3% of 92 respondents were comfortable with sharing their biological sample with investigators in the united states , but 23.8% were uncomfortable with sharing with investigators outside the united states . some participants expressed concern over sharing their data and information with federal repositories . in one study , 18.5% of 4,050 vanderbilt university faculty and staff were more likely to want to participate in their institution 's biobank if the de - identified data were deposited into a national database ; however , 12.1% were less likely to want to participate . in two large nationwide surveys , 80% of 4,659 adults were willing to have their data shared with government researchers ; however , 75% of the same sample also were concerned about the government having [ their ] samples and information . similarly , another study found that 71% of 931 veterans were willing to grant database access to government researchers , but half were concerned about the government having [ their ] samples and information . other studies have shown that some people are concerned about government involvement in maintaining databases containing biomedical information . more than half of the 40 participants in a focus group study of north carolina community members were concerned about government researchers having access to their institution 's biorepository . despite concerns , 61% of 203 kaiser patients in colorado would still provide a sample even if the data would be submitted to a government database , and 82% of 500 kaiser patients in oregon agreed to have their information posted in a us government database . in a large metropolitan area in southwest florida , some of 95 focus group participants believed that biospecimens were already being collected from leftover tissue , and others suspected that tissues were already being shared with researchers in other countries who lack strict laws ' governing research . in a focus group study of 178 alaska native participants , some cited mistrust of the government and police having access to their samples and wanted transparency from the researchers about how their samples were used . the majority of participants were willing to share with pharmaceutical company researchers , but the percentage was generally less than the percentage willing to share with academic researchers . seventy - five percent of 4,659 us adults , 54% of 931 veterans , 55.2% of 1,599 adults responding to a nationwide survey , and 75.1% of members of the crohn 's and colitis foundation of america partners cohort were willing to share with pharmaceutical company researchers . focus group participants in florida voiced concern about providing blanket consent because they would not benefit financially from any resulting discoveries . factors associated with views about data sharing . with the exception of gender , few demographic data ( e.g. , about race / ethnicity , socioeconomic status , education , and urban / rural residency ) were available . even when demographic information was obtained , investigators did not always report how these variables correlated with respondents ' opinions . therefore , it was largely not possible to draw meaningful conclusions about the associations between sociodemographic factors and views on data sharing . the willingness of patients with cancer to share seemed to be shaped by their devotion to the institution at which they were receiving care . for example , patients with cancer in indiana who agreed to participate in a biobank were less likely to be willing to allow their tissue samples to be used by researchers who were not affiliated with the local researchers ( 89.7% ) , compared with 96.3% who were willing to share with local university researchers ( p < 0.01 ) . half of 100 patients with breast cancer at md anderson cancer center preferred to allow only their physician ( 24% ) or other researchers at their hospital ( 26% ) to use their de - identified genetic data for research ; fewer patients were willing to share their de - identified data with any cancer researcher ( 25% ) or any researcher ( 18% ) . in another study , 95% of 315 patients with cancer in atlanta were willing to allow researchers to share samples with other local researchers , but only 85% and 92% of participants at two different sites were willing to have their samples shared elsewhere in the united states ( p < 0.05 ) . a total of 51 publications comprising 48 studies were included in this review . most studies involved surveys ( n = 23 ) , followed by focus groups ( n = 8) , mixed methods ( n = 14 ) , interviews ( n = 1 ) , and analyses of consent forms ( n = 2 ) ( supplementary table s3 online ) . two publications used a mixed - methods approach that included qualitative studies that informed the development and implementation of a survey . nineteen studies were of good quality , 27 of fair quality , and 2 of poor quality . roughly one - third of the studies ( n = 20 ) were written and published after the office of human research protections issued the anprm in july 2011 . the number of studies published per year from 2008 to 2014 ranged from five to seven , with no notable difference after the anprm was issued . some of the studies published after 2011 mention the anprm . although we examined studies published since 1990 , no studies that met our inclusion criteria were published before 2001 . of these , just over half ( 51.3% ) of participants identified as white , and 13.6% were african american and 6.3% were hispanic / latino . native - american , alaska native , native hawaiian , and pacific islander participants made up 2.2% of the sample . many studies did not report other demographic data . only 21 studies reported socioeconomic status , and 43 reported educational level . twenty - eight studies were conducted primarily in urban settings , two were conducted in rural settings , nine were conducted in both urban and rural settings , and nine studies were conducted nationwide . three papers each reported two unique studies ; other studies were reported in multiple papers . for example , a retrospective analysis of signed informed consent forms found that 87.1% of 1,298 research participants at the nih authorized all future research . in a different large national study , the national health and nutrition examination survey ( nhanes ) , 84.8% of 4,480 overall participants recruited in 1999 and 2000 agreed to dna specimen collection for inclusion in a national repository for genetic research . many studies asked participants hypothetical questions about their willingness to provide broad consent for research . in indiana , 88.4% of 273 cancer patients agreed that they would be willing to permit their tissue sample to be used in research on any condition . after time for deliberation , 85% of 40 focus group participants in north carolina reported that they would agree to have blood and information stored indefinitely in a biorepository for future research . similarly , 78% of 49 focus group participants in chicago were interested in participating in a biobank , and the majority stated they would give broad consent . of 30 patients who were interviewed at a hawaiian cancer center , 77% endorsed broad consent . one representative nationwide survey found that 68% of 1,593 respondents were willing to give broad consent for research , although their enthusiasm waned if they had a moral objection to certain types of studies for which their samples might be used . two studies examined patients ' willingness to participate in biobanks managed by kaiser permanente : 69% of 500 kaiser patients in the northwest and 69% of 203 in colorado agreed to participate in a biobank . in a focus group study in boston , patients with breast cancer were generally positive about having their samples used for secondary studies that were not planned at the time they gave consent . scott et al . reported the results of a 1998 survey of blood donors that asked about their views regarding storage and use of the blood for research . of the 49,775 respondents , 60.3% said that testing stored blood for any research was acceptable with the donor 's permission , and 35.5% would not require permission for research use . these studies reported substantial acceptance for broad consent . asking participants for their preference among different types of consent broad , study - by - study , or categorical consent revealed more mixed support for broad consent . for example , 47% of 931 veterans preferred to give broad consent over other types of consent for all research approved by an oversight board . after adjusting for missing data , a national survey of 4,569 adults found that 52% preferred broad consent , whereas 48% preferred study - by - study consent . in a survey of 751 iowans , 42% preferred broad consent and 29% favored study - specific consent , compared with 25% who favored categorical consent . in another study of 315 cancer patients at two hospitals in atlanta , 92 and 97% were willing to allow their samples to be used for research on other diseases ; when asked to specify a preference , 56% preferred one - time broad consent and 11% preferred study - by - study consent over no consent or no preference . in a 2001 nationwide survey , 43% of 2,621 participants were willing to donate blood for genetic research and to allow it to be stored for future research . similarly , only 39.3% of 30 patients who had already donated samples preferred broad consent over consent for specific studies . by contrast , 77.7% of 1,276 people recruited through a crowd - sourced internet marketplace were willing to donate to biobanks , even after receiving disclosures about potentially objectionable research ; however , 40.8% of participants still felt that specific consent was necessary , even if it might inhibit research progress . a similar nationwide survey of 1,599 individuals conducted through a probability - based online panel of adults found a wide range of opinions , with broad consent and real - time study - by - study consent considered the several studies showed that participants preferred to give informed consent for each study rather than a broad consent , with preferences ranging from 42 to 72% : 42% of a national sample of 4,700 us adults ( which rose to 48% after adjusting for missing data ) , 43 to 50% of 931 veterans nationwide , and 60.7% of adults recruited in new york . of 393 parents , 72% reported that they would want to consent each time to allow their child 's dried bloodspots to be used for research . in focus groups of 92 native hawaiians , respondents repeatedly expressed desire to re - consent , although some stated that they would be content if they trusted the researcher or the biobank 's governance . in one study of 273 jewish individuals , 6075% believed that consent should be required regardless of whether the dna was collected in a research or clinical setting . in a focus group study of 178 alaska native participants , some indicated a preference to have consent options for a variety of specimen uses , storage duration , and destruction of the sample at the completion of the study . in the same group , some wanted re - contact each time , whereas others felt that a one - time consent was appropriate for new studies . in chicago , 239 postpartum women were asked about their willingness to enroll their children into a pediatric biobank : 48% of women would enroll their child , but 24% would not ; of the latter , 82% of the participants were african american . in another focus group study , 11 of 15 participants preferred tiered consent over other methods to exert the greatest level of control regarding how they wanted their data to be shared ; however , participants who were willing to provide broad consent also appreciated the option to opt in or opt out of dna data sharing . some studies reported that most respondents favored an opt - in approach , whereas others found that opt - out was acceptable or even preferred by the majority . a majority of participants67% of 751 survey respondents and 63% of 57 focus group participants who were asked about biobank participation in iowa preferred opt - in , whereas 18% of survey respondents and 25% of focus group participants in the same study preferred opt - out . in a study of 451 nonactive military veterans , 82% thought it would be acceptable for the proposed million veterans biobank to use an opt - in approach , and 75% thought that an opt - out approach was acceptable ; 80% said that they would take part if the biobank were opt - in as opposed to 69% who would participate if it were an opt - out approach . when asked to choose which option they would prefer , 29% of respondents chose the opt - in method , 14% chose opt - out , 50% said either would be acceptable , and 7% would not want to participate . in some cases , biobank participants were re - contacted to inquire about their thoughts regarding proposed changes to the biobank in which they participated . thirty - two biobank participants who attended focus groups in wisconsin regarding proposed minimal - risk protocol changes were comfortable with using an opt - out model for future studies because of the initial broad consent given at the beginning of the study and their trust in the institution . a study of 365 participants who were re - contacted about their ongoing participation in a biobank in seattle showed that 55% thought that opt - out would be acceptable , compared with 40% who thought it would be unacceptable . similarly , several studies explored perspectives on the acceptability of an opt - out biobank at vanderbilt university . first , 91% of 1,003 participants surveyed in the community thought leftover blood and tissues should be used for anonymous medical research under an opt - out model ; these preferences varied by population , with 76% of african americans supporting this model compared with 93% of whites . in later studies of community members , approval rates for the opt - out biobank were generally high ( around 90% or more ) in all demographic groups surveyed , including university employees , adult cohorts , and parents of pediatric patients . three studies explored community perspectives on using newborn screening blood spots for research through the michigan biotrust for health program . first , 77% of 393 parents agreed that parents should be able to opt out of having their child 's blood stored for research . second , 87 participants were asked to indicate a preference : 55% preferred an opt - out model , 29% preferred to opt - in , and 16% felt that either option was acceptable . finally , 39% of 856 college students reported that they would give broad consent to research with their newborn blood spots , whereas 39% would want to give consent for each use for research . in a nationwide telephone survey regarding the use of samples collected from newborns , 46% of 1,186 adults believed that researchers should re - consent participants when they turn 18 years old . some studies examined the differences in participants ' willingness to provide broad consent for samples that were de - identified or anonymous as compared with identifiable . respondents generally preferred to give consent if their samples were identifiable . in two studies involving 429 primarily native hawaiian participants , 78% of native hawaiians and 66% of whites indicated that they would require consent for research if the specimens were identifiable and collected in the clinical setting . for genetics research , 81% native hawaiians and 78% of whites indicated that they would require consent if the specimens were identifiable . in a us - wide telephone survey , 81% of 1,193 respondents stated that they would want to be informed about research being done with their sample if it were identifiable ; additionally , 57% said they would require permission to use their samples if they were identifiable . for example , 65.8% of 504 adults who participated in a telephone survey across the united states reported that they would require consent for samples collected in the clinic if they were identifiable , compared with 27.3% who reported they would require consent if samples were anonymized . in the research setting , fewer people thought consent was required for identifiable ( 29.0% ) or anonymized ( 12.1% ) samples . in a study utilizing a hypothetical biobank scenario , 43% of 565 government and medical employees in new mexico indicated that they would donate their sample for future genetic testing if it could not be traced to them . not all studies found that people were worried about identifiability . in one survey of 144 clinicians , 86% said that they would donate a dna sample to a hypothetical biobank in new york regardless of whether it was linked to or unlinked from their identity . in the study in new mexico , 36% of 565 respondents found it acceptable for broadly consented samples to be used by their local university , even if the samples were linked to them . characteristics associated with favoring broad consent included being male , white / caucasian , older , and more affluent . by contrast , asians , black non - hispanics , african americans , and others ( who represented 14.3% of the total ) were less likely than whites to believe that research without explicit permission was acceptable . one study of consent forms showed that 75.0% of african americans gave broad consent compared with 88.4% of whites ( p = 0.002 ) . similarly , in the nhanes data , 78.7% of african americans and 87.1% of whites consented to genetics research . one study reported that participants who were significantly more likely to prefer broad consent also believed that participating would make me feel like i was contributing to society ( odds ratio = 1.85 ; p = 0.001 ) , that the study would accelerate medical treatments and cures ( odds ratio = 2.20 ; p = 0.001 ) , and that participating in the cohort study would be easy ( odds ratio = 1.59 ; p < 0.001 ) . other investigators reported that the large majority ( 97.7% ) of respondents said yes or maybe to the idea that it is a gift to society when an individual takes part in medical research . many other studies cited the benefit of research to improve health as a reason to favor broad consent . we identified 23 studies of data sharing . the earliest publications about participants ' preferences on data sharing date to 2006 . most studies of data sharing were conducted with studies of consent preferences ; however , six studies were conducted with the primary goal of eliciting preferences on data sharing . participants were generally willing to have their samples and information shared with other academic institutions . willingness to share data with academic and medical researchers was acceptable for 92% of 4,659 us adults generally , and 80% of 931 us veterans specifically . more than 70% of 100 young adults in baltimore who were enrolled in a longitudinal study of prevention were willing to share results arising from their dna . nearly three fourths of 40 community members in a focus group study in north carolina were comfortable with academic researchers having access to their samples . many of 79 focus group participants in seattle endorsed the value of sharing , agreed that sharing locally and with close collaborators was acceptable , and were comfortable with nonprofit and public - interest organizations using data from their samples . in one focus group study of 48 primarily white and female participants in iowa , the majority cited positive reasons for donating their samples to help and to contribute to advancements in research , and that data sharing would not affect their decision to enroll in a biobank . in another focus group study of 100 african americans in north carolina , many recognized the benefits of data sharing but wanted the potential risks to be disclosed , and some wanted the data to be restricted . in another study of patients with inflammatory bowel diseases , 97.3% of 92 respondents were comfortable with sharing their biological sample with investigators in the united states , but 23.8% were uncomfortable with sharing with investigators outside the united states . some participants expressed concern over sharing their data and information with federal repositories . in one study , 18.5% of 4,050 vanderbilt university faculty and staff were more likely to want to participate in their institution 's biobank if the de - identified data were deposited into a national database ; however , 12.1% were less likely to want to participate . in two large nationwide surveys , 80% of 4,659 adults were willing to have their data shared with government researchers ; however , 75% of the same sample also were concerned about the government having [ their ] samples and information . similarly , another study found that 71% of 931 veterans were willing to grant database access to government researchers , but half were concerned about the government having [ their ] samples and information . other studies have shown that some people are concerned about government involvement in maintaining databases containing biomedical information . more than half of the 40 participants in a focus group study of north carolina community members were concerned about government researchers having access to their institution 's biorepository . despite concerns , 61% of 203 kaiser patients in colorado would still provide a sample even if the data would be submitted to a government database , and 82% of 500 kaiser patients in oregon agreed to have their information posted in a us government database . in a large metropolitan area in southwest florida , some of 95 focus group participants believed that biospecimens were already being collected from leftover tissue , and others suspected that tissues were already being shared with researchers in other countries who lack strict laws ' governing research . in a focus group study of 178 alaska native participants , some cited mistrust of the government and police having access to their samples and wanted transparency from the researchers about how their samples were used . the majority of participants were willing to share with pharmaceutical company researchers , but the percentage was generally less than the percentage willing to share with academic researchers . seventy - five percent of 4,659 us adults , 54% of 931 veterans , 55.2% of 1,599 adults responding to a nationwide survey , and 75.1% of members of the crohn 's and colitis foundation of america partners cohort were willing to share with pharmaceutical company researchers . focus group participants in florida voiced concern about providing blanket consent because they would not benefit financially from any resulting discoveries . factors associated with views about data sharing . with the exception of gender , few demographic data ( e.g. , about race / ethnicity , socioeconomic status , education , and urban / rural residency ) even when demographic information was obtained , investigators did not always report how these variables correlated with respondents ' opinions . therefore , it was largely not possible to draw meaningful conclusions about the associations between sociodemographic factors and views on data sharing . the willingness of patients with cancer to share seemed to be shaped by their devotion to the institution at which they were receiving care . for example , patients with cancer in indiana who agreed to participate in a biobank were less likely to be willing to allow their tissue samples to be used by researchers who were not affiliated with the local researchers ( 89.7% ) , compared with 96.3% who were willing to share with local university researchers ( p < 0.01 ) . half of 100 patients with breast cancer at md anderson cancer center preferred to allow only their physician ( 24% ) or other researchers at their hospital ( 26% ) to use their de - identified genetic data for research ; fewer patients were willing to share their de - identified data with any cancer researcher ( 25% ) or any researcher ( 18% ) . in another study , 95% of 315 patients with cancer in atlanta were willing to allow researchers to share samples with other local researchers , but only 85% and 92% of participants at two different sites were willing to have their samples shared elsewhere in the united states ( p < 0.05 ) . in 2013 , nih funded the emerge consortium to perform a broad population - based survey to assess public opinion about broad consent for research and data sharing . this systematic literature review , which ultimately contained 48 studies involving 35,969 participants , was conducted to identify gaps and issues that needed to be addressed in this survey . the most notable finding is that many people do not favor broad consent for either research itself or for research and subsequent wide data sharing . while the majority often expressed support for broad consent when that was the only choice offered , only a minority of respondents favored broad consent when other options , such as tiered or study - by - study consent , were offered . furthermore , earlier studies focused on the importance of obtaining consent for research , whereas later studies focused on the preferences for different consent options . willingness to give broad consent increased if data were de - identified . while individuals were generally willing for data or biospecimens to be shared with other academic researchers , individuals were less willing for their data to be shared in federal databases or with commercial enterprises . what is equally striking are the large gaps in what is known about factors that affect people 's decisions . while a few studies generally found that men were more likely to support broad consent , most investigators did not examine the impact of gender on attitudes . although data about race / ethnicity are incomplete , it seems that minorities often have more concerns about broad consent , although existing evidence suggests that these concerns can be ameliorated in some cases by discussion and education . much less is known about the impact of sociodemographic factors such as socioeconomic status , education , and whether people live in urban or rural environments on attitudes toward broad consent and data sharing . building on these findings , the emerge cerc survey developed a sampling strategy , experimental study design , and survey questions to ascertain more uniformly the views of individuals throughout society in order to identify and address concerns . first , we used broad search terms to capture the existing literature on broad consent and data sharing . thus , while we used multiple approaches ( e.g. , searching multiple sources , reviewing reference lists , and searching the unpublished , gray literature , such as dissertations and reports ) to comprehensively identify studies , we may not have identified all salient research . second , we adapted existing metrics of quality scores to our study . for many studies , we were unable to ascertain the appropriateness of study questions or an analysis plan , thus limiting our ability to thoroughly assess the quality of the studies . third , the studies that have been conducted to date have a number of limitations , which in turn limit the generalizability of this literature review . many of the surveys focus what people say they think , rather what they actually do , even though opinions may differ from action . definitions of consent were not always consistent and have changed over time , which not only limits our ability to compare studies but also may affect our evaluation of older studies given today 's ethical standards for biobanking governance . however , all studies were sufficiently focused on broad consent for research or for data sharing to permit some comparison . most of the surveys heavily oversampled whites , whereas the qualitative studies disproportionately involved minority participants . studies that incorporated an educational component may have influenced respondents compared with those studies that did not involve education around biobanking practices . this review also was limited to the united states , which is warranted given the different policy preferences in other countries . the ultimate goal of this literature review and the emerge cerc survey is to obtain a more comprehensive understanding of public opinion about broad consent for data sharing and use . the studies included here typically noted a general acceptance for broad consent and endorsement of data sharing , but with notable privacy and governance concerns , especially by minority participants . the policy question will be what to do if some people , particularly from certain demographics , express a desire for more granular control over the use of data obtained from them in light of the policy trend toward requiring individual consent for broad data use and sharing . at a minimum , it suggests the need to engage those who are skeptical , even if it is decided that the public good of research to improve health outweighs honoring individual objections in some cases or the risk that some people will choose not to participate .

purpose : in 2011 , an advanced notice of proposed rulemaking proposed that de - identified human data and specimens be included in biobanks only if patients provide consent . the national institutes of health genomic data sharing policy went into effect in 2015 , requiring broad consent from almost all research participants.genet med 18 7 , 663671.methods:we conducted a systematic literature review of attitudes toward biobanking , broad consent , and data sharing . bibliographic databases included medline , web of science , ethxweb , and genethx . study screening was conducted using distillersr.genet med 18 7 , 663671.results:the final 48 studies included surveys ( n = 23 ) , focus groups ( n = 8) , mixed methods ( n = 14 ) , interviews ( n = 1 ) , and consent form analyses ( n = 2 ) . study quality was characterized as good ( n = 19 ) , fair ( n = 27 ) , and poor ( n = 2 ) . although many participants objected , broad consent was often preferred over tiered or study - specific consent , particularly when broad consent was the only option , samples were de - identified , logistics of biobanks were communicated , and privacy was addressed . willingness for data to be shared was high , but it was lower among individuals from under - represented minorities , individuals with privacy and confidentiality concerns , and when pharmaceutical companies had access to data.genet med 18 7 , 663671.conclusions:additional research is needed to understand factors affecting willingness to give broad consent for biobank research and data sharing in order to address concerns to enhance acceptability.genet med 18 7 , 663671 .

Materials and Methods Definitions Literature search strategy Data extraction and analysis Results Article selection Participant demographics Studies of broad consent Studies of data sharing Discussion and Conclusion Disclosure Supplementary Material

due to the habit of eating raw foods , parasitic infection does occur in many developing areas of the world . humans are accidental hosts and become infected by ingesting third - stage larvae from raw intermediate hosts such as snails , slugs , frogs , prawns , and crabs . infection has also rarely occurred by consuming contaminated water or uncooked vegetables . in only 1.1% of angiostrongyliasis cases is an angiostrongylus cantonensis larva identified in the eye.1 evidently , 35 cases of ocular angiostrongyliasis have been previously reported,2 most of which were found in asia , especially thailand , including the first case in the world.3 ocular findings as a result of parasitic infection have included lateral rectus paralysis , facial palsy , uveitis , glaucoma , subretinal tracks , necrotizing retinitis , disc swelling , disc atrophy , retinal pigment alteration , and exudative retinal detachment.2 herein , we report a case of ocular angiostrongyliasis with retrobulbar optic neuritis , in which the parasite was found in the subretinal space . a 27-year - old thai male presented with progressive visual loss and a membrane - like floater in the right eye that had persisted for 1 month . he had a history of eating raw foods , in particular of raw pila sp . . initial visual acuity of the affected eye was counting fingers at 1 ft and he had a relative afferent pupillary defect . a live roundworm , nearly 15 mm in length , with subretinal tracks was found near the normal optic disc . during indirect ophthalmoscopy , topical prednisolone acetate and oral prednisolone 40 mg daily , tapered after 2 weeks , were prescribed to reduce the subsequent inflammation . due to the patient s history of ingesting raw food , from a review of 35 cases in the literature , the typical presenting symptom of ocular angiostrongyliasis is blurred vision without headache , although the eosinophilic meningitis may also present prior to , or coexisting with , the ocular symptoms . in some patients with angiostrongyliasis who reported having mild headache , their illness was not recognized or was misdiagnosed as migraine , tension headache , psychoneurosis , or even malaria.4 initial visual acuity varied widely from 6/9 to light perception . the incubation period is between 2 weeks and 2 months.1 punyagupta et al undertook clinical studies of 484 cases of typical eosinophilic meningitis and found 16% of patients had visual impairment , while 12% had an optic disc abnormality such as papilledema or atrophy.4 in these cases , we hypothesize the intraocular parasite was not identified because no ophthalmologist was available who could perform slit - lamp ophthalmoscopy and indirect ophthalmoscopy . three decades later , sawanyawisuth et al conducted a 10-year review of angiostrongyliasis in the northeast of thailand and reported that the larva could be identified in only 1.1% of patients.1 almost all previous reports have indicated that only one living larva was found in the eye of each patient . further , in about half of all cases , the motile worms were located in the vitreal cavity.2 we have also found that intravitreal and intracameral larvae are usually localized by fibrin , but that subretinal parasites usually move freely.5 pathological study has indicated that a. cantonensis may move along the cranial nerves after reaching its fifth - stage at the brain surface.4 cranial nerves 2 , 5 , and 7 have a long intracranial course , which may make them more susceptible than others . the larva can migrate to the orbit by traveling between the optic nerve and the sheath and penetrate the eye by way of the cribriform plate . a. cantonensis is easily identified by slit - lamp ophthalmoscopy and indirect ophthalmoscopy because this helminth can be easily distinguished from other parasites by its physical characteristics , so ocular examination is crucial for diagnosis . the other common intraocular roundworm is gnathostoma spinigerum , a nematode that reaches only 4 mm in length and has a tapering end . because the typical physical features of the parasite were observed and it could be treated nonsurgically , local antibody evaluation such as polymerase chain was not performed in this case report . although blood leukocytosis and eosinophilia have been demonstrated in 56% and 73% , respectively , of eosinophilic meningitis cases , eosinophilia has not been observed in ocular angiostrongyliasis without meningitis but leukocytosis has been observed in a few cases.1,4 in cases presenting with severe headache or neurologic abnormalities , lumbar puncture indicated eosinophilic pleocytosis.1a . cantonensis larvae and eggs have seldom been found on stool examination , while o. viverrini and hookworm eggs have commonly been found.1 several treatments have been used to treat ocular angiostrongyliasis , including intravenous methylprednisolone , topical prednisolone , oral prednisolone , laser photocoagulation , and surgical removal.2 over three decades ago in thailand , we found that the intravitreal parasite often moved to the anterior chamber after the patient was placed in a facedown position . the motile worm could then be removed much more easily once in the anterior chamber . many patients in rural and remote areas often can not be referred due to financial and transportation problems . if the intravitreal parasite moves to the anterior chamber after the patient is placed in the face - down position , general ophthalmologist can remove it . we recommend applying laser treatment before surgical removal in every case because the motile worm may disappear in the operative field . our laser technique involved directing a laser aiming beam of 200300 um on the pigmented gut of the larva . for a subretinal parasite , it is very important to use the laser to drive the larva away from the posterior pole , as in the case described here . in previous cases of secondary optic neuritis caused by a. cantonensis , most of the patients experienced only a slight improvement in visual acuity after treatment . in previous studies , steroids have been shown to have a beneficial effect on the clinical course of ocular angiostrongyliasis.6 however , anti - helminthic drugs should be used with caution because although they have been shown effective in experimental animals , larvicidal drugs can result in serious adverse neurological effects . cuckler et al revealed that thiabendazole treatment in experimental rats that had been infested with a. cantonensis for 34 weeks comparable to persons with a serious infestation of this parasite resulted in the inhibition of parasitic migration from the animals brains.7 however , the death of many worms simultaneously in the brain or spinal cord might produce catastrophic effects from toxic substances released by the dying and necrotic worms . therapeutic success in ocular angiostrongyliasis mainly depends on early diagnosis and complete surgical removal of the parasite . unfortunately , visual prognosis depends largely on the initial pathology and visual acuity ; ocular angiostrongyliasis often still results in permanent visual impairment , even blindness . in the case of surgical removal , the parasitologist can clearly identify the sex and stage of the larva . although several treatments are available and used , most patients attain only slight visual improvement following treatment . optic neuritis can be secondary to mechanical injury due to the migrating nematodes , granulomatous inflammatory reactions due to a dead worm , or localized antigen - antibody reactions . oral or intravenous steroid treatment is recommended for secondary optic neuritis caused by a. cantonensis .

a 27-year - old thai male presented with progressive visual loss and a membrane - like floater in the right eye that had persisted for 1 month . he had a history of eating raw foods , including snails . his initial visual acuity was counting fingers at 1 ft and he had a relative afferent pupillary defect . a movable larva with subretinal tracks was found in the subretinal space near a normal optic disc . visually evoked potentials showed delayed latency , which indicated secondary retrobulbar optic neuritis . a diode laser was directly applied to the motile worm . the patient was subsequently prescribed oral prednisolone and albendazole . after treatment , his visual acuity was slightly improved at 2/60 . ocular manifestation is a very rare event resulting from parasitic infection . in only 1.1% of angiostrongyliasis cases is an angiostrongylus cantonensis larva identified in the eye . ocular angiostrongyliasis with optic neuritis may be secondary to mechanical injury and/or inflammatory reactions . steroid treatment is recommended , although most patients have only slight visual improvement after treatment .

Introduction Case report Discussion Conclusion

bile acid - sensitive ion channel ( basic ) is a member of the deg / enac family of cation channels . other mammalian members of this gene family are the epithelial na channel ( enac ) and acid - sensing ion channels ( asics ) . while the function of enac in epithelial na reabsorption and na homeostasis has been known for some time and the role of asics in neuronal transmission and sensation of painful acidosis has been revealed over the last years , the physiological role of basic has remained unknown . cloned more than a decade ago from rat and mouse , it was originally named blinac , according to its predominant sites of expression , namely the brain , the liver and the intestinal tract . the human homolog was cloned shortly after basic and originally named inac ( intestine na channel ) , because its expression was mainly restricted to the intestinal tract . while basic from mouse ( mbasic ) is a constitutively open , na - selective channel , its ortholog from rat ( rbasic ) is almost completely blocked by physiological concentrations of extracellular ca . the residual rbasic current is unselective but removal of extracellular ca opens rbasic and renders the channel more selective for na over k. a hallmark of deg / enac channels is the block by the diuretic amiloride . while mbasic is inhibited by micromolar concentrations of amiloride , rbasic is only partially inhibited by millimolar concentrations of the drug . the anti - protozoal diarylamidines , in particular diminazene and the related compound nafamostat , inhibit basic at micromolar concentrations . because diarylamidines do not inhibit enac , they are well suited to distinguish between enac and basic currents in tissues and cells . since its cloning , it was hypothesized that basic might be a ligand - gated channel , like other members of the deg / enac family , for example the hydra na channel ( hynac ) from the freshwater polyp hydra magnapapillata and fanac , the fmrfamide - activated na channel from snails , which have neuropeptides as ligands . the ligand - hypothesis gained further support when flufenamic acid ( ffa ) was identified as an artificial agonist of rbasic . micro- to millimolar concentrations of ffa rapidly activate the channel , inducing na - selective currents . recently we identified cholangiocytes , the epithelial cells lining the bile ducts , as the main site of basic protein expression in the liver . this in turn led to the identification of bile acids as agonists of rbasic , confirming that rbasic requires a ligand for activation . based on the sensitivity of the channel for bile acids we changed the original name blinac to basic . various bile acids naturally occurring in mouse , rat and pig bile , in particular hyodeoxycholic acid ( hdca ) and chenodeoxycholic acid ( cdca ) , activate rbasic when applied individually . they are synthesized by hepatocytes and then transported via the bile ducts to the gallbladder , where they are stored and from which they are released into the small intestine when required . rats lack a gallbladder ; in these animals the bile is directly released from the major extrahepatic bile duct into the duodenum . hundreds of different bile acids are known to date , the structure of their side chain , their stereochemistry and the number and position of their hydroxylgroups varies and determines their chemical properties . furthermore the bile acid composition is highly variable between different species . in humans for example , the major bile acids are cdca and cholic acid ( ca ) whereas in rodents , ca , -muricholic acid ( -mca ) and hdca are the major bile acids . ursodeoxycholic acid ( udca ) is the major physiological constituent of bear bile but it is also present in trace amounts in human and rodent bile . in traditional chinese medicine , udca isolated from bear bile has been administered as a remedy for liver diseases for almost 3000 y. in the 20th century , udca was discovered by western medicine as a compound capable of dissolving gallstones and inducing choleresis , an increased bile flow . today udca is used to treat various cholestatic liver diseases , for example primary biliary cirrhosis , primary sclerosing cholangitis or intrahepatic cholestasis of pregnancy . udca exerts its beneficial anti - cholestatic effect by several different but possibly linked mechanisms in hepatocytes and cholangiocytes . in hepatocytes , udca increases secretion by stimulating the expression of transporter proteins required for secretory processes , for example the bile salt export pump ( bsep ) and the multidrug resistance - associated protein 2 ( mrp2 ) , and by increasing the insertion rate of these proteins into the apical membrane cholangiocytes are constantly exposed to high concentrations of hydrophobic bile acids , which can damage the plasma membrane leading to cholangiocyte malfunction . udca , a relatively hydrophilic bile acid counteracts this membrane - damaging effect in vitro . in addition , udca can stimulate secretion of cholangiocytes indirectly via intracellular signaling cascades that affect apically located proteins involved in secretion , e.g. , purinergic py receptors and the chloride channel cftr ( cystic fibrosis transmembrane conductance regulator ) . in this addendum to our previous study we demonstrate that the removal of extracellular divalent cations potentiates the activation of basic by bile acids . we had previously shown that removal of extracellular ca opens rbasic , suggesting that ca strongly stabilizes the inactive , resting state of rbasic . here we determined the current amplitude of rbasic with different concentrations of extracellular mg in the absence of ca , revealing that mg also strongly inhibited rbasic with an ic50 of 79 10 m ( n = 8 ; fig . 1 ) . thus , apparent affinity of mg - inhibition was 6-fold lower than of ca - inhibition ( 13 2 m , n = 8 , p < 0.01 ; fig . 1 ) , showing that both , ca and mg , tightly control rbasic activity and stabilize its resting state . ( a ) upper panel , representative current trace from rbasic - expressing oocytes recorded in the absence of mg and decreasing [ ca]e . lower panel , representative current trace recorded in the absence of ca and decreasing [ mg]e . ( b ) concentration - dependent inhibition of rbasic by extracellular ca ( closed circles ) and mg ( open circles ) . currents were normalized to the current in the presence of 10 nm ca or mg , respectively . next , we tested whether removal of extracellular divalent cations affects the activation of basic by hdca and whether it can further increase basic activity in the presence of a maximal concentration of hdca . we used mg - free solutions and determined the ec50 of basic for hdca both in the presence ( 1.8 mm ) and the absence ( 10 nm ) of extracellular ca ( fig . 2 ) . similar to our previous study , we found that 2 mm hdca did not change the concentration of free ca compared with standard bath ( not shown ) , ruling out an unspecific effect via chelation of ca . ec50 for hdca was modestly increased from 2.1 0.04 mm in the presence of ca to 1.6 0.05 mm in its absence ( n = 8 , p < 0.01 ; fig . moreover , at any concentration of hdca , the current amplitudes induced by hdca were three- to four - fold higher in the absence of extracellular ca than in its presence ( fig . 2 ) . ( a ) representative current traces from rbasic - expressing oocytes showing the concentration - dependent activation of rbasic by hdca in the presence of 1.8 mm extracellular ca and 1.0 mm extracellular mg ( upper panel ) or of 10 nm ca and 0 mg ( -ca ) ( lower panel ) . ( b ) concentration - response curves for hdca in the presence of 1.8 mm extracellular ca and 1.0 mm extracellular mg ( closed circles ) or of 10 nm ca and 0 mg ( open circles ) . therefore , we previously proposed that removal of divalent cations does not simply unblock the basic pore but induces a conformational change that is associated with open gating of the channel . assuming a pure effect of divalent cations on gating , potentiation of the basic current by removal of ca at a maximal concentration of hdca suggests that hdca is a partial agonist that does not induce full basic activity . likewise , the similar hdca concentration - response relationship in the presence and absence of ca suggests that hdca further increases basic activity even when ca was not bound to the channel . these results , thus , argue that removal of ca and hdca gate basic by an allosteric mechanism , meaning that removal of ca and bile acids use two independent molecular mechanisms to synergistically influence the activity of basic . at present we can not exclude , however , that a block by ca of the open basic pore is the reason of the increased current amplitude after removal of ca . future studies determining the dependence of the open channel amplitude on ca will show whether ca has a pure gating effect on basic or a combined effect on gating and single channel amplitude . udca and hdca differ only in the position of one hydroxyl group : in udca , c-7 is hydroxylated , whereas in hdca , c-6 is hydroxylated . the only difference between udca and cdca is the steric orientation of the hydroxyl group at position c-7 : in udca it is in the -position , whereas in cdca it is in the -position ( fig . 3a ) . because of this high similarity we reasoned that udca might also activate rbasic . indeed , udca robustly activated rbasic when applied at a concentration of 2 mm . the current amplitude induced by udca was even significantly higher ( 3.0 0.5 a , n = 10 ) than the amplitude induced by the same concentration of hdca ( 1.9 0.3 a , n = 10 , p < 0.05 ; fig . activation of rbasic by udca was concentration dependent , similar to activation by hdca ( fig . the ec50 value for udca was 2.5 0.04 mm ( n = 10 ) , similar to the ec50 for hdca ( 2.1 0.04 mm , n = 8) . we have shown previously that when hdca and cdca are applied together at a concentration of 1.0 mm and 0.5 mm , respectively , they induce a significantly larger current amplitude than when applied individually , suggesting that both bile acids activate the channel synergisitically . udca at a concentration of 1 mm together with 0.5 mm cdca induced a 3-fold larger current ( 2.4 0.3 a , n = 10 ) than udca applied alone at a concentration of 1.5 mm ( 0.7 0.1 a , n = 10 , p < 0.01 ) , suggesting that cdca and udca synergistically activate rbasic . structures were drawn using cs chemdraw ultra ( cambridgesoft ) based on structures available from pubchem ( http://pubchem.ncbi.nlm.nih.gov/ ) . upper panel , representative current trace from an rbasic - expressing oocyte showing the activation of rbasic by individual application of 2 mm hdca or udca . lower panel , quantitative comparison of current amplitudes induced by hdca ( gray bar ) and udca ( black bar ) . currents were normalized to the current induced by the removal of extracellular divalent cations ( 10 nm ca , 0 mg ; error bars = sem ( c ) upper panel , representative current trace from an rbasic - expressing oocyte showing the concentration - dependent activation of rbasic by udca . currents were normalized to the maximum current in the presence of 5 mm udca , which was 13.2 1.1 a ( n = 8) . error bars = sem . upper panel , representative current trace showing the activation of rbasic by individual application of 1.5 mm udca and by co - application of 1.0 mm udca and 0.5 mm cdca , respectively . lower panel , quantitative comparison of current amplitudes induced by udca ( gray bar ) and udca / cdca ( black bar ) . currents were normalized to the current induced by the removal of extracellular divalent cations ( -ca ) which was 2.9 0.4 a ( n = 10 ) . whether the effect of udca on rbasic activity is of any physiological or clinical relevance remains to be elucidated but it is tempting to speculate that rbasic is involved in absorptive and/or secretory processes in cholangiocytes and that it might represent an hitherto unknown molecular target of udca . basic is a cation channel , however , and cation reabsorption by cholangiocytes would lead to a net fluid absorption and thus reduced bile flow , which contradicts the anticholestatic effect of udca . future results will show whether basic contributes to cation transport in bile ducts and whether it promotes secretion or absorption by the bile duct epithelium . we had previously shown that removal of extracellular ca opens rbasic , suggesting that ca strongly stabilizes the inactive , resting state of rbasic . here we determined the current amplitude of rbasic with different concentrations of extracellular mg in the absence of ca , revealing that mg also strongly inhibited rbasic with an ic50 of 79 10 m ( n = 8 ; fig . 1 ) . thus , apparent affinity of mg - inhibition was 6-fold lower than of ca - inhibition ( 13 2 m , n = 8 , p < 0.01 ; fig . 1 ) , showing that both , ca and mg , tightly control rbasic activity and stabilize its resting state . ( a ) upper panel , representative current trace from rbasic - expressing oocytes recorded in the absence of mg and decreasing [ ca]e . lower panel , representative current trace recorded in the absence of ca and decreasing [ mg]e . ( b ) concentration - dependent inhibition of rbasic by extracellular ca ( closed circles ) and mg ( open circles ) . currents were normalized to the current in the presence of 10 nm ca or mg , respectively . next , we tested whether removal of extracellular divalent cations affects the activation of basic by hdca and whether it can further increase basic activity in the presence of a maximal concentration of hdca . we used mg - free solutions and determined the ec50 of basic for hdca both in the presence ( 1.8 mm ) and the absence ( 10 nm ) of extracellular ca ( fig . 2 ) . similar to our previous study , we found that 2 mm hdca did not change the concentration of free ca compared with standard bath ( not shown ) , ruling out an unspecific effect via chelation of ca . ec50 for hdca was modestly increased from 2.1 0.04 mm in the presence of ca to 1.6 0.05 mm in its absence ( n = 8 , p < 0.01 ; fig . moreover , at any concentration of hdca , the current amplitudes induced by hdca were three- to four - fold higher in the absence of extracellular ca than in its presence ( fig . 2 ) . ( a ) representative current traces from rbasic - expressing oocytes showing the concentration - dependent activation of rbasic by hdca in the presence of 1.8 mm extracellular ca and 1.0 mm extracellular mg ( upper panel ) or of 10 nm ca and 0 mg ( -ca ) ( lower panel ) . ( b ) concentration - response curves for hdca in the presence of 1.8 mm extracellular ca and 1.0 mm extracellular mg ( closed circles ) or of 10 nm ca and 0 mg ( open circles ) . therefore , we previously proposed that removal of divalent cations does not simply unblock the basic pore but induces a conformational change that is associated with open gating of the channel . assuming a pure effect of divalent cations on gating , potentiation of the basic current by removal of ca at a maximal concentration of hdca suggests that hdca is a partial agonist that does not induce full basic activity . likewise , the similar hdca concentration - response relationship in the presence and absence of ca suggests that hdca further increases basic activity even when ca was not bound to the channel . these results , thus , argue that removal of ca and hdca gate basic by an allosteric mechanism , meaning that removal of ca and bile acids use two independent molecular mechanisms to synergistically influence the activity of basic . at present we can not exclude , however , that a block by ca of the open basic pore is the reason of the increased current amplitude after removal of ca . future studies determining the dependence of the open channel amplitude on ca will show whether ca has a pure gating effect on basic or a combined effect on gating and single channel amplitude . udca and hdca differ only in the position of one hydroxyl group : in udca , c-7 is hydroxylated , whereas in hdca , c-6 is hydroxylated . the only difference between udca and cdca is the steric orientation of the hydroxyl group at position c-7 : in udca it is in the -position , whereas in cdca it is in the -position ( fig . 3a ) . because of this high similarity we reasoned that udca might also activate rbasic . indeed , udca robustly activated rbasic when applied at a concentration of 2 mm . the current amplitude induced by udca was even significantly higher ( 3.0 0.5 a , n = 10 ) than the amplitude induced by the same concentration of hdca ( 1.9 0.3 a , n = 10 , p < 0.05 ; fig . 3b ) . activation of rbasic by udca was concentration dependent , similar to activation by hdca ( fig . the ec50 value for udca was 2.5 0.04 mm ( n = 10 ) , similar to the ec50 for hdca ( 2.1 0.04 mm , n = 8) . we have shown previously that when hdca and cdca are applied together at a concentration of 1.0 mm and 0.5 mm , respectively , they induce a significantly larger current amplitude than when applied individually , suggesting that both bile acids activate the channel synergisitically . udca at a concentration of 1 mm together with 0.5 mm cdca induced a 3-fold larger current ( 2.4 0.3 a , n = 10 ) than udca applied alone at a concentration of 1.5 mm ( 0.7 0.1 a , n = 10 , p < 0.01 ) , suggesting that cdca and udca synergistically activate rbasic . structures were drawn using cs chemdraw ultra ( cambridgesoft ) based on structures available from pubchem ( http://pubchem.ncbi.nlm.nih.gov/ ) . upper panel , representative current trace from an rbasic - expressing oocyte showing the activation of rbasic by individual application of 2 mm hdca or udca . lower panel , quantitative comparison of current amplitudes induced by hdca ( gray bar ) and udca ( black bar ) . currents were normalized to the current induced by the removal of extracellular divalent cations ( 10 nm ca , 0 mg ; -ca error bars = sem ( c ) upper panel , representative current trace from an rbasic - expressing oocyte showing the concentration - dependent activation of rbasic by udca . currents were normalized to the maximum current in the presence of 5 mm udca , which was 13.2 1.1 a ( n = 8) . error bars = sem . upper panel , representative current trace showing the activation of rbasic by individual application of 1.5 mm udca and by co - application of 1.0 mm udca and 0.5 mm cdca , respectively . lower panel , quantitative comparison of current amplitudes induced by udca ( gray bar ) and udca / cdca ( black bar ) . currents were normalized to the current induced by the removal of extracellular divalent cations ( -ca ) which was 2.9 0.4 a ( n = 10 ) . whether the effect of udca on rbasic activity is of any physiological or clinical relevance remains to be elucidated but it is tempting to speculate that rbasic is involved in absorptive and/or secretory processes in cholangiocytes and that it might represent an hitherto unknown molecular target of udca . basic is a cation channel , however , and cation reabsorption by cholangiocytes would lead to a net fluid absorption and thus reduced bile flow , which contradicts the anticholestatic effect of udca . future results will show whether basic contributes to cation transport in bile ducts and whether it promotes secretion or absorption by the bile duct epithelium . despite our recent progress regarding the expression pattern of basic in cholangiocytes and regarding its activation by bile acids , we are still far away from understanding the physiological role of basic in these cells , let alone its role in other tissues such as the intestinal tract or the brain . in future studies it will therefore be important to confirm expression of basic in cholangiocytes and to discover its cellular and subcellular expression pattern in other tissues . furthermore it will be necessary to study basic in a native cell or a native epithelium or both , to unravel its role in ion transport mediated by these cells and epithelia .

bile acid - sensitive ion channel ( basic ) is a member of the deg / enac gene family of unknown function . rat basic ( rbasic ) is inactive at rest . we have recently shown that cholangiocytes , the epithelial cells lining the bile ducts , are the main site of basic expression in the liver and identified bile acids , in particular hyo- and chenodeoxycholic acid , as agonists of rbasic . moreover , it seems that extracellular divalent cations stabilize the resting state of rbasic , because removal of extracellular divalent cations opens the channel . in this addendum , we demonstrate that removal of extracellular divalent cations potentiates the activation of rbasic by bile acids , suggesting an allosteric mechanism . furthermore , we show that rbasic is strongly activated by the anticholestatic bile acid ursodeoxycholic acid ( udca ) , suggesting that basic might mediate part of the therapeutic effects of udca .

Introduction Results and Discussion rBASIC is strongly inhibited by extracellular Mg rBASIC activation by bile acids is potentiated by removal of divalent cations rBASIC is activated by ursodeoxycholic acid Outlook

they are caused by distinct viruses that belong to different families ( varicella - zoster virus , a dna virus belonging to the family herpesviridae ; morbilli virus , an rna virus belonging to the family paramyxoviridae ) . owing to sustained high vaccination coverage with two doses of measles vaccine , at the age of one and seven years , measles are virtually eliminated in croatia . in the last decade only sporadic imported cases of measles are reported , with the exception of two small outbreaks , which occured in 2004 and 2008 following importation of measles . since there is no universal chickenpox vaccination in croatia and the number of vaccinated persons upon request is very low , chickenpox is a common childhood disease with an annual incidence of 2530 cases per 1000 children under 15 years of age . the first symptoms of illness ( fever and rash on the trunk and extremities ) appeared during their stay in italy . upon arrival to croatia , on 5 july , two of the children ( 15 and eight years of age ) were admitted to hospital with suspected measles and chickenpox . both children presented with fever up to 39c , dry cough and confluent macular rash wich was most prominent on the face and neck . the 15-year - old daughter had prominent retroauricular confluent rash and koplik spots on the buccal mucosa . five days later , on 10 july an 18-year - old boy from the same family , presented at the infectology clinic with fever up to 39c and dense confluent macular rash , with numerous scabs on the face and entire body . an epidemiological investigation revealed that he had chickenpox with disease onset at the time of their stay in italy about 15 june . the epidemiological investigation focused on ten children from the same family . in six children ( including the two hospitalized girls ) blood samples were taken on 14 july and sent to the refence laboratory at the croatian national institute of public health ( cniph ) for measles and varicella - zoster serology testing . based on clinical manifestations and results of serology testing , four of these six children had simultaneous infection with measles and varicella and two children had chickenpox . four siblings who had no symptoms and had no history of measles immunization were vaccinated with a monovalent measles vaccine following the investigation . serologic tests were performed at who national measles laboratory , department of virology ( cniph ) . specific igm and igg antibodies to measles and varicella - zoster virus ( vzv ) were detected using commercial enzyme - linked immunosorbent assay ( virotech , russelsheim , germany ) . vzv igg positive samples were tested for igg avidity ( euroimmun , lubeck , germany ) . serologic results are presented in table 1 . in two patients ( patiens 1 and 2 ) varicella infection two patients ( patients 3 and 4 ) had positive vzv igm antibodies with low igg avidity . for two patients ( patients 5 and 6 ) , paired samples were obtained three weeks later . in both patients , varicella infection was confirmed by low igg avidity in the second sample ( table 1 ) . table 1serologic results in six patients with suspected measles and varicella infection.patientagesexmeasles virusvaricella - zoster virusigmiggigmiggigg avidity1i11fnegativenegativepositivepositivelow2i12mnegativenegativepositivepositivelow3i15fpositivenegativenegativepositivelow4i8fpositivenegativepositivepositivelow5i18mpositivenegativepositiveequivocal - ii*positivepositivepositivepositivelow6i12fpositivepositivenegativenegative - ii*positivepositivepositiveequivocallow*paired serum samples ( obtained three weeks later ) . paired serum samples ( obtained three weeks later ) . the epidemiological investigation revealed that none of the ten children were vaccinated against measles ( which is mandatory according to the childhood immunization programme in croatia ) or varicella ( which is not mandatory ) . the fact that none of the children were vaccinated represents a public health issue in a relatively small migrant population and indicates that vaccination coverage may be low in this population . simultaneous infection and clinical illnesses of a viral and bacterial etiology is a well known fact , as well as co - infections but not simultaneous illness caused by two distinct viruses . however , clinical disease caused by two viruses at the same time is known to be a feature of only a few viruses , notably hiv , hepatitis b and hepatitis c viruses . our literature search revealed only a few case report of children who had measles and chickenpox at the same time . all these cases occurred at the time when incidences of both measles and chickenpox were high in the populations . due to very high incidence rates of chickenpox and still high incidence of measles in countries with low vaccination coverage , one would expect numerous cases of simultaneous disease in the absence of some kind of immunological interference . the rarity of reports on simultaneous measles and chickenpox illness indicates that recent infection with one virus results in suppression of clinically manifest disease caused by another virus if a person acquires the other infection soon afterward . the simultaneous illness described in our report is quite unexpected because measles is virtually eliminated in croatia and in earlier decades , when measles was a common childhood disease , we have not identified cases of simultaneous clinical illness caused by measles and chickenpox .

we are reporting on a household outbreak of measles , in which cases of simultaneous measles and chickenpox infection occured in children of a family who resided in italy during the incubation period ( june 2011 ) . in three children , fever and generalized confluent macular rash were the dominant symptoms . serology testing revealed simultaneous measles and chickenpox infection in four children .

Introduction Case Report Laboratory Investigation Discussion

retinitis pigmentosa ( rp ) is the term used for a group of retinal diseases that are characterized by inherited , progressive degeneration of retinal tissue , mainly rod and secondarily cone photoreceptors . the clinical features are night blindness and visual field ( vf ) loss due to loss of rod photo - receptors . many patients fall into a classical pattern of difficulties with dark adaptation and night blindness and loss of midperipheral vision field . as the disease advances , they lose peripheral vision , eventually developing tunnel vision with the remaining cone photoreceptors , and finally lose central vision and visual acuities ( vas ) as these cones secondarily degenerate in the macular region.1,2 typically , it takes several years until the patients lose their central vision ; therefore , it is important to protect the cone photoreceptors in the macular area for rp patients . because rp is caused by various mutations in any of > 45 responsible genes , the processes of degeneration are considered to be not uniform , and no effective treatment other than nutritional supplementation of vitamin a currently exists . recently , noorwez et al3 reported that valproic acid ( vpa ) can increase the yield of properly folded rp mutant rhodopsins ; by using their high - throughput screening method involving in silico , cell - based , and in vitro assays , the authors were able to identify pharmacological chaperones of misfolded rhodopsin . based on the data , clemson et al4 reported in their retrospective study that treatment with vpa in patients with rp improved vas and vfs . however , there were controversies over that study,57 and another group , bhalla et al,8 not only claimed no improvement in va and vf in their study but also stated that vpa may facilitate some adverse side effects . to date , various clinical studies have been performed,9,10 but no conclusion has been reached regarding the efficacy of using vpa in patients with rp . the pharmacological basis of the antiepileptic action of vpa has been related to the regulation of the glutamate excitatory neurotransmission and/or gamma - aminobutyric acid ( gaba ) inhibitory neurotransmission.11 recent studies showed that vpa is an effective inhibitor of histone deacetylases , the key enzymes for the control of histone acetylation state and hence for the epigenetic regulation of gene expression . mainly through inhibition of histone deacetylases , vpa induces apoptosis of microglia cells12 and activates bdnf promoter.13 moreover , vpa induces neuronal differentiation but suppresses astrocytic and oligodendrocytic differentiation of neural stem cells14 and promotes neurite outgrowth.15 in this prospective study , we examined the efficacy and safety of vpa use in japanese patients with rp . this study is registered with the clinical trials registry of the japan medical association center for clinical trials , number jma - iia00053 . in this prospective , interventional , noncomparative case study ethics committee approval was granted by the ethics committee at the institute of biomedical research and innovation . all the patients were seen at the institute of biomedical research and innovation hospital ( kobe , japan ) from december 2010 to january 2013 . the diagnosis of rp was based on the patients symptoms of night blindness , ring scotoma or concentric constriction of vfs , markedly reduced or nonrecordable a- and b - wave amplitudes on electroretinogram ( erg ) testing , and ophthalmoscopic findings ( ie , characteristic fundus changes in attenuated retinal vessels and bone - spicule - like pigment clumping ) . the inclusion criteria were the following : 20 years old or older , best - corrected visual acuities ( bcvas ) of > 20/200 and < 20/30 , and vfs of 10 measured using goldmann perimeter with isopter i4 . the exclusion criteria were the following : patients with retinal diseases other than rp , including retinal degeneration secondary to inflammation or infection and retinal vascular or macular diseases ; cataractous lens gradings of more than n1 , c2 , or p1 according to lens opacities classification system iii grading ; previous intraocular surgery except for uncomplicated cataract extraction ; women of childbearing potential who were pregnant , nursing , or planning a pregnancy ; presentation of liver disease or a urea cycle disorder ; patients who had drug hypersensitivity ; patients who had attempted suicide or had suicidal thoughts with manic depressive illness ; and patients who were using contraindication medicine . prior to treatment at the initial study visit , each patient underwent ophthalmic examinations , including bcva measured using a landolt chart , intraocular pressure measurements , vf measured with the humphrey field analyzer ( hfa ; zeiss - humphrey systems , dublin , ca , usa ) 10 - 2 program , slit - lamp biomicroscopy , and dilated indirect fundus ophthalmoscopy . after baseline measurements were obtained , all the patients were instructed to receive oral supplementation of 400 mg ( the lowest dosage used for anticonvulsant therapy ) of vpa ( depakene - r ; kyowa hakko kirin , tokyo , japan ) daily for 6 months . the patients returned to our clinic for follow - up visits and were asked to report on the development of any subjective visual changes as well as any systemic adverse events . bcvas , vfs , and ophthalmic findings were collected throughout the entire study at months 1 , 3 , 6 ( end of supplementation ) , 9 , and 12 . blood samples were collected to check blood counts , clinical biochemistry , and the blood concentration of vpa at months 1 , 2 , 3 , 4 , and 6 ( end of supplementation ) . bcva was converted to the value of logarithm of the minimum angle of resolution ( logmar ) for all analyses . vf test results were summarized using the mean deviation ( md ) value calculated by the hfa provided software . the calculation of the md value involved averaging the differences between the measured sensitivities and the age - adjusted normal sensitivities ( total deviations ) at each test point . although not included as routine tests in our study design , microperimetry-1 ( mp-1 ; nidek , gamagori , japan ) or multifocal erg ( veris ; electro - diagnostic imaging , inc . , redwood , ca , usa and le-4000 ; tomey , nagoya , japan ) were also recorded in some patients at pretreatment and at 6 months or at 6 months and 12 months . the primary end point of this study was improvement in bcva after the 6 months of treatment with vpa , and the secondary end points were vf and the occurrence of adverse events . the variance approximation for the estimation of sample size was obtained from previous studies that have tested a similar hypothesis.4 a sample size calculation was performed before the study , assuming a maximum dropout rate of 30% . accordingly , we assumed that at least 30 patients were going to fail power of 80% ( -1 ) to detect a logmar 0.2 difference in va between patients before and after receiving vpa . all parameters obtained prior to vpa treatment and at 1 month , 3 months , 6 months , 9 months , and 12 months after treatment initiation were compared using the wilcoxon signed - rank test with bonferroni correction . we utilized a bonferroni adjustment for multiple comparisons , after which p - values 0.01 were considered as statistically significant . all statistical analyses were performed using the statistical analysis software ( spss inc . , chicago , il , usa ) . this study is registered with the clinical trials registry of the japan medical association center for clinical trials , number jma - iia00053 . in this prospective , interventional , noncomparative case study , the study protocols adhered to the tenets of the declaration of helsinki . ethics committee approval was granted by the ethics committee at the institute of biomedical research and innovation . all the patients were seen at the institute of biomedical research and innovation hospital ( kobe , japan ) from december 2010 to january 2013 . the diagnosis of rp was based on the patients symptoms of night blindness , ring scotoma or concentric constriction of vfs , markedly reduced or nonrecordable a- and b - wave amplitudes on electroretinogram ( erg ) testing , and ophthalmoscopic findings ( ie , characteristic fundus changes in attenuated retinal vessels and bone - spicule - like pigment clumping ) . the inclusion criteria were the following : 20 years old or older , best - corrected visual acuities ( bcvas ) of > 20/200 and < 20/30 , and vfs of 10 measured using goldmann perimeter with isopter i4 . the exclusion criteria were the following : patients with retinal diseases other than rp , including retinal degeneration secondary to inflammation or infection and retinal vascular or macular diseases ; cataractous lens gradings of more than n1 , c2 , or p1 according to lens opacities classification system iii grading ; previous intraocular surgery except for uncomplicated cataract extraction ; women of childbearing potential who were pregnant , nursing , or planning a pregnancy ; presentation of liver disease or a urea cycle disorder ; patients who had drug hypersensitivity ; patients who had attempted suicide or had suicidal thoughts with manic depressive illness ; and patients who were using contraindication medicine . prior to treatment at the initial study visit , each patient underwent ophthalmic examinations , including bcva measured using a landolt chart , intraocular pressure measurements , vf measured with the humphrey field analyzer ( hfa ; zeiss - humphrey systems , dublin , ca , usa ) 10 - 2 program , slit - lamp biomicroscopy , and dilated indirect fundus ophthalmoscopy . after baseline measurements were obtained , all the patients were instructed to receive oral supplementation of 400 mg ( the lowest dosage used for anticonvulsant therapy ) of vpa ( depakene - r ; kyowa hakko kirin , tokyo , japan ) daily for 6 months . the patients returned to our clinic for follow - up visits and were asked to report on the development of any subjective visual changes as well as any systemic adverse events . bcvas , vfs , and ophthalmic findings were collected throughout the entire study at months 1 , 3 , 6 ( end of supplementation ) , 9 , and 12 . blood samples were collected to check blood counts , clinical biochemistry , and the blood concentration of vpa at months 1 , 2 , 3 , 4 , and 6 ( end of supplementation ) . bcva was converted to the value of logarithm of the minimum angle of resolution ( logmar ) for all analyses . vf test results were summarized using the mean deviation ( md ) value calculated by the hfa provided software . the calculation of the md value involved averaging the differences between the measured sensitivities and the age - adjusted normal sensitivities ( total deviations ) at each test point . although not included as routine tests in our study design , microperimetry-1 ( mp-1 ; nidek , gamagori , japan ) or multifocal erg ( veris ; electro - diagnostic imaging , inc . , redwood , ca , usa and le-4000 ; tomey , nagoya , japan ) were also recorded in some patients at pretreatment and at 6 months or at 6 months and 12 months . the primary end point of this study was improvement in bcva after the 6 months of treatment with vpa , and the secondary end points were vf and the occurrence of adverse events . the variance approximation for the estimation of sample size was obtained from previous studies that have tested a similar hypothesis.4 a sample size calculation was performed before the study , assuming a maximum dropout rate of 30% . accordingly , we assumed that at least 30 patients were going to fail power of 80% ( -1 ) to detect a logmar 0.2 difference in va between patients before and after receiving vpa . all parameters obtained prior to vpa treatment and at 1 month , 3 months , 6 months , 9 months , and 12 months after treatment initiation were compared using the wilcoxon signed - rank test with bonferroni correction . we utilized a bonferroni adjustment for multiple comparisons , after which p - values 0.01 were considered as statistically significant . all statistical analyses were performed using the statistical analysis software ( spss inc . , chicago , il , usa ) . two patients were lost to follow - up after the 6 months visit ; the data for these patients were not included in the analysis . overall , 29 patients ( 12 males and 17 females ) with rp completed the 12 months study period . the patients ages ranged from 30 years to 72 years ( mean sd : 52.511.5 years ) . mendelian inheritance studies disclosed 13 sporadic , eleven autosomal recessive , and five autosomal dominant patterns . the age , sex , mendelian inheritance , bcva , md value of the vf , and mean blood vpa concentration are shown in table 1 . first , we evaluated the changes in the visual function during the vpa administration period ( from baseline to 6 months ) and the cessation period ( from 6 months to 12 months ) . the median changes in the value of log - mar bcva per month were 0.00 ( interquartile range [ iqr ] , 0.180.00 ) during administration and 0.00 ( iqr , 0.000.20 ) during cessation , which showed statistically significant difference ( p=0.001 ; figure 1a ) . the median changes in the md value of vf per month were 0.11 db ( iqr , 0.180.03 ) during administration and 0.48 db ( iqr , 0.170.28 ) during cessation , which also showed statistically significant difference ( p=0.001 ; figure 1b ) . next , we evaluated the shift in va ( logmar ) and vf ( db ) over time ( figure 2 ) . the median logmar bcva values were 0.39 ( iqr , 0.300.69 ) at baseline , 0.39 ( iqr , 0.300.52 ; p=0.08 ) at 1 month , 0.39 ( iqr , 0.300.61 ; p=0.02 ) at 3 months , 0.39 ( iqr , 0.300.52 ; p=0.006 ) at 6 months , 0.39 ( iqr , 0.300.69 ; p=0.14 ) at 9 months , and 0.39 ( iqr , 0.300.76 ; p=0.62 ) at 12 months . compared with baseline , the logmar bcva value was significantly improved at 6 months , during the period of vpa treatment ( figure 2a ) . the median md values of vf were 28.89 db ( iqr , 20.2633.18 ) at baseline , 27.54 db ( iqr , 18.9232.52 ; p=0.001 ) at 1 month , 28.14 db ( iqr , 18.2932.60 ; p=0.004 ) at 3 months , 28.16 db ( iqr,18.5931.96 ; p=0.004 ) at 6 months , 27.97 db ( iqr , 19.5133.11 ; p=0.88 ) at 9 months , and 29.15 db ( iqr , 18.6833.06 ; p=0.97 ) at 12 months . compared with baseline , the median md values of vf were significantly improved at 1 month , 3 months , and 6 months , corresponding to the period of vpa treatment ( figure 2b ) . the mean blood concentration of vpa increased to 43.0416.96 g / ml at 1 month after intake . during the internal use period , the blood concentration of vpa was stable in each patient and the total mean blood concentration value of vpa within 6 months was 39.0012.47 g / ml . as shown in figure 3 , there were no significant relations between the mean blood vpa concentration values of each patient and the changes in bcva ( r=0.06 , p=0.73 ) and vf ( r=0.18 , p=0.33 ) at 6 months . the patients subjective visual symptoms reported during and after vpa treatment are summarized in table 2 . during intake of vpa , eleven of 29 ( 38% ) patients felt no change in their vision , eight ( 28% ) patients felt clearer color vision , four ( 14% ) patients felt legibleness , and four ( 14% ) patients felt brightness . after the cessation of vpa intake , eight ( 28% ) patients reported having blurred vision , four ( 14% ) patients reported seeing dimness , three ( 10% ) patients reported having photophobia , two ( 7% ) patients reported difficulty seeing colors , and one ( 3% ) patient experienced fatigue . although not included in the study design and statistical analysis , we performed mp-1 and multifocal erg tests on some patients , and the preliminary results are shown in the supplementary materials section . some patients gained sensitivity by mp-1 at 6 months after vpa treatment ( figure s1 ) . with multifocal erg , the amplitudes of ( p1-n1 ) in rings 3 and 4 ( perifoveal area)16 were relatively unchanged between the two periods , whereas ( p1-n1 ) amplitudes of ring 1 ( center of the fovea ) seem to increase in some patients after 6 months of treatment , whereas the changes after vpa cessation seem to be insignificant ( figure s2 ) . throughout the study period , no systemic drug - related serious adverse events were observed in the study participants ; checked blood counts from collected blood samples and clinical biochemistry were within normal lesion . during the period of vpa intake , dizziness stomatitis , alopecia , and diarrhea were each reported in one ( 3% ) patient . while several reports showed that oral vpa treatment improved vas and vfs of rp patients , the opposite results were shown in other reports . the results of existing reports in vpa treatment are summarized in table 3 . in the present study of rp patients , the bcva and md values in the hfa 10 - 2 program significantly improved on average after 6 months of vpa intake and returned to the baseline levels after the cessation of the vpa treatment ( figure 2 ) . based on a large cohort study of natural courses of rp , the mean annual rates of decline of remaining bcva and vf were estimated to be 1.0%8.6% and 2.6%13.5% , respectively.17 compared to these data , our results showed some beneficial effect of vpa on rp patients at the 12-month time point even with its confined periodic effect . we can not deny the possibility of placebo effect , but two previous studies using docosahexaenoic acid or 9-cis -carotene had a randomized placebo treatment group without provision of multivitamin , and the placebo group in both of these studies worsened in vf by 1.41.32 db with hfa between years 0 and 4 or by 0.54.5 cm with goldmann perimetry within 90 days.18,19 indeed , we can not make a direct comparison between our results and these past studies , but we think that the vpa effect observed here is worthy of further investigation with a controlled study design in the future . nevertheless , the effect of vpa on bcva observed in our study may not seem to be remarkable as one might expect ( 0.2 log units ) . a large cohort study showing the significant effect to slow the progression of rp by nutritional supplements such as vitamin and docosahexaenoic acid presented its efficacy by vf and erg amplitudes but not by bcva.20,21 altogether , these results indicate that the change in bcva may not be sufficiently sensitive to evaluate the efficacy of a treatment for rp patients . we also performed mp-1 and , more objectively , multifocal ergs on a limited number of patients . although the data collection was performed in the limited number of patients , we observed the increased p1-n1 amplitudes specifically in ring 1 central fovea in some patients after 6 months of vpa treatment . this may imply the effect of vpa on the area of remaining photo - receptors , but the overall amplitudes were very small . we need more data to objectively evaluate the effect of vpa on foveal function . in this study , there were no significant relationship between the mean blood vpa concentrations of each patient and the changes in bcva and vf . first of all , vpa dosage used in this study was relatively low in order to minimize adverse effect of vpa , and the plasma vpa levels in our patients were below the therapeutic range ( 45100 mg / l ) . with this low concentration , albumin binding sites on vpa were unsaturated , and therefore , vpa binds to albumin at variable degrees , making its pharmacological behavior difficult to estimate.2224 if we use the therapeutic range of vpa , it might be able to show clearer effect of vpa on bcva or vf . we also observed a significant improvement in md values of hfa 10 - 2 programs with vpa treatment . in the original report by clemson et al , their studies were based on an in vitro experiment that vpa acts as a molecular chaperone of rhodopsin proteins that increases the yield of properly folded mutant rhodopsins . therefore , these authors suggested a potential effect of vpa on autosomal dominant rp , targeting improperly folded mutant rhodopsins , in rod photoreceptors . our current study included rp patients with seemingly various causal genes with 13 sporadic , eleven autosomal recessive , and five autosomal dominant hereditary patterns . our hfa examination with central 10 - 2 program may also represent cone photoreceptor functions . additionally , close hearing of patient s subjective symptoms also suggested some improvement in cone photoreceptor function : 16 of 29 ( 55% ) patients felt it was easier to see during the period of vpa intake , whereas after cessation , eye discomfort was registered in 18 of 29 ( 62% ) patients and half of the patients made some description related to color vision . stasheff et al25,26 found that after degeneration started , ganglion cells exhibited hyperactivity , firing spontaneously at rates many times greater than normal in rd1 and rd10 mice , strains with closely related rp . because the pharmacological basis of the antiepileptic action of vpa has been related to reduction in neuronal excitability by the increase in gabaergic activity , it is possible that vpa reduced hyperactivity of ganglion cells . kimura et al27 also reported that vpa reduced retinal ganglion cell death in a mouse model of normal tension glaucoma . in this report , they indicated that vpa exerts neuroprotective effects through suppression of oxidative stress and stimulation of cell survival signaling . therefore , patients may have felt that it was easier to see with reduced visual noise from spontaneous firing of ganglion cells or with neuroprotective effects . this phenomenon may also explain why bcva and vf were improved in our study with various types of genetic patterns . however , this hypothesis was based on subjective symptoms of vpa - treated rp patients , and we need further objective evaluation of cone - related functions , including color vision or contrast sensitivity , in vpa - treated patients . vpa has been widely used as an antiepileptic drug for several decades , and the use of vpa monotherapy in the treatment of epilepsy was not associated with vf defects.28,29 however , abnormal color visions in epileptic adolescents treated with vpa were reported.30,31 sisk7 reported three cases with complications of vpa treatment , two of which had severe decrease in bcva ; the two patients were 8 years and 15 years of age and received 10 mg / kg / d of vpa for 45 months . bhalla et al8 reported that 12 ( 39% ) of 31 vpa - treated patients reported systemic side effects , of whom nine ( 29% ) discontinued vpa intake due to side effects . in this study , we did not observe a severe decline in visual functions or systemic adverse events to discontinue vpa treatment . one possible explanation is that our patients were all at the age of 30 years or older and the dosage of vpa was relatively low ( 400 mg / d ) . it is still necessary to carefully observe the patients systemic conditions during vpa treatment and to exercise caution when using vpa for young rp patients . in this prospective study , we found the following : 1 ) while in use , oral intake of vpa was suggestive of a short - term benefit to patients with rp and 2 ) regardless of the genotype , there were no systemic drug - related adverse events . it is necessary to examine the effect of a longer vpa supplementation in a controlled study design . the changes in the retinal sensitivity during the vpa administration period and the cessation period . notes : scatter plots show changes in retinal sensitivity during the vpa administration period ( from baseline to 6 months ; n=24 ) ( a ) and the cessation period ( from 6 months to 12 months ; n=24 ) ( b ) . retinal sensitivities of the central 2 the changes in the ( p1-n1 ) amplitude during the vpa administration period and the cessation period . notes : scatter plots showing changes in retinal sensitivities during the vpa administration period ( from baseline to 6 months ; n=21 ) ( a ) and the cessation period ( from 6 months to 12 months ; n=9 ) ( b ) . multifocal ergs of the central 20 were measured with veris ( electro - diagnostics , inc . , ) and le-4000 ( tomey ) . abbreviations : p1-n1 , first positive wave minus first negative wave ; vpa , valproic acid ; erg , electroretinogram ; deg , degree .

purposethe purpose of this study was to examine the efficacy and safety of valproic acid ( vpa ) use in patients with retinitis pigmentosa ( rp).patients and methodsthis was a prospective , interventional , noncomparative case study . in total , 29 eyes from 29 patients with rp whose best - corrected visual acuities ( bcvas ) in logarithm of the minimum angle of resolution ( logmar ) ranged from 1.0 to 0.16 with visual fields ( vfs ) of 10 ( measured using goldmann perimeter with i4 ) were recruited . the patients received oral supplementation with 400 mg of vpa daily for 6 months and were followed for an additional 6 months . bcvas , vfs ( measured with the humphrey field analyzer central 10 - 2 program ) , and subjective questionnaires were examined before , during , and after the cessation of vpa supplementation.resultsthe changes in bcva and vf showed statistically significant differences during the internal use of vpa , compared with after cessation ( p=0.001 ) . with vpa intake , bcva in logmar significantly improved from baseline to 6 months ( p=0.006 ) . the mean deviation value of the vf significantly improved from baseline to 1 month ( p=0.001 ) , 3 months ( p=0.004 ) , and 6 months ( p=0.004 ) . these efficacies , however , were reversed to the baseline levels after the cessation of vpa intake . there were no significant relations between the mean blood vpa concentrations of each patient and the changes in bcva and vf . during the internal use of vpa , 15 of 29 patients answered easier to see , whereas blurred vision was registered in 21 of 29 patients on cessation . no systemic drug - related adverse events were observed.conclusionwhile in use , oral intake of vpa indicated a short - term benefit to patients with rp . it is necessary to examine the effect of a longer vpa supplementation in a controlled study design .

Introduction Patients and methods Trial registration Ethics Patients Study protocols Determination of sample size Statistical analysis Results Discussion Conclusion Supplementary materials

it is used as a muscle relaxant for spasticity caused by multiple sclerosis , amyotrophic lateral sclerosis ( als ) , spinal injury , and stroke.1 as a muscle relaxant , tizanidine is as effective as baclofen and diazepam.2 the most common side effects of tizanidine treatment include drowsiness , hypotension , dry mouth , muscle weakness , and fatigue.3 its prescription in patients taking antihypertensive medications needs careful consideration.4 it can also cause constipation and liver function test abnormalities.5 cystitis is a less frequently occurring problem with tizanidine , which has been rarely reported . to our knowledge , the first case report of tizanidine - induced hemorrhagic cystitis was published in literature in 2013.6 we discuss here a case of a 26-year - old asian female on famotidine ( h2 antihistaminic ) , who presented with acute severe dysuria after taking the second 2 mg dose of tizanidine . a 26-year - old asian female presented to the emergency room for increased urinary frequency , severe pain , and burning overnight . she was unable to hold urine ; however , she had no abdominal pain , blood in the urine , abnormal or cloudy urine color , strong or foul urine odor , or fever . her menstrual periods had always been regular . she had a 5-year - old healthy child and no history of any obstetric or gynecological problems . she had a pulse rate of 90 beats / minute and blood pressure of 100/60 mmhg . investigations showed hemoglobin of 13.5 g / dl ( normal range : 1216 ) and a total white blood cell count of 6,800/mm ( normal range : 4,00011,000 ) ; urine microscopy test did not reveal any red blood cells or white blood cells . the woman had presented to an outpatient clinic the day before for neck pain and headache ; with a diagnosis of torticollis , she was prescribed tizanidine 2 mg three times a day and acetaminophen 500 mg four times a day . she developed symptoms an hour after the second dose of tizanidine , ie , within 10 hours of initiation of the drug . she had been on famotidine 40 mg once a day for 4 weeks for dyspepsia . there was no history of any allergies or predisposing conditions that could have been responsible for the acute onset of this adverse event . tizanidine treatment was subsequently discontinued and the patient was treated with hydration ; her symptoms gradually improved within 24 hours . after stabilization , the patient was referred for urological consultation and ultrasonography of the urinary tract that failed to show any evidence of the current urinary problems . the naranjo probability scale was used to evaluate the possible causal relationship between tizanidine and the acute urinary symptoms . the scoring obtained by this algorithm was 4 , which indicates a possible causal association between the drug and the adverse reaction . the naranjo probability scale categorizes adverse drug reaction ( adr ) probability based on predefined weighted questions evaluating factors like temporal association of drug use and adr occurrence , previous reports of adr , alternative explanation of the event , drug level , dose response relationship , etc . scoring for naranjo algorithm follows : > 9= definite adr ; 58= probable adr ; 14= possible adr ; 0= doubtful adr.7 acute severe urinary symptoms can be alarming to both the patient and the health care provider , especially in the context of no clearly differentiating etiology . non - infectious cystitis is most common in women of childbearing years , which may be idiopathic ; or associated with bubble baths , feminine hygiene sprays , spermicidal jellies , radiation therapy to the pelvis ; or consumption of certain foods , such as tomatoes , artificial sweeteners , caffeine , chocolate , and alcohol can also cause bladder symptoms.8 tizanidine - induced cystitis is underreported due to challenges in establishing the causality with certainty ; however , according to a key principle of pharmacovigilance , it is better to report even a suspicious case to generate an alarm in the interest of protecting public health.6 in multiple doses , in placebo - controlled studies using tizanidine , the incidence of urinary tract infection was 10% ( 7% in placebo group ) and urinary frequency was 3% ( 2% in placebo group).9 between 2003 and 2012 , the us food and drug administration ( fda ) reported 54 cases of hemorrhagic cystitis related to tizanidine use in the usa.6 why tizanidine causes urinary burning and cystitis is not known . in our case , there was no predisposing factor for the urinary symptoms . however , if we assume these symptoms were a result of tizanidine use , there was concomitant use of famotidine , which could have increased the blood levels of tizanidine by inhibiting the cyp1a2 system , thereby decreasing its metabolism which could accentuate any effects attributable to tizanidine . tizanidine is metabolized in the liver by cyp1a2 , so drug interaction may occur when used with cyp1a2 inhibitors . concomitant use of tizanidine with potent inhibitors of cyp1a2 , fluvoxamine or ciprofloxacin , is contraindicated because of potential serious adverse effects.911 less potent inhibitors of cyp1a2 , eg , zileuton , other fluoroquinolones , antiarrythmics , cimetidine , famotidine , oral contraceptives , acyclovir , and ticlopidine should be used with caution.9 given the very few case reports and the absence of references in the literature , this unique adverse effect of tizanidine needs a better consideration . physicians , pharmacists , and other health care providers should be aware of this possible adverse event during treatment with tizanidine . tizanidine is a centrally acting 2 adrenergic agonist prescribed as a muscle relaxant in various causes of spasticity and pain . while dry mouth , dizziness , hypotension , and fatigue are frequently occurring side effects of the use of tizanidine , it has sometimes been associated with unexplainable symptoms of urinary infection and cystitis . although rarely reported , health care providers and pharmacists should be aware of such possible reactions for better patient care . when etiology and mechanisms are uncertain , there is little opportunity for intervention ; however , we can always help to minimize any drug reactions by closely following general precautions like avoiding drugs with contraindications , eg , the use of tizanidine with cyp1a2 inhibitors .

cystitis is a possible adverse drug reaction associated with the use of tizanidine . such cases have been rarely reported in literature because of the difficulty in establishing the causality . however , from a pharmacovigilance point of view , it is better to report such cases of a possible association between a drug s use and potential adverse drug reactions . we report a case of a 26-year - old asian female on famotidine who presented with acute severe urinary burning after taking tizanidine .

Introduction Case presentation Discussion Conclusion

there is a relative paucity of data on clinical outcomes of elderly patients undergoing contemporary percutaneous coronary interventions ( pcis ) with drug eluting stents ( dess ) . elderly patients have been frequently excluded from randomized clinical trials because of multiple comorbidities making available data on des difficult to generalize to older patients . several reports indicated that older age ( > 65 years old and particularly > 75 years old ) is an independent predictor of adverse events after percutaneous coronary interventions ( pcis ) with higher inhospital vascular complications and cardiac death [ 2 , 3 ] and higher long term cardiac mortality . other reports suggested that older age , after adjusting for various clinical and procedural variables , does not appear to independently predict adverse early or late outcomes after pci [ 5 , 6 ] . the paclitaxel - eluting stent ( pes ) taxus liberte ( boston scientific , natick , ma , usa ) and the everolimus - eluting stent ( ees ) xience ( or promus ) ( abbott laboratories , abbott park , il , usa ) are drug eluting stents ( dess ) that showed lower tvr than bare metal stents ( bmss ) irrespective of age , although higher mortality and myocardial infarction seem to increase with higher age groups . in this report , we examine our own data for differences between younger ( < 65 years ) and older ( 65 years ) patients in target lesion failure ( tlf ) in an unselected consecutive series of patients treated with the ees and pes stents and followed for at least 2 years at our medical center . unselected consecutive patients treated with the pes and ees stents were retrospectively recruited from a single center . patients who received mixed stents during the index procedure or bypass graft treatment were excluded . demographics , clinical , procedural , and angiographic variables are shown in tables 1 and 2 . angiographic variables ( including ejection fraction from left ventriculography ) were obtained by an independent blinded review of the angiograms to patients ' clinical variables and outcomes . followup was completed at 2 years from the index procedure using medical records , phone calls , or both . patients were mailed a brief letter describing the protocol , followed by a phone call to obtain verbal consent to be part of the study . patients who died during the follow - up period had their death certificates retrieved to verify the cause of death . the primary outcome of the study was differences in target lesion failure ( tlf ) defined as cardiac death , nonfatal myocardial infarction related to target vessel and target lesion revascularization ( tlr ) between younger ( < 65 years ) and older patients ( 65 years ) patients . differences in secondary outcomes ( target vessel revascularization ( tvr ) , target vessel failure ( tvf ) , acute stent thrombosis ( st ) as defined by the academic research consortium ( arc ) , nonfatal mi , and cardiac death ) were prespecified as secondary endpoints . t - testing was used for continuous variables and chi - square testing for dichotomous variables . univariate analysis compared the demographic , clinical , angiographic , and outcome variables between males and females . tlf survival analysis ( kaplan - meier ) was performed for both subgroups . logistic regression analysis modeling for age , gender , obesity , diabetes , hypertension , lm lesions , renal insufficiency , number of stents per patient , and stent type was performed . spss ( ibm , ny , usa ) software was used to conduct the analysis . there were more males , smokers , obese patients , and a higher incidence of premature family history of coronary disease in the younger group . the majority of both younger and older patients were still on dual antiplatelet agents on followup . older patients had a nonsignificant trend for more left main and more vessels treated per patient , but otherwise angiographic variables appear to be similar between the 2 groups . there was a high prevalence of treated bifurcating , left main , and ostial disease in both groups . the reasons for the index angiogram are listed in table 3 and appear to be similar in both younger and older patients . the majority of patients were symptomatic with either acute coronary syndromes or chest pain with abnormal functional testing . a smaller percentage similar between the 2 groups had no symptoms and were treated for an abnormal functional test or as part of a staged procedure . despite the complex disease treated , angiographic success , defined as obtaining a residual stenosis of less than 30% , was achieved in all cases . at 2-year followup , the primary endpoint of tlf was 27.7% and 25.5% in both younger and older cohorts , respectively , ( p = 0.711 ) ( table 4 ) with no statistical difference in the secondary endpoints between tvf ( 36.0% versus 32.8% , p = 0.569 ) , tlr ( 24.8% versus 21.4% , p = 0.518 ) , cardiac death ( 3.4% versus 2.5% , p = 0.750 ) , definite and probable stent thrombosis ( 2.0% versus 1.0% ) , and nonfatal myocardial infarction ( 4.0% versus 4.5% , p = 0.475 ) . logistic regression analyses showed that renal failure ( p = 0.045 , odds ratio : 2.552 , 95% confidence interval : 1.021 to 6.381 ) , number of stents per patient ( p = 0.001 ; odds ratio : 1.603 , 95% confidence interval : 1.255 to 2.047 ) and to a lesser extent younger age ( p = 0.010 ; odds ratio : 0.969 , 95% confidence interval : 0.947 to 0.992 ) , but not gender , diabetes , or type of des stent ( ees versus pes ) predicted tlf . several reports indicated that older age is an independent predictor of adverse events after pci with higher inhospital vascular complications and cardiac death [ 2 , 3 ] and higher long term cardiac mortality . feldman et al . reported the outcomes of pci patients in 3 age groups ( < 60 , 6080 , and > 80 years ) from the new state angioplasty registry . older patients had more comorbidities with more extensive coronary disease , hypertension , peripheral vascular disease , and renal insufficiency . in the emergency pci group , there was an age - related incremental increase in inhospital mortality ( 1.0% versus 4.1% versus 11.5% , p < 0.05 ) and major adverse events ( 1.6% versus 5.2% versus 13.1% , p < 0.05 ) . similarly , in those patients presenting for elective pci group , there was also an age - related incremental increase in mortality ( 0.1% versus 0.4% versus 1.1% , p < 0.05 ) , and adverse events ( 0.4% versus 0.7% versus 1.6% , p < 0.05 ) but to a lesser extent than emergency patients . in their series , multivariate analysis demonstrated that age was strongly predictive of inhospital mortality for all pci patients . in addition , assali et al . compared the outcomes of 266 consecutive patients 75 years with 1681 consecutive patients < 75 years of age undergoing nonemergent pci . elderly patients had a higher length of hospital stay , more vascular complications , and bleeding complications . multivariate analysis demonstrated that age 75 years was found to be an independent predictor of inhospital cardiac death ( odds ratio = 3.9 ; 95% ci = 1.311.5 ; p = 0.015 ) . in our reports , cardiac mortality and tlr were not different between younger and older patients at 2-year followup . there was a statistical increase in the odds ratio of tlr for younger patients , although the magnitude of this change was clinically insignificant . et al . reported in 1364 patients undergoing pci and stratified by age . in their cohort , and despite an increase in cardiac mortality in the elderly , the long term adverse events were similar between younger and older patients ( > 75 years ) . similarly , xu et al . reported in 333 patients undergoing pci that there were no differences in restenosis , tlr , stent thrombosis , bleeding , and stroke in younger versus older patients on followup at 7 months . finally , rathore et al . reported no differences in procedural success , inhospital adverse cardiac events , and major adverse events at 1-year between younger ( < 65 years ) and older ( 65 years ) women undergoing pci . in fact , similar to our data , older patients had less likely ischemia - driven revascularization at 1-year followup . although we see a statistical reduction in the odds for tlf in older patients in our cohort , the magnitude of the change is small and likely to be clinically insignificant . although elderly patients are more likely to have a higher cardiac mortality with long term followup , particularly when followup starts at an advanced age ( > 75 years or 80 years of age ) , there is no apparent disadvantage in revascularization of elderly patients compared to younger ones with respect to recurrent revascularization and tlf . this data supports the conclusion that elderly patients need to be given the option of revascularization when feasible with expected tlf similar to the younger population . one of the limitations of this study is its relatively small size and its retrospective design . the difference in tlf rates between the younger and older populations is , however , very small ( 2.2% ) and unlikely to be significant even with a much larger number of patients enrolled . also , bias has been reduced by an unselected cohort of patients , and the data appears consistent with published outcomes in younger versus older patients in the current era of post - pci . finally , we selected 65 years of age ( rather than 75 years ) to be the cutoff limit for defining an older population . whether our data can be extrapolated exclusively to patients over 75 years of age

we evaluate differences in outcomes in younger ( < 65 years ) and older ( 65 years ) patients for target lesion failure ( tlf ) at 2-year follow - up in an unselected consecutive series of patients treated with the everolimus- ( ees ) and paclitaxel - eluting ( pes ) stents at a tertiary medical center . 348 consecutive patients ( younger 150 ; older 198 ) stented with the ees and pes were retrospectively analyzed . the primary endpoint was tlf ( composite endpoint of cardiac death , non fatal myocardial infarction due to index vessel and target lesion revascularization ( tlr ) ) . at 2 years follow up , younger versus older patients had the following outcomes respectively : tlf 27.7% versus 25.5% ( p = 0.71 ) , tlr 24.8% versus 21.4% ( p = 0.52 ) , cardiac death 3.4% versus 2.5% ( p = 0.75 ) and definite and probable stent thrombosis ( 2.0% versus 1.0% ) . multivariate analysis showed that renal failure ( odds ratio : 2.55 , p = 0.045 ) , number of stents per patient ( odds ratio : 1.60 , p = 0.001 ) and younger age ( odds ratio : 0.97 ; p = 0.010 ) , but not gender , diabetes or type of des stent ( ees versus pes ) predicted tlf . we conclude that older age was not a predictor of tlf at 2-year follow - up after adjusting for renal insufficiency , number of stents used per patient , gender , diabetes and type of des used .

1. Introduction 2. Methods 3. Results 4. Discussion

since it was impossible to get samples from all districts of education department of isfahan , 70 primary school teachers , just from the district one were randomly selected . one group underwent a two - day workshop education and the other one ( the study group ) was educated by booklets in non - attendance method . firstly , the subjects were explained about the methodology and the goal of work in an orientation session . then , an educational workshop was held by an assistant professor , a subspecialist of a child and adolescent psychiatry and her fellowship assistant for two days . after filling demographic data forms including age , sex , teaching experience and working experience with adhd students by both groups , a pretest on teachers knowledge , attitude and knowledge of function toward adhd the questionnaire , used in this study , has already been used in a similar study14 . in this study , validity of data collection tool was confirmed by face validity whereas the reliability was obtained by a pilot study conducted on primary school teachers and calculation of cronbach 's alpha.14 face validity of data collection method was done through consulting with experts of child and adolescent psychiatry and content validity was approved after some changes . to measure the reliability of questionnaire , 11 teachers with sufficient standards completed them and by using spss cronbach 's alpha was assigned which was 0.75 for knowledge questionnaires , 0.79 for attitude questionnaires and 0.71 for function questionnaires . the only inclusion criterion in this study was having working experience of over 5 years . exclusion criterion for workshop education group was missing both days of the workshop and for the nonattendance group , was not studying the booklet . the workshop was hold in two days in a row in the consulting center of education department each day 5 for hours . at the ends of workshops , the subjects answered the post - tests of knowledge , attitude and knowledge of function questionnaires . the educational content , on the first day of the workshop , included recognition and definition of adhd , epidemiology , etiology , differential diagnosis , accompanied disorders , prognosis and the treatment . on the second day , it was about unreal beliefs about the disorder , adhd impulse and hyperactivity control , strategies for attention increase in classrooms and schools , the manner of teacher - parents and teacher the second groups were educated by educational booklets in nonattendance method with the precise educational content similar to that of the workshop . the booklet had been prepared through consultation with a child and adolescents subspecialist of psychiatry and had been approved by isfahan behavioral sciences research center . the subjects in this group took part in a post test of knowledge , attitude and knowledge of function ten days after they had studied the booklet . this questionnaire included a questionnaire of demographic data including age , sex , teaching experience , teaching experience with adhd children ; the knowledge questionnaire , a 33-item questionnaire with 3 responses of right , wrong and no idea concerning dsm - iv - tr criteria , epidemiological disorder , etiology , accompanied disorders , differential diagnosis and adhd prognosis . each , agreed , no idea , disagreed and totality disagreed . scoring scale was + 5 for the correct answer and + 1 for the wrong one . never for which each correct answer of always scored + 2 , on average + 1 and each answer of never was coded as zero . in group of workshop , 33 subjects remained in the study and two were left out of the study due to attending just one day to the workshop . in nonattendance group , 34 subjects took part in the study ; one did not take post - test due to being sick . the data were analyzed using spss version 18 and the mean score ( sd ) of variables calculated . then , mean scores of teachers knowledge , attitude and knowledge of function between the two groups were compared using ancova test . among 67 teachers attending the study , the mean age was 41.677.61 years ranging between 25 - 55 years . all subjects were accidentally married and had experience of teaching adhd students . in order to perform co - variance analysis , the normal response variable and the variance between the two groups must be the same . the normal distribution of the variables ( knowledge , attitude , and teacher function ) were approved and the levene 's test showed similar variances of the scores in knowledge , attitude and knowledge of function ( p > 0.05 ) . based on the above table , mean year of education , with regard to calculation of 12 years for a high school diploma , 14 years for an associate degree and 16 years for a bachelor 's degree , was 1410.5 in workshop group and 14.822.5 in nonattendance group . mean year of experience in workshop group was 18.36.5 and in nonattendance group was 19.719.75 . as presented in table 2 , the mean scores of knowledge between the two groups of workshop and nonattendance ( after checking the controlling variable ) was not significantly different after intervention ( p = 0.8 ) which means that the increase in teachers knowledge was nearly the same in workshop and non - attendance group . the mean ( sd ) of demographic characteristics in teachers based on two groups of workshop and nonattendance education . based on the table 2 , the mean scores of attitude showed a significant difference between the two groups ( p < 001 ) which means that in workshop group , the change in teachers attitude after education was more positive compared to that of nonattendance group . finally , as presented in table 2 , mean scores of knowledge of function between the two groups showed a significant difference ( after checking the controlling variable ) ( p = 0.001 ) which means that knowledge of function in workshop group was more promoted after intervention compared to that of non - attendance group . there was no significant association between mean scores of knowledge between the two groups of workshop and nonattendance education . the less knowledge teachers have about adhd , the more destructive behaviors the children may have in the classrooms.15 former studies have shown workshop education to be more effective in increasing teachers knowledge.16 nowadays , e - learning through internet and computers has yielded positive results . in a study ( 2006 ) , conducted on 7 - 14 year old adolescents , on e - education of anxiety management strategies,_it was revealed that this method of education was effective to decrease anxiety.17 in another comparative study on the effect of cognitive behavioral therapy to decrease adolescents anxiety by two methods of attendance and non - attendance education , no significant difference was seen . but , non - attendance method took less time ( 4 sessions ) compared to attendance method ( 12 sessions ) . in regards to the attitude , there was a significant difference between the two groups ( p < 0.05 ) which means that workshop group showed more attitude change than nonattendance group . since , workshop education is counted as an active face to face method18 and with regards to the fact that a change in attitude needs different steps , of which , one is having active education and relationship with learners,19 , this method seems to be a more effective method to change attitude19 compared to nonattendance method . there was a significant difference between knowledge of function mean scores of the two groups ( p < 0.05 ) . it was so that the knowledge of function had been more promoted in the workshop education compared to nonattendance group . although enough knowledge about behavioral strategies is essential to have appropriate knowledge of function , it can not guarantee appropriate practice in real situations . although such tests are not valid enough to measure individuals field function20 , with regard to the measurement of knowledge of function , it seems in workshop group , compared to nonattendance group , the problems are better solved due to discussing teachers problems in details and getting an answer of face to face.18 nonattendance education has been effective to increase teachers knowledge in dealing with adhd as much as workshop education , but workshop education seems better for an attitude change and increase of knowledge of function compared to nonattendance education . this short term study was conducted on primary school teachers in district one education department in isfahan , which can be counted as a limitation . further long term studies are suggested to be conducted with a higher number of samples and in all districts of education department in the city with post - tests taken in the 3 and 6 month post - intervention in order to check the retention of teachers knowledge and its application in the classrooms . the quality of the workshop affects the results , and it could be considered as a limitation of study . another limitation for this study was preparation of a primary booklet with an applicable content for primary school teachers who had lots of experience in facing with this sort of students in classrooms . ns and mk carried out the design and coordinated the sessions of teachers , collected data and prepared the manuscript .

background : attention deficit hyperactivity disorder ( adhd ) is the most common childhood behavioral disorder causing hyperactivity , attention deficit and education decline among students . the teachers may not have enough knowledge about this disorder and are in a real need in this field . teachers education is one of the ways to get knowledge about this disorder . nowadays , finding a way like a short term nonattendance education method is highly in demand . therefore , the aim of the study was to compare effectiveness of nonattendance and workshop education of primary school teachers on their knowledge , attitude , and function towards adhd students.methods:sixty seven primary school teachers from the first districts of education department of isfahan were randomly selected and put into two groups of workshop education ( 33 participants ) and nonattendance education ( 34 participants ) . at first , both groups filled demographic date questionnaires and then , were given a pretest . post tests were given after a two day education in workshop group and after ten days in nonattendance group who had studied the related booklet . finally , the mean post test scores of knowledge , attitude and knowledge of function were compared between the two groups using ancova analysis.results:after intervention , the mean scores of knowledge between the two groups was not significantly different whereas the mean scores of attitude and the mean scores of knowledge of function showed a significant difference between the two groups.conclusions:nonattendance education was as effective as workshop education in promotion of teachers knowledge , but workshop education was more effective in attitude change and promotion of teachers knowledge of function about dealing with adhd students .

Methods Results Discussion Conclusion Limitations Authors Contributions

parkinson 's disease ( pd ) is the second common neurodegenerative disease in the world , after alzheimer 's disease ( 1 ) . it is caused by gradual death of many neuronal systems specially dopaminergic neurons in substantia nigra pars compacta ( 24 ) . the most important risk factor of pd is age ( 5 , 6 ) . by increasing of age , pd results in hypokinetic dysarthria that affects all aspects of speech such as respiration , phonation , articulation and prosody ( 7 , 8) . nearly 90% of patients have oral communication disorders ( 9 ) but voice is affected more and sooner than other speech subsystems ( 1012 ) . one third of parkinson patients suffer from dysphonia and they present breathy and harsh voice as their most debilitating deficit ( 13 ) . voice disorders consist of several different aspects , therefore several measurements and scales should be used ( 14 ) . clinical evaluation of voice includes perceptual , acoustic , ( video ) laryngosteroboscopic and aerodynamic assessments ( 1416 ) that are very useful in clinical evaluation of neurological disorders ( 15 , 17 ) . neither voice objective scales such as video/ auditory nor perceptual assessment can evaluate the amount of handicap that a patient experiences as a result of voice disorder . patient - based measurements can add some necessary supplementary information to biological and physiological data that are associated with voice disorder ( 17 , 18 ) . voice handicap index ( vhi ) is a common questionnaire used in a wide range of voice disorders and it is the most applicable subjective self - rating questionnaire in patients who have perceived voice disability . it shows the effect of disabilities resulting from voice handicap on quality of life ( qol ) ( 15 , 16 ) . vhi is a perceptual analysis tool of voice quality that shows us the influence of voice problems and their treatments on patients qol ( 19 ) . like other neurodegenerative disorders the unified parkinson 's disease rating scale(updrs ) is the most common tool for clinical evaluation of pd ( 2 ) and measures motor and some of non - motor symptoms of pd . the 3rd part of the test ( updrs - iii ) evaluates all fundamental motor characteristics of pd ( 22 ) . in present research , movement disorder society ( mds - updrs ) version of the test has been used . hoehn and yahr ( h&y ) is another scale for pd 's severity that rates between 0 - 5 based on the level of clinical disabilities ( 23 ) . there is no study about vhi in iranian pd 's patients ; and therefore no research about any relation between pd 's motor disabilities and voice disorder . due to increase in iranian aged population in future decades , pd prevalence will increase as well ( 24 ) , and necessity of these kinds of studies are obvious . several studies express vhi progression in pd and suggest the effective role of vhi in determination of voice disorder influence on pd 's quality of life ( 2527 ) . the only research about relation between movement disabilities and vhi in pd under pharmacologic therapy is a study by midi et al ( 28 ) . it hasn't found any correlation between vhi and disease severity ( updrs - iii ) . frost et al ( 25 ) did not find any relation between vhi and updrs in patients under surgical therapy ( deep - brain stimulation of the subthalamic nucleus /stn - dbs ) . the purpose of this study is to examine correlations between disease severity and handicap due to voice disorder ; and whether the vhi score increases with the increase of disease severity , and also the relation between vhi domains ( physical , functional , emotional ) and disease severity . some objective and subjective studies in pd have been reported several different items by sex ( 2931 ) and some findings have suggested that certain speech characteristics are different in male and females ( 3237 ) . hence the role of sex and probable differences ( in pd voice handicap index ) based on sexuality was another purpose of this study . this cross - sectional , analytical and non - interventional study was carried out on 23 pd patients who were chosen from attendants of movement disorders clinic of rasool akram hospital , from january until june of 2011 . tehran university of medical sciences ethics committee approved the study and all of patients signed the consent form . their demographic characteristics ( table 1 ) and drug information were recorded . n - methyl - d - aspartate ( nmda ) antagonists , dopamine agonist , benzodiazpines and selective serotonin reuptake inhibitors ( ssris ) have been among most used medications by patients . patients pharmacotherapy , at least in recent year was under supervision of a movement disorders specialist ( shahidi ) . to avoid scoring bias , another neurologist expert in updrs scoring , participated in this research ( karkheiran ) . for patient selection , u.k parkinson 's disease society brain bank 's clinical criteria utilized in diagnosis of probable parkinson 's disease have been used . exclusion criteria were : suffering from another neurological or movement disorders , ages younger than 50 years , levodopa therapy under 3 month , disease onset less than 5 years ( for differential diagnosis of pd from other parkinsonism disorders ) ( 38 ) and have speech therapy . basic characteristics of patients with parkinson 's disease . h&y : hoehn and yahr scale , updrs : unified parkinson 's disease rating scale implementation of tests was done in speech therapy department of tehran university of medical sciences . all of participants have been examined 45 - 90 minutes after taking the drugs so they were in the on state . at first , patients were evaluated according to updrs - iii ( karkheiran ) , then 5 - 10 minutes after finishing updrs test , patients answered vhi questionnaire . a speech and language pathologist was beside patients for any guide or help . to avoid fatigue and psychiatric symptoms of pd , vhi questionnaire updrs - iii consist of 18 cardinal items and according to likert rating scale , the total score is between 0 - 132 . since the first item of updrs - iii is speech which is so important , final scores were obtained via recording every stage of this test and matching all items with the educational film was published by movement disorder society . after filling vhi questionnaire by patients , its total score and 3 related domains ( physical , functional , and emotional ) means , standard deviation ( sd ) and p - values of vhi and 3 domains scores vhi : voice handicap index , vhi - p : vhi physical , vhi - f : vhi functional , vhi - e : vhi emotional the spss 18.0.0 software package was used for statistical analysis . pearson and spearman correlation coefficient was used to examine the relation between total score of updrs , its 18 items , vhi total score and its 3 related domains . 2 ( for sex equality ) and independent sample t- test ( for compare variables means between males and females ) were used with the confidence interval of 95% ( p < 0.05 ) . updrs - iii consist of 18 cardinal items and according to likert rating scale , the total score is between 0 - 132 . since the first item of updrs - iii is speech which is so important , final scores were obtained via recording every stage of this test and matching all items with the educational film was published by movement disorder society . after filling vhi questionnaire by patients , its total score and 3 related domains ( physical , functional , and emotional ) were computed separately ( table 2 ) . means , standard deviation ( sd ) and p - values of vhi and 3 domains scores vhi : voice handicap index , vhi - p : vhi physical , vhi - f : vhi functional , vhi - e : vhi emotional the spss 18.0.0 software package was used for statistical analysis . kolmogorov smirnov test used to determine variables normality . pearson and spearman correlation coefficient was used to examine the relation between total score of updrs , its 18 items , vhi total score and its 3 related domains . 2 ( for sex equality ) and independent sample t- test ( for compare variables means between males and females ) were used with the confidence interval of 95% ( p < 0.05 ) . this study was done on 23 pd patients reported voice disorder due to their disease . the relationship between disease severity ( according to h&y and updrs - iii ) and vhi questionnaire ( and its 3 domains ) was investigated . minimum and maximum scores of updrs - iii and h&y were 11 - 69 and 2 - 3 . mean vhi scores ( total and all of 3 domains ) of males were higher than females ( table 2 ) , however significant difference was not observed ( table 2 , p - values ) . based on h&y ( r = 0.260 ) , a positive correlation was found between total vhi ( vhi - t ) score and disease severity , according to updrs - iii ( r = 0.485 ) . however , no relation was observed between these two variables in males and females ( table 3 ) . there was not any relationship between vhi domains scores ( physical , functional , emotional ) and h&y scale , in all of patients and by sex segregation . there were positive correlations between vhi physical and functional scores ; and updrs - iii in all participants ( rp=0.530 , rf = 0.479 ) but no sex - related correlation was present . correlation between vhi ( and domains ) , disease severity , disease duration , speech ( item of updrs ) vhi - t : vhi total , vhi - p : vhi physical , vhi - f : vhi functional , vhi - e : vhi emotional : correlation is significant at the 0.05 level ( 2-tailed ) : correlation is significant at the 0.01 level ( 2-tailed ) in present study the relationship between updrs - iii subscales ( 18 items represented patient motor performance ) and vhi score ( total and 3 domains ) was investigated . the aim of this activity was to evaluate possible relations between motor disabilities , especially speech ( table 3 ) recorded by sex and vhi in all patients and in both sexes separately . 9 updrs - iii items had correlation with vhi - t scores and its 3 domains ( table 4 ) . the vhi - t scores ( r = 0.612 ) and domains had a positive relation with speech item . in males group , vhi - t scores ( r = 0.628 ) , functional and emotional domains had correlation with speech item ( rf=0.632 , re = 0.706 ) but in females just functional domain showed significant relation with speech item ( r = 0.716 ) . significant correlation between vhi ( and domains ) and motor examination factors of updrs - iii vhi - p : vhi physical , vhi - f : vhi functional , vhi - e : vhi emotional , vhi - t : vhi total correlation is significant at the 0.05 level ( 2-tailed ) there was no correlation between vhi - t score and duration of disease in patients(r = 0.342 ) ( table 3 ) but vhi - t had a correlation with disease duration in male sub group ( r = 0.613 ) . based on h&y ( r = 0.260 ) , there was not any relationship between vhi score and disease severity . a positive correlation was found between total vhi ( vhi - t ) score and disease severity , according to updrs - iii ( r = 0.485 ) . however , no relation was observed between these two variables in males and females ( table 3 ) . there was not any relationship between vhi domains scores ( physical , functional , emotional ) and h&y scale , in all of patients and by sex segregation . there were positive correlations between vhi physical and functional scores ; and updrs - iii in all participants ( rp=0.530 , rf = 0.479 ) but no sex - related correlation was present . correlation between vhi ( and domains ) , disease severity , disease duration , speech ( item of updrs ) vhi - t : vhi total , vhi - p : vhi physical , vhi - f : vhi functional , vhi - e : vhi emotional : correlation is significant at the 0.05 level ( 2-tailed ) : correlation is significant at the 0.01 level ( 2-tailed ) in present study the relationship between updrs - iii subscales ( 18 items represented patient motor performance ) and vhi score ( total and 3 domains ) was investigated . the aim of this activity was to evaluate possible relations between motor disabilities , especially speech ( table 3 ) recorded by sex and vhi in all patients and in both sexes separately . 9 updrs - iii items had correlation with vhi - t scores and its 3 domains ( table 4 ) . the vhi - t scores ( r = 0.612 ) and domains had a positive relation with vhi - t scores ( r = 0.628 ) , functional and emotional domains had correlation with speech item ( rf=0.632 , re = 0.706 ) but in females just functional domain showed significant relation with speech item ( r = 0.716 ) . significant correlation between vhi ( and domains ) and motor examination factors of updrs - iii vhi - p : vhi physical , vhi - f : vhi functional , vhi - e : vhi emotional , vhi - t : vhi total correlation is significant at the 0.05 level ( 2-tailed ) there was no correlation between vhi - t score and duration of disease in patients(r = 0.342 ) ( table 3 ) but vhi - t had a correlation with disease duration in male sub group ( r = 0.613 ) . pd is a movement disorder that causes hypokinetic dysarthria and affects all of speech aspects including voice . although the males group was reported more voice handicap ( resulted from pd ) than females , but no statistical difference was found between two groups , similar to other research ( 39 ) . it is known that increases in movement disorder severity affect the speech subsystems like voice . the vhi - t cut off point in iranian patients suffering from voice disorders was 14.5 ( 40 ) ; in this research , the mean vhi_t was 38.22 which suggested that pd patients qol ( based on voice handicap ) were out of normal range . the positive correlation between vhi_t , physical and functional scores and disease severity ( updrs - iii ) imply that patient 's perception of handicap resulted from voice disorder gets worse with increasing of disease severity . midi ( 28 ) did not find any relation between updrs and vhi - t . that is why the participants in his study were in their first 5 years of disease and therefore , their motor impairment severity was mild . but , in present study , minimum duration of disease was 5 years and severity range included mild to severe ( updrs 11 - 69 ) . not finding a relation between vhi - t and disease severity ( h&y ) may be due to lower h&y sensitivity and accuracy rather than updrs . speech item ( first updrs item ) has strong relation with vhi scores ( table 4 ) . this finding shows patient perception of voice situation is consistent with clinical scores determined by neurologist ( by motor assessment ) . the interesting issue is the positive correlation between 9 items of updrs and vhi ( total and subscales scores ) . in previous conducted studies ( 41 ) , this may suggest an accurate and important patient viewpoint about voice disorder and its handicap . " signs " are observable and testable voice characteristics but symptoms are the patient reports and complaints about voice problem ( 23 ) . patient based voice evaluation , like vhi , can help us to diagnosis and treatment of voice disorder . even though it was expected that the increase of vhi would be correlated with the disease duration , such result were not observed . there was a strong correlation between vhi - t , functional & emotional scores and duration of pd in males . a larger sample size may help to find these relations in females and all patients as a group . iranian pd patients feel handicap due to voice disorder caused by pd and their quality of life was affected by voice impairment . voice assessment , especially patient - based voice evaluation such as vhi , is an important offered issue used in pd beside other assessments .

backgroundone third of patients with parkinson 's disease ( pd ) have mentioned dysphonia as their most debilitating communication deficit . patient - based measurements , such as voice handicap index ( vhi ) add necessary supplementary information to clinical and physiological assessment . there are a few studies about relation between vhi and disease severity in pd , although none of them showed any significant correlation . the goal of this study was to find correlation between these variables in iranian pd patients.methodthis cross - sectional , analytical and non - interventional study was done on 23 pd patients who reported a voice disorder related to their disease . they were selected from attendants of movement disorders clinic of hazrat rasool akram hospital . the relationship between disease severity ( according to hoehn and yahr / h&y and unified parkinson 's disease rating scale - part3 /updrs - iii ) and vhi questionnaire ( and its 3 domains ) was investigated based on patients sex , updrs - iii score h&y and vhi.resultstotal vhi and its 3 domains had no relationship with disease severity ( h&y ) in all patients and by sex separation . however , there was a positive correlation between vhi and disease severity ( updrs - iii ) ( r = 0.485 ) . there was also a relation between physical and functional domains of vhi and updrs ( rp=0.530 , rf=0.479 ) while no relationship observed regarding sex differences . 9 out of 18 updrs - iii items had strong relationship with vhi ( total and 3subscales).conclusioniranian pd patients feel handicap according to voice disorder caused by pd . patient satisfaction of voice decreases with the disease severity and progression . a larger sample size is necessary to find relationship in genders . vhi is an important issue could be offered to be used in pd beside other assessments

Introduction Methods Disease severity Voice Handicap Index Statistical analysis Results Relation between VHI and disease severity Relation between VHI and motor dysfunction Relation between VHI and disease duration Discussion Conclusion

atmospheric aerosol particles influence the global climate through their two - fold impact on earth s radiative balance . they scatter incoming solar radiation directly , but they also affect the climate indirectly by acting as condensation nuclei for cloud droplets ( ccn ) , therefore affecting the radiative properties and lifetime of clouds . the ccn grow to become cloud droplets by condensation of water vapor , and this growth is controlled by the ability of the droplets to uptake the condensing water vapor molecules . therefore an understanding of the underlying condensational growth process is necessary to achieve correct concentrations of cloud droplets in climate models . the key quantity controlling the growth of submicrometer aerosol particles is the mass accommodation coefficient m , which is defined as the fraction of vapor molecules hitting the particle surface that will be accommodated by the condensed phase . the mass accommodation of water molecules on water surfaces has been extensively studied both experimentally and with molecular dynamics ( md ) simulations . however , the value of m reported by different experimental studies has varied in the range 0.011 . a recent sensitivity analysis of results measured by a number of ensemble and single particle techniques has suggested that the values of the mass accommodation coefficients retrieved from these studies are consistent with a value larger than 0.5 . the wide range of experimental values is contrasted by md simulations which have consistently resulted in a unity mass accommodation coefficient for water . part of the difficulty in determining the mass accommodation coefficient is linked to the fact that the coefficient can be defined in different ways . while the definition given above seems simple , the mass accommodation coefficient can be understood in at least two ways : either as surface accommodation where all molecules that are not directly scattered are considered to be accommodated or as bulk accommodation where mass accommodation is defined as the fraction of the molecules arriving at the surface that are absorbed to the bulk . the experimental results on mass accommodation and evaporation are usually interpreted with the aid of various condensation models . these models are generally based on a combination of the kinetic gas theory and macroscopic mass and heat transfer theories . in this work we compare md simulations to these kinetic condensation models to shed light on how compatible the two approaches actually are for the accommodation of water molecules onto water surfaces . one of the key complications in the interpretation of the laboratory experiments is that they always probe net condensation or evaporation processes , thus requiring quantification of simultaneous evaporation and condensation processes . md simulations , on the other hand , provide a means to study these two processes separately , and at constant temperature . basic kinetic condensation models estimate the condensational flux from the kinetic theory of gases , correcting for diffusional effects in the gas phase , where needed . the description considers the flux as occurring directly between the gas and condensed phases ( see figure 1 ) without any specific consideration of the processes occurring in the surface region . the condensational flux consists of molecules arriving at the surface from a distance that is of the order of the molecular mean free path . in these kinetic models the mass accommodation coefficient is present as the condensation coefficient , multiplying the maximum kinetic collision rate to the liquid surface . based on the equality of the net condensation and evaporation fluxes in equilibrium , the condensation coefficient is typically considered to be equal to the evaporation coefficient . as a next step from these simple theoretical considerations , more sophisticated models which also explicitly include the surface processes have been presented . developed a new kinetic multilayer model for gas particle interactions in aerosols and clouds ( km - gap ) . in km - gap the aerosol gas system is divided into several layers ( figure 1 ) , with corresponding fluxes between each layer . the mass accommodation coefficient is present as separately defined surface and bulk accommodation coefficients that appear as parameters of the model . md simulations provide a means to investigate these descriptions of the condensation / evaporation process on a molecular basis ( figure 1 ) . schematic figure illustrating the different levels of theory from kinetic condensation models through km - gap to md . the adsorption flux in km - gap ( jads ) is equivalent with the condensation flux of the general kinetic condensation model , and the km - gap desorption flux ( jdes ) is equivalent with the evaporation flux . md simulations provide a straightforward way to determine m , as the trajectories of individual molecules can be followed throughout a simulation and the fraction of accommodated molecules can be simply evaluated . the md mass accommodation simulations consist of shooting individual gas phase molecules toward a surface and determining the subsequent fate of those molecules ( see section 2.4 ) . to our knowledge , so far in pure water mass accommodation md the surface in question has always been a planar surface . at typical atmospheric conditions , however , only the growth of the smallest nanodroplets ( of submicrometer size ) are in fact sensitive to mass accommodation processes . droplets in the few - nanometers range are accessible for present - day md , and the surface curvature could have an effect on the mass accommodation process , being especially important for small atmospheric droplets . we study the potential effect of surface curvature by conducting md simulations on the accommodation of water on nanodroplets and comparing the results to similar simulations for a planar surface . a further complication related to a md mass accommodation coefficient , and in fact to a molecular level m in general , is the fact that a fraction of the evaporating molecules observed during the mass accommodation simulations can be due to the incoming molecules inducing an exchange evaporation of a surface molecule . if this phenomenon has a nonnegligible effect , the assumed equality of the condensation and evaporation coefficients may not hold . while the exchange evaporation cases should also be considered as nonaccommodation , lacking any clear temporal and spatial definition on when the evaporation is induced by the incoming molecules , it is impossible to assign an individual evaporation event to either exchange or thermal evaporation . however , the thermal evaporation rate is independent of the properties of the surrounding vapor phase , and it can be determined by simulating evaporation from the liquid into a vacuum . we compare the evaporative flux into a full vacuum with that of a mass accommodation simulation to yield estimates on what fraction of the evaporated molecules should be counted as exchange evaporation and thus inducing a feedback between the condensation and evaporation processes . the md simulations were performed using the gromacs molecular dynamics software . the tip4p - ew water potential was used . the simulation time step was 1 fs , the temperature was controlled through the bussi thermostat , and particle - mesh ewald summation was used for the long - range part of the coulombic interactions . the initial configurations consisted of either a liquid slab with the surfaces in the xy - plane and the simulation box elongated in the z - direction , or a liquid droplet located at the center of the simulation box . the various simulation configurations are collected in table 1 . for each initial condition a total of 1000 incident molecules were generated at 10 ps intervals at a distance of about 1.5 nm from the target surface and were assigned velocities from the maxwell boltzmann velocity distribution corresponding to the temperature in question . for the planar cases , the incident molecules were introduced at alternating sides of the slab at random x , y - coordinates and the center of mass velocity of the molecule was set toward the center of the surface . consequently , the procedure results in a variety of incident angles and orientations . for the droplet cases , the incident molecules were placed at randomly selected locations around the droplet and the initial velocity was set toward the center of mass of the droplet . after the generation of the tenth incident molecule the simulation was continued for a further 20 ps before the simulation was terminated and a new mass accommodation simulation was started with a fresh starting configuration . the total simulation time for a single condition was thus 11 ns , the setup following the steps of morita et al . the necessity of restarts becomes especially clear in the case of the droplet simulations , as the droplet radius needs to be constant . the number of molecules denotes the molecules in the target bulk liquid at the start of the simulation . we have also performed simulations without the impacting molecules present , that is , simulations where the system only consists of the slab or droplet , in order to study the evaporation from the surface without incoming gas phase molecules affecting the situation . this is not a true vacuum case as the evaporated molecules are allowed to travel across the periodic boundary of the simulation box and , thus , eventually return to the liquid . however , the resulting evaporation flux should represent a reasonable approximation of the evaporation flux to a true vacuum when considering the small amount of evaporating molecules in the studied temperature range . these runs were performed for 20 ns of simulation time for all conditions used in the mass accommodation simulation except for the larger droplet , which is omitted because of the relatively high computational cost of a 10 000 water molecule system . the kinetic gas theory can be used for modeling the net condensation / evaporation to / from an aerosol particle if the knudsen number kn , which is the ratio between the mean free path of the vapor molecules and the particle radius rp , is considerably larger than 1 . in this free molecular regime , the net condensational mass flux ( in molecules per second ) to a droplet with surface area a ( m ) is thus given by1where v is the average thermal velocity of a molecule ( m / s ) , c is the gas phase density ( 1/m ) far from the droplet ( about one mean free path away and further ) , and ca is the gas density at the droplet surface . the here is the condensation coefficient , which is equal to the evaporation coefficient in an equilibrium case . this equality is usually assumed to hold in general , thus yielding the form of eq 1 , where the first term refers to the forward condensation flux to the particle and the second term refers to the evaporation from it . the condensation coefficient can also be called the mass accommodation coefficient , as it is by definition the ratio of the actual condensational mass flux and the collision flux . at this level of theory ( see figure 1 ) , it is not possible to address whether the condensation coefficient requires that the colliding molecule should end up in the bulk or merely stick to the surface as the surface is not treated explicitly . based on the collision flux and the requirement for the net flux between the gas and liquid phases to be zero at equilibrium , the evaporative flux from a surface with an area a is given by2where pe is the equilibrium vapor pressure ( pa ) , k is the boltzmann constant ( j / k ) , and t is the temperature ( k ) . equation 2 is derived from considering an equilibrium situation between the condensed and vapor phases , but as the thermal evaporation rate is a property of only the condensed phase , the equation is usually assumed to be valid regardless of the vapor conditions above the surface . as mentioned above , the free molecular regime equations hold if kn 1 , while as the knudsen number approaches unity and diminishes to values considerably less than 1 , the flux expressions need to be corrected for gas phase diffusional effects . this is done in practice by multiplying the free molecular regime flux by a correction factor , yielding a general flux expression of the form3one of the most widely used transition regime correction factors was derived by fuchs and sutugin , and is given by ( see , e.g. , ref ( 7))4this factor follows from a fit to a numerical solution to the boltzmann equation for a condition where the diffusing species is lighter than the background gas . figure 2a illustrates the kinetic collision flux density , that is jcond , kin / a with = 1 , as a function of water vapor pressure . for the four different temperatures used in this study ( 268 , 273.15 , 290 , and 300 k ) the lines lie practically on top of each other , so for clarity only the line corresponding to the lowest temperature is included . the dashed lines show the flux densities corresponding to the conditions in our mass accommodation simulations , with the squares highlighting the corresponding pressures . as can be seen , the generation of incident molecules every 10 ps effectively corresponds to a range of very high supersaturations of 10200 . figure 2b shows the mean free path of water molecules as a function of pressure . again , the lines corresponding to the three highest temperatures are omitted for clarity . the circles denote the equilibrium vapor pressures at our model temperatures , while the squares indicate the mean free paths corresponding to the effective pressure created by the incident molecules . as can be seen , even with the relatively high supersaturations represented by these simulations the mean free paths are orders of magnitude longer than the 1.5 nm distance from where the incident molecules begin their trajectory to the surface . the corresponding knudsen numbers for our simulated conditions are thus on the order of about 30 to a few hundred , thus justifying the use of the free molecular regime condensation equations for our comparisons . in general , there are two possible approaches to set up the mass accommodation md simulations : the one employed here ( and in , e.g. , ref ( 18 ) ) where several molecules are generated before restarting , or restarting for every incident molecule ( e.g. , ref ( 21 ) ) . because of computational limitations , both necessarily represent a high ratio of collisions / simulation time and thus correspond to high supersaturations . in the latter case , however , the surface is refreshed and is thus not subject to continuous bombardment . ( a , top ) molecular flux density as a function of vapor pressure at t = 268 k. other temperatures used in this work are omitted as they result in overlapping lines . circles correspond again to the equilibrium vapor pressures at the various temperatures , while the squares correspond to the md simulation conditions . while the kinetic condensation models assume that the molecules arriving at the surface originate on average from the distance of the mean free path , creating the incident molecules in md closer to the surface does not hamper the determination of the mass accommodation coefficient in any way ; for this purpose only the fate of the molecules at the surface is needed , not the long journey beforehand . the km - gap model is based on the kinetic model framework of pschl , rudich , and ammann and treats explicitly the steps of mass transfer from gas to condensed phase including gas diffusion , surface bulk exchange , and bulk diffusion of water molecules ( see figure 1 ) . the model divides the gas phase and the bulk condensed phase into a number of layers , and the surface is described by two layers : the quasistatic surface layer and the sorption layer . the flux between the aerosol and the gas phase occur only between the sorption layer and the near - surface gas phase . compared to the simplified picture of section 2.2 ( figure 1 , left ) , where mass transfer is only described by the condensation and evaporation fluxes between the condensed and gas phases , km - gap adds a comprehensive set of additional fluxes to the picture with an additional pair of fluxes describing the transport between each layer ( figure 1 ) . the transport from the near - surface gas phase to the first ( near - surface ) bulk layer is not only controlled by the condensational flux to the sorption layer , but also by the transport between the sorption and quasi - static surface layers and between the quasi - static surface layer and the near - surface bulk . determining the condensational flux to the surface in km - gap follows from the collision flux in the same way as for the simple kinetic models , and for gas molecules of a given species the collision flux is given by5where cgs is the near - surface gas phase concentration of the species in question . uptake of the gas molecules will cause a depletion in the near - surface gas phase , establishing a concentration gradient in the gas phase , and thus uptake will be influenced by gas phase diffusion . this is addressed by adjusting the concentration with a diffusion correction factor bg = cgs / cg . following the fuchs and sutugin transition regime correction , the correction factor is given by6where kn is the knudsen number and is the uptake coefficient , defined as the ratio of the net flux between the gas and the condensed phases ( as defined by eq 1 ) and the collision flux . finally , the adsorption flux ( corresponding to the condensation flux in eq 1 ) in km - gap can be written as7where s is the surface accommodation coefficient . the surface accommodation coefficient in eq 7 is formally identical to the definition of the condensation coefficient given in section 2.2 . km - gap also provides a bulk accommodation coefficient b as an output parameter which describes the probability of a gas phase molecule entering the bulk . however , as outlined above , b does not enter the equations arising from gas phase kinetics in the km - gap treatment . unlike the kinetic models where the mass accommodation coefficient appears in equations concerning mass fluxes , in md the coefficient the possible fates of gas phase molecules arriving at the surface can be roughly divided into four outcomes , which are scattering , desorption , adsorption , and absorption . both scattered and desorbed molecules return to the gas phase , the difference being that desorbed molecules spend some time on the surface before doing so . adsorbed and absorbed molecules remain in the liquid , with absorbed molecules ending up in the bulk liquid and adsorbed molecules on the surface . there are a few ways in which the mass accommodation coefficient can be defined with this classification . it is clear that the scattered molecules can not be considered accommodated in any definition . lacking any definite criteria on the time an incoming molecule has to stay on the surface , the definition for a surface accommodation coefficient is8this definition is in agreement with the surface accommodation coefficient as it appears in km - gap . however , if the mass accommodation coefficient is understood as the fraction of incoming molecules that are absorbed into the bulk liquid , we might use the formula9where the correction factor pk is10 this correction factor is introduced because the limited simulation time prevents following the trajectories of the adsorbed molecules until they are either absorbed or desorbed . in the case for water , both in our present work and in for example ref ( 19 ) , no occurrences of desorption of the incoming molecules is observed . this makes the two definitions presented above identical over the time scales of our md simulations . from the classification above it is clear that these definitions consider only the fate of incoming molecules , and the possible exchange evaporation , that is , the evaporation of a surface molecule induced by an incoming molecule , is not taken into account . however , from the point of view of the mass fluxes to and from the surface , it is irrelevant if the outgoing molecule is the same as the incoming one . in principle the exchange evaporation could be taken into account in the above definitions by assigning to this new category what would otherwise be classified as absorption or adsorption , but the problem remains that these events would need to be distinguished from thermal evaporation governed by eq 2 . indeed , even performing a separate set of evaporation simulations to observe differences in the evaporation rate provides only an idea of the magnitude of this effect , not a way to classify individual evaporation occurrences . the md simulated evaporation rates for the planar surfaces are plotted as a function of temperature in figure 3 for both the evaporation and mass accommodation simulations . for comparison , figure 3 shows the theoretical prediction given by eq 2 , with the equilibrium vapor pressures based on the simulated values for tip4p - ew water reported by vega et al . while vega et al . report values for pe down to 245.5 k , their reported fit for pe with the form ln(p ) = a + b/(t + c ) is for temperatures above 300 k. we have therefore for our purposes fitted the lower temperature end ( < 400 k ) of their simulated pressures using the same functional form . the value for the mass accommodation , or evaporation , coefficient in eq 2 is set to 1 . figure 4 shows the evaporation rates for different droplet sizes at t = 273.15 k. the droplet radii given , 1.92 and 4.14 nm for the 1000 and 10 000 molecule droplets respectively , are the equimolar radii of the droplets . for equilibrium vapor pressures above a curved surface , the kelvin effect must be accounted for , which requires knowledge of the liquid density and surface tension . we have used the recent values given by sakamaki et al . at 273 k for the tip4p - ew model . for convenience these values are also listed in table 2 . evaporation rate as a function of droplet size at t = 273.15 k. equilibrium vapor pressures pe from our fit to data from ref ( 34 ) ( see text ) , and surface tension and liquid density l from ref ( 35 ) . for comparison , figure 3 shows also the prediction of eq 2 when the equilibrium vapor pressure of real water is used . it should be stressed that for a meaningful comparison between simulated rates and the prediction of eq 2 one must look at the points obtained using the simulated pe , not the experimental one . in order to get an error estimate from the md simulations , we note that the evaporation process is a poisson process , and we calculate the 1 error for the observed number of evaporation events during the total simulation time . if there is exchange evaporation taking place within the mass accommodation simulations , the observed evaporation is a combination of two processes and this error treatment is too simplified . the error bars shown are nonetheless found by treating both simulation sets in the same manner , since this will help clarify whether the differences seen could just be a product of the shorter simulation time in the mass accommodation simulations . figures 3 and 4 show that the theoretical evaporation rate from eq 2 results in values that are reasonably close to the evaporation rates seen in simulations . moreover , the same qualitative behavior as a function of temperature and droplet size is seen in both simulation and theory . a notable exception would appear to be the dip seen when going from 268 to 273.15 k in the mass accommodation simulations . however , considering both the theoretically expected evaporation rates that are quite close to each other for the two temperatures and the relatively large and overlapping error bars which follow from the small number of evaporation events ( see table 3 ) , it is strongly suggested that the dip follows from poor statistics rather than an actual feature of the temperature dependence of the evaporation rate . the differences between the evaporation rates from mass accommodation and evaporation simulations appear to mostly be within statistical uncertainty for the lower temperatures , implying that the exchange evaporation does not have a significant role in these simulation conditions . for the higher temperatures , however , the evaporation simulations start to exhibit notably lower evaporation rates , remaining closer to the theoretical prediction which describes only thermal evaporation . it is therefore conceivable that a fraction of the evaporating molecules in the mass accommodation md simulations at higher temperatures could be attributed to exchange evaporation . as was seen from figure 2 , the mass accommodation simulations correspond to very high supersaturations as a consequence of the relatively frequent generation of incident molecules . thus , the assumption that the evaporation flux is independent of the condensation flux can be considered to be a good one for most , if not all , realistic natural situations for water . however , the exchange evaporation apparent in figure 3 is notable only at the higher temperatures , which actually correspond to lower supersaturations than the lower temperature cases ( see figure 2 ) . we conclude that the supersaturation where the effect becomes nonnegligible is temperature dependent , and the importance of exchange evaporation for other types of molecules should be further investigated . although the agreement between theory and simulation is fairly good ( within a factor of 2 ) , the theoretical prediction consistently underestimates the simulated evaporation rate . the error bars in the simulated values are of course quite large , but the sensitivity of eq 2 to the input values should also be considered . as is already set to 1 , changing the value of the evaporation coefficient will only make the agreement worse ( i.e. , the value can not exceed unity ) . the temperature and surface area are fixed in the simulations , so we are left with a possible underestimation of pe as a source for the discrepancy . in figure 5 the equilibrium vapor pressures of vega et al . are compared to values obtained by solving pe from eq 2 using the md simulated evaporation rate . we stress that the validity of the equilibrium vapor pressures of vega et al . is not questioned , figure 5 merely illustrates the change in pe that would be required to have the simulated and theoretical evaporation rates in figures 3 and 4 agree . the equilibrium vapor pressure obtained through eq 2 is off by a factor of 2.7 for t = 268 k and by less than a factor of 2 for the other temperatures , equivalent to a difference of a few hundred pascals . the error bars are also in the range of a few hundred pascals , but as the pressures from eq 2 result consistently in an overestimation , it is unlikely that a longer simulation time and improved evaporation statistics would result in the vapor pressures coming into better agreement . comparison of simulated equilibrium vapor pressure of tip4p - ew water with approximated value obtained through the evaporation rate . for the droplet cases , errors in the surface tension and bulk liquid density might also explain some of the disagreement between the theoretical and simulated evaporation rates . for the value of surface tension an error estimate of 0.4 mn / m has been given , which translates to about a 0.51 pa uncertainty in the droplet pe . no error estimates were given for the liquid density , but even when considering a very generous error estimate of 10 kg / m , a change in pe of only about 0.51.5 pa would result . thus , the errors in surface tension and bulk liquid density do not improve the consistency between theoretical and simulated evaporation rates for the droplets . the surface region can be identified from a density profile in a md simulation as the part where the density changes from the bulk liquid value to the gas phase value ; see figure 6 . as a more rigorous definition for the surface , the region where the density is between 90 and 10% of the liquid value is commonly used . the km - gap model on the other hand describes the surface with two layers , the quasistatic surface layer and the sorption layer ( see figure 1 ) . the rate of evaporation is described by the desorption lifetime d , which is the mean time an evaporating molecule spends in the sorption layer before evaporating into the gas phase . as a test case in ref ( 23 ) , the km - gap model was used to simulate the experimental water vapor condensation and droplet growth in the expansion chamber work of winkler et al . in their experiments , monodisperse ag particles with a diameter of 9 nm and particle number concentration of 4381 cm were used as condensation nuclei and humidified under an initial supersaturation of 37.5% at 268 k and 737 torr . a value of d = 35 ps was used in ref ( 23 ) for the desorption lifetime , based on earlier md simulations . the value is , however , based on only a handful of desorption events of incoming molecules , of which not all were water molecules , and which were obtained using the 9010 surface definition . example density profile ( t = 300 k ) where the area between black vertical lines is the km - gap sorption layer . the red lines denote where the density falls to 90% and 10% of the bulk liquid value . to identify where the location of the sorption layer is in terms of the md density profile , we take advantage of the quantity denoted by s in the km - gap model . s is the ratio between the actual surface concentration of the sorption layer and the maximum surface concentration of water molecules . we take the outer limit of the sorption layer to be located at the distance where the density has fallen to the fraction of the corresponding bulk liquid value that is indicated by s , which for the water condensation example in ref ( 23 ) is s 7 10 . the thickness of the sorption layer is set to 0.3 nm , since in km - gap the sorption layer has a fixed width of one molecular diameter . the black lines in figure 6 show the region of the md density profile that corresponds to the km - gap sorption layer . as can be seen , the outer limit of the sorption layer is quite far from the bulk liquid phase and the sorption layer lies entirely outside the 9010 surface region . this was to be expected , as the km - gap surface region includes also the quasi - static surface layer located between the sorption layer and bulk condensed phase . due to the dense vapor that follows from the frequently generated incoming molecules , the density does not fall in the mass accommodation simulations of the planar interface to the small value indicated by s . this is however not a problem in the evaporation simulations , and the location identified from the evaporation simulations is used also for the mass accommodation simulations when calculating the d related to the sorption layer . table 4 collects the values for the mean lifetime before evaporation when the 9010 surface definition is used . the times the evaporating molecules spend in the surface are calculated starting from the last time the molecules enter the surface before evaporation without entering the bulk in between . evaporation is here taken to occur when the molecule enters the constant density vapor phase . we find that , while individual evaporating molecules occasionally spend 35 ps or even longer in the 9010 surface region , the mean lifetime is around 10 ps or less . to be consistent with km - gap this results in a d that is on average below 1 ps for all of the various simulated conditions . the longest time observed is only about 2 ps , but these are a minority among the evaporation events with only six such occurrences among the total number of 134 evaporation events observed throughout all of the simulations . the number of events listed here is not exactly the same as the total number of evaporations since on three occasions the molecule was in the surface from the start of the simulation until evaporating . to examine the effect of the value of d on the predictions of km - gap , we have simulated water vapor condensation using km - gap with various d values , again in comparison to experimental data from winkler et al . we investigate the impact of d on droplet growth with d values of 1 , 10 , and 100 ps . as shown in figure 7a , km - gap reproduces the observed growth very well and the exact value of d has practically no effect on particle growth . this is because particle growth is limited by gas phase diffusion and subsequent surface accommodation . however , d does have a critical effect on the surface coverage of water molecule s as shown in figure 7b . increase of d by an order of magnitude leads to roughly an order of magnitude increase in s : s is 2 10 with d = 1 ps , increasing to 2 10 with d = 100 ps . ( a ) water droplet growth curve with different desorption lifetimes of h2o ( d ) ( 1 , 10 , and 100 ps ) in comparison with the experimental data by ref ( 10 ) . ( b ) surface coverage of h2o . ( c ) surface and bulk mass accommodation coefficients ( s and b ; left axis ) and uptake coefficient of h2o ( ; right axis ) with d = 1 ps . figure 7c shows the temporal evolution of the surface and bulk mass accommodation coefficients ( s and b ) and uptake coefficient ( ) . s stays at 1 whereas b 0.998 , which means that about 99.8% of water molecules that collide with the surface eventually enter the bulk . the almost exact agreement between the values of s and b indicates that the transport of water molecules from surface to bulk is a very fast process due to the high bulk diffusivity of water molecules of 10 cm s. drops from 1 to 0.1 very quickly and afterward continues decreasing to 0.01 , corresponding to a slowing down of particle growth . water molecules are always desorbing from the surface , and the balance between adsorption and desorption of water molecules determines the value . as time progresses , the net flux decreases and the uptake coefficient decreases . thus , for water , the surface and the bulk accommodation coefficient values as predicted by km - gap are nearly identical , and the problem reduces to the simple kinetic condensation problem . when identifying the equivalent of the km - gap sorption layer within the md simulations , we used the value of the sorption layer surface coverage s taken from the km - gap runs of ref ( 23 ) . figure 7b shows , however , that the value of s changes when d is changed , and the location of the sorption layer should be moved accordingly . this makes it impossible to determine a definite location for the sorption layer in md , and therefore also d : a new value of d will then again change the value of s calculated from km - gap . in practice , however , we can be quite confident that d should be around 1 ps . while they are orders of magnitude different from each other , all of the s values seen in figure 7b are small . thus , when used to determine the md equivalent of the sorption layer , each results in a sorption layer located close to the bulk gas and completely outside the 9010 surface region . then , for any of these values of s , the sorption layer is located so far from the bulk liquid that an evaporating molecule in a md simulation will not spend more time in the sorption layer than is required to cross it , of the order of 1 ps . the introduction of the md equivalent of the km - gap sorption layer was done here for the purpose of connecting the md picture to km - gap terminology , and therefore the md sorption layer is utilized only in this section . using eq 9 to determine the mass accommodation coefficient requires one to choose a definition for the surface . for this purpose we adopt the 9010 definition ( figure 6 ) , which is consistent with previous mass accommodation md work . we find that the water mass accommodation coefficient , as defined by eq 9 , is close to unity not only for the planar surfaces but also for the droplet surfaces , as is seen in figure 8 . the number of scattered molecules is particularly small ( see table 3 ) , to the extent that we see no scattered molecules among the 1000 incoming molecules for the planar surface in simulations at the two lowest temperatures . the triangles in figure 8 are calculated when taking the exchange evaporation into account where the number of evaporated molecules that are assigned to the exchange evaporation are determined from the ratio of evaporation rates from the evaporation and mass accommodation simulations . for completeness the results using the exchange evaporation are plotted also for the two lower temperatures , even though the difference in evaporation rates could clearly be accounted for by statistical error in these two cases ( see figure 3 ) . there seems to be a slight decrease in as the temperature grows and a slight increase as the droplet size grows . the decreasing trend as temperature rises is in line with earlier experimental results and with simulation results . this behavior is intuitively expected as higher temperature corresponds to on average more energetic incoming molecules . note that the region where the accommodation coefficient drops to values considerably below unity in refs ( 26 ) and ( 38 ) is at temperatures close to the critical temperature , that is , at temperatures much higher than those in the present study or in experiments . mass accommodation coefficient as a function of temperature ( top ) and droplet size ( bottom ) . the circles in the top follow from only counting scattered molecules as nonaccommodated ; the triangles take also into account the difference in evaporation rate between mass accommodation and evaporation simulations . the mass accommodation coefficient remains practically unity even when the exchange evaporation is taken into account . however , it is interesting to note that for t = 300 k the number of nonaccommodated molecules due to exchange evaporation is about 4 times the number of scattered molecules , making the exchange evaporation the dominant type of nonaccommodation under these conditions . however , translating these findings to other substances with mass accommodation coefficients smaller than 1 is speculative . if the magnitude of the evaporation events caused by the incoming molecules is similar to what it is for water , the number of scattered molecules could outnumber the evaporated by a clear margin . on the other hand , it might be that the exchange evaporation is also enhanced in these situations . for accommodation of a molecule on a surface that consists of a different molecular species , it seems natural to only take into account the fate of the incoming molecular species when calculating the mass accommodation coefficient , even if the adsorption leads to an increase in the evaporation of the surface species . while it might seem worthwhile to use the sorption layer also when determining m , the fact that the md sorption layer is here so removed from the condensed phase makes it ill - suited for the task . according to the definitions in section 2.4 , an incoming molecule that has passed through the surface is classified as absorbed into the bulk liquid , but from figure 6 it is clear that any molecule that has just traveled past the md sorption layer can hardly be considered to reside in the bulk liquid phase . we have performed molecular dynamics simulations of water mass accommodation on both planar and droplet surfaces as well as evaporation simulations with the same set of simulation conditions . these included a planar surface at four different temperatures and droplets at t = 273.15 k with radii of 1.92 and 4.14 nm , with the latter size considered in the mass accommodation simulations only . our simulated water evaporation rates are in qualitative agreement with the evaporation rate given by simple kinetic condensation equations , but this theoretical expression consistently underestimates the observed rates . while a longer simulation time might result in a better quantitative agreement , the systematic difference between the two makes this doubtful . on the other hand , a change of a few hundred pascals in the equilibrium vapor pressure would be needed to bring the theoretical prediction to the same level as simulations . in the two highest of the studied temperatures , t = 290 k and t = 300 k , the evaporation rate in the md mass accommodation simulations is elevated compared to the evaporation simulations . this effect can be attributed to exchange evaporation ; that is , an incoming molecule will remain in the condensed phase but causes a surface molecule to evaporate . such behavior is at odds with the commonly used assumption that the evaporation mass flux is independent of the condensational mass flux , but it should be noted that the relatively frequently generated incident molecules cause the simulation conditions to correspond to very high supersaturations of the order 10200 . the comparison of md evaporation rates and theoretical free molecular regime evaporation rates suggests that the evaporation coefficient for water is unity , which is in agreement with earlier md work where the evaporation coefficient has been calculated from the evaporation fluxes in liquid vapor equilibrium and vacuum evaporation simulations . this is at odds , however , with experimental raman thermometry results , which point to a value below unity . the md simulations also provided an opportunity to refine the average desorption lifetime that is required as an input parameter for the detailed kinetic flux model km - gap . using the surface coverage of the km - gap sorption layer , the region in the md simulations that corresponds to this km - gap sorption layer is identified . from the time that evaporating molecules spend in this region , we find the average desorption lifetime to be around 1 ps . although this new d differs by an order of magnitude from the earlier value used in km - gap , the model succeeds in describing the condensational growth of water droplets from the experiments of ref ( 10 ) . in fact , the droplet growth is described equally well with desorption lifetimes ranging from 1 to 100 ps , indicating that the growth is limited by gas phase diffusion and surface accommodation rather than desorption . thus the simple kinetic treatment ( see figure 1 , left panel ) is sufficient for describing pure water . this is likely not the case for a situation where the transport between surface and bulk is less efficient , for example , for a water droplet coated with organic molecules . a mass accommodation coefficient between 0.99 and 1 is found for all studied planar interfaces , which is in accordance with previous md studies . using a droplet as the target surface also produces a coefficient that is practically unity , even though the coefficient appears to get slightly ( < 0.5% ) lower as the droplet radius decreases . the mass accommodation coefficient gets slightly ( 0.2% ) smaller as temperature increases , which is in agreement with experiments . when the exchange evaporation is taken into account , the decrease with increasing temperature is somewhat more pronounced , resulting in a value of 0.99 at the highest temperature . the effect of exhange evaporation is included by comparing the evaporation fluxes in mass accommodation and evaporation simulations and attributing the difference to molecules evaporated by the exchange method and , consequently , as nonaccommodated . the molecular level definitions of the mass accommodation coefficient conventionally used in md consider only the fate of the incoming molecules . however , when kinetic condensation models for aerosol growth are used , the picture is not a molecular level one but instead is one of mass fluxes , and then the mass accommodation coefficient acts as a factor that effectively decides the magnitude of the condensation and evaporation fluxes . in this case , the information that the coefficient is expected to contain includes the possible exchange evaporation .

the condensational growth of submicrometer aerosol particles to climate relevant sizes is sensitive to their ability to accommodate vapor molecules , which is described by the mass accommodation coefficient . however , the underlying processes are not yet fully understood . we have simulated the mass accommodation and evaporation processes of water using molecular dynamics , and the results are compared to the condensation equations derived from the kinetic gas theory to shed light on the compatibility of the two . molecular dynamics simulations were performed for a planar tip4p - ew water surface at four temperatures in the range 268300 k as well as two droplets , with radii of 1.92 and 4.14 nm at t = 273.15 k. the evaporation flux from molecular dynamics was found to be in good qualitative agreement with that predicted by the simple kinetic condensation equations . water droplet growth was also modeled with the kinetic multilayer model km - gap of shiraiwa et al . [ atmos . chem . phys.2012 , 117 , 2777 ] . it was found that , due to the fast transport across the interface , the growth of a pure water droplet is controlled by gas phase diffusion . these facts indicate that the simple kinetic treatment is sufficient in describing pure water condensation and evaporation . the droplet size was found to have minimal effect on the value of the mass accommodation coefficient . the mass accommodation coefficient was found to be unity ( within 0.004 ) for all studied surfaces , which is in agreement with previous simulation work . additionally , the simulated evaporation fluxes imply that the evaporation coefficient is also unity . comparing the evaporation rates of the mass accommodation and evaporation simulations indicated that the high collision flux , corresponding to high supersaturation , present in typical molecular dynamics mass accommodation simulations can under certain conditions lead to an increase in the evaporation rate . consequently , in such situations the mass accommodation coefficient can be overestimated , but in the present cases the corrected values were still close to unity with the lowest value at 0.99 .

Introduction Methods Results and Discussion Conclusions

bacteria have several strategies to combat against -lactam antibiotics including production of -lactamases enzyme which hydrolyze the -lactam ring of lactam antibiotics.[46 ] the -lactamases are classified into four groups ( 1 , 2 , 3 and 4 ) on the basis of function . moreover , based on molecules ( nucleotides and amino acid sequences ) -lactamases are classified into four groups ( a , b , c and d ) comprising two families : serine--lactamases ( sbls ) and metallo--lactamases ( mbls ) . new delhi metallo--lactamase-1 ( ndm-1 ) belongs to the subclass b1 of mbl , in which two zinc ion ( s ) are required for the activity , where the tightly bound zinc is referred to as zn1 and the loosely bound zinc is called as zn2 . in zn1 , a tetrahedral geometry is coordinated by three histidine residues and one solvent molecule in the crystal structure . while , a distorted trigonal bipyramidal geometry is the coordination of zn2 by three amino acids ( his , cys , asp ) , a water molecule and a solvent molecule ( glycerol ) that serves as a ligand to zn1 too . the mbl was first identified in a swedish patient of indian origin , from new delhi , who was suffering from urinary tract infection , caused by carbapenem - resistant klebsiella pneumoniae ( crkp ) . ndm-1 is mainly found in k. pneumoniae , but recently ndm-1 activity is also observed in many other bacteria such as enterobacteriaceae and acinetobacter baumannii , which causes antibiotic resistance due to its hydrolyzing tendency for -lactam antibiotics . however , such species - specific barrier was maintained due to the gene coding for ndm-1 is present as mobile genes on plasmids , therefore , such gene can readily spreaded through bacterial populations . hence , it would be a promising choice to block the ndm-1 with suitable inhibitor . to reveal the resistance mechanism of bacteria to -lactam antibiotics , we selected a series of 35 different natural antibacterial compounds from various literary sources , and successively docked with the active site of ndm-1 [ table 1 ] . some of the selected natural compounds show a good binding affinity at the active site of ndm-1 , particularly nimbolide and isomargololone , produce lower binding energy than the -lactam antibiotics with ndm-1 and also have appreciable ic50 value . these findings may provide useful insights for designing new potent drugs to fight against the antibiotic resistance of ndm-1 . in order to find the ndm-1 inhibitors , we selected 35 different antibacterial natural compounds for docking against ndm-1 [ table 1 , figure 1a ] . we further selected -lactam antibiotics from pubchem ( http://pubchem.ncbi.nlm.nih.gov/ ) and subsequently created a representative set of 14 -lactam antibiotics , which interact with ndm-1 [ table 2 , figure 1b ] . the molecular structures of antibacterial natural compounds and -lactam antibiotics were drawn by the chemdraw , and molecules were converted into protein data bank ( pdb ) format from mdl mol by using online mn molecular format convertor ( http://www.molecular-networks.com ) . high - resolution structure of ndm-1 was already reported , and its atomic coordinates were taken from the protein data bank ( pdb code : 3q6x ) for docking . visualization of all docked structure was performed on pymol molecular graphics program , a comprehensive software package for rendering and animating 3d - structures . alignment of all ( a ) natural compounds and ( b ) antibiotic molecules ( stick model ) in the lowest - energy confirmation in the ndm-1 structure shown in cartoon model ( light grey ) . chemical structural representation of ( c ) nimbolide and ( d ) isomargolonone . three - dimensional structure of ( e ) nimbolide and ( f ) isomargolonone are shown in ball and stick model drawn in pymol list of antibiotics from the -lactam family used in docking study we used autodock 4.2.3 program for docking simulations of ligands shown in table 1 and table 2 with ndm-1 . further , we added polar hydrogen atoms and performed kollman united atom charge assignment to ndm-1 molecules followed by the generation of pdbq file . autogrid program was used to generate 3d affinity grid fields with grid map of 40 50 40 points . autodock tools utility was used to generate both grid and docking parameter files ( i.e. , gpf and dpf ) . we performed 50 independent runs with the step sizes of 0.2 for translations and 8 for orientations and torsions for docking of ndm-1 with various ligands . the possibility of performing local search on an individual in the population was 0.06 and the termination criterion for the local search was 0.01 . van der waals interaction , hydrogen bonding , and the coulombic electrostatic potential for charges were used for binding energy calculations . the docking simulations with multiple runs and cluster analysis of ligands were performed with their corresponding docked energy . docking solutions with ligand all - atom root mean square deviation ( rmsd ) within 1.0 of each other were clustered together and ranked by the lowest energy . the lowest - energy solution of the lowest ligand all - atom rmsd cluster was accepted as the calculated binding energy . although the solvation energies could not be explicitly considered during the minimization , the energy calculations were performed with a distance - dependent dielectric constant of 5 to mimic the solvation effect of the inhibitors in the protein environment . energy minimization of the docked complex of nimbolide and isomargolonone with ndm-1 were performed by ammp molecular dynamics software of vega opengl package version vega zz 2.4.0 using the sp4 force - field . firstly , the correct bond types were assigned to the ndm-1 complex . moreover , using the default parameters in the vega program , force fields and charges were assigned according to amber and gasteiger algorithms , respectively . then , ndm-1 complex with nimbolide and isomargolonone was embedded in a box solvated with 2613 water molecules . to neutralize the system 52 cl ions were added and arranged randomly in the system . then , the entire system underwent energy minimization relaxation in the two steps procedure without any restraints . first 500 steps of steepest decent method followed by 2000 steps of conjugate gradient minimization method . in order to find the ndm-1 inhibitors , we selected 35 different antibacterial natural compounds for docking against ndm-1 [ table 1 , figure 1a ] . we further selected -lactam antibiotics from pubchem ( http://pubchem.ncbi.nlm.nih.gov/ ) and subsequently created a representative set of 14 -lactam antibiotics , which interact with ndm-1 [ table 2 , figure 1b ] . the molecular structures of antibacterial natural compounds and -lactam antibiotics were drawn by the chemdraw , and molecules were converted into protein data bank ( pdb ) format from mdl mol by using online mn molecular format convertor ( http://www.molecular-networks.com ) . high - resolution structure of ndm-1 was already reported , and its atomic coordinates were taken from the protein data bank ( pdb code : 3q6x ) for docking . visualization of all docked structure was performed on pymol molecular graphics program , a comprehensive software package for rendering and animating 3d - structures . alignment of all ( a ) natural compounds and ( b ) antibiotic molecules ( stick model ) in the lowest - energy confirmation in the ndm-1 structure shown in cartoon model ( light grey ) . chemical structural representation of ( c ) nimbolide and ( d ) isomargolonone . three - dimensional structure of ( e ) nimbolide and ( f ) isomargolonone are shown in ball and stick model drawn in pymol list of antibiotics from the -lactam family used in docking study we used autodock 4.2.3 program for docking simulations of ligands shown in table 1 and table 2 with ndm-1 . further , we added polar hydrogen atoms and performed kollman united atom charge assignment to ndm-1 molecules followed by the generation of pdbq file . autogrid program was used to generate 3d affinity grid fields with grid map of 40 50 40 points . autodock tools utility was used to generate both grid and docking parameter files ( i.e. , gpf and dpf ) . we performed 50 independent runs with the step sizes of 0.2 for translations and 8 for orientations and torsions for docking of ndm-1 with various ligands . the possibility of performing local search on an individual in the population was 0.06 and the termination criterion for the local search was 0.01 . van der waals interaction , hydrogen bonding , and the coulombic electrostatic potential for charges were used for binding energy calculations . the docking simulations with multiple runs and cluster analysis of ligands were performed with their corresponding docked energy . docking solutions with ligand all - atom root mean square deviation ( rmsd ) within 1.0 of each other were clustered together and ranked by the lowest energy . the lowest - energy solution of the lowest ligand all - atom rmsd cluster was accepted as the calculated binding energy . although the solvation energies could not be explicitly considered during the minimization , the energy calculations were performed with a distance - dependent dielectric constant of 5 to mimic the solvation effect of the inhibitors in the protein environment . energy minimization of the docked complex of nimbolide and isomargolonone with ndm-1 were performed by ammp molecular dynamics software of vega opengl package version vega zz 2.4.0 using the sp4 force - field . firstly , the correct bond types were assigned to the ndm-1 complex . moreover , using the default parameters in the vega program , force fields and charges were assigned according to amber and gasteiger algorithms , respectively . then , ndm-1 complex with nimbolide and isomargolonone was embedded in a box solvated with 2613 water molecules . to neutralize the system 52 cl ions were added and arranged randomly in the system . then , the entire system underwent energy minimization relaxation in the two steps procedure without any restraints . first 500 steps of steepest decent method followed by 2000 steps of conjugate gradient minimization method . the crystal structure of ndm-1 has determined recently . it is evident from the crystal structure analysis that the ndm-1 has an open active site with a unique electrostatic profile , which essentially provides broader substrate specificity . zinc ion catalyses the hydrolysis of the lactam ring of the antibiotics and in turn inactivates . we performed the flexible docking of ndm-1 with selected 35 antibacterial natural compounds [ table 1 and figure 1a ] and 14 -lactam - containing antibiotics [ table 2 and figure 1b ] . we have used two parameters , ic50 and binding energy to screen the best compound out of the 35-compound library . as evident from table 3 and table 4 nimbolide ( molecule 15 ) , margolone ( molecule 18 ) , marganone ( molecule 19 ) , isomargolonone ( molecule 20 ) , acetyl aleuritolic acid ( molecule 27 ) and harmane ( molecule 33 ) have lower ic50 value than the -lactam antibiotics . we further screened all these molecules on the basis of binding energy , in which only nimbolide and isomargolonone qualify , showing significant binding in proximity of the active site [ table 3 ] [ figure 1c f ] . since all the selected compounds were natural , we did not perform lipinski 's filter analysis . binding energy of natural compounds with ndm-1 calculated using autodock-4.2.3 binding energy of -lactam antibiotics with ndm-1 calculated using autodock- 4.2.3 we further minimized the energy of both protein - ligand complexes . the energy minimized model of ndm-1-nimbolide and ndm-1-isomargolonone complexes showed rmsd of 0.246 and 0.367 respectively . the result of energy - minimized structure showed a significant number of hydrogen - bonded as well as van der waals interactions formed between ndm-1 residues and nimbolide or isomargolonone [ figure 2 ] . the protein - ligand complexes are highly stable and complex formation occurs with high affinity . ( a ) ligplot showing residues involved in interactions between ndm-1and nimbolide ( stick model ) . ( b ) surface model of the docked ndm-1 with nimbolide where protein molecules are shown as surface ( cyan ) and nimbolide structure is shown in ball and stick ( yellow ) . ( c ) ligplot showing residues involved in interactions between ndm-1 and isomargolonone ( stick model ) . ( d ) presence of isomargolonone in the ndm-1 structure protein molecules are shown as surface ( light pink ) and isomargolonone structure is shown in ball and stick ( green ) figure 2a and b show the mode of interaction of nimbolide with the ndm-1 as evident from ligplot and surface diagram . figure 2a clearly indicates that nimbolide forms a large number of interactions with ndm-1 residues such as pro263 , asp124 , gln37 , gly36 , gln38 , asp212 , ile35 , ser251 and ala252 . interestingly , interaction of zn1 has been also observed with his120 , his122 and his189 of active site ( not shown in figure ) . therefore , the binding of nimbolide to ndm-1 may affect the coordination of the zn1 atom which further influences the catalytic activity of the enzyme . we can observe in figure 2c that isomargololone forms a large number of interactions with ndm-1 residues such as his122 , asp124 , trp93 , val73 , his250 , leu218 , gly219 , lys211 , cys208 and gln123 . moreover , isomargololone has shown ionic interaction with the zn2 [ figure 2c ] and affects the coordination of zn1 with its binding residues . furthermore , the surface diagram clearly indicates the presence of isomargololone in the active site cavity of ndm-1 [ figure 2d ] . a tight mode of binding observed between isomargololone and ndm-1 suggests that the activity of the enzyme may be highly affected by this ligand . in order to identify the novel classes of ndm-1 inhibitors by means of structure - based drug design , prediction of protein - ligand interaction is essential for virtual screening approaches . this process requires docking tools to produce suitable conformations of a ligand within a protein - active site . furthermore , a reliable energy evaluation can easily indicate the quality of a receptor - ligand putative complex and provide insights for biomedical science and drug development . since the active site of ndm-1 may bind to different classes of the carbapenem family of antibiotics , it can be useful to consider the differences in binding affinity of the selected inhibitors and their natural substrate , that is carbapenem antibiotics . we observed that the piperacillin ( antibiotic 3 ) had lowest binding energy ( -6.98 kcal / mol ) and ic50 ( 6.45 m ) value as well . here our aim is to identify a potent inhibitor to block the lactamase activity of ndm-1 . we selected 35 natural compounds from various plant sources and subsequently docked in the active site of ndm-1 . binding affinity calculation a representative set of 14 antibiotics of the -lactam family was selected from different sub - families like penicillins ( penams ) , penems , carbapenem , cephalosporins , monobactams , -lactamase inhibitors and combinations as shown in table 2 . the docking analysis of -lactam antibiotic with ndm-1 revealed that piperacillin ( antibiotic 3 ) antibiotic have lowest binding energy of -6.9 kcal / mol and ic50 value ( 6.45 m ) . on the other hand , the docking analysis of the antibacterial natural compounds showed that nimbolide ( 1.34 m ) , margolone ( 5.25 m ) , margolonone ( 5.34 m ) , isomargolonone ( 1.25 m ) , acetyl aleuritolic acid ( 0.2772 m ) and harmane ( 4.32 m ) , had ic50 value lower then -lactam antibiotics . interestingly , isomargololone ( -7.49 kcal / mol ) and nimbolide ( -8.01 kcal / mol ) showed lesser binding energy than the -lactam antibiotics . moreover , their ic50 values are quite good to consider as drug molecule [ table 2 ] . furthermore , both these compounds are devoid of -lactam ring therefore , they can easily resist the hydrolase activity of ndm-1 . all these results clearly indicate that isomargololone and nimbolide , and their derivative compounds may block ndm-1 , however , further work is needed to optimize these compounds for specificity , efficacy and experimental validation . recent studies showed that ndm-1 plays an essential role in the bacterial resistance to antibiotics . here we showed that isomargololone and nimbolide may be considered as potent and suitable inhibitors for the antibiotic resistance against ndm-1 . these compounds showed an appreciable binding affinity in comparison to other natural compounds as well as their substrate antibiotics . all these observations revealed that isomargololone and nimbolide and their derivative compounds may block ndm-1 activities and provide a significant basis for drug development for therapeutic intervention in bacterial resistance to antibiotics . however , experimental validations are needed to consider these molecules as a suitable drug against the superbug .

background : new delhi metallo--lactamase-1 ( ndm-1)-producing gram - negative bacteria are today 's major worldwide health concern . the enzyme ndm-1 provides bacterial resistance by its hydrolytic activity against the -lactam ring of antibiotics . inhibition of ndm-1 may prevent the hydrolysis of -lactam ring of the antibiotics , and therefore , plays an important role against antibacterial resistance.materials and methods : here we made an attempt to design suitable inhibitors against ndm-1 from different natural antibacterial compounds using molecular docking approach.results:we observed that natural compounds such as nimbolide and isomargololone are showing an appreciable ic50 value as well as significant binding energy value for ndm-1 . we further observed these compounds showing better affinity to ndm-1 on comparison with 14 -lactam antibiotics.conclusion:finally , our study provides a platform for the development of a potent inhibitor of ndm-1 , which may be considered as a potential drug candidate against bacterial resistance .

INTRODUCTION MATERIALS AND METHODS Data set and molecule preparation Molecular docking Energy minimization RESULTS DISCUSSION CONCLUSIONS

chronic pelvic pain ( cpp ) is defined as non - menstrual or non - cyclic pelvic pain lasting for at least 6 months that interferes with normal activities and requires medical or surgical treatment . according to gelbaya and el - halwagy , cpp is considered a major health problem for women . in the u.s.a . , cpp is responsible for 10% of outpatient visits to a gynecologist , 40% of laparoscopies , and 10% to 15% of hysterectomies [ 3 - 5 ] . its estimated prevalence is 3.8% in women aged 15 73 years and 14% 24% in women of reproductive age [ 7 , 8 ] , and it has direct effects on civil , social , and professional status . is the complex interaction between the gastrointestinal , genitourinary , musculoskeletal , nervous , and endocrine systems , in addition to sociocultural influences . a growing body of studies has highlighted the importance of the musculoskeletal system in the etiology and persistence of cpp . strong evidence indicates that up to 85% of patients with cpp have musculoskeletal system dysfunction ; myofascial syndrome is one of the anomalies that have been identified . abdominal myofascial pain syndrome ( amps ) is characterized as a deep and intense pain in the abdominal region , originating from latent myofascial trigger points ( mtrps ) located in the muscles and/or fascia . active mtrps may cause pain at rest and produce referred pain similar to that felt during compression of the point . latent mtrps do not cause spontaneous pain , but can restrict movement or cause muscle weakness , and only become sore if they receive direct pressure . in addition to nociceptive phenomena , latent mtrps may also produce muscle spasm and autonomic phenomena such as piloerection , vasoconstriction , vasodilatation , sweating , temperature changes , and a variety of visceral somatic reflexes [ 12 , 13 ] . treatment of amps requires a multidisciplinary approach in order to break the cycle of pain , deactivate the mtrps , and restore muscle flexibility , thereby eliminating predisposing factors and perpetuation of pain . treatment strategies include behavioral therapy , medications , physical therapy , injections at trigger points , neuromodulation , botulinum toxin injection , and various forms of alternative treatments , such as acupuncture . traditional chinese medicine ( tcm ) techniques manipulate vital energy ( qi ) flow through meridians to balance the opposing forces of yin and yang , as well as the five elements [ 15 , 16 ] . the meridians through which qi is circulated comprise a succession of points located at anatomically specific sites across different regions of the human body , including the lung , heart , liver , spleen , kidneys , and pericardium meridians ; the latter is not associated with a specific organ , but involves action on yin qi and genitourinary function . other meridians include the large intestine , small intestine , gallbladder , stomach , bladder , and the triple energizer meridians , the latter of which acts on the yang qi and respiratory , cardiac , and digestive functions . for tcm , and by extension acupuncture , the theories of yin and yang , zang - fu are interlinked and advocate an interdependence of humans with nature ; these theories are widely observed and applied in clinical practice . in tcm , pain is a result of a blockage or stagnation of the normal movement of qi in the painful area and is understood to be a consequence of biological - process disruption . changes in the flow of qi present symptoms of energy accumulation ( yang ) or deficiency ( yin ) in relation to the organs and viscera . if a diagnosis is to be made , the energy imbalance must be recognized by analyzing the individual as a whole based on the categories of the semiological disorder parameters related to pain : sensory , temporal , topographical , factors of aggravation and improvement , and pathophysiological . these can be assessed according to qualitative criteria : surface and depth , that set the standard for pathogenic factors ; or quantitative criteria : yin - yang deficiency or yin - yang excess in relation to the internal organs ( zang - fu ) , as well as the musculoskeletal system . acupuncture is based on a clinical diagnosis that recognizes and groups semiological data on the syndrome to provide clear guidelines for establishing therapeutic measures . the aim of this study was to determine which zang - fu meridians had altered qi behavior and to determine if yin - yang disharmony existed in the altered meridians in women diagnosed with amps through a tcm evaluation . this study was approved by the ethics committee of the faculty of medicine at the hospital of ribeirao preto , university of so paulo , and patient consent was obtained . this study included women with a clinical diagnosis of cpp , secondary to amps , who visited the clinic of gynecological endoscopy and pelvic pain , hospital das clnicas , faculty of medicine of ribeirao preto , university of so paulo ( usp - hcfmrp ) . we excluded women with a limited understanding of the study and those who refused to participate . informed patient consent was obtained via a signed document that contained information on the procedures to be performed . evaluations based on tcm were performed by two researchers with professional skills and expertise in acupuncture , who used a questionnaire that had been adapted according to wen , lee , auteroche and navailh , and pin . women who fit the inclusion criteria answered questions related to their age , weight , height , marital status , level of education , and number of pregnancies so that the study group could be characterized . during patient evaluation , the following aspects were taken into consideration : present illness ; symptomatology ; specific locations of mtrps ; start , cause , duration and frequency of symptoms ; personal and family history related to pain , breathing performance , sweating occurrence , and sleep quality ; reported emotions ; and preferences related to color , food , flavors and weather or season . the following aspects were also investigated : thirst , gastrointestinal dysfunction , excreta ( feces and urine ) , menstrual cycle , all five senses , and characteristic pain symptoms related to headache and to musculoskeletal , abdominal , and chest pain . patients were also evaluated regarding the following : aspect of tongue , skin color , tone of speech , and lips . following completion of the questionnaires , all answers regarding each item were carefully analyzed by the researchers , and all reports were considered according to the yin - yang , zang - fu , and five elements theories . the yin - yang theory analyzes the vital energy that flows through the meridians . zang - fu theory analyzes internal organs through an energy network in relation to numerous factors including anatomical aspect , emotions , mental activities , sensory organs , colors , and flavors . according to zang - fu , organs that are yin in nature absorb and accumulate energy . the viscera correspond to the fu , which is yang in nature and transforms and transmits energy . the five elements theory ( wood , fire , earth , metal , and water ) states that the elements have an interdependent relationship that generates a state of constant motion and are associated with element factors such as colors , flavors , emotions , feelings , and physiological characteristics . consequently , the balance of each function depends on the balance of the other functions , which are interconnected within the yin - yang , and the preparation of the database and the spreadsheets was performed by using microsoft office excel . the answers were added to the spreadsheets , and percentages were determined , taking into consideration the meridians with altered energetic behavior in each evaluation . the main meridians with altered energetic behavior were considered to be those with frequencies above 50% ; the frequency of yin - yang disharmonies detected in each meridian was also taken into consideration . based on the answers obtained , with each answer referring to one yin - yang disharmony , and the answers considered when determining the number of alterations in each specific meridian , the main yin - yang disharmonies were those with frequencies above 90% . as to the sample characterization , percentage calculations were also used , except for weight and height when determining the body mass index ( bmi ) and the body fat ( bf ) percentages . the statistical analysis was descriptive , and the results were presented as means standard deviations ( sds ) and frequencies . the majority of patients were married ( 78% ) , with a elementary school ( 66% ) and one or two children ( 76% ) . the average bmi and bf of the patients were 26.86 kg/ cm ( range : 17.7 39.0 ) and 32.4% ( range : 10.7 45.7 ) , respectively . results of the evaluation based on tcm and innervation corresponding to the pelvic floor are described in ( tables 2,3 ) from the analysis of each patient s questionnaire answers , we were able to conclude that , of the 12 zang - fu meridians , only the triple energizer and the pericardium meridians did not show an altered energetic behavior or yin - yang disharmony in contrast , 96% of the women had some kind of major alteration in energy in the kidney meridian , and 98% had major alterations in energy in the gallbladder meridian . the percentage of each energetic alteration in each meridian is presented in ( table 2 ) . in a second step , we performed percentage calculations corresponding to the major changes found in the meridians , so , we consider only the energy changes above 95% corresponding to the respective zang - fu meridians . this showed that the main yin - yang disharmonies encountered were related to the meridians of the kidney , gallbladder , and bladder . when the sequence of meridians and the frequency of yin - yang disharmony between them were analyzed , the anatomical locations of five of the ten meridians with energetic alterations were clearly similar to the location of the innervation in the pelvic region . the similarities were observed when comparing the trajectories of these meridians with the trajectories of the nerves mentioned . the details of the evaluations based on tcm and on innervation corresponding to the pelvic floor are described in table 3 . in this study , we used tcm - based evaluations to analyze the qi behavior of the zang - fu meridians and to verify the yin - yang disharmonies of those meridians in women with a syndrome diagnosis of amps . the objective of the study was not to suggest any protocol for the treatment of amps . according to this model , diagnosis and treatment are performed through careful assessment based on signs and symptoms while understanding the underlying causes . our study revealed a greater qi change and yin - yang disharmony in the gallbladder meridian , a tendon muscle qi channel with the functions of moving muscles and joints and promoting the body s defense via blood circulation . , the trigger points of anti - phospholipid antibody syndrome can produce muscle spasms , a fact that is in agreement with the results of our study concerning the energetic alteration presented by the gallbladder meridian in women [ 12 , 13 ] . the kidney meridian showed one of the largest energy changes and yin - yang disharmonies in our study . the chronic pain of internal organs causes a deficiency of this meridian and may produce symptoms such as impotence , sterility , stone formation , oliguria or polyuria , and bloating . due to this change , the heat propagated in the energy channel ( homeostasis ) of the spleen meridian becomes deficient , corresponding to the findings of the present study , and can lead to symptoms such as depression , weakness , and fatigue . these symptoms can directly impact the quality of life of these women because they affect emotional and professional aspects of life [ 2 , 7 , 8 ] . by analyzing the evaluation results according to tcm , we identified a similarity between the paths of the five meridians ( gall bladder , kidney , spleen , liver , and stomach ) and innervation of the pelvic region in support of gardner et al and dangelo and fattini . morphofunctional studies have identified the nerve plexus , vascular elements , and muscle bundles as the most likely locations of acupoints . other encapsulated receptors , mainly the golgi tendon organ and krause terminals bulbs , are also observable . according to melzack et al and kendall , acupoints are located in rows or meridians that follow the paths of the main nerves and blood vessels , assuming positions similar to those of trigger points . peng reported more than 92% of the trigger points correspond to points of acupuncture in anatomical locations and that 79.5% of those were similar to corresponding myofascial trigger points , as observed in the present study . ruby - klein et al applied an assessment protocol based on tcm to patients with cpp and endometriosis and reported that treatment using specific acupuncture points appeared to be an efficient method for treating endometriosis . treatment at acupuncture points through yin and yang is used to restore the normal flow of qi [ 36 , 37 ] . according to sanchez et al , the prescription of acupuncture points differs from the choice of myofascial trigger points to be disabled . if the acupuncturist adopts a western approach , the focus is on trigger points through neurophysiology ; however , if the approach is based on tcm , dysfunctional ashi points ( pain points ) and specific points on the meridians observed in the final evaluation are utilized . needling those points sussmann highlighted that , in addition to an effective evaluation , understanding the paths of the meridians and the qi in the body is important for improving the selection of acupuncture points and , therefore , providing a more effective treatment . at the end of the study , patients were evaluated according to tcm criteria and had obstetrics and gynecology outpatient medical appointments at the usp - hcfmrp for clinical evaluations and further procedures to aid in pain relief . despite the major role played to the evaluation of diseases through tcm prior to proposing a treatment protocol , few studies have addressed the aspects investigated in the present study , transforming treatment protocols into experiments that depend on the success rate of the selected technique to determine if acupuncture should be implemented as a complementary therapy . in this study , women diagnosed with cpp secondary to amps , who had been subjected to evaluation by using tcm , exhibited changes in qi , as well as yin - yang disharmonies , in the zang - fu meridians ( gall bladder , kidney , and bladder ) that were related to major gastrointestinal and urogenital diseases . the paths of some of the principal meridians analyzed were directly related to innervation of the pelvic floor and abdominal region . if an effective treatment is be proposed and a successful outcome is to be achieved , a thorough assessment to establish an individual protocol is necessary . cpp , chronic pelvic pain ; bmi , body mass index ; bf , body fat .

objectives : this study used semiology based on traditional chinese medicine ( tcm ) to investigate vital energy ( qi ) behavior in women with abdominal myofascial pain syndrome ( amps).methods : fifty women diagnosed with chronic pelvic pain ( cpp ) secondary to amps were evaluated by using a questionnaire based on the theories of yin - yang , zang - fu , and five elements . we assessed the following aspects of the illness : symptomatology ; specific location of myofascial trigger points ( mtrps ) ; onset , cause , duration and frequency of symptoms ; and patient and family history . the patients tongues , lips , skin colors , and tones of speech were examined . patients were questioned on various aspects related to breathing , sweating , sleep quality , emotions , and preferences related to color , food , flavors , and weather or seasons . thirst , gastrointestinal dysfunction , excreta ( feces and urine ) , menstrual cycle , the five senses , and characteristic pain symptoms related to headache , musculoskeletal pain , abdomen , and chest were also investigated.results:patients were between 22 and 56 years old , and most were married ( 78% ) , possessed a elementary school ( 66% ) , and had one or two children ( 76% ) . the mean body mass index and body fat were 26.86 kg/ cm2 ( range : 17.7 39.0 ) and 32.4% ( range : 10.7 45.7 ) , respectively . a large majority of women ( 96% ) exhibited alterations in the kidney meridian , and 98% had an altered gallbladder meridian . we observed major changes in the kidney and the gallbladder qi meridians in 76% and 62% of patients , respectively . five of the twelve meridians analyzed exhibited qi patterns similar to pelvic innervation qi and meridians , indicating that the paths of some of these meridians were directly related to innervation of the pelvic floor and abdominal region.conclusion:the women in this study showed changes in the behavior of the energy meridians , and the paths of some of the meridians were directly related to innervation of the pelvic floor and abdominal region .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

biologists and bioinformaticians have made extensive use of protein interaction information to interpret experimental results in the context of a global protein interaction network and to test new hypotheses . protein interaction databases have played a major role in capturing this information from the literature and in presenting it in a structured format to interested users . nevertheless no single database covers the entire interaction information reported in the literature and , to achieve the largest possible coverage , users or online resources are forced to combine data downloaded from different databases with different data models and ontologies ( 14 ) . to facilitate the exchange and integration of molecular interactions by data providers , databases and data users , the molecular interaction group of the human proteome organization protein standard initiative , has proposed a data representation standard ( current version psi - mi 2.5 ) ( 5 ) . this standard has been adopted by the major protein protein interaction ( ppi ) databases and has formed the basis for the emergence of the international molecular exchange ( imex ) consortium ( http://imex.sourceforge.net/ ) ( 6 ) . imex follows the model of similar initiatives in different domains of biological data , such as the nucleotide sequence exchange between embl ( 7 ) , genbank ( 8) and ddbj ( 9 ) , and aims at distributing the curation workload between participating databases thus avoiding work duplication and increasing literature coverage . the databases adhering to this consortium have developed and adopted a common curation manual ( http://imex.sourceforge.net/doc/imex-curationmanual.doc ) , describing both the information that should be captured by the member databases and how the information should be represented . the consortium currently comprises four active members : dip ( 10 ) , intact ( 11 ) , matrixdb ( 12 ) and mint ( 13 ) . the psi - mi controlled vocabulary , a major component of the psi - mi and imex data representation standard , defines interactions in a broad sense . two proteins are said to interact if they score positive in any of the many experimental procedures used to detect molecular interactions , without implying that they make direct physical contact . however , the experimental evidence is clearly defined in associated database records leaving users free to assess confidence for a given piece of experimental evidence . that is , each entry is annotated with the supporting methods , some of which are understood to provide evidence of direct physical contact between the partner proteins such as x - ray crystallography , nuclear magnetic resonance , biochemical assays carried out on purified proteins , and those for which the presence of bridging molecules can not be excluded such as , pull - down , co - immunoprecipitation and two hybrid assays . a recent major advance in the protein interaction field is the community definition of the minimal information required for reporting a molecular interaction experiment ( mimix ) ( 14 ) . authors reporting protein interaction information in their manuscripts are asked to follow this guidelines , ensuring that this minimal information is unambiguously described with controlled vocabularies and cross - references to major public databases . the checklist contains information such as the name and organism of the proteins , their experimental role ( bait , prey ) , or the detection method . mint , as a member of the imex consortium , is one of the major ppi repositories . the database content has grown ( more than 19 000 experimental evidences have been added since the last report in 2006 ) , the curation policy has been updated to meet psi standards , and the web interface has become more user friendly with the development of new query and graphic tools . in addition each interaction is now annotated with a score ranging from 0 to 1 reflecting the quality and quantity of experimental information supporting the interaction . over the past three years in concert with other databases , mainly intact and dip , the annotation policy has been reviewed to meet the standards of psi - mi and the guidelines of the imex consortium . one major advance of the psi - mi standard has been the replacement of the physical interaction term with two new definitions that permit to discriminate between interactions that have a clear experimental evidence for direct contact between the two partners ( physical association ) and those where the direct contact is not demonstrated ( association ) . each article is curated in its entirety , following the psi - mi recommendations , and all the interactions and the experimental details of their supporting evidences are captured in the database entries . there has recently been some vociferous debate between some data providers and databases regarding the role of database curators with respect to assessment of data quality or reliability ( 15 ) ( thorneycroft et al . to clarify , the mint curation process does not involve any judgment of the accuracy of the published evidence and curators do not make any assessment or ad - hoc reliability ranking of the different interactions reported in a peer reviewed article . this supporting evidence can then be used by database users to filter the data according to their own reliability standards . in order to facilitate the navigation of the results of a query , the mint database associate to each interaction a reliability score ( described below ) that takes into account the experimental support . mint relies on the work of two professional curators and , as a member of the imex consortium , has been assigned the task of curating four journals : febs letters , embo journal , embo reports and more recently the febs journal . all ppi described in an article published by one of these journals are added to mint according to the imex manual . furthermore , as many high - throughput datasets are published by journals not covered by the imex consortium , these articles are curated in rotation by the three member databases . whereas most entries are curated after publication , mint has begun collaborating with febs letter and febs journal on an editorial procedure that , as recommended by the mimix guidelines , involves pre - publication participation of the manuscript authors in the curation process ( 16 ) . the journal editorial offices submit accepted articles to mint curators who , in concert with authors , process the protein interaction information as database entries . the processed information is returned to the journal publisher as a structured digital abstract ( sda ) , where all the interactions described in the article are summarized in a short structured sentence that uses a controlled vocabulary and is appended at the end of the traditional abstract . this sda can be easily parsed by automatic software and , in the online version of the manuscript , they are hyperlinked to relevant databases . as a consequence of limited support ( i.e. small curation team ) and of the curation depth required by imex , mint does not cover all the protein interactions reported in the literature . to increase the coverage in domains of particular interest to our experimental group , mint also contains entries that are not fully imex compliant , albeit adhering to the psi - mi model and controlled vocabularies . light curation and has allowed an increase in the number of articles curated per time unit . for example mint has a very high coverage of the experimental evidence supporting interactions mediated by modular domains such as sh3 , sh2 or 14 - 3 - 3 domains , similarly most interactions between viral and host proteins are annotated in mint . many of the articles supporting these interactions were curated to a lower level of detail than recommended by imex , and only the information required by the mimix guidelines were captured by curators . the differences between imex curation and light ( mimix based ) curation is summarized in table 1 . table 1.differences between imex and light curationannotationimex curationlight curationadditional information / examplespublicationreferencepmid / d.o.i.interactionfigurefigure , tableinteractioninteraction typedirect , physical , enzymatic reactionexperimentdetection methodco - immunoprecipitation , two - hybridexperimentbiosourcetaxid , cell type , tissueinteractorauthor given nameinteractorcross referenceuniprotkb , refseqinteractororganismtaxidinteractorexperimental rolebait / preyinteractorbiological roleenzyme , enzyme target western blotinteractorparticipant identificationinteractorexpression levelendogenous / over - expressed purificationinteractorsample processinteractortaginteractorbinding siterange , domaininteractormodificationphosphorylation , resulting / required position , amino - acidsinteractormutation differences between imex and light curation it is important to understand that entries curated according to the light curation model are as accurate as the imex ones . the same controlled vocabularies , proposed by the psi - mi consortium , are used and in both cases , for instance , the annotator makes a distinction between direct interactions and physical associations , where the experimental evidence can not prove direct association between the partners . most of these light curation entries are annotated by experimentalists that are specialists in the given biological domain and are reviewed by one of the professional curators . the differences between the two curation models do not affect most users , mainly looking for high quality data , but should be taken into consideration when the analysis requires more details about the experimental setup . the entries that are not annotated according to the imex manual are clearly labeled in the web - interface and in the exported files . in addition , a light curator may choose to capture from an article only those interactions related to his topic of interest , for instance interactions involving a specific domain , and skip additional interaction information that may be present in the same article . this label may be used by users that only want to focus on imex data , and by curators who may later complete those entries . in 2009 the oldest interactions in mint , for which these policies had not been followed , have been blocked and hidden to the users . once an interaction is curated and validated in mint it is automatically imported , according to its properties , by one or more sister databases . homomint ( http://mint.bio.uniroma2.it/homomint ) ( 17 ) is a database of human interactions that are either experimentally verified or inferred from model organisms . each time an interaction between human proteins is deposited into mint , it is automatically imported into homomint . the interactions between proteins of model organisms ( for instance rat , mouse , yeast , worm or fly ) are imported into homomint after mapping to the human orthologs . orthologs are retrieved from ensembl compara through the biomart webservice ( http://www.ensembl.org/biomart/martview ) ( 18 ) . the information about the species in which the interaction was experimentally demonstrated is maintained in the homomint entry . the database of domain peptide interactions , domino ( http://mint.bio.uniroma2.it/domino ) ( 19 ) , focuses on interactions mediated by domains ( sh3 , sh2 , 14 - 3 - 3 , pdz , etc . ) . wherever the domain mediating an interaction is specified in the mint entry , the entry is automatically imported into domino . in addition domino contains interactions between domains and peptides that are not present in proteins ( for instance peptides selected by phage display ) and offers a different interface , including the domino viewer applet in which the modular composition of the proteins is displayed . finally , all virus virus and virus host interactions in mint are automatically transferred to virusmint ( http://mint.bio.uniroma2.it/virusmint ) ( 20 ) . virusmint has a specialized interface which focuses on virus interactomes , completed with host interactions connecting the viral networks . this is partly due to experimental false positives , especially in high throughput experiments and partly to the different sensitivity and specificity of the diverse experimental setups . thus , as it remains difficult for the final user to assess the quality of each binary interaction , we have developed a scoring system to facilitate the evaluation of the reliability of each single interaction , with particular focus on direct physical interactions ( 21 ) . the mint scoring system reflects the quantity and quality of independent supporting evidence stored in the database . cumulative evidence as the sum of all the supporting evidence weighted by coefficients that reflects the confidence in the specific approach . this is based on : the size of the experiment : experiments are defined large scale if the article reporting them describes more than 50 interactions , otherwise they are defined small scale . as only the 0.01% of the stored articles report more than 50 interactions we considered this a reasonable threshold to distinguish between large and small scale experiments. the type of experiment supporting the interaction. it emphasizes evidence of direct interaction ( i.e. two - hybrid ) with respect to experimental support that does not provide unequivocal evidence of direct interaction ( i.e. in vivo co - immunoprecipitation). the number of interaction partners detected in a single purification. the sequence similarity of ortholog proteins , for interactions mapped to the human proteome in homomint. the number of different publications supporting the interaction . the resulting score ranges between 0 and 1 and only well supported interactions obtain a value close to 1 . more details and updates about the score are available at http://mint.bio.uniroma2.it/mint/doc/mint-confidence-score.html . the size of the experiment : experiments are defined large scale if the article reporting them describes more than 50 interactions , otherwise they are defined small scale . as only the 0.01% of the stored articles report more than 50 interactions we considered this a reasonable threshold to distinguish between large and small scale experiments . the type of experiment supporting the interaction . it emphasizes evidence of direct interaction ( i.e. two - hybrid ) with respect to experimental support that does not provide unequivocal evidence of direct interaction ( i.e. in vivo co - immunoprecipitation ) . the number of interaction partners detected in a single purification . the sequence similarity of ortholog proteins , for interactions mapped to the human proteome in homomint . the number of different publications supporting the interaction . the scoring system , as illustrated in figure 1 , is an effective tool for filtering interactions . in panel ( a ) we have displayed all the proteins that , according to the mint database interact with the proteins participating in the egfr pathway as defined by the reactome database ( 22 ) . panel ( b ) shows the network that is obtained after removing interactions that are below a certain confidence threshold . interestingly , the remaining interactions can be easily recognized by any biologist familiar with this pathway ( e.g. efgr - grb2 , efgr - shc1 ) . the network in panel ( b ) is obtained by removing interactions below a certain confidence threshold ( 0.72 ) . the network in panel ( b ) is obtained by removing interactions below a certain confidence threshold ( 0.72 ) . mint can be queried online using the web interface available at http://mint.bio.uniroma2.it / mint/. the list of molecules that have been shown to interact with a chosen query protein may be displayed either as text on an html page or as a graph in the viewer applet . in the html output page ( figure 2 ) , we have recently added new columns to provide an overview of the type of evidence supporting the interaction . we distinguish between experimental evidence for direct interactions , associations ( we group here both psi - mi terms association and physical association ) , enzymatic reactions and co - localizations . the number of experiments supporting the association of the two proteins in a larger complex and the number of high throughput experiments are indicated in the last two columns . proteins partners of the e3 ubiquitin - protein ligase cbl . in the right frame interactors the total number of evidences is provided as well as the number of direct interactions , physical associations ( the two psi - mi terms physical association and association are grouped here ) , colocalizations and enzymatic reactions . even if enzymatic reactions are considered according to psi - mi standard as a subtype of direct interactions , there are counted here only as enzymatic reaction . the number of evidences by high throughput experiment and the number of evidences in which the two proteins are part of a larger complex are indicated in the last two columns . each figure in the different columns is linked to the description of the evidences supporting the interaction . by clicking the 22 link on the first row one obtains the information in the the left frame where the evidences for sh3kbp1 as a partner of cbl are grouped by publication and detection method . proteins partners of the e3 ubiquitin - protein ligase cbl . in the right frame interactors the total number of evidences is provided as well as the number of direct interactions , physical associations ( the two psi - mi terms physical association and association are grouped here ) , colocalizations and enzymatic reactions . even if enzymatic reactions are considered according to psi - mi standard as a subtype of direct interactions , there are counted here only as enzymatic reaction . the number of evidences by high throughput experiment and the number of evidences in which the two proteins are part of a larger complex are indicated in the last two columns . each figure in the different columns is linked to the description of the evidences supporting the interaction . by clicking the 22 link on the first row one obtains the information in the the left frame where the evidences for sh3kbp1 as a partner of cbl are grouped by publication and detection method . in the viewer applet the network can be extended by clicking on the + symbol in the small circles ( it is possible to undo this operation by right clicking on the same symbol ) . a protein can be removed from the displayed graph by right - clicking on it . the size of the nodes and the distance between them can be controlled through the slide bars in the upper part of the graphic frame . a third slide bar allows the user to hide interactions whose scores are below a chosen threshold . in the graphic display algorithm , the node repulsion force is proportional to the number of partners . as a consequence , two proteins with many interactors ( hubs ) will tend to lie further away in the graph display when compared with proteins with fewer partners . this graph display rule facilitates the identification of hubs in the graph . as an additional feature , to help identify interaction partners in complex graphs , the action of clicking on a node brings all its partners forward and all the other nodes in the network decrease in size . only bait prey partners are represented in the viewer ( spoke model ) , but all components of the same complex are also brought forward during this operation . any network displayed by the viewer can be exported as a list of protein pairs along with their confidence score ( button score ) , or in either psi - mitab and psi - mi xml format , both described later in this document . the network exported in a standard psi - mi format may be easily imported and analyzed in visualization software such as cytoscape ( 23 ) . both the html page and the viewer applet are connected to relevant information in other pages of the mint website . hyperlinks are provided to the source of the descriptions [ this information is imported from the uniprot knowledge base ( 24 ) ] or the full description of the interactions and the experiments by which they are supported . a visit to the mint web - site typically starts by searching for a gene name , a protein name or a cross - reference [ to uniprotkb , refseq ( 25 ) , etc . ] . if the protein is present in the mint database , the query returns an html page describing the protein on the left frame and listing the interactors in the right frame as described in the previous paragraph . in addition to the information about the protein imported from uniprot , a list of ortholog proteins available in mint is appended . if the protein is human or has a human ortholog , it is possible to switch to homomint , where the network of experimentally verified human protein interactions is extended with the interactions transferred from model organisms . an additional page describes all the experimental details and provides a link to sister databases whenever the interaction is relevant for the specific topic . sister databases offer several advantages , including additional data ( for instance inferred interactions , or interactions between non - natural peptides and proteins ) and an interface adapted to the specific needs of the specialized database ( display of the modular structure of the proteins , visualization of viral - host networks ) . finally , a new tool . this tool permits interrogation of the database with a list of proteins and returns the entire network of interactions connecting them . the search is performed on a list of proteins cross - references ( for instance a list of uniprot accession numbers ) , and the user can choose whether to include in the network additional proteins that connect the query proteins ( figure 3 ) . since the algorithm underlying this tool is demanding up to 100 proteins can be submitted . the node size has been reduced to the minimum with the scrollbar to provide a lighter view of the network . the node size has been reduced to the minimum with the scrollbar to provide a lighter view of the network . all the entries in mint can be freely downloaded in several formats from a public ftp site , and are programmatically accessible through a web - service . the former version of the psi - mi xml format ( 1.0 ) has been deprecated and it is no longer available for downloading . the model is normalized , meaning that the experiments and interactors are not repeated in the interaction descriptions but are first listed and then referenced by the interactions . the normalized model results in lighter files . the psi - mi xml format , in its complex structure , is not human readable but allows a complete description of molecular interactions and their experimental evidences . one of the most relevant advantages is the possibility to associate more than two proteins with an interaction , allowing the correct representation of purified complexes , without misleading binary extensions . additionally , features such as mutations , modifications or binding sites can be annotated with their sequence . the ftp site for psi - mi xml export contains two directories : pmids : a single file is generated for each publication in mint.datasets : containing xml files with the complete dataset or separate files describing interaction entries for each of the main model organisms ( human , yeast , fly and worm ) or a group of phylogenetically related organisms ( e.g. mammals ) . psi - mi xml files for large datasets containing more than 1000 interactions , such as those derived from manuscripts reporting high throughput experiments or datasets for intensively studied organisms , are split in smaller files and zipped together . datasets : containing xml files with the complete dataset or separate files describing interaction entries for each of the main model organisms ( human , yeast , fly and worm ) or a group of phylogenetically related organisms ( e.g. mammals ) . files in the psi - mitab format contain the same information , but in a tab - delimited format that can be opened in a spreadsheet software and it is easier to parse . the columns of version 2.6 are the 15 columns of version 2.5 ( see http://code.google.com/p/psimi/wiki/psimitabformat ) extended with 16 new columns ( read discussion at http://code.google.com/p/psimi/issues/detail?id=2 ) . an expansion strategy is applied in order to represent a complex of three or more proteins in a binary file format . there are two models that can be adopted to achieve this goal . on one hand , matrix model , one can represent the complex as the ensemble of all the possible binary interactions between the protein members . alternatively , spoke model , one member of the complex ( bait ) can be associated to all the remaining members ( prey ) . none of those models faithfully describes the topology of a complex , and the resulting protein pairs are not meant to represent the interaction between the protein in the complex . if the interaction on a row results from the expansion of a complex , the expansion mode ( spoke , matrix ) is specified in this field . the field is empty if the binary interaction is not the result of an expansion procedure . this allows the user to filter rows where the interaction is not supported by an experiment that is evidence for a binary interaction , or to reconstruct the complexes ( for instance by grouping rows by interaction identifier and looking at the experimental role of the components ) . ppi databases , adhering to psi mi , have commonly agreed to use the spoke model as a method to represent n - ary interaction data in a binary format during the psi - mi 2009 spring meeting . this means that if the experiment consists of the identification of many preys with a single bait ( i.e. as in tap tag technology ) , all possible bait prey interactions are represented . if , on the other hand , the role of the proteins in the experiment supporting the existence of the complex is neutral ( i.e. in the case of a complex identified by purification by co - sedimentation ) , one protein is chosen as an arbitrary bait . since we feel that this policy may be misleading for some user cases , we provide two files . exploded according to the spoke model . there is no overlap between those two files , which can be appended one to the other to obtain the full dataset . this issue is not relevant for xml files in which the representation of complexes is possible . in the last additional column , caution interaction , we export the caution annotations described in the previous paragraphs for instance if an interaction is curated with mimix standards rather than fully adhering to the imex curation manual , or if a publication has been only partially curated . finally , we provide a tab - delimited format , similar to mitab , where all the proteins forming a complex are described in a single line ( complexes are not exploded ) . in this format we list the baits or enzymes ( for enzymatic reactions ) in the first column , and the preys or enzyme targets in the second . web services allow the access to the data computationally and have become increasingly more popular in the bioinformatics community . the hupo - psi workgroup has defined a standard web service to access molecular databases : the psicquic interface . documentation about the psicquic interface , the psicquic providers and the reference implementation are available at http://code.google.com / p / psicquic/. italian association for cancer research ( airc ) , telethon and the enfin fp7 network of excellence .

mint ( http://mint.bio.uniroma2.it/mint ) is a public repository for molecular interactions reported in peer - reviewed journals . since its last report , mint has grown considerably in size and evolved in scope to meet the requirements of its users . the main changes include a more precise definition of the curation policy and the development of an enhanced and user - friendly interface to facilitate the analysis of the ever - growing interaction dataset . mint has adopted the psi - mi standards for the annotation and for the representation of molecular interactions and is a member of the imex consortium .

INTRODUCTION ANNOTATION POLICY LIGHT CURATION SISTER DATABASES A SCORING SYSTEM FOR INTERACTION CONFIDENCE WEB INTERFACE DATA AVAILABILITY FUNDING

the field of nanotechnology has been growing rapidly within various industries over the last decade . various types of nanoparticles , including titanium oxide , zinc oxide , and silica dioxide ( sio2 ) , are used in cosmetics , sports equipment , and building materials.1 due to their widespread applications in various industries , use of nanoparticles continues to increase . however , nanoparticles may be hazardous to human health because of their unusual physicochemical properties , eg , small size , high surface to volume ratio , chemical composition , crystallinity , electronic properties , surface structure reactivity and functional groups , inorganic or organic coatings , solubility , shape , and aggregation behavior.24 the risk to human health arising from exposure to nanoparticles through ingestion , inhalation , and dermal absorption may increase as the applications of nanoparticles continue to increase.57 the organization for economic cooperation and development ( oecd ) has also paid attention to this problem and organized a special session in a joint meeting on the potential implications of manufactured nanomaterials for human health and environmental safety in 2005 . the oecd established the working party on manufactured nanomaterials in 2006 for dealing with human and environmental safety issues associated with manufactured nanomaterials.8 sio2 nanoparticles have been widely used in a variety of industrial fields , including the plastics , rubber , ceramics , coatings , adhesives , and medical industries.9,10 numerous studies have reported the cytotoxicity , genotoxicity , and alterations in protein expression associated with sio2 nanoparticles in both in vitro and in vivo systems.11,12 further , it has been suggested that the genotoxicity caused by sio2 nanoparticles may be due to proinflammatory effects , modification of chromatin structure , and liberation of dnase or a potent inducer of cytogenetic damage.13,14 however , these studies were controversial due to the slightly different physicochemical features involved in the synthesis , dispersion , and stability of nanoparticles in biological media.1518 nanoparticle - related studies reported that these differences were generated by the size and surface charge of the specific nanoparticles.1922 the size of nanoparticles could influence their absorption , distribution , metabolism , and excretion.2325 the hydrodynamic size distributions of nanoparticles could be also changed by surface charge and properties , affecting agglomeration . moreover , the surface charge of nanoparticles could affect uptake and translocation within organisms.26,27 several nanotoxicology reports have proposed that more detailed characterization of nanoparticles would yield a better understanding of their properties and interactions in vivo.2830 therefore , the physicochemical features of nanoparticles would be the critical factor in studying nanotoxicology . in the present study , four genotoxicity tests were conducted with well characterized sio2 nanoparticles 20 nm ( sio2 ) and 100 nm ( sio2 ) in size , each having a negative surface charge . in order to accurately evaluate toxicity , physicochemical characterization of nanoparticles and their behavior under physiological conditions were determined by following experimental protocols similar to those used in our previous study.31 for accurate evaluation of genotoxicity , four types of in vitro and in vivo genotoxicity tests , ie , the bacterial mutation assay , in vitro chromosomal aberration test , in vivo comet assay , and in vivo micronucleus test , were performed according to oecd guidelines3234 or international validation study guideline35 with the good laboratory practice ( glp ) . all animals used in this study were cared for in accordance with the guide for the care and use of laboratory animals issued by the animal care and use committee of the national veterinary research and quarantine service . sio2 colloids 20 nm ( sio2 ) and 100 nm ( sio2 ) in size were obtained from e&b nanotech co ltd ( gyeonggi - do , republic of korea ) . the preparation process and physicochemical characterizations were conducted as described in a previous report.31 briefly , a jsm-6700f field emission scanning electron microscope ( joel ltd , tokyo , japan ) and zetasizer nanozs ( malvern instruments ltd , malvern , uk ) were used to determine the particle size , morphology , and surface charge of sio2 . the bacterial reverse mutation test was conducted in compliance with the korea food and drug administration notification no . 2009 - 116 testing guideline and oecd testing guideline 471.32 the tester strains used in this study were ames salmonella typhimurium ta98 , ta100 , ta1535 , and ta1537 , and escherichia coli wp2uvra in the absence and presence of metabolic activation system . the metabolic activation system was prepared by mixing s9 metabolic activation ( molecular toxicology inc . ) with cofactor 1 from wako pure chemical industries ltd ( osaka , japan ) , giving a final concentration of 10% ( volume / volume ) s9 . the tester strains were cultured in 2.5% nutrient broth no 2 ( oxoid ltd , basingstoke , uk ) in a 37c shaking incubator ( 120 rpm ) for approximately 11 hours . the mutagenicity test was performed by mixing test substance and tester strains , which was cultured overnight in the presence and absence of the s9 mix . next , the mixture was incubated in a water bath for 20 minutes at 37c , mixed with top agar and a minimal amount of histidine - biotin ( for s. typhimurium strains ) or tryptophan ( for e. coli strain ) , and then poured onto the surface of a gamma - ray sterile falcon petri dish ( thermo fisher scientific , waltham , ma , usa ) containing about 15 ml of solidified bottom agar . all plates were prepared in triplicate , and the results were tabulated as the mean standard deviation for each condition . the in vitro chromosomal aberration test was performed according to the korea food and drug administration notification no . 2009 - 116 testing guideline and oecd testing guideline 473.33 the clastogenicity of sio2 nanoparticles was evaluated for its ability to induce chromosomal aberrations in chinese hamster lung ( chl ) fibroblast cells . a clonal subline of chl cells was obtained from the american type culture collection ( rockville , md , usa ) . the chl cells were grown in minimum essential eagle s medium , supplemented with 10% fetal bovine serum , 50 u / ml penicillin , and 50 g / ml streptomycin ( all from gibco brl life technologies inc . , gaithersburg , md , usa ) at 37c in a humidified atmosphere containing 5% co2 . mitomycin c ( cas no . 50 - 07 - 7 ; sigma - aldrich co. , st louis , mo , usa ) was used as a positive control , both with and without the s9 mixture . after 22 hours of incubation , colcemid was added to the cultures at a final concentration of 0.2 g / ml , and meta - phase cells were harvested by trypsinization and centrifugation . the cells were swelled by adding hypotonic ( 0.075 m ) kcl solution for 20 minutes at 37c , and then washed three times in ice - cold fixative ( methanol to glacial acetic acid , 3:1 ) . a few drops of cell pellet suspension were dropped onto precleaned glass microscope slides and air - dried . the slides were stained with 5% giemsa buffer solution ( thermo fisher scientific , waltham , ma , usa ) . the classification of aberration types referred to jems - mms ( japanese environmental mutagen society - mammalian mutagenesis study group ) . aberration frequencies , defined as aberrations observed , were divided by the number of cells counted , and were analyzed using fisher s exact test with dunnett s adjustment , and compared with results from the solvent controls . the alkaline ( ph > 13 ) comet assay was conducted according to international validation of the in vivo rodent alkaline comet assay for the detection of genotoxic carcinogens ( version 14.2).35 male crl : cd ( sprague dawley [ sd ] ) rats ( aged 6 weeks ) were used for the in vivo alkaline comet assay . after a 7-day acclimation period , the test substance was administered three times by gavage at 0 , 24 , and 45 hours . the test doses ( 500 , 1,000 , and 2,000 mg / kg ) were selected by a range - finding experiment . following the guideline , ethyl methanesulfonate was used for the positive control at a dose of 200 mg / kg . the liver and stomach were collected from each animal and maintained in cold mincing buffer ( mg - free and ca - free hanks balanced salt solution ( gibco , carlsbad , ca , usa ) with 20 mm ethylenediaminetetraacetic acid ( edta)-na2 and 10% volume / volume dimethylsulfoxide ( sigma - aldridge , st louis , mo , usa ) . the forestomach was discarded , and the glandular stomach was placed into cold mincing buffer and incubated on ice for 1530 minutes . this layer was discarded subsequently , and the stomach epithelium was carefully scoured with a scraper to release the cells . the cell suspension was stored on ice for 1530 seconds to allow large clumps to settle , and the supernatant was used to prepare the comet slides . a 10 l aliquot of single cell suspension was mixed with 0.5% low melting agarose ( invitrogen , carlsbad , ca , usa ) and spread on comet assay slides ( travigen , gaithersburg , md , usa ) . the slides were immersed in cold lysis solution ( 2.5 m nacl , 100 mm edta - na2 , 10 mm tris - base , 10% dimethylsulfoxide , 1% triton - x [ ph10 ] ) overnight . after this incubation , the slides were placed in electrophoresis solution ( 0.3 m naoh , 1 mm edta [ ph > 13 ] ) for 20 minutes to allow for unwinding of dna . the slides were then immersed in neutralization solution ( 0.4 m tris - base [ ph 7.5 ] ) for at least 5 minutes and then dehydrated with absolute ethanol to fix . the cells were stained with sybr gold ( invitrogen ) according to the manufacturer s specifications . the comet was observed via fluorescence microscopy ( nikon , tokyo , japan ) at a magnification of 200 and analyzed by comet assay iv software ( perceptive instruments ltd , bury st edmunds , uk ) . for each sample ( animal / tissue ) , a positive response is defined as a statistically significant change in the percent tail dna in at least one dose group in comparison with the vehicle control value using dunnett s test ( two - sided , p<0.05 ) as well as a statistically significant linear trend test ( two - sided , p<0.05 ) . the positive control should produce a statistically significant increase as determined by the student s t - test ( one - sided , p<0.025 ) . the in vivo micronucleus test was performed in compliance with the korea food and drug administration notification no . 2009 - 116 testing guideline and oecd testing guideline 474.34 out - bred 67-week - old mice of strain icr were used in this study . the test substance was administered orally in three doses in volumes of 10 ml / kg . it was given twice with a 24-hour interval in between , and test subjects were sacrificed by cervical dislocation . preparation and staining of bone marrow was carried out according to the method described by schmid.36 in scoring the preparations , micronuclei were counted in polychromatic erythrocytes and separately in monochromatic erythrocytes . the rate of micronucleated cells , expressed as a percentage , was based on the total of polychromatic erythrocytes present in the scored optic fields . this method of scoring , which must always be followed where the test substance markedly influences the proliferation rate in bone marrow , prevented distortion of the results by the influx of peripheral blood into the damaged marrow . the scoring of micronucleated normocytes was used to recognize the presence of artifacts ( which is rare in mouse preparations ) , which provided additional interesting information on the mode of action of the test substances . generally , an incidence of more than one micronucleated normocyte per 1,000 polychromatic erythrocytes indicates an effect on cell stages , especially post - s - phase . the result of the statistical evaluation was deemed to be statistically significant when the p - value was less than 0.05 . wallis h test and dunnett s test for differences in numbers of micronucleated polychromatic erythrocytes between the treated and negative control groups ; the mann whitney u test for differences in numbers of micronucleated polychromatic erythrocytes between the positive and negative control groups ; analysis of variance and dunnett s test for differences in the polychromatic erythrocyte ( pce)/(pce + normochromatic erythrocyte [ nce ] ) ratio between the treated and negative control groups ; the student s t - test for differences in the pce/(pce + nce ) ratio between the positive and negative control groups ; and analysis of variance and dunnett s test for comparison of animal body weight at the time of euthanasia . all animals used in this study were cared for in accordance with the guide for the care and use of laboratory animals issued by the animal care and use committee of the national veterinary research and quarantine service . sio2 colloids 20 nm ( sio2 ) and 100 nm ( sio2 ) in size were obtained from e&b nanotech co ltd ( gyeonggi - do , republic of korea ) . the preparation process and physicochemical characterizations were conducted as described in a previous report.31 briefly , a jsm-6700f field emission scanning electron microscope ( joel ltd , tokyo , japan ) and zetasizer nanozs ( malvern instruments ltd , malvern , uk ) were used to determine the particle size , morphology , and surface charge of sio2 . the bacterial reverse mutation test was conducted in compliance with the korea food and drug administration notification no . 2009 - 116 testing guideline and oecd testing guideline 471.32 the tester strains used in this study were ames salmonella typhimurium ta98 , ta100 , ta1535 , and ta1537 , and escherichia coli wp2uvra in the absence and presence of metabolic activation system . the metabolic activation system was prepared by mixing s9 metabolic activation ( molecular toxicology inc . ) with cofactor 1 from wako pure chemical industries ltd ( osaka , japan ) , giving a final concentration of 10% ( volume / volume ) s9 . the tester strains were cultured in 2.5% nutrient broth no 2 ( oxoid ltd , basingstoke , uk ) in a 37c shaking incubator ( 120 rpm ) for approximately 11 hours . the mutagenicity test was performed by mixing test substance and tester strains , which was cultured overnight in the presence and absence of the s9 mix . next , the mixture was incubated in a water bath for 20 minutes at 37c , mixed with top agar and a minimal amount of histidine - biotin ( for s. typhimurium strains ) or tryptophan ( for e. coli strain ) , and then poured onto the surface of a gamma - ray sterile falcon petri dish ( thermo fisher scientific , waltham , ma , usa ) containing about 15 ml of solidified bottom agar . all plates were prepared in triplicate , and the results were tabulated as the mean standard deviation for each condition . the in vitro chromosomal aberration test was performed according to the korea food and drug administration notification no . 2009 - 116 testing guideline and oecd testing guideline 473.33 the clastogenicity of sio2 nanoparticles was evaluated for its ability to induce chromosomal aberrations in chinese hamster lung ( chl ) fibroblast cells . a clonal subline of chl cells was obtained from the american type culture collection ( rockville , md , usa ) . the chl cells were grown in minimum essential eagle s medium , supplemented with 10% fetal bovine serum , 50 u / ml penicillin , and 50 g / ml streptomycin ( all from gibco brl life technologies inc . , gaithersburg , md , usa ) at 37c in a humidified atmosphere containing 5% co2 . mitomycin c ( cas no . 50 - 07 - 7 ; sigma - aldrich co. , st louis , mo , usa ) was used as a positive control , both with and without the s9 mixture . after 22 hours of incubation , colcemid was added to the cultures at a final concentration of 0.2 g / ml , and meta - phase cells were harvested by trypsinization and centrifugation . the cells were swelled by adding hypotonic ( 0.075 m ) kcl solution for 20 minutes at 37c , and then washed three times in ice - cold fixative ( methanol to glacial acetic acid , 3:1 ) . a few drops of cell pellet suspension were dropped onto precleaned glass microscope slides and air - dried . the slides were stained with 5% giemsa buffer solution ( thermo fisher scientific , waltham , ma , usa ) . the classification of aberration types referred to jems - mms ( japanese environmental mutagen society - mammalian mutagenesis study group ) . aberration frequencies , defined as aberrations observed , were divided by the number of cells counted , and were analyzed using fisher s exact test with dunnett s adjustment , and compared with results from the solvent controls . the alkaline ( ph > 13 ) comet assay was conducted according to international validation of the in vivo rodent alkaline comet assay for the detection of genotoxic carcinogens ( version 14.2).35 male crl : cd ( sprague dawley [ sd ] ) rats ( aged 6 weeks ) were used for the in vivo alkaline comet assay . the sd rats were randomized into groups containing five rats each . after a 7-day acclimation period , the test substance was administered three times by gavage at 0 , 24 , and 45 hours . the test doses ( 500 , 1,000 , and 2,000 mg / kg ) were selected by a range - finding experiment . following the guideline , ethyl methanesulfonate was used for the positive control at a dose of 200 mg / kg . the liver and stomach were collected from each animal and maintained in cold mincing buffer ( mg - free and ca - free hanks balanced salt solution ( gibco , carlsbad , ca , usa ) with 20 mm ethylenediaminetetraacetic acid ( edta)-na2 and 10% volume / volume dimethylsulfoxide ( sigma - aldridge , st louis , mo , usa ) . the forestomach was discarded , and the glandular stomach was placed into cold mincing buffer and incubated on ice for 1530 minutes . this layer was discarded subsequently , and the stomach epithelium was carefully scoured with a scraper to release the cells . the cell suspension was stored on ice for 1530 seconds to allow large clumps to settle , and the supernatant was used to prepare the comet slides . a 10 l aliquot of single cell suspension was mixed with 0.5% low melting agarose ( invitrogen , carlsbad , ca , usa ) and spread on comet assay slides ( travigen , gaithersburg , md , usa ) . the slides were immersed in cold lysis solution ( 2.5 m nacl , 100 mm edta - na2 , 10 mm tris - base , 10% dimethylsulfoxide , 1% triton - x [ ph10 ] ) overnight . after this incubation , the slides were placed in electrophoresis solution ( 0.3 m naoh , 1 mm edta [ ph > 13 ] ) for 20 minutes to allow for unwinding of dna . the slides were then immersed in neutralization solution ( 0.4 m tris - base [ ph 7.5 ] ) for at least 5 minutes and then dehydrated with absolute ethanol to fix . the cells were stained with sybr gold ( invitrogen ) according to the manufacturer s specifications . the comet was observed via fluorescence microscopy ( nikon , tokyo , japan ) at a magnification of 200 and analyzed by comet assay iv software ( perceptive instruments ltd , bury st edmunds , uk ) . for each sample ( animal / tissue ) , a positive response is defined as a statistically significant change in the percent tail dna in at least one dose group in comparison with the vehicle control value using dunnett s test ( two - sided , p<0.05 ) as well as a statistically significant linear trend test ( two - sided , p<0.05 ) . the positive control should produce a statistically significant increase as determined by the student s t - test ( one - sided , p<0.025 ) . the in vivo micronucleus test was performed in compliance with the korea food and drug administration notification no . 2009 - 116 testing guideline and oecd testing guideline 474.34 out - bred 67-week - old mice of strain icr were used in this study . the test substance was administered orally in three doses in volumes of 10 ml / kg . it was given twice with a 24-hour interval in between , and test subjects were sacrificed by cervical dislocation . preparation and staining of bone marrow was carried out according to the method described by schmid.36 in scoring the preparations , micronuclei were counted in polychromatic erythrocytes and separately in monochromatic erythrocytes . the rate of micronucleated cells , expressed as a percentage , was based on the total of polychromatic erythrocytes present in the scored optic fields . this method of scoring , which must always be followed where the test substance markedly influences the proliferation rate in bone marrow , prevented distortion of the results by the influx of peripheral blood into the damaged marrow . the scoring of micronucleated normocytes was used to recognize the presence of artifacts ( which is rare in mouse preparations ) , which provided additional interesting information on the mode of action of the test substances . generally , an incidence of more than one micronucleated normocyte per 1,000 polychromatic erythrocytes indicates an effect on cell stages , especially post - s - phase . the result of the statistical evaluation was deemed to be statistically significant when the p - value was less than 0.05 . wallis h test and dunnett s test for differences in numbers of micronucleated polychromatic erythrocytes between the treated and negative control groups ; the mann whitney u test for differences in numbers of micronucleated polychromatic erythrocytes between the positive and negative control groups ; analysis of variance and dunnett s test for differences in the polychromatic erythrocyte ( pce)/(pce + normochromatic erythrocyte [ nce ] ) ratio between the treated and negative control groups ; the student s t - test for differences in the pce/(pce + nce ) ratio between the positive and negative control groups ; and analysis of variance and dunnett s test for comparison of animal body weight at the time of euthanasia . particle size and surface charge are significant factors when determining the biological behavior of nanoparticles.31 the physicochemical properties of sio2 nanoparticles were investigated in a previous study , as described briefly below.31 the average size and morphology of the sio2 nanoparticles was investigated by field emission scanning electron microscopy . the results showed a monodispersed size distribution and spherical morphology with a mean size of ~33 nm and ~90 nm for sio2 and sio2 , respectively . dynamic light scattering analysis was determined to be 230.1 nm and 91.60.5 nm for sio2 and sio2 , respectively . the surface charge on the sio2 nanoparticles in distilled water suspension was determined to be negative ( around 40 mv ) . in the preliminary dose - ranging tests ( data not shown ) , two kinds of sio2 nanoparticles , ie , sio2 and sio2 , were found to have a nontoxic effect in all tester strains of s. typhimurium ( ta98 , ta100 , ta1535 , and ta1537 ) and in e. coli wp2uvra at a dose of 5,000 g per plate in the presence and absence of s9 . based on the data from the preliminary dose - ranging tests , we selected 5,000 g per plate as the highest dose . as shown in table 1 , none of the tester strains showed any increase in the number of revertant colonies in comparison with the solvent control ( 0 g per plate ) when the bacteria were treated with the two types of sio2 nanoparticles at 313 , 625 , 1,250 , 2,500 , and 5,000 g per plate , regardless of metabolic activation . on the other hand , the positive control group resulted in more revertant colonies than the solvent control or other sio2 treatment groups . initially , a dose - ranging test was performed to determine the test doses for use in the in vitro chromosome aberration test . the highest concentration was determined to be 1,400 g / ml , as it showed less than 50% cytotoxicity in chl cells ( data not shown ) . the in vitro chromosome aberration test was conducted with sio2 and sio2 at concentrations of 175 , 350 , 700 , and 1,400 g / ml , both with and without metabolic activation ( s9 ) . except for the positive control group , the results indicated no significant increase in sio2 nanoparticles in the treatment groups in comparison with the solvent control at the four concentrations , regardless of metabolic activation ( table 2 ) . on the other hand , the positive control group showed significantly increased structural aberrations in comparison with the solvent control and with the other sio2 treatment groups . a dose - ranging study was conducted in sd rats ( data not shown ) , and the test doses were determined as 500 , 1,000 , and 2,000 mg / kg body weight . dna damage was measured by the in vivo alkaline comet assay , following the international validation study protocol ( version 14.2).35 our data showed no significant differences in percent tail dna in single cells from the liver and stomach treated with sio2 ( figure 1a ) and sio2 ( figure 1b ) . the positive control showed a significant increase in tail dna intensity ( percent tail dna ) in comparison with the negative control . therefore , no genotoxic effect of sio2 nanoparticles ( sio2 and sio2 ) was observed using the in vivo comet assay . in the preliminary dose - ranging test , acute oral toxicity , death , or apparent abnormality in appearance could not be determined in mice at doses ranging from 500 mg / kg to 2,000 mg / kg body weight . the pce/(nce + pce ) ratios were used as an index of bone marrow cytotoxicity . the ratios did not show any significant difference in the sio2 treatment groups in comparison with the solvent control group , for either size of sio2 nanoparticle . the micronucleated pce frequencies were not statistically significant and did not yield any dose - dependent pattern among the three treatment groups in comparison with the solvent control group for either size of sio2 nanoparticle . on the other hand , the positive control group showed a significantly increased micronucleated pce frequency in comparison with the solvent control and sio2 treatment groups ( table 3 ) . therefore , both types of sio2 nanoparticles were regarded to have no genotoxic or cytotoxic potential using the current in vivo system . particle size and surface charge are significant factors when determining the biological behavior of nanoparticles.31 the physicochemical properties of sio2 nanoparticles were investigated in a previous study , as described briefly below.31 the average size and morphology of the sio2 nanoparticles was investigated by field emission scanning electron microscopy . the results showed a monodispersed size distribution and spherical morphology with a mean size of ~33 nm and ~90 nm for sio2 and sio2 , respectively . dynamic light scattering analysis was determined to be 230.1 nm and 91.60.5 nm for sio2 and sio2 , respectively . the surface charge on the sio2 nanoparticles in distilled water suspension was determined to be negative ( around 40 mv ) . in the preliminary dose - ranging tests ( data not shown ) , two kinds of sio2 nanoparticles , ie , sio2 and sio2 , were found to have a nontoxic effect in all tester strains of s. typhimurium ( ta98 , ta100 , ta1535 , and ta1537 ) and in e. coli wp2uvra at a dose of 5,000 g per plate in the presence and absence of s9 . based on the data from the preliminary dose - ranging tests , we selected 5,000 g per plate as the highest dose . as shown in table 1 , none of the tester strains showed any increase in the number of revertant colonies in comparison with the solvent control ( 0 g per plate ) when the bacteria were treated with the two types of sio2 nanoparticles at 313 , 625 , 1,250 , 2,500 , and 5,000 g per plate , regardless of metabolic activation . on the other hand , the positive control group resulted in more revertant colonies than the solvent control or other sio2 treatment groups . initially , a dose - ranging test was performed to determine the test doses for use in the in vitro chromosome aberration test . the highest concentration was determined to be 1,400 g / ml , as it showed less than 50% cytotoxicity in chl cells ( data not shown ) . the in vitro chromosome aberration test was conducted with sio2 and sio2 at concentrations of 175 , 350 , 700 , and 1,400 g / ml , both with and without metabolic activation ( s9 ) . except for the positive control group , the results indicated no significant increase in sio2 nanoparticles in the treatment groups in comparison with the solvent control at the four concentrations , regardless of metabolic activation ( table 2 ) . on the other hand , the positive control group showed significantly increased structural aberrations in comparison with the solvent control and with the other sio2 treatment groups . a dose - ranging study was conducted in sd rats ( data not shown ) , and the test doses were determined as 500 , 1,000 , and 2,000 mg / kg body weight . dna damage was measured by the in vivo alkaline comet assay , following the international validation study protocol ( version 14.2).35 our data showed no significant differences in percent tail dna in single cells from the liver and stomach treated with sio2 ( figure 1a ) and sio2 ( figure 1b ) . the positive control showed a significant increase in tail dna intensity ( percent tail dna ) in comparison with the negative control . therefore , no genotoxic effect of sio2 nanoparticles ( sio2 and sio2 ) was observed using the in vivo comet assay . in the preliminary dose - ranging test , acute oral toxicity , death , or apparent abnormality in appearance could not be determined in mice at doses ranging from 500 mg / kg to 2,000 mg / kg body weight . the pce/(nce + pce ) ratios were used as an index of bone marrow cytotoxicity . the ratios did not show any significant difference in the sio2 treatment groups in comparison with the solvent control group , for either size of sio2 nanoparticle . the micronucleated pce frequencies were not statistically significant and did not yield any dose - dependent pattern among the three treatment groups in comparison with the solvent control group for either size of sio2 nanoparticle . on the other hand , the positive control group showed a significantly increased micronucleated pce frequency in comparison with the solvent control and sio2 treatment groups ( table 3 ) . therefore , both types of sio2 nanoparticles were regarded to have no genotoxic or cytotoxic potential using the current in vivo system . nanotoxicity studies have been necessary , although their results are still controversial due to variations in the physicochemical properties of the materials under investigation.1921,3739 further , their results could differ according to the protocol used for evaluation . hence , well characterized nanoparticles and approved methods are necessary when conducting nanotoxicity studies . in this study , nanogenotoxicity was investigated using well characterized sio2 nanoparticles , ie , sio2 and sio2 . characterization of these nanoparticles and their behavior was done under physiological conditions , as described in our previous study.31 next , four different end point genotoxic tests , ie , the bacterial mutation assay , in vitro chromosomal aberration test , in vivo alkaline comet assay , and in vivo micronucleus test , were conducted in accordance with oecd guidelines and an international validation study protocol using the glp system . the bacterial mutation assay is used to evaluate the mutagenicity of a chemical compound.1 it is also reported to be an essential test within the current battery of assays required for evaluation of genotoxicity.40 to date , there have been a few reports on the mutagenicity of nanoparticles such as aluminum oxide , cobalt oxide , titanium oxide , and zinc oxide based on the bacterial mutation assay . hence , we performed this assay using strains of s. typhimurium ta98 , ta100 , ta1535 , and ta1537 , and e. coli wp2uvra , with and without metabolic activation by s9 mixture.4143 it has recently been reported that no mutagenic potential is observed in the ames test with and without metabolic activation.4446 in addition , li et al investigated the genotoxic potential of exfoliated silicate nanoclay.47 our data also showed no significantly increased mutagenicity in any of the strains exposed to sio2 and sio2 with and without s9 ( table 1 ) . the in vitro chromosomal aberration test is another standard genotoxicity test , and is commonly used to observe variations in chromosomal structure induced by toxic chemicals.33 our data show that sio2 and sio2 did not induce any structural chromosomal aberrations in chl cells , with or without s9 mixture ( table 2 ) . another previous report showed no induction of chromosomal aberrations in mammalian cells.4446 although different types of sio2 were used in the previous studies , similar results were obtained . hence , sio2 nanoparticles might not induce clastogenesis in mammalian cells . in vitro genotoxicity tests the in vivo alkaline comet assay and in vivo micronucleus test were included in the current study in order to conduct and evaluate genotoxicity tests accurately . the comet assay , a single cell gel electrophoresis assay , has been widely used for detection of dna damage due to its simplicity , low cost , and high sensitivity.48 the in vivo comet assay has been regarded as a potential replacement for the in vivo rodent hepatocyte unscheduled dna synthesis assay , and the protocol for the in vivo comet assay has been standardized and published by an international expert group . in the present study , the in vivo comet assay was conducted using sio2 and sio2 and followed the standard protocol , revealing no genotoxic effect of sio2 and sio2 in rat liver and stomach cells ( figure 1a and 1b ) . even though the majority of the studies have reported negative results for the genotoxicity of sio2,11,17,47 a few investigations have indicated otherwise.49 downs et al investigated the genotoxic effects of exposure to three consecutive intravenous injections of sio2 nanoparticles by in vivo comet assay in rat liver and lung tissues , and observed the induction of dna damage by sio2.50 hence , the different administration route can lead to different results for genotoxicity evaluation . the micronucleus test was used to evaluate genotoxicity by scoring the number of micronuclei under chemical exposure . regarding the genotoxicity induced by sio2 nanoparticles , several publications have reported on in vitro micronucleus tests.11,15,47,51,52 in contrast , downs et al conducted in vivo micronucleus testing of sio2 nanoparticles , where they analyzed micronuclei in rat blood.50 in the present study , in vivo micronucleus testing was performed with rat bone marrow cells for the first time to determine whether sio2 and sio2 could induce chromosome abnormalities or mitotic apparatus in mouse model . based on the frequencies of micronucleated pce , no genotoxic effect of sio2 was found ( table 3 ) . nanotoxicology study results can be influenced by physicochemical properties , and the contrast between our results and the previous data could be due to the different administration methods used or different organs investigated , as mentioned above . in the present study , the genotoxic effects of sio2 and sio2 were elucidated using four genotoxicity tests , ie , the bacterial mutation assay , in vitro chromosomal aberration test , in vivo comet assay , and in vivo micronucleus test , under standardized protocols with glp system . although the different exposure routes from our study can induce sio2 genotoxicity in different organs in in vivo systems , our data suggest that sio2 and sio2 are not genotoxic substances based on the oecd test guidelines .

backgroundsilica dioxide ( sio2 ) has been used in various industrial products , including paints and coatings , plastics , synthetic rubbers , and adhesives . several studies have investigated the genotoxic effects of sio2 ; however , the results remain controversial due to variations in the evaluation methods applied in determining its physicochemical properties . thus , well characterized chemicals and standardized methods are needed for better assessment of the genotoxicity of nanoparticles.methodsthe genotoxicity of sio2 was evaluated using two types of well characterized sio2 , ie , 20 nm ( ) charge ( sio en20()2 ) and 100 nm ( ) charge ( sio en100()2 ) . four end point genotoxicity tests , ie , the bacterial mutation assay , in vitro chromosomal aberration test , in vivo comet assay , and in vivo micronucleus test , were conducted following the test guidelines of the organization for economic cooperation and development ( oecd ) with application of good laboratory practice.resultsno statistically significant differences were found in the bacterial mutation assay , in vitro chromosomal aberration test , in vivo comet assay , and in vivo micronucleus test when tested for induction of genotoxicity in both two types of sio2 nanoparticles.conclusionthese results suggest that sio2 nanoparticles , in particular sio2en20( ) and sio2en100( ) , are not genotoxic in both in vitro and in vivo systems under oecd guidelines . further , the results were generated in accordance with oecd test guidelines , and good laboratory practice application ; it can be accepted as reliable information regarding sio2-induced genotoxicity .

Introduction Materials and methods Animal care Preparation and characterization of nanoparticles Bacterial reverse mutation test In vitro chromosomal aberration test In vivo alkaline comet assay In vivo micronucleus test Results Characterization of nanoparticles Bacterial reverse mutation test In vitro chromosome aberration test In vivo alkaline comet assay In vivo micronucleus test Discussion Conclusion

portal - systemic encephalopathy ( pse ) is frequently recognized by hyperammonemia in patients with portal - systemic shunt ( pss ) due to chronic hepatitis and cirrhosis . it is very rarely seen in patients with congenital intrahepatic pss without cirrhosis ( ipsswoc).1 many elderly patients with psychiatric symptoms frequently visit outpatient clinics of general medicine , but the diagnosis of ipsswoc is often difficult to obtain because symptoms of pse and hyperammonemia levels are inconstant . a 74-year - old man with behavior abnormalities ( indoor urination and poriomania ) was referred to our hospital for further examination . when the symptoms suddenly occurred before 1.5 months , head magnetic resonance imaging in some neighbor clinic ruled out brain lesions . a psychiatric disorder was suspected and quetiapine was prescribed , but his condition did not improve . after 2 weeks , an electroencephalogram was examined and showed general continuous slow wave patterns , and his blood test revealed hyperammonemia ( 218 g / dl ) in the previous clinic . hepatic encephalopathy ( he ) was suspected , but his psychiatric symptoms diminished spontaneously without any specific treatment by the time of his first visit to us . his consciousness was normal on examinations . he did not exhibit any neurological abnormal findings and any assertive symptoms associated with chronic hepatitis or cirrhosis , including flapping tremor , but his family quite a few times witnessed his behavior abnormalities . he had severe constipation and regularly used laxatives . at his second visit , he looked normal , but his venous ammonia level ( 135 g / dl ) was high again . contrast computed tomography of the abdomen revealed a large right portal - middle hepatic venous shunt ( figure 1 , striped arrows ) and a left portal - left hepatic venous shunt ( figure 1 , dotted arrows ) . he was diagnosed with ipsswoc , type ia on the watanabe classification.1 considering his age and complications from the curative operation , conventional medical therapy was indicated . we advised him to take laxative and water for avoiding constipation and dehydration to prevent hyperammonemia . during 1.5 years of follow - up congenital ipsswoc is very rare and easily misdiagnosed as psychiatric disorders because both symptoms resemble each other . this case was type b of he according to international society for hepatic encephalopathy and nitrogen metabolism ( ishen ) practice guidelines.2 we did not examine blood citrulline in the present case , but type d of he ( urea - cycle disorders ) could be ruled out because of elder age and clinical finding.3 precipitating factors of he ( eg , excess protein , infection , diuretics , hyponatremia , acidosis , gastrointestinal bleeding , trauma , sedatives ) worsen the relevant components ( hyperammonemia , hyponatremia , inflammatory cytokines , benzodiazepines ) and oxidative stress derived brain damages.4 hyperammonemia is an important diagnostic clue to diagnose acute liver dysfunction ; however , blood ammonia level does not always correlate with degrees of pse in chronic liver disease.5 encephalopathy from ipsswoc intermittently occurs in the elderly , probably because of the irregular susceptibility of the brain to ammonia by aging.6,7 to understand the correlation between blood ammonia levels and the pse , we extracted japanese congenital or idiopathic pss without cirrhosis cases from the national center for biotechnology information literature search sites3,820 and estimated grades of pse based on the symptoms described in them according to the guideline21 ( table 2 ) . there was a moderate correlation between blood ammonia levels and the estimated grades of pse of pss without cirrhosis ( figure 2 , r = 0.495 ) . we should note that repeated ammonia blood tests are important for the diagnosis of ipsswoc in elderly patients when they present psychiatric symptoms because blood ammonia level could be changeable according to daily activity and because of the factors of hyperammonemia . limitation is that the grade of pse was estimated only through the information described in each paper . it is important to investigate how many blood ammonia tests are needed to not overlook ipsswoc .

we report an elderly male patient with hyperammonemia induced by intrahepatic portal - systemic shunt without cirrhosis ( ipsswoc ) . the occasional emergence of his erratic behaviors was misdiagnosed as a psychiatric disorder . regardless of his uneven symptoms , ipsswoc was suspected due to his hyperammonemia . the contrast computed tomography of the abdomen revealed a congenital type of ipsswoc . as blood ammonia levels are inconstant , repeated blood tests are recommended when this disease is suspected in elderly patients with psychiatric symptoms .

Introduction Case Discussion

women with unresectable chest wall recurrence ( cwr ) of breast cancer are challenging patients to treat . they often receive doxorubicin , as it has considerable efficacy and is the most frequently used systemic agent for breast cancer [ 14 ] . when patients treatments fail following prior radiation and anthracycline therapy , clinicians face a dilemma as to what systemic agents and/or treatment modalities to use . here we describe the combination of mild hyperthermia with a thermally sensitive doxorubicin containing liposome for patients with chest wall recurrences of breast cancer . the logic for this combination is multifold : 1 ) low temperature sensitive liposomal formulations of doxorubicin ( ltld ) have been engineered to rapidly release high concentrations of drug when exposed to temperatures ranging from 39.5 to 42.0 c [ 57 ] . these liposomes exhibit enhanced drug delivery to tumour tissue as a result of intravascular release . 2 ) hyperthermia partially reverses drug resistance to doxorubicin and increases perfusion , which should enhance drug delivery . 3 ) there is a strong clinical indication for increasing the local control rate in patients with cwr . morbidities associated with local recurrence of breast cancer on the chest wall include pain , ulceration , odour , bleeding , lymphoedema and the psychological distress of having visible local disease . local therapies such as re - irradiation with hyperthermia can achieve control in some patients . although many patients with chest wall recurrences present with metastatic disease , a proportion can achieve durable local control and alleviation of symptoms . the objectives of this study were 1 ) to identify the maximum tolerated dose ( mtd ) of ltld , ( thermodox ) in the setting of local regionally recurrent disease in a heavily pretreated population , 2 ) to analyse pharmacokinetics ( pk ) when combined with local hyperthermia in multiple cycle dosing , and 3 ) to provide initial assessment of anti - tumour activity . the mtd was found to be 50 mg / m , after two dose - limiting toxicities were seen at a dose of 60 mg / m ( grade 3 alt increase , and grade 4 neutropenia ) . trial a was an investigator - sponsored trial at duke university medical center which ran from may 2006 to january 2010 and treated 18 patients . one other patient discontinued without completing cycle 1 due to a grade 2 hypersensitivity reaction to ltld that resolved without sequelae ( described in detail in the results section ) . trial b was a multi - center phase i trial sponsored by celsion , conducted from april 2009 to march 2011 . for both trials all women had histologically documented recurrent / metastatic adenocarcinoma of the breast , <3 cm thick , to allow adequate heating . patients with distant metastatic disease and/or inflammatory disease were allowed . all had to have progressed after at least one course of hormonal therapy , provided their tumour was oestrogen ( er ) or progesterone ( pr ) positive . all patients had to have also received prior radiotherapy to their chest wall or breast either in the adjuvant or metastatic setting ; no radiotherapy was to be administered to the area of recurrence within 14 days prior to enrolment . patients had to have had systemic chemotherapy for recurrent disease ( 1 regimen in trial a , 2 regimens in trial b ) . all women had to be 18 years of age , not pregnant , able to provide consent , and have a zubrod performance status of 01 . haematological indices had to be within normal limits and baseline muga / echocardiogram assessed left ventricular ejection fraction ( lvef ) must have been 50% . previous doxorubicin and epirubicin must not have exceeded 450 mg / m and 900 mg / m , respectively . this limit is based on the dose equivalency for cardiotoxicity being 2:1 for doxorubicin to epirubicin . the only time dose escalated was when the prior level was found to be safe in a previous cohort . then the entire next cohort of patients started and stayed at the next higher level dose increment . prior to each treatment cycle , subjects received a 24-h prophylactic premedication regime designed to reduce immediate hypersensitivity reactions . patients were to receive six cycles of ltld every 2135 days , followed immediately by local hyperthermia to the chest wall . in trial a , the initial dose level was 20 mg / m and sequential dose levels were to be 30 , 40 , 50 , and 60 mg / m , given intravenously over 30 min . in trial b , the two dose levels were 40 and 50 mg / m ; if no more than one of six patients had a dose - limiting toxicity ( dlt ) at 50 mg / m , then that dose level would be the mtd . ltld was not planned to exceed the established mtd of 50 mg / m dose level . all patients were premedicated with a standardised regimen including dexamethasone , diphenhydramine and an antacid . dexamethasone 10 mg per os twice a day three doses ( the third dose was the morning of treatment ) . approximately 1 h prior to the administration of the study drug , 500 ml of normal saline was infused intravenously \(iv ) . approximately 30 min prior to the administration of the study drug , all of the patients received dexamethasone , diphenhydramine , and ranitidine . hyperthermia treatments were to be given within 3060 min after completion of the ltld infusion , using fda - approved microwave or ultrasound superficial hyperthermia devices able to cover the target volume with a maximum of two hyperthermia fields . we used 915 mhz microwave applicators , with the bsd 500 ( salt lake city , ut ) commercial hyperthermia system . the applicator sizes available for use were a 19 10 cm , 15 8 cm , and a circular 6 cm applicator . an area of 16 8 cm falls within the 25% iso - sar ( specific absorption rate ) for the largest applicator . the hyperthermia dose goal was to maintain 40.042.0 c in greater than 90% of measured points for approximately 60 min duration . maximum allowable temperatures in normal and tumour tissues were 44.0 c and 45.0 c , respectively . toxicities were assessed using the us national cancer institute common terminology criteria for adverse events , v3.0 . to be evaluable for mtd , patients must have completed the first day of cycle 3 ( days 143 ) or withdrawn due to a dlt . haematological dlts included grade 4 thrombocytopenia , febrile neutropenia , or grade 4 neutropenia 5 days in duration ( 7 days in trial non - hematological dlts included grade 3 toxicities ( except alopecia , nausea , and vomiting ) ; in trial b , grade 3 fatigue was not a dlt . secondary end points included characterising the safety and pharmacokinetic profile of ltld in multiple cycle dosing and computing the local objective response rate . all subjects were assessed for safety with treatment - emergent adverse events ( aes ) , muga scans or echocardiograms ( each patient had the same test done on all occasions ) , physical exams , vital signs , and laboratory measurements ( including clinical chemistry , haematology , and urinalysis ) . subjects were evaluated for efficacy at baseline , at cycles 3 and 5 , and 2142 days after cycle 6 . for the patients with recurrent chest wall disease there are limited imaging techniques that can assist clinicians in deciding the course of therapy and in evaluating the effectiveness of chemotherapeutic agents . in trial a , digital infrared imaging ( dii ) was tested for its ability to estimate response and/or progression inside and outside the heated fields . patients were imaged in a temperature controlled room with a digital infrared camera ( irsnapshot , fluke , everett , wa ) at baseline , prior to cycles 3 , 5 , and post - cycle 6 . regions of interest ( roi ) were selected around the heated target lesions ( tl ) and non - heated target lesions ( ntl ) defined by the treating physician . the average and maximum temperatures in each roi were recorded for baseline and for each subsequent post - treatment image . in trial a , pk blood specimens were drawn in cycles 1 and 2 at approximately 0 , 0.25 , 0.5 ( end of infusion ) , 0.75 , 1.0 , 1.25 , 2 , 3 , 4 , 6 , 24 and 48 h and on days 4 and 8 . we measured levels of doxorubicin and doxorubicinol , the latter being an active metabolite implicated in the cardiotoxicity of doxorubicin . urine specimens were collected before the start of the infusion and at approximately 2 , 4 , and 24 h and on days 4 and 8 . in trial b , pk was assessed during the first two cycles of study drug administration by drawing four blood samples ( 4 ml each ) at specified time intervals of 30 2 min ( i.e. at the end of the infusion ) and at 5 0.5 h , 10 1 h , and 24 1 h following the start of the infusion . thermal dosimetry was summarised as the tenth percentile of the temperature distribution of all sensors , or t90 , meaning the temperature that is exceeded by 90% of all measurements ( using fibreoptic thermometers ) for each treatment . two - tailed exact non - parametric tests are used for dose response analysis and for comparing the two trials in demographics , treatments , and outcomes . patients in the two trials were similar on all 11 demographic and pretreatment characteristics except that trial a subjects had fewer total prior treatments ( table 1 , p = 0.0133 ) and a shorter time from cwr to first ltld treatment ( p = 0.0046 ) . table 1.summary of baseline characteristics.characteristiccombined ( n = 29)trial a ( n = 18)trial b ( n = 11)p valueage ( years)0.1042 mean57.859.155.6 standard deviation8.29.74.7 minimum424249.2 median57.460.554.8 maximum757566.8oestrogen receptor ( er ) status ( % ) 1.0000 negative19 ( 65.5)12 ( 66.7)7 ( 63.6 ) positive9 ( 31.0)5 ( 27.8)4 ( 36.4 ) not assessed / unknown1 ( 3.4)1 ( 5.6)0 ( 0.0)progesterone receptor ( pr ) status ( % ) 0.6525 negative22 ( 75.9)14 ( 77.8)8 ( 72.7 ) positive6 ( 20.7)3 ( 16.7)3 ( 27.3 ) not assessed / unknown1 ( 3.4)1 ( 5.6)0 ( 0.0)her2 status ( % ) 0.1535 negative21 ( 72.4)15 ( 83.3)6 ( 54.5 ) positive6 ( 20.7%2 ( 11.1)4 ( 36.4 ) not assessed / unknown2 ( 6.9)1 ( 5.6)1 ( 9.1)triple negative for er , pr , and her2 ( n , % ) 0.1212 no12 ( 41.4)5 ( 27.8)7 ( 63.6 ) yes16 ( 55.2)12 ( 66.7)4 ( 36.4 ) not assessed / unknown1 ( 3.4)1 ( 5.6)0 ( 0.0)distant metastases at baseline ( % ) 0.2490 no16 ( 55.2)8 ( 44.4)8 ( 72.7 ) yes3 ( 44.8)10 ( 55.6)3 ( 27.3)time from initial diagnosis to chest wall recurrence ( years)0.2515 mean4.13.84.6 standard deviation3.74.23.1 minimum0.50.50.7 median2.61.63.1 maximum12.512.510.4time from chest wall recurrence to first study treatment ( months)0.0046 mean13.75.027.9 standard deviation24.95.436.5 minimum0.00.00.2 median7.42.413.5 maximum125.417.6125.4total number of prior treatments for breast cancer ( % ) 0.0133 12 ( 6.9)2 ( 11.1)0 ( 0.0 ) 26 ( 20.7)5 ( 27.8)1 ( 9.1 ) 310 ( 34.5)7 ( 8.9)3 ( 27.3 ) 47 ( 24.1)3 ( 16.7)4 ( 36.4 ) 51 ( 3.4)1 ( 5.6)0 ( 0.0 ) 62 ( 6.9)0 ( 0.0)2 ( 18.2 ) 121 ( 3.4)0 ( 0.0)1 ( 9.1)prior anthracycline exposure ( mg / m)0.7233 mean304.1307.1 299.2 standard deviation115.4101.5 140.7 minimum80222 80.0 median256.5275 251.5 maximum570570 555.0 prior radiation exposure ( cgy)0.7913 mean644961007021 standard deviation2455812.23895 minimum198045001980 median610061106040 maximum16 810738016 8101exact wilcoxon - mann - whitney test , two - tailed.2fisher s exact test , two - tailed.3excludes one subject who reportedly received a single anthracycline treatment of unknown dose.4excludes one subject each whose prior anthracycline dose was reported as unknown and as not assessed . summary of baseline characteristics excludes one subject each whose prior anthracycline dose was reported as unknown and as not assessed . most subjects ( 55.2% ) were triple negative and 44.8% had distant metastases at baseline . the mean and median prior anthracycline exposures were 304.1 mg / m and 256.5 mg / m , respectively ; the minimum total dose was 80.0 mg / m while the maximum was 570.0 mg / m . the mean and median prior radiation exposures were 64.49 gy and 61 gy respectively ; the minimum total dose was 19.80 gy while the maximum was 168.10 gy . both trials were similar in number of study treatments completed and in thermal doses ( table 2 ) . the thermal dose goal was to reach a temperature between 40 and 42 c in greater than 90% of measured points ( t90 ) for approximately 60 min duration . a total of 165 hyperthermia fields were treated . of these 165 hyperthermia treatment fields , 58 ( 35.2% ) had a t90 of less than 40.0 c and the other 107 ( 64.8% ) had a t90 between 40.0 and 42.9 c . of all 165 treatment fields , 33 ( 20% ) had a t90 below 39.5 c , the minimum temperature needed to release doxorubicin from ltld . eleven ( 37.9% ) of 29 subjects had at least one treatment field with a t90 below 39.5 c . table 2.summary of study treatment.characteristiccombined ( n = 29)trial a ( n = 18)trial b ( n = 11)p valuetotal number of study treatments ( % ) 0.7004 11 ( 3.4)1 ( 5.5)0 ( 0.0 ) 28 ( 27.6)5 ( 27.8)3 ( 27.3 ) 34 ( 13.8)1 ( 5.5)3 ( 27.3 ) 45 ( 17.2)3 ( 16.7)2 ( 18.2 ) 51 ( 3.4)1 ( 5.5)0 ( 0.0 ) 610 ( 34.5)7 ( 38.9)3 ( 27.3)combined ( n = 165)trial a ( n = 112)trial b ( n = 53 ) p valuet90 for each hyperthermia treatment field ( % ) 0.4853 < 40.0 c58 ( 35.2)37 ( 33.0)21 ( 39.6 ) 40.042.9 c107 ( 64.8)75 ( 67.0)32 ( 60.4 ) 43.0 c0 ( 0.0)0 ( 0.0)0 ( 0.0)1exact wilcoxon - mann - whitney test , two - tailed.2fisher s exact test , two - tailed . summary of study treatment . exact wilcoxon - mann - whitney test , two - tailed . fisher s exact test , two - tailed . thirteen subjects were evaluable for mtd in trial a and 10 in trial b. in trial a , dose escalation continued to the 40 mg / m dose level , at which time trial b initiated at 40 mg / m prior to reaching a mtd . in trial a , one patient experienced a grade 2 hypersensitivity reaction that included a drug - related fever at 30 mg / m ; this was considered a dlt . two of seven subjects at 40 mg / m experienced a dlt ( grade 4 neutropenia lasting > 5 days and grade 3 dehydration requiring hospitalisation for support for 27 days ) . in trial b , one of six patients at the 50 mg / m dose level had a dlt ( grade 3 hypokalaemia unrelated to study treatment ) , so the mtd was 50 mg / m . five of the six non - evaluable patients withdrew due to progression of disease during the first two treatment cycles and one for an unrelated adverse event . grade 4 toxicity was only observed in three ( 10.3% ) patients with neutropenia and two ( 6.9% ) with a neutrophil count decrease ( table 3 ) . grade 3 toxicity included six patients ( 20.7% ) with a neutrophil count decrease , five ( 17.2% ) with neutropenia , four ( 13.8% ) with leucopenia , and three ( 10.3% ) with a white blood cell count decrease . all other grade 3 toxicities consisted of a single case of each of the following : anaemia , lymphopenia , thrombocytopenia , dehydration , axillary pain , fatigue , cellulitis , third degree burn adjacent to a silicone implant ( trial b ) , activated partial thromboplastin time - prolonged , haemoglobin decreased , hypokalaemia , back pain , musculoskeletal chest pain , musculoskeletal pain , and lymphoedema . two subjects , both in trial b , experienced first degree thermal burns that were managed conservatively and healed . ( subjects are counted only once within each system - organ class and preferred term , at the highest severity grade experienced . n = 29.).system - organ class / preferred termgrade 3 n ( % ) grade 4 n ( % ) grade 34 total n ( % ) blood and lymphatic system disorders1 ( 3.4)0 ( 0.0)1 ( 3.4 ) anaemia4 ( 13.8)0 ( 0.0)4 ( 13.8 ) leukopenia1 ( 3.4)0 ( 0.0)1 ( 3.4 ) lymphopenia5 ( 17.2)3 ( 10.3)8 ( 27.6 ) neutropenia1 ( 3.4)0 ( 0.0)1 ( 3.4 ) thrombocytopeniageneral disorders and administration site conditions axillary pain1 ( 3.4)0 ( 0.0)1 ( 3.4 ) fatigue1 ( 3.4)0 ( 0.0)1 ( 3.4)infections and infestations cellulitis1 ( 3.4)0 ( 0.0)1 ( 3.4)injury , poisoning , and procedural complications burns third degree1 ( 3.4)0 ( 0.0)1 ( 3.4)investigations activated partial thromboplastin time - prolonged1 ( 3.4)0 ( 0.0)1 ( 3.4 ) haemoglobin decreased1 ( 3.4)0 ( 0.0)1 ( 3.4 ) neutrophil count decreased6 ( 20.7)2 ( 6.9)8 ( 27.6 ) white blood cell count decreased3 ( 10.3)0 ( 0.0)3 ( 10.3)metabolism and nutrition disorders dehydration1 ( 3.4)0 ( 0.0)1 ( 3.4 ) hypokalaemia1 ( 3.4)0 ( 0.0)1 ( 3.4)musculoskeletal and connective tissue disorders back pain1 ( 3.4)0 ( 0.0)1 ( 3.4 ) musculoskeletal chest pain1 ( 3.4)0 ( 0.0)1 ( 3.4 ) musculoskeletal pain1 ( 3.4)0 ( 0.0)1 ( 3.4)vascular disorders lymphoedema1 ( 3.4)0 ( 0.0)1 ( 3.4 ) combined summary of grade 34 adverse events . ( subjects are counted only once within each system - organ class and preferred term , at the highest severity grade experienced . there were no clinically significant cardiac toxicities ; however , in trial b , one asymptomatic decline in lvef from 55% to 45% was recorded after six ltld treatments and a prior anthracycline exposure of 240 mg / m . in addition , there were no cases of hand foot syndrome , which has been reported with the use of non - temperature - sensitive liposomal doxorubicin . plasma concentrations of doxorubicin achieved their maximum at the end of the 30-min infusion and subsequently declined rapidly ( figure 1 ) . as expected , plasma concentration of doxorubicin increased with each subsequent dose level ( table 4 ) . the near superimposition of curves for cycles 1 and 2 demonstrate that there was no accumulation of drug between cycles . the average plasma clearance of doxorubicin was 1.3 l / min / m , but there was considerable heterogeneity among patients . the average terminal plasma half - life for all patients was 35.15 min , but ranged from 9.26 to 45.27 min . there was no statistically significant difference between these variables among the various dose cohorts . figure 1.pharmacokinetic profiles for cycles 1 and 2 at each dose level for doxorubicin and its cardiotoxic metabolite , doxorubicinol . the half - life of the drug was the same for cycle 1 and cycle 2 and was not dependent upon doxorubicin dose . ( h)tmax ( h)cmax ( ng / ml)cmax/ d ( ng / ml / mg / m)auclast ( ng h / ml)auc/ d ( ng / h / ml / mg / m)vz ( l)cl ( l / h)tmax ( h)cmax ( ng / ml)auc/ d ( ng / h / ml / mg / m)doxorubicin 20 mg / m n = 3 patients ( cycle 1)doxorubicinolmean34.750.73311 10055717 6008821072.204.0010.229.3cv % 44.520.501.8315.3015.3011.5211.5341.8714.463.084.0027.6040.20doxorubicin 30 mg / m n = 6 patients ( cycle 1)doxorubicinolmean37.200.52516 20053925 0008341242.265.0013.826.6cv % 19.540.500.7524.2524.2524.6524.5739.3428.743.006.0838.4940.38doxorubicin 40 mg / m n = 9 patients ( cycle 1)doxorubicinolmean33.520.61718 40046032 9008241202.463.0022.328.8cv % 22.750.501.0021.1221.1227.8327.8039.0729.792.0024.2039.0735.12auclast , area under the curve to the last measured plasma concentration ; auc/d , auc extrapolated to infinity divided by dose ; cl , clearance ; cmax , maximum plasma concentration ; d , dose ; t1/2 , terminal exponential half life ; tmax , time to cmax ; vz , terminal phase volume of distribution . pharmacokinetic profiles for cycles 1 and 2 at each dose level for doxorubicin and its cardiotoxic metabolite , doxorubicinol . the half - life of the drug was the same for cycle 1 and cycle 2 and was not dependent upon doxorubicin dose . trial a. auclast , area under the curve to the last measured plasma concentration ; auc/d , auc extrapolated to infinity divided by dose ; cl , clearance ; cmax , maximum plasma concentration ; d , dose ; t1/2 , terminal exponential half life ; tmax , time to cmax ; vz , terminal phase volume of distribution . for trial b sparse sampling results include the mean cmax of doxorubicin ranged from 19 800 to 25 400 ng / ml in the 40 to the 50 mg / m dose range and between cycles . the mean cmax of doxorubicinol ranged from 19.6 to 21.9 ng / ml in the 4050 mg / m dose range and between cycles . both doxorubicin and doxorubicinol exhibit linear ( dose - independent ) pharmacokinetics following a single dose in the 4050 mg / m dose range . the within - subject variability in doxorubicin and doxorubicinol exposure was small between each administration cycle with mean cycle 2 vs cycle 1 ratios ranging from 0.99 to 1.06 . the local objective tumour response was similar in the two trials ( table 5 , 6 and supplementary tables 13 ) . when combined , five ( 17.2% ) complete local responses and nine ( 31% ) partial local responses were seen . the rate of local response in these heavily pretreated patients was 48.3% ( 14/29 , 95% ci : 30.166.5% ) . ( a ) photo of thermometry placement , and ( b ) position of the 18 10 cm applicator over the lesion . the margins of the tumour are easily seen by the red colour against the normal skin . ( e ) thermographic camera image of chest well shows temperature distribution on the surface of the tumour region , prior to therapy . ( f ) thermographic image of the chest wall prior to cycle 4 shows reduced surface temperature compared with baseline . ( g ) thermographic images of the chest wall prior to cycle 5 . by this time this was most likely the result of reduced perfusion and metabolism , associated with tumour regression . table 5.efficacy : local objective response.local objective responsecombined n = 29 ( % ) trial a n = 18 ( % ) trial b n = 11 ( % ) stable / progressive15 ( 51.7)9 ( 50.0)6 ( 54.5)partial9 ( 31.0)5 ( 27.8)4 ( 36.4)complete5 ( 17.2)4 ( 22.2)1 ( 9.1)local objective response in the two trials is not significantly different : p = 0.6317 by exact wilcoxon - mann - whitney test , two - tailed . table 6.efficacy : local objective response rates in the combined trials.local objective responsenumber rate ( n = 29)95% citotal ( partial + complete)14 ( 48.3)30.166.5partial9 ( 31.0)14.247.8complete5 ( 17.2)3.530.9 evaluation of treatment course for a patient who achieved a complete response . ( a ) photo of thermometry placement , and ( b ) position of the 18 10 cm applicator over the lesion . the margins of the tumour are easily seen by the red colour against the normal skin . ( e ) thermographic camera image of chest well shows temperature distribution on the surface of the tumour region , prior to therapy . ( f ) thermographic image of the chest wall prior to cycle 4 shows reduced surface temperature compared with baseline . ( g ) thermographic images of the chest wall prior to cycle 5 . by this time this was most likely the result of reduced perfusion and metabolism , associated with tumour regression . local objective response in the two trials is not significantly different : p = 0.6317 by exact wilcoxon - mann - whitney test , two - tailed . efficacy : local objective response rates in the combined trials . in trial a , time to local progression ( ttlp ) and overall survival were additional end points ( supplementary tables 2 and 3 ) . response trend for ttlp , but it was not statistically significant . in trial b , ltld and approved hyperthermia therapy resulted in clinically significant ( 8 point ) improvements in patient self - assessed qol on the fact - b scale . six of 11 subjects ( 54.5% , 95% ci : 25.183.9 ) had a clinically significant qol improvement . patients in the two trials were similar on all 11 demographic and pretreatment characteristics except that trial a subjects had fewer total prior treatments ( table 1 , p = 0.0133 ) and a shorter time from cwr to first ltld treatment ( p = 0.0046 ) . table 1.summary of baseline characteristics.characteristiccombined ( n = 29)trial a ( n = 18)trial b ( n = 11)p valueage ( years)0.1042 mean57.859.155.6 standard deviation8.29.74.7 minimum424249.2 median57.460.554.8 maximum757566.8oestrogen receptor ( er ) status ( % ) 1.0000 negative19 ( 65.5)12 ( 66.7)7 ( 63.6 ) positive9 ( 31.0)5 ( 27.8)4 ( 36.4 ) not assessed / unknown1 ( 3.4)1 ( 5.6)0 ( 0.0)progesterone receptor ( pr ) status ( % ) 0.6525 negative22 ( 75.9)14 ( 77.8)8 ( 72.7 ) positive6 ( 20.7)3 ( 16.7)3 ( 27.3 ) not assessed / unknown1 ( 3.4)1 ( 5.6)0 ( 0.0)her2 status ( % ) 0.1535 negative21 ( 72.4)15 ( 83.3)6 ( 54.5 ) positive6 ( 20.7%2 ( 11.1)4 ( 36.4 ) not assessed / unknown2 ( 6.9)1 ( 5.6)1 ( 9.1)triple negative for er , pr , and her2 ( n , % ) 0.1212 no12 ( 41.4)5 ( 27.8)7 ( 63.6 ) yes16 ( 55.2)12 ( 66.7)4 ( 36.4 ) not assessed / unknown1 ( 3.4)1 ( 5.6)0 ( 0.0)distant metastases at baseline ( % ) 0.2490 no16 ( 55.2)8 ( 44.4)8 ( 72.7 ) yes3 ( 44.8)10 ( 55.6)3 ( 27.3)time from initial diagnosis to chest wall recurrence ( years)0.2515 mean4.13.84.6 standard deviation3.74.23.1 minimum0.50.50.7 median2.61.63.1 maximum12.512.510.4time from chest wall recurrence to first study treatment ( months)0.0046 mean13.75.027.9 standard deviation24.95.436.5 minimum0.00.00.2 median7.42.413.5 maximum125.417.6125.4total number of prior treatments for breast cancer ( % ) 0.0133 12 ( 6.9)2 ( 11.1)0 ( 0.0 ) 26 ( 20.7)5 ( 27.8)1 ( 9.1 ) 310 ( 34.5)7 ( 8.9)3 ( 27.3 ) 47 ( 24.1)3 ( 16.7)4 ( 36.4 ) 51 ( 3.4)1 ( 5.6)0 ( 0.0 ) 62 ( 6.9)0 ( 0.0)2 ( 18.2 ) 121 ( 3.4)0 ( 0.0)1 ( 9.1)prior anthracycline exposure ( mg / m)0.7233 mean304.1307.1 299.2 standard deviation115.4101.5 140.7 minimum80222 80.0 median256.5275 251.5 maximum570570 555.0 prior radiation exposure ( cgy)0.7913 mean644961007021 standard deviation2455812.23895 minimum198045001980 median610061106040 maximum16 810738016 8101exact wilcoxon - mann - whitney test , two - tailed.2fisher s exact test , two - tailed.3excludes one subject who reportedly received a single anthracycline treatment of unknown dose.4excludes one subject each whose prior anthracycline dose was reported as unknown and as not assessed . summary of baseline characteristics excludes one subject each whose prior anthracycline dose was reported as unknown and as not assessed . most subjects ( 55.2% ) were triple negative and 44.8% had distant metastases at baseline . the mean and median prior anthracycline exposures were 304.1 mg / m and 256.5 mg / m , respectively ; the minimum total dose was 80.0 mg / m while the maximum was 570.0 mg / m . the mean and median prior radiation exposures were 64.49 gy and 61 gy respectively ; the minimum total dose was 19.80 gy while the maximum was 168.10 gy . both trials were similar in number of study treatments completed and in thermal doses ( table 2 ) . the thermal dose goal was to reach a temperature between 40 and 42 c in greater than 90% of measured points ( t90 ) for approximately 60 min duration . a total of 165 hyperthermia fields were treated . of these 165 hyperthermia treatment fields , 58 ( 35.2% ) had a t90 of less than 40.0 c and the other 107 ( 64.8% ) had a t90 between 40.0 and 42.9 c . of all 165 treatment fields , 33 ( 20% ) had a t90 below 39.5 c , the minimum temperature needed to release doxorubicin from ltld . eleven ( 37.9% ) of 29 subjects had at least one treatment field with a t90 below 39.5 c . table 2.summary of study treatment.characteristiccombined ( n = 29)trial a ( n = 18)trial b ( n = 11)p valuetotal number of study treatments ( % ) 0.7004 11 ( 3.4)1 ( 5.5)0 ( 0.0 ) 28 ( 27.6)5 ( 27.8)3 ( 27.3 ) 34 ( 13.8)1 ( 5.5)3 ( 27.3 ) 45 ( 17.2)3 ( 16.7)2 ( 18.2 ) 51 ( 3.4)1 ( 5.5)0 ( 0.0 ) 610 ( 34.5)7 ( 38.9)3 ( 27.3)combined ( n = 165)trial a ( n = 112)trial b ( n = 53 ) p valuet90 for each hyperthermia treatment field ( % ) 0.4853 < 40.0 c58 ( 35.2)37 ( 33.0)21 ( 39.6 ) 40.042.9 c107 ( 64.8)75 ( 67.0)32 ( 60.4 ) 43.0 c0 ( 0.0)0 ( 0.0)0 ( 0.0)1exact wilcoxon - mann - whitney test , two - tailed.2fisher s exact test , two - tailed . summary of study treatment . thirteen subjects were evaluable for mtd in trial a and 10 in trial b. in trial a , dose escalation continued to the 40 mg / m dose level , at which time trial b initiated at 40 mg / m prior to reaching a mtd . in trial a , one patient experienced a grade 2 hypersensitivity reaction that included a drug - related fever at 30 mg / m ; this was considered a dlt . two of seven subjects at 40 mg / m experienced a dlt ( grade 4 neutropenia lasting > 5 days and grade 3 dehydration requiring hospitalisation for support for 27 days ) . in trial b , one of six patients at the 50 mg / m dose level had a dlt ( grade 3 hypokalaemia unrelated to study treatment ) , so the mtd was 50 mg / m . five of the six non - evaluable patients withdrew due to progression of disease during the first two treatment cycles and one for an unrelated adverse event . grade 4 toxicity was only observed in three ( 10.3% ) patients with neutropenia and two ( 6.9% ) with a neutrophil count decrease ( table 3 ) . grade 3 toxicity included six patients ( 20.7% ) with a neutrophil count decrease , five ( 17.2% ) with neutropenia , four ( 13.8% ) with leucopenia , and three ( 10.3% ) with a white blood cell count decrease . all other grade 3 toxicities consisted of a single case of each of the following : anaemia , lymphopenia , thrombocytopenia , dehydration , axillary pain , fatigue , cellulitis , third degree burn adjacent to a silicone implant ( trial b ) , activated partial thromboplastin time - prolonged , haemoglobin decreased , hypokalaemia , back pain , musculoskeletal chest pain , musculoskeletal pain , and lymphoedema . two subjects , both in trial b , experienced first degree thermal burns that were managed conservatively and healed . ( subjects are counted only once within each system - organ class and preferred term , at the highest severity grade experienced . n = 29.).system - organ class / preferred termgrade 3 n ( % ) grade 4 n ( % ) grade 34 total n ( % ) blood and lymphatic system disorders1 ( 3.4)0 ( 0.0)1 ( 3.4 ) anaemia4 ( 13.8)0 ( 0.0)4 ( 13.8 ) leukopenia1 ( 3.4)0 ( 0.0)1 ( 3.4 ) lymphopenia5 ( 17.2)3 ( 10.3)8 ( 27.6 ) neutropenia1 ( 3.4)0 ( 0.0)1 ( 3.4 ) thrombocytopeniageneral disorders and administration site conditions axillary pain1 ( 3.4)0 ( 0.0)1 ( 3.4 ) fatigue1 ( 3.4)0 ( 0.0)1 ( 3.4)infections and infestations cellulitis1 ( 3.4)0 ( 0.0)1 ( 3.4)injury , poisoning , and procedural complications burns third degree1 ( 3.4)0 ( 0.0)1 ( 3.4)investigations activated partial thromboplastin time - prolonged1 ( 3.4)0 ( 0.0)1 ( 3.4 ) haemoglobin decreased1 ( 3.4)0 ( 0.0)1 ( 3.4 ) neutrophil count decreased6 ( 20.7)2 ( 6.9)8 ( 27.6 ) white blood cell count decreased3 ( 10.3)0 ( 0.0)3 ( 10.3)metabolism and nutrition disorders dehydration1 ( 3.4)0 ( 0.0)1 ( 3.4 ) hypokalaemia1 ( 3.4)0 ( 0.0)1 ( 3.4)musculoskeletal and connective tissue disorders back pain1 ( 3.4)0 ( 0.0)1 ( 3.4 ) musculoskeletal chest pain1 ( 3.4)0 ( 0.0)1 ( 3.4 ) musculoskeletal pain1 ( 3.4)0 ( 0.0)1 ( 3.4)vascular disorders lymphoedema1 ( 3.4)0 ( 0.0)1 ( 3.4 ) combined summary of grade 34 adverse events . ( subjects are counted only once within each system - organ class and preferred term , at the highest severity grade experienced . there were no clinically significant cardiac toxicities ; however , in trial b , one asymptomatic decline in lvef from 55% to 45% was recorded after six ltld treatments and a prior anthracycline exposure of 240 mg / m . in addition , there were no cases of hand foot syndrome , which has been reported with the use of non - temperature - sensitive liposomal doxorubicin . plasma concentrations of doxorubicin achieved their maximum at the end of the 30-min infusion and subsequently declined rapidly ( figure 1 ) . as expected , plasma concentration of doxorubicin increased with each subsequent dose level ( table 4 ) . the near superimposition of curves for cycles 1 and 2 demonstrate that there was no accumulation of drug between cycles . the average plasma clearance of doxorubicin was 1.3 l / min / m , but there was considerable heterogeneity among patients . the average terminal plasma half - life for all patients was 35.15 min , but ranged from 9.26 to 45.27 min . there was no statistically significant difference between these variables among the various dose cohorts . figure 1.pharmacokinetic profiles for cycles 1 and 2 at each dose level for doxorubicin and its cardiotoxic metabolite , doxorubicinol . the half - life of the drug was the same for cycle 1 and cycle 2 and was not dependent upon doxorubicin dose . ( h)tmax ( h)cmax ( ng / ml)cmax/ d ( ng / ml / mg / m)auclast ( ng h / ml)auc/ d ( ng / h / ml / mg / m)vz ( l)cl ( l / h)tmax ( h)cmax ( ng / ml)auc/ d ( ng / h / ml / mg / m)doxorubicin 20 mg / m n = 3 patients ( cycle 1)doxorubicinolmean34.750.73311 10055717 6008821072.204.0010.229.3cv % 44.520.501.8315.3015.3011.5211.5341.8714.463.084.0027.6040.20doxorubicin 30 mg / m n = 6 patients ( cycle 1)doxorubicinolmean37.200.52516 20053925 0008341242.265.0013.826.6cv % 19.540.500.7524.2524.2524.6524.5739.3428.743.006.0838.4940.38doxorubicin 40 mg / m n = 9 patients ( cycle 1)doxorubicinolmean33.520.61718 40046032 9008241202.463.0022.328.8cv % 22.750.501.0021.1221.1227.8327.8039.0729.792.0024.2039.0735.12auclast , area under the curve to the last measured plasma concentration ; auc/d , auc extrapolated to infinity divided by dose ; cl , clearance ; cmax , maximum plasma concentration ; d , dose ; t1/2 , terminal exponential half life ; tmax , time to cmax ; vz , terminal phase volume of distribution . pharmacokinetic profiles for cycles 1 and 2 at each dose level for doxorubicin and its cardiotoxic metabolite , doxorubicinol . the half - life of the drug was the same for cycle 1 and cycle 2 and was not dependent upon doxorubicin dose . trial a. auclast , area under the curve to the last measured plasma concentration ; auc/d , auc extrapolated to infinity divided by dose ; cl , clearance ; cmax , maximum plasma concentration ; d , dose ; t1/2 , terminal exponential half life ; tmax , time to cmax ; vz , terminal phase volume of distribution . for trial b sparse sampling results include the mean cmax of doxorubicin ranged from 19 800 to 25 400 ng / ml in the 40 to the 50 mg / m dose range and between cycles . the mean cmax of doxorubicinol ranged from 19.6 to 21.9 ng / ml in the 4050 mg / m dose range and between cycles . both doxorubicin and doxorubicinol exhibit linear ( dose - independent ) pharmacokinetics following a single dose in the 4050 mg / m dose range . the within - subject variability in doxorubicin and doxorubicinol exposure was small between each administration cycle with mean cycle 2 vs cycle 1 ratios ranging from 0.99 to 1.06 . the local objective tumour response was similar in the two trials ( table 5 , 6 and supplementary tables 13 ) . when combined , five ( 17.2% ) complete local responses and nine ( 31% ) partial local responses were seen . the rate of local response in these heavily pretreated patients was 48.3% ( 14/29 , 95% ci : 30.166.5% ) . ( a ) photo of thermometry placement , and ( b ) position of the 18 10 cm applicator over the lesion . the margins of the tumour are easily seen by the red colour against the normal skin . ( e ) thermographic camera image of chest well shows temperature distribution on the surface of the tumour region , prior to therapy . ( f ) thermographic image of the chest wall prior to cycle 4 shows reduced surface temperature compared with baseline . ( g ) thermographic images of the chest wall prior to cycle 5 . by this time this was most likely the result of reduced perfusion and metabolism , associated with tumour regression . table 5.efficacy : local objective response.local objective responsecombined n = 29 ( % ) trial a n = 18 ( % ) trial b n = 11 ( % ) stable / progressive15 ( 51.7)9 ( 50.0)6 ( 54.5)partial9 ( 31.0)5 ( 27.8)4 ( 36.4)complete5 ( 17.2)4 ( 22.2)1 ( 9.1)local objective response in the two trials is not significantly different : p = 0.6317 by exact wilcoxon - mann - whitney test , two - tailed . table 6.efficacy : local objective response rates in the combined trials.local objective responsenumber rate ( n = 29)95% citotal ( partial + complete)14 ( 48.3)30.166.5partial9 ( 31.0)14.247.8complete5 ( 17.2)3.530.9 evaluation of treatment course for a patient who achieved a complete response . ( a ) photo of thermometry placement , and ( b ) position of the 18 10 cm applicator over the lesion . the margins of the tumour are easily seen by the red colour against the normal skin . ( e ) thermographic camera image of chest well shows temperature distribution on the surface of the tumour region , prior to therapy . ( f ) thermographic image of the chest wall prior to cycle 4 shows reduced surface temperature compared with baseline . ( g ) thermographic images of the chest wall prior to cycle 5 . by this time this was most likely the result of reduced perfusion and metabolism , associated with tumour regression . local objective response in the two trials is not significantly different : p = 0.6317 by exact wilcoxon - mann - whitney test , two - tailed . efficacy : local objective response rates in the combined trials . in trial a , time to local progression ( ttlp ) and overall survival were additional end points ( supplementary tables 2 and 3 ) . there was a modest dose response trend for ttlp , but it was not statistically significant . in trial b , ltld and approved hyperthermia therapy resulted in clinically significant ( 8 point ) improvements in patient self - assessed qol on the fact - b scale . six of 11 subjects ( 54.5% , 95% ci : 25.183.9 ) had a clinically significant qol improvement . ltld was tolerated well by our heavily pretreated patients with four dlts observed between two trials . grade 34 neutropenia occurred in eight patients ( 27.6% ) and was afebrile in all patients . there were no dose - limiting cardiac toxicities seen in our patients and there were no symptomatic lvef decreases seen on serial echo / muga imaging . this is similar to the cardiotoxicity profile commonly seen with non - temperature - sensitive liposomal doxorubicin , with very few cases of heart failure , and if any cardiac morbidity is seen it is often asymptomatic declines in lvef [ 1824 ] . two trial b subjects experienced thermal burns , one grade 2 with possible radiation recall and one grade 3 event in a subject with a silicone breast implant . mild to severe thermal injury is reported as a known side effect of hyperthermia . while not the primary end point of the trials , the combined local response rate of 48% is quite impressive . however , the median time to local progression in trial a was not long ( 4.9 months ) and might be lengthened with technical improvements in delivery of hyperthermia and by treating future patients at the 50 mg / m mtd . twenty per cent of all treatment fields had a t90 below 39.5 c , the minimum temperature needed to release doxorubicin from ltld . eleven ( 37.9% ) of 29 subjects had at least one treatment field with a t90 below 39.5 c . however , the local objective response rate of these 11 subjects was similar to that for the other 18 subjects ( 55% and 44% respectively , p = 0.7104 ) . thus , a modest improvement in minimum tumour temperatures without significantly increasing the maximum temperatures should prove useful . moreover , it has been predicted mathematically and shown that maximal drug delivery with this drug formulation occurs when the drug is administered during heating , as opposed to heating after drug administration . in these phase unfortunately , due to the differences in time from when each patient received their infusion and subsequent heating , it was not possible to make meaningful interpretation of the heterogeneous pharmacokinetic values . technical advances that would permit heating during chemotherapy administration could achieve as much as a two - fold increase in drug delivery . doxorubicin has a terminal half - life reported in the 2048-h range , a non - temperature - sensitive liposomal formulation of doxorubicin ( doxil ) has a half - life of approximately 55 h , whereas ltld has a half - life considerably shorter , in the order of 35 min , regardless of dose . for ltld , drug delivery could be substantially increased by heating during drug administration , one might be able to maximise the therapeutic benefit . gasselhuber has considered these factors theoretically to demonstrate the influence of pharmacokinetics , release kinetics and rate of extravasation of drug on drug accumulation in the heated volume . this trial included many patients with disease that extended beyond the outer perimeter of the applicators available with the current microwave hyperthermia system . in order to improve average temperatures and corresponding thermal doses skin interface temperatures as high as 45c for cases with only superficial disease ( < 1 cm deep ) , in order to extend high temperatures out to the margins of disease . larger microwave applicators that can conform to contoured patient anatomy and adjust the heating pattern to accommodate irregularly shaped diffuse disease would be expected to raise thermal dose and minimum tumour temperatures substantially compared to the centrally peaked heating patterns of rectangular box - shaped waveguide antennas used in this study . needham et al . have shown that drug release occurs at 40c although maximal drug release rates occur nearer to 41.3c , which is the transition temperature for this liposome . of all 165 treatment fields , 33 ( 20% ) had a t90 below 39.5 c , the minimum temperature needed to release doxorubicin from ltld . thus , moving to larger conformal array microwave applicators that can effectively heat much larger areas of contoured anatomy above the required threshold temperature for drug release should significantly improve drug delivery to large area locoregional disease . radiotherapy plus hyperthermia can provide local control of superficial tumours ; in recurrent disease , previously irradiated patients may benefit most . treating with concurrent doxorubicin and radiotherapy has largely been abandoned due to the potent radiosensitisation and resultant morbidities seen with it in the past . however , there may be significant concerns with soft tissue and bone injury along with potential cardiac toxicity in the setting of left side cwr . one possible solution is to use a thermobrachytherapy surface applicator to deliver a conformal radiation dose with restricted depth of penetration in combination with superficial heating and ltld to localise treatment to the chest wall [ 3134 ] . unfortunately , as is the case with many women who experience cwr , distant metastases are frequent and the majority of patients die of their disease . trial a s median ttlp of 4.9 months and os of 9.0 months highlight the often poor prognosis of these patients ; in trial b , the subjects had had even more prior treatment . one might also consider heat sensitive liposomal formulations of other agents that might also be combined with local radiotherapy . over half ( 55.2% ) of our patients had triple negative cwrs , and there is ongoing interest in using parp inhibitors in this cohort ; the delivery of these agents might be enhanced with temperature - sensitive liposomal formulations . over half of the subjects had been diagnosed with a breast cancer recurrence at the chest wall more than 6 months ( median 7.4 months , mean 13.7 months ) prior to their first study treatment and 44.8% had distant metastases at baseline . despite the encouraging rate of local response , seven of 29 subjects ( 24.1% ) progressed outside the study treatment field . we were able to achieve local control in nearly half the patients as a salvage therapy with ltld / hyperthermia treatment and it is reasonable to expect better results in a population with less advanced disease . this thermally enhanced therapy is safe and produces objective responses in heavily pretreated cwr patients .

purposeunresectable chest wall recurrences of breast cancer ( cwr ) in heavily pretreated patients are especially difficult to treat . we hypothesised that thermally enhanced drug delivery using low temperature liposomal doxorubicin ( ltld ) , given with mild local hyperthermia ( mlht ) , will be safe and effective in this population.patients and methodsthis paper combines the results of two similarly designed phase i trials . eligible cwr patients had progressed on the chest wall after prior hormone therapy , chemotherapy , and radiotherapy . patients were to get six cycles of ltld every 2135 days , followed immediately by chest wall mlht for 1 hour at 4042 c . in the first trial 18 subjects received ltld at 20 , 30 , or 40 mg / m2 ; in the second trial , 11 subjects received ltld at 40 or 50 mg / m2.resultsthe median age of all 29 patients enrolled was 57 years . thirteen patients ( 45% ) had distant metastases on enrolment . patients had received a median dose of 256 mg / m2 of prior anthracyclines and a median dose of 61 gy of prior radiation . the median number of study treatments that subjects completed was four . the maximum tolerated dose was 50 mg / m2 , with seven subjects ( 24% ) developing reversible grade 34 neutropenia and four ( 14% ) reversible grade 34 leucopenia . the rate of overall local response was 48% ( 14/29 , 95% ci : 3066% ) , with . five patients ( 17% ) achieving complete local responses and nine patients ( 31% ) having partial local responses.conclusionltld at 50 mg / m2 and mlht is safe . this combined therapy produces objective responses in heavily pretreated cwr patients . future work should test thermally enhanced ltld delivery in a less advanced patient population .

Introduction Patients and methods Patient selection Study design Patient evaluation Results Patient demographic and baseline characteristics Study treatment Dose escalation and MTD Safety Pharmacokinetics: Trial A Pharmacokinetics: Trial B Efficacy Discussion Conclusion None

the src family kinases ( sfks ) are a unique group of enzymes that have diverse functions in cell proliferation , survival , differentiation , adhesion , and migration . they not only play important regulatory roles in hematopoiesis , but also contribute to development of hematopoietic cancers . one historically prominent paradigm of sfk action is cell proliferation and contribution to cell transformation . sfks are known to have functional importance in chronic myelogenous leukemia ( cml ) because of the interaction between sfks and the oncogenic fusion protein bcr - abl . sfk members hck and lyn readily interact with bcr - abl via kinase - dependent and -independent mechanisms , and this interaction can not be inhibited by the bcr - abl inhibitor , imatinib [ 2 - 4 ] . in addition , this interaction between sfks and bcr - abl appears to be crucial for the transforming activity of bcr - abl , which is particularly essential for bcr - abl - driven b cell leukemia . lyn is the predominant active sfk expressed in acute myeloid leukemia ( aml ) cells . blocking sfk activity according to recent studies using gene knock - out mice , sfks , most notably lyn , fgr , and hck , play a role in regulation of myelopoiesis in vivo . mice lacking lyn manifest an increase in myeloid progenitors , enhancement of granulocyte colony - stimulating factor - stimulated granulopoiesis , and development of a myeloproliferative disorder leading to development of monocyte / macrophage tumors . similar findings were reported in triple knock - out mice lacking lyn , fgr , and hck . sfk activity and expression could also modulate all - trans - retinoic acid ( atra ) differentiation induction therapy . in a recent study reported by miranda et al . , the sfk inhibitor pp2 was found to potentiate atra - induced gene expression and enhanced the differentiation marker cd11b in myeloid nb4 , hl-60 , and primary acute promyelocytic leukemia ( apl ) cells and the synergic effects of pp2 were dose dependent . arsenic trioxide ( as2o3 , ato ) has considerable efficacy in treatment of previously untreated and relapsed apl . although initial studies focused on the apl fusion protein , promyelocytic leukemia ( pml)-retinoic acid receptor ( rar ) , in mediating response to ato , subsequent investigations have revealed that ato acts on numerous intracellular targets . in this study , we investigated the question of whether sfk inhibitor pp2 has an equal synergistic effect on differentiation of nb4 cells when combined with atra or ato . in addition , we examined the changes in retinoic acid ( ra)-induced gene expression in order to determine the possible mechanism for the different effect of pp2 on atra- or ato - induced differentiation of nb4 cells . nb4 cells were grown in rpmi1640 medium ( gibco , rockville , ny ) supplemented with 10% heat - inactivated fetal bovine serum ( gibco ) and 1% penicillin / streptomycin ( gibco ) in a humidified 5% carbon dioxide and 95% air incubator at 37. atra was obtained from sigma , and 5 mm stock solution was prepared in ethanol and stored at -20. ato ( as2o3 ) , nitroblue tetrazolium ( nbt ) , and phorbol 12-myristate 13-acetate ( pma ) were obtained from sigma ( st . louis , mo ) . the src family kinase inhibitor pp2 was obtained from sigma and 20 mm stock solution was prepared in dimethyl sulfoxide and stored at -20. antibodies against cathepsin d and intercellular adhesion molecule-1 ( icam-1 ) were purchased from santa cruz biotechnology ( santa cruz , ca ) . secondary anti - rabbit and anti - mouse horseradish peroxidase conjugated antibodies were purchased from dako ( glostrup , denmark ) . in order to induce differentiation , nb4 cells were treated with atra or ato in the absence or presence of pp2 for 72 hours . for analysis of cell surface antigens , cells were harvested and washed twice with washing buffer ( phosphate buffered saline [ pbs ] containing 0.2% bovine serum albumin and 0.1% nan3 ) ; they were then incubated with anti - cd11b - pe antibody ( bd biosciences , san jose , ca ) for 30 minutes at 4 in the dark . the cells were analyzed for cd11b expression using flow cytometry ( fc500 , beckman coulter , fullerton , ca ) . briefly , each cell suspension was mixed with an equal volume of a solution containing 1 mg / ml of nbt and 2.5 g / ml of pma and incubated at 37 for 30 minutes . the differentiated cells were identified by their intracellular blue formazan deposits . using a light microscope , a minimum of 200 cells was counted , in order to determine the percentage of differentiated cells . the annexin - v fitc kit ( biosource , camarillo , ca ) was used for detection of apoptotic cells . briefly , nb4 cells were treated with atra or ato in the absence or presence of pp2 for 72 hours . cells were washed twice with pbs and stained in binding buffer containing annexin - v fitc and propidium iodide ( pi ) at room temperature for 15 minutes in the dark . the reaction was stopped by addition of 400 l of binding buffer and analyzed by flow cytometry ( fc500 ) with a total of 10,000 events acquired for each sample . cells were treated with atra or ato , in the absence or presence of pp2 for 72 hours , and were harvested and washed with pbs . total cellular proteins were isolated by sonication using ice - cold pbs containing 1% nonidet p-40 , 0.5% sodium deoxycholate , 0.1% sodium dodecyl sulfate ( sds ) , 2.0 g / ml aprotinin , and protease inhibitor cocktail ( roche , mannheim , germany ) , and centrifuged at 12,000 g for removal of cellular debris . the protein concentrations in extracts were determined using the bicinchoninic acid colorimetric method ( pierce , rockford , il ) . equal amounts of proteins were separated by 10% sds - polyacrylamide gel electrophoresis and electrophoretically transferred to polyvinylidene difluoride membranes ( bio - rad , hercules , ca ) . the membranes were then blocked with 5% nonfat dried milk ( bio - rad ) in ttbs ( 50 mm tris - hcl [ ph 7.5 ] , 150 mm nacl , and 0.1% [ v / v ] tween 20 ) for 1 hour at room temperature and then incubated with primary antibodies diluted to 1:1,000 - 1:3,000 in 5% nonfat dried milk / ttbs overnight at 4 with gentle shaking . the membranes were then washed with ttbs ( 315 minutes ) and subsequently incubated with secondary anti - rabbit or anti - mouse horseradish peroxidase conjugated antibodies diluted to 1:5,000 in 5% nonfat dried milk / ttbs for 2 hours at room temperature . the membranes were then washed as described above and developed using the enhanced chemiluminescence detection system ( amersham , buckinghamshire , uk ) . nb4 cells were grown in rpmi1640 medium ( gibco , rockville , ny ) supplemented with 10% heat - inactivated fetal bovine serum ( gibco ) and 1% penicillin / streptomycin ( gibco ) in a humidified 5% carbon dioxide and 95% air incubator at 37. atra was obtained from sigma , and 5 mm stock solution was prepared in ethanol and stored at -20. ato ( as2o3 ) , nitroblue tetrazolium ( nbt ) , and phorbol 12-myristate 13-acetate ( pma ) were obtained from sigma ( st . louis , mo ) . the src family kinase inhibitor pp2 was obtained from sigma and 20 mm stock solution was prepared in dimethyl sulfoxide and stored at -20. antibodies against cathepsin d and intercellular adhesion molecule-1 ( icam-1 ) were purchased from santa cruz biotechnology ( santa cruz , ca ) . secondary anti - rabbit and anti - mouse horseradish peroxidase conjugated antibodies were purchased from dako ( glostrup , denmark ) . in order to induce differentiation , nb4 cells were treated with atra or ato in the absence or presence of pp2 for 72 hours . for analysis of cell surface antigens , cells were harvested and washed twice with washing buffer ( phosphate buffered saline [ pbs ] containing 0.2% bovine serum albumin and 0.1% nan3 ) ; they were then incubated with anti - cd11b - pe antibody ( bd biosciences , san jose , ca ) for 30 minutes at 4 in the dark . the cells were analyzed for cd11b expression using flow cytometry ( fc500 , beckman coulter , fullerton , ca ) . briefly , each cell suspension was mixed with an equal volume of a solution containing 1 mg / ml of nbt and 2.5 g / ml of pma and incubated at 37 for 30 minutes . the differentiated cells were identified by their intracellular blue formazan deposits . using a light microscope , a minimum of 200 cells was counted , in order to determine the percentage of differentiated cells . the annexin - v fitc kit ( biosource , camarillo , ca ) was used for detection of apoptotic cells . briefly , nb4 cells were treated with atra or ato in the absence or presence of pp2 for 72 hours . cells were washed twice with pbs and stained in binding buffer containing annexin - v fitc and propidium iodide ( pi ) at room temperature for 15 minutes in the dark . the reaction was stopped by addition of 400 l of binding buffer and analyzed by flow cytometry ( fc500 ) with a total of 10,000 events acquired for each sample . cells were treated with atra or ato , in the absence or presence of pp2 for 72 hours , and were harvested and washed with pbs . total cellular proteins were isolated by sonication using ice - cold pbs containing 1% nonidet p-40 , 0.5% sodium deoxycholate , 0.1% sodium dodecyl sulfate ( sds ) , 2.0 g / ml aprotinin , and protease inhibitor cocktail ( roche , mannheim , germany ) , and centrifuged at 12,000 g for removal of cellular debris . the protein concentrations in extracts were determined using the bicinchoninic acid colorimetric method ( pierce , rockford , il ) . equal amounts of proteins were separated by 10% sds - polyacrylamide gel electrophoresis and electrophoretically transferred to polyvinylidene difluoride membranes ( bio - rad , hercules , ca ) . the membranes were then blocked with 5% nonfat dried milk ( bio - rad ) in ttbs ( 50 mm tris - hcl [ ph 7.5 ] , 150 mm nacl , and 0.1% [ v / v ] tween 20 ) for 1 hour at room temperature and then incubated with primary antibodies diluted to 1:1,000 - 1:3,000 in 5% nonfat dried milk / ttbs overnight at 4 with gentle shaking . the membranes were then washed with ttbs ( 315 minutes ) and subsequently incubated with secondary anti - rabbit or anti - mouse horseradish peroxidase conjugated antibodies diluted to 1:5,000 in 5% nonfat dried milk / ttbs for 2 hours at room temperature . the membranes were then washed as described above and developed using the enhanced chemiluminescence detection system ( amersham , buckinghamshire , uk ) . to determine the effect of pp2 on atra- or ato - induced differentiation of nb4 cells , we examined cd11b expression by flow cytometry . treatment of nb4 cells with 10 m of pp2 alone , 0.001 m of atra alone , or 0.5 m of ato alone for 72 hours resulted in only 11.23% , 13.64% , or 14.06% of cd11b - positive cells , respectively ( fig . however , co - treatment with atra plus pp2 or ato plus pp2 resulted in significant enhancement of cd11b - positive cells ( 60.73% and 31.58% , respectively ; p<0.05 ) ( fig . the synergistic effect of pp2 combined with atra was more significant than that of pp2 combined with ato ( p<0.05 ) . similar results were obtained in five independent experiments , and were confirmed with nbt staining of nb4 cells ( fig . this means that treatment with pp2 resulted in significantly enhanced atra- or ato - induced differentiation of nb4 cells in vitro and that the synergistic effect of pp2 was higher in combination with atra than in combination with ato in nb4 cells in vitro . to determine the effect of pp2 on atra- or ato - induced apoptosis of nb4 cells , we evaluated apoptotic cell death after annexin v - fitc and pi staining using flow cytometric analysis . 3 shows that treatment of nb4 cells with atra or ato alone or in combination with pp2 for 72 hours did not induce apoptosis in nb4 cells . this means that the ability of pp2 to enhance atra- or ato - induced differentiation of nb4 cells was not due to its effect on apoptosis in nb4 cells in vitro . to determine the possible mechanism for the effect of pp2 on atra- or ato - induced differentiation of nb4 cells , we examined the changes in expression of proteins ( icam-1 and cathepsin d ) derived from rar target genes . 4 , control nb4 cells that were not treated with any reagents expressed low levels of these proteins . treatment with pp2 alone resulted in a modest induction of icam-1 and cathepsin d expression . treatment with atra alone resulted in increased expression of icam-1 , as well as a modest induction of cathepsin d expression . treatment with ato alone resulted in increased expression of cathepsin d , whereas it had no effect on expression of icam-1 . this induction of expression by atra or ato was further enhanced when cells were treated with pp2 in combination with atra or with pp2 in combination with ato . in particular , icam-1 expression showed a significant increase in cells treated with pp2 in combination with atra , whereas cathepsin d expression was significantly increased in cells treated with pp2 in combination with ato . these findings suggest that pp2 has different effects on atra and ato - induced differentiation of nb4 cells . pp2 promotes atra - induced differentiation of nb4 cells through icam-1 and ato - induced differentiation of nb4 cells through cathepsin d. to determine the effect of pp2 on atra- or ato - induced differentiation of nb4 cells , we examined cd11b expression by flow cytometry . treatment of nb4 cells with 10 m of pp2 alone , 0.001 m of atra alone , or 0.5 m of ato alone for 72 hours resulted in only 11.23% , 13.64% , or 14.06% of cd11b - positive cells , respectively ( fig . however , co - treatment with atra plus pp2 or ato plus pp2 resulted in significant enhancement of cd11b - positive cells ( 60.73% and 31.58% , respectively ; p<0.05 ) ( fig . the synergistic effect of pp2 combined with atra was more significant than that of pp2 combined with ato ( p<0.05 ) . similar results were obtained in five independent experiments , and were confirmed with nbt staining of nb4 cells ( fig . this means that treatment with pp2 resulted in significantly enhanced atra- or ato - induced differentiation of nb4 cells in vitro and that the synergistic effect of pp2 was higher in combination with atra than in combination with ato in nb4 cells in vitro . to determine the effect of pp2 on atra- or ato - induced apoptosis of nb4 cells , we evaluated apoptotic cell death after annexin v - fitc and pi staining using flow cytometric analysis . 3 shows that treatment of nb4 cells with atra or ato alone or in combination with pp2 for 72 hours did not induce apoptosis in nb4 cells . this means that the ability of pp2 to enhance atra- or ato - induced differentiation of nb4 cells was not due to its effect on apoptosis in nb4 cells in vitro . to determine the possible mechanism for the effect of pp2 on atra- or ato - induced differentiation of nb4 cells , we examined the changes in expression of proteins ( icam-1 and cathepsin d ) derived from rar target genes . 4 , control nb4 cells that were not treated with any reagents expressed low levels of these proteins . treatment with pp2 alone resulted in a modest induction of icam-1 and cathepsin d expression . treatment with atra alone resulted in increased expression of icam-1 , as well as a modest induction of cathepsin d expression . treatment with ato alone resulted in increased expression of cathepsin d , whereas it had no effect on expression of icam-1 . this induction of expression by atra or ato was further enhanced when cells were treated with pp2 in combination with atra or with pp2 in combination with ato . in particular , icam-1 expression showed a significant increase in cells treated with pp2 in combination with atra , whereas cathepsin d expression was significantly increased in cells treated with pp2 in combination with ato . these findings suggest that pp2 has different effects on atra and ato - induced differentiation of nb4 cells . pp2 promotes atra - induced differentiation of nb4 cells through icam-1 and ato - induced differentiation of nb4 cells through cathepsin d. apl , a subtype of aml , with distinctive biologic and clinical features , is now highly curable . translocation of the pml gene on chromosome 15 adjacent to the rar gene on chromosome 17 produces a fusion protein that can be quantitatively monitored using polymerase chain reaction in order to document disease burden and to ultimately confirm molecular remission . the unique ability of atra to produce differentiation in apl blasts can reverse coagulopathy , which is the major cause of death during induction . emerging evidence has implicated sfks as regulators of proliferation and survival of myeloid lineage cells and regulators of cytokine - induced myelopoiesis . aml is a diverse malignancy characterized by defective myeloid differentiation and accumulation of proliferative blasts . recent studies have demonstrated that sfks act to negatively regulate ra - induced gene expression and myeloid differentiation and suggest that the combination of sfk inhibition and ra treatment may be therapeutically beneficial in aml . in this study , we investigated the question of whether sfk inhibitor pp2 enhanced the differentiation of nb4 cells when combined with ato or atra . ato , an effective drug for treatment of apl , was shown to exert dose - dependent dual effects on apl cells , i.e. , triggering apoptosis and inducing partial differentiation . it has also been suggested that these effects were related to ato - induced modulation / degradation of pml - rar protein . we found that treatment with sfk inhibitor pp2 resulted in significantly enhanced atra- or ato - induced differentiation of nb4 cells and that the synergistic effect was significantly stronger when pp2 was combined with atra than when pp2 was combined with ato . to the best of our knowledge , this is the first evidence that sfk inhibitors can enhance ato - induced myeloid differentiation of apl cells , even though the synergistic effect between atra and pp2 was significantly stronger than that between ato and pp2 . of particular importance , these synergistic differentiation - enhancing effects were not related to apoptosis when pp2 was combined with ato as well as when pp2 was combined with atra . these results suggested that , even in ato - induced apoptosis and differentiation of apl cells , the synergistic effect between ato and pp2 was also related to the presence of rar . , reported that sfks regulated rar - mediated gene transcription and that sfk inhibition potentiated ra - induced gene expression . in our study , ra - induced gene expression was different in both groups . expression of icam-1 showed a significant increase in cells treated with pp2 in combination with atra , whereas cathepsin d expression was significantly increased in cells treated with pp2 in combination with ato . these results suggest that the mechanism of sfk inhibitor - induced synergistic effect of apl cell differentiation on atra or ato is associated with ra - induced gene expression and that the difference in apl differentiation between atra and ato is related to disparate activation of ra - induced genes . dasatinib , a us food and drug administration ( fda)- approved compound , was developed as an inhibitor of abl and sfks . recent studies have demonstrated the effects of dasatinib in hematopoietic malignancies other than cml and have suggested additional therapeutic opportunities . because some investigators have demonstrated that dasatinib promotes atra - induced differentiation of aml cells , fda - approved dasatinib in combination with atra may be beneficial in treatment of apl and non - apl aml . in 2004 , shen et al . first published the outcomes of single agent atra , single agent ato , or the combination of both drugs . while complete remission rates exceeded 90% in all three arms , the decline in the level of pml - rar fusion protein was significantly higher with the use of the combination . hematologic recovery was more rapid and relapse - free survival was improved at 18 months . for subsequent similar data , national comprehensive cancer network ( nccn ) guidelines indicate that atra plus ato is an alternative for patients who can not tolerate anthracycline therapy . a recent trend in cancer treatment is moving toward the use of targeted therapy and we eagerly look forward to obtaining therapeutic benefit due to low toxicity of targeted therapy . our data showed that sfk inhibitor enhanced apl cell differentiation when combined with either atra or ato with difference in activation of ra - induced genes . this suggests that a new combination of sfk inhibitor , pp2 plus atra and ato may be therapeutically beneficial in apl .

purposeleukemic promyelocytes have the unique ability to undergo differentiation after exposure to retinoic acid and both differentiation and apoptosis after exposure to arsenic trioxide ( ato ) . recent studies have shown that inhibition of src family kinases ( sfks ) resulted in enhancement of retinoic acid - induced myeloid differentiation.materials and methodsin this study , we investigated the question of whether the sfk inhibitor pp2 enhanced the differentiation of nb4 cells when combined with ato as well as when combined with all - trans - retinoic acid ( atra ) . in addition , we attempted to determine the difference in retinoic acid - induced gene expression between cells treated with pp2 in combination with atra and in combination with ato.resultssfk inhibitor pp2 induced significant enhancement of atra- or ato - induced differentiation of nb4 cells . a significantly stronger synergistic effect was observed when pp2 was combined with atra than when combined with ato . flow cytometric analysis demonstrated a significant increase in cd11b - positive granulocytes up to 60.73% and 31.58% , respectively . these results were confirmed by nitroblue tetrazolium staining . these effects were not related to apoptosis . results of annexin - v - fluorescein staining revealed that pp2 combined with atra or pp2 combined with ato did not induce apoptosis in nb4 cells . retinoic acid - induced gene expression was different in both groups . intercellular adhesion molecule-1 expression showed a significant increase in cells treated with pp2 in combination with atra , whereas cathepsin d expression showed a significant increase in cells treated with pp2 in combination with ato.conclusionour data showed that sfk inhibitor pp2 enhanced acute promyelocytic leukemia cell differentiation when combined with either atra or ato with difference in activation of retinoic acid - induced genes .

Introduction Materials and Methods 1. Cells and reagents 2. Assay for differentiation 3. Annexin-V-fluorescein staining assay 4. Western blotting 5. Statistical analysis Results 1. PP2 enhances ATRA- or ATO-induced differentiation of NB4 cells 2. PP2 has no effect on ATRA- or ATO-induced apoptosis of NB4 cells 3. PP2 has different effects on ATRA- or ATO-induced NB4 cell differentiation Discussion Conclusion

when the vaginal bleeding is cyclic and lasts for two to five days , isolated menses should be considered . the first menstruation normally appears approximately two and a half years after the onset of breast development . the occurrence of a menstrual - like bleeding before telarche is very rare and has also been defined as premature menarche analogous to premature pubarche and premature telarche . these conditions are considered as an incomplete form of precocious puberty since no other signs of puberty are present . the pathophysiology of cyclic vaginal bleeding in prepubertal girls is not well understood and is thought to be due to unusual sensitivity of the endometrium to very low prepubertal levels of oestrogens ( stanhope , 2006 ; traggiai et al . , 2003 ) . in one study it is possible that a range of environmental factors can influence the prepubertal endometrium and thus be involved in abnormal bleeding patterns ( croes et al . , 2009 ; degen et al . , 2004 ; we report on nine girls who presented with menstrual - like cyclic vaginal bleeding during the last three years . from a retrospective case review in four medical centers ( st pieter hospital brussels , ulb erasmus hospital brussels , queen paola s children hospital antwerp and uz brussels ) we retrieved nine girls with a diagnosis of menstrual - like unexplained vaginal bleeding over a period of three years ( between 2009 and 2011 ) . in all girls a complete clinical examination , including body height , body weight and tanner staging was performed . bone age was determined by x - ray of the left hand and wrist , according to the greulich and pyle atlas . basal concentrations of lh , fsh , e2 , dheas , progesterone , 17-oh - progsterone , igf1 , prl , tsh , t4 were measured . in all patients a gnrh stimulation test ( 2.5 micrograms / kg bodyweight ) was performed ( cesario et al . , 2007 ; perry et al . , 2008 ) uterine length , thickness of the endometrial lining , uterine artery flow and ovarian volumes were measured by ultrasound ( badouraki et al . the included patients were from different ethnic origins and their chronological age at examination ranged from three to ten and a half years . the number of menstrual - like vaginal bleedings varied from one to eight . the duration of bleeding varied from one to five days and in most patients less than three pads were used . growth data , including the bmi , were normal ( rosenfeld et al . , 2009 ) . pelvic ultrasound showed a normal prepubertal sized uterus without endometrial proliferation and with a prepubertal uterine artery flow , with the exception of one girl who had an endometrial lining of 3 mm . two girls with more than two episodes of vaginal bleeding underwent a vaginoscopy but no anomaly was seen . serum concentrations of oestradiol ( < 20 pg / ml ) , lh ( < 1 miu / ml ) and fsh ( < 5 miu / ml ) were all within the prepubertal ranges . the peak lh response at gnrh testing was lower than 4.5 there are rather scarce data in the literature on prepubertal menstrual - like bleeding ( berberoglu et al . , 2009 ; heller et al . , 1979 ; although a seasonal pattern was found in one study ( blanco et al . , 1985 ) , the occurrence of cyclic vaginal bleeding was not related to a specific season in our case . exclusion of any other underlying pathology is essential and needs the consideration of several underlying conditions . whether recurrent cyclic prepubertal vaginal bleeding can be defined as prepubertal menarche ( shanthi et al . , 2006 ) or premature menarche ( murram et al . , 1983 it could be argued that by definition menarche is one step in the chain of pubertal events and necessitates a certain level of cyclic hormonal changes , which is not the case in this study . anyway , in all cases reported there was no impact on the subsequent menstrual pattern and fertility prognosis ( sterling , 2007 ) . early menarche ( before the age of ten years ) can occur in case of central precocious puberty . this disorder is by definition gonadotrophin dependent and is caused by a precocious maturation of the hypothalamic pituitary axis , which results in physical and hormonal changes ( cesario et al . , 2007 ) . in none of our tested girls a pubertal response to gnrh was seen and no other signs of pubertal development were present . the response to gnrh test was suppressed ( no increase in basal gonadotrophins ) in two cases , but this was not associated with an elevated oestradiol level . this might be due to a previous and transient follicular cyst although these transient ovarian cysts are often associated with breast development which was not the case in our patients . a suppressed response of gonadotrophins is seen in other causes of peripheral precocious puberty such as adrenal and ovary tumors . dheas values were normal in all our patients and none of them had an advanced bone age , which is classically seen in such cases of peripheral precocious puberty . two girls were younger than four years of age . in case of uterine bleeding at a very young age ( most often below the age of two ) this sporadic disorder is accompanied by caf - au - lait spots and fibrous bone dysplasia . the ultrasound examination of these children typically shows voluminous ovarian cysts , which was not seen in our cases . none of them had taken any herbal medicines or was having contact with a mother , grandmother or caretaker treated with dermal oestrogens . a temporary activation of the hypothalamic pituitary axis was unlikely in our population of girls with menstrual - like vaginal bleeding , since there was neither an increase of gonadotrophins nor of oestradiol levels . ultrasound showed a normal prepubertal state of uterine maturation and the absence of endometrial proliferation . in only one girl endometrial lining was evidenced , suggestive of an increased sensitivity of the endometrium as possible mechanism in this particular case . we can not exclude that some of these girls might suffer from the munchausen by proxy syndrome . this psychiatric syndrome due to relational problems confirms the importance of an objective evaluation of the vaginal bleeding ( sterling , 2007 ) . some conditions and symptoms may be faked by the caregiver or the parents and even the child may inflict injury on itself to draw attention and sympathy . prepubertal vaginal bleeding is a source of anxiety not only for the girl , but also for her family . in each case if no explanation can be found , only clinical observation and reassurance of the girl and parents are necessary ( golub et al . , 2008 ; posnet et al . , 2006 ) . harmful traditional practices of genital mutilation in foreign girls can be another cause of genital bleeding .

unexplained menstrual - like cyclic vaginal bleeding , lasting for several days and without any uterine and vaginal anomaly , is a rare condition in prepubertal girls . only small series ( containing four to eleven cases ) have been described in literature . we report our in nine girls presenting with vaginal bleeding without any abnormality at gynaecological , hormonal and echographic examination .

Introduction Materials and Methods Results Discussion Conclusion

schizophrenia is a severe mental illness that affects approximately 1% of the population worldwide.1 nakane et al2 reported that prevalence rates for schizophrenia in japan ranged from 0.19% to 1.79% and morbidity risk rates ranged from 0.35% to 2.48% . they remarked that when compared with mean values from other countries , no significant differences were observed.2 unsatisfactory outcomes after pharmacotherapy3 and physical complications in patients with schizophrenia4 suggest that the dopamine hypothesis and antipsychotic treatment are not sufficient approaches to understanding the etiology of schizophrenia . previous studies have shown that physical complications and schizophrenia outcomes are related to diet.5 simonelli - muoz et al6 showed that patients who have unhealthy dietary habits have a higher risk of obesity than patients with good dietary habits . sugawara et al7 suggested that dietary patterns ( including a higher intake of protein , fat , n-3 polyunsaturated fatty acids , n-6 polyunsaturated fatty acids , and vitamins ) may be related to a decreased prevalence of obesity in patients with schizophrenia . in addition , based on an ecological analysis of nutritional patterns , peet8 determined that a higher national dietary intake of refined sugar and dairy products predicted a worse 2-year outcome of schizophrenia . it is difficult to study them in isolation because they may have mutually complementary effects . with regard to the risk of schizophrenia , dietary patterns or combinations of foods the aim of this study was to assess the relationship between dietary patterns and schizophrenia in japan . the subjects comprised 237 outpatients aged 3060 years ( 123 males and 114 females ) diagnosed with the diagnostic and statistical manual of mental disorders , fourth edition criteria of either schizophrenia or schizoaffective disorder at four psychiatric hospitals in japan . 404 healthy volunteers aged 3060 years ( 158 males and 246 females ) who participated in the iwaki health promotion project in 2011 were also included . the study was approved by the ethics committee of the hirosaki university school of medicine , hirosaki , japan , and all subjects signed informed consent . demographic data ( age , sex , and level of education ) were collected by face - to - face method interviews and self - administered questionnaires . we assessed eating habits over the last month using a validated brief self - administered diet history questionnaire ( bdhq)9 that consisted of inquiries concerning the consumption frequency of 56 foods and beverages and nine dishes generally consumed in japanese populations . in order to estimate the intake of calories and of selected nutrients , we used a computer algorithm for the 56 foods and beverages of the bdhq with the standard tables of food composition in japan.10,11 dietary patterns were detected through a principal component analysis . we adopted the calorie - adjusted intake that used a density method for the 52 food and beverage items ( excluding four items that overlapped with others ) . we determined the number of principal components to retain by eigenvalues , the scree test , and the interpretability of the factors ; two principal components were retained . the principal components for each dietary pattern and for each individual were divided into tertiles by principal component scores . the subjects with and without schizophrenia were compared using unpaired student s t - tests for continuous variables or chi - squared tests for categorical variables . we assessed trend associations across the tertile categories of each dietary pattern using linear regression analysis for continuous variables and the cochran armitage trend test for categorical variables , with ordinal values ranging from 1 to 3 assigned to the tertile categories of each dietary pattern . a logistic regression analysis was carried out to evaluate the relationship between dietary patterns and schizophrenia . the data analysis was performed using r for windows , version 3.0.2 ( the r foundation for statistical computing , vienna , austria ) . the subjects comprised 237 outpatients aged 3060 years ( 123 males and 114 females ) diagnosed with the diagnostic and statistical manual of mental disorders , fourth edition criteria of either schizophrenia or schizoaffective disorder at four psychiatric hospitals in japan . 404 healthy volunteers aged 3060 years ( 158 males and 246 females ) who participated in the iwaki health promotion project in 2011 were also included . the study was approved by the ethics committee of the hirosaki university school of medicine , hirosaki , japan , and all subjects signed informed consent . demographic data ( age , sex , and level of education ) were collected by face - to - face method interviews and self - administered questionnaires . we assessed eating habits over the last month using a validated brief self - administered diet history questionnaire ( bdhq)9 that consisted of inquiries concerning the consumption frequency of 56 foods and beverages and nine dishes generally consumed in japanese populations . in order to estimate the intake of calories and of selected nutrients , we used a computer algorithm for the 56 foods and beverages of the bdhq with the standard tables of food composition in japan.10,11 we adopted the calorie - adjusted intake that used a density method for the 52 food and beverage items ( excluding four items that overlapped with others ) . we determined the number of principal components to retain by eigenvalues , the scree test , and the interpretability of the factors ; two principal components were retained . the principal components for each dietary pattern and for each individual were divided into tertiles by principal component scores . the subjects with and without schizophrenia were compared using unpaired student s t - tests for continuous variables or chi - squared tests for categorical variables . we assessed trend associations across the tertile categories of each dietary pattern using linear regression analysis for continuous variables and the cochran armitage trend test for categorical variables , with ordinal values ranging from 1 to 3 assigned to the tertile categories of each dietary pattern . a logistic regression analysis was carried out to evaluate the relationship between dietary patterns and schizophrenia . the significance level for the results obtained in the hypothesis contrast was p<0.05 . the data analysis was performed using r for windows , version 3.0.2 ( the r foundation for statistical computing , vienna , austria ) . the number of subjects of monotherapy is 156 , while the number of subjects of polypharmacy ( using two or more antipsychotic agents ) is 95 . the subjects of polypharmacy were receiving risperidone ( n=51 ) , aripiprazole ( n=25 ) , olanzapine ( n=21 ) , blonanserin ( n=26 ) , quetiapine ( n=25 ) , haloperidol ( n=41 ) , levomepromazine ( n=31 ) , and other antipsychotic agents . the first component , which loaded green leafy vegetables , lettuce , cabbage , mushrooms , and fruit , was labeled the vegetable dietary pattern . the second component , which loaded rice , bread , and confectioneries , was labeled the cereal dietary pattern . the characteristics of the dietary pattern scores categorized by tertiles are shown in table 3 . the vegetable dietary pattern was positively associated with the intake of proteins , carbohydrates , fats , saturated fatty acids , monounsaturated fatty acids , polyunsaturated fatty acids , n-3 fatty acids , and n-6 fatty acids . higher scores for the cereal dietary pattern were positively associated with the intake of proteins , fats , saturated fatty acids , monounsaturated fatty acids , polyunsaturated fatty acids , n-3 fatty acids , and n-6 fatty acids . the odds ratios for schizophrenia according to the tertile categories of each dietary pattern score are shown in table 4 . the vegetable dietary pattern was not associated with an increased risk of schizophrenia . for the cereal dietary pattern , the high tertile was associated with a significantly increased risk of schizophrenia . we designed this cross - sectional study to evaluate the relationship between dietary patterns and schizophrenia in japan . two dietary patterns were derived ; namely , the vegetable and cereal patterns . the vegetable dietary pattern was characterized by a high consumption of green leafy vegetables , seaweed , potatoes , and soybean products such as tofu and natto , and positively correlated with the intake of fats and proteins . a previous study demonstrated a relationship between fatty acids and schizophrenia.12 therefore , we hypothesized that a dietary pattern consuming a large quantity of vegetables would be associated with a lower risk of schizophrenia morbidities . however , an apparent association was not observed between the vegetable dietary pattern and schizophrenia . by contrast , the cereal dietary pattern , which was characterized by a high consumption of rice , breads , and confectioneries and positively correlated with the intake of fats and proteins , was associated with schizophrenia . in the cereal pattern , schizophrenia correlated to fatty acid per calories intake . previous studies have demonstrated a relationship between polyunsaturated fatty acids and the pathogenesis of schizophrenia.12,13 a sudden change in fatty acids can play a role in a wide range of psychiatric , neurological , and developmental disorders in adults.12 a lack of omega-3 fatty acids in particular is related to the pathogenesis of schizophrenia.13 the dietary and physical activity habits of individuals with schizophrenia contribute to an unfavorable metabolic profile . the daily calories intake between patients with schizophrenia and control patients was similar ; however , individuals with schizophrenia consumed significantly greater amounts of sugar and fat.14 a few studies among patients with schizophrenia also reported a significantly increased intake of calories1517 and low consumption of both monounsaturated and polyunsaturated fatty acids.4 five studies reported no significant difference in the diets of patients with schizophrenia compared with those of healthy subjects.1721 our study shows that there was a higher ratio of fatty acids in the gross calories of the diet in patients with schizophrenia . this result supports the hypothesis that fatty acids may play a role in schizophrenia pathogenesis . alternatively , as a result of having compensated for a lack of fatty acids in the nervous system , the human body may consume more fatty acids , leading to this result . this study also shows that patients with schizophrenia tend to consume meals that contain substantially more oil and fat . in addition , it shows that the ratio of fatty acids in the gross calories of the diet is higher in patients with schizophrenia . this result suggests that schizophrenic patients may be more likely to consume food that contains oil and fat . roick et al22 reported that schizophrenic patients have a supper snack and consume fast food more frequently than the general population does . it is concerning that schizophrenic patients in japan live in an environment in which a diet that contains a substantial amount of fatty acids can be obtained relatively easily and inexpensively . only a few studies have investigated which factors may influence the diet of individuals with schizophrenia , and the findings appear to be inconsistent . the results from two such studies suggest that the poor diet associated with schizophrenia is influenced by socioeconomic status.22,23 fewer males , compared with the general population , reached acceptable levels for consumption of fruit , vegetables , milk , potatoes , and pulses.24 fewer females reached the levels for consumption of milk and potatoes.24 however , other authors noted that female patients consumed more fat , carbohydrates , and overall calories17 and less fruit , vegetables , and nuts25 than females in the general population did . in any case , poor diet may be associated with schizophrenia , and the lifestyle of people with schizophrenia raises concerns when considering the relationship of this diet with coronary heart disease.24 in this context , limiting fat intake in patients with schizophrenia may help prevent the onset of metabolic syndrome . we can not refer to causal determinations to be made between dietary patterns and the onset of schizophrenia . the results may be influenced by potential misclassification of dietary patterns , although the validity and reliability of bdhq have been estimated.9,26 third , we did not examine several potential confounding factors in our study , such as income levels and interpersonal relationships among families . income levels may be a peculiarly important factor , as the results may have been confounded by low income level . fourth , in this study , the ages of the participants were limited to 3060 years . it is known that the onset of schizophrenia commonly occurs between the ages of 10 and 20 years . our study did not investigate the 10 to 20-year age group ; therefore , we could not accurately determine whether there was a relationship between schizophrenia and fatty acids in this younger cohort . fifth , all of the volunteer participants may have been relatively healthier than the general population because they were more interested in their own health . thus , the members of the community who did not participate in the study may exhibit different schizophrenia morbidities . finally , we could not completely eliminate a beta error as the cause of our inability to detect certain associations between dietary patterns and schizophrenia , as our sample size was relatively small . we hypothesized that a dietary pattern comprising high amounts of vegetables would be associated with a lower risk of schizophrenia . however , no evident association was observed between the vegetable dietary pattern and schizophrenia . by contrast , the cereal dietary pattern , which was characterized by a high consumption of rice , bread , and confectioneries and positively correlated with the intake of fats and proteins , was associated with schizophrenia . this result may provide clues regarding the pathogenesis of schizophrenia and the prevention of metabolic syndrome in schizophrenic patients .

backgroundit has been reported that the onset of schizophrenia and the physical complications after its onset are related to diet . diet has been considered as a variable factor of the pathogenesis of schizophrenia . however , the results of studies on this relationship have been inconsistent . nutrients are consumed as a mixture in the diet . it is difficult to study them in isolation because they may have mutually complementary effects . the aim of this study was to assess the association between dietary patterns and schizophrenia in japan.methodsthe subjects comprised 237 outpatients aged 3060 years ( 123 males and 114 females ) with diagnoses of either schizophrenia or schizoaffective disorder . the patient diagnoses were determined based on medical records . patients were recruited between june 2011 and august 2011 . as a reference group , 404 healthy volunteers aged 3060 years ( 158 males and 246 females ) were also included . demographic data ( age , sex , and level of education ) were collected by face - to - face method interviews and self - administered questionnaires . we assessed eating habits over the last month using a validated brief self - administered diet history questionnaire . we detected dietary patterns through a principal component analysis of calorie - adjusted intake ; two principal components were retained . the principal components for each dietary pattern and for each individual were divided into tertiles by principal component scores.resultswe derived two dietary patterns by principal component analysis ; namely , the vegetable dietary pattern and the cereal dietary pattern . in the cereal dietary pattern , the high tertile was associated with a significantly increased risk of schizophrenia ( p<0.001).conclusionthe cereal dietary pattern is associated with schizophrenia . this article is the first to describe a study examining the association of dietary pattern and schizophrenia .

Introduction Methods Participants Measurements Statistical analyses Results Discussion Conclusion

a 42-year - old italian man , who had been living in nigeria because of his job since two years , was urgently repatriated following diagnosis of acute plasmodium falciparum malaria . fourteen days after anti - malarial treatment started , with quick resolution of fever , he suddenly complained of acute left flank pain . laboratory tests disclosed severe anemia ( hemoglobin 7.7 g / dl ) , moderate leukocytosis , markedly elevated c - reactive protein ( 232 mg / l ) , plasma d - dimer ( 2188 ug / l ) , lactic dehydrogenase ( 654 iu / l ) and creatine kinase ( 1255 rapid blood assay tested positive for p. falciparum antigen , with negative blood cultures for bacteria and parasites . prompt investigation with multi - detector ct [ figure 1 ] allowed confident diagnosis of diffuse , moderately hyperdense peritoneal effusion consistent with hemoperitoneum and splenomegaly with hyperdense , stratified subcapsular and perisplenic clotted hematoma . axial unenhanced ( a ) and contrast - enhanced ( b ) images of the upper abdomen reveal splenomegaly with stratified subcapsular and perisplenic hyperdensity consistent with ruptured splenomegaly and clotted hemorrhage . axial unenhanced image of the pelvis ( c ) and post - contrast panoramic coronal - reformatted image ( d ) show moderately hyperdense ( 30 - 40 hu ) effusion ( asterisks ) occupying the douglas pouch as well as other peritoneal compartments urgent laparotomic surgery confirmed abundant hemorrhagic peritoneal effusion without detectable active bleeding . pathology specimen reported 850-g enlarged spleen measuring 17148 cm after fixation , with large capsular interruption and underlying hematoma . histologically , diffuse parenchymal hemorrhage and markedly hypertrophic red pulp were observed , without follicular structure abnormalities nor signs of malignancy . although very uncommon , spontaneous ( non - traumatic ) hemoperitoneum is a life - threatening condition that generally represents a surgical emergency and may prove fatal even if promptly diagnosed and appropriately treated . its differential diagnosis includes bleeding from liver ( mostly hepatocellular adenoma or carcinoma rather than metastases ) or kidney ( particularly angiomyolipomas ) tumors , splenic rupture , visceral aneurysms or pseudo - aneurysms , deep abdominal varices from portal hypertension , excessive anticoagulant treatment , hemodialysis and gynaecological disorders such as ovarian cyst or ectopic pregnancy rupture . because of its widespread availability and extreme acquisition speed , ct currently performed on multi - detector scanners represents the mainstay diagnostic modality to investigate patients presenting to with acute abdomen and signs of hemodynamic instability . at ct , hemoperitoneum is heralded by higher - than - water density ( measuring 30 - 45 hounsfield units , hu ) peritoneal effusion , whereas the even more hyperdense ( 45 - 70 hu ) sentinel blood clot is usually observed nearest to the site of hemorrhage ; sometimes contrast extravasation indicating active bleeding may be detected , a finding that indicates the necessity for emergency surgical or interventional treatment . as in this case , ct confidently identifies the spleen as the injured organ . splenic rupture most usually occurs during various systemic infections , mostly including malaria , cytomegalovirus and epstein - barr virus , so a quick but thorough history and laboratory search for infection is required when spontaneous splenic rupture is diagnosed . uncommonly , rupture may complicate diffuse splenic infiltration such as in amyloidosis or gaucher 's disease , or leukemic , lymphomatous , or malignant disorders . since malaria still represents a major medical problem worldwide ( particularly in tropical and subtropical regions of asia and africa and parts of the americas ) , because of expanding travel and plasmodium resistance clinicians in the western world notably , malaria ranks first among causes of fever among travellers coming back from the tropics . when confronted with acute abdomen with signs of shock in a recent immigrant , tourist or expatriate returning from an endemic nation , malaria complicated by splenic rupture should be strongly suspected . during the course of acute malaria , splenic changes range from asymptomatic , palpable enlargement to serious complications such as infarction , rupture , hematoma , or abscess that occur more frequently in non - immune adults such as western travellers , often despite appropriate prophylaxis or during anti - malarial therapy . whereas splenic infarction has a favourable course and needs to be treated conservatively to avoid postoperative and asplenic morbidity , splenic rupture represents a life - threatening emergency with a non - negligible mortality ( 22% ) and usually requires immediate or delayed surgical splenectomy.[35 ] since clinical , laboratory , and ultrasound findings are usually insufficient to correctly differentiate these two complications , patients coming from overseas with suspected or confirmed malaria presenting to with enlarging tender splenomegaly , left upper abdomen , and/or pleuritic lower chest pain and variable - degree hemodynamic compromission require prompt imaging assessment with contrast - enhanced multi - detector ct that allows confident diagnosis and correct therapeutic choice .

splenic rupture with hemoperitoneum represents a life - threatening surgical emergency . malaria should be highly suspected as the probable underlying disease in returning travellers , expatriates , or recent immigrants from endemic countries . malarial complications involving the spleen occur even with appropriate prophylaxis or during antimalarial therapy . among them , splenic infarction has a favourable course and is treated conservatively , whereas life - threatening rupture requires immediate or delayed splenectomy . computed tomography ( ct ) allows confident differentiation between these two complications by identifying ruptured spleen with clotted hematoma and associated high - density peritoneal effusion ; furthermore , ct allows differential diagnosis from other causes of spontaneous hemoperitoneum .

CASE DESCRIPTION DISCUSSION

whole - body bone scintigraphy ( wbbs ) with technetium-99 m methylene diphosphonate ( tc-99 m mdp ) is widely available and commonly used to detect metastases from malignant tumors because it is more sensitive than x - rays and allows the whole body to be surveyed . however , multiple benign osteolytic lesions are very similar with bone metastasis in findings of bone scintigraphy . before sending out the report of multiple metastases , benign osteolytic lesions should be considered according to other imaging findings , detailed medical history , or even the preliminary pathology result . in this pictorial review , we retrospectively studied the wbbs with tc-99 m mdp findings in 5 patients of selected multiple benign osteolytic lesions . for adult patients a smaller dose was used dependent on patient body weight : adult dose/70 patient weight ( kg ) . a 41-year - old man with left upper arm pain for 3 months was admitted for left humerus fracture after a tumble . all of images of tc-99 m mdp wbbs ( figure 1 ) , left shoulder joint mri ( figure 2 ) , and thoracic ct ( figure 3 ) indicated bone metastases . eg was diagnosed definitely by histopathological examination ( positive : cd1a , s-100 , lca , ki67 ( 6% ) and negative : cd68 , cd79a , cd138 , and p53 ) . the patient received 4 courses of chemotherapy ( steroids , vinca alkaloids , and antimetabolites ) before discharge . two years later , the patient was admitted again in our hospital for right femoral fracture caused by an accidental fall . another tc-99 m mdp wbbs ( figure 4 ) was performed , and similar findings ( except for deterioration of right femur site ) were observed as shown in the previous one ( figure 1 ) . a 45-year - old female patient suffered chest pain for 2 months that deteriorated recently . g / l and 18.58 mg / l , respectively , and both were above the normal level . tc-99 m mdp wbbs ( figure 5 ) was performed before chemotherapy and found multiple bones accumulated the agent abnormally . clinical diagnosis was multiple myeloma igg stage iii ; then , chemotherapy of vad regimen was given to this patient . a 25-year - old male patient suffered cough and chest pain for 1 month , and the pain extended to back and waist recently . diffused military nodules with small cavities in both lungs , and multiple bone destructions in thoracic and lumbar vertebra were found on chest ct suggesting of disseminated tuberculosis . an 18-year - old female patient suffered right hip pain after long walking for this year . she received sectional resection of right femur and allograft for the reason of fibrous dysplasia when she was only 7 years old . x - ray showed benign tumor changes in upper section of right femur , considering fibrous dysplasia . wbbs ( figure 7 ) before operation found abnormal accumulation in right femur , tibia , and cotyle a 14-year - old male patient found swelling of interphalangeal joint in left middle finger 11 years ago . cr and mri illustrated multiple enchondroma in left hand . before the operation , tc-99 m mdp wbbs ( figure 8) found additional bones involvement . this patient received sectional resection of multiple lesions in left hand and allograft the next day . histopathological examination after operation was cracked cartilage tissue which is in accordance with multiple enchondroma . eg , formerly termed histiocytosis x , is the most common and benign form of the langerhans cell histiocytosis which includes another two forms : the hand - schller - christian disease ( the triad of diabetes insipidus , exophthalmos , and lytic bone lesions ) and the letterer - siwe syndrome ( a rapidly - progressing multisystem disease with poor prognosis ) . a 41-year - old man with eg admitted for pathologic fracture demonstrated multiple malignant metastases like bone involvement on both scintigraphic and radiographic imaging . although multiple bones were involved in this case with eg , we can easily differentiate it from the hand - schller - christian disease for the absence of main characteristics of diabetes insipidus and exophthalmos . the skeletal involvement is frequent and generally demonstrates as destroyed solitary or multiple bones in any age [ 14 ] , while the visceral involvement is rare and often occurs at age below 2 years old . localized pain is always the first symptom of bone involvement , but it can also be presented as pathologic fractures after injuries . the most commonly involved bones are skull , mandible , pelvis , spine , ribs , and long bones . radiographic imaging is the main modality for the diagnosis of eg , although the radiographic characteristics of eg are considerably different according to the site and the activity of the lesion . bone destruction in granulation tissue forming areas of osteolysis is the main pathological characteristic of eg and may involve any portion of any bone . typical finding on tc-99 m mdp wbbs in the patients with eg is the lesion with intensive radioactive accumulation with a photopenic center [ 13 ] , because the bone involvement in eg always begins from osteolysis that arise in the bone marrow cavity and following periosteal reaction . however , all the manifestations of the lesions with increased , decreased , or normal accumulation on tc-99 m mdp wbbs could be observed according to the amount of viable residual or reactive bone tissue . those can significantly accumulate the radioactive tracer [ 6 , 8 ] . in eg , tc-99 m mdp wbbs is generally less sensitive than radiography in the detection of osseous lesions . the findings in this patient confirmed this opinion . however , tc-99 m mdp wbbs may play roles in searching additional bone lesions and monitoring therapeutic response and is helpful when the radiographs are normal or equivocal . in addition , tc-99 m mdp wbbs has the advantage of detecting the asymptomatic bone abnormalities possibly missed by other imaging modalities . it is suggested that combination of various imaging modalities might be helpful to make a definite diagnosis when bone biopsy or operation is not available . in this patient , all images of tc-99 m mdp wbbs , mri , and ct demonstrated the characteristics of disseminated bone metastases although eg was finally diagnosed by postoperative pathological examination . multiple bone lesions in eg are relatively rare because solitary lesion predominates over multiple lesions , and only around 10% of solitary lesion may eventually develop into multiple lesions . eg is a benign inflammatory disease , and the activity of this disease may remain stable during follow - up . in this case , the tc-99 m mdp wbbs performed 2 year later revealed only mild alternations in a wide range of bone involvement as shown in the previous one except the increased radioactive accumulation in fractured right femur , confirming the benignity of eg . it can be mistaken radiographically for metastatic bone disease because it presents with multiple osteolytic lesions or diffuse osteopenia . wbbs often fails to demonstrate a hyperconcentration at sites of skeletal involvement by myeloma despite extensive disease by radiography . this occurs because reactive bone formation is not a feature of the disease ; this might be due to release of an inactivation factor by the tumor . radiographs typically show either a solitary or multifocal osteolytic pattern . however , skeletal survey is not always a useful screening method , so other imaging modalities such as ct and wbbs are often used . wbbs is sensitive in 75% of patients with myeloma , but only about 10% of lesions are shown . therefore , wbbs may be helpful when there is focal pain and a negative radiograph . skeletal tb occurs in only very small part of patients with tb , and therefore the diagnosis is often difficult due to the nonspecific nature of the clinical presentation . the spine , particularly the thoracolumbar spine , is the most common site of skeletal involvement of tb . back pain can affect anyone and in general can originate from the bone ( vertebrae ) , muscles , ligaments , tendons , or nerves . tuberculosis of the spine is one of the causes for back pain , and early diagnosis and management can prevent complications . the intense vertebra uptake on wbbs is nonspecific , so the differential diagnosis would include bone metastases from lung cancer . it is important to obtain material for culture and sensitivity in the absence of confirmed pulmonary tb for a definitive diagnosis . fibrous dysplasia is a benign tumor in which masses of fibroblasts and islands of cartilage replace bone marrow in one or more locations . it is commonly found in young patients with mild bone pain or as an incidental finding , although the lesions may persist into late adulthood . the main value of wbbs in fibrous dysplasia is to show polyostotic involvement , but sometimes these lesions may show only minimal uptake or even no uptake . from our case of multiple fibrous dysplasia , the differentiation from bone metastasis can be made by combining with their past medical history . enchondroma is a common benign lesion that appears in the medullary portion of bone and is composed chiefly of mature hyaline cartilage . when one side of the body exhibits greater involvement than the other , the condition is called ollier 's disease . the combination of enchondromatosis and soft tissue hemangiomata is referred to as maffucci 's syndrome . enchondroma can have high fdg and mdp uptake on scintigraphic imaging and occasionally may mimic metastatic lesions in patients being screened for metastatic disease . taking one with another , wbbs is an effective and economic method in detecting multiple enchondromatosis . given the low specificity of tc-99 m mdp wbbs and its sensitivity to increased bone remodeling from any cause , whether benign or malignant , the presence of multiple benign osteolytic lesions renders the interpretation indistinguishable from malignant metastasis . therefore , we should be watchful of giving the diagnosis of disseminated bone metastasis during our daily work ; furthermore , detailed past medical history and various laboratory results might be helpful for accurate diagnosis .

multiple benign osteolytic lesions are very hard to differentiate from disseminated bone metastasis . whole - body bone scintigraphy ( wbbs ) with technetium-99 m methylene diphosphonate ( tc-99 m mdp ) demonstrates multiple lesions with increased uptake in any bone involved . even combined with medical history and multiple imaging results , such as mri and ct , the clinical diagnosis of metastasis lesion remains as a challenge . these clinical characteristics are similar to multiple malignant bone metastases and therefore affect the following treatment procedures . in this paper , we analyzed multiple benign osteolytic lesions , like eosinophilic granuloma ( eg ) , multiple myeloma ( mm ) , disseminated tuberculosis , fibrous dysplasia , or enchondroma , occurring in our daily clinical work and concluded that additional attention should be paid before giving the diagnosis of multiple bone metastases .

1. Introduction 2. Eosinophilic Granuloma 3. Multiple Myeloma 4. Disseminated Tuberculosis 5. Fibrous Dysplasia 6. Enchondroma 7. Discussion 8. Conclusion

the existence of a human h / h genetic polymorphism was first established by the discovery of an individual devoid of the h antigen on red cells in bombay ( india ) who had antibodies in plasma reacting with all the red cells exhibiting the normal red cell abo phenotypes . this phenotype was characterized by the absence of a , b , and h antigens on red cells , and the serum of these persons had anti - a , anti - b , and anti - h , reacting with all o group bloods . they were non - secretors of abh and the majority of them were le ( a+ ) . watkins and morgan and gerard et al . later elucidated the biosynthetic pathway for abh and lewis ( le ) antigens . recently , molecular genetic studies were carried out to determine role of the h , se , and le genes in the expression of h antigen in secretions and lewis blood group antigen on erythrocytes . h - deficient bombay phenotype is rare , since it occurs in about 1 in 10,000 individuals in india and 1 per 1,000,000 individuals in europe . more recently , a large series ( 42 h - deficients ) of h - deficient individuals ( ~1:1000 ) were found in a small french island 800 km east of madagascar in the indian ocean , called reunion island . the two phenotypes resulted from products , or lack of products , of two different alleles of fut1 and fut2 genes ; the same and also additional alleles of both fut1 and fut2 were documented in other populations , particularly in japan , where the incidence of bombay and para - bombay individuals was shown to be 1 - 2 in 300,000 . in taiwan , para - bombay phenotype has a frequency of 1:8000 . in india , the fut1 mutation travels almost always ( one exception ) with a total deletion of fut2 ; in reunion island ( caucasian ) , the major inactivating mutation of fut1 travels almost always with the inactivating mutation of fut2 ; and the main oriental inactivating mutations of fut1 travel almost always with the wild - type fut2 . after the first report of oh phenotype from mumbai ( formerly bombay ) in 1952 by bhende et al . , several other workers detected this peculiar phenotype in india and also in the european countries . later on , it was found that many of the european cases , which were initially labeled as typical bombay phenotypes , turned out to be para - bombay phenotypes after absorption - elution studies.[1315 ] the difficulty with the bombay phenotype is that the individuals having blood group of bombay phenotype ( oh ) can either receive autologous donation or blood from an individual of bombay phenotype only ; no other blood will match in case of an emergency blood transfusion . the present study , being a part of the screening for hereditary hemolytic anemia ( i.e. , hemoglobinopathies and allied disorders ) in the tribal communities , was designed with the following aim and objective : to study and identify the rare blood groups like bombay ( oh ) phenotype detected , if any , in the bhuyan tribe of north - western orissa . a total of 244 khandayat bhuyan from ratansara village in hemgiri block and 379 paudi bhuyan tribals from three villages , namely , badjal , budhabhuin , and kuliposh colony in lahunipara block of sundargarh district in northwestern orissa were screened for hemoglobin disorders and abo and rh ( d ) blood groups during the year 2003 - 04 . from these villages , venous blood samples ( 1 - 2 ml in edta containing vials ) and saliva samples ( in tubes ) were collected . members of both the genders were included in the study and prior written informed consent was obtained from each subject . the human ethical committee of our institute had approved the screening and intervention for hereditary hemolytic disorders among the major tribal communities of sundargarh district in orissa . these samples were transported under ice - cold conditions to the laboratory within 24 h of collection and were analyzed using tube technique as per the instructions of the manufacturer of the anti - sera ( tulip diagnostics private limited , panaji , goa , india ) . the abh phenotyping was carried out by applying the standard forward and reverse grouping tube techniques . the bombay phenotype detected was further confirmed by certain specialized tests like absorption - elution studies , titration of naturally occurring antibodies at different temperatures , hemagglutination - inhibition study on anti - h by o saliva secretor , and secretor - status of the person as described by flynn and boorman and coworkers . two hundred and forty - four khandayat bhuyans from ratansara village in hemgiri block and 379 paudi bhuyan tribals from badjal and budhabhuin villages and kuliposh colony in lahunipara block of sundargarh district were screened . two unrelated women , aged 25 and 30 years , from the former block and a 30-year - old woman from kuliposh colony of the latter block showed no agglutination of red blood cells with anti - a , anti - b , and anti - h antisera , but the plasma of these individuals showed the presence of anti - a , anti - b , and anti - h antibodies , indicating the presence of the bombay phenotype . all the three cases were non - secretors of abh , i.e. , le ( a+ ) . the most striking finding of the present study is the detection of three unrelated cases of bombay ( oh ) phenotype in paudi bhuyan ( a primitive tribe ) and khandayat bhuyan from lahunipara and hemgiri blocks , respectively , of sundargarh district in north - western orissa , the central - eastern part of india . to the best of our knowledge , except in one study , no case of the bombay phenotype has ever been reported among the primitive tribes from the state of orissa . the present study showed a 1 in 122 incidence of the bombay phenotype among khandayat bhuyan tribe and 1 in 379 in paudi bhuyan , with an average of 1 in 278 among the bhuyan tribal population of orissa . since the population size of paudi bhuyan tribe is relatively small ( 3,521 individuals as per paudi bhuyan development agency at khuntagaon ) , and the practice of endogamy is strictly followed , inbreeding and consanguinity amongst them is not ruled out , which may be one of the major factors for the relatively high prevalence of recessive rare alleles like bombay phenotype among the khandayat and paudi bhuyan tribe . balgir has reported an incidence of 1 in 33 among the kutia kondh primitive tribe from kandhamal district of orissa . bhatia and sanghvi calculated the incidence of this phenotype as 1 in 13,000 individuals in mumbai . later on , bhatia and sathe found an incidence of 1 in 7600 after screening a large number of samples in mumbai . , after systematic screening of the rural population from ratnagiri and sindhudurg districts of maharashtra , reported the incidence of the bombay phenotype as 1 in 4500 in that region , while moores reported its incidence as 1 in 18,404 amongst indians settled in south africa . regarding the distribution and spread of the bombay phenotype in different states of india , it is apparent that the phenotype is more common in the states of western and southern parts of india as compared to other states . of the 179 cases recorded by sathe et al . . a slightly higher frequency of the bombay phenotype was also found in the neighboring state of karnataka ( 14 cases ) , andhra pradesh ( 8 cases ) , goa ( 6 cases ) , gujarat ( 5 cases ) , uttar pradesh ( 5 cases ) , and so on in the decreasing order . there is no published data available in literature on the caste / tribe - wise distribution of the bombay phenotype in india . moreover , most of the reported cases were either referred cases or were hospital cases seeking blood transfusions . hence , the exact prevalence of the bombay phenotype , which is based on random population screening ( not based on hospital data ) , is not yet precisely known in india . further , based on the available information in india , it is interesting to note that the incidence of the bombay phenotype is high in those states of india where consanguineous marriages are more prevalent , i.e. , andhra pradesh , tamil nadu , karnataka , maharashtra , gujarat , etc . than in the other states . the bombay phenotypes were also detected in japan , malayasia , thailand and sri lanka . found seven individuals of oh phenotype in two generations of an indian family settled in the usa . similarly , moores found 24 cases of oh phenotypes in 11 unrelated indian families settled in natal , south africa . more recently , a large series of h - deficient individuals ( ~1:1000 ) were found in reunion island in the indian ocean . this indicates that the bombay phenotype is mostly confined to south - east asian countries . it is suggested that further molecular research on the bombay phenotype is required , which may add to the existing variant phenotypes and elucidate the evolutionary significance and the operation of natural selection among the khandayat and paudi bhuyan primitive tribes of india . the bhuyan tribe is an endogamous community , which is mostly confined to sundargarh district of orissa . this is a border district , with jharkhand state in the north , chhattisgarh state in the west , keonjhar district in the east , and jharsuguda , sambalpur , and deogarh districts in the south [ figure 1 ] map of orissa showing thirty districts and study area ( shaded ) however , there are sporadic families of the bhuyan tribe seen in anugul , deogarh , jharsuguda , and keonjhar districts . some of their families have also migrated to assam to work in the tea plantations as labor force.[2729 ] the bhuyan tribe , although originally of one ethnic stock , is now divided into three social groups namely , the hill bhuyan ( pahari or paudi bhuyan ) , paraja bhuyan ( common people ) , and the paik or khandayat bhuyan ( warrior ) , which are distinguished from each other on the basis of three grades of primitive culture in the state of orissa . the hill bhuyan , the primitive and backward section , represents the hunting and food gathering stage of economic life ; they also practice a rudimentary shifting cultivation and have a primitive culture . the paraja bhuyan section represents a more advanced culture , and practise plough - cultivation and food production . the khandayat bhuyans have the most advanced culture , which equates them with other nontribal populations of the region .

background : blood group serology plays a vital role in transfusion medicine . the bombay ( oh ) phenotype is characterized by the absence of a , b , and h antigens on red cells and occurs rarely , especially in tribal populations of india.aims and objectives : this is a field - based random population study in the bhuyan tribal community . the study reports three cases of the rare bombay ( oh ) phenotype for the first time in the bhuyan tribe of sundargarh district in north - western orissa.materials and methods : taking informed consent , red blood cells of 836 bhuyan subjects were tested with three antisera , i.e. , anti - a , anti - b , and anti - h ( lectin ) for forward reaction . agglutinations of plasma with a , b , and o ( h ) red cells ( reverse reaction ) were also tested for the presence or absence of antibodies in the serum . specialized tests like absorption - elution , titration of naturally occurring antibodies at different temperatures , inhibition of anti - h by o saliva secretor , and determination of secretor status were performed.results:three cases of a rare blood group , bombay ( oh ) phenotype , ( 2 out of 244 khandayat bhuyan and 1 out of 379 paudi bhuyan from hemgiri and lahunipara blocks , respectively ) in the bhuyan tribe of sundargarh district in north - western orissa were detected , giving an incidence of 1 in 122 in khandayat bhuyan and 1 in 379 in paudi bhuyan , with an average of 1 in 278 among the bhuyan tribal population . this incidence is high in comparison to earlier studies reported from india.conclusions:the practice of tribal and territorial endogamy in a smaller effective populations ( for example , there are only 3,521 individuals in paudi bhuyan ) results in smaller marital distance and inbreeding , leading to increased homozygous expression of rare recessive genetic characters like the bombay ( oh ) phenotype . this study further testifies that the incidence is higher in those states of india where the consanguinity is a common practice .

Introduction Materials and Methods Results Discussion Appendix

diabetes is increasing in japan to levels that are comparable with those of other countries , and a recent publication reported that the number of individuals strongly suspected of having diabetes in japan was approximately 8.9 million in 2007 . the increasing rate of diabetes in japan probably reflects a complex interplay between genetic and environmental factors , including an increasingly westernized diet , a more sedentary lifestyle and the thrifty genotype characteristic of many japanese people . compared with other ethnic populations , japanese patients with type 2 diabetes show markedly reduced basal and impaired earlyphase insulin secretion , but lower indices of insulin resistance . accordingly , body mass index ( bmi ) , which has a positive correlation with insulin resistance , is generally lower in japanese type 2 diabetes patients , with a mean bmi of 24 kg / m , compared with 2730 kg / m and > 30 kg / m in european and us patients , respectively . in summary , these observations suggest that cell failure might play a relatively greater part than insulin resistance in the pathophysiology of type 2 diabetes in japanese people . this might be a result of loss of cell mass or function . in japan , sulfonylureas ( su ) are widely used either as monotherapy or in combination with other oral antidiabetic drugs ( oad ) to treat type 2 diabetes . in a crosssectional study of 17,000 japanese type 2 this is consistent with the known etiology of the disease in this population , where the key feature appears to be insufficient insulin secretion . the a diabetes outcome progression trial ( adopt ) study showed that treatment efficacy of glyburide ( also known as glibenclamide ) waned with successive treatment years . whereas glyburide improved cell function to almost normal levels within 6 months of initiation , the effect then decreased and cell function declined to below baseline level . reported that homeostasis model assessment of cell function ( homab ) gradually decreased over time after a transient improvement during 5year treatment with glibenclamide in japanese type 2 diabetes patients . this paradoxical effect might result from increased cell stress accelerating cell apoptosis , as well as the natural decline in cell function associated with disease progression . an alternative explanation is that desensitization to su occurs , in which case , the state of decreased cell function might be reversible . among the newer treatments for type 2 diabetes are the incretinbased therapies that include the glucagonlike peptide1 receptor ( glp1r ) agonists and dipeptidyl peptidase4 inhibitors ( dpp4i ) , which exert their actions through potentiation of incretin receptor signaling . glp1r agonists control blood glucose through regulation of islet function , principally with the stimulation of insulin and inhibition of glucagon secretion . liraglutide ( novo nordisk a / s , bagsvrd , denmark ) is a oncedaily , human glp1r agonist . glp1r agonists are glucosedependent insulin secretagogues , but their mechanism of action and target receptors on the cell differ from su . response to physiological levels of glp1 is reduced in type 2 diabetes patients ; pharmacological levels of native glp1 or glp1 analog therapy can restore this response . in clinical trials , in predominantly caucasian populations , treatment with glp1r agonists is associated with sustained improvements in glycemic control , weight reduction and low hypoglycemia risk . in clinical trials in european and us populations , glp1r agonists have shown favorable effects on several parameters of cell function . in animal models , in contrast to su , it is therefore possible that glp1r agonists might limit the progressive loss of cell function . it is of clinical interest to determine whether the beneficial effects of liraglutide on cell function evident in other populations could also provide clinical benefits in japanese patients , and if these benefits could be sustained for longer periods than are achievable with su . the results of glycemic control parameters , such as glycated hemoglobin [ hba1c ] , fasting plasma glucose ( fpg ) , postprandial glucose ( ppg ) and sevenpoint selfmonitored plasma glucose , as well as safety data , have been reported for two clinical trials with japanese type 2 diabetes patients receiving liraglutide , either as monotherapy in one trial or added on to su therapy in the other trial , for 24 weeks . here , we report the shortterm effect of liraglutide on cell function in these trials . adult japanese type 2 diabetes patients were screened and enrolled in one of two doubleblind , multicenter , randomized , parallelgroup clinical trials ( trial a or b ) if they were 20 years of age , with hba1c7.4 to < 10.4% and bmi < 35 . patients were to be on diet and oad ( trial a : oad monotherapy biguanide , sulphonylamide , su [ 50% approved dose in japan ] , glucosidase inhibitor , insulin secretagogue or insulin sensitizer , within approved japanese dose ranges ; trial b : su monotherapy glibenclamide 1.2510 mg / day , gliclazide 40160 mg / day or glimepiride 16 mg / day ) . patients with clinical conditions likely to interfere with the conduct of the trial were excluded . trials were carried out in accordance with the declaration of helsinki , with informed consent of patients and approval of relevant ethics committees . in trial a ( 24 weeks ; n = 411 ) , patients were randomized ( 2:1 ) to oncedaily liraglutide ( 0.9 mg ) or once or twicedaily glibenclamide ( 1.252.5 mg ) . in trial b ( 24 weeks ; n = 267 ) , patients continued su treatment ( glibenclamide [ 1.2510 mg ] , gliclazide [ 40160 mg ] or glimepiride [ 16 mg ] ) , and were randomized to one of two daily doses of liraglutide ( 0.6 or 0.9 mg ) , or placebo . in trial a , a 46 week runin / screening period preceded a 2week doseescalation period followed by a 22week maintenance period . in trial b , a screening visit was followed by a startoftreatment visit after 4 weeks , a 2week doseescalation period and a 22week treatment period . patients in trial a were stratified by pretreatment therapy ( oad ) and , in trial b , according to type of su . in both trials , liraglutide was initiated with 0.3 mg during week 1 and increased weekly ( in 0.3 mg increments ) to the final dose to minimize gastrointestinal sideeffects . randomization lists were prepared by the contract research organization responsible for the study , transcosmos inc . this organization also ensured that liraglutide was unidentifiable from placebo , blinded trial products and randomized patients , and informed the investigator and sponsor of randomization numbers . liraglutide was given by subcutaneous injection in the abdomen using a prefilled pen once daily in the morning or evening in the upper arm , abdomen or thigh . the primary outcome measure in all trials was hba1c at the end of the trial ( expressed by national glycohemoglobin standardization program values ) . secondary endpoints included sevenpoint selfmeasured ppg profiles , fpg , glucose homeostasisrelated parameters ( fasting insulin , proinsulin , cpeptide , glucagon , postprandial insulin and glucagon ) . secondary endpoints reported here include measures of homab index , proinsulin : insulin ratio and proinsulin : cpeptide ratio . a meal test ( japanesestyle breakfast ) was also carried out at baseline and 24 weeks . for each individual patient , the content of the meal was identical at these timepoints . intact proinsulin concentrations were determined by enzymelinked immunosorbent assay , based on antiproinsulin monoclonal antibodies ( ibl ; immunobiological laboratories , hamburg , germany ) . human insulin does not crossreact in this assay . within a concentration range of 5500 pmol / l , proinsulin des 6465 crossreacted with frequencies of 5365% . all analyses were carried out by a central laboratory ( mitsubishi kagaku bcl inc . , tokyo , japan ) , except the sevenpoint plasma glucose profile , which was measured before and approximately 2 h after each meal and at bedtime by selfmonitoring using standardized glucose meters ( glutest ace ; glutest pro , sanwakagaku , nagoya , japan ; glucocard diameter or glucocard diameter ; arkray kdk corp . , kyoto , japan ) before the start of treatment and at study end . cell function was assessed using the homab index , where homab = 360 fasting insulin/(fpg 63 ) and units of insulin and glucose were u / ml and mg / dl , respectively . for insulin and glucagon ( meal test ) , the area under the curve ( auc ) was calculated using the trapezoidal rule . trial a was carried out between december 2006 and november 2008 , and trial b between november 2006 and october 2007 . efficacy endpoint analyses included data from all patients who were randomized and received trial product with efficacy data . primary and secondary endpoints were analyzed using an analysis of variance ( anova ) model , with treatment group and stratification factor as fixed effects and baseline value as a covariate . an ad hoc analysis , aucinsulin 03 h : aucglucose 03 h , was carried out using anova model with trial ( a or b ) and treatment group ( liraglutide or comparator ) as fixed effects and corresponding baseline values as covariate . in trial a , sample size calculation was based on 1.2% common standard deviation ( sd ) for both treatments , and 0.0% true difference in hba1c at 80% power , a noninferiority margin for hba1c of 0.4% at a significance level of 2.5% . the sample size calculation in trial b was based on a mean difference of 0.6% in hba1c between 0.9 mg + su and placebo + su after 24 weeks , with a sd of 1.2 and 80% power . efficacy endpoint analyses included data from all patients who were randomized and received trial product with efficacy data . primary and secondary endpoints were analyzed using an analysis of variance ( anova ) model , with treatment group and stratification factor as fixed effects and baseline value as a covariate . an ad hoc analysis , aucinsulin 03 h : aucglucose 03 h , was carried out using anova model with trial ( a or b ) and treatment group ( liraglutide or comparator ) as fixed effects and corresponding baseline values as covariate . in trial a , sample size calculation was based on 1.2% common standard deviation ( sd ) for both treatments , and 0.0% true difference in hba1c at 80% power , a noninferiority margin for hba1c of 0.4% at a significance level of 2.5% . the sample size calculation in trial b was based on a mean difference of 0.6% in hba1c between 0.9 mg + su and placebo + su after 24 weeks , with a sd of 1.2 and 80% power . no baseline differences were noted between the trials . * at baseline . the value for glycated hemoglobin ( hba1c ; % ) is estimated as a national glycohemoglobin standardization program ( ngsp ) equivalent value ( % ) calculated by the formula hba1c ( % ) = hba1c according to the japanese diabetes society ( jds ) ( % ) + 0.4% , considering the relational expression of hba1c ( jds ) ( % ) measured by the previous japanese standard substance and measurement methods and hba1c ( ngsp ) . a , hba1c was reduced by 0.50% points with liraglutide relative to glibenclamide , whereas in trial b , mean hba1c was 1.00 and 1.27% points lower than placebo in the 0.6 and 0.9 mg liraglutide treatment groups , respectively . significant improvements in all other measured parameters of glycemia ( fpg , ppg and selfmonitored plasma glucose ) were also reported in each trial ( data not shown ) . no major hypoglycemic events were reported , and liraglutide was well tolerated across both trials . in trial a , the overall rate of hypoglycemia ( episodes / subjectyear of exposure ) was significantly lower in liraglutide than glibenclamidetreated patients ( 0.8 vs 5.5 ; p < 0.0001 ) . in trial b , the number of all hypoglycemic episodes was higher in the 0.6 and 0.9 mg / day liraglutide + su groups than in the placebo + su monotherapy group ( p = 0.0159 and p = 0.0085 , respectively ) . insulin levels in the 3h postbreakfast period ( aucinsulin 03 h ) were higher with liraglutide than with the comparator in both trials ( figure 1a ) . aucinsulin 03 h was significantly higher at week 24 ( last observation carried forward [ locf ] ) in liraglutidetreated groups than in the glibenclamide group ( p = 0.0165 ; trial a ) or placebo + su group ( p < 0.0001 ; trial b ; figure 1a ) . insulin and glucagon profiles and area under the curve ( auc)03 h values for insulin and glucagon by trial ( a and b ) and by treatment group in the 3 h after the standard meal test at the end of the study period . ( a ) insulin profiles ( 03 h ) and comparison of aucinsulin 03 h by trial and by treatment group . ( b ) glucagon profiles ( 03 h ) and comparison of aucglucagon 03 h by trial and by treatment group . the aucinsulin 03 h : aucglucose 03 h ratio was increased from baseline values ( 0.060.09 ) by more than 40% with liraglutide ( 0.140.16 ) relative to comparators ( 0.090.11 ) in both trials . the estimated mean ( 95% confidence interval [ ci ] ) treatment difference for aucinsulin 03 h : aucglucose 03 h after administration of 0.9 mg liraglutide vs comparator was 0.038 ( 0.028 , 0.048 ) . after administration of 0.6 or 0.9 mg liraglutide , the treatment difference ( liraglutide comparator ) was 0.038 ( 0.029 , 0.048 ) . fasting glucagon levels and aucglucagon 03 h at week 24 ( locf ) in the liraglutide group were significantly lower than in the glibenclamide group ( trial a ) , but not different to the su monotherapy groups ( trial b ; table 2 and figure 1b ) . ci , confidence interval ; ls , least squares ; na , not available ; su , sulfonylureas . fasting insulin was similar between liraglutide and comparatortreated patients ( table 2 ) in both trials . endofstudy fasting cpeptide levels were significantly higher in liraglutide + sutreated patients than in those on placebo + su in trial b ( p = 0.0017 ) , but there was no significant difference between liraglutide and glibenclamidetreated patients in trial a. the estimated mean of fasting proinsulin at trial end was significantly lower in liraglutide than glibenclamidetreated patients in trial a ( p < 0.0001 ) , and was not significantly different for patients on liraglutide + su and placebo + su in trial b ( table 2 ) . in trial b , the estimated treatment difference ( [ liraglutide + su ] [ placebo + su ] ) in homab index was significant for both doses of liraglutide ( p = 0.047 and p = 0.0012 for 0.6 and 0.9 mg , respectively ) . no significant betweentreatment difference at the end of trial in homab was observed in trial a ( glibenclamide 34.9% ; liraglutide 39.0% ; p = 0.0997 ; table 3 ) . ci , confidence interval ; homab , homeostasis model assessment of cell function ; ls , least squares ; se , standard error ; su , sulfonylureas . decreases in the proinsulin : insulin ratio from baseline ( baseline of 1.792.15 across all groups ) for liraglutidetreated groups ( decrease of 0.650.87 across all groups ) were greater than in sutreated groups ( decrease of 0.150.26 ) , resulting in lower values for the liraglutidetreated group than for the comparator or placebotreated group at week 24 . reduction in the proinsulin : cpeptide ratio from baseline ( baseline of 4.094.76 across groups ) was also greater in liraglutidetreated groups ( decrease of 1.241.61 ) than in sutreated patients ( decrease of 0.060.55 ) . the present report shows that 24 weeks treatment with liraglutide provides a significant improvement in cell function in japanese type 2 diabetes patients . additionally , liraglutide was associated with significantly greater improvements in key parameters of glycemia , namely hba1c , fpg , ppg and sevenpoint selfmonitored plasma glucose , than comparators , and these results have been reported elsewhere . as previously described , liraglutide resulted in weight loss or no weight gain in japanese patients . the overall improvement of glycemic control with 0.9 mg liraglutide seen in japanese populations was not different to that observed with 1.2 mg liraglutide in nonjapanese populations . indirectly , these observations suggest that different degrees of su insensitivity rather than cell apoptosis are responsible for the failure of pretrial treatment in japanese type 2 diabetes patients . although su and liraglutide have powerful insulinreleasing effects on cells , they exert their effect through separate , independent receptors . glp1r exist in the cell plasma membrane , and receptor interaction leads to mobilization and exocytosis of insulincontaining granules . in contrast , su stimulate insulin secretion by closing cell adenosine5triphosphatesensitive potassium channels ( katp ) through binding to su receptor 1 ( sur1 ) and , according to recent evidence , by activating the cyclic adenosine monophosphate ( camp ) sensor exchange protein activated by camp with the exception of gliclazide also through direct binding . the differences in cell function reported here should , however , be considered in respect to the different levels of glycemic control achieved with liraglutide vs comparators . recently , it has been shown that glp1r agonists can improve impaired glucose metabolism in diabetic pancreatic cells , resulting in an increase in adenosine5triphosphate ( atp ) production . as the closure of katp channels by su is atpdependent , it seems likely that the combination of a glp1r agonist and an su would be more effective at stimulating insulin secretion than a glp1r agonist alone . we have recently shown that active glp1 levels after meal ingestion are extremely low in healthy japanese subjects and japanese patients with type 2 diabetes . it seems likely , therefore , that supplementation of glp1r agonists that are resistant to degradation by dpp4 would be effective in enhancing the glp1 effect . all indicators of cell function were substantially ameliorated , showing that liraglutide positively affected the insulin response to glucose . a significant increase in postprandial insulin secretion ( aucinsulin 03 h ) compared with comparators was shown . in support of this observation , the postprandial insulin : although insulin secretion by liraglutide from cells is glucosedependent , insulin secretion diminishes despite the continued presence of liraglutide as glucose levels normalize . this could be expected to counter postprandial hyperglycemia , a feature of type 2 diabetes , even at an early stage , in japanese type 2 diabetes patients . liraglutide appears to have a positive impact on pancreatic glucoregulatory function , as shown by the trend to a reduction in fasting and postprandial glucagon levels . trial a , in particular , showed significant glucagon reductions with liraglutide treatment compared with glibenclamide , and a similar trend was observed in trial b , despite not achieving significance . the absence of significance in trial b might be related to the longterm use of su , which are reported to increase prandial glucagon levels . therefore , in patients receiving combination therapy with liraglutide and an su , the observable effect on glucagon levels would be attenuated as a result of the opposing effects each agent has on glucagon secretion . in type 2 diabetes , normal suppression of glucagon after a meal is blunted , resulting in hyperglucagonemia and increased hepatic glucose production in many patients , thus exacerbating hyperglycemia . therefore , counterregulatory responses affecting glucagon secretion are impaired in these patient groups , and larger , more focused studies using appropriately matched patient groups will be required to unambiguously determine the effect of liraglutide on glucagon secretion . liraglutide promotes cell preservation in animal studies , increasing cell mass in rodents and inhibiting cell apoptosis in vitro . in our studies , a , homab measurements with 0.9 mg liraglutide and glibenclamide were significantly improved from baseline . these results were also in accordance with a previous monotherapy trial ( lead3 ) carried out in a predominantly caucasian population . although liraglutide did not outperform glibenclamide regarding improvements in homab , it is encouraging to observe that it can be as equally effective as such a potent and widely used insulin secretagogue . consistent with this finding , madsbad et al . reported a significant improvement from baseline in homab with 0.75 mg liraglutide ( 23.6% ) , which was similar to that observed with glimepiride ( 14 mg , 24.6% ) in 193 caucasian type 2 diabetes patients . the magnitude of the liraglutideassociated increase in homab from baseline in the present study ( in the order of 90100% ) was greater than that shown in other studies in mainly caucasian study populations . in another study , treatment with liraglutide increased homab relative to baseline by approximately 30% . during liraglutide treatment , the fasting proinsulin : insulin ratio was decreased . this might suggest improved processing of insulin in the cell , possibly as a result of a more appropriate pattern of insulinotropic action reducing overall cell stress . an elevated proinsulin : insulin ratio is a principal feature of type 2 diabetes and prediabetes , and shows cell dysfunction . hyperproinsulinemia might be caused by increased demand on the cells ( during hyperglycemia and as a consequence of insulin resistance ) , increasing the release of incompletely processed granules containing proinsulin . alternatively , it is suggested that the increased proinsulin concentration might be a result of an intrinsic cell defect in type 2 diabetes . the improvement in proinsulin : insulin ratio with liraglutide relative to su therapy might reflect the different modes of action of the two agents . while both enhance insulin secretion from cells , liraglutide s effect appears to be glucosedependent , and hence predominantly a postprandial effect , whereas that of the su appears more or less continuous , leading to increased cell stress and , potentially , an increased rate of cell apoptosis . taken together , the results from the present report suggest that treatment with liraglutide is at least as effective in japanese patients with type 2 diabetes as in comparable populations . despite the fact that the insulin secretory capacity of the cells in japanese type 2 diabetes patients might be substantially more impaired than in other populations , there appears to be sufficient cell mass to preserve significant capacity for a glucosedependent insulin secretory response to liraglutide . this could indirectly show that the decreased insulin secretion seen in this population is more a consequence of impaired cell function than lost cell mass . the reported improvement in parameters of cell function and glucoregulation provides scope for optimism that the therapeutic effects of liraglutide could be sustainable with longterm therapy , possibly retarding the eventual decline in cell secretory function that typifies su therapy .

abstractaims / introduction : cell function was evaluated by homeostasis model assessment of cell function ( homab ) index , proinsulin : insulin and proinsulin : cpeptide ratios in adult , japanese type 2 diabetes patients receiving liraglutide.materials and methods : data from two randomized , controlled clinical trials ( a and b ) including 664 japanese type 2 diabetes patients ( mean values : glycated hemoglobin [ hba1c ] 8.619.32% ; body mass index [ bmi ] 24.425.3 kg / m2 ) were analyzed . in two 24week trials , patients received liraglutide 0.9 mg ( n = 268 ) or glibenclamide 2.5 mg ( n = 132 ; trial a ) , or liraglutide 0.6 , 0.9 mg ( n = 176 ) or placebo ( n = 88 ) added to previous sulfonylurea therapy ( trial b).results : liraglutide was associated with improved glycemic control vs sulfonylurea monotherapy or placebo . in liraglutidetreated groups in trials a and b , area under the curve ( auc ) insulin 03 h was improved ( p < 0.001 for all ) and the aucinsulin 03 h : aucglucose 03 h ratio was increased ( estimated treatment difference [ liraglutide comparator ] 0.058 [ 0.036 , 0.079 ] ) . homab significantly increased with liraglutide relative to comparator in trial b ( p < 0.05 ) , but not in trial a. the reduction in fasting proinsulin : insulin ratio was 50% greater than in comparator groups.conclusions : in japanese type 2 diabetes patients , liraglutide was associated with effective glycemic control , restoration of prandial insulin response and indications of improved cell function . this trial was registered with clinicaltrials.gov ( trial a : no . nct00393718/japiccti060328 and trial b : no . nct00395746/japiccti060324 ) . ( j diabetes invest , doi : 10.1111/j.20401124.2012.00193.x , 2012 )

Introduction Materials and Methods Statistical Analysis Results Discussion

evaluation of her current complaint revealed a mobile urethra , stable cystometrogram , and complete bladder emptying . she had a positive cough stress test with a valsalva leak point pressure of 119 cm h2o with 150 ml of fluid in the bladder . one hour after surgery , she complained of lower abdominal pain , a feeling of lower abdominal distension , and nausea . her hemoglobin changed from 12.7 g / dl preoperatively to 8.3 g / dl about 2 hours postoperatively . computed tomography ( ct ) revealed a retropubic hyperdense hematoma sized up to 10 cm9 cm8 cm and active contrast leakage from the left internal pudendal artery ( fig . the arteriography also confirmed left internal pudendal arterial injury , which was successfully treated by selective embolization with a gelatin sponge ( gelfoam , pfizer inc . , new york , ny , usa ) ) with 25% n - butyl - cyanoacrylate ( fig . the patient 's postoperative course was uneventful requiring neither blood transfusion nor surgical removal of the hematoma . two years after surgery , her stress incontinence was resolved , and she complained of mild urge incontinence . since the tvt procedure was introduced , it has become the gold standard for the treatment of female stress urinary incontinence . although this method is minimally invasive , various complications have been reported even though the complication rate is low . new minitapes , such as tvt - secur , may be a way to reduce such perioperative complications . the tvt - secur system was developed with the intention of further reducing the invasiveness of the surgical procedures by avoiding the passage of the needle carriers through the retropubic or obturator regions . the advantages of this new technique are thus related to the short passage of the needles , which minimizes the risk of vascular , nerve , or visceral injury . the tvt - secur system was designed to overcome two of the perioperative complications reported with the use of the tvt - obturator : thigh pain and bladder outlet obstruction . these complications were addressed by tailoring the tape to a length of only 8 cm and anchoring the tape edges into the internal obturator muscle , rather than passing it through the obturator foramen , muscle , and membrane . however , a possible reason for hemorrhagic complications of the tvt - secur procedure may be the scalpel - shaped tip of the inserter , which can cut the vessels . minor intraoperative bleeding from the initial vaginal dissection can usually be controlled with direct pressure on the paraurethral and retropubic areas , held for 5 to 10 minutes and followed by vaginal packing . greatly increased bleeding that results in a retropubic hematoma usually arises from a venous injury during trocar passage , and up to 2.8% of these cases may require transfusion . depending on the size of the hematoma , signs and symptoms may include pain , urgency and frequency from bladder compression , a suprapubic mass , hypotension , tachycardia , lightheadedness , vaginal and abdominal tenderness , and a decrease in hematocrit . interestingly , specified bleeding from an internal pudendal artery has not been reported previously with the tvt or tvt - obturator technique . reported in research carried out on 141 cases of tvt - secur that no injuries to the vessels and no hematoma were observed . . demonstrated that no bleeding or hematoma occurred during their 91 cases of the tvt - secur procedure . however , severe bleeding from the internal obturator muscle and injury of the corona mortis after tvt - secur have been reported . if abnormal abdominal pain or abdominal distension appears after the tvt - secur procedure , a ct scan should be performed . the patient should also be carefully examined if other complications occur , such as buttock or groin pain , signs of shock , vaginal bleeding , or urinary retention . to decrease the risk of vascular injury , the pelvic surgeon should pay attention to proper technique during the approach and have a high clinical suspicion of complications under the appropriate circumstances .

various postoperative complications have been reported after the use of tension - free vaginal tapes ( tvt ) . the transobturator approach was introduced to minimize the potential complications . the next generation of recently introduced tvt - secur is intended to minimize the incidence of complications . herein we report a case of internal pudendal artery injury sustained during this procedure that was successfully treated by radiological embolization . angiography with vessel embolization , when available , should be considered when the arterial injury is suspected .

CASE REPORT DISCUSSION

solid pseudopapillary tumor ( spt ) of the pancreas is a rare pancreatic neoplasm with uncertain etiology that usually occurs in young females . since frantz first described spt in 1959 there have been several synonyms for spt in the literature , such as franz 's tumor , solid and cystic tumor , solid and papillary epithelial neoplasm , papillary - cystic neoplasm , papillary cystic epithelial neoplasm and papillary - cystic tumor . in 1996 , the world health organization ( who ) renamed this tumor as spt in the international histological classification of tumors . solid pseudopapillary tumor is generally considered to have a low potential for malignancy , which is often localized in the pancreas and is rarely a metastatic disease . because of its rareness and unusual behavior , spt is often associated with diagnostic and therapeutic challenges . surgical resection is now considered the most efficient treatment option for patients with spt , because it offers a good chance of long - term survival . however , there is a lack of data on the management of liver metastasis in patients with spt . we report a case of a patient with pancreatic spt with liver metastasis , who obtained a favorable outcome after rigorous treatment . a 19-year - old female was admitted to our hospital in january 2009 with chief complaints of epigastric mass on palpation for 16 months and upper abdominal pain for 2 months . findings of routine laboratory tests , including carcinoembryonic antigen ( cea ) and cancer antigen 19 - 9 ( ca 19 - 9 ) , were within the normal range . an abdominal ct scan found a giant solid mass ( 14.8 cm 8.9 cm ) in the pancreatic body , multiple nodules in the anterior and posterior segment of the right lobe of the liver about 8.5 cm 3.7 cm and 7.2 cm 3.1 cm and splenomegaly ( fig . subsequently , we performed percutaneous ct - guided tru - cut biopsy of the tumor and pathological diagnosis of the biopsy material revealed pancreatic spt . abdominal ct scan on admission revealed a giant solid mass ( 14.8 cm 8.9 cm ) in the pancreatic body , multiple nodules in the anterior and posterior segment of right lobe of liver about 8.5 cm 3.7 cm and 7.2 cm 3.1 cm and splenomegaly . a ) unenhanced ct ; b ) early phase of contrast - enhanced ct ; c ) portal phase of contrast - enhanced ct given the patient 's young age as well as the location of the pancreatic tumor , which was not situated in the tail but in the body , pancreaticoduodenectomy apart from distal pancreatectomy , hepatic tumor resection and splenectomy was conducted . a large mass in the pancreas with multiple metastatic nodules in the liver was seen during the operation . her post - operative course was unremarkable , and she was discharged 1 week after her surgery with routine follow - ups . when dissecting the mass , we found a heterogeneous solid appearance with areas of hemorrhage and extensive necrosis . microscopically , solid areas mainly consisting of monomorphic epithelioid cells and a moderate cellular atypia without mitotic activity were found ( fig . 2 ) . characteristic pseudopapillary formations were frequently observed in the liver metastases ( fig . immunohistochemical studies of the primary lesion revealed that the tumor cells were diffusely positive for vimentin , neuron - specific enolase ( nse ) , synaptophysin , and cd10 , with less than 20% ki67 proliferation index . a ) low magnification ( 100 ) ; b ) high magnification ( 400 ) . he microscopic image of tumor showing the presence of pseudopapillary formations in the liver metastases . a ) low magnification ( 100 ) ; b ) high magnification ( 400 ) . ct scan performed 3 months after the surgery showed a metastatic mass in the medial segment of the left lobe of the liver with a size of 5 cm 3 cm ( fig . radical excision of the metastatic nodules was considered unfeasible , and transcatheter arterial chemoembolization ( tace ) with epirubicin and iodized oil was performed 3 times in total . adjuvant chemotherapy or radiotherapy were not offered , because very few reports regarding the use of such therapies for pancreatic spt existed with only limited response [ 3 , 4 ] . and then , follow - up abdominal and chest ct scans were done every 3 months in the first half year and every 6 months afterwards , and no tumor in the pancreas or in the liver was detected . the patient remained disease - free at 35 months after tace , i.e. 38 months after removal of the primary pancreatic tumor . three months after the surgery , ct revealed a metastatic mass in the medial segment of the left lobe of liver with a size of 5 cm 3 cm . a ) unenhanced ct ; b ) early phase of contrastenhanced ct ; c ) portal phase of contrast - enhanced ct solid pseudopapillary tumor is a rare and indolent neoplasm of the pancreas with a favorable prognosis after resection . it usually occurs in young women in the second or third decade of life , with an average female : male ratio of 5 : 1.9 , which is up to 10 : 1 in certain studies . the tendency of spn to afflict predominantly young women leads to the hypothesis that its pathogenesis may be influenced by sex hormones . yeh et al . have reported that the progesterone receptor is uniquely expressed in spt while both estrogen and progesterone receptors are expressed in mucinous cystic neoplasm . tien et al . reported no significant differences in qualitative sex hormone receptor status between male and female spt patients . clinical studies have shown that the progesterone receptor is expressed in all cases of spt . and in our report , the patient tested negative for both estrogen and progesterone receptors . thus , more evidence has to be collected to clarify the potential impact of sex hormones on the pathogenesis of spt . immunohistochemical stains show a variety of expressions , such as epithelial , neural and stromal elements . a previous study hypothesized that it might be a tumor derived from the pancreatic duct cells , acinar cells , and endocrine cells . recent evidence indicates that spt may arise from the centroacinar cell of the pancreas . based on both immunohistochemical staining and electron microscopic findings , a potential link between tumor cells and centroacinar cells is identified . however , further studies are still needed to confirm this correlation . like solid variant of serous cystadenoma of the pancreas , a rare tumor of the pancreas , there often has been a delay in diagnosis until the discovery of a large tumor mass during abdominal examination or imaging . it appears to be capable of local invasion but usually does not metastasize to distant sites . some studies observed that metastases or tumor recurrence were detected in about 15% of cases of spt . other sites that may have metastatic masses include the vena cava , spleen , peritoneum and duodenum . in our report , ultrasonography and ct revealed a large mass in the pancreatic body and multiple nodules in the liver when the patient was admitted to the hospital . after complete resection of these tumors , liver metastases appeared again 3 months following the surgery , indicating malignancy of the tumor . generally speaking , surgery is the best choice of treatment even in cases of distant metastasis , because other adjuvant therapies have not shown demonstrable responses . distal pancreatectomy combined with or without splenectomy can be performed for pancreatic body and/or tail tumor , and pancreatoduodenectomy for pancreatic head tumor . considering the multiple liver metastases in this case , we performed aggressive surgical resection to remove spt , spleen and liver nodules . the patient received tace treatment and she remained disease - free at 35 months after tace . follow - up ct scans did not detect any nodes in the liver after tace . our report suggests that although pancreatic spt may be associated with malignant potentiality , a favorable prognosis can also be obtained via rigorous treatment . tace with pharmorubicin and iodized oil is an effective treatment option for the control of liver metastasis of spt .

solid pseudopapillary tumor of the pancreas is a rare pancreatic neoplasm that typically occurs in young females . as a low - grade malignancy , the tumor seldom recurs and metastasizes . management of liver metastasis from such a tumor remains unclear . we present a case of a young girl with liver metastasis due to solid pseudopapillary tumor of the pancreas . she was admitted with chief complaints of epigastric mass on palpation for 16 months and upper abdominal pain for 2 months . an abdominal ct scan detected a mass in the pancreas and multiple nodules in the liver . then , percutaneous ct - guided tru - cut biopsy was performed and pathological diagnosis of the biopsy material revealed solid pseudopapillary tumor of the pancreas . at 3 months after surgical resection of the pancreatic and liver tumors , ct scan found nodules in her liver . the patient received treatment with transcatheter arterial chemoembolization . she remained well during the 3 years of follow - up with no evidence of recurrence . therefore , it is suggested that although solid pseudopapillary tumor of the pancreas may be associated with malignant potentiality , a favorable prognosis can also be obtained via rigorous treatment .

Introduction Case report Discussion None

we constructed a decision tree cost - effectiveness model for a target population of 163,000 women who at the time of the intervention are sexually active with a male partner , fertile , not desiring pregnancy within the next 12 months , and not using permanent contraception methods ( e.g. , tubal ligation and vasectomy ) ( technical appendix table and figure 1 ) . in the no intervention scenario , no changes in contraceptive use distributions from the status quo are expected to occur . in the intervention scenario , women in puerto rico are assumed to have same - day access to contraception methods , including larc , with no out - of - pocket costs . in addition , healthcare providers would be trained to provide client - centered contraceptive counseling and outreach so that women have the information they need to make an informed choice on the contraception method that is best for them . the model specifies contraceptive method use distribution , unintended pregnancy events , and the frequency of zam ( technical appendix figure 1 ) . we assumed an intervention in place throughout a year - long zika virus outbreak in puerto rico . we evaluated the costs and outcomes of increased access to contraception compared with no intervention ( i.e. , status quo ) . output measures included numbers of zam cases prevented , including stillbirths , elective terminations , and live - born infants , and healthy life years ( hly ) gained . economic benefits of the intervention included avoided costs from zam cases prevented and costs avoided for monitoring for zika virus exposed pregnancies and infants born from zika virus infected mothers . in addition , the avoided cost of prenatal , delivery , postpartum , and neonatal care associated with avoided unwanted pregnancies was considered an economic benefit . in cost - effectiveness analyses , if total avoided cost exceeds the cost of an intervention that improves health , the intervention is considered cost - saving . for scenarios with positive net costs , we reported the incremental cost - effectiveness ratio ( icer ) , which is the net cost per hly gained in comparison to the status quo . independent of zika virus exposed pregnancies and zam , unintended pregnancy is associated with adverse maternal and child health outcomes . because roughly 60% of unintended pregnancies are classified as mistimed , which might result in a delayed rather than avoided pregnancy , with the same costs occurring later ( 7 ) , we only estimated avoided medical costs from prevention of the 40% of unintended pregnancies presumed to be not desired at a later time irrespective of zika virus infection . we estimated the inputs for the decision - tree model and their sources ( table 1 ) . in the no intervention scenario , we took the distribution of women in the target population by use of different types of reversible contraceptives ( or no use ) from a 2002 survey administered in puerto rico and adjusted it to reflect the 36% decrease in fertility rates in puerto rico during 20022015 ( 8,23,24 ) . * brfss , behavior risk surveillance system ; cdc , centers for disease control and prevention ; hly ; healthy life years ; iud , intrauterine device ; larc , long - acting reversible contraceptive ; nsfg , national survey of family growth ; ondieh , office of noncommunicable diseases , injury and environmental health ; zam , zika virus associated microcephaly . authors calculation based on 2015 puerto rico total population size , 2015 birth rate , and adjusted contraception usage in 2002 brfss in puerto rico ( online technical appendix table , http://wwwnc.cdc.gov/eid/article/23/1/16-1322-techapp1.pdf ) . less - effective methods include condoms , spermicides , fertility awareness methods , withdrawal , sponge , and diaphragm . moderately effective methods include oral contraceptive pills , patches , vaginal rings , and injectable contraceptives . the contraception use distribution at baseline ( without intervention ) is based on adjusting the distribution reported in the 2002 brfss in puerto rico excluding women using permanent contraception by assuming 5 percentage points fewer women using no contraception than in 2002 , which is based on a 36% reduction of birth rate among women 1544 years of age in puerto rico from 2002 to 2015 ( national vital statistics report for 2002 and 2015 unpublished birth data from puerto rico ) , and the reported reasons for us teen pregnancy reduction ( http://www.cdc.gov/nchhstp/newsroom/docs/factsheets/yrbs-fact-sheet-final-508.pdf ) ; the decline in teen pregnancies was the fastest of any age group in puerto rico during 20102014 , as reported in national vital statistics reports . data from title x clinics in puerto rico also show that the percentage of women of reproductive age served in title x clinics increased from 2.2% in 2006 to 10% in 2015 . we also assume that new contraception users have the same contraception method distribution as contraception users as reported in the 2002 brfss survey ( 8) . we assume 22% dual use among moderately effective method users at baseline ( based on nsfg 20112013 data and unpublished analyses supplied by karen pazol , ondieh , cdc ; we accounted for the effectiveness of dual - method use in preventing pregnancy but not for preventing sexual transmission of zika virus ) . we calculated method - specific annual pregnancy rates by multiplying the failure rates of contraception methods under typical use by a calculated correction factor of 0.88 to adjust for the model over - predicting the number of unintended births in 2015 using the typical failure rates only . multiplying method - specific contraceptive failure rates by numbers of women in each method category typically results in more predicted pregnancies and births than are actually observed , in part because of heterogeneity in sexual behaviors ( 19 ) . assuming 50% of no contraception users , 60% of less - effective contraception users , and 100% of moderately effective contraception users will visit a healthcare provider for contraception services under intervention . based on the nsfg 20112013 , among women of reproductive age who did not intend to become pregnant and not using permanent contraceptive methods , 21% of no contraception users , 33% less - effective method users , 97% moderately effective method users had at least 1 visit for contraception services in the last 12 months ( personal communication , karen pazol , ondieh , cdc , 2016 ) . contraceptive services include receiving a birth control method or a prescription , receiving a checkup for birth control , receiving counseling about birth control , receiving a sterilizing operation , receiving counseling about a sterilizing operation , receiving emergency contraception , or receiving counseling about emergency contraception . we assume the intervention will increase the percentage of women visiting their provider for contraception counseling . in the contraceptive choice project ( 9 ) , 67% of participants who wished to avoid pregnancy chose to use highly effective methods , and 33% chose to use moderately effective methods . for the main scenario , we applied those estimates to 40% of the target population , assuming that 40% of unintended pregnancies are unwanted , and assumed that 20% of the remaining 60% of switchers would choose highly effective methods . # ellington et al . ( 5 ) estimated 180 cases ( interquartile range 100270 cases ) of congenital microcephaly associated with zika virus in puerto rico among an estimated 31,272 births ( unpublished birth data , puerto rico department of health , 2015 ) . on the basis of those estimates , we estimated the prevalence of congenital microcephaly : 58/10,000 births ( interquartile range 32/10,00086/10,000 ) . * * the pregnancy loss rate in the us zika pregnancy registry as of july 21 , 2016 , was 35% ( 14 ) . the termination rate is calculated as the overall pregnancy loss rate minus the assumed stillbirth rate . a range of the main value 20% was used to create upper and lower bounds used in sensitivity analyses . includes cost for devices and costs for 1 year of injections , pills , patches , rings , condoms , and the cost for related services in the first year . weighted average cost for hormonal iud ( 50% , $ 659 ) , copper iud ( 25% , $ 598 ) , and implant ( 25% , $ 659 ) , based on contraception choice study ( 9 ) and commonly used devices in puerto rico . weighted average cost for generic contraceptive pill ( 78% , $ 370/y ) , injectable ( 14% , $ 240/y plus $ 130 for consultation for the year ) , and ring or patch ( 8% , $ 964/y ) , with the distribution of moderately effective methods based on nsfg , 20112013 . # # weighted average cost of moderately effective method plus cost of less - effective method . * * * male condom . including the cost for checking the placement of iud in the first year of insertion . weighted average for vaginal and c - section delivery , including prenatal care , delivery , postpartum , and neonatal cost at delivery and in the first 3 months . assumes additional costs related to repeated zika virus testing by igm ( 12 tests ) for all pregnant women , 4 extra detailed ultrasound examinations , and 25% of women getting amniocentesis during all zika - positive pregnancies ( 25% infection rate at baseline , range 10%70% ) ( 5 ) , based on oduyebo et al . assumes 2 zika virus tests ( igm and pcr ) for serum and placenta , cranial ultrasound , and eye examination for all infants born to zika virus positive mothers based on fleming - dutra et al . # # # three pcr tests for zika virus using placenta , cord , and brain tissues of the fetus based on martines et al . ( 22 ) . * * * * assuming all prenatal care cost , including extra cost of zika virus associated testing and monitoring during pregnancy and extra cost for zika virus associated testing for fetus . assuming half of the prenatal care cost , including extra cost of zika virus associated testing and monitoring during pregnancy and extra cost for zika virus associated testing for fetus . cost of prenatal care and delivery and extra cost of zika virus associated testing and monitoring during pregnancy and testing of infants for zika virus . present value of cumulative medical and supportive care cost for infant with zam , discounted at 3% annually and taking into account mortality . expenditures by employer - sponsored health plans for privately insured children with combined diagnoses of microcephaly and congenital cytomegalovirus enrolled during the first 4 years of life were used to project medical costs for cases of zam . for the main intervention scenario , we assumed that 50% of no contraception users , 60% of less - effective contraceptive method users , and 100% of moderately effective contraceptive method users would visit a healthcare provider during the intervention period and be counseled about contraception use ( table 1 ) . the first 2 percentages are roughly twice the percentages of women reported in the 20112013 us national survey on family growth to have received contraceptive services ( contraception or counseling ) within the past year because we assumed that , during the zika virus outbreak , more women and providers would discuss contraception ; virtually all moderately effective method users were assumed to see providers to obtain contraceptive prescriptions . for the main scenario , we also assumed , optimistically , that 50% of women in the target population who receive contraceptive services during the zika virus outbreak would be willing to change to a more effective contraceptive method , evenly divided between moderately effective and highly effective methods . 33% used moderately effective methods ) ( 9 ) to the 40% of women assumed to not want to be pregnant ; we assumed 20% of other women not intending pregnancy would use larc . we further assumed that 30% of moderately effective contraception users would also choose to use condoms ( dual - method use ) under the intervention , based on a study reporting dual - method use among persons at risk for hiv ( 25 ) . we calculated method - specific annual pregnancy rates by applying failure rates of contraception methods under typical use ( 10 ) , in combination with information on estimated numbers of unintended pregnancies , to adjust for other factors influencing pregnancy risk ( 19 ) . we estimated the proportion of fetal losses among unintended pregnancies from data for the caribbean region , including puerto rico ( 12 ) , and calculated the proportion of induced abortion among unintended pregnancies from a survey conducted in puerto rico in 2001 ( the latest year for which data were available ) ( 11 ) . we assumed that the distribution of fetal loss and induced abortions in unintended pregnancies unaffected by zam would not be altered by the zika virus outbreak or the intervention . for adverse pregnancy and birth outcomes associated with zika virus , we only considered zam and associated brain anomalies , including live births , stillbirths , and terminations attributable to prenatal diagnosis . although zika virus can cause brain lesions and dysfunction in fetuses and newborns who do not have microcephaly ( 26 ) , we lacked the data to model their prevalence and cost . in the main analysis , we assumed 58 cases of zam per 10,000 live births ( range 3286/10,000 ) based on a modeling study that considered data from other mosquitoborne illnesses in puerto rico and zika virus outbreaks in other locations ( 5 ) . we assumed a pregnancy loss rate of 35% among zika virus exposed fetuses with diagnosed birth defects based on cases in the us zika pregnancy registry as of july 21 , 2016 ( 14 ) . we projected gains in hly by multiplying total cases of zam prevented by 30.0 , which is the average number of quality - adjusted life - years at birth in the united states for an infant without severe microcephaly ( 15 ) and the estimated loss in disability - adjusted life years from microcephaly ( 27 ) . we multiplied 30.0 by the sum of live births and fetal losses associated with zam to calculate gains in hly . we included fetal losses in the hly calculations because in the absence of zam those pregnancies would have resulted in live births , with the same healthy life expectancy as other children ( 15 ) . we conducted the analysis from a healthcare system perspective that includes direct medically related costs regardless of payer . we used payments from private insurance because payments from medicaid might underestimate the cost of healthcare ( 28 ) . intervention costs included program costs of training providers , patient educational materials , outreach / media campaigns on the availability of contraceptives services , and program coordination and the incremental costs of family planning services . the latter comprised the costs of contraception methods and related office visits and services ( e.g. , insertion and removal of larc for new method users resulting from the intervention and the cost of more intensive counseling for all women receiving contraceptive services during the intervention ) . we took the 1-year costs for contraception methods from the literature ( 16,29 ) and based the other program costs on the estimated costs for a pilot program planned to increase access to contraception in puerto rico as part of the current zika virus outbreak response ( 30 ) . we did not apply a discount rate to intervention costs because of the time horizon of 12 months . zika virus related costs prevented by this intervention were in 2 parts : 1 ) costs for zika virus testing and monitoring for zika virus exposed pregnancies and infants , and 2 ) costs of zam cases ( table 1 ) . the cost estimates for testing and monitoring presumed 100% adherence by clinicians and patients to recommendations ( 2022 ) . the lifetime cost per live - born infant with zam includes direct medical and nonmedical costs . zam is among the most severe types of microcephaly and is associated with loss of brain tissue volume , increased fluid spaces , and intracranial calcifications . all 3 cases of live - born infants with zam in french polynesia demonstrated severe neurologic outcomes with delayed cognitive development ( 26 ) . on the basis of expert opinion , infants with zam who survive the neonatal period would be expected to have neurologic dysfunction consistent with severe cerebral palsy within 12 years of birth . as a proxy for the medical cost of zam , we used the estimated cost of treating infants with microcephaly associated with a diagnosis of symptomatic congenital cytomegalovirus ( cmv ) . we used the marketscan commercial database ( truven health analytics ) with a sample of 100 million us residents covered by employer - sponsored insurance at any time during 20092014 . we used average costs for 4 newborn infants with diagnoses of microcephaly and cmv who survived and were enrolled in a health plan for > 3 years . for the direct nonmedical cost of zam , we used the estimated cost for supportive care for children with severe congenital brain injury , both paid care and unpaid care . the total lifetime cost for surviving infants with zam was estimated at $ 3.8 million per infant , taking into account infant and child mortality and discounting of costs in future years at a 3% rate per year ; the sum of undiscounted costs for children who survive to adulthood might reach $ 10 million . zika virus related medical costs associated with women s prenatal care , labor and delivery , and postpartum care for pregnancies ending in live birth and neonatal care from a study of us commercial health plan expenditures ( 17 ) . estimates for costs associated with pregnancies ending in induced abortion were based on our analyses of commercial claims data ( table 1 ) . because many parameters used in the model are uncertain , we conducted sensitivity analyses on selected parameters , including different scenarios for the baseline and postintervention contraception use distributions in puerto rico . we tested alternate baseline contraception use distributions in puerto rico for women at risk for unintended pregnancy by using the actual distribution of method use reported in 2002 ( 8) and among women attending title x clinics in puerto rico in 2014 ( 31 ) . for the postintervention contraception use distribution , we tested scenarios assuming different proportions of women receiving contraceptive services from a healthcare provider , different levels of willingness to switch to a more effective method , and different shares of moderately effective and highly effective methods among switchers . other parameters evaluated during sensitivity analysis included the incidence of zam during the zika virus outbreak in puerto rico , percentage of pregnancies with zam terminated , the cost of caring for a live - born infant with microcephaly , and the cost of the intervention . we conducted sensitivity analyses in which we altered selected assumptions . in one , we annualized the cost of larc devices considering the expected duration of method use . in another , we adjusted observed data on us healthcare and supportive care costs to the generally lower levels of prices in puerto rico market by applying conversion factors of ratios of healthcare spending per capita and wages of nurse assistants between the united states and puerto rico ( 32,33 ) . we also conducted a probabilistic sensitivity analysis by using monte carlo simulation ( 10,000 draws ) that assumed different distributions for all the parameters used in the model ( table 1 ) . all analyses were conducted using treeage pro 2016 software ( treeage software , williamstown , ma , usa ) and excel 2013 ( microsoft , redmond , wa , usa ) . all costs were adjusted to 2014 us dollars by using the health component of the personal consumption expenditures price index ( 34 ) . we estimated the inputs for the decision - tree model and their sources ( table 1 ) . in the no intervention scenario , we took the distribution of women in the target population by use of different types of reversible contraceptives ( or no use ) from a 2002 survey administered in puerto rico and adjusted it to reflect the 36% decrease in fertility rates in puerto rico during 20022015 ( 8,23,24 ) . * brfss , behavior risk surveillance system ; cdc , centers for disease control and prevention ; hly ; healthy life years ; iud , intrauterine device ; larc , long - acting reversible contraceptive ; nsfg , national survey of family growth ; ondieh , office of noncommunicable diseases , injury and environmental health ; zam , zika virus associated microcephaly . authors calculation based on 2015 puerto rico total population size , 2015 birth rate , and adjusted contraception usage in 2002 brfss in puerto rico ( online technical appendix table , http://wwwnc.cdc.gov/eid/article/23/1/16-1322-techapp1.pdf ) . less - effective methods include condoms , spermicides , fertility awareness methods , withdrawal , sponge , and diaphragm . moderately effective methods include oral contraceptive pills , patches , vaginal rings , and injectable contraceptives . the contraception use distribution at baseline ( without intervention ) is based on adjusting the distribution reported in the 2002 brfss in puerto rico excluding women using permanent contraception by assuming 5 percentage points fewer women using no contraception than in 2002 , which is based on a 36% reduction of birth rate among women 1544 years of age in puerto rico from 2002 to 2015 ( national vital statistics report for 2002 and 2015 unpublished birth data from puerto rico ) , and the reported reasons for us teen pregnancy reduction ( http://www.cdc.gov/nchhstp/newsroom/docs/factsheets/yrbs-fact-sheet-final-508.pdf ) ; the decline in teen pregnancies was the fastest of any age group in puerto rico during 20102014 , as reported in national vital statistics reports . data from title x clinics in puerto rico also show that the percentage of women of reproductive age served in title x clinics increased from 2.2% in 2006 to 10% in 2015 . we also assume that new contraception users have the same contraception method distribution as contraception users as reported in the 2002 brfss survey ( 8) . we assume 22% dual use among moderately effective method users at baseline ( based on nsfg 20112013 data and unpublished analyses supplied by karen pazol , ondieh , cdc ; we accounted for the effectiveness of dual - method use in preventing pregnancy but not for preventing sexual transmission of zika virus ) . we calculated method - specific annual pregnancy rates by multiplying the failure rates of contraception methods under typical use by a calculated correction factor of 0.88 to adjust for the model over - predicting the number of unintended births in 2015 using the typical failure rates only . multiplying method - specific contraceptive failure rates by numbers of women in each method category typically results in more predicted pregnancies and births than are actually observed , in part because of heterogeneity in sexual behaviors ( 19 ) . assuming 50% of no contraception users , 60% of less - effective contraception users , and 100% of moderately effective contraception users will visit a healthcare provider for contraception services under intervention . based on the nsfg 20112013 , among women of reproductive age who did not intend to become pregnant and not using permanent contraceptive methods , 21% of no contraception users , 33% less - effective method users , 97% moderately effective method users had at least 1 visit for contraception services in the last 12 months ( personal communication , karen pazol , ondieh , cdc , 2016 ) . contraceptive services include receiving a birth control method or a prescription , receiving a checkup for birth control , receiving counseling about birth control , receiving a sterilizing operation , receiving counseling about a sterilizing operation , receiving emergency contraception , or receiving counseling about emergency contraception . we assume the intervention will increase the percentage of women visiting their provider for contraception counseling . in the contraceptive choice project ( 9 ) , 67% of participants who wished to avoid pregnancy chose to use highly effective methods , and 33% chose to use moderately effective methods . for the main scenario , we applied those estimates to 40% of the target population , assuming that 40% of unintended pregnancies are unwanted , and assumed that 20% of the remaining 60% of switchers would choose highly effective methods . # ellington et al . ( 5 ) estimated 180 cases ( interquartile range 100270 cases ) of congenital microcephaly associated with zika virus in puerto rico among an estimated 31,272 births ( unpublished birth data , puerto rico department of health , 2015 ) . on the basis of those estimates , we estimated the prevalence of congenital microcephaly : 58/10,000 births ( interquartile range 32/10,00086/10,000 ) . * * the pregnancy loss rate in the us zika pregnancy registry as of july 21 , 2016 , was 35% ( 14 ) . the termination rate is calculated as the overall pregnancy loss rate minus the assumed stillbirth rate . a range of the main value 20% was used to create upper and lower bounds used in sensitivity analyses . includes cost for devices and costs for 1 year of injections , pills , patches , rings , condoms , and the cost for related services in the first year . weighted average cost for hormonal iud ( 50% , $ 659 ) , copper iud ( 25% , $ 598 ) , and implant ( 25% , $ 659 ) , based on contraception choice study ( 9 ) and commonly used devices in puerto rico . weighted average cost for generic contraceptive pill ( 78% , $ 370/y ) , injectable ( 14% , $ 240/y plus $ 130 for consultation for the year ) , and ring or patch ( 8% , $ 964/y ) , with the distribution of moderately effective methods based on nsfg , 20112013 . # # weighted average cost of moderately effective method plus cost of less - effective method . * * * male condom . including the cost for checking the placement of iud in the first year of insertion . weighted average for vaginal and c - section delivery , including prenatal care , delivery , postpartum , and neonatal cost at delivery and in the first 3 months . assumes additional costs related to repeated zika virus testing by igm ( 12 tests ) for all pregnant women , 4 extra detailed ultrasound examinations , and 25% of women getting amniocentesis during all zika - positive pregnancies ( 25% infection rate at baseline , range 10%70% ) ( 5 ) , based on oduyebo et al . assumes 2 zika virus tests ( igm and pcr ) for serum and placenta , cranial ultrasound , and eye examination for all infants born to zika virus positive mothers based on fleming - dutra et al . # # # three pcr tests for zika virus using placenta , cord , and brain tissues of the fetus based on martines et al . ( 22 ) . * * * * assuming all prenatal care cost , including extra cost of zika virus associated testing and monitoring during pregnancy and extra cost for zika virus associated testing for fetus . assuming half of the prenatal care cost , including extra cost of zika virus associated testing and monitoring during pregnancy and extra cost for zika virus associated testing for fetus . cost of prenatal care and delivery and extra cost of zika virus associated testing and monitoring during pregnancy and testing of infants for zika virus . present value of cumulative medical and supportive care cost for infant with zam , discounted at 3% annually and taking into account mortality . expenditures by employer - sponsored health plans for privately insured children with combined diagnoses of microcephaly and congenital cytomegalovirus enrolled during the first 4 years of life were used to project medical costs for cases of zam . for the main intervention scenario , we assumed that 50% of no contraception users , 60% of less - effective contraceptive method users , and 100% of moderately effective contraceptive method users would visit a healthcare provider during the intervention period and be counseled about contraception use ( table 1 ) . the first 2 percentages are roughly twice the percentages of women reported in the 20112013 us national survey on family growth to have received contraceptive services ( contraception or counseling ) within the past year because we assumed that , during the zika virus outbreak , more women and providers would discuss contraception ; virtually all moderately effective method users were assumed to see providers to obtain contraceptive prescriptions . for the main scenario , we also assumed , optimistically , that 50% of women in the target population who receive contraceptive services during the zika virus outbreak would be willing to change to a more effective contraceptive method , evenly divided between moderately effective and highly effective methods . 33% used moderately effective methods ) ( 9 ) to the 40% of women assumed to not want to be pregnant ; we assumed 20% of other women not intending pregnancy would use larc . we further assumed that 30% of moderately effective contraception users would also choose to use condoms ( dual - method use ) under the intervention , based on a study reporting dual - method use among persons at risk for hiv ( 25 ) . we calculated method - specific annual pregnancy rates by applying failure rates of contraception methods under typical use ( 10 ) , in combination with information on estimated numbers of unintended pregnancies , to adjust for other factors influencing pregnancy risk ( 19 ) . we estimated the proportion of fetal losses among unintended pregnancies from data for the caribbean region , including puerto rico ( 12 ) , and calculated the proportion of induced abortion among unintended pregnancies from a survey conducted in puerto rico in 2001 ( the latest year for which data were available ) ( 11 ) . we assumed that the distribution of fetal loss and induced abortions in unintended pregnancies unaffected by zam would not be altered by the zika virus outbreak or the intervention . for adverse pregnancy and birth outcomes associated with zika virus , we only considered zam and associated brain anomalies , including live births , stillbirths , and terminations attributable to prenatal diagnosis . although zika virus can cause brain lesions and dysfunction in fetuses and newborns who do not have microcephaly ( 26 ) , we lacked the data to model their prevalence and cost . in the main analysis , we assumed 58 cases of zam per 10,000 live births ( range 3286/10,000 ) based on a modeling study that considered data from other mosquitoborne illnesses in puerto rico and zika virus outbreaks in other locations ( 5 ) . we assumed a pregnancy loss rate of 35% among zika virus exposed fetuses with diagnosed birth defects based on cases in the us zika pregnancy registry as of july 21 , 2016 ( 14 ) . we projected gains in hly by multiplying total cases of zam prevented by 30.0 , which is the average number of quality - adjusted life - years at birth in the united states for an infant without severe microcephaly ( 15 ) and the estimated loss in disability - adjusted life years from microcephaly ( 27 ) . we multiplied 30.0 by the sum of live births and fetal losses associated with zam to calculate gains in hly . we included fetal losses in the hly calculations because in the absence of zam those pregnancies would have resulted in live births , with the same healthy life expectancy as other children ( 15 ) . we conducted the analysis from a healthcare system perspective that includes direct medically related costs regardless of payer . we used payments from private insurance because payments from medicaid might underestimate the cost of healthcare ( 28 ) . intervention costs included program costs of training providers , patient educational materials , outreach / media campaigns on the availability of contraceptives services , and program coordination and the incremental costs of family planning services . the latter comprised the costs of contraception methods and related office visits and services ( e.g. , insertion and removal of larc for new method users resulting from the intervention and the cost of more intensive counseling for all women receiving contraceptive services during the intervention ) . we took the 1-year costs for contraception methods from the literature ( 16,29 ) and based the other program costs on the estimated costs for a pilot program planned to increase access to contraception in puerto rico as part of the current zika virus outbreak response ( 30 ) . we did not apply a discount rate to intervention costs because of the time horizon of 12 months . zika virus related costs prevented by this intervention were in 2 parts : 1 ) costs for zika virus testing and monitoring for zika virus exposed pregnancies and infants , and 2 ) costs of zam cases ( table 1 ) . the cost estimates for testing and monitoring presumed 100% adherence by clinicians and patients to recommendations ( 2022 ) . the lifetime cost per live - born infant with zam includes direct medical and nonmedical costs . zam is among the most severe types of microcephaly and is associated with loss of brain tissue volume , increased fluid spaces , and intracranial calcifications . all 3 cases of live - born infants with zam in french polynesia demonstrated severe neurologic outcomes with delayed cognitive development ( 26 ) . on the basis of expert opinion , infants with zam who survive the neonatal period would be expected to have neurologic dysfunction consistent with severe cerebral palsy within 12 years of birth . as a proxy for the medical cost of zam , we used the estimated cost of treating infants with microcephaly associated with a diagnosis of symptomatic congenital cytomegalovirus ( cmv ) . we used the marketscan commercial database ( truven health analytics ) with a sample of 100 million us residents covered by employer - sponsored insurance at any time during 20092014 . we used average costs for 4 newborn infants with diagnoses of microcephaly and cmv who survived and were enrolled in a health plan for > 3 years . for the direct nonmedical cost of zam , we used the estimated cost for supportive care for children with severe congenital brain injury , both paid care and unpaid care . the total lifetime cost for surviving infants with zam was estimated at $ 3.8 million per infant , taking into account infant and child mortality and discounting of costs in future years at a 3% rate per year ; the sum of undiscounted costs for children who survive to adulthood might reach $ 10 million . zika virus related medical costs associated with women s prenatal care , labor and delivery , and postpartum care for pregnancies ending in live birth and neonatal care from a study of us commercial health plan expenditures ( 17 ) . estimates for costs associated with pregnancies ending in induced abortion were based on our analyses of commercial claims data ( table 1 ) . because many parameters used in the model are uncertain , we conducted sensitivity analyses on selected parameters , including different scenarios for the baseline and postintervention contraception use distributions in puerto rico . we tested alternate baseline contraception use distributions in puerto rico for women at risk for unintended pregnancy by using the actual distribution of method use reported in 2002 ( 8) and among women attending title x clinics in puerto rico in 2014 ( 31 ) . for the postintervention contraception use distribution , we tested scenarios assuming different proportions of women receiving contraceptive services from a healthcare provider , different levels of willingness to switch to a more effective method , and different shares of moderately effective and highly effective methods among switchers . other parameters evaluated during sensitivity analysis included the incidence of zam during the zika virus outbreak in puerto rico , percentage of pregnancies with zam terminated , the cost of caring for a live - born infant with microcephaly , and the cost of the intervention . in one , we annualized the cost of larc devices considering the expected duration of method use . in another , we adjusted observed data on us healthcare and supportive care costs to the generally lower levels of prices in puerto rico market by applying conversion factors of ratios of healthcare spending per capita and wages of nurse assistants between the united states and puerto rico ( 32,33 ) . we also conducted a probabilistic sensitivity analysis by using monte carlo simulation ( 10,000 draws ) that assumed different distributions for all the parameters used in the model ( table 1 ) . all analyses were conducted using treeage pro 2016 software ( treeage software , williamstown , ma , usa ) and excel 2013 ( microsoft , redmond , wa , usa ) . all costs were adjusted to 2014 us dollars by using the health component of the personal consumption expenditures price index ( 34 ) . in the main scenario , we predict the intervention would prevent 25 cases of zam among unintended pregnancies avoided , of which 16 would have resulted in live births ( table 2 ) . the incremental intervention cost of us $ 33.5 million ( i.e. , $ 206 per member of target population ) relative to no intervention ( status quo ) is more than offset by $ 65.2 million in avoided zika virus associated costs , $ 2.8 million from extra testing and monitoring for pregnant women and infants for zika virus exposed pregnancies avoided , and $ 62.3 million from zam cases prevented . the net savings from zika virus the numbers in the columns and rows might not exactly match because of rounding . target population size : 163,000 women who do not intend to become pregnant during zika virus outbreak . women of reproductive age in puerto rico who are sexually active with a male partner , fertile , not desiring pregnancy , and not using permanent contraception methods ( e.g. , tubal ligation and vasectomy ) . only including cost of testing for zika virus and monitoring for exposed infants without zam ; testing costs for infants with zam are included in the direct costs of zam . from healthcare system perspective , includes direct medical and medical - related costs , including supportive care for persons with zam , even if the cost might not be paid by healthcare payers or delivered by healthcare providers . # total zika virus associated cost avoided ( absolute value ) minus the additional cost of family planning service under intervention compared with no intervention . * * unwanted pregnancies which are not desired in the future ( assuming 60% of unintended pregnancies are mistimed ) , irrespective of zika virus infection absolute value of net medical cost for unwanted pregnancy plus absolute value of net cost savings from zika virus associated costs avoided . the number of zam cases prevented and zika virus associated costs avoided are sensitive to the proportion of women receiving contraceptive services and the proportion of those women willing to switch to a more effective contraception method during the zika virus outbreak ( figure ; table 3 ) . if the proportions of women receiving contraception services are assumed to be the same as estimated for the continental united states in the national survey of family growth for 20112013 ( i.e. , 21% among no contraception users , 33% among less - effective method users , and 97% among all moderately effective method users ) , 16 cases of zam are prevented , and the net savings is $ 15.4 million ( table 3 ) . if 10% of women receiving contraceptive services switch to a more effective method , 6 cases of zam are prevented , and net saving is $ 2.8 million . if the intervention only shifts users of moderately effective methods to a highly effective method ( no change in non - use or use of less - effective methods ) , 7 zam cases are prevented , with an icer of $ 24,608/hly gained . increasing the proportion of dual - method users increases the number of cases of zam prevented and net savings attributable to higher contraception effectiveness . the results are also sensitive to the prevalence of zam among mid - trimester pregnancies , the percentage of zam cases resulting in live - born infants , lifetime cost per live - born infant with zam , and the intervention cost . if we adjust us cost estimates for lower prices in puerto rico while keeping intervention costs at us prices , net savings are $ 1.7 million . in all but 1 of the scenarios sensitivity analysis indicating the effect of changes of assumptions on the number of zam cases prevented in a proposed intervention to increase access to contraception to women during the zika virus outbreak , puerto rico , 2016 . larc , long - acting reversible contraceptive ; zam , zika virus associated microcephaly . * brfss , behavioral risk factor surveillance system ; cn , cost - neutral ; cs , cost - saving ; hly , healthy life years ; larc , long - acting reversible contraceptive ; nsfg , national survey of family growth ; up , unwanted pregnancy ; zam , zika virus associated microcephaly . total incremental cost is the additional cost of contraception minus zika virus associated cost avoided . 30% of no contraception users , 60% of less - effective contraceptive method users , 100% of moderately effective contraceptive method users seeking contraceptive services from healthcare provider during the zika virus outbreak . based on nsfg 20112013 , among women of reproductive age who are sexually active , did not intend to become pregnant , and were not using permanent contraceptive methods , 21% of no contraception users , 33% of less - effective contraceptive method users , 97% of moderately effective contraceptive method users , and 94% of dual - method users had at least 1 contraceptive service visit in the last 12 months ( in total 50% ) . based on title x family planning annual report for 20072015 in colorado , 30% of clients who visited title x clinics switched to a new method . # eighteen percentage points of users of moderately effective methods are assumed to switch to highly effective methods , of whom 21% were dual - method users . * * contraception distribution in puerto rico in 2002 15.9% no method , 41.6% less - effective methods , 40.2% moderately effective methods , and 2.4% highly effective methods . 20% of women at risk for unintended pregnancy used less - effective methods , 77% used moderately effective methods , and 2% used highly effective methods . intervention cost equals to the medical savings from zam cases prevented . conversion factor of 0.36 applied to pregnancy and zam medical costs based on the ratio of per capita medical expenditure in puerto rico and in the united states in 2012 as in portela et al . 2015 ( 32 ) ; conversion factor of 0.72 applied to costs of supportive care for live - born infants with zam , based on the ratio of annual salary for assistant nurses in puerto rico and in the united states ( 33 ) . a probabilistic sensitivity analysis scatter graph shows that most of the model simulations result in icers in the lower right quadrant with lower costs and better health outcomes ( technical appendix figure 2 ) . specifically , the intervention is cost - saving in 92.11% of the 10,000 iterations , and in 98.10% of the iterations , the intervention has an icer of < $ 20,000/hly gained . the intervention is also predicted to prevent $ 40.4 million in medical costs from unwanted pregnancies avoided in the main scenario ( table 2 ) . in many sensitivity analyses , the cost avoided from these unwanted pregnancies prevented alone is greater than the intervention cost . the larger the numbers of no contraception users and less - effective method users receiving contraceptive services and willing to switch to more effective methods , the greater the magnitude of cost savings from unwanted pregnancies avoided ( table 3 ) . the results of our modeling analysis suggest that increasing access to effective contraception in the context of the 2016 zika virus outbreak for women in puerto rico who do not intend to become pregnant could proportionally reduce the number of unintended pregnancies and cases of zam by 25% . the intervention is cost - saving ( negative net cost ) when considering the benefits from preventing zam and avoiding zika virus exposed pregnancy costs in the main scenarios and in most of the scenarios we tested . in scenarios in which the intervention is not cost - saving , it is still cost - effective relative to accepted cost - effectiveness thresholds ( 35 ) . the world health organization suggests that interventions that cost <3 times the gross domestic product per capita per hly ( equivalent to $ 150,000 in the united states and $ 60,000 in puerto rico ) are cost - effective and those costing less than gross domestic product per capita are highly cost - effective ( 36 ) . when considering additional benefits from preventing unintended pregnancies not desired at a later time , the intervention is cost - saving in all scenarios . previous studies have shown that expanding access to contraception , especially larc , is cost - saving ( 16,37,38 ) . likewise , our findings suggest that this intervention could be cost - saving or cost - effective within the context of a public health emergency response . first , we project the effects of a hypothetical intervention in place in puerto rico during the 2016 zika virus outbreak . however second , the baseline contraception use distribution is based on a 2002 survey ; the current distribution in puerto rico might be different . third , uncertainty exists about the effect of the proposed intervention on postintervention contraceptive use distribution ; however , the sensitivity analyses indicate that different distributions of larc types among switchers does not have a substantial influence on the results . fourth , our study assumes that women have full access to healthcare providers . in areas with limited access to providers , the effectiveness of the intervention might be lower , although puerto rico has a similar ratio of physicians to population as the united states as a whole ( 39 ) , and despite a loss of physicians in recent years , puerto rico has a network of providers , federally qualified health clinics , and title x providers in rural and urban areas . we lack data on miscarriage and induced abortion rates in puerto rico and so did not have sufficient data to model uncertainty in these parameters . the rates of stillbirth and pregnancy termination among pregnancies with zam in puerto rico are also unknown . our assumed percentage of live births among pregnancies with recognized zam ( 65% ) compares with a 38% rate reported in french polynesia during the 2013 zika virus outbreak ( 11 ) . sixth , pregnancy intentions and use of contraception among women in puerto rico might differ during the zika virus outbreak compared to preoutbreak periods . seventh , our analysis does not consider possibly higher rates of fetal loss and induced abortion among women infected by zika virus during early pregnancy or brain abnormalities or conditions related to zika virus not involving microcephaly . eighth , the assumed zika virus testing costs assume 100% adherence to recommended testing practices ; the actual cost savings taking nonadherence into account would be lower . ninth , the cost estimates of zam cases in live - born infants do not include costs of managing mental health conditions among parents of affected infants . however , if the cost of zam exceeds $ 1.9 million , the intervention is still cost - saving . finally , if efforts to prevent transmission of zika virus in puerto rico are effective , the rate of infection in pregnancy and the incidence of zam relative to that projected could be reduced . despite its limitations , second , the contraception scenarios are based on real - world programs and have resulted from consultation with subject matter experts . third , expenditure data from a large sample of us residents with commercial health insurance were used to calculate the potential medical cost of zam on the basis of combinations of diagnostic codes for virus - associated microcephaly , although costs might be lower for similar children with public insurance . finally , sensitivity analyses give consistent results indicating expected net cost savings associated with an intervention that would increase access to contraception in response to the zika virus outbreak in puerto rico . zika virus can cause devastating birth defects , and infants born with zam and their families will require lifelong support . avoiding unintended pregnancies is a critical intervention to mitigate the effects of zam . efforts to prevent adverse zika virus related pregnancy outcomes in puerto rico are especially important because of limited resources ( 40 ) . our analyses suggest that increasing access to a full range of contraception among women in puerto rico who want to delay or avoid becoming pregnant during a zika virus outbreak would be a cost - saving strategy to reduce the effects of zam . the magnitude of cost savings is even greater when considering the avoided cost of unwanted pregnancies prevented . process for deriving the size of the target population , decision tree structure , and probabilistic sensitivity analysis of cost - effectiveness for a proposed intervention to increase access to contraception to women during the zika virus outbreak , puerto rico , 2016 .

we modeled the potential cost - effectiveness of increasing access to contraception in puerto rico during a zika virus outbreak . the intervention is projected to cost an additional $ 33.5 million in family planning services and is likely to be cost - saving for the healthcare system overall . it could reduce zika virus related costs by $ 65.2 million ( $ 2.8 million from less zika virus testing and monitoring and $ 62.3 million from avoided costs of zika virus associated microcephaly [ zam ] ) . the estimates are influenced by the contraception methods used , the frequency of zam , and the lifetime incremental cost of zam . accounting for unwanted pregnancies that are prevented , irrespective of zika virus infection , an additional $ 40.4 million in medical costs would be avoided through the intervention . increasing contraceptive access for women who want to delay or avoid pregnancy in puerto rico during a zika virus outbreak can substantially reduce the number of cases of zam and healthcare costs .

Methods Contraception Use with and without the Intervention Epidemiologic Model Input Parameters Cost Parameters Sensitivity Analyses Results Discussion None

hydrogenic impurities , including donors and acceptors , have been widely studied in theoretical and experimental approaches . recently , mahieu et al . investigated the energy and symmetry of zn and be dopant - induced acceptor states in gaas using cross - sectional scanning tunneling microscopy and spectroscopy at low temperatures . the ground and first excited states were found to have a non - spherical symmetry . in particular , the first excited acceptor state has td symmetry . bernevig and zhang proposed a spin manipulation technique based entirely on electric fields applied to acceptor states in p - type semiconductors with spin - orbit coupling . while interesting on its own , the technique could also be used to implement fault - resilient holonomic quantum computing . studied tunneling transport through the depletion layer under a gaas surface with a low temperature scanning tunneling microscope . their findings suggest that the complex band structure causes the observed anisotropies connected with the zinc blende symmetry . kundrotas et al . investigated the optical transitions in be - doped gaas / alas multiple quantum wells with various widths and doping levels . the fractional dimensionality model was extended to describe free - electron acceptor ( free hole - donor ) transitions in a quantum well ( qw ) . the measured photoluminescence spectra from the samples were interpreted within the framework of this model , and acceptor - impurity induced effects in the photoluminescence line shapes from multiple quantum wells of different widths were demonstrated . presented results on the ground - state binding energies for donor and acceptor impurities in a deformed quantum well wire ( qww ) . the impurity effective - mass schrdinger equation was reduced to a one - dimensional equation with an effective potential containing both the coulomb interaction and the effects of the wire surface irregularities through the boundary conditions . studying the ground - state wave functions for different positions of the impurity along the wire axis , they found that there are wire deformation geometries for which the impurity wave function is localized either on the wire deformation or on the impurity , or even on both . calculated the magnetic - field dependence of low - lying spectra of a single - electron magnetic quantum ring and dot , formed by inhomogeneous magnetic fields using the numerical diagonalization scheme . the effects of on - center acceptor and donor impurities were also considered . in the presence of an acceptor impurity , transitions in the orbital angular momentum were found for both the magnetic quantum ring and the magnetic quantum dot when the magnetic field was varied . galiev and polupanov calculated the energy levels and oscillator strengths from the ground state to the odd excited states of an acceptor located at the center of a spherical quantum dot ( qd ) in the effective mass approximation . they also used an infinite potential barrier model . using variational envelope functions , janiszewski and suffczynski computed the energy levels and oscillator strengths for transitions between the lowest states of an acceptor located at the center of a spherical qd with a finite potential barrier in the effective mass approximation . calculated the spectrum of a mn ion in a p - type inas quantum disk in a magnetic field as a function of the number of holes described by the luttinger - kohn hamiltonian . for simplicity , we will study the electronic structures and binding energy of a hydrogenic acceptor impurity in semiconductor nano - structures in the framework of effective - mass envelope - function theory . in our calculations , the finite potential barrier and the mixing effects of heavy- and light - holes are all taken into account . throughout this paper , the units of length and energy are given in terms of the bohr radius and the effective rydberg constant where m0 and 0 are the mass of a free electron and the permittivity of free space . for a hydrogenic acceptor impurity located at in a semiconductor nano - structure , the electron envelope function equation in the framework of the effective - mass approximation is(1 ) in the above equations , 1,2 , and 3are the luttinger parameters and the subscript n = 0 , 1 , 2 , ... correspond to the ground- , first excited- , second excited- , ... states , respectively . the quantum confinement potential can be written in different forms for various nano - structures . in eq . 1 , is 0 when there are no acceptors and 1 when there are acceptors in the nano - structure . the binding energy of the n - order hydrogenic donor impurity state is explicitly calculated by the following equation:(2 ) we express the wave function of the impurity state as ( 3 ) where lxly , and lz are the side lengths of the unit cell in the x , y , and z directions , respectively . kx = 2 /lx , ky = 2 /ly , kz = 2 /lz , nx { mx , , mx } , ny { my , , my } , and nz { mz , , mz}. the plane wave number is nxyz = nxnynz = ( 2 mx + 1)(2 my + 1)(2 mz + 1 ) , where mxmy , and mz are positive integers . we take lx = ly = lz = l = wmax + 25 nm , kx = ky = kz = k = 2 /l , and nx = ny = nz = 7 in the following calculation , where wmax is the maximum side length of the nano - structures . if we take larger nxny , and nz , the calculation precision will be increased somewhat . the matrix elements for solving the energy latent root of the impurity states can be found from eqs . 1 and 5 . the electronic structures and binding energy in the nano - structure can be calculated from the matrix elements . in the following sections , we will give some numerical results for the electronic structure and binding energy of a hydrogenic acceptor impurity in several typical gaas / ga1xalxas nano - structures . 1 = 6.98,2 = 2.06 , 3 = 2.93 . the band gaps eg ( ev ) of bulk gaas and al0.35ga0.65as are 1.519 and 2.072 ev , respectively . the valence - band offset is assumed to be 35% of the band gap difference , so v0 = 193.55 mev . we adopt a square potential energy model in the following calculation , i.e. , v(r ) = 0 inside and v(r ) = v0 outside of the nano - structures . figures 1 and 2 show the first five energy levels and binding energy levels of an impurity in a qw as functions of the qw width w for an acceptor at the qw center . figure 1 shows that the energy levels monotonically and quickly decrease as the well width increases . it is well known that the donor binding energy has a peak as the qw width increases . however , fig . 2 shows that the changes of the acceptor binding energies are very complex as the qw widthwincreases . this is because the holes have asymmetric effective masses , and there are mixing effects between heavy- and light - hole states . the energy levels of the first five states as functions of the qw width w for an acceptor at the qw center the binding energy levels of the first five states as functions of the qw width w for an acceptor at the qw center figure 3 shows the binding energy levels of the first five states as functions of the donor positionz0for the qw widthw = 10 nm . this figure shows that the binding energies monotonically decrease as the acceptor moves away from the qw center . the binding energy levels of the first five states as functions of the donor position z0 for the qw width w = 10 nm figure 4a and b shows the impurity energy levels of the first five states as functions of the square qww side length l0(a ) and the cylindrical qww radius ( b ) for an acceptor at the qww center . compared with fig . 1 , we find from fig . 4 that the impurity energy levels decrease slowly as the qww size increases . this is because the acceptor is confined in two directions . the impurity energy levels of the first five states as functions of the square qww side length l0(a ) and the cylindrical qww radius ( b ) for an acceptor at the qww center figure 5a and b is the same as fig . 4a and b , respectively , but are for the binding energy levels instead of the impurity energy levels . the binding energy of the acceptor in the qww is larger than that in the qw because the quantum confinement effects in the qww are larger than in the qw . the same as fig . 4 but for the binding energy levels of the first five states figure 6a and b shows the binding energy of the first five states as a function of the impurity position for a square qww with side widthl0 = 10 nm ( a ) and for a cylindrical qww with radius ( b ) . the positions of o , a , and b in fig . it is easy see that the binding is the weakest for the impurity located at the corner of the square qww . the binding energy of the first five states as functions of the impurity position for the square qww side length l0 = 10 nm ( a ) and the cylindrical qww radius ( b ) . the positions of o , a , and b in ( a ) are indicated in the inserted figure figure 7(a ) , b , and c gives the impurity energy levels as functions of the spherical qd radius r0(a ) , the square qd side length w(b ) , and the cylindrical qd radius and height w ( ) ( c ) for an acceptor at the qd center . compared with figs . 1 and 4 , we find that the impurity energy levels decrease more slowly in the qd than in the qw or the qww . this is because the quantum confinement effect is larger in the qd than in the qw and qww . the impurity energy levels as functions of the spherical qd radius r0(a ) , the square qd side width w(b ) , and the cylindrical qd radius and height ( c ) for an acceptor at the qd center figure 8a , b , and c is the same as fig . 7a , b , and c , respectively , but are for the binding energy levels . from fig . 8(a ) , we find that there is only one binding energy for which r0 is greater than about 2.2 nm . the first two quantum states are degenerate and correspond to the first energy level , due to the symmetry of the spherical qd . figure 8(b ) shows that there is only one binding energy level when the side length is between 3 and 10.5 nm . if the side length is greater than 10.3 nm , the second binding energy level arises once again . figure 8(c ) shows that the first two binding energy levels diverge quickly , and the other binding energy levels disappear as the qd radius and height become larger than about 2.5 nm . the same as fig . 7 but for the binding energy levels of the first five states figure 9a , b , and c shows the binding energy as a function of the impurity position with a spherical qd radius of r0 = 5 nm ( a ) , with a cubic qd side length of w = 10 nm ( b ) , and a cylindrical qd radius and height w equal to 5 nm ( c ) . 9b and c are indicated on the inserted qd figure , respectively . as the acceptor moves away from the center , the symmetry decreases , figure 9c shows that there are two binding energy levels when the cylindrical qd radius and height w equal 5 nm . the binding energy is the largest when the impurity is at the qd center , and it is least when the impurity is at the corner . the binding energy as a function of the impurity position with the spherical qd radius of r0 = 5 nm ( a ) , with the cubic qd side length w = 10 nm ( b ) , and the cylindrical qd radius and height w equal to 5 nm ( c ) . the impurity positions of o , a , b and c in ( b ) and ( c ) are indicated on the inserted qd figure , respectively in summary , we have calculated the electronic structures and binding energy levels of a hydrogenic acceptor impurity in 2 , 1 , and 0-dimensional semiconductor nano - structures in the framework of effective - mass envelope - function theory . our method can be widely applied in the calculation of the electronic structures and binding energy levels of a hydrogenic acceptor impurity in semiconductor nano - structures of other shapes and other semiconductor material systems . this work was supported by the national natural science foundation of china under grant nos 60325416 , 60521001 , and 90301007 .

the electronic structure and binding energy of a hydrogenic acceptor impurity in 2 , 1 , and 0-dimensional semiconductor nano - structures ( i.e. quantum well ( qw ) , quantum well wire ( qww ) , and quantum dot ( qd ) ) are studied in the framework of effective - mass envelope - function theory . the results show that ( 1 ) the energy levels monotonically decrease as the quantum confinement sizes increase ; ( 2 ) the impurity energy levels decrease more slowly for qwws and qds as their sizes increase than for qws ; ( 3 ) the changes of the acceptor binding energies are very complex as the quantum confinement size increases ; ( 4 ) the binding energies monotonically decrease as the acceptor moves away from the nano - structures center ; ( 5 ) as the symmetry decreases , the degeneracy is lifted , and the first binding energy level in the qd splits into two branches . our calculated results are useful for the application of semiconductor nano - structures in electronic and photoelectric devices .

Introduction Theoretical Model Results and Discussion Conclusion Acknowledgments

the experimental set - up used to generate and acquire the experimental data is shown in supplementary fig . s1 . the source used was a q - switched frequency - doubled nd : yag laser ( elforlight inc . , uk ) centred at 532 nm with pulse duration of 10 ns and coherence length of 7 mm . the repetition rate of the laser was tuneable between 50 hz and 200 hz , and the full pulse energy was 0.6 mj . before entering the mach - zehnder interferometer , the light beam was collimated to a diameter of 2 mm by a beam expander . the power injected into the system was adjustable via a half - wave plate ( hwp ) paired with a polarizing beamsplitter ( pbs ) , and further attenuated through a neutral density filter . light was split into a probe beam and a reference beam by another pbs , the ratio between the two beams was controlled by a hwp . the polarization of the reference beam was rotated by 90 before passing through an acousto - optic modulator ( aom ) which up - shifted its frequency by f . the reference beam was further expanded by an afocal lens pair to a diameter of 25 mm and spatially filtered by a pinhole . the probe beam entered a scattering cell composed of two optical diffusers ( dg10 - 600 , thorlabs , usa ) or two pieces of ex vivo chicken breast tissue . the reference beam was combined with the scattered light from the probe by a 50:50 beamsplitter ( bs1 ) . the path lengths of the reference and probe beams were balanced for strongest interference using two tuneable delay lines . inside the dopc , the beams were retro - reflected by the surface of a phase - only slm ( vis - pluto , holoeye , germany ) . the beams were further reflected by a 90:10 ( 90% transmission ) beamsplitter ( bs2 ) to form a speckle pattern on an scmos camera ( pco . the pixels of the camera and the slm were digitally aligned with 1 ( pixel ) alignment error for optimal phase conjugation quality . once the scattered fields were measured at two instants , a trap phase map was calculated and displayed on the slm . in the hologram reading mode , the probe beam was blocked . reflection by the slm generated the phase - conjugated beam , which was delivered to the scattering medium after passing through bs2 and bs1 . the light intensity distribution on the focal plane inside the two scattering media was monitored either by replacing the target with a cmos camera ( firefly mv , point grey research , canada ) , or by using a bs to reflect the focal pattern onto the camera . the frequency difference between the probe and reference beams was set by the aom modulation frequency , which was f = 50.0000125 mhz . the aom was triggered by a function generator ( dg4000 , rigol technologies , china ) with a sinusoidal waveform at f . a delay generator ( dg645 , stanford research systems , usa ) , sharing a global time - base with the function generator , produced two channels of pulse sequences at fs = 50 hz with a proper relative delay to externally trigger and synchronize the laser and the camera . the reference beam , when undersampled at fs by the camera , cycled through four phases0 , /2 , , 3/2corresponding to four interferograms pi ( i = 1 , 2 , 3 , 4 ) . during the measurement , the slm was blanked by displaying a constant phase map ( phase value = 0 ) . the complex amplitude of the field was obtained by e = ( p1 p3 ) + i(p2 p4 ) . after the two complex amplitudes were acquired , they were subtracted to get e , and the trap phase map was calculated by = arg [ i m ( e)/re(e ) ] ( arg[ ] denotes taking the argument ) . for applications requiring higher measurement accuracy ( e.g. , the experiment shown in fig . i , where the perturbation was weak ) , a different signal acquisition scheme was used . the aom was driven at f = 50.0000001 mhz , and the delay generator triggered the laser and the camera at 200 hz and 4 hz , respectively . the sampling frequency of fs = 4 hz ensured a phase difference of /2 between neighbouring frames . the exposure time of the camera was set to 51 ms , during which 10 laser shots were averaged to reduce the noise caused by laser shot - to - shot intensity fluctuations . in the probing mode ( fig . 1d ) , the scattered electromagnetic field distribution on a phase - only spatial light modulator ( slm ) was measured via digital phase - shifting holography . the virtual difference field e was synthesized by subtracting the fields acquired before and after the perturbation and then optimizing the phase offset . a phase map was then extracted from e and subsequently conjugated to yield the trap phase map ( ) . in the focusing mode ( fig . 1e ) , an intense planar reading beam was transformed into a time - reversed beam after reflecting off the slm , and converged onto the target . the experimental set - up used to generate and acquire the experimental data is shown in supplementary fig . s1 . the source used was a q - switched frequency - doubled nd : yag laser ( elforlight inc . , uk ) centred at 532 nm with pulse duration of 10 ns and coherence length of 7 mm . the repetition rate of the laser was tuneable between 50 hz and 200 hz , and the full pulse energy was 0.6 mj . before entering the mach - zehnder interferometer , the light beam was collimated to a diameter of 2 mm by a beam expander . the power injected into the system was adjustable via a half - wave plate ( hwp ) paired with a polarizing beamsplitter ( pbs ) , and further attenuated through a neutral density filter . light was split into a probe beam and a reference beam by another pbs , the ratio between the two beams was controlled by a hwp . the polarization of the reference beam was rotated by 90 before passing through an acousto - optic modulator ( aom ) which up - shifted its frequency by f . the reference beam was further expanded by an afocal lens pair to a diameter of 25 mm and spatially filtered by a pinhole . the probe beam entered a scattering cell composed of two optical diffusers ( dg10 - 600 , thorlabs , usa ) or two pieces of ex vivo chicken breast tissue . the reference beam was combined with the scattered light from the probe by a 50:50 beamsplitter ( bs1 ) . the path lengths of the reference and probe beams were balanced for strongest interference using two tuneable delay lines . inside the dopc , the beams were retro - reflected by the surface of a phase - only slm ( vis - pluto , holoeye , germany ) . the beams were further reflected by a 90:10 ( 90% transmission ) beamsplitter ( bs2 ) to form a speckle pattern on an scmos camera ( pco . the pixels of the camera and the slm were digitally aligned with 1 ( pixel ) alignment error for optimal phase conjugation quality . once the scattered fields were measured at two instants , a trap phase map was calculated and displayed on the slm . in the hologram reading mode , the probe beam was blocked . reflection by the slm generated the phase - conjugated beam , which was delivered to the scattering medium after passing through bs2 and bs1 . the light intensity distribution on the focal plane inside the two scattering media was monitored either by replacing the target with a cmos camera ( firefly mv , point grey research , canada ) , or by using a bs to reflect the focal pattern onto the camera . the frequency difference between the probe and reference beams was set by the aom modulation frequency , which was f = 50.0000125 mhz . the aom was triggered by a function generator ( dg4000 , rigol technologies , china ) with a sinusoidal waveform at f . a delay generator ( dg645 , stanford research systems , usa ) , sharing a global time - base with the function generator , produced two channels of pulse sequences at fs = 50 hz with a proper relative delay to externally trigger and synchronize the laser and the camera . the reference beam , when undersampled at fs by the camera , cycled through four phases0 , /2 , , 3/2corresponding to four interferograms pi ( i = 1 , 2 , 3 , 4 ) . during the measurement , the slm was blanked by displaying a constant phase map ( phase value = 0 ) . the complex amplitude of the field was obtained by e = ( p1 p3 ) + i(p2 p4 ) . after the two complex amplitudes were acquired , they were subtracted to get e , and the trap phase map was calculated by = arg [ i m ( e)/re(e ) ] ( arg[ ] denotes taking the argument ) . for applications requiring higher measurement accuracy ( e.g. , the experiment shown in fig . i , where the perturbation was weak ) , a different signal acquisition scheme was used . the aom was driven at f = 50.0000001 mhz , and the delay generator triggered the laser and the camera at 200 hz and 4 hz , respectively . the sampling frequency of fs = 4 hz ensured a phase difference of /2 between neighbouring frames . the exposure time of the camera was set to 51 ms , during which 10 laser shots were averaged to reduce the noise caused by laser shot - to - shot intensity fluctuations . 1d ) , the scattered electromagnetic field distribution on a phase - only spatial light modulator ( slm ) was measured via digital phase - shifting holography . the virtual difference field e was synthesized by subtracting the fields acquired before and after the perturbation and then optimizing the phase offset . a phase map was then extracted from e and subsequently conjugated to yield the trap phase map ( ) . in the focusing mode ( fig . 1e ) , an intense planar reading beam was transformed into a time - reversed beam after reflecting off the slm , and converged onto the target .

the ability to steer and focus light inside scattering media has long been sought for a multitude of applications . to form optical foci inside scattering media , the only feasible strategy at present is to guide photons by using either implanted1 or virtual24 guide stars , which can be inconvenient and limits potential applications . here , we report a scheme for focusing light inside scattering media by employing intrinsic dynamics as guide stars . by time - reversing the perturbed component of the scattered light adaptively , we show that it is possible to focus light to the origin of the perturbation . using the approach , we demonstrate non - invasive dynamic light focusing onto moving targets and imaging of a time - variant object obscured by highly scattering media . anticipated applications include imaging and photoablation of angiogenic vessels in tumours as well as other biomedical uses .

Methods Experimental set-up TRAP phase map measurement TRAP focusing based on DOPC Supplementary Material

this study was conducted at a tertiary eye care center , catering to a population of approximately a million . all patients on the diabetes mellitus register held at general practices in the catchment population were screened by a national diabetic eye screening program , and all patients with referable diabetic retinopathy ( dr ) were seen in dedicated dr clinics . in these clinics , all patients underwent a comprehensive ophthalmic examination , including visual acuity evaluation , slit - lamp examination , and dilated fundus examination , along with sdoct imaging and infrared fundus photography , and those patients who met the nice guidelines for intravitreal treatment with ranibizumab were referred to a dedicated dmo clinic . we retrospectively reviewed sdoct images of all eyes that were initiated on intravitreal ranibizumab treatment for dmo with central subfield thickness ( cst ) more than 400 , as per nice guidelines , between april 2013 and march 2015 . each oct was carefully observed for the presence of hyperreflective dots in a contiguous ring around the inner wall of cystoid spaces ( pearl necklace images of patients displaying this sign were singled out and these were sequentially followed up for a minimum of 10 months to track the course of this sign . sdoct images were acquired at every clinic visit as part of the established standard of care using the macula protocol for heidelberg sdoct ( spectralis hra + oct ; heidelberg engineering , heidelberg , germany ) . octs were performed with volume scans with at least 19 single sections . on each follow - up the oct images of patients included for the study were matched with the infrared fundus photograph of the corresponding location . clinical charts were retrospectively reviewed and patient characteristics of age , gender , electronic early treatment for diabetic retinopathy study visual acuity and response to treatment , were recorded and correlated with sdoct imaging findings . totally , 267 patients ( age 2491 years , 64 14.8 years ) were seen and initiated on intravitreal ranibizumab therapy in the dmo clinic between april 2013 and march 2015 . 35 eyes of 35 patients ( 23 males , 12 females ) were found to display the pearl necklace sign , giving a prevalence of 13.1% in our cohort of patients [ table 1 ] . this sign was seen in cystoid spaces located in the outer nuclear / outer plexiform layer of the retina in 30 eyes [ fig . 1 ] and lining the inner wall of a neurosensory detachment in 5 eyes [ fig . 2 ] . the follow - up period ranged between 10 and 24 months ( 16 4 months ) . details of patients displaying pearl necklace sign pearl necklace sign in outer plexiform layer the sign in subretinal space in the 35 eyes showing the pearl necklace sign , the mean best - corrected visual acuity ( bcva ) letter score at the start of treatment was 46.7 12.9 letters ; at the final follow - up , the mean bcva was 53.5 14.1 letters . of the 35 eyes , 15 ( 42.8% ) improved by 10 letters or more ; 3 eyes lost 10 or more letters over the follow - up period . the mean cst was 524 82 at baseline and 365 62.3 at final follow - up . qualitative assessment of the pearl necklace sign over the follow - up period showed that of the 35 eyes , 28 showed a significant reduction in macular edema , and in 21 eyes the hyperreflective dots forming the pearl necklace coalesced to form a clump . this appeared as a visible clump of hard exudates in infrared fundus photographs [ fig . the location of these hard exudate clumps was closely associated with the location of the intraretinal / subretinal cysts seen on oct [ fig . as the edema resolved , the pearl necklace sign disappeared completely , without leaving visible hard exudates . ( a ) optical coherence tomography of the eye in fig . 1 at month 3 ; fluid resolved and hard exudate clump at exactly the same spot . ( b ) color fundus photograph of the eye in fig . 3a ; clinically visible hard exudate in the area of pearl necklace ( a ) intraretinal pearl necklace extrafoveally . ( b ) four injections later showing partial resolution of edema and he in the same location as a pearl necklace . ( c ) 12 months and 10 injections later ; he++ ( a ) pearl necklace sign before treatment . 5b showing new clump of he in the location of pearl necklace in three eyes , the pearl necklace sign was seen in cystoid spaces located subfoveally [ fig . with intravitreal therapy , although there was resolution of macular edema , large clumps of hard exudates appeared subfoveally [ fig . this was associated with a drop in the vision of 20 letters or more in these three eyes . multiple studies published previously have described hyperreflective foci ( hf ) , detectable by sdoct techniques , in various retinal pathologies , including exudative age - related macular degeneration and retinal vein occlusion . in age - related macular degeneration , it has been reported that after a loading dose of three intravitreal ranibizumab injections , the number of hfs reduced ; the number of such hf at baseline was suggested as a predictive factor for the outcome of treatment . the presence of similar hf on sdoct , across all retinal layers , has also been reported in dmo . gelman et al . described a novel pearl necklace sign of the contiguous ring of hyperreflective dots along the inner wall of cystoid spaces in the retina in 21 eyes with exudative macular diseases . we found that this sign is not uncommon in dmo and was seen in 13.1% eyes in our series of patients . 75% of eyes where the dmo resolved with treatment developed clinically visible hard exudates in exactly the same location as the pearl necklace sign . the characteristic arrangement along the wall of the cystoid spaces may indicate a relatively large amount of lipoproteins / lipid - laden macrophages that tend to precipitate and leave behind clinically observable hard exudates once the edema resolves following intravitreal therapy . we did not find that the presence of this either predicts or adversely affects the outcome of treatment . our results of a mean letter gain of 6.8 letters with 42.8% eyes improving by 10 letters or more and mean reduction in cst of 159 are comparable to those achieved in restore and drcrnet studies . however , of note is the fact that three eyes that had a dramatic loss of vision ( 20 letters or more ) had subfoveal pearl necklace sign and a large clump of hard exudates appeared subfoveally as the edema resolved in these three eyes . we infer that the presence of this sign in a subfoveal location may result in accumulation of this particulate entity subfoveally ( clinically visible hard exudates ) , causing irreversible damage to photoreceptors in that area , thereby limiting the long - term visual outcome . hyperreflective dots arranged as a contiguous ring along the inner wall of cystoid spaces on the macular oct scan , termed as the pearl necklace sign , are commonly seen in dmo patients who require intravitreal treatment . with a resolution of edema , hard exudates frequently appear in the same location on the retina , implying that the pearl necklace sign is a precursor to hard exudates , in the majority of cases . the presence of this sign does not affect visual prognosis or the response to intravitreal treatment , except where this sign is located subfoveally .

purpose:(1 ) the purpose of this study was to describe significance and prevalence of the newly reported pearl necklace spectral domain optical coherence tomography ( sdoct ) sign , in diabetic macular edema ( dmo ) , ( 2 ) to track the course of this sign over a period of at least 10 months.materials and methods : the pearl necklace sdoct sign refers to hyperreflective dots in a contiguous ring around the inner wall of cystoid spaces in the retina , recently described for the first time in 21 eyes with chronic exudative maculopathy . a retrospective analysis was performed of sdoct images of all patients presenting to the dmo referral clinic of a tertiary eye care center , over a period of 24 months . images of patients displaying this sign were sequentially analyzed for at least 10 months to track the course of the sign.results:thirty-five eyes of 267 patients ( 13.1% ) were found to display the pearl necklace sign . twenty - eight eyes responded to intravitreal ranibizumab treatment with resolution of edema . in 21 eyes , the dots coalesced to form a clump , visible in the infrared fundus photograph as hard exudates ; in seven eyes , dots disappeared without leaving visible exudates . in three eyes , the sign was seen in subfoveal cystoid spaces , with subsequent development of hard exudates , and drop in visual acuity of 20 letters or more.conclusion:pearl necklace sdoct sign is not infrequent in dmo . this sign is a precursor to hard exudates in the majority of cases . if this sign is seen subfoveally , drop in visual acuity can be expected , despite treatment .

Materials and Methods Results Discussion Conclusions Financial support and sponsorship Conflicts of interest

moreover , secondary syphilis should be considered in the differential diagnosis of any dermatosis which is atypical . we are reporting a case of secondary syphilis , without any history of a primary lesion , that resembled borderline lepromatous ( bl ) leprosy , and in whom the diagnosis was considered on clinical grounds . a 57 year old middle class male patient presented with asymptomatic , generalized , annular plaques present for 2 months , and without constitutional symptoms . the plaques were situated on the front and back of trunk [ figure 1 ] , on the upper extremities and thighs , and on the face , with confluent nodules on the forehead . the larger plaques were 4 - 5 cm in size , and had succulent papulonodules at the margin [ figure 1 , site of biopsy 1 ] . other plaques had scaly margins , which were rolled out [ figure 1 ] . on the right forearm there were eroded , annular plaques , with sharply raised overhanging , and scaly margins [ figure 2 ] . however , on noting that the plaques showed increased sensitivity to pain ( buschke - ollendorf sign ) , secondary syphilis was also considered . moreover , a generalized and epitrochlear lymphadenopathy was also noted , but there were no mucous patches or condyloma lata . the plaque with a scaly margin is seen on the left scapular area ( biopsy 2 ) the eroded , annular plaques with scaly margins , on the right forearm , before treatment subsequent investigations confirmed the diagnosis of secondary syphilis , as his rapid plasma reagin ( rpr ) test was reactive in 1:128 dilution , his skin smears were negative for lepra bacilli , and his treponema pallidum haemagglutination test was also positive . on direct questioning , he also had concomitant hiv infection by the elisa test , and his cd4 count was 269 cells / cmm . his chest x - ray was normal , and his eye , cardiovascular , and neurological examination did not reveal any abnormality . his cerebrospinal fluid ( csf ) examination revealed asymptomatic neurosyphilis , with 10 cells / cmm and 50 mg protein / dl , but with a negative csf venereal disease research laboratory ( vdrl ) test . his skin biopsy performed from two different plaques showed essentially similar features , with the presence of a florid subepidermal granulomatous infiltrate without a free grenz zone , in biopsy 2 . a few langhans and multinucleate giant cells were also seen , apart from a periappendageal and perineural granulomatous infiltrate rich in plasma cells [ figure 3 , biopsy 1 ] that was breaking up the arrectores pilorum muscle . in addition , endothelial swelling , with luminal narrowing , and a perivascular infiltrate of lymphocytes and plasma cells was also present . a periappendageal and perineural infiltrate ( h and e 200 , biopsy 1 ) the patient received three weekly injections of 2.4 million units of intramuscular benzathine penicillin , along with 2 g of daily intravenous ceftriaxone for 15 days . he did not develop any fever after any of his injections ( negative jarisch - herxheimer reaction ) . the plaques on the back had flattened 50% within one week of the penicillin injection [ figure 4 ] and the eroded plaques on the forearm had regressed 70% by then . within 20 days , the plaques had almost totally flattened , and 1 months later , only hyperpigmented macules were remaining . after 4 months his repeat rpr had fallen to 1:64 dilution , and his cd4 count had risen to 547 cells / cmm . when last seen one year later , his rpr had further fallen to 1:16 dilution , and there was no recurrence of his skin lesions . hence , it is suggested that an rpr / vdrl test should be routinely performed in any atypical dermatosis . in our patient , there was both a clinical and a histological resemblance to leprosy , as well as atypical features . however , on careful evaluation , a diagnosis of granulomatous secondary syphilis could have been considered , as there were numerous plasma cells , associated with changes in the blood vessels . there have been similar reports of secondary syphilis resembling bl or ll leprosy , with , . and without associated hiv . syphilis , when associated with hiv , could be more severe and unusual , with an increased risk of neurological involvement , hastening of the late stage , and treatment failure . hence , treatment as for late syphilis has been advocated in cases of secondary syphilis , with hiv , along with a mandatory csf test . we treated his asymptomatic neurosyphilis with the alternative recommended dose of ceftriaxone , . and also decided to complete the course of benzathine penicillin , as it had already been started . syphilis facilitates the transmission of hiv , by increasing the viral load , and reduces the cd4 count , which increases after the syphilis is successfully treated . in conclusion , it may be stated that this case has demonstrated the primacy of the time - tested method of a thorough clinical examination and history , followed by the relevant and interpretative investigations , and a good , clinico - pathological correlation for making the correct diagnosis in any unusual dermatosis .

we are reporting an unusual case of secondary syphilis , in a homosexual male patient , which resembled borderline lepromatous leprosy , and in whom the diagnosis was considered on clinical grounds . the patient also had concomitant hiv infection , with asymptomatic neurosyphilis . his rapid plasma reagin test was reactive in 1:128 dilution . he improved with three standard , weekly injections of benzathine penicillin , along with 2 g of intravenous ceftriaxone daily for 15 days . this case is being reported to highlight the need for a high index of suspicion in diagnosing unusual cases of secondary syphilis , especially in those with concomitant hiv infection .

INTRODUCTION CASE REPORT DISCUSSION Financial support and sponsorship Conflicts of interest

idebenone ( 2-(10-hydroxydecyl)-5,6-dimethoxy-3-methyl - cyclohexa-2,5-diene-1,4-dione ) ( figure 1 ) is a synthetic analogue of ubiquinone ( coenzyme q10 ) , a known physiological mitochondria 's membrane compound . idebenone appears to act as a coenzyme q10-like compound exhibiting similarly antioxidant and electron chain transport properties involved in the generation of atp [ 1 , 2 ] . idebenone has been reported to improve energetic metabolism deficiencies and to relieve neurologic symptoms [ 3 , 4 ] . initially developed for the treatment of cognitive disturbances and alzheimer 's disease , idebenone is approved as an orphan drug by the food drug and administration ( fda ) and european agencies for the treatments of friedreich 's ataxia , leber 's hereditary optic neuropathy , or duchenne muscular dystrophy [ 57 ] . reported methods for the determination of ubiquinones are available in biological fluids by a reverse phase hplc with a step extraction procedure , uv detection , and a run time of about 20 min [ 8 , 9 ] . we report the first reverse phase hplc stability - indicating method for assessing idebenone in pharmaceutical forms using a visible detection , direct injection , and a run time of 3 min . according to the international conference on harmonisation ( ich ) stability guideline , idebenone pharmaceutical - quality grade powder was supplied by inresa ( bartenheim , france , lot pr140151b ) . hplc - grade methanol was provided by merck kgaa ( lichrosolv , darmstadt , germany ) . a dionex ultimate 3000 system ( thermo scientific , villebon sur yvette , france ) was used for the assay . this hplc system contained an integrated solvent and degasser srd-3200 , an analytical pump hpg-3200sd , a thermostated autosampler wps-3000tsl , a thermostated column compartment tcc-3000sd , and a diode array detector mwd-3000 . data acquisition was carried out using in - line chromeleon software ( v6.80 sp2 ) ( thermo scientific ) . chromatographic separation was achieved at 25c using a nova - pak c18 column ( waters , guyancourt , france ) with 4 m particle size , 4.6 mm internal diameter , and 150 mm length . the mobile phase of 100% methanol was pumped at a flow rate of 1.0 ml / min . idebenone stock solution ( 100 mg / ml ) was prepared by accurately weighing 10 g and transferring to 100 ml volumetric flask . two idebenone 45 mg tablets were crushed to a fine powder in a glass mortar and 5 ml of methanol was added . the suspension was transferred to a 10 ml volumetric flask and made up to 10 ml with methanol to achieve a final idebenone 9 mg / ml concentration . calibration standards at 3.0 , 4.0 , 5.0 , 6.0 , 7.0 , and 8.0 mg / ml were freshly prepared using the stock solution . quality control solutions at 3.5 , 4.5 , and 6.5 mg / ml were prepared extemporaneously . the method was validated for specificity , linearity , limit of detection ( lod ) , limit of quantification ( loq ) , precision , accuracy , robustness , and the stability - indicating capability . the specificity was determined by analyzing the chromatograms of tablets in comparison with those obtained for idebenone standard solution aiming at confirming that none of the ingredients interfere with the quantitation of the drug . the linearity was determined by a least - square linear regression routine using the compound peak area and concentration of the working standard solutions prepared at six concentration levels ( 3.0 , 4.0 , 5.0 , 6.0 , 7.0 , and 8.0 mg / ml ) . six replicates of each concentration were independently prepared and injected in triplicate into the chromatograph . the method was evaluated by determination of the correlation coefficient and intercept values according to the ich guidelines . lod and loq were expressed as 3.3 syx / b and 10.0 syx / b , respectively , where syx is residual variance due to regression and b is the mean slope of the linear regression curves . the intraday precision was determined by measuring quality control samples of 3.5 , 4.5 , and 6.5 mg / ml of idebenone , injected six times on the same day . the intermediate ( interday ) precision was estimated by injecting quality control samples prepared at the same concentrations on three different days by different operators . the accuracy was investigated by using the standard addition method at different levels : 20 , 40 , 80 , 100 , and 120% . the mean recovery of idebenone of the target concentration ( 4 mg / ml ) was calculated and accepted with 100 2% . to determine the robustness , the evaluation of robustness was based on rsd values obtained by changing analytical setting such as isocratic flow rate ( 1.1 to 1.3 ml / min ) , wavelength detection ( 481 to 483 nm ) , temperature of analytical column ( 23 to 30c ) , and composition of mobile phase ( 1 and 2% deionised water ) . forced degradation studies were carried out to provide some information about the drug stability and to validate the specificity of the idebenone quantification of the assay . the standard solution of idebenone was exposed to accelerated degradation by alkaline , acid , and oxidative and direct exposure to sunlight conditions . to perform the alkaline hydrolysis , 2 ml of idebenone stock solution ( 100 mg / ml ) was mixed in a 4 ml tube with 800 l of 1 n sodium hydroxide ( naoh ) for 1 h and maintained in the dark at 50c . after the reaction time , this solution was cooled at room temperature and neutralized with 1 n hydrochloric acid ( hcl ) . the solution was completed with methanol to reach a targeted concentration of 5 mg / ml before injection into the hplc system . the same procedure was used for the acid hydrolysis using 1 n hcl in sample preparation and 1 n naoh for neutralization before hplc assay . to investigate oxidative degradation , 2 ml of idebenone stock solution was mixed in a 4 ml tube with 1 ml of 3% hydrogen peroxide for 48 h at 50c in the dark . this solution was completed with methanol to reach a targeted concentration of 5 mg / ml before injection into the hplc system . for the photolytic degradation , 2 ml of idebenone stock solution was transferred in a 4 ml tube and directly exposed to sunlight for 5 days . the solution was completed with methanol to reach a targeted concentration of 5 mg / ml . to achieve a quick and effective separation , idebenone was injected into different mobile phase solutions mixing deionised water and methanol at different proportions . due to the insolubility of idebenone in water , the various assays demonstrated that the proportion of 100% methanol was more appropriate for the assay and an idebenone elution was observed at 1.70 min . the optimum drug absorbance was obtained at 480 nm , as there was no interference from excipients present in commercial tablets . a typical chromatogram obtained with the present method the proposed method was validated by determining its performance characteristics regarding specificity , linearity , lod , loq , accuracy , precision , and robustness . specificity was estimated by comparing the chromatograms of blank methanol solution , idebenone standard solution , and excipients solution from tablets as per assay method ( figure 3 ) . the results showed that there was no interference at the retention time of idebenone from the formulation tablet components . the linearity range of idebenone was demonstrated in the interval of 3.0 to 8.0 mg / ml . the mean linear regression equation obtained was y = 13.093x + 0.581 , where y is the peak area and x is the standard solution concentration in mg / ml . the correlation coefficient ( r = 0.9987 ) is suitable ( table 1 ) to determine idebenone concentration range of 3.0 to 8.0 mg / ml . lod and loq were 0.031 and 0.047 mg / ml , respectively . the rsd values were less than 1.0% for all concentrations tested and confirmed the suitable intraday and interday precision of the method . the percent recoveries of idebenone were good under most conditions except for the flow rate at 1.3 ml / min ( table 4 ) . as shown in table 5 , alkaline stress led to the faster effect on idebenone degradation with about 17% of idebenone remaining only after 48 h after exposure to acid stress , about 48% of idebenone was degraded showing the critical ph effects on idebenone stability ( table 5 ) . in oxidative condition , 15% of the drug was degraded whereas in high temperature and direct sunlight conditions , idebenone was found more stable with degradation under 10% ( table 5 ) . at ambient temperature , the drug was stable for at least 15 days . any peak of product degradation was observed in all stress conditions ( figure 4 ; table 5 ) . a simple and rapid stability - indicating high - performance liquid chromatographic method was developed and validated for the determination of idebenone in pharmaceutical dosage forms . the analytical method is specific , linear , precise , accurate , and robust for a rapid determination of this drug and can be used for studying the stability and degradation kinetics of idebenone .

a stability - indicating method was validated for the determination in pharmaceutical forms of idebenone a coenzyme q10-like compound . the assay was achieved by liquid chromatography analysis using a reversed - phase c18 column and a detector set at 480 nm . the optimized mobile phase consisted of isocratic flow rate at 1.0 ml / min for 3 min with methanol . the linearity of the assay was demonstrated in the range of 3.0 to 8.0 mg / ml with a correlation coefficient r2 > 0.998 . the limits of detection and quantification were 0.03 and 0.05 mg / ml , respectively . the intraday and interday precisions were less than 1.0% . accuracy of the method ranged from 98.6 to 101.5% with rsd < 0.6% . specificity of the assay showed no interference from tablets components and breakdown products formed by alkaline , acidic , oxidative , sunlight , and high temperature conditions . this method allows accurate and reliable determination of idebenone for drug stability assay in pharmaceutical studies .

1. Introduction 2. Material and Method 3. Results and Discussion 4. Conclusion

single and double , fluorescent and non - fluorescent , in situ hybridization and immunohistochemical stainings were performed using standard protocols . to analyze the ltbp3 loss of function phenotype , we injected anti - sense ltbp3 morpholinos into one - cell stage wt and transgenic embryos . for genetic lineage tracing , a transgenic driver strain expressing cre recombinase in ltbp3 cells and four cre - responsive color switching the driver strain was crossed individually to each of the reporter strains and their double transgenic progenies were analyzed for zsyellow protein fluorescence using confocal microscopy . to follow the migration of zebrafish shf cells , a tracking dye was injected into the zsyellow , amcyan region of tg(nkx2.5::zsyello ) ; tg(cmlc2::csy ) embryos at 24hpf , the embryos were imaged immediately , and then again at 48 and/or 72hpf . a transgenic strain carrying a cdna encoding a constitutively active human tgf type i receptor ( caalk5 ) under control of the zebrafish heat shock promoter was generated and used to rescue the myocardial defect in ltbp3 morphant embryos . full methods and any associated references are available in the online version of the paper at www.natre.com/nature

the four - chambered mammalian heart develops from two fields of cardiac progenitor cells ( cpcs ) distinguished by their spatiotemporal patterns of differentiation and contributions to the definitive heart [ 13 ] . the first heart field differentiates earlier in lateral plate mesoderm , generates the linear heart tube and ultimately gives rise to the left ventricle . the second heart field ( shf ) differentiates later in pharyngeal mesoderm , elongates the heart tube , and gives rise to the outflow tract ( oft ) and much of the right ventricle . because hearts in lower vertebrates contain a rudimentary oft but not a right ventricle [ 4 ] , the existence and function of shf - like cells in these species has remained a topic of speculation [ 410 ] . here we provide direct evidence from cre / lox - mediated lineage tracing and loss of function studies in zebrafish , a lower vertebrate with a single ventricle , that latent - tgf binding protein 3 ( ltbp3 ) transcripts mark a field of cpcs with defining characteristics of the anterior shf in mammals . specifically , ltbp3 + cells differentiate in pharyngeal mesoderm after formation of the heart tube , elongate the heart tube at the outflow pole , and give rise to three cardiovascular lineages in the oft and myocardium in the distal ventricle . in addition to expressing ltbp3 , a protein that regulates the bioavailability of tgf ligands [ 11 ] , zebrafish shf cells co - express nkx2.5 , an evolutionarily conserved marker of cpcs in both fields [ 4 ] . embryos devoid of ltbp3 lack the same cardiac structures derived from ltbp3 + cells due to compromised progenitor proliferation . additionally , small - molecule inhibition of tgf signaling phenocopies the ltbp3-morphant phenotype whereas expression of a constitutively active tgf type i receptor rescues it . taken together , our findings uncover a requirement for ltbp3-tgf signaling during zebrafish shf development , a process that serves to enlarge the single ventricular chamber in this species .

Methods Summary Supplementary Material

a gluten - free ( gf ) diet reduces the incidence of diabetes in nonobese diabetic ( nod ) mice and dp - bb rats [ 1 , 2 ] . in humans , early exposure to gluten - containing food has been associated with increased risk of islet autoimmunity , and a recent case study has described a prolonged remission period in a type 1 diabetes ( t1d ) patient adhering to the gf diet [ 4 , 5 ] . finally , up to 10% of t1d patients have coeliac disorders , compared to 1% of the background population , indicating a common pathogenesis in coeliac disease and t1d . a gluten - containing diet affects immune cells in the pancreatic lymph nodes and possibly contributes to local inflammation . in healthy mice , gluten intake promotes a proinflammatory profile of regulatory t - cells in both mesenteric and pancreatic lymph nodes . in balb / c and nod mice , we recently described changes in nk- and dendritic cell populations in pancreatic lymph nodes , when comparing gf- with a gluten - containing diet [ 8 , 9 ] . however , whether the effects of gluten take place in the intestinal immune system or by direct priming in the local lymph nodes and pancreas is unknown . much evidences suggest that gliadin peptides cross the intestinal barrier . after gluten intake , large gliadin fragments are found in the small intestine due to partial resistance of gliadin to digestive enzymes [ 10 , 11 ] . intestinal permeability and serum zonulin levels are increased in t1d patients even before clinical onset of the disease [ 12 , 13 ] . this may likely enhance the entry of gliadin fragments into lamina propria and lymphoid tissue . finally , enterovirus infection , which is associated with t1d , increases the intestinal permeability . after crossing the intestinal epithelium , this is seen for other dietary proteins such as ovalbumin when administered orally to mice , and , in one study , gliadin has been demonstrated in serum and breast milk by elisa , although the finding was never confirmed . the current study investigates the murine uptake and biodistribution of 33-mer and 19-mer gliadin peptides . we used the proline - rich 33-mer ( p5688 ) and 19-mer ( p3149 ) alpha - gliadin peptides , which are resistant to digestive proteases [ 10 , 11 , 17 ] and widely studied due to their implication in coeliac disease ( cd ) [ 18 , 19 ] . their transepithelial passage in vitro is low in healthy individuals compared to cd patients , in whom the fragments are transported by protected transcellular transport [ 17 , 20 , 21 ] . we show that these large gliadin peptides are present in circulation after oral administration and that large gliadin fragments access pancreas even in nondiabetic balb / c and c57bl/6 mice . this may contribute to local inflammation and beta cell stress , which could accelerate the development of type 1 diabetes . the peptides h - lqlqpfpqpelpypqpelpypqpelpypqpqpf - ohy ( 33-mer ) and h - lgqqqpfppqqpypqpqpf - ohy ( 19-mer ) , 98% pure ( schafer - n , denmark ) , were h - labeled in the underlined positions using diiodotyrosine ( y(3,5-i2 ) ) iodinated peptides by standard technique [ 22 , 23 ] . they were dissolved in dmso , mixed with 10% palladium on carbon catalyst , and subjected to 10 ci tritium gas in a tritium manifold system ( rc tritec ) for 2 h at room temperature , then purified by hplc , and conserved by addition of 50 mm ascorbic acid . ph was 7.5 for intravenous use ( i.v . ) and 6 for peroral ( p.o . ) balb / ca bomtac ( males ) , c57bl/6jbomtac ( males ) , and nod / mrktac mice were purchased from taconic europe a / s , ejby , denmark , kept in an spf animal facility and fed standard altromin 1324 diet . animal experiments were approved by the danish animal experiments inspectorate and experiments performed according to international guidelines for the care and use of laboratory animals . balb / c mice , 416 weeks of age , were given 650900 g of 33-mer , either i.v . or p.o . , and heparin - plasma was prepared 1560 min later at 0c . protein inhibitors were added to the tissues that were homogenized , mixed with internal standard ( geneseqp : azf58701 ) , and precipitated with 50% methanol , 1% tfa , and centrifugation . the samples were analyzed using an orbitrap xl ( thermo scientific ) equipped with a nano lc ( easy nlc ii , thermo scientific ) . the chromatographic system was a 10 cm , i d 75 m , 3 m c18-a2 column ( thermo scientific ) with a flow of 300 nl / min with 0.1% formic acid as mobile phase a and 0.1% formic acid in acetonitrile as b. the ms scan was performed using a resolution of 30000 and a scan range of 3002000 m / z . six mice received 2301200 ci of h-33-mer or h-19-mer i.v . or p.o . or 200 ci of h - tyrosine ( perkin elmer ) . heparin - plasma was prepared from tail blood at 0c and analysed by sds - page without further processing , after depletion of albumin and igg using a commercial kit ( protea biosciences ) or after digestion with trypsin ( incubation with 125 mm dithiothreitol , 0.05% sds at 53c , ph 7.5 for 45 min , followed by digestion with trypsin ( fluka ) at 37c ) . for fluorography , the fixed gels were soaked in 7% glycerol and amplify fluorographic reagent ( ge healthcare ) , each for 30 min , dried , and exposed on amersham hyperfilm mp at 80c . subsequently , the dried gels were rehydrated in 7% acetic acid for 24 h and coomassie - stained . for scintillation counting , gel slices were excised from the nonfixed gel , covered with 600 l of 30% hydrogen peroxide , and heated at 50c overnight before measurement . plasma was fractionated in amicon ultra 10 kda centrifugal filter units ( merck millipore ) , vivaspin 500 , 5 kda filter units ( sartorius ) , pd10 columns , amicon ultra 0.5 ml 10 kda centrifugal filters , or sep - pak c18 plus short cartridges ( waters ) , or they were ethanol - precipitated or acid - ethanol extracted . slices from nonfixed gels were extracted overnight at 37c in 100 l of 50 mm nh4co3 with or without 12.5 ng/l endoproteinase glu - c sequencing grade ( roche diagnostics ) . the gel slices were further extracted on a shaker for 15 min in 20 l extraction buffer ( 1 : 2 ( vol / vol ) 50 mm nh4hco3/acetonitrile ) . samples were dried in a vacuum concentrator ( eppendorf 5301 ) and reconstituted in 20 l 5% acetic acid before desalting using poros c18 matrix and elution onto a stainless steel 96-well maldi target plate with 1 l -cyano-4-hydroxycinnamic acid ( hcca matrix ) ready - made from agilent ( 6 mg / ml in 30% acetonitrile , 30% methanol , and 0.1% tfa ) for dried droplet crystallization . analysis was done on bruker ultraflex with daltonics flexanalysis software , externally calibrated using a standard peptide mixture ( bruker , range : 1,0003,200 da ) . they were randomly generated from the 33-mer sequence , allowing for deamidation of up to two glutamine residues ( only one deamidation for mr < 1500 da ) and for sodium and potassium ion adduct formation . measured masses were matched to the predicted masses , using a difference of < 0.5 da as threshold . for initial evaluation of accumulation and elimination in blood , nod mice ( 68 weeks ) received 230900 ci h-33-mer or h-19-mer . for biodistribution experiments , balb / c , c57bl/6 , and nod mice ( 8 or 12 weeks ) received 50 ci ( 1.53.6 nmol ) of 33-mer or 19-mer , either p.o . or i.v . , and nod mice aged 20 weeks received 25 ci ( 0.5 nmol ) h - tyrosine . organs were incubated with solvable ( perkin - elmer ) at 55c until dissolved and then with 30% hydrogen peroxide to decolorize the solution . ultima gold ( perkin elmer ) was added , and samples were counted 1 h later in a packard 1600tr scintillation counter . specific activities ( dpm / mg tissue ) were calculated by dividing the counts by the respective weight of the sample that was measured . the tissue distribution was examined using the tissue / blood ratios . to compare responses in blood across different doses ( 230900 ci ) , data were normalized to a dosage of 100 ci . for kinetics studies , using sds - page and fluorography , 230 ci h-33-mer or 770 ci of h-19-mer was used for i.v . administration and 6201200 ci h-33-mer was used for oral administration to nod mice aged 68 weeks . one nod mouse aged 20 weeks received 200 ci h - tyrosine . before oral gavage , mice were starved for 4 h and were not fed until 20 min after . standard tissue sections were dipped in a 1 : 1 dilution in water of melted kodak ntb emulsion with 10% amplify fluorographic reagent ( ge healthcare ) , air - dried , stored in the dark at 4c with desiccant for 13 weeks , developed in kodak d19 developer , fixed in ilford rapid fixer , he stained , and examined in an olympus bx51 microscope ( uplansapo 20x , 0.40 ) equipped with a colorview 1 camera and analysis getit software ( olympus ) . one - way anova with tukey posttest was carried out using graphpad prism version 5.00 for windows ( graphpad software , san diego , california , usa ) to analyze the distribution of the label at each time point . the age of the animals ( 8 and 12 weeks ) did not influence the uptake or distribution of radioactivity from the h-33-mer peptide . to test the hypothesis that large gluten fragments might be absorbed from the intestine , two fragments that have been well investigated in coeliac disease , gliadin 33- and 19-mer , were tritium - labeled and given orally to nod mice , and blood and tissues were sampled up to 72 hours after administration ( figure 1(a ) ) . interestingly , a high level of label from both fragments was seen in the pancreas shortly after administration ( 0.01 < p < 0.05 ) . to increase the time resolution for this phenomenon , we looked in detail at the early events in nod mice ( figure 2(b ) ) and found that the label was present 1/2 h after administration and still remained 3 hours after oral administration . a tyrosine control was included to simulate enzymatic degradation of the peptides , since the label was introduced into the peptides through this amino acid . this label accumulated similarly to the 33- and 19-mer , suggesting that degradation of the peptides could account for the accumulation of label . to investigate if the intestinal transfer of tracer was specific for nod mice , we also investigated balb / c and c57bl/6 mice . in these strains , similar findings were seen ( figure 2 ) , suggesting that the enteric permeability for gluten peptides was not specific for nod mice and that the pancreatic accumulation of the label occurs similarly in several strains . for reference , we investigated the absorbance and distribution of gliadin fragments following intravenous injection and observed an even more pronounced accumulation of label ( supp . again , the results did not differ when investigating the matter in balb / c mice ( supp . , we performed autoradiography . in pancreas ( figure 3(a ) ) , the majority of the label was present in the zymogen granules of the exocrine pancreas and in the duct system and to a lesser extent in the islets . in the other tissues examined ( lung ( b ) , kidney ( c ) , and ileum ( d ) ) , the label was less abundant and evenly distributed . the results do not necessarily demonstrate the presence of the peptides in the various tissues , as the peptides might cleave during uptake . figure 2a ) , molecular weight species about twice the molecular weight of the peptide ( 12 kda ) were seen within minutes of injection . formation of the hmw species could be prevented by injecting unlabeled 33-mer , suggesting that the signals originated from 33-mer adsorbing to high molecular weight species or from tyrosine from the 33-mer that were incorporated into newly synthesized hmw molecules . figure 2b ) showed similar behavior , except that the 12 kda signals were absent at 30 min . it is noticeable that the 33-mer signal is still present in the blood , although in low amounts , 1 h after oral administration of the peptide . interestingly , the 12 kda signal , but not the hmw signal , also formed in vitro ( supp . this suggests that the 12 kda signal does not require de novo synthesis , whereas the hmw does . to investigate the relation of the hmw signal with albumin and igg , we selectively removed these molecules from blood samples from mice that had received 33-mer orally this removed 35% of the label , regardless of the route of administration . if adding the h-33-mer to blood in vitro or if cold peptide was injected prior to injection of the labeled peptide , only 14 - 15% could be removed ( supp . following trypsin digestion of serum , which degrades albumin , but not 33-mer ( supp . figure 2f ) , no distinct band was released , suggesting that the hmw signals originate from de novo synthesis . further , injection of h - tyrosine in mice results in appearance of the hmw band ( data not shown ) . this is compatible with the delay in the appearance of the signal following oral ingestion ( supp . we first optimized the lc - ms detection of the 33-mer by different purification procedures , using samples containing 33-mer , plasma , and plasma spiked with 33-mer ( figure 4 ) . we then analyzed blood from balb / c mice that had received 33-mer by intravenous or peroral administration and detected intact peptide in samples 15 , 30 , and 60 minutes after injection and 60 min after oral administration ( figure 4 ) . a total of 21 maldi - tof ms signals from blood and tissues could be matched to 33-mer fragments ( table 1 ) . in blood , the longest peptide detected was a 32-mer , which was originally described as stable . using pancreas samples , the longest peptide observed was 16 amino acids . in nod mice , we detected fragments in mice at 6 , 8 , 10 , and 20 weeks of age . further , we demonstrated that many of the fragments are also generated in vitro ( table 2 ) if 33-mer is incubated with mouse plasma , suggesting that the fragments form as a result of proteolytic enzymes found in plasma . in this report , we demonstrated that 33-mer and 19-mer gliadin peptides are readily absorbed from the intestine of nod mice and healthy balb / c and c57 mice . gliadin stimulates zonulin expression , which in turn enhances the uptake of 33-mer by the paracellular route , and absorption is also affected by cytokines and gut bacteria [ 2628 ] . it could be expected that the absorption is increased during development of diabetes , as increased capillary permeability is seen in the gut [ 12 , 13 , 29 , 30 ] and in the islets [ 31 , 32 ] in type 1 diabetes patients , prediabetes patients , and relatives and in the bb rat model . in nod mice , infection with a bacterial pathogen ( citrobacter rodentium ) that can increase the intestinal permeability in nod mice also increases disease incidence , but a change in permeability alone does not affect the disease mechanisms . nondegraded gliadin was previously identified in human breast milk and in blood plasma in wistar rats . in addition , gliadin fragments have been demonstrated in animals under pathological conditions : in rhesus macaques suffering from gluten - induced enteropathy or when sensitized to gluten . absorption of other macromolecules ( ovalbumin and -lactoglobulin ) has been described , but in general the bioavailability is low and the half - life short of orally delivered peptide drugs and bioactive peptides [ 37 , 38 ] . therefore , our observation of 33-mer crossing the gut barrier in healthy mice is interesting in the light of the few similar reports describing dietary protein fragments of significant length , crossing the intestinal epithelium . it is difficult to quantify the daily intake of 33-mer as the gliadin content in crop is variable , but based on data from and , assuming that a mouse ingests 5 g of food per day , we estimate that the intake is 50100 g . the native , amidated form of the 33-mer was not included in our studies , but since tissue transglutaminase is present in the intestine , it is likely that gliadin is at least partly deamidated before absorption . we therefore believe that the chosen dosages and peptides reflect the physiological exposure to gliadin . we observed 1020 kda bands on sds gels , which contained 33-mer and fragments hereof . the bands could be sds - resistant , noncovalent di- , tri- , and multimers in agreement with the ability of the ( native , nondeamidated ) 33-mer to dimerize and assemble into supramolecular structures , such as colloidal nanospheres . polymerized gliadin fragments could possibly accelerate the development of t1d , as multivalent surface presentation of epitopes and particulate material can more efficiently elicit immune responses . self - assembly of the 33-mer might also protect it from enzymatic degradation or influence the uptake mechanism in the gut . deamidation of glutamines increases the number of negatively charged residues , thus decreasing the migration rate . prolyl cis - trans isomerization of gliadin fragments could result in more rigid conformations that move slower in the gel and could form as the 33-mer and other gliadin sequences are able to form ppii helix structure , which might exist at the denaturing conditions . in blood , the two latter phenomena could be promoted by enzymes ( e.g. , transglutaminases and prolyl isomerases ) , but spontaneous reactions are also possible . the demonstration of gliadin fragments in islets provides new insight into how gliadin might contribute to diabetes development . the observation that gliadin readily or as a result of increased zonulin secretion penetrates the gut , even in healthy animals and irrespective of the genetic background , suggests that gluten contributes to the pathogenesis of the disease . thus , beta cells are most likely also exposed to the gliadin fragments as their molecular weight ( 4 kda ) is lower than capillaries retain . this would cause stimulation of the insulin secretion , under both resting and glucose - stimulated conditions , and lead to beta cell stress . further , gliadin contributes to local inflammation as it induces a more proinflammatory cytokine profile among t - cells in the intestinal and extraintestinal lymphatic centers , reduces the number of regulatory t - cells in balb / c mice , stimulates nkg2d expression and nk cell activity in balb / c and nod mice , increases expression of dendritic cell activation markers in nod mice , and , at least in vitro , activates macrophages . how this suggested sequence of events translates into the human disease is not known , but several pathogenic aspects are similar in human and murine disease . for instance , gliadin also increases permeability in human intestinal mucosa , and recently a prolonged remission period among newly diagnosed t1d patients on a gluten - free , low - glycemic diet was demonstrated . if the immunological consequences of gliadin exposure are similar in humans , the findings in the present study represent a missing link for understanding how gliadin contributes to the disease development .

gluten promotes type 1 diabetes in nonobese diabetic ( nod ) mice and likely also in humans . in nod mice and in non - diabetes - prone mice , it induces inflammation in the pancreatic lymph nodes , suggesting that gluten can initiate inflammation locally . further , gliadin fragments stimulate insulin secretion from beta cells directly . we hypothesized that gluten fragments may cross the intestinal barrier to be distributed to organs other than the gut . if present in pancreas , gliadin could interact directly with the immune system and the beta cells to initiate diabetes development . we orally and intravenously administered 33-mer and 19-mer gliadin peptide to nod , balb / c , and c57bl/6 mice and found that the peptides readily crossed the intestinal barrier in all strains . several degradation products were found in the pancreas by mass spectroscopy . notably , the exocrine pancreas incorporated large amounts of radioactive label shortly after administration of the peptides . the study demonstrates that , even in normal animals , large gliadin fragments can reach the pancreas . if applicable to humans , the increased gut permeability in prediabetes and type 1 diabetes patients could expose beta cells directly to gliadin fragments . here they could initiate inflammation and induce beta cell stress and thus contribute to the development of type 1 diabetes .

1. Introduction 2. Methods 3. Results 4. Discussion

the pharmacokinetics of many medications change as we age , dictating the need for dosing strategies that adjust for these changes . one such example is vancomycin . the half - life of vancomycin ranges from approximately 2 to 10 hours depending on age ( table 1 ) . focusing on patients aged 3 months to 4 years old compared to those older than 4 years , there is an approximately twofold difference in their half - lives , which can lead to a huge difference in the dosing strategies of vancomycin . with these age - related differences in pharmacokinetics , one would expect dosing strategies to be adjusted . however , dosing of vancomycin in the pediatric population , excluding neonates , is not age - specific ( i.e. , infants , children , and adolescents ) , failing to adjust for the variability in pharmacokinetics among pediatric age groups ( table 2 ) [ 1 , 2 ] . previous studies have shown that higher doses and more frequent dosing strategies are needed to produce therapeutic concentrations . glover and colleagues evaluated the dosing of vancomycin in 76 pediatric intensive care unit ( picu ) patients aged from 1 month to 18 years old . vancomycin 20 mg / kg given every 8 hours was needed to obtain therapeutic concentrations . in another retrospective database review , benner and colleagues evaluated several vancomycin dosing schemes in 357 patients aged from 1 month to 18 years old . vancomycin 10 mg / kg every 6 to 8 hours was compared to vancomycin 15 to 20 mg / kg every 6 to 8 hours . the latter dosing strategies were needed to produce more therapeutic levels . at the moses h. cone memorial hospital , the standard pediatric dosing protocol ordered by the physicians for vancomycin is 15 mg / kg every 8 hours . the objective of this study is to assess the need for a revision to this initial vancomycin dosing strategy in three pediatric age groups . to our knowledge , there are not any other studies available that have evaluated vancomycin dosing strategies based on different pediatric age groups . we hypothesize that patients falling into the infant and adolescent age groups would potentially still reach goal serum trough levels , while those in the child age group would need higher starting doses and/or more frequent dosing regimens . this retrospective study reviewed data from patients admitted to the moses h. cone memorial hospital general pediatric unit and picu between 2006 and 2010 . patients were included if the ages were from 1 month to 18 years old , received vancomycin 15 mg / kg every 8 hours , and had a respective trough concentration measured appropriately , defined as a serum level drawn approximately 30 minutes before the third or subsequent doses . patients were excluded if they had poor renal function , defined as an increase in serum creatinine by 50 percent or more from their baseline or normal serum creatinine for their age . electronic medical records were reviewed , and data collected include the initial vancomycin dose and respective serum trough concentration , timing of the trough concentration , patient demographics , and renal function . the primary outcome was the percentage of patients achieving goal serum trough concentrations defined as 10 to 15 mcg / ml for cellulitis and 15 to 20 mcg / ml for bacteremia , pneumonia , meningitis , osteomyelitis , and endocarditis . secondary outcomes included the percentage of patients with subtherapeutic and supratherapeutic trough concentrations as well as the indication of vancomycin . infants were defined as ages from 1 to 23 months old , children from 2 to 12 years old , and adolescents from 13 to 18 years old . demographics and the primary outcome were analyzed using descriptive statistics , while the secondary outcomes were analyzed by the fisher 's exact test . the study was approved by the institutional review board of the moses cone health system . of the 50 patients ' medical records reviewed , only 25 were included in the analysis due to exclusions . eighteen patients had been started on vancomycin using different dosing strategies other than 15 mg / kg every 8 hours . four patients were excluded due to inappropriate trough timing , in which the trough concentration was charted as being measured after the next dose of vancomycin . other patients who were excluded consist of one patient being less than one month old , one had no weight documented , and three had documented acute renal failure , of which 2 were appropriately started on a different dosing regimen . the majority of patients were female and caucasian in the infant and child age groups , while all the patients in the adolescent group were male and evenly divided between caucasians and african americans ( table 3 ) . none of the patients in the cohort had cystic fibrosis or any past medical histories that could have increased their volume of distribution . most of the patients had their trough concentrations collected with the third or fourth doses of vancomycin and were on vancomycin for less than one week . in regards to the primary outcome , none of the patients achieved goal serum trough concentrations with vancomycin dosed at 15 mg / kg every 8 hours ( table 4 ) . the majority of the trough concentrations were subtherapeutic , with only one infant having a supratherapeutic level ( table 5 ) . the serum trough concentrations of the infants were more likely to fall between 5 to 10 mcg / ml ( 55.6% in the infant group compared to 41.7% in the child age group , p = 0.86 ) , while those in the child age group had more levels less than 5 mcg / ml ( 41.7% in the infant group compared to 58.3% in the child age group , p = 0.86 ) ( table 6 ) . vancomycin is an antimicrobial indicated in patients suffering from infections with methicillin - resistant gram - positive pathogens . it is usually used as the empiric therapy if the proportion of methicillin - resistant gram - positive pathogens is significant ( > 5% ) in the patient population , or if the patients are suspected to be suffering from serious infections ( e.g. , bacteremia ) , or if other antimicrobials like clindamycin can not effectively combat the infection believed to be caused by methicillin - resistant gram - positive pathogens . at our institution , vancomycin is only utilized when the latter two incidences occur . our drug of choice for less serious infections with methicillin - resistant gram - positive pathogens is clindamycin , since such pathogens have a sensitivity of approximately 95% to clindamycin in our pediatric population . many previous studies targeted vancomycin trough concentrations ranging from 5 to 15 mcg / ml , which is lower than the new recommendations by the american society of health system pharmacists , the infectious diseases society of america , and the society of infectious disease pharmacists . due to the rise in the mean inhibitory concentration ( mic ) , it is recommended that vancomycin trough concentrations should be maintained at least above 10 mcg / ml for less severe infection like cellulitis and between 15 and 20 mcg / ml for more complicated infections like bacteremia , pneumonia , meningitis , osteomyelitis , and endocarditis . these recommendations are primarily for the adult population , but they can probably be extrapolated to pediatric patients . our institution 's standard physician vancomycin dosing protocol of 15 mg / kg every 8 hours did not achieve the new goal serum trough concentrations for any of the pediatric age groups . only one patient had a level greater than 10 mcg / ml , and the level was found to be supratherapeutic . again , this patient was also on other agents likely to cause nephrotoxicity including furosemide and gentamicin . previous studies have shown that the risk of nephrotoxicity while on vancomycin increases with concomitant use of other nephrotoxic agents like gentamicin , as well as an extended duration of therapy , leading to high concentrations of vancomycin and potential kidney damage . in a study by glover and colleagues , vancomycin 20 mg / kg every 8 hours produced a mean trough concentration of 7.8 mcg / ml , whereas vancomycin 15 to 20 mg / kg every 6 to 8 hours produced levels from 8 to 12 mcg / ml in a study by benner et al . only the vancomycin dosing regimens with the frequency of every 6 hours was able to produce trough concentrations greater than 10 mcg / ml . none of the dosing strategies in either trial were able to reach concentrations greater than 15 mcg / ml needed for more complicated infections per the new recommendations . interestingly , the mean age for each study was 5 years old , falling into the shortest half - life group for vancomycin . in a newer study of 430 pediatric patients aged from 1 month to 18 years old , eiland and colleagues found that vancomycin dosing strategies of 70 mg / kg / day and 85 mg / kg / day were needed to produce target serum trough concentrations of 10 mcg / ml and 15 mcg / ml , respectively . using the standard pediatric dosing regimens of 40 to 60 mg / kg / day only reached therapeutic levels 49 percent of the time based on the new higher serum trough concentration recommendations . the mean age of the patient population was 5.9 years , which also fell into the child age group . in our study , those in the infant age group were more likely to have a trough level in the 5 to 10 mcg / ml range , while the patients in the child age group had more trough concentrations less than 5 mcg / ml . the adolescent group 's trough concentrations were evenly divided between troughs less than 5 mcg / ml and 5 to 10 mcg / ml . however , due to the small sample size of adolescents , no conclusions can be drawn though one would expect based on the hypothesized adolescent half - life that their trough concentrations would be similar to those of the infant group . we expect that if our patient population had been larger , we might have been able to see more of a trend with each age group . unfortunately , the sample size was small due to half of the patients being excluded . originally , we had set out to collect and analyze more patient data , but due to the fact that all the patients ' serum trough concentrations were subtherapeutic , data collection was stopped early . other limitations to the study include its retrospective nature and the fact that it was conducted at a single center . nonetheless , it is very important to provide a vancomycin dosing regimen to patients that will lead to therapeutic concentration in a timely manner , since methicillin - resistant gram - positive pathogens , especially staphylococcus aureus , have become more virulent in recent years . as a matter of fact , a study by welsh and colleagues confirmed a high rate of vancomycin treatment failures ( 50% ) in pediatric patients with methicillin - resistant staphylococcus aureus ( mrsa ) bacteremia . this failure might have been due to either subtherapeutic vancomycin trough concentrations or the development of vancomycin - resistant mrsa . the latter is of a grave concern , since there are limited data on the use of other more powerful antimicrobials treating methicillin - resistant or vancomycin - resistant gram - positive pathogens in the pediatric population . numerous reports and studies exist that describe the safe and effective use of linezolid in the pediatric population [ 1012 ] ; however , there is not any comparative study between these two agents ( i.e. , vancomycin and linezolid ) in pediatric patients with mrsa infections . if this study is to be conducted , the higher vancomycin dosing strategies need to be considered in the design in order to reach therapeutic concentration . the traditional dosing schemes of vancomycin , including our standard physician protocol of 15 mg / kg every 8 hours , most likely do not produce therapeutic trough concentrations in otherwise healthy patients with normal renal function . our next step at the moses h. cone memorial hospital is to start dosing vancomycin at 20 mg / kg every 8 hours for patients in the infant and adolescent age groups , and vancomycin 15 mg / kg every 6 hours for patients in the child age group . however , for our pediatric patients with clinically significant comorbidities ( e.g. , congenital heart disease , nephrotic syndrome , and renal dysfunction ) , we will continue dosing vancomycin at 15 mg / kg every 8 hours . we then hope to evaluate these two dosing strategies in the future , as these doses and/or frequencies may need to be pushed even higher , especially for patients in the child age group due to their short half - life . large randomized controlled trials are needed to determine the most appropriate dosing regimens of vancomycin in the pediatric population , and the differences in pharmacokinetics must be recognized in order to develop the best dosing for each patient .

background . the pharmacokinetics of many medications change as we age , thus most would assume dosing strategies would adjust for these changes . the objective of this study is to evaluate the initial vancomycin dosing in three pediatric age groups based on measured serum trough concentrations . methodology . this retrospective database review included patients aged from 1 month to 18 years old admitted to the moses h. cone memorial hospital . patients had to have received vancomycin dosed at 15 mg / kg every 8 hours with an appropriately measured trough concentration . the primary outcome was to determine the percentage of patients in 3 pediatric age groups achieving therapeutic trough concentrations with the initial vancomycin dosing regimen . results . twenty - five patients were included in the study . none of the patients had therapeutic trough concentrations after receiving vancomycin 15 mg / kg every 8 hours . only one patient had a supratherapeutic level , while all of the other patients had levels less than 10 mcg / ml . conclusions . vancomycin 15 mg / kg every 8 hours did not provide therapeutic serum trough concentrations for any pediatric age groups . higher doses and/or more frequent dosing regimens need to be evaluated for each age group to determine the most appropriate strategies for producing therapeutic trough concentrations .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

this study used data from the 2008 florida behavioral risk factor surveillance system ( brfss ) . the brfss is an ongoing , telephone - based survey of noninstitutionalized adults in households in the united states and its territories . the brfss was established in 1984 and designed to monitor behavioral risks in the sampled population . the brfss is funded by the centers for disease control and prevention and administered by state - based health departments . a sample of telephone numbers within each state is randomly selected using a disproportionate stratified sample design to obtain a probability sample ( 14,15 ) . each state uses trained interviewers to collect data , which , when weighted , are representative of the state s noninstitutionalized adult population 18 years of age ( 14 ) . in addition to socioeconomic questions , the brfss survey instrument contains questions about a variety of health topics , including overall health status , chronic health conditions ( including diabetes ) , disability , oral health , cancer screening , physical activity , nutrition , immunization , and mental health . state health departments are allowed to include state - added questions in response to emerging issues and to collect additional data on a specific topic . this study used answers to the diabetes - related brfss questions listed in table 1 ( 16 ) . diabetes - related questions from the 2008 florida brfss that were used in this study * additional verbiage that appeared before or after questions to define specific terms has been omitted . the single question ascertaining whether respondents had ever taken a class or course in how to manage their diabetes allows public health systems to monitor the percentage of adults with diabetes who receive dsme on a state and national level . there are two significant problems with using this question : first , one can not determine the quality of and setting for dsme delivery ; and , second , one can not quantify dsme duration for each respondent . a state - added question included in the 2008 florida brfss survey attempted to quantify dsme duration but did not attempt to ascertain dsme quality and setting . respondents who indicated they had ever taken a course or class in how to manage diabetes were asked to respond to the state - added question listed in table 1 ( 17 ) . of the 1,446 respondents with diagnosed diabetes , 1,445 ( 99.9% ) had valid responses to the diabetes module s dsme question , and 1,335 ( 92.3% ) had valid responses to the state - added dsme duration question . to our knowledge , florida is the only state that has used this state - added question . from the responses to this added question , the independent variable of interest , dsme duration , was categorized in the following manner : no dsme , > 0 to < 4 hours , 410 hours , and > 10 hours . several dichotomous ( yes / no ) dependent variables were examined using data from corresponding questions listed in table 1 : engaged in self - monitoring of blood glucose ( smbg ) at least once per day on average ( engaged in smbg ) ; received at least one dilated retinal exam in the past year ( annual eye exam ) ; received at least one foot exam by a health care professional in the past year ( annual foot exam ) ; received at least two a1c tests in the past year ( two hba1c tests ) ; received an influenza vaccination either by injection or spray in the past year ( annual flu shot ) ; ever received a pneumococcal vaccination ( one - time pneumococcal ) ; and uses insulin . for each of the dependent variable questions , do nt know and refused were response options on the survey that were treated as missing data in the analyses . the data were weighted to account for nonresponse and were managed using sas version 9.2 ( sas , cary , n.c . ) . descriptive , , and logistic regression analyses were conducted using sudaan version 11.0 ( sudaan , research triangle park , nc ) . the university of north florida institutional review board approved the use of the 2008 florida brfss data . the results of the analyses indicate that there are a number of statistically significant associations between dsme duration and the outcomes of interest . because of the cross - sectional study design table 2 shows the number of respondents with diagnosed diabetes , the prevalence of diabetes by sociodemographic characteristics , and the percentage of each sociodemographic characteristic among those with diabetes . in addition , the table shows the percentage of adults with diabetes in each dsme duration category ( among those with valid dsme duration responses ) . in florida in 2008 , the prevalence of diabetes was statistically significantly higher among those in the following subpopulations : non - hispanic blacks , those 45 years of age , those with a high school education or less , those earning < $ 50,000 per year , and those with health insurance . among those with valid dsme duration responses , 52.1% received no dsme , 22% had < 4 hours of dsme , 14.8% had 410 hours of dsme , and 11.6% had > 10 hours of dsme . the percentage receiving each level of the dsme duration did not vary significantly by sex , race / ethnicity , age - group , education level , income , or marital status ( data not shown ) . diabetes prevalence among adults by sociodemographic covariates and distribution of each covariate among diagnosed adults , florida brfss 2008 figure 1 shows the percentage of adults who received services or engaged in self - management practices by dsme duration category.the percentage who engaged in smbg varied significantly by dsme duration category ( p < 0.05 ) . the percentage engaging in smbg was highest among those who received 4 hours of dsme . although the percentage who had an annual eye exam increased with increasing dsme duration , the differences were not statistically significant . the percentages of individuals who had an annual foot exam , had at least two a1c tests in the past year , and had received an annual influenza vaccination had positive dose - response relationships with dsme duration ( all p < 0.05 ) . the percentages of individuals who received a one - time pneumococcal vaccination varied significantly by dsme duration category ( p < 0.05 ) . the percentage receiving this vaccination was highest among those who received 4 hours of dsme . each of the dependent variables was statistically significant for trend , with the exception of annual eye exams , suggesting a dose - response relationship between dsme duration and these dependent variables . percentage of florida adults with diagnosed diabetes who received services or engaged in self - management practices by dsme duration category , florida brfss 2008 . table 3 shows the adjusted odd ratios ( ors ) for receiving services or engaging in self - management practices by dsme duration category from logistic regression models adjusted for sex , race / ethnicity , age - group , education level , marital status , health insurance status , and insulin use status . education level was used as a proxy for socioeconomic status , and annual income was not included in the logistic regression models because these two indicators are highly correlated ( 18 ) . compared to those who did not receive dsme , the adjusted odds of performing smbg , having had an annual eye exam , and having had an annual foot exam did not vary significantly by dsme duration category . the adjusted odds of having had at least two a1c tests in the past year was 2.69 ( 95% ci 1.305.58 ) times higher among those who received 410 hours of dsme and 2.63 ( 95% ci 1.106.31 ) times higher among those who received > 10 hours of dsme compared to those receiving 0 hours . the adjusted odds of having an annual flu shot was 2.20 ( 95% ci 1.184.09 ) times higher among those who received > 10 hours of dsme compared to those who received no dsme . finally , the adjusted odds of ever receiving a pneumococcal vaccination was almost twice as high among those who received 410 hours ( or 1.98 , 95% ci 1.033.80 ) and > 10 hours of dsme ( or 1.92 , 95% ci 1.013.64 ) compared to those who did not receive dsme . results from logistic regression models for clinical services or self - management practices , florida brfss 2008 all referent categories have an or of 1.00 . existing literature documents the benefits of engaging in self - management practices and receiving clinical services for those with diabetes ( 10,1922 ) . likewise , the literature documents positive associations between receiving dsme and clinical and self - care ( 10,20,22 ) . what remains less understood is the association between dsme duration and receiving clinical care or engaging in self - care practices . a review of existing literature did not reveal any large , population - based studies examining the relationship between dsme duration and clinical- or self - care outcomes . the results of this study show that , among those with diagnosed diabetes who received dsme , a positive association exists between dsme duration and a number of clinical - care utilization patterns . in particular , having received at least 4 hours of dsme had the greatest impact on clinical - care utilization , specifically a1c testing and influenza and pneumococcal vaccinations . the results also indicate that those who use insulin have significantly higher odds of performing smbg and having an annual foot examination . a number of potential confounding variables are associated with the patient behaviors and outcomes of interest in this study but were not well recorded in the available data ( 2330 ) . these variables can be broadly grouped into provider behaviors , social support , and access to care issues . provider behaviors include providing patients with the care outlined in clinical practice guidelines , providing necessary referrals to specialty care such as podiatrists and ophthalmologists , and effectively communicating with patients to ensure they understand examination outcomes and the importance of receiving the recommended care . the ability to quantify social support variables was very limited in the data used for this study . finally , although the data presented controls for having health insurance , insurance is only part of the overall access - to - care construct . variables such as the inability to access the health care system because of monetary , transportation , geographic isolation , and psychosocial issues were not included . finding the balance between dsme duration and best health outcomes is crucial for people with diabetes . it is imperative to determine the most effective dose of dsme necessary to decrease the prevalence of the debilitating consequences of poor diabetes outcomes while also containing costs and making the best use of limited resources . although the results of this study help to inform this endeavor , more research is needed . in addition to examining the effects of dsme duration , further qualifying the nature of dsme delivery is another area that needs more study ( 11,12 ) . important topics to consider in future studies include determining the most effective length for a single session of dsme , the most beneficial time lapse between individual sessions , and the optimal total number of sessions that a person with diabetes should receive . in addition , studies comparing health outcomes of individual- versus group - based dsme would help guide health educators to the most prudent , cost - effective approach . the combined results of studies such as these would provide a more complete , evidence - based picture of what constitutes a successful dsme program . there are a number of limitations to consider when examining the results of this analysis . the brfss is a cross - sectional study , and one can not infer causal relationships from the results . the 2008 florida brfss was a telephone - based questionnaire administered to a sample of individuals living in households with landlines . given the sampling methodology , those without landline telephones in the household and those who do not reside in households ( e.g. , homeless individuals and those who reside in institutional settings ) were not eligible for participation , increasing the chances of exclusion bias . the brfss collects self - reported data , which may introduce recall and interviewer bias . in addition , the dsme duration question was a state - added question unique to the 2008 florida brfss , and the means to verify the information provided by respondents did not exist . therefore , the authors can not evaluate the accuracy and precision of the question using the study data . moreover , although the state - added dsme duration question provides a means to quantify the estimated number of hours of dsme a respondent received , it does not collect data for the following important considerations : educational setting , curriculum quality , course sequence , and spacing of dsme hours over time ( i.e. , days , weeks , or months ) . finally , the outcome behaviors examined are potentially influenced by health care provider behaviors and referral practices . the effects of provider behavior on the outcomes studied can not be assessed using these data . however , this line of inquiry is a logical next step in research on this topic . given the ever - increasing magnitude of diabetes incidence and prevalence , the potential for devastating health complications , and the skyrocketing costs associated with diabetes , the urgent need for effective dsme is clear . the results of this study can be used as an important segue for future studies that strive to hone and refine best practices in dsme delivery . it is already widely accepted that dsme is associated with improved clinical / self - care and diabetes - related health outcomes ( 4,79 ) . further elucidating the parameters of what constitutes the most effective form and dosage of dsme will help improve evidence - based strategies for preventing complications and maintaining a good quality of life among people with diabetes .

objective . previous studies have shown that receiving diabetes self - management education ( dsme ) is associated with increased care utilization . however , the relationship between dsme duration and care utilization patterns remains largely unexamined . our purpose is to characterize dsme duration and examine the relationship between dsme duration and clinical- and self - care utilization patterns.methods . the study sample included 1,446 adults who were 18 years of age , had diabetes , and had participated in the 2008 florida behavioral risk factor surveillance system survey . clinical- and self - care outcomes were derived using responses to the survey s diabetes module and were based on minimum standards of care established by the american diabetes association . the outcomes examined included self - monitoring of blood glucose at least once per day ; receiving at least one eye exam , one foot exam , a1c tests , and an influenza vaccination in the past year ; and ever receiving a pneumococcal vaccination . dsme duration was categorized as no dsme , > 0 to < 4 hours , 410 hours , and > 10 hours.results . after adjusting for sociodemographic variables , compared to those who did not receive dsme , those who had 410 or 10 + hours of dsme were more likely to receive two a1c tests ( odds ratio [ 95% ci ] 2.69 [ 1.305.58 ] and 2.63 [ 1.106.31 ] , respectively ) and have a pneumococcal vaccination ( 1.98 [ 1.033.80 ] and 1.92 [ 1.013.64 ] , respectively ) . those receiving 10 + hours of dsme were 2.2 times ( 95% ci 1.184.09 ) as likely to have an influenza vaccination.conclusion . these data reveal a positive relationship between dsme duration and utilization of some diabetes clinical care services .

Methods Results Discussion

tissue doppler imaging ( tdi ) quantitatively assesses global and regional systolic function and abnormal relaxation of the heart by measuring tissue velocity , strain and strain rate . tissue velocity directly describes wall motion , which is a tethering motion of the heart regardless of whether regional myocardium movement is active or passive . strain is an index of the length change in a myocardial segment during the cardiac cycle , and strain rate is calculated as the time - derivative of strain . if two adjacent points in one myocardial segment show different lengths of change with respect to time , the myocardial segment shows a change in its own shape . using this property , strain and strain rate reflect myocardial deformation and deformation rate , respectively . however , these two parameters are less affected by the tethering movement of the heart and may discriminate between passive and active cardiac motion . this disorder can cause various side effects such as steroid hepatopathy , hypertension , impaired glucose tolerance of diabetes , and hypercoagulability . the effects of hypercortisolism on cardiac function have been investigated in humans , and hypertrophy and concentric remodeling of the left ventricle ( lv ) and systolic and diastolic dysfunction have been suggested by conventional echocardiography and tdi studies . in particular , impairment of lv systolic dysfunction , moreover , the association between hypercortisolism and cardiac function has not yet been studied in dogs using conventional echocardiography or tdi . in this study , intra - observer within- and between - day tdi variability was assessed and lv function was investigated in dogs with iatrogenic hypercortisolism using tdi , including strain imaging , and the reliability of these methods for lv function was determined . this study protocol was approved by the institutional animal care and use committee of chonnam national university and the animals were cared for in accordance with the guidelines for animal experiments of chonnam national university . eleven 3-year - old healthy male beagles ( weight , 7.7 - 11.9 kg ; median weight , 10.5 kg ) were used in this study . the clinical state of every dog was determined by physical examination , systemic arterial blood pressure measured indirectly using a standard doppler method , complete blood count , biochemistry , electrolytes , adrenocorticotropic hormone ( acth ) stimulation with injection of 5 g / kg of synthetic acth ( synacthen ; dalim biotech , korea ) , urinalysis , heartworm occult antigen test , thoracic and abdominal radiographs , abdominal ultrasonography , conventional echocardiography and tdi . seven dogs were then randomly selected for the iatrogenic hypercortisolism group and one dog was used for myocardium sampling for histopathologic examination . dogs in the iatrogenic hypercortisolism group received 2 mg / kg prednisolone ( solondo ; yuhan medica , korea ) per oral q12 h for 28 days . on day 28 , body weight , blood pressure , conventional echocardiography , and tdi were repeated in the iatrogenic hypercortisolism group . echocardiography was performed with a prosound 7 instrument ( hitachi - aloka medical , japan ) using a 3 to 7.5 mhz phased - array transducer according to the recommendations of the american society of echocardiography . echocardiographic measurements were carried out by one veterinarian ( ohj ) , and mean values from three separate cardiac cycles were used . in m - mode of the lv taken from the right parasternal short - axis view , lv internal dimension and the thicknesses of the lv free - wall ( lvfw ) and the interventricular septum ( ivs ) were measured at the end - diastole and end - systole , after which these parameters were normalized using cornell 's equation to compare with prediction intervals . the diameters of the aorta ( ao ) and left atrium ( la ) were measured at the level of the aortic valve during diastole in two - dimensional mode . lv inflow velocities in early ( e ) and late ( a ) diastoles were measured using pulsed - wave doppler mode in the left apical four - chamber view . two - dimensional color tdi was performed in the right parasternal short - axis view to evaluate the radial motion of the lv and left apical four - chamber view for the longitudinal motion ( fig . the gray scale gain setting was adjusted to optimize wall boundaries of the lvfw and ivs , the doppler velocity range was set as low as possible to avoid aliasing artifacts , and the frame rate was 150 frames / sec . the recorded tdi images were reviewed using a software program ( sop - alpha7 - 13 ; hitachi - aloka medical ) . the region of interest ( roi ) in the diastole was determined based on the wall width and length ( table 1 ) . the peak velocities of lv myocardium were measured at systole ( sm ) , early diastole ( em ) , and late diastole ( am ) . the systolic strain rate ( srs ) , early diastolic ( sre ) and late diastolic strain rates ( sra ) of the radial motion were measured from lvfw . strain and srs of the longitudinal motion from lvfw and ivs were measured . before the study , within- and between - day variabilities of the tdi - derived variables six beagles were examined using tdi on three different days . on a given day , tdi examination was performed three different times . a total of 30 echocardiographic variables were measured using the same method as described above and mean values and standard deviations were used to determine the coefficient of variation using a variance component analysis . myocardial tissues were collected from one dog each in the normal and iatrogenic hypercortisolism groups , then fixed in 10% buffered formalin for histopathological examination . serial 3 m sections were cut , and routine histological staining was performed with hematoxylin and eosin . statistical analysis was performed using the spss statistical program ( ibm spss statistics 21 ; ibm , usa ) . all data are presented as median and ranges and a p < 0.05 was considered significant . intra - observer within- and between - day coefficient of variation values are given in table 2 . most within - day coefficient of variation values ( 23/30 ) were < 15% ( range : 4.2 - 25% ) , except sre and sra at the radial lvfw , em at the apex of the longitudinal lvfw , am at the base and the apex of the longitudinal lvfw , and am at the apex of longitudinal ivs . most between - day coefficient of variation values ( 24/30 ) were also < 15% ( range : 4.3 - 28.2% ) , except peak sra at the radial lvfw , em at the apex of longitudinal lfvw , am at the base and apex of longitudinal lvfw and ivs , and srs at the apex of longitudinal lvfw . dogs in the iatrogenic hypercortisolism group had higher concentrations of basal cortisol , serum alkaline phosphatase , and alanine aminotransferase than those of dogs in the normal group ( data not shown ) . on day 28 , serum cortisol concentrations were significantly higher than baseline values on day 0 , and the acth - stimulated cortisol concentration was lower than the reference range ( basal cortisol concentration : 2.0 - 6.0 g / dl , acth - stimulated cortisol concentration : 5.0 - 18.0 g / dl ) in the hypercortisolism group . blood pressure in the hypercortisolism group was significantly higher than that of the normal group ( p < 0.05 ) ( table 3 ) . no abnormal blood flow was detected in any of the groups by color doppler conventional echocardiography . the normalized echocardiographic parameters of the two groups were within normal reference ranges ( table 4 ) . the diastolic thicknesses of lvfw and ivs in the hypercortisolism group were significantly higher than those in the normal group ( p < 0.05 ) . the e / em ratio of the hypercortisolism group was significantly lower than that of the normal group . table 6 shows the longitudinal lvfw variables , and table 7 shows the longitudinal ivs variables . no significant differences in the radial lvfw variables such as em or am velocities of endocardial and epicardial segments were observed , or in the em / am ratio in the epicardial segment of the two groups . conversely , several diastolic alterations were observed in the endocardial segment of the hypercortisolism group . the em velocity and the em / am ratio of the hypercortisolism group were significantly lower ( p < 0.05 ) , and the am velocity was significantly higher ( p < 0.05 ) than those in the normal group . strain and srs in the basal and apical segments were significantly lower in the iatrogenic hypercortisolism group than in the normal group ( p < 0.05 ) , but no difference in systolic velocities was observed in the segments . the em velocity and em / am ratio in the basal and apical segments significantly differed in the hypercortisolism group relative to the normal group ( p < 0.05 ) . in longitudinal ivs variables , strain , the em velocity and em / am ratio in the hypercortisolism group were significantly lower than those of the normal group ( p < 0.05 ) . no significant differences histopathological examination revealed no gross myocardial lesions in the myocardial sections of the normal or iatrogenic hypercortisolism groups . examination of the arteries in the experimental dogs revealed no intimal thickening ( arteriosclerosis ) relative to normal dogs . no differences in fibrosis were observed upon masson 's trichrome staining of the lv sections of any two dogs . a quantitative assessment of tdi in beagles with iatrogenic hypercortisolism showed subclinical systolic and diastolic dysfunction of lv myocardium , whereas conventional echocardiography could not determine myocardial dysfunction . although the exact mechanism has not been clearly identified , excessive glucocorticoids impair conversion of cortisol to an inactive form , thereby allowing glucocorticoid - mediated mineralocorticoid effects on the heart such as increased myocardial fibrosis . atherosclerosis with intimal thickening in coronary arteries occurs during hypercortisolism and may cause an imbalance between tissue oxygen requirements and supply , resulting in cardiac ischemia . however , fibrosis or arteriosclerosis was not found in myocardial tissues of dogs with iatrogenic hypercortisolism in this study . the discrepancy between our results and those of previous studies may be attributed to the short duration of glucocorticoid treatment . cardiac fibrosis of this study was evaluated subjectively upon microscopic examination , not quantitatively as in previous studies ; thus , mild alterations could have been missed . however , other factors that might play crucial roles in the development of fibrosis and atherosclerosis with exogenous treatment of glucocorticoids in dogs need to be investigated . conventional echocardiography revealed that the diastolic lvfw and ivs were significantly thicker in the hypercortisolism group than in the normal group , although these parameters in the hypercortisolism group were also within the reference range . specifically , the hypercortisolism group showed symmetrically concentric lv hypertrophy with normal fractional shortening . in humans , a positive correlation was detected between relative wall thickness and duration of the hypercortisolism . in light of the short duration of this study , this tendency for thicker lvfw and ivs might indicate that lv concentric remodeling was in progress in the hypercortisolism group . previous human studies demonstrated that systolic and diastolic dysfunction in patients with cushing 's syndrome develops independent of hypertension . systemic hypertension can cause significant myocardial hypertrophy and myocardial dysfunction . in dogs with systemic hypertension , myocardial dysfunction , particularly for the lvfw longitudinal diastolic motion , occurred independently of the presence of myocardial hypertrophy . the effects of blood pressure on cardiac function in dogs with hypercortisolism could not be excluded in this study because the systemic blood pressure of the hypercortisolism group was significantly higher than that of the normal group . however , the effects of systemic hypertension on the myocardium depend on the degree of systemic hypertension . since the absolute value in the hypercortisolism group was smaller than the criteria for systemic hypertension ( > 160 mmhg ) , the effects of blood pressure on myocardial dysfunction of the hypercortisolism group may be minimal . the e / a ratio is a useful parameter for evaluating lv filling pressure . however , this ratio may not be accurate in patients with a preserved lv ejection fraction . em velocity and the e / em ratio are more reliable indices of lv relaxation , and the e / em ratio reflects lv filling pressure , independent of lv ejection fraction . in the present study , em , em / am , and e / em in were significantly lower the hypercortisolism group than in the normal group . increased lv filling pressure was observed in the hypercortisolism group because of the occurrence of abnormal myocardial relaxation . human patients with hypercortisolism show tdi - derived diastolic parameter alterations , as well as decreased e velocity and e / a ratio on conventional echocardiography , while conventional echocardiographic changes may be related to the long duration and stages of hypercortisolism . dogs with hypercortisolism showed a significant decrease in systolic strain values , similar to a human study . sm can be used to assess lv contractile function , but the parameter depends on preload and afterload . strain can demonstrate local dysfunction and detects the regional contractile function more precisely than sm velocity . in the present study , sm velocity did not differ between two groups , suggesting that myocardial dysfunction occurred locally and sm velocities in the affected segments were unchanged by passive movement of the adjacent normal tissue . the degree of decreased strain was more remarkable in longitudinal values than in radial values , and was compatible with the result of study in human . first , tdi variables with a coefficient of variation > 15% may have interacted with the technical aspect of this method . the tdi - derived variables obtained from the apical segment had relatively higher coefficients of variation than those in the basal segment . this may have occurred because tdi is angle - dependent and sensitive to noise . finally , this study was performed in a relatively small population of adult dogs for a short period . despite these limitations these changes were detected more clearly with tdi - derived variables , particularly in longitudinal motion before becoming prominent on conventional echocardiography . the results presented herein will serve as fundamental data for investigating the effects of cortisol effect on myocardial changes in a larger population of dogs with hypercortisolism .

changes in radial and longitudinal left ventricular ( lv ) function were investigated in beagles with iatrogenic hypercortisolism . a total of 11 normal dogs were used , and 2 mg / kg prednisone was administered per oral q12 h for 28 days to 7 out of 11 dogs to induce iatrogenic hypercortisolism . body weight , blood pressure , conventional echocardiography and tissue doppler imaging ( tdi ) of normal and iatrogenic hypercortisolism groups were conducted . the myocardial wall velocity of the lv was measured using color tdi and myocardial deformation was determined by the strain and strain rate . conventional echocardiography revealed that the diastolic lv free wall and interventricular septum in the hypercortisolism group were thickened relative to those in the normal group . the peak early diastolic myocardial velocity and early to late diastolic myocardial velocity ratio of tdi in the hypercortisolism group were significantly lower than those in the normal group . the strain values in the hypercortisolism group were significantly lower than those in the normal group , particularly for longitudinal wall motion . the lower values of myocardium from tdi and strain imaging could be used to investigate subclinical lv systolic and diastolic dysfunction in dogs with the iatrogenic hypercortisolism .

Introduction Materials and Methods Results Discussion

post - operative analgesia is important after surgery to avoid various complications such as venous thromboembolism , respiratory complications and prolonged hospital stay . substantial pain and discomfort are anticipated after caesarean delivery ; hence , analgesic regimen should ensure effective and safe analgesia . the transversus abdominis plane ( tap ) is the fascial plane between the internal oblique and transversus abdominis muscle containing the thoracolumbar nerves t10 to l1 . the introduction of local anaesthetic in this plane blocks these nerves ( t10 to l1 ) . we hypothesised that ultrasonography ( usg)-guided tap block reduces requirement of opioids and provides effective and adequate analgesia . after obtaining approval from the institutional ethics committee and written informed consent , sixty american society of anesthesiologists ( asa ) i and ii patients posted for elective and emergency caesarean section were included in a prospective , randomised , double - blind , controlled clinical trial which was completed over a period of 6 months . patients were excluded from the study if they refused , had contraindications to spinal anaesthesia , required general anaesthesia for the surgery , had local anaesthetic sensitivity or were morbidly obese . patients were randomised by sealed envelope technique to undergo usg guided tap block with 0.5% ropivacaine ( n = 30 ) 15 ml on either side group s or usg guided tap block with 0.9% normal saline ( n = 30 ) 15 ml on either side group c. the allocation sequence was generated by random number table . all patients also received injection paracetamol 1 g intravenously ( iv ) at the end of the surgery . tap block was administered by the posterior approach using the sonosite nanomaxx ultrasonography machine with a linear array transducer probe ( 613 mhz ) . pain severity was assessed by an investigator blinded to the allotment every 2 , 4 , 6 , 8 , 12 , 18 and 24 h. it was measured using visual analogue score ( vas ) ( 0 = no pain and 10 = worst possible pain ) . rescue analgesia was given to patients on demand or when vas was more than 4 in the form of iv tramadol 2 mg / kg . the parameters studied and compared in both the groups were time to first request for analgesic , total tramadol requirement in 24 h and vas at 2 , 4 , 6 , 8 , 12 , 18 , 24 h. for sample size calculation , we considered that a clinically important reduction in 24 h tramadol consumption would be 25% absolute reduction . we calculated that 28 patients per group would be required for an experimental design incorporating two equal - sized groups , using 0.05 and 0.2 alpha and beta errors . to minimise any effect of data loss chicago : spss inc . ) demographic data were analysed using student 's t - test or fisher 's exact test as appropriate . the comparison of total tramadol requirement , time to first analgesic administration and vas between the two groups was done by paired t - test . sixty patients were recruited in the study , of these thirty were randomised to undergo tap block with 0.5% ropivacaine and remaining 30 with placebo . demographic profile , pulse , demographic data were comparable in both groups time to first analgesic administration ( tramadol ) was prolonged significantly in group s ( mean - 9.53 h ) as compared to group c ( mean - 4.1 h ) , p = 0.0163 [ figure 1 ] . time for rescue analgesia in hours in patients receiving tap block with 0.5% ropivacaine ( group s ) , the requirement for analgesic significantly reduced as compared to those who received the placebo block ( group c ) . mean tramadol requirement for group s was 140 mg and for the placebo group ( group c ) was 246.66 mg , which was statistically significant ( p = 0.000000439 ) [ figure 2 ] . mean tramadol requirement in milligrams in the first 24 h after caesarean delivery vas was noted at 2 , 4 , 6 , 8 , 12 , 18 and 24 h. vas was reduced after tap block with 0.5% ropivacaine for the first 810 h post - operatively as compared to patients receiving placebo block [ figure 3 ] . the results of our study show that tap block when used as part of multimodal analgesic regimen after caesarean delivery delayed time for rescue analgesia , reduced requirement of opioid analgesic and decreased vas . multimodal analgesia provides better results by combining various drugs with different duration , and onset of action also reduces the side effects of individual drugs . various studies have been conducted in which opioids have been used iv , intrathecally and also epidurally . however , opioids are associated with complications such as respiratory depression , pruritus , sedation , nausea and vomiting . non - steroidal anti - inflammatory drugs are commonly used but are associated with complications such as bleeding tendencies , uterine atony and gastrointestinal bleeding . ketamine can also be used , but it affects interaction between the mother and the new - born . diclofenac , indomethacin and acetaminophen suppositories have also been used for post - operative pain relief . epidural analgesia is a good alternative for post - operative pain relief , but the gravid uterus increases the chances of dural and vascular puncture , also making it difficult to identify the space . infiltration of local anaesthetic is also used to provide pain relief , but it is not effective for prolonged analgesia . he described it as block delivering local anaesthetics in the tap using the anatomical landmarks ( iliac crest ) by first identifying the lumbar triangle of petit . in 2007 , hebbard et al . the usg probe was placed transverse to the abdominal wall which made the three muscle layers distinctly visible after which the probe was moved to the mid - axillary line just above the iliac crest ( i.e. , over the triangle of petit ) . tap block has been used for various abdominal procedures other than caesarean section such as large bowel resection , open / laparoscopic appendectomy , total abdominal hysterectomy , laparoscopic cholecystectomy , open prostatectomy , abdominoplasty with or without flank liposuction , inguinal hernia and iliac crest bone graft . the tap has poor vascularity , and hence the action is prolonged and not associated with any major complications . we used the usg - guided technique to avoid complication more common with the blind approach . in addition , it gives a real - time picture and chances of failure are reduced . a study using usg - guided tap block with 0.5% ropivacaine after caesarean section was associated with reduction in total morphine use in 24 h in the active group ( median 18 mg ) compared with the placebo group ( median 31.5 mg ) . vass also reduced in the active group compared to placebo group ( 96 mm vs. 77 mm p = 0.008 ) . similarly , a study was conducted in 2008 using tap block after caesarean delivery by the blind approach , with 1.5 mg / kg ropivacaine ( to a maximal dose of 150 mg ) or saline on each side . the study confirmed the usefulness of tap block as seen by the reduced the vas and requirement for morphine ( 66 26 mg vs. 18 14 mg , p < 0.001 ) . two similar studies of tap block were conducted in asa i and ii patients undergoing elective caesarean section under spinal anaesthesia using 20 ml of 0.25% bupivacaine or levobupivacaine . the studies revealed that pain scores were lower and time of demand for first analgesia was significantly longer in study groups compared to control ( no drug ) groups . another study was conducted using 20 ml of 0.375% ropivacaine on either side , which included asa ii patients undergoing caesarean section under spinal anesthesia ; reduction in mean vas score ( p < 0.001 ) and reduced opioid requirement were observed . in our study , we used usg - guided technique for tap block to avoid the complications of blind technique . we used 0.5% ropivacaine 30 ml and also took care not to exceed the toxic dose that is , 3 mg / kg . a study conducted in patients undergoing caesarean section using ropivacaine , 0.375% , 40 ml for tap block for post - operative analgesia showed that the pain scores and opioid consumption were similar between the two groups . the groups consisted of one that received tap block with ropivacaine ( n = 50 ) and the other , placebo ( n = 50 ) . the mean ( standard deviation ) vas on movement at 24 h in the ropivacaine and placebo groups was 3.4 ( 2.4 ) and 3.2 ( 2.2 ) cm , respectively , p = 0.47 . mckeen et al . in 2014 conducted a similar study using tap block and observed no significant difference in opioid consumption ( p = 0.2 ) and vas ( p = 0.61 ) . obese patients were excluded as the block was difficult to perform , and assessment was limited to only 24 h post - operatively ( but pain severity reduced even in control group by this time ) . usg - guided bilateral tap block with 0.5% ropivacaine ( total 30 ml ) reduces the postoperative opioid analgesic consumption in caesarean section patients .

background and aims : transversus abdominis plane ( tap ) block is a fascial plane block providing post - operative analgesia in patients undergoing surgery with infra - umbilical incisions . we evaluated analgesic efficacy of tap block with ropivacaine for 24 h after caesarean section through a pfannenstiel incision.methods:sixty patients undergoing caesarean section under spinal anaesthesia were randomised to undergo tap block with ropivacaine ( n = 30 ) versus control group ( n = 30 ) with normal saline , in addition to standard analgesia with intravenous paracetamol and tramadol . at the end of the surgery , ultrasound - guided tap plane block was given bilaterally using ropivacaine or normal saline ( 15 ml on either side ) . each patient was assessed post - operatively by a blinded investigator at regular intervals up to 24 h for visual analogue score ( vas ) and requirement of analgesia . spss version 18.0 software was used . demographic data were analysed using student 's t - test and the other parameters using paired t-test.results:tap block with ropivacaine compared with normal saline reduced post - operative vas at 24 h ( p = 0.004918 ) . time for rescue analgesia in the study group was prolonged from 4.1 to 9.53 h ( p = 0.01631 ) . mean requirement of tramadol in the first 24 h was reduced in the study group.conclusion:us guided tap block after caesarean section reduces the analgesic requirement in the first 24 h.

INTRODUCTION METHODS RESULTS DISCUSSION CONCLUSIONS Financial support and sponsorship Conflicts of interest

therapeutic hypothermia has been used in survivors of cardiopulmonary resuscitation , patients with brain trauma and with acute myocardial infarction [ 13 ] . mild systemic hypothermia might theoretically be used for rate control in critically ill patients with supraventricular tachycardias instead of or on top of drug therapy . many drugs with negative dromotropic effects also decrease left ventricular inotropy and are thus contraindicated in patients with significant heart failure and supraventricular tachycardias . in this animal study , we sought to investigate the effect of negative chronotropy and especially dromotropy in langendorff - perfused rabbit hearts . animal care and euthanasia were performed according to the guidelines of the american society of physiology with institutional approval and permission of the competent authorities ( bezirksregierung kln ) . female new zealand white rabbits aged 36 months were euthanized and the beating hearts removed . the tyrode used for perfusion consisted of 130 mm nacl , 5.6 mm kcl , 24.2 mm nahco3 , 2.2 mm cacl2 , 0.6 mm mgcl2 , 1.2 mm nah2po4 , and 12.2 mm glucose and was equilibrated with 95% o2 and 5% co2 . bipolar electrodes were positioned on the surface of right and left atrium and right ventricle . the temperature of tyrode and tissue bath was changed in 5-degree steps between 17 and 42c ( constant temperature bath t1000 , p.m. tamson , netherlands ) ( figure 1 ) . we measured the atrial and ventricular refractory period ( aerp and verp ) by extrastimulus testing . the antegrade and retrograde wenckebach periods ( awb and rwb ) were determined by decremental pacing . atrial fibrillation was induced by continuous high - frequency burst stimulation with 100 ms . if atrial fibrillation could not be induced , it was simulated by continuous stimulation with 100 ms . during atrial fibrillation , the mean ventricular heart rate was determined by averaging all cycle lengths during intervals of 30 sec . two - sided student 's t - test was used to compare spontaneous cycle length , refractory periods , awb , rwb , and mean ventricular rate during atrial fibrillation . with decreasing temperature , significant increases of the spontaneous sinus cycle length , the mean ventricular heart rate during atrial fibrillation , and relevant increases of aerp , verp , awb , and rwb were observed ( anova p < .01 ) . at moderate hypothermia of 32c , a 2540% decrease of cardiac chronotropy and dromotropy could be obtained ( figures 2 and 3 ) . the effects of temperature on atrial and ventricular refractory periods as well as awb and rwb are shown in figure 4 . an increased ventricular vulnerability was noted at a temperature level of 42c ; induction of ventricular fibrillation occurred in 13 hearts , whereas ventricular fibrillation was observed in 2 hearts at other temperature levels . the rate of biological processes usually decreases by half to two - thirds with a decrease in temperature of 10c . . the deleterious effect of tachycardia on cardiac output can not be well addressed by pharmacological approaches as many drugs which exert significant negative dromotropic effects also decrease left ventricular inotropy and may decrease systemic vascular resistance . cardiac hypothermia has been used as a therapeutic option in patients after cardiac arrest and in patients with brain injury [ 13 , 5 , 6 ] . in our animal study , we have demonstrated a decline in ventricular heart rate of about 8% per degree c of cooling . a mild hypothermia of 32c resulted in a significant decrease in ventricular heart rate from 267/min to 166/min ( 38% ) during atrial fibrillation in this animal model . the spontaneous cycle length increased from 485 to 615 ms ( 27% ) during mild hypothermia of 32c . in addition , atrial and ventricular refractory periods increased significantly with a decrease in temperature . studied cardiac electrophysiology properties in mice and used mild hypothermia ( 33 - 34c ) as well as hyperthermia . the results of this in vivo mice study are congruent to our results with regard to refractory periods . ventricular rate during atrial fibrillation , however , was not tested in the study by appleton et al . a high percentage of patients treated by mild hypothermia after resuscitation due to cardiac arrest suffer from acute myocardial infarction . the incidence of atrial fibrillation after cardiac arrest is around 15% , and atrial fibrillation is associated with a higher mortality rate [ 8 , 9 ] . hypothermia might reduce the ventricular rate during atrial fibrillation . although we can only speculate on the effect of cooling in patients , extrapolation of our animal data would suggest a reduction in ventricular heart rate of about 30% during mild hypothermia , for instance , from 150/min to 105/min . in the majority of patients , a ventricular heart rate in addition , cooling might be a therapeutic approach of last resort in critically ill patients with sustained supraventricular tachycardias which can not be controlled by cardioversion and pharmacotherapy . hypothetically , selective av nodal cooling could slow down the ventricular rate in critically ill patients with refractory atrial fibrillation without the need for systemic hypothermia . however , this would require technical solutions in order to deliver cooling to a distinct cardiac area . the results we obtained were from an isolated heart model , and no in vivo data are available . differences between human and rabbit electrophysiology may limit the applicability of the results of the study . although the rabbit cardiac action potential is of shorter duration than the human action potential , its shape is very similar . in addition , the kinetic properties of human and rabbit cardiac slow delayed rectifier potassium current ( iks ) are comparable . even though the numerically reconstructed human if is considerably smaller than the typical rabbit if , verkerk and wilders describe a striking similarity between human and rabbit if with regard to the net membrane current . thus , moderate cardiac hypothermia might be used as a new therapeutic tool in critically ill patients nonresponding to electrical cardioversion or pharmacotherapy .

background . cooling has emerged as a therapeutic option in critically ill patients ( especially after cardiac resuscitation ) and might also have a negative dromotropic effect in atrial fibrillation . we sought to determine the impact of cooling on electrophysiologic properties of langendorff - perfused rabbit hearts . methods and results . in 20 isolated langendorff - perfused rabbit hearts , the temperature of the tissue bath was changed between 17 and 42c . with decreasing temperature , significant increases of the spontaneous sinus cycle length , decreases of the mean ventricular heart rate during atrial fibrillation , and relevant increases of atrial and ventricular refractory periods were observed ( anova p < .01 ) . conclusions . cardiac hypothermia leads to a significant drop of mean ventricular heart rate during atrial fibrillation . negative chronotropy and dromotropy induced by moderate cardiac hypothermia might be a feasible therapeutic approach in patients with hemodynamically relevant tachyarrhythmias in a ccu / icu setting .

1. Introduction 2. Materials and Methods 3. Results and Discussion 4. Limitations 5. Conclusions

these advantages have increased the utilization and acceptability of laparoscopy and indeed other forms of minimally invasive procedures over the past few decades . in nigeria , there is a recent surge in interest in laparoscopic surgery among general surgeons with many private and public hospitals adopting the technique for different conditions . our hospital has had her share of similar enthusiasm and has been able to sustain routine practice of laparoscopy in general surgery . still , there exist some worries about the safety and overall outcome of laparoscopy for different conditions in our developing setting . creation of laparoscopic ports may be attended by intraoperative complications such as bleeding and puncture injuries to abdominal viscera . postoperatively , infections and its sequelae , hernia formation and port site metastasis are commonly reported . the occurrence and frequency of these complications vary widely in many series depending on the type , location , and size of ports created , as well as the types of material employed in creating them . this study aims to determine the frequency and types of morbidity associated with laparoscopic surgery in our setting . we prospectively evaluated the port sites of all patients undergoing laparoscopic procedures in one of two general surgery units at the ife hospital unit of the obafemi awolowo university teaching hospital , ile - ife , nigeria between january 2009 and december 2012 . we generally employed the veress needle for carbon dioxide insufflations except in those with intra - abdominal malignancies and those who have had laparotomies . we operated all patients with re - useable trocar and cannulae except for three retroviral positive patients and nine others who requested for disposable materials . conventional laparoscopy was performed in all instances as we do not yet perform single port procedures . the ports wounds were observed intra - operatively for bleeding and on completion of the procedure , the cannulae were removed under direct vision with closure of fascia in ports 10 mm or more . postoperatively , all port sites were examined for bleeding , infection , herniation , metastasis and or chronic pain . data generated were entered into a personal computer and subjected to descriptive and inferential statistics using the statistical package for social sciences version 16.0 for windows ( ibm spss statistics , usa ) . possible influences of patients sociodemographic and anthropometric characteristics on the observed port site complications were investigated . we excluded six patients whose procedures were converted to open laparotomy and subsequently included the remaining 236 patients in our analysis . there were 155 ( 65.7% ) females and 81 ( 34.3% ) male patients on whom 644 laparoscopic ports were created giving an average of 2.7 ports per procedure . of the 236 procedures , 63 ( 26.7% ) were cholecystectomies , 62 ( 26.3% ) staging and biopsies of intra - abdominal tumors , 49 ( 20.8% ) appendectomies , 22 ( 9.3% ) adhesiolysis , 11 ( 4.7% ) diagnostic procedures , 8 ( 3.4% ) groin and ventral hernia repairs , 6 ( 2.5% ) colon cancer surgeries , and 11 ( 4.7% ) other varied procedures . we used transcutaneous sutures for closure of the ports in 41 ( 17.4% ) , subcuticular suture in 151 ( 64.0% ) patients , skin staples in 38 ( 16.1% ) and cyanoacrylate glue in 6 ( 2.5% ) others . patients mean age was 38.1 years ( range = 16 - 82 years ) , mean weight was 56.2 kg ( range = 32.5 - 102 kg ) and mean body mass index was 26.3 ( range = 16.1 - 33.4 ) . at a median follow - up duration of 11.3 months ( range 5 - 34 months ) , port site complications had occurred in 18 ( 2.8% ) port wounds on 16 ( 6.8% ) patients . this includes port site infections ( psis ) in 12 ports occurring in 10 patients with two patients having psis of two different ports . of these the infections involved the umbilical port in nine cases , suprapubic port in two patients and right upper quadrant port in one patient [ table 1 ] . occurrence of wound infection was not significantly associated with the type of procedure ( p = 0.34 ) , its duration ( p = 0.84 ) or the closure technique employed ( p = 0.06 ) . a statistically significant association was however found between occurrence of wound infection on one hand and the site of the ports ( p = 0.004 ) as well as the class of wound created ( p = 0.036 ) on the other hand [ table 2 ] . occurrence of complications in laparoscopic port sites relating occurrence of port site infection to wound class other port site complications recorded includes hypertrophic scars in 4 ( 1.7% ) patients . two of these occurred at the epigastric port following laparoscopic cholecystectomy , one occurred at the umbilicus following cholecystectomy and one at the suprapubic port following appendectomy . there was port site bleeding in 1 ( 0.4% ) patient who was undergoing biopsy of an advanced intra - abdominal tumor , and port site metastasis in another patient following laparoscopic assisted right hemicolectomy for a caecal tumor [ figure 1 ] . port site metastasis in a 68-year - old woman the superficial port infections were managed with wound dressings and this was combined with antibiotics therapy in patients with deep infections . the hypertrophic scars were managed with topical steroid application by the plastic surgery units , while the patient with port site metastasis had a wide local excision biopsy after initial fine - needle aspiration cytology confirmed presence of malignant cells . overall , wound complications were observed at laparoscopic port sites in 2.8% port wounds on 6.8% of patients in this study . this is high compared with 3% patients recorded by karthik et al . in india who however included a larger sample size and we are hopeful that the rate in our center will decline with increasing number of laparoscopic procedures . this translates to 12 of 644 ports ( 1.9% ) and 10 of 236 ( 4.2% ) patients being involved . we have included a number of contaminated and dirty wounds in this analysis as we adopted laparoscopy for treatment of gallbladder empyemas and mucoceles as well as a number of ruptured appendixes with localized abscesses . we observed a statistically significant association between the occurrence of psi and the class of wound created as shown in table 2 . the majority of psis ( 9 of 12 , 75% ) recorded was superficial and involved the umbilical wound . this observation led us to advocate for a change in the routine antiseptic used for preoperative skin preparation in our center from chlorhexidine / cetrimide to povidone iodine . we have observed a marked reduction in the psi rate particularly with the umbilical wound since then . a randomized prospective study is currently being carried out in the unit regarding the use of these two antiseptics . two of these occurred in the epigastric port and one of these patients had been treated for keloidal scars 2 years earlier . all four patients were managed conservatively by the plastic surgery unit with topical agents and the scars regressed in all instances between 5 and 19 months of follow - up . port site metastasis occurred in one of 71 ( 1.4% ) patients who had laparoscopy for malignant conditions in this study . the 68-year - old female had a laparoscopic assisted right hemicolectomy with exteriorization of a particularly bulky cecal mass for extracorporeal resection and anastomosis . a nodular swelling was felt at the extraction site 12 weeks after surgery , while she was on chemotherapy . a wide local excision was carried out and the nodule did not extend into the abdominal cavity . she continued chemotherapy and had no recurrence at the site after 13 months follow - up . the extraction site in laparoscopic colon surgeries has been known for a high incidence of complications particularly hernias and port site metastasis . we however recorded no incisional hernias among the few patients who had colon extraction from midline wounds in this study . there was undue bleeding from one port site during a diagnostic laparoscopy and biopsy of an intra - abdominal mass . other complications such as gastrointestinal or genitourinary injuries and port site hernia were absent in this cohort . several studies have attributed the occurrence of hernias to the use of large size trocars . perhaps , our scanty use of such trocars and the routine adoption of closure of all 10 mm ports led to the absence of hernias in our patients . laparoscopy is currently performed in only one of the two general surgery units of the hospital and this along with other challenges in our setting have limited the number of cases recruited for this study . we have also included a wide range of cases and the location and number of ports differs with the procedures carried out . finally , our primary objective was port site complications including immediate and long - term complications but our period of follow - up may be too short for certain long - term complication like incisional hernia from extraction site . this , along with other benefits , has aided patients acceptance and enthusiasm toward laparoscopic surgeries in our hospital . we advocate increased adoption of the laparoscopic surgeries in nigeria and similar developing countries to reduce the wound complications that commonly attend conventional open surgeries in our environment .

background : different complications may occur at laparoscopic port sites . the incidence of these varies with the size of the ports and the types of procedure performed through them.objectives:the aim was to observe the rate and types of complications attending laparoscopic port wounds and to identify risk factors for their occurrence.patients and methods : this is a prospective descriptive study of all patients who had laparoscopic operations in one general surgery unit of a university teaching hospital in nigeria between january 2009 and december 2012.results:a total of 236 ( 155 female and 81 male ) patients were included . the laparoscopic procedures include 63 cholecystectomies , 49 appendectomies , 62 diagnostic , biopsy and staging procedures , 22 adhesiolyses , six colonic surgeries , eight hernia repairs and 22 others . port site complications occurred in 18 ( 2.8% ) ports on 16 ( 6.8% ) patients including port site infections in 12 ( 5.1% ) and hypertrophic scars in 4 ( 1.7% ) patients , while one patient each had port site bleeding and port site metastasis . nine of 11 infections were superficial , while eight involved the umbilical port wound.conclusion:port site complications are few following laparoscopic surgeries in our setting . we advocate increased adoption of laparoscopic surgeries in nigeria to reduce wound complications that commonly follow conventional open surgeries .

I P R D

the results of all leptospirosis mats for dogs from january 2002 through december 2004 were obtained electronically from antech diagnostic veterinary laboratory ( los angeles , ca , usa ) . the 7 leptospira serovars included in the mats were canicola , grippotyphosa , icterohaemorrhagiae , hardjo , pomona , autumnalis , and bratislava . mat results for each serovar were reported as the highest dilution of serum ( 1:100 , 1:200 , 1:400 , 1:800 , 1:1,600 , 1:3,200 , 1:6,400 , or > 1:12,800 ) at which > 50% agglutination of organisms occurred when compared with a control suspension . calculation of seropositivity was performed separately by using cutoff titers of > 400 , > 800 , or > 1,600 . the percentage of seropositive test results for each serovar was calculated both as the number of positive test results divided by the total number of tests performed and by the total number of positive test results with 95% confidence limits . proportions for categoric variables were compared by using the test for independence . a rank from 1 to 9 was assigned based on the serum dilution results . if 2 serovars had equivalent titers on a mat for a dog , both serovars received the same rank score appropriate for that dilution . all calculations were performed by using sas version 9.1.3 statistical software ( sas , cary , nc , usa ) , and a p value > 0.05 was considered significant . tests that used paired sera from the same dog or tests repeated on the same dog at a different time could not be identified because patient identifiers were not included in the database . therefore , a few individual dogs could have contributed > 1 test to the dataset , but this possibility was considered uncommon . during the study , 23,005 serum samples were submitted for a leptospirosis mat , and 23,000 tests were performed for each of 5 serovars , namely canicola , grippotyphosa , icterohaemorrhagiae , hardjo , and pomona ( table ) . laboratory testing for serovars autumnalis and bratislava was initiated in 2003 , and 11,600 tests were performed for each of these 2 serovars . the percentage of mats that were positive significantly increased from 2002 to 2004 by using cutoff titers > 400 ( p<0.002 ) , > 800 ( p<0.0001 ) , or > 1,600 ( p<0.0001 ) . at these 3 cutoff titers , the percentage of positive mat results was greatest for serovars autumnalis ( 9.1% , 6.5% , and 4.7% , respectively ) and grippotyphosa ( 6.4% , 4.9% , and 4.0% , respectively ) . the proportion of positive mat results attributable to serovars canicola or icterohaemorrhagiae declined as the cutoff titer increased , while it generally increased for serovars autumnalis , bratislava , grippotyphosa , and pomona ( figure 1 ) . no consistent or distinct geographic pattern for positive mat results was observed in the study ( figure 2 ) , but seropositivity was greater in the midwest , south - central , and northwest regions of the united states . percentage of positive microscopic agglutination tests by leptospira serovar , using 3 different cutoff titers for 23,005 canine sera from 20022004 . serovars canicola and icterohaemorrhagiae have been used in canine bacterins for leptospirosis during the study period . canine leptospirosis microscopic agglutination test results shown as the percentage positive and standard error , by state and year from 20022004 . a test was considered positive if the titer for any serovar was > 400 for autumnalis , bratislava , canicola , grippotyphosa , icterohaemorrhagiae , pomona , or hardjo serovars . moderately strong positive correlation in seropositivity ( r , 0.590.72 ) was present between serovars autumnalis , pomona , grippotyphosa , and bratislava , with the strongest correlation between serovars autumnalis and pomona . in contrast , weak positive correlation ( r = 0.36 ) was found between serovars canicola and icterohaemorrhagiae , and each of these serovars was weakly correlated ( r , 0.200.33 ) with serovars autumnalis , pomona , grippotyphosa , and bratislava . serovar hardjo was excluded from correlation analysis because of the small number of positive test results . positive leptospirosis mat results in dogs may indicate natural infection due to direct or indirect contact with wildlife maintenance hosts or recent vaccination ( 2 ) . however , titers > 800 from vaccination are considered unlikely as postvaccinal titers wane rapidly ( 10 ) and most leptospiral bacterins available for dogs are bivalent for canicola and icterohaemorrhagiae , 2 serovars with low seropositivity in this study . although the health and vaccination status of dogs from which sera were submitted was unknown , veterinarians most likely submitted samples for leptospirosis testing when they suspected leptospirosis based on clinical signs including vomiting , fever , lethargy , and anorexia . the most common serovar associated with a positive mat result was autumnalis , a serovar not currently included in licensed canine bacterins . reactivity to this serovar in the mat has been considered a possible paradoxical cross - reaction with serovar pomona ( 11 ) ; a strong positive correlation in titers for these 2 serovars was found in this study . the autumnalis serovar has been isolated from raccoons in the southern united states ( 12 ) , and seropositivity in dogs may represent natural infection from this source . the mat is not serovar - specific , but the 7 serovars evaluated in this study belong to different serogroups ( 13 ) . serovar grippotyphosa , the second most common positive serovar in this study , has also been associated with human leptospirosis outbreaks in the 1990s ( 8) . the finding of a moderately high correlation in serologic reactivity between serovars autumnalis , pomona , grippotyphosa , and bratislava suggests that cross - protection to autumnalis could be induced by current bacterins that lack this antigen . canine vaccines are now available with serovars grippotyphosa and pomona as well as the traditional serovars canicola and icterohaemorrhagiae . this vaccine may confer some immunity to serovar autumnalis , since some protein antigens are highly conserved among several pathogenic serovars ( 14 ) . limitations of the present study included the inability to determine if multiple tests had been performed for individual dogs , lack of data on clinical signs , and unknown vaccination status of the dogs . the geographic distribution of serologic reactivity during the study , however , indicates broad dispersion of leptospira pathogens that pose a risk to both domestic animals and humans . dogs in suburban or rural environments have been shown to be at increased risk of leptospirosis ( 15 ) , presumably because of greater likelihood of contact with wildlife habitats . veterinary practitioners and public health officials need to be aware of the potential change in the ecologic environment and circulating endemic strains for this zoonotic organism .

the proportion of positive leptospira microscopic agglutination tests for 23,005 dogs significantly increased from 2002 to 2004 ( p<0.002 ) regardless of the positive cutoff titer used and was highest ( p<0.05 ) for serovars autumnalis and grippotyphosa . the strongest positive serologic correlation ( r = 0.72 ) was between serovars autumnalis and pomona .

The Study Conclusions

childhood obesity has spread dramatically over the previous decades . to curtail this major health issue , , several studies have shown positive and encouraging outcomes of multidisciplinary approach for childhood obesity . a combination of dietary , physical activity and behavioural interventions compared to standard care or self - help can produce a significant and clinically meaningful reduction in obesity in children and adolescents [ 1 , 2 ] . however , in most studies , programs are limited to between 6 and 12 months of duration , and beneficial effects are partly lost from 6 to 12 months after completion , especially for severely obese children . long - term follow - up studies of paediatric obesity interventions show a mean 10% reduction in relative weight but also substantial relapse [ 5 , 6 ] . as obesity is a chronic disease , the question of the need of a chronic care program is raised . whether the continuation of the program will still be beneficial and how to implement this in a real - life situation remains to be answered identification of factors associated with better outcomes can help maximize the effectiveness of existing interventions , tailor treatment programs to the specific needs of the patients , and set realistic weight loss goals . treatment for children presents a unique challenge as nutrition education , physical activity , and behaviour modification must be presented to both the parents / caregiver and child . parental involvement and individual counselling have been recognised as an important feature of behavioural programs , particularly in preadolescent children [ 3 , 4 , 9 ] . it is thus relevant to examine the impact of family characteristics and psychosocial factors on children 's weight loss . in this paper , we first analyzed the 5-year results of an interdisciplinary long - term care program for childhood obesity . secondly , we determined the baseline factors ( medical , dietary , and psychosocial ) which were associated with weight loss . in 2000 , we set up an interdisciplinary approach for the treatment of childhood obesity . our approach is an individually adapted ( specific for each patient ) family - based , behavioural lifestyle and dietary intervention program . it consists in joint consultations where each child and his family are seen by both a psychologist and a paediatric endocrinologist at the same time . after a time together , the patient is examined ( weight , height , blood pressure , and tanner stage ) by the physician in a separate room which gives the opportunity to the child of having personal time with the paediatrician . during this time , the parents / family / caregivers are seen by the psychologist trained in family therapy . then , the child and the physician get back to the psychologist and the family for a resume of the situation in order to make some decisions . thereafter , the child and his family are taken by the psychologist to the dietician . the psychologist gives a summary of the situation , and then all the family is seen by the dietician . before each session , the interdisciplinary team reviews the situation of each patient . at the end of the visit a letter , including all the decisions taken with the child and his family , and some personal encouragement for the child is written and sent to the patient one month later . for further analysis , the implementation of those decisions was defined as adherence to the treatment . they participate in our program as long as they want or need . between two interdisciplinary visits , the patient and some patients are referred to a specific psychotherapist , and individual physiotherapy can also be prescribed in some situations to reintroduce physical activity especially if joining a sport club is difficult at the beginning of the treatment . the psychotherapy and the physiotherapy are defined in our approach as adjuvant therapies . our way to treat obese children the team develops realistic goals ( small step changes ) together with the child and his family rather than imposing ideas and assumptions about what they need to do to change their lifestyle . we start the treatment from their questions or their needs ( what can we do for you ? ) in order to stimulate them to be an active player in their own changes . we focus on the development of the confidence and competence of the parents or caregivers and of the children . our approach is also in agreement with the evidences published in the bmj by edmunds et al . in 2001 . we encourage the child to grow without gaining weight which decreases bmi slowly . the dietician does not prescribe any specific diet but focuses on healthy eating patterns ( decrease exposure to obesogenic foods , designate times for family meals , and allocate individual portions ) and on increasing the intake of healthy foods . adolescents who were educated about better food choices of moderate portion sizes had been described to be more successful in the long term than teenagers who were given a structured meal plan or restrictive diets . but , we mostly encourage regular daily activities such as riding a bicycle , walking the dog , dancing , gardening , using the stairs instead of elevators , and playing outside with friends who are more easily integrated into a child 's lifestyle than participation in organized sport teams . data suggested that less structured , more flexible lifestyle exercise may be superior to more structured and higher - intensity aerobic exercise for weight control . recommended activities must be enjoyable and consistent with the child 's and his / her family 's lifestyle and be rewarding irrespective of the health benefits . obesity may be reactive to an event of life ( divorce of their parents , difficulties at school ) . parents are encouraged to not focus on weight loss but address their and the child 's internal needs by expressing feelings and nurturing the child emotionally . the parents are targeted as the main agents of change , and they are responsible for inducing this change in the family home , not specifically at the target child . extended family members are included as a means of reaching all people who play a significant role in the child 's health . 428 medical files of children who entered the interdisciplinary consultations between 2002 and 2007 were retrospectively reviewed . inclusion criteria were to have participated in , at least , 2 interdisciplinary visits and to have at least one year of treatment . children with obesity due to an organic / syndromic cause or with type 2 diabetes were excluded . among the included patients : 73% were caucasian , 12% were hispanic , 10% were arabian , 2% were african , 2% were asiatic ( representative of the national population ) . the latest visit was defined as the most recent visit reported in the medical files when they were reviewed between 2007 and 2009 . thus , for some children the latest visit is the last visit before they were no longer monitored . for other children , the latest visit is not the last because they are still monitored by the team . weight was measured ( patient in socks with no shoes and wearing a light gown ) in kilograms to the nearest 0.1 kg using a medical weight scale ( seca nondigital medical scale ) , zeroed and calibrated before each weight . a stadiometer ( bmi ( kg / m ) were expressed relative to the cole population reference data . weight loss was defined by reduction of the bmi standard deviation score ( bmi - z - score ) since bmi is gender and age dependent in childhood . bmi - z - score standardizes an individual 's size , adjusting for age and sex , and allows comparison between values on an equivalent basis . the medical , dietary , and psychosocial factors characterizing the child and his family at baseline were assessed retrospectively by an external consultant ( who was not made aware of the patients weight evolution ) by reviewing the records ( standard home - made questionnaire ) filled in by the team at the first visit . as it is a retrospective and not a prospective study , a semiquantitative ( low / intermediate / high ) approach was used to evaluate each factor . for food consumption , no / low means not every day or never ; intermediate ( if applicable ) means every day but at a low ( 1 - 2 ) level ; yes / high means every day at a high ( > 2 ) level . physical activity means that the child attends a sports club or a youth organization at least twice a week ( yes / high ) , once a week ( intermediate ) or never ( no / low ) . delayed puberty was considered when a girl was assessed m1 > 13.5 years or a boy was assessed g1 > 14 years . obesity in the family means the child has at least one of the two parents who is obese ( bmi > 30 bad quality of sleep was assessed by snoring or short sleep duration ( < 9 h / night ) . family encouragement for the project and child 's motivation were assessed according to the involvement of the family and of the child in the project ( who had the idea to come here ? social integration was assessed as the participation of the child in out - of - school activities . family encouragement for leisure activities was assessed as activities realised by all the family out of the home . we use the quasilikelihood estimation with a linear or a logistic canonical link . for the measures of the same patient , we used an autoregressive correlation matrix and computed the covariance matrix by quasi - least - squares ( qlss ) . for the significance of the results , we used the sandwich variance matrix augmented by the correction proposed by morel et al . which may be evaluated by the normal distribution . for continuous independent variables , we worked with nonlinear regression by p splines ( b splines with penalization of degree 4 ) . out of 428 patients seen between 2002 and 2007 , 322 patients ( 75% ) were interested in our interdisciplinary treatment and attended a second visit . of those , 144 children ( 45% ) ( 59 boys ( 41.0% ) , 85 girls ( 59.0% ) ; mean age : 10.5 3.1 years ( range 419 years ; 105 ( 73% ) < 13 years , 39 ( 26% ) > 13 years ; mean bmi - z - score : 2.73 0.62 ) had at least a 1 year intervention program and were selected for our study . mean length of treatment was 2.2 years ( 16.7 years ) with an average of 3 1 visits per year . after 24 months , 72 children were still monitored ; 14 achieved a 48-month intervention . the length of treatment or assiduity ( number of visits ) did not depend on the initial weight loss ( bmi - z - score ) between the first , and the second visit ( p = 0.63 ) . sex , age and bmi - z - score at the first visit did also not influence the length of intervention ( p = 0.76 ; p = 0.09 and p = 0.43 resp . ) . table 1 described the percentage of patients where bmi - z - score decreased and was stable or increased at the second visit and at the latest visit . at the second visit ( approximately after 36 months ) , bmi - z - score was decreased in 53% of the patients , remained unchanged in 31% , and was increased in 16% . at the latest visit in fact , weight loss was mainly observed during the first 6 months of treatment ( figures 1(a ) and 1(b ) ) but was sustained long - term . the mean bmi - z - score 0.04 mean bmi - z - score ) of the initial mean bmi - z - score after a mean of intervention of 2.2 years and decreased by 12% 2% ( 0.28 0.06 mean bmi - z - score ) for patients with a 48-month treatment . initial bmi - z - score , age at the first visit , sex ( data of boys and girls were thus combined for further analysis ) and number of visit(s ) per year did not influence these results ( p = 0.73 ; p = 0.27 ; p = 0.95 and p = 0.89 resp . ) . furthermore , an additional weight loss was observed between 6 and 48 months of intervention whatever the bmi - z - score between the first and the second visit ( figure 2 ) . patients with a bmi - z - score reduction 0.3 units were 23% ( 2027 ; 95% ci ) of the population at 3 months versus 49% ( 4058 ; 95% ci ) at 48 months of treatment ( figure 3(a ) ) . however , 16% ( 1319 ; 95% ci ) of our patients gained weight after 3 months of treatment . the percentage was increased to 31% ( 2538 ; 95% ci ) of the patients reaching 48 months of treatment ( figure 3(b ) ) . the weight change between the first and the second visit was predictive of the additional weight change over the time ( figure 4 ) . no evidence of adverse effects on growth , eating disorder pathology or mental health , was found . we next investigated whether baseline medical , dietary , and psychosocial parameters reported at the first visit could influence the weight change over the time and which one could be associated with weight loss . patients who exercised in daily life before joining the interdisciplinary treatment were the most successful in term of weight loss ( table 2 ) . preexisting regular physical activity had a statistically significant ( p = 0.037 ) positive influence ( 0.42 0.11 of mean bmi - z - score ) on the weight evolution of the child , in comparison with those who did not exercise before starting the treatment ( 0.18 0.04 of mean bmi - z - score ) . having delayed puberty had a negative influence on the evolution of the mean bmi - z - score of the patients ( 0.02 0.10 of mean bmi - z - score ) in comparison with those who did not ( 0.23 0.03 of mean bmi - z - score , p = 0.046 ) . moreover , baseline daily water intake and daily soda intake had a statistical significant impact on the children 's weight outcome ( p = 0.046 and p = 0.00006 resp . ) we then determined whether the psychosocial context of the child at the first visit may influence the weight change observed later on ( table 4 ) . we showed that being a single child , having family encouragement for the project , the child 's motivation , the adherence to the treatment , and the compliance to adjuvant therapies had a statistically positive effect on the mean bmi - z - score at 9 months of intervention . the duration of the obesity and dual parent households did not impact the weight changes observed . this retrospective real - life study reported the outcomes of a long - term approach for treating childhood obesity and identified baseline predictors of weight changes . this intervention used interdisciplinary strategies ( with effective interaction between the team , not only juxtaposed competences ) but had the specificity to be individually adapted with a continuous care program . to our knowledge , this is the first time that the sustained benefit of a chronic intervention is reported and that the feasibility of a long - term intervention in real life is described in obese children . for example , family - based lifestyle behavioural treatment for obese children with similar clinical characteristics resulted in an average % decrease in overweight of ~7% after 6 months of treatment [ 3 , 4 ] which is comparable to the 8% decrease observed at 24 months in the current study . we described only a 4% bmi - z - score decrease at the second visit ( 3 - 6 months ) but a 12% bmi - z - score decrease at 48 months . in contrast , in the long term , the results of the abovementioned studies were not as promising as they were immediately after completion of the program ( ~ 3.5% decrease in weight at 12 months , 1% at 18 months ) . the beneficial effects of short intervention programs ( from 3 to 6 months ) were partly lost on the follow - up . even with a 12-month drug ( orlistat ) intervention combined to lifestyle , the initial weight loss was not maintained for more than 6 months . with this emphasis on acute short - term intervention , contemporary healthcare may not be well suited to meet the long - term needs of overweight children and their families fighting against this chronic disease . this indicates the need to develop chronic care models to optimize results , especially for severely obese children [ 4 , 7 ] . the addition of a 4-month maintenance treatment after short - term weight loss treatment resulted in better maintenance of weight loss compared with the no maintenance group ( 0.04 versus + 0.05 bmi - z - score ) but no additional weight loss was obtained over followup . in contrast , our program was still beneficial after 48 months of treatment . moreover , the percentage of patients with a 0.3 bmi - z - score reduction increased over time . at least 50% of children reaching a 36-month intervention presented a 0.3 reduction of bmi - z - score . the longer the treatment , the greater the proportion of patients who do not attend . this problem may be magnified with families , who may have more challenges in scheduling than individual adults , and where there are multiple people who may want to drop out of the treatment . in our study , 72 participants were still monitored at 24 months . mean drop - out rates in the literature are varying from 10% to 60% at 12 months of followup . for example , in an italian multicentric study of nutritional intervention in obese paediatric patients , drop - out rates ranged from 3034% to 9094% after 2 years . according to the literature , the main reasons for dropout are loss of interest , relocation , schedule conflict , transport difficulties , family issues for example , limited time for recurrent group sessions , and even for daily household demands [ 3 , 25 ] . . showed that participants in a 3-month brief multidisciplinary intervention still maintained an increased leisure - time physical activity compared to the control group subjects after 1 year of followup . even the weight benefit was modest after 1 year of followup ; this could help them to better general health in the long term . the fall in bmi observed in our study may be clinically relevant as demonstrated by many studies , even though not analysed here . short - term family - based treatment which combined nutrition education , behavioural modification and exercise was shown to improve body composition , lipids profile , blood pressure , and insulin resistance [ 4 , 25 , 26 ] . many of the obesity - associated complications can be reversed with a 5% decrease in age - adjusted bmi percentile . in adults with impaired glucose tolerance , the diabetes prevention program demonstrated that an intensive lifestyle program that reduced body weight by 7% delayed or prevented the development of type 2 diabetes . moreover , savoye et al . reported that obese adolescents with impaired glucose tolerance who were able to limit increases in bmi reverted to normal glucose tolerance 2 years later . thus , the bmi changes observed over time in our study are likely to be clinically significant as those changes were sustained over the longer term . we determined parameters characterizing the families and children at baseline conditions which were associated with a better weight control . indeed , for those less or not responsive patients , new research studies should try to devise new treatments to optimize long - term weight benefits . we demonstrated that those patients could be identified quickly according to the initial weight change observed between the first and the second visits . tanaka et al . also reported that a greater weight loss between the first and the second visits was a predictive factor in the success of the treatment . goldschmidt et al . also reported that early weight change seems to be related to treatment response through to the end of the treatment and also the 2-year followup . identification of factors that promote early weight change is critical because modification of these factors before initiation of the treatment may promote a better early response . in our study , similarly to reinehr et al . , reduction of overweight was independent of initial bmi - z - score , age at the first visit , and sex . it is well know that physical activity is related to long - term weight maintenance but , as suggested in another study , our data supports its role before the initiation of the treatment . children with large birth weight , gestational diabetes , no or short - term breastfeeding , parental obesity , asthma , and short sleep duration were described as having an increased risk of obesity [ 33 , 34 ] . baseline daily water and soda intake seemed to be a good predictor of early weight change . consumption of sugar sweetened drinks by adolescents is an independent variable associated with increasing bmi , but its role on early weight loss was never examined . healthy eating habits as eating breakfast and participating in programmed exercises were described to be correlated to healthful bmi , suggesting that these factors may be potentially protective against obesity in 1216-year old adolescents . our study extends those results by showing that prevention policy may also be helpful even for children who have to lose weight . our results demonstrated that motivated children given family encouragement were more likely to succeed in our treatment . interestingly , recent reports suggested greater weight loss in obese children when parents alone are targeted for intervention , which emphasizes the role of the parents in the child 's weight reduction . larger reductions in adult bmi were associated with more successful results , which indicates that working to enhance the adult role in child weight control programs may improve results . data from rhee et al . suggested that parents having an older child , believing that they themselves were overweight , perceiving that their child had a health problem were associated with greater parental readiness to make changes . emerging research also indicates that overweight children with psychosocial problems or the occurrence of maternal psychopathology are less responsive to weight - control intervention over the longer term the divorce rate has increased as well as the number of families with both parents working . our data suggested that the dual parent households did not affect weight changes observed at 9 months . this is in contrast with a recent study which showed a relationship between single - parents status and excess weight in children . further studies are needed to explore the dynamics of single - parent households and its influence on childhood diet and obesity . interestingly , our study showed that a family with an only child may expect a greater weight loss . other factors such as higher incomes and higher level of education for the mother were also reported to be associated with better results but were not analyzed in the current study . in conclusion , this study was a first step in determining whether weight loss was achievable with our interdisciplinary approach and highlighted potential success of a continuous care weight control program to lower bmi . an early weight change seems to be a marker for children 's long - term treatment response . preexisting regular physical activity , normal timing of puberty , baseline daily water and soda intake , motivation and some family characteristics predict the early response to the treatment . better prevention policy and parental support may thus improve the success of the childhood obesity treatment . our data may provide a better understanding of the factors involved in better weight control and may help to optimize / adapt our strategies for participants who do not benefit from treatment .

background . efforts are needed to improve the long - term efficiency of childhood obesity treatment . to adapt strategies , the identification of subgroups of patients with a greater weight loss may be useful . objective . to analyze the results of a chronic care program for childhood obesity and to determine baseline factors ( medical , dietary , and psychosocial ) associated with successful weight loss . subjects and method . we set up a family - targeted and individually adapted interdisciplinary long - term care program . we reviewed the medical files of 144 children ( 59 boys and 85 girls ; 10.5 3.1 y ; mean bmi - z - score : 2.73 0.62 ) who had 2 interdisciplinary visits and 1-year treatment . results . mean treatment length was 2.2 y ( 16.7 y ) with 3 1 visits / year . the duration of treatment did not depend on the initial weight loss , but this was predictive of the weight change over time . furthermore any additional weight loss was observed with time whatever the initial weight change . high levels of physical activity and daily water intake from baseline conditions were associated with a greater weight loss after 9 months of intervention . in contrast , a high baseline consumption of soft drinks resulted in lower weight loss . family specific factors such as being a single child or the child 's family support were identified as baseline factors which may contribute to better results . conclusion . our study suggests that the benefit of a chronic weight control program supports the need for its integration into the current concept of treatment . better prevention policy and parental support may improve the success of the childhood obesity treatment .

1. Introduction 2. Subjects and Methods 3. Results 4. Discussion

these tumors can arise from any nerve covered with a schwann cell sheath , which include the cranial nerves ( except for the optic and olfactory ) , the spinal nerves , and the autonomic nervous system . when the nerve of origin is small , its association with a given tumor may be difficult to demonstrate . on the other hand , if a larger nerve is the site of origin , the nerve fibers are found to be splayed out over the outer aspect of the capsule rather than incorporated within the mass of the tumor . approximately 112% occur intraorally [ 4 , 5 ] with the tongue being the most common site [ 5 , 6 ] . although several case reports of schwannomas of the tongue exist in the literature , there has been no comprehensive review of the literature since hatziotis et al . . we present two cases of schwannoma of the tongue and review the available literature of the last 51 years ( 19552006 ) . a pubmed search of the terms tongue schwannoma , lingual schwannoma , tongue neurilemmoma , and schwannomas of the floor of mouth were not included unless the ventral tongue was also involved . all of the case reports had histologically confirmed the identity of the masses as schwannomas . the following elements were extracted from the case reports for data analysis : age , gender , location of schwannoma ( anterior one - third vs. posterior two - thirds of tongue ) , presenting symptoms , size of tumor , and treatment modality . an 19-year - old female presented to the head and neck surgery clinic with complaints of a slowly enlarging painless mass in the back of her throat . magnetic resonance ( mr ) imaging was obtained which illustrated a well - circumscribed mass in the right posterolateral tongue that was isointense on t1 , hyperintense on t2 , and enhanced with gadolinium ( fig . the patient was taken to the operating room for a transoral excision under general anesthesia . the mass was submucosal and once a mucosal flap was raised , the tumor was readily shelled out using blunt dissection . the mass had a smooth surface , was tan - white in color , and measured 18 13 11 mm . 1a well - circumscribed mass is located at right posterior tongue as illustrated by the axial t1 ( a ) , sagittal t2 ( b ) , and coronal t1 ( c ) magnetic resonance imagesfig . a at low power ( h&e , 4 ) , both antoni a and antoni b morphologies can be seen . b at high power ( h&e , 20 ) , palisading nuclei and verocay bodies are noted . c s-100 is diffusely positive ( s-100 , 20 ) a well - circumscribed mass is located at right posterior tongue as illustrated by the axial t1 ( a ) , sagittal t2 ( b ) , and coronal t1 ( c ) magnetic resonance images schwannoma of the tongue . a at low power ( h&e , 4 ) , both antoni a and antoni b morphologies can be seen . b at high power ( h&e , 20 ) , palisading nuclei and verocay bodies are noted . c s-100 is diffusely positive ( s-100 , 20 ) a 77-year - old male was referred to the head and neck surgery clinic after his dentist noted an 1 cm firm , sessile mass at the right lateral border of his tongue . the patient reported that the mass had been there for approximately 5 years and had not grown significantly over those years . the patient denied any pain associated with the mass , dysphagia , or change in voice . the mass was gray - tan in color , smooth in texture , dome - shaped , and measured 7 5 5 mm . a final diagnosis of schwannoma was ascribed . an 19-year - old female presented to the head and neck surgery clinic with complaints of a slowly enlarging painless mass in the back of her throat . magnetic resonance ( mr ) imaging was obtained which illustrated a well - circumscribed mass in the right posterolateral tongue that was isointense on t1 , hyperintense on t2 , and enhanced with gadolinium ( fig . the patient was taken to the operating room for a transoral excision under general anesthesia . the mass was submucosal and once a mucosal flap was raised , the tumor was readily shelled out using blunt dissection . the mass had a smooth surface , was tan - white in color , and measured 18 13 11 mm . 1a well - circumscribed mass is located at right posterior tongue as illustrated by the axial t1 ( a ) , sagittal t2 ( b ) , and coronal t1 ( c ) magnetic resonance imagesfig . a at low power ( h&e , 4 ) , both antoni a and antoni b morphologies can be seen . b at high power ( h&e , 20 ) , palisading nuclei and verocay bodies are noted . c s-100 is diffusely positive ( s-100 , 20 ) a well - circumscribed mass is located at right posterior tongue as illustrated by the axial t1 ( a ) , sagittal t2 ( b ) , and coronal t1 ( c ) magnetic resonance images schwannoma of the tongue . a at low power ( h&e , 4 ) , both antoni a and antoni b morphologies can be seen . b at high power ( h&e , 20 ) , palisading nuclei and verocay bodies are noted . a 77-year - old male was referred to the head and neck surgery clinic after his dentist noted an 1 cm firm , sessile mass at the right lateral border of his tongue . the patient reported that the mass had been there for approximately 5 years and had not grown significantly over those years . the patient denied any pain associated with the mass , dysphagia , or change in voice . the mass was gray - tan in color , smooth in texture , dome - shaped , and measured 7 5 5 mm . a pubmed search from 1955 to 2006 identified 124 cases of schwannoma of the tongue ( table 1 ) . of the 126 cases ( including the two patients reported in this paper ) , 106 identified the gender of the patient which showed an almost equal gender predilection with 50 males ( 47.2% ) and 56 females ( 52.8% ) . tongue schwannomas were also noted at all age ranges , but had a significantly higher incidence between the second and fourth decades of life ( fig . 3).table 1patient and tumor characteristics of tongue schwannomasauthoryearage / genderlocation of tumorsize ( greatest dimension , mm)presenting symptomssurgical approachcameron 195925manterior15painless masstransoralmercantini et al . 1960report of 5 cases ; patient and tumor characteristics not describedchadwick 196420fposterior22globustransoralcraig 19648fposterior30painless masstransoralchhatbar 196529mposterior50throat discomforttransoralpantazopoulos 196525manterior<10painless masstransoral45fposterior45dysphagia , change in voicetransoralfirfer et al . 196725mposteriorhazelnut sizepainless masstransoral60fanteriorpea sizepainless masstransoralreport of 46 more cases ( 18 males , 28 females ) ; patient and tumor characteristics not describedoles et al . 196824manterior10painless masstransoral23manterior5painless masstransoralbititci 196940manterior25slight discomforttransoraldas gupta 196921fposterior50paintransoralreport of 7 more cases ; patient and tumor characteristics not describedcherrick et al . 200626fposterior40dysphagia , snoring , change in voicesuprahyoidcohen and wangcurrent study18fposterior18painless masstransoral77manterior7painless masstransoralcase report of malignant schwannoma of the tonguefig . 3age at presentation of patients with tongue schwannomas patient and tumor characteristics of tongue schwannomas case report of malignant schwannoma of the tongue age at presentation of patients with tongue schwannomas the location of the schwannoma was categorized as either anterior two - thirds or posterior one - third of the tongue . this classification was possible in 56 of the 126 cases with 37 cases occurring anteriorly and 19 cases identified posteriorly . descriptions of the patient s clinical symptoms were only found in 57 case reports . the majority of patients presented with an asymptomatic mass ( 39/57 ; 69.6% ) . of the patients that did present with a symptomatic mass , the most common complaints were throat pain or discomfort , dysphagia , and voice change ( table 2 ) . when the location of the schwannoma and the presence of symptoms were examined , a correlation was identified . of the 19 patients with posterior one - third tumors , 12 patients reported symptoms ( 63.2% ) . on the other hand , in the anterior two - thirds group , only five patients reported symptoms ( 13.5%).table 2presenting symptoms of patients with tongue schwannomassymptomnumber of patients ( n = 56)painless mass39throat pain / discomfort7dysphagia4change in voice3globus sensation2difficulty breathing2snoring2ulceration with pain1 presenting symptoms of patients with tongue schwannomas the exact size of the schwannoma was documented in 53 patients . the average size of the excised tumor in all documented patients was 24.04 mm . when the size of the tumor was examined between the symptomatic and asymptomatic groups , a clear distinction was noted . the average schwannoma size in the asymptomatic groups was 18.2 versus 33.0 mm in the symptomatic group . the remaining patients had their tumors excised via a transhyoid , suprahyoid , or submandibular approach . it originates from the schwann cell of the peripheral , autonomic , and cranial nerve . it is usually a single , circumscribed , firm , painless lesion of variable size . approximately 2545% of all schwannomas occur in the head and neck with the parapharyngeal space being the most common site . less commonly , schwannomas present in the oral cavity , and of this subset , the tongue is the most frequently involved [ 5 , 6 ] . in this literature review of the past 51 years , the majority of them present as a painless mass . however , as they approach 3 cm in greatest dimension , they are more likely to produce symptoms such as throat discomfort , dysphagia , and voice changes . moreover , if the schwannomas arises in the posterior two - thirds of the tongue , they are more likely to produce debilitating symptoms . the differentiation between schwannoma and neurofibroma is essential because an apparently solitary neurofibroma may be a manifestation of neurofibromatosis . approximately 15% of patients with neurofibromatosis will have malignant transformation in one or more lesion , which is in marked contrast to the typical behavior of a schwannoma . two main patterns are seen intermingled but sharply defined from each other . the first pattern is referred to as antoni type a which consists of closely packed schwann cells that form bundles or are arranged in rows with palisading , elongated nuclei . the second pattern is known as antoni type b and is composed of very loosely arranged schwann cells set in a meshwork of reticulum fibers and microcysts . in addition to these characteristic patterns , diagnosis is aided by immunohistochemical markers , s-100 and leu 7 , which support the schwann cell nature of these tumors . these authors , in addition to others , noted extensive degeneration within the schwannoma and attributed this change to the aging process of the schwannoma . aside from nuclear atypia , additional changes associated with the degenerative process include formation of cysts , stromal edema , xanthomatous change , and fibrosis . this hypothesis is supported by the finding that the degenerative changes correlate with tumor size . it is now generally accepted that all schwannomas can demonstrate some degenerative changes and the ancient variety probably represents the far end of the continuum of histologic appearance . several cases of malignant transformation of head and neck schwannomas have been reported [ 2 , 17 ] , including one occurrence in the tongue . to support a diagnosis of malignant transformation in benign schwannoma , the following features should be confirmed : ( a ) the tumor demonstrates , to some extent , benign schwannoma ; ( b ) the tumor contains unequivocal malignant foci as manifested by the presence of increased cellularity , numerous mitoses , anaplastic cells , and invasiveness ; ( c ) transitional features between malignant and benign areas can be seen ; and ( d ) the patient has no evidence of von recklinghausen s disease . the mr image is not degraded by dental amalgam or the beam - hardening artifacts that plague ct scanning of the oral cavity . in addition , mr allows an accurate measurement of tumor size and precise localization in relation to other structures . on mr , tongue schwannomas appear isointense to muscle on t1-weighted images and homogenously hyperintense on t2-weighted images . moreover , these tumors usually appear smooth , well demarcated , and do not invade the surrounding musculature . this is an obvious choice for approaching these tumors since most are easily accessible via this route . several other approaches have also been reported to have success including submandibular , suprahyoid pharyngotomy , and transhyoid approaches . all of these approaches were used for base of tongue schwannomas that were deemed difficult to approach by the transoral route . more recently , the use of co2 laser for excision of a base of tongue schwannoma has also been reported . if this is accomplished , recurrence is rare . in evaluating a patient with a slow - growing tongue mass that has been present for a long period of time , in addition to schwannomas , the differential diagnosis should include neurofibromas , granular cell tumors , irritation fibromas , leiomyomas , rhabdomyomas , hemangiomas , lymphangiomas , lipomas , pyogenic granulomas , and benign salivary gland tumors . malignant etiologies should always be considered , but are unlikely to present with the slow clinical course that is typical of a schwannoma . transoral resection allows for removal of this tumor in a manner that precludes recurrence , avoids causing morbidity of tongue function , and remains the standard approach for treatment of the vast majority of these tumors .

the aim of this study was to describe clinicopathologic and radiographic features of two cases of schwannoma involving the oral tongue and to review the literature of this unusual clinical entity . case reports with review of the pathologic , radiologic and clinical data for two patients with schwannoma of the tongue are reported . review of the literature of case reports of schwannomas ( neurilemmomas ) of the tongue from 1955 to 2006 with analysis of the patient s age , gender , presenting symptom(s ) , tumor size , and surgical approach was undertaken . the two patients in our series presented with painless swelling of the tongue . transoral excision was performed and pathologic examination confirmed the diagnosis of schwannoma in both the cases . a total of 126 cases of schwannoma of the tongue have been reported in the english literature over the past 51 years . schwannomas of the tongue typically present in the third decade of life ( 33% ) , display no gender predilection ( 52.8% female ; 47.2% male ) and often present as a painless mass ( 69.6% ) . schwannomas are likely to elicit distressing symptoms when they occur in the posterior one - third of the tongue ( 63.2 vs. 13.5% ) or approach 3 cm in greatest dimension ( 33.0 vs. 18.2 mm ) . the vast majority of cases have been treated with transoral excision ( 94.8% ) . recurrence after surgical excision has not been reported . schwannoma of the tongue is a relatively rare tumor of the head and neck . transoral resection allows for removal of this tumor in a manner that precludes recurrence , avoids causing morbidity of tongue function , and remains the standard approach for the treatment of the vast majority of these tumors .

Introduction Materials and methods Case reports Case report #1 Case report #2 Results Discussion Conclusions

this study provides class ii evidence that rc - ifa accurately detects anti - tr as compared to conventional ifa . anonymized sera from 38 patients with pcd were sent under code to euroimmun by centers in the netherlands , france , spain , germany , and italy for confirmatory anti - dner testing . all sera had previously tested positive for anti - tr in the contributing laboratories , either by conventional immunohistochemistry or by tissue - based ifa using cryosections of rat cerebellum , according to published criteria for anti - tr staining . clinical information was obtained from forms filled out by the referring neurologists , telephone interviews , and review of the clinical records . the remaining 5 samples included 1 patient with pcd without a confirmed tumor , 1 with limbic encephalitis and hl , 1 with paraneoplastic encephalomyelitis and hl , 1 with hl only , and 1 with unknown diagnosis . five samples from patients with cerebellar ataxia were originally included as disease controls in a study evaluating the utility of antineuronal antibody testing in neuromyelitis optica ( s.j . and b.w . , unpublished data ) ; these samples were tested in an anonymized fashion . in addition , serum samples from 207 controls were tested . controls included 66 patients with pcd with a variety of tumors but no anti - tr antibodies : 25 with non - hl , 12 with hl , 7 with breast cancer , 6 with non - sclc , 3 with ovarian cancer , and 13 with other tumors . furthermore , 53 patients with hl without neurologic symptoms were enrolled , as were 46 patients with other diseases ( 20 rheumatoid arthritis , 10 systemic lupus erythematosus , 10 sjgren syndrome , 4 encephalitis , 2 neuropathy ) and 42 healthy individuals . the cdnas for human dner ( uniprot q8nft8 ) , its extracellular domain ( dner[ec ] : amino acids 1640 ) , cdr2 ( q01850 ) , or cdr2l ( q86x02 ) were obtained by performing pcr on a commercially available cdna ( biosource , solingen , germany , genbank bc035009 ; bc017503 ; bc047534 ) . the amplification products were ligated with ptriex-1 ( merck biosciences , darmstadt , germany ) . dner , dner(ec ) , cdr2/yo , or cdr2l ( each with c - terminal octahistidine - tags ) was expressed in human hek293 cells after exgen500-mediated transfection ( fermentas , st . leon - rot , germany ) according to the manufacturer 's instructions . to prepare substrates for the ifa , hek293 cells were grown on sterile cover glasses , transfected , and allowed to express the recombinant protein for 48 hours . cover glasses were washed with phosphate - buffered saline ( pbs ) , fixed with either acetone or 1% ( w / v ) formalin for 10 minutes at room temperature , air dried , cut into millimeter - sized fragments ( biochips ) , and used as substrates in ifa ( see below ) . for selected experiments , cells were transfected in standard t - flasks and the cell culture medium was harvested after 5 days . the medium was centrifuged at 20,000 g at 4c for 20 minutes , and the resulting supernatant was stored in aliquots at 80c until further use . ifa was conducted using slides with a mosaic of 9 biochip substrates : hek293-dner , hek293-cdr2/yo , hek293-cdr2l , and mock - transfected hek293 , each acetone- and formalin - fixed , as well as 4 m unfixed cryosections of monkey cerebellum ( figure 1a ) . each biochip mosaic was incubated with 70 l of pbs - diluted sample at room temperature for 30 minutes , washed with pbs - tween , and immersed in pbs - tween for 5 minutes . in the second step , fluorescein isothiocyanate labeled goat anti - human igg ( euroimmun , lbeck , germany ) was applied and incubated at room temperature for 30 minutes . slides were washed again with a flush of pbs - tween and then immersed in pbs - tween for 5 minutes . slides were embedded in pbs - buffered dabco containing glycerol ( approximately 20 l per field ) and examined by fluorescence microscopy with 460490 nm led excitation ( eurostar , euroimmun ) . results were evaluated by 2 independent observers with more than 10 years of professional experience . samples were classified according to the fluorescence intensity of the transfected cells in direct comparison with cdr2/yo , crd2l , and mock - transfected cells and control samples . a specific fluorescence of the transfected cells at a dilution of 1:10 or higher was considered positive . a staining of monkey cerebellum was scored as having an anti - tr pattern when a distinct punctate immunoreactivity was detected in purkinje cell dendritic tree and soma , as previously described . endpoint titers refer to the last dilution showing visible fluorescence . in competitive inhibition experiments , recombinant antigens were mixed with diluted serum sample 30 minutes prior to the ifa , as described in stcker et al . each reaction field contained 9 biochips with hek293 cells expressing delta / notch - like epidermal growth factor - related receptor ( dner ) , cdr2/yo , or cdr2l , and mock - transfected control cells fixed with either acetone or formalin as well as cryosections of monkey cerebellum . ( b ) binding of serum igg of a patient with paraneoplastic cerebellar degeneration and hodgkin lymphoma ( a c ) to purkinje cell somata and dendritic trees ( anti - tr ) pattern on monkey cerebellum ( a , d ) and to dner - expressing cells ( b , e ) but not control cells used as internal control ( c , f ) . none of these reactivities were seen with serum from controls ( d f ) . ( c ) preincubation with a lysate of hek293 expressing dner ( a , b ) completely abolished the anti - tr / dner fluorescence ( a , c : monkey cerebellum ; b , d : dner - expressing cells ) , but it was not abolished following incubation with a similar lysate from wild - type hek293 ( c , d ) . the extracellular domain of dner was expressed in hek293 cells essentially as described for the full - length protein . the recombinant protein was purified by immobilized metal affinity chromatography , as described for the extracellular domains of desmoglein 1 and 3 . the fractionation of dner(ec ) was monitored by western blot using a monoclonal antibody against hexahistidine and alkaline phosphatase anti - mouse igg ( jackson immunoresearch laboratories , west grove , pa ) , as in reference 14 . the purified antigen was characterized by sds - page using the nupage system ( invitrogen , darmstadt , germany ) according to the manufacturer 's instructions , western blot , and maldi - tof fingerprinting , and maldi - tof tandem mass spectrometry after sds - page and tryptic cleavage . all reagents were obtained from merck or sigma - aldrich , heidelberg , germany , unless otherwise specified . anonymized sera from 38 patients with pcd were sent under code to euroimmun by centers in the netherlands , france , spain , germany , and italy for confirmatory anti - dner testing . all sera had previously tested positive for anti - tr in the contributing laboratories , either by conventional immunohistochemistry or by tissue - based ifa using cryosections of rat cerebellum , according to published criteria for anti - tr staining . clinical information was obtained from forms filled out by the referring neurologists , telephone interviews , and review of the clinical records . the remaining 5 samples included 1 patient with pcd without a confirmed tumor , 1 with limbic encephalitis and hl , 1 with paraneoplastic encephalomyelitis and hl , 1 with hl only , and 1 with unknown diagnosis . five samples from patients with cerebellar ataxia were originally included as disease controls in a study evaluating the utility of antineuronal antibody testing in neuromyelitis optica ( s.j . and b.w . , unpublished data ) ; these samples were tested in an anonymized fashion . in addition , serum samples from 207 controls were tested . controls included 66 patients with pcd with a variety of tumors but no anti - tr antibodies : 25 with non - hl , 12 with hl , 7 with breast cancer , 6 with non - sclc , 3 with ovarian cancer , and 13 with other tumors . furthermore , 53 patients with hl without neurologic symptoms were enrolled , as were 46 patients with other diseases ( 20 rheumatoid arthritis , 10 systemic lupus erythematosus , 10 sjgren syndrome , 4 encephalitis , 2 neuropathy ) and 42 healthy individuals . the cdnas for human dner ( uniprot q8nft8 ) , its extracellular domain ( dner[ec ] : amino acids 1640 ) , cdr2 ( q01850 ) , or cdr2l ( q86x02 ) were obtained by performing pcr on a commercially available cdna ( biosource , solingen , germany , genbank bc035009 ; bc017503 ; bc047534 ) . the amplification products were ligated with ptriex-1 ( merck biosciences , darmstadt , germany ) . dner , dner(ec ) , cdr2/yo , or cdr2l ( each with c - terminal octahistidine - tags ) was expressed in human hek293 cells after exgen500-mediated transfection ( fermentas , st . leon - rot , germany ) according to the manufacturer 's instructions . to prepare substrates for the ifa , hek293 cells were grown on sterile cover glasses , transfected , and allowed to express the recombinant protein for 48 hours . cover glasses were washed with phosphate - buffered saline ( pbs ) , fixed with either acetone or 1% ( w / v ) formalin for 10 minutes at room temperature , air dried , cut into millimeter - sized fragments ( biochips ) , and used as substrates in ifa ( see below ) . for selected experiments , cells were transfected in standard t - flasks and the cell culture medium was harvested after 5 days . the medium was centrifuged at 20,000 g at 4c for 20 minutes , and the resulting supernatant was stored in aliquots at 80c until further use . ifa was conducted using slides with a mosaic of 9 biochip substrates : hek293-dner , hek293-cdr2/yo , hek293-cdr2l , and mock - transfected hek293 , each acetone- and formalin - fixed , as well as 4 m unfixed cryosections of monkey cerebellum ( figure 1a ) . each biochip mosaic was incubated with 70 l of pbs - diluted sample at room temperature for 30 minutes , washed with pbs - tween , and immersed in pbs - tween for 5 minutes . in the second step , fluorescein isothiocyanate labeled goat anti - human igg ( euroimmun , lbeck , germany ) was applied and incubated at room temperature for 30 minutes . slides were washed again with a flush of pbs - tween and then immersed in pbs - tween for 5 minutes . slides were embedded in pbs - buffered dabco containing glycerol ( approximately 20 l per field ) and examined by fluorescence microscopy with 460490 nm led excitation ( eurostar , euroimmun ) . results were evaluated by 2 independent observers with more than 10 years of professional experience . samples were classified according to the fluorescence intensity of the transfected cells in direct comparison with cdr2/yo , crd2l , and mock - transfected cells and control samples . a specific fluorescence of the transfected cells at a dilution of 1:10 or higher was considered positive . a staining of monkey cerebellum was scored as having an anti - tr pattern when a distinct punctate immunoreactivity was detected in purkinje cell dendritic tree and soma , as previously described . endpoint titers refer to the last dilution showing visible fluorescence . in competitive inhibition experiments , recombinant antigens were mixed with diluted serum sample 30 minutes prior to the ifa , as described in stcker et al . each reaction field contained 9 biochips with hek293 cells expressing delta / notch - like epidermal growth factor - related receptor ( dner ) , cdr2/yo , or cdr2l , and mock - transfected control cells fixed with either acetone or formalin as well as cryosections of monkey cerebellum . ( b ) binding of serum igg of a patient with paraneoplastic cerebellar degeneration and hodgkin lymphoma ( a c ) to purkinje cell somata and dendritic trees ( anti - tr ) pattern on monkey cerebellum ( a , d ) and to dner - expressing cells ( b , e ) but not control cells used as internal control ( c , f ) . none of these reactivities were seen with serum from controls ( d f ) . ( c ) preincubation with a lysate of hek293 expressing dner ( a , b ) completely abolished the anti - tr / dner fluorescence ( a , c : monkey cerebellum ; b , d : dner - expressing cells ) , but it was not abolished following incubation with a similar lysate from wild - type hek293 ( c , d ) . the extracellular domain of dner was expressed in hek293 cells essentially as described for the full - length protein . the recombinant protein was purified by immobilized metal affinity chromatography , as described for the extracellular domains of desmoglein 1 and 3 . the fractionation of dner(ec ) was monitored by western blot using a monoclonal antibody against hexahistidine and alkaline phosphatase anti - mouse igg ( jackson immunoresearch laboratories , west grove , pa ) , as in reference 14 . the purified antigen was characterized by sds - page using the nupage system ( invitrogen , darmstadt , germany ) according to the manufacturer 's instructions , western blot , and maldi - tof fingerprinting , and maldi - tof tandem mass spectrometry after sds - page and tryptic cleavage . all reagents were obtained from merck or sigma - aldrich , heidelberg , germany , unless otherwise specified . prior to the testing of all sera , fixation experiments were conducted with representative , decoded , anti - tr positive control sera from erasmus mc previously shown to bind to dner . these sera reacted with both acetone- and formalin - fixed dner - transfected hek293 cells . however , formalin - fixed cells showed lower background staining , which allowed for more reliable evaluation of low - titer sera . accordingly , only data obtained with the formalin - fixed dner substrate were included in the study . in contrast to dner , the control substrates cdr2/yo and cdr2l were expressed intracellularly and , as expected , were only detected by anti - yo positive control sera after acetone fixation but not after treatment with nonpermeabilizing formalin . accordingly , acetone - fixed cdr2/yo and cdr2l cells were used for the study . storing experiments revealed that dust - free storing of desiccated slides containing the dner , cdr2/yo , and cdr2l substrates and mock - transfected control cells at 20c for up to 12 months did not affect the outcome of individual tests . all 38 sera with anti - tr antibodies ( as previously identified by the senders according to conventional or immunofluorescence - based immunohistochemistry ) were positive for anti - dner in the dner rc - ifa but did not react with the control substrates ( figure 1b ) . moreover , all 6 anti - yo positive samples reacted with cdr2/yo- and cdr2l - expressing cells but not with those expressing dner or with the mock - transfected hek293 cells . of the other 201 control sera , this corresponds to a sensitivity of 100% ( 95% confidence interval [ ci ] 92.8%100% ) and a specificity of 100% ( 95% ci 98.7%100% ) of the recombinant cell - based assay for anti - dner . when testing the same sera using the commercial non - recombinant ifa using monkey cerebellar tissue sections , only 34 of the 38 sera produced the typical anti - tr pattern on tissue ( table ) , corresponding to a sensitivity of 89.5% ( 95% ci 80.6%89.5% ) . all control sera were also negative for anti - tr in the monkey tissue based ifa ( specificity 100% , 95% ci 98.7%100% ) . one control serum showed a weak cytoplasmic purkinje cell staining pattern but no anti - tr specific fluorescence at a 1:10 dilution . correlation of indirect immunofluorescence using cryosections of monkey cerebellum or hek293 expressing dner endpoint titers were determined in all 38 anti - dner positive sera on the recombinant cells and monkey cerebellum . all but 3 sera showed higher titers when the recombinant cells were used in comparison to monkey tissue ( p < 0.001 , fisher exact test ) ( figure 2 ) , which yielded low - titer or negative results in 20 of 38 cases . full reproducibility was demonstrated with representative samples on the basis of 3 subsequent slide lots , and all criteria for the ce - labeling of in vitro diagnostics in norm iso 13485 were fulfilled . each dot represents the endpoint titer of a single serum ( n = 38 ) . dner = delta / notch - like epidermal growth factor - related receptor . in neutralization experiments , lysates from hek293-dner and purified dner(ec ) abolished anti - dner reactivities of human sera with recombinant cells and the corresponding anti - tr reactivity on monkey cerebellum in a dose - dependent manner ( figure 1c ) . in contrast , similar fractions of hek293 cells expressing cdr2/yo , mock - transfected hek293 , and the purified extracellular domain of desmoglein 3 did not affect anti - dner or the anti - tr reactivities . prior to the testing of all sera , fixation experiments were conducted with representative , decoded , anti - tr positive control sera from erasmus mc previously shown to bind to dner . these sera reacted with both acetone- and formalin - fixed dner - transfected hek293 cells . however , formalin - fixed cells showed lower background staining , which allowed for more reliable evaluation of low - titer sera . accordingly , only data obtained with the formalin - fixed dner substrate were included in the study . in contrast to dner , the control substrates cdr2/yo and cdr2l were expressed intracellularly and , as expected , were only detected by anti - yo positive control sera after acetone fixation but not after treatment with nonpermeabilizing formalin . accordingly , acetone - fixed cdr2/yo and cdr2l cells were used for the study . storing experiments revealed that dust - free storing of desiccated slides containing the dner , cdr2/yo , and cdr2l substrates and mock - transfected control cells at 20c for up to 12 months did not affect the outcome of individual tests . all 38 sera with anti - tr antibodies ( as previously identified by the senders according to conventional or immunofluorescence - based immunohistochemistry ) were positive for anti - dner in the dner rc - ifa but did not react with the control substrates ( figure 1b ) . moreover , all 6 anti - yo positive samples reacted with cdr2/yo- and cdr2l - expressing cells but not with those expressing dner or with the mock - transfected hek293 cells . of the other 201 control sera , this corresponds to a sensitivity of 100% ( 95% confidence interval [ ci ] 92.8%100% ) and a specificity of 100% ( 95% ci 98.7%100% ) of the recombinant cell - based assay for anti - dner . when testing the same sera using the commercial non - recombinant ifa using monkey cerebellar tissue sections , only 34 of the 38 sera produced the typical anti - tr pattern on tissue ( table ) , corresponding to a sensitivity of 89.5% ( 95% ci 80.6%89.5% ) . all control sera were also negative for anti - tr in the monkey tissue based ifa ( specificity 100% , 95% ci 98.7%100% ) . one control serum showed a weak cytoplasmic purkinje cell staining pattern but no anti - tr specific fluorescence at a 1:10 dilution . correlation of indirect immunofluorescence using cryosections of monkey cerebellum or hek293 expressing dner endpoint titers were determined in all 38 anti - dner positive sera on the recombinant cells and monkey cerebellum . all but 3 sera showed higher titers when the recombinant cells were used in comparison to monkey tissue ( p < 0.001 , fisher exact test ) ( figure 2 ) , which yielded low - titer or negative results in 20 of 38 cases . full reproducibility was demonstrated with representative samples on the basis of 3 subsequent slide lots , and all criteria for the ce - labeling of in vitro diagnostics in norm iso 13485 were fulfilled . each dot represents the endpoint titer of a single serum ( n = 38 ) . dner = delta / notch - like epidermal growth factor - related receptor . in neutralization experiments , lysates from hek293-dner and purified dner(ec ) abolished anti - dner reactivities of human sera with recombinant cells and the corresponding anti - tr reactivity on monkey cerebellum in a dose - dependent manner ( figure 1c ) . in contrast , similar fractions of hek293 cells expressing cdr2/yo , mock - transfected hek293 , and the purified extracellular domain of desmoglein 3 did not affect anti - dner or the anti - tr reactivities . we report on the first well - standardized rc - ifa , which was developed to determine autoantibodies against tr / dner and then evaluated using samples collected in several european centers . in a blinded study of 245 sera , including a large panel of 38 sera with anti - tr autoantibodies , the new assay yielded 100% sensitivity and specificity with respect to the serologic precharacterization that was performed at the contributing centers . in comparison to the reference procedure , which had to use the elaborate epitope blocking step as a confirmatory measure in many cases our results are in agreement with the initial report on the identification of dner as the target antigen of anti - tr antibodies and a subsequent independent confirmation study that used in - house rc - ifas and significantly smaller sample cohorts . rca - ifa has already been shown to be a suitable method to sensitively and specifically detect other anti - neural surface autoantibodies such as anti - nmda receptor or anti - aquaporin-4 . likewise , although intracellularly expressed , hek293 cells expressing cdr2/yo or cdr2l are apparently competent substrates for detecting autoantibodies against cdr2/yo . all in all , recombinant cell substrates complement or even improve indirect immunofluorescence for the detection of paraneoplastic anti - neural autoantibodies for which cryosections of mammalian cerebellum are classically used . by specific neutralization of the autoantibody reactions with recombinant full - length dner expressed in hek293 , on the one hand , and the anti - tr pattern on cerebellum using dner(ec ) , we confirmed the earlier report on the exclusive presence of relevant epitopes in the extracellular domain of dner . we also demonstrated that the recombinant dner(ec ) construct is a fully competent antigen that may help in the development of a microplate elisa or dot / lineblot for integration with other paraneoplastic neurologic syndrome markers such as hu , yo , ri , and cv2 . as a rule , adult patients with subacute - onset cerebellar ataxia should be tested for anti - dner and the other well - characterized onconeural antibodies . first , an immunohistochemical screening can be performed using cryosections of cerebellum and then be confirmed in anti - dner rc - ifa when the anti - tr staining pattern is observed or suspected . alternatively , direct screening can be performed using the anti - dner rc - ifa ; if the results are equivocal or the clinical data are highly suggestive , an additional immunohistochemistry could be performed as well . it is most preferable , however , to determine the autoantibodies by using a multiparametric approach using mosaics of tissue and recombinant cells , similar to the approach used in this study . symptomatology - driven sets of test substrates can be assembled , and a broad spectrum of anti - neural autoantibodies can be tested for simultaneously . , w. schlumberger , w. stcker , and p.a.e.s.s . were involved in the conception and organization of the research project and in the writing of the manuscript . m. van coevorden - hameete , v. rogemond , j. honnorat , and l. sabater report no disclosure . f. graus is on the editorial board for lancet neurology and has received research support from fondo investigaciones santitarias . b. wildemann has received travel funding and speaker honoraria from bayer healthcare , biogen idec , merck serono , teva , and sanofi - aventis / genzyme and has received research support from biogen idec , merck serono , teva , novartis , biotest , dietmar - hopp - foundation , and german ministry for education and research . w. stcker holds patents for alibrationsstreifen fr einen immunoblot , vorrichtung und verfahren zur automatischen fokussierung fr die mikroskopie schwach leuchtender substrate , verfahren zum spezifischen und quantitativen nachweis von antikrpern in einer probe , zum nachweis von anti - nmda - rezeptor - autoantikrpern zum einsatz in diagnoseverfahren , verfahren und vorrichtung zur bearbeitung von proben biologischen materials , diagnosekit sowie verfahren zur untersuchung einer menschlichen patientenprobe auf das vorhandensein neuromyelitis - optica - spezifischen antikrpern , testkit fr die labordiagnostik , vorrichtung zur steuerung einer pipettiervorrichtung , verfahren und analysevorrichtung zur mikroskopischen untersuchung eines gewebeschnittes oder eines zellausstriches , and verfahren sowie vorrichtung zur inkubation von patentientenproben ; is the head of the board for euroimmun medizinische labordiagnostika ag ; is employed by klinisch - immunologisches ; and holds stock in euroimmun medizinische labordiagnostika ag .

objective : to determine sensitivity and specificity of a standardized recombinant cell - based indirect immunofluorescence assay ( rc - ifa ) for anti - tr antibodies in comparison to a reference procedure.methods:delta/notch-like epidermal growth factor - related receptor ( dner ) was expressed in hek293 and used as a substrate for rc - ifa . hek293 control cells expressing cdr2/yo and cdr2l as well as mock - transfected hek293 cells were used as controls . serum samples from 38 patients with anti - tr antibodies ( 33 with paraneoplastic cerebellar degeneration [ pcd ] and hodgkin lymphoma ) , 66 patients with anti - tr negative pcd , 53 patients with hodgkin lymphoma without neurologic symptoms , 40 patients with rheumatic diseases , and 42 healthy blood donors were tested for anti - dner reactivity in the rc - ifa . in addition , rc - ifa results were compared to those from a commercial tissue - based ifa using monkey cerebellum.results:using the rc - ifa , anti - dner was detected in all anti - tr positive patients but in none of the controls ( sensitivity 100% , 95% confidence interval [ ci ] 92.8%100% ; specificity 100% , 95% ci 98.7%100% ) . in comparison , anti - tr was not detected in 4 samples with low - titer autoantibodies using the commercial tissue - based assay . preadsorption of sera with either recombinant full - length dner or its extracellular domain selectively abolished anti - tr reactivity.conclusion:anti-tr antibodies bind to the extracellular domain of dner and can be detected by rc - ifa using hek293 cells expressing the recombinant receptor . the new method performs better than a frequently used commercial tissue - based indirect immunofluorescence assay ( ifa ) in samples with low - titer antibodies.classification of evidence : this study provides class ii evidence that rc - ifa accurately detects anti - tr as compared to conventional ifa .

Classification of evidence: METHODS Human sera. Standard protocol approvals, registrations, and patient consents. Cloning and expression of DNER in HEK293. Detection of anti-DNER antibodies by indirect immunofluorescence. Purification of recombinant human DNER(ec) from HEK293 cells. Miscellaneous. RESULTS Determination of anti-DNER by indirect immunofluorescence. DISCUSSION AUTHOR CONTRIBUTIONS STUDY FUNDING DISCLOSURE

the lens of the eye is recognized as one of the most radio - sensitive tissues in the human body , and radiation - induced cataract is a well - known adverse effect . from a review of epidemiologic data , the threshold dose for cataract formation may be judged to be 0.5 gy [ 1 , 2 ] . a recent draft report by the international commission on radiological protection ( icrp ) documented that better techniques for detecting , quantifying and documenting early radiation - associated lens changes , as well as better dosimetry , have potentially contributed to recent findings of radiation cataract risk at lower exposure levels than previously considered . for occupational exposure , a new icrp positional statement recommended that an equivalent dose limit for the lens be reduced from 150 msv / year to 20 msv / year , averaged over defined periods of 5 years , with no single year exceeding 50 msv . the cross - sectional data from astronauts and matched subjects found using an automated anterior eye segment analysis system ( eas-1000 , nidek , aichi , japan ) were analyzed and revealed a small deleterious effect of space radiation for cortical cataracts and possibly for psc cataracts . we hypothesized that interventional radiologists ( irs ) are exposed to low - dose scattered radiation , which may cause radiation - related lens changes well before they would otherwise be appreciated by slit - lamp examination , and may therefore be picked up by directed objective scoring systems [ 5 , 6 ] . even recent studies [ 7 , 8 ] lack quantitative assessment of radiation - induced lens changes utilizing the metric variable of light scattering intensities ( lsis ) . we and others believe that lsis represent focal aggregated proteins that form from various effects , such as radiation exposure , and that an increase in lsis might be predictive of cataract formation [ 9 , 10 ] . to evaluate minimal lsi changes in specific regions in the lens of the eye , we carried out a pilot study on our described exposed subjects and unexposed subjects using eas-1000 . following institutional review board ( irb ) approval , written informed consent was obtained from all participants . all exposed subjects were japanese volunteer male irs in the japanese society of interventional radiology ( jsir ) , and all unexposed subjects were japanese volunteer male employees of medical service companies with no history of occupational radiation exposure . exposed subjects ' examinations were conducted during the annual jsir meeting in osaka , japan , on 1819 may 2006 , and unexposed subjects ' examinations took place in tokyo , japan , 31 may and 1 june 2007 . examiners were aware of the status of the two groups , specifically whether they were exposed or unexposed subjects . eye examinations were performed following a health survey questionnaire inquiring about eye health , general medical health and lifestyle . questions included age , radiation exposure in interventional procedures ( yes / no ) , smoking ( smoking index = cigarettes smoked per day years of smoking ) , drinking ( ever / never ) , wearing glasses ( ever / never ) and solar ultraviolet ray exposure during working hours ( working indoors only , versus working both indoors and outdoors ) . for the exposed subjects of irs the survey also included a self - report of professional experience as an ir . a team of ophthalmologists performed all initial examinations . to screen suitable subjects for pharmacologic mydriasis , an ophthalmologist performed an initial screening slit - lamp examination ( slit lamp bq 900 haag - streit , koeniz , switzerland ) of the left eye anterior eye segment , in addition to intraocular pressure measurement ( non - contact totometer nt-4000 , nidek , aichi , japan ) . one hundred and sixty exposed subjects and 326 unexposed subjects were included following screening and mydriasis safety assessment , and subsequently underwent examination of the left eye with pharmacologic pupillary dilation using a drop of midrin - p ( tropicamide and phenylephrine ; santen pharmaceuticals , japan ) . because the examinations were performed in the daytime while exposed subjects were attending their annual professional society meeting , and during the daytime while the unexposed subjects were also working , only single eye pharmacologic dilations were performed . therefore only examination of the left eye was conducted . the left side was specifically chosen since the ir 's left eye is closer than the right eye to the x - ray tube in the vast majority of instances . in addition a recent study showed that the dose on the side nearest to the x - ray tube was three to five times greater than for the farthest side of the head . for all qualified subjects the lens of the left eye was examined with scheimpflug slit images obtained using eas-1000 , with a representative slit image shown in fig . 1 . scheimpflug photography and densitometric image analysis are techniques applied to light scattering measurement and biometry in the anterior eye segment . they reproducibly characterize the anterior eye and allow discrimination of minimal light scattering changes , using a grading system from otherwise aging , disease or toxic effects . these tools help quantify threshold levels or maximum allowable dosages of physical and chemical noxious factors , which are causative or associative with opacifying ocular pathologies . therefore , most epidemiological studies dealing with ocular pathologies in the lens use either cataract scoring or the scheimpflug technique . fig . 1.scheimpflug slit image obtained using an anterior eye segment analysis system digitalized anterior eye segment image is demonstrated at a mid - sagittal section , the front of the cornea is at the top of the image . the seven numbers depicted on the axis sequentially indicate the cornea ( 1 ) , anterior capsule ( 2 ) , most transparent layer of the anterior superficial cortex ( 3 ) , anterior adult nucleus ( 4 ) , anterior fetal nucleus ( 5 ) , central clear zone ( 6 ) and posterior subcapsular region ( 7 ) . the peak light scattering intensity for each segment is demonstrated to the right of each respective layer . scheimpflug slit image obtained using an anterior eye segment analysis system digitalized anterior eye segment image is demonstrated at a mid - sagittal section , the front of the cornea is at the top of the image . the seven numbers depicted on the axis sequentially indicate the cornea ( 1 ) , anterior capsule ( 2 ) , most transparent layer of the anterior superficial cortex ( 3 ) , anterior adult nucleus ( 4 ) , anterior fetal nucleus ( 5 ) , central clear zone ( 6 ) and posterior subcapsular region ( 7 ) . the peak light scattering intensity for each segment is demonstrated to the right of each respective layer . one experienced technician performed all examinations using the eas-1000 . the highest quality scheimpflug photograph obtained in one session was recorded , and quantitative analysis of the crystalline lens lsis was provided and saved as an 8-bit digital value . the data of exposed and unexposed subjects were analyzed at the same time , although the technologist was not blinded to the condition of exposure status . the peak lsi value was measured in each of the six layers of the lens automatically and measured points were confirmed manually . these six layers included the anterior capsule , the most transparent layer of the anterior superficial cortex , the anterior adult nucleus , the anterior fetal nucleus , the central clear zone and the posterior subcapsular region ( psr ) ( fig . subjects with cataract risk factors other than occupational radiation exposure were excluded from analysis to increase the comparability of the groups and reduce the influence of group bias risk . such other factors included a history of diabetes mellitus ( exposed subjects n= 4 ; unexposed subjects n= 6 ) , eye trauma ( exposed subjects n= 0 ; unexposed subjects n= 1 ) , ophthalmic surgery ( exposed subjects n= 1 ; unexposed subjects n= 4 ) and ocular inflammation ( exposed subjects n= 0 ; unexposed subjects n= 2 ) . subjects with uncorrectable factors causing poor - quality photographs on the eas-1000 were also excluded ( exposed subjects n= 15 ; unexposed subjects n= 35 ) . poor photographic factors included insufficient pupillary dilation ( exposed subjects n= 44 ; unexposed subjects n= 62 ) , congenital cataracts ( exposed subjects n= 5 ; unexposed subjects n= 9 ) , excessive myopia by a spherical equivalent ( se ) of less than 6.00 diopters ( exposed subjects n= 31 ; unexposed subjects n= 61 ) , excessive hypermetropia by an se larger than 5.25 diopters ( exposed subjects and unexposed subjects n= 0 ) , ocular hypertension ( tonometer pressure > 20 mmhg ) ( exposed subjects n= 8 ; unexposed subjects n= 7 ) , corneal abnormalities ( exposed subjects n= 2 ; unexposed subjects n= 15 ) and miscellaneous contributory congenital ocular abnormalities ( exposed subjects n= 4 ; unexposed subjects n= 7 ) . subjects with an insufficient number of lens images to permit proper tabulation were also excluded . after consideration of the above exclusion criteria , 92 of the 160 exposed subjects and 155 of the 326 unexposed subjects were excluded . in the final count , many excluded subjects had more than one exclusion criterion . the eligible population for quantitative analyses consisted of 68 exposed subjects and 171 unexposed subjects . none of the selected subjects had any visual complaints or any subjective decrease in visual acuity . age - related increases in lsis have been demonstrated in prior investigations as a physiological change . to reduce the effect of aging , the eligible subjects were matched and selected with a chosen ratio of one ir to two randomly selected unexposed subjects within 1-year difference . the age - matched group consisted of 54 exposed subjects and 108 unexposed subjects . for intergroup comparison , student 's t - test was performed for descriptive characteristics and light scattering intensity in the six lens layers . multiple regression analyses were carried out using the stepwise method to evaluate lsis in the six layers of the left lens adjusting for age , smoking , drinking , wearing glasses , sunlight exposure during working hours and scattered radiation exposure during working hours . the selected variables were evaluated with an automatic model selection procedure using a sequence of f - tests in the stepwise method ( the pvalue for additional variables was 0.25 and for removal of variables was 0.10 ) . comparison of the average lsis between the age - matched groups was performing using analysis of variance ( anova ) . following institutional review board ( irb ) approval , written informed consent was obtained from all participants . all exposed subjects were japanese volunteer male irs in the japanese society of interventional radiology ( jsir ) , and all unexposed subjects were japanese volunteer male employees of medical service companies with no history of occupational radiation exposure . exposed subjects ' examinations were conducted during the annual jsir meeting in osaka , japan , on 1819 may 2006 , and unexposed subjects ' examinations took place in tokyo , japan , 31 may and 1 june 2007 . examiners were aware of the status of the two groups , specifically whether they were exposed or unexposed subjects . eye examinations were performed following a health survey questionnaire inquiring about eye health , general medical health and lifestyle . questions included age , radiation exposure in interventional procedures ( yes / no ) , smoking ( smoking index = cigarettes smoked per day years of smoking ) , drinking ( ever / never ) , wearing glasses ( ever / never ) and solar ultraviolet ray exposure during working hours ( working indoors only , versus working both indoors and outdoors ) . for the exposed subjects of irs the survey also included a self - report of professional experience as an ir . a team of ophthalmologists performed all initial examinations . to screen suitable subjects for pharmacologic mydriasis , an ophthalmologist performed an initial screening slit - lamp examination ( slit lamp bq 900 haag - streit , koeniz , switzerland ) of the left eye anterior eye segment , in addition to intraocular pressure measurement ( non - contact totometer nt-4000 , nidek , aichi , japan ) . one hundred and sixty exposed subjects and 326 unexposed subjects were included following screening and mydriasis safety assessment , and subsequently underwent examination of the left eye with pharmacologic pupillary dilation using a drop of midrin - p ( tropicamide and phenylephrine ; santen pharmaceuticals , japan ) . because the examinations were performed in the daytime while exposed subjects were attending their annual professional society meeting , and during the daytime while the unexposed subjects were also working , only single eye pharmacologic dilations were performed . therefore only examination of the left eye was conducted . the left side was specifically chosen since the ir 's left eye is closer than the right eye to the x - ray tube in the vast majority of instances . in addition a recent study showed that the dose on the side nearest to the x - ray tube was three to five times greater than for the farthest side of the head . for all qualified subjects the lens of the left eye was examined with scheimpflug slit images obtained using eas-1000 , with a representative slit image shown in fig . 1 . scheimpflug photography and densitometric image analysis are techniques applied to light scattering measurement and biometry in the anterior eye segment . they reproducibly characterize the anterior eye and allow discrimination of minimal light scattering changes , using a grading system from otherwise aging , disease or toxic effects . these tools help quantify threshold levels or maximum allowable dosages of physical and chemical noxious factors , which are causative or associative with opacifying ocular pathologies . therefore , most epidemiological studies dealing with ocular pathologies in the lens use either cataract scoring or the scheimpflug technique . fig . 1.scheimpflug slit image obtained using an anterior eye segment analysis system digitalized anterior eye segment image is demonstrated at a mid - sagittal section , the front of the cornea is at the top of the image . the seven numbers depicted on the axis sequentially indicate the cornea ( 1 ) , anterior capsule ( 2 ) , most transparent layer of the anterior superficial cortex ( 3 ) , anterior adult nucleus ( 4 ) , anterior fetal nucleus ( 5 ) , central clear zone ( 6 ) and posterior subcapsular region ( 7 ) . the peak light scattering intensity for each segment is demonstrated to the right of each respective layer . scheimpflug slit image obtained using an anterior eye segment analysis system digitalized anterior eye segment image is demonstrated at a mid - sagittal section , the front of the cornea is at the top of the image . the seven numbers depicted on the axis sequentially indicate the cornea ( 1 ) , anterior capsule ( 2 ) , most transparent layer of the anterior superficial cortex ( 3 ) , anterior adult nucleus ( 4 ) , anterior fetal nucleus ( 5 ) , central clear zone ( 6 ) and posterior subcapsular region ( 7 ) . the peak light scattering intensity for each segment is demonstrated to the right of each respective layer . one experienced technician performed all examinations using the eas-1000 . the highest quality scheimpflug photograph obtained in one session was recorded , and quantitative analysis of the crystalline lens lsis was provided and saved as an 8-bit digital value . the data of exposed and unexposed subjects were analyzed at the same time , although the technologist was not blinded to the condition of exposure status . the peak lsi value was measured in each of the six layers of the lens automatically and measured points were confirmed manually . these six layers included the anterior capsule , the most transparent layer of the anterior superficial cortex , the anterior adult nucleus , the anterior fetal nucleus , the central clear zone and the posterior subcapsular region ( psr ) ( fig . subjects with cataract risk factors other than occupational radiation exposure were excluded from analysis to increase the comparability of the groups and reduce the influence of group bias risk . such other factors included a history of diabetes mellitus ( exposed subjects n= 4 ; unexposed subjects n= 6 ) , eye trauma ( exposed subjects n= 0 ; unexposed subjects n= 1 ) , ophthalmic surgery ( exposed subjects n= 1 ; unexposed subjects n= 4 ) and ocular inflammation ( exposed subjects n= 0 ; unexposed subjects n= 2 ) . subjects with uncorrectable factors causing poor - quality photographs on the eas-1000 were also excluded ( exposed subjects n= 15 ; unexposed subjects n= 35 ) . poor photographic factors included insufficient pupillary dilation ( exposed subjects n= 44 ; unexposed subjects n= 62 ) , congenital cataracts ( exposed subjects n= 5 ; unexposed subjects n= 9 ) , excessive myopia by a spherical equivalent ( se ) of less than 6.00 diopters ( exposed subjects n= 31 ; unexposed subjects n= 61 ) , excessive hypermetropia by an se larger than 5.25 diopters ( exposed subjects and unexposed subjects n= 0 ) , ocular hypertension ( tonometer pressure > 20 mmhg ) ( exposed subjects n= 8 ; unexposed subjects n= 7 ) , corneal abnormalities ( exposed subjects n= 2 ; unexposed subjects n= 15 ) and miscellaneous contributory congenital ocular abnormalities ( exposed subjects n= 4 ; unexposed subjects n= 7 ) . subjects with an insufficient number of lens images to permit proper tabulation were also excluded . after consideration of the above exclusion criteria , 92 of the 160 exposed subjects and 155 of the 326 unexposed subjects were excluded . in the final count , many excluded subjects had more than one exclusion criterion . the eligible population for quantitative analyses consisted of 68 exposed subjects and 171 unexposed subjects . none of the selected subjects had any visual complaints or any subjective decrease in visual acuity . age - related increases in lsis have been demonstrated in prior investigations as a physiological change . to reduce the effect of aging , the eligible subjects were matched and selected with a chosen ratio of one ir to two randomly selected unexposed subjects within 1-year difference . for intergroup comparison , student 's t - test was performed for descriptive characteristics and light scattering intensity in the six lens layers . multiple regression analyses were carried out using the stepwise method to evaluate lsis in the six layers of the left lens adjusting for age , smoking , drinking , wearing glasses , sunlight exposure during working hours and scattered radiation exposure during working hours . the selected variables were evaluated with an automatic model selection procedure using a sequence of f - tests in the stepwise method ( the pvalue for additional variables was 0.25 and for removal of variables was 0.10 ) . comparison of the average lsis between the age - matched groups was performing using analysis of variance ( anova ) . in the screening examination for all subjects without exclusion , slit - lamp examination of the left eye under pupillary dilation showed posterior subcapsular cataract ( psc ) in three ( 1.9% ) of 160 exposed subjects ( 45 , 62 and 63 years ) and one ( 0.3% ) of 326 unexposed subjects ( 51 years ) . one exposed subject showed a dense patchy opacity and two showed vacuoles in the psr on retroillumination images . all four subjects were excluded from quantitative analyses because they met other predetermined exclusion criteria ( two had excessive myopia and one had poor pupillary dilation in the exposed subjects , and one had excessive myopia in the unexposed subjects ) . 8539.8 690.0059smoking ( yes ) , n(%)40 ( 58.8)115 ( 67.2)0.180smoking index1770 28.5211.7 18.00.06drinking ( yes ) , n(%)53 ( 77.9)147 ( 85.9)0.080wearing glasses ( yes ) , n(%)54 ( 79.4)120 ( 70.5)0.101workplace ( indoors only ) , n(%)68 ( 100)82 ( 48.0)<0.0001years of interventional experience,15.6 7.8na median ( minimum maximum)14 ( 132)total number of angiographies,1846.1 1998.6na median ( minimum maximum)1500 ( 010 000)total number of interventions,1982.3 2056.5na median ( minimum maximum)1200 ( 1012 000)irs = interventional radiologists , values are means sd , na = not applicable . descriptive characteristics of the study subjects who met the eligibility criteria irs = interventional radiologists , values are means sd , na = not applicable . the characteristics of the study subjects for quantitative analysis are shown in table 1 . there was a significant difference in the ages of the two groups , with the exposed subjects showing a greater age than the unexposed subjects . there were significant differences in the lsis in five out of six eye layers when comparing exposed subjects with the unexposed subjects . table 2.light scattering intensity in the six lens layers between exposed and unexposed group ( 8-bit grayscale value)layer of lensirscontrolspvalue(n= 68)(n= 171)anterior capsule63.0 7.860.3 7.90.020most transparent layer of the anterior superficial cortex41.1 8.339.5 7.70.157anterior adult nucleus96.6 33.081.3 25.50.0002anterior fetal nucleus50.7 11.547.4 10.90.039central clear zone38.3 9.635.3 8.40.018posterior subcapsular region39.7 light scattering intensity in the six lens layers between exposed and unexposed group ( 8-bit grayscale value ) values are means sd . the results of the stepwise method for lsi assessment in each of the six layers of the eye lens are shown in table 3 . in all six layers of the eye lens , the variable of age was statistically significant for increased lsis . in the layer of the central clear zone , smoking was also significant for increased lsis ( p= 0.002 ) . in the psr , radiation exposure from interventional procedures was significant ( p= 0.012 ) for increased lsis following adjustment for the other variables including age . table 3.evaluation of light scattering intensity in the six lens layers by multiple regression analysis using the stepwise method in all subjects ( n= 239)layer of lensvariableparameter estimate ( 95% ci)pvalueanterior capsuleage0.691 ( 0.6160.766)<0.0001most transparent layer of the anterior superficial cortexage0.153 ( 0.0350.270)0.011workplace0.580 ( 0.2911.452)0.191smoking0.003 ( 0.0070.001)0.094anterior adult nucleusradiation exposure2.307 ( 0.6205.233)0.122age2.644 ( 2.2882.999)<0.0001work place1.793 ( 0.9104.496)0.192anterior fetal nucleusage1.405 ( 1.2351.574)<0.0001smoking0.003 ( 0.0020.008)0.290wearing glasses1.072 ( 2.7850.641)0.219central clear zoneage1.132 ( 1.0571.207)<0.0001smoking0.004 ( 0.0010.006)0.002posterior subcapsular regionradiation exposure2.089 ( 0.4663.711)0.012age0.307 ( 0.528 to 0.086)0.007smoking0.004 ( 0.0100.003)0.277wearing glasses0.925 ( 0.7352.586)0.273ci = confidence interval . evaluation of light scattering intensity in the six lens layers by multiple regression analysis using the stepwise method in all subjects ( n= 239 ) ci = confidence interval . the mean age standard deviation ( sd ) of age - matched exposed subjects and unexposed subjects were 39.5 6.9 and 39.4 6.9 , respectively . in the age - matched comparison , there was a significant difference in lsis in the psr ( table 4 ) . table 4.evaluation of light scattering intensity in the six layers between exposed and unexposed group by age - matched comparison ( 8-bit grayscale value)layer of lensirscontrolspvalue(n= 54)(n= 108)anterior capsule61.3 7.359.4 7.30.10most transparent layer of the anterior superficial cortex41.1 8.838.7 7.60.07anterior adult nucleus87.6 26.982.2 26.90.23anterior fetal nucleus47.7 10.347.2 11.10.80central clear zone35.6 8.435.1 8.60.75posterior subcapsular region40.5 13.434.5 7.20.0031values are means sd . evaluation of light scattering intensity in the six layers between exposed and unexposed group by age - matched comparison ( 8-bit grayscale value ) values are means sd . lens opacities were classified into three types according to their anatomical location : cortical region , nucleus and psr . it has been demonstrated that high - dose ionizing radiation primarily associated with psc can also induce cortical cataract formation [ 12 , 13 ] . in the widely used grading system for radiation - induced cataracts by slit - lamp examination , the early stage of psc shows a lens change consisting of the formation of small dots and vacuoles . in a cross - sectional study in interventional cardiologists , pscs were significantly more frequent among interventional cardiologists than the control subjects . the increased lsis in exposed subjects compared with unexposed subjects analyzed by multiple regression analysis and age - matched comparison suggest a potential adverse effect on the lens with low - dose radiation exposure . in spite of the minimal increased lsis , the functional effect of these increased lsis on visual acuity and undesirable risk is unclear . this phenomenon may be a predictor of a primary effect of low - dose radiation on the eye . smoking is independently recognized to correlate with a higher risk of incident nuclear cataract development . our findings regarding smoking reinforce previous studies and suggest that the increase in lsis in the central clear zone may be an early sign of nuclear cataracts . in our study , the variable of age was significant for lsis in all six layers of the eye lens . we performed multiple regression analyses including exposed subjects and unexposed subjects to adjusting the variables . other factors such as ultraviolet light exposure , diabetes , renal failure , drug intake and malnutrition also individually and collectively contribute over time to further increase light scattering and can not be readily separated from aging . lsis in the six layers of the lens increase in the anterior five layers and decrease in the psr in a linear manner with aging . this decrease in apparent lsis in the psr over time is likely related to age - related reduction in lens transparency . in the exposed subjects , therefore radiation exposure shows a positive relation to lsis in the psr . in the most transparent layer of the anterior superficial cortex , lsis did not show a significant difference between irs and controls , and the parameter estimate of age was relative lower than for the other layers . this may be related to the fact that the age - related cortical cataract began on the outer edge of the lens cortex and slowly extended to the center . regarding ir dose , the average lens dose received by japanese radiologists measured by thermoluminescent dosimeters ( tlds ) during hepatocellular carcinoma embolization has been calculated at an average dose per procedure of approximately 0.04 msv . the average estimated cumulative dose in exposed subjects was 79.3 msv ( mean number of interventional procedure = 1982.3 ) . the estimated annual dose was 5.1 msv ( mean annual number of interventional procedure = 127.1 ) . a multi - center study with continuous 2-month dose readings demonstrated extrapolated annual radiation doses at the collar badge of 48 msv in the mean annual number of interventional procedure of 972 . the estimated average lens dose in interventional cardiologists with estimated cumulative occupational dose considering eye protection was 6.0 6.6 sv ( 0.127 sv ) and 3.7 7.5 gy ( 0.0243 gy ) [ 7 , 8 ] . it is estimated that the lens dose of exposed subjects in our study is lower than that of previous reports . in our screening examination , the detection rate of the psc in the exposed subjects is 1.9% , considerably lower than the 38% and 52% reported in interventional cardiologists [ 7 , 8 ] . this lower incidence of psc may also be a collateral finding of lower radiation exposure . lens dosimetry was not performed in this retrospective study since two categories of information were unavailable ; first , collar - badge readings were not uniformly available for all practitioners and second , existing under - apron individual monitoring data were unreliable due to inconstant usage of personal dosimeter , employment changes and also the fact that full versus part - time employment was not noted , neither was individual positioning and wearing of protection devices . due to the aforementioned challenges , we chose not to include estimated lens dose , which can not be considered in such circumstances as objectively quantifiable , and we therefore chose to simply register presence or absence of radiation exposure status ( yes or no ) as the categorical variable . individual dosimetry remains problematic , and alternative strategies will be needed in order to more precisely evaluate the effects of radiation in specific occupational situations , since strict individual monitoring and strategic management will be necessary . one of the largest study limitations is our choice of a single left - eye examination for the purposes of this study ; the laterality of lsis of the lens could not be assessed . in the oramed ( optimization of radiation protection for medical staff ) project , the dosimeter on the near side eye to the x - ray tube showed a higher dose than the dosimeter in the region between the eyes . and , in the study of dose distribution with ten tlds on the eyebrow ridge , the dose on the side nearest to the x - ray tube was three to five times greater than those on the farthest side . it was recommended that dosimeters for the monitoring of eye dosage should be positioned on the side of the brow ridge adjacent to the x - ray tube . because the majority of exposed subjects were primarily abdominal oncologic vascular interventionalists and the physician 's left eye was commonly closer to the x - ray tube , we believed that the left - sided eye examination in this study was more likely to evaluate the side with the highest exposure . further study is required that includes lens dosimetry and evaluation of lsis on each side . our study limitations include our group choices for exposed subjects and unexposed subjects ; a more comparable control group may have been physicians without radiation exposure . similarly , we had numerous exclusion criteria that were only answered and served as exclusions following initial screening ophthalmologic examination . we felt that rigid adherence to the exclusionary criteria was necessary for the purposes of data integrity , although it resulted in a large number of exclusions reducing the sample size . the questionnaire was also imperfect ; unfortunately questions regarding any medical history of ionizing radiation exposure to the head and neck , such as head computed tomography , were not included . our single meridian cross - sectional analyses by eas-1000 were performed in the mid - sagittal plane of the eye lens , therefore , there were no data obtained for off - center , off - angle and off - axis portions of the lens . as has been previously reported with the eas-1000 , the correlation coefficient in scatter light intensity measurement as measured over a 2-week interval may be greater than or equal to r= 0.9 , additionally interoperator measurement error has previously been measured to range from 8 to 10% . in order to confirm the reproducibility of the eas-1000 , mean individual coefficient of variation was segmentally measured in four different lens regions with a 1-week interval in measurements , and the variation was measured as between 3.6 and 5.1% , in keeping with the previously described examination . as previously alluded to , a potential limitation of our study is also that the technologist was unblinded , although the automated nature of the lsi measurements for data collection , and the reliable proscriptive nature of mid - sagittal plane selection , suggests this is an unlikely cause for concern . in conclusion , we found that there were minimal increased lsis in the psr of the lens in exposed subjects as compared with the unexposed subjects in this pilot study . such findings will need to be longitudinally followed to establish their predictive value as far as cataractogenesis is concerned . further quantitative studies concerning minimal radiation - related lens changes may additionally be required especially in low - dose exposure groups .

to evaluate low - dose x - ray radiation effects on the eye by measuring the amount of light scattering in specific regions of the lens , we compared exposed subjects ( interventional radiologists ) with unexposed subjects ( employees of medical service companies ) , as a pilot study . according to numerous exclusionary rules , subjects with confounding variables contributing to cataract formation were excluded . left eye examinations were performed on 68 exposed subjects and 171 unexposed subjects . the eye examinations consisted of an initial screening examination , followed by scheimpflug imaging of the lens using an anterior eye segment analysis system . the subjects were assessed for the quantity of light scattering intensities found in each of the six layers of the lens . multiple stepwise regression analyses were performed with the stepwise regression for six variables : age , radiation exposure , smoking , drinking , wearing glasses and workplace . in addition , an age - matched comparison between exposed and unexposed subjects was performed . minimal increased light scattering intensity in the posterior subcapsular region showed statistical significance . our results indicate that occupational radiation exposure in interventional radiologists may affect the posterior subcapsular region of the lens . since by its very nature this retrospective study had many limitations , further well - designed studies concerning minimal radiation - related lens changes should be carried out in a low - dose exposure group .

INTRODUCTION MATERIALS AND METHODS Screening examination and subjects Quantitative analyses Selection of subjects Statistical analysis RESULTS DISCUSSION

it consists of cystic dilatation of the extrahepatic biliary tree , intrahepatic biliary radicles or both . some aspects are consistent with congenital etiology and others with congenital predisposition to acquire the disease under conditions like anomalous pancreatobiliary junction with subsequent reflux cause . in support of congenital cause , defects in epithelization , recanalization of the developing bile ducts during organogenesis and congenital weakness of the duct wall are implicated . a 47-day - old female infant with jaundice from leh , india , was referred for a tc-99 m hida scan to rule out extrahepatic biliary atresia ( ehba ) . there was no history of direct or indirect trauma . on day 2 of life , the child developed fever and had a seizure . over the next few days , she started having jaundice , distension of the abdomen , acholic stools and was found to be anemic . the child was treated as a case of abo incompatibility with phototherapy in view of mother 's blood group o and baby 's b. subsequent laboratory examination revealed conjugated hyperbilirubinemia ( total 6.8 mg% , conjugated 5.4 mg% ) . first ultrasound ( usg ) on 12.08.10 revealed ? portal venous thrombosis with cirrhosis , ascites and mass in relation to segment vi of the liver . repeat usg on 03.09.10 showed cystic lesion in the region of porta hepatis with diagnosis of choledochal cyst and differential diagnosis of enteric duplication cyst . the child was treated with antibiotics and therapeutic ascitic fluid tap due to respiratory distress . tc-99 m hida scan was ordered to rule out ehba , which showed adequate tracer uptake by the liver in 5 min . a photopenic area appeared at porta hepatis which subsequently accumulated and held the activity [ figure 1 ] . delayed imaging at 2 h showed slowly rising activity in the ascitic fluid [ figure 2 ] . immediate laparotomy was done and the leak was identified in a fusiform dilatation of the extrahepatic biliary duct with gall bladder opening into it ( type i ) . the child recovered from the sepsis with biliary diversion and antibiotics , and was planned for definitive surgery . choledochal cyst rupture is managed with major excision reconstruction procedure unlike spontaneous perforation of the extrahepatic bile duct which is managed by temporary tube cholecystectomy or subhepatic drainage till subsidence of the biliary leak . initial composit dynamic images showing adequtae tracer uptake by liver at 05 min and filling up of the choledochal cyst by radiotracer delayed images at 01hr and 02hrs showing the persistent radiotracer activity in the choledochal cyst and increasing activity in the ascitic fluid . another adjacent focus of increased radiotracer activity is intrahepatic ductal pooling incidence of the choledochal cyst is very low ( 1/100,000150,000 live births ) , but now with the improved diagnostic techniques it is diagnosed more frequently . about 80% of the cysts become symptomatic early and are diagnosed before the age of 10 years . biliary peritonitis secondary to cyst perforation or rupture is a rare complication reported to occur in 12% cases of choledochal cyst , compared to other complications like cholangitis , cirrhosis , portal hypertension , hepaticocholedochal lithiasis , liver abscess , etc . it is important to differentiate a spontaneous perforation of choledochal cyst from spontaneous perforation of the extrahepatic bile duct a classic entity which is more common and occurring exclusively in infants below 20 weeks of age . choledochal cysts must be differentiated from cysts in other nearby organs , including cystic lesions of the kidney ( renal cyst , hydronephrosis and wilm 's tumor ) , pancreas ( pseudocyst ) , or duodenum ( diverticulum ) , etc . usg / computed tomography ( ct ) scan is used to demonstrate choledochal cyst , and tc-99 m hida and magnetic resonance cholangiopancreatography ( mrcp ) for increasing the accuracy . percutaneous transhepatic cholangiography ( ptc ) , endoscopic retrograde cholangiopancreatography , oral and iv cholecystography are the other diagnostic tests . once a cyst is identified with one of the imaging modalities , cholescintigraphy confirms the diagnosis . usually there is no need for pre - treatment with phenobarbitone , unless the child is severely jaundiced . delayed filling of abnormal biliary tree with activity persisting in the cyst on delayed images is diagnostic of a choledochal cyst . postoperative scan can also be used to check the patency of the anastomosis or to detect any leak . in conclusion , m hida scan is used to increase the accuracy of the diagnosis and can provide additional vital information influencing the management . once a cyst is identified with one of the imaging modalities , cholescintigraphy confirms the diagnosis . usually there is no need for pre - treatment with phenobarbitone , unless the child is severely jaundiced . delayed filling of abnormal biliary tree with activity persisting in the cyst on delayed images is diagnostic of a choledochal cyst . postoperative scan can also be used to check the patency of the anastomosis or to detect any leak . in conclusion , tc-99 m hida scan is used to increase the accuracy of the diagnosis and can provide additional vital information influencing the management .

a 47-day - old female infant presented with congenital inguinal hernia , seizure on the 2nd day of life , fever , progressive jaundice , acholic stools and distension of abdomen . she was suspected to have choledochal cyst with extrahepatic biliary atresia ( ehba ) and referred for an hepatobiliary tc-99 m iminodiacetic acid ( hida ) scan . on hida scan , a functional diagnosis of ruptured choledochal cyst was made which was not possible on anatomical imaging like ultrasound ( usg)/computed tomography ( ct ) scan . this was supported thereafter by bilious aspirate on abdominal paracentesis . immediate laparotomy with t - tube insertion was done . the child improved dramatically after the procedure . biliary peritonitis secondary to cyst perforation or rupture is a rare complication reported to occur in 12% cases of choledochal cyst . early diagnosis and management is the key to reduce the morbidity and mortality .

INTRODUCTION CASE REPORT DISCUSSION Tc-99m HIDA scan

cutaneous plasmacytosis ( cp ) is a very rare , recently described entity in world literature . there are < 60 cases reported worldwide , no case reported from india till date . we report a case of primary cp in an adult female with site predilection of apocrine gland - bearing areas which has not been described previously in world literature . a 46-year - old married female presented with asymptomatic , multiple , reddish - brown lesions in axillae , mammary area , lower abdomen , perineum , and upper inner thighs since last 2 years . they started as small pea - sized lesions with a gradual progression in size and number . on general examination cutaneous examination revealed multiple well defined erythematous skin to brown colored succulent - looking papulo - plaque lesions in the above - mentioned sites ranging from 0.5 to 10 cm in diameter [ figure 1 ] . the vulva showed mainly papular lesions with a predominance of plaques in medial thighs which had atrophy as well . initially , a presumptive clinical diagnosis of hidradenitis suppurativa ( hs ) was made observing the distribution areas , and she was put on antibiotics and topical benzoyl peroxide 5% , but the lesions did not show regression . after 2 weeks , she was put on oral isotretinoin 1 mg / kg for a period of further 2 weeks , but still there were no signs of regression in the lesions . moreover , new lesions kept on emerging . hence , a biopsy was performed , and it revealed acanthosis , parakeratosis , mature polyclonal plasma cells with small uniformly sized nuclei present up to the deep dermis and fibrosis [ figure 2 ] . interestingly , the folliculosebaceous apparatus was seen to be uninvolved at places with plasma cell infiltrates in dermis , excluding the diagnosis of hs . ( a - d ) multiple erythematous , red - brown infiltrated plaques distributed in apocrine gland bearing areas but not strictly bilateral . well defined fibrosed plaques seen in upper medial thighs ( a ) perivascular and periadnexal patchy infiltrate of mature typical plasma cells admixed with some lymphocytes and histiocytes ( h and e , 10 ) . ( c ) lambda stain ( immunostain , 10 ) immunohistochemical examination revealed a polyclonal staining pattern with kappa to lambda ratio of 3:1 , with cd138 being positive [ figure 3 ] . serum protein electrophoresis revealed polyclonality with levels of igg as 2300 mg / dl ( reference range 8801800 mg / dl ) , iga as 762 mg / dl ( reference range 126517 mg / dl ) , igm as 486 mg / dl ( reference range 52270 mg / dl ) , and ige as 980 mg / dl ( reference range 0450 mg / dl ) . chest x - ray , ultrasound whole abdomen and pelvis and computed tomography scan did not reveal any significant abnormality . bone marrow examination revealed a normocellular marrow with normal myeloid to erythroid ratio and plasma cells being 4% of marrow cellularity . since no internal organ was involved and also there was no history of any previous cutaneous disease , the final diagnosis was confirmed as primary cp . ( a ) sparing of hair follicle with perifollicular plasmacytic infiltrate ( h and e , 400 ) . ( d ) lambda positivity ( immunostain , 400 ) she was put on prednisolone 40 mg / day and after 8 weeks of treatment , there was moderate effect in that there were no new lesions and size and elevation of old lesions regressed . we have currently put her on monthly follow - up to monitor progression to systemic plasmacytosis ( pc ) , and it has been 1 year now she has not developed systemic involvement . cutaneous and systemic plasmacytosis ( csp ) is a rare disorder with approximately 60 cases being reported worldwide , mostly from japan ; none from the indian subcontinent . it consists of a triad of cutaneous lesions , superficial lymphadenopathy , and polyclonal hypergammaglobulinemia . it was first reported in 1976 , with the first case in english literature being reported by watanabe et al . , in 1986 . cutaneous lesions are characterized by disseminated reddish - brown macules and plaques distributed mainly on the trunk . there may be systemic involvement with hepatosplenomegaly and constitutional symptoms , but the term systemic plasmacytosis is used in such cases . extracutaneous involvement of lymph nodes , lungs , liver and spleen is also seen . among all the systemic sites , histologically , uhara et al . stated that the most characteristic histopathological change in cp is perivascular and periadnexal patchy infiltrate of mature typical plasma cells admixed with some lymphocytes and histiocytes . cutaneous plasma cell infiltration of the skin can be due to various reasons ranging from neoplasms to infections . the differential diagnoses to be considered are malignancies ( cutaneous plasmacytoma , marginal zone b - cell lymphoma , follicle center b - cell lymphoma ) , systemic lupus erythematosus , scleroderma , infections ( bacterial , fungal , mycobacterial , syphilis ) , plasma cell vulvitis , systemic plasmacytosis , nodular amyloidosis , and cutaneous rosai dorfman disease . in this case , hs / acne inversa ( ai ) is an additional diagnosis to be considered . here , although significant fibrosis was present and the igg4 levels were normal , we favor the diagnosis of cp because : absence of ruptured cysts , follicular involvement clinically in this patient , which characterize aiin the vulval area , predominant areas involved were upper medial thighs and not vulva proper . there were erythematous succulent and fibrosed asymmetrical plaques in upper medial thighs , unlike the lesions of ai . also , there was no predominant areolar area involvementthe infiltrate is predominantly non - specific lymphohistiocytic , plasma cells , mononuclear infiltrate , and neutrophilic granulocytes in ai , which is lacking here . no sinus tracts or late apocrine gland involvement absence of ruptured cysts , follicular involvement clinically in this patient , which characterize ai in the vulval area , predominant areas involved were upper medial thighs and not vulva proper . there were erythematous succulent and fibrosed asymmetrical plaques in upper medial thighs , unlike the lesions of ai . also , there was no predominant areolar area involvement the infiltrate is predominantly non - specific lymphohistiocytic , plasma cells , mononuclear infiltrate , and neutrophilic granulocytes in ai , which is lacking here . no sinus tracts or late apocrine gland involvement was seen . basically , the inciting event leading to proliferation of plasma cells has been unknown till date . kodama et al . , detected increase in serum il-6 in systemic plasmacytosis and intralesional injection of corticosteroids has led to decrease in lesions in few patients . we also are of the view that maceration and friction in these areas in predisposed individuals may lead to the development of cp in patients as seen in our patient . uhara et al . , reported that serum immunoglobulin levels more than 5000 mg / dl as well as plasma cell counts in bone marrow more than 6.9% are associated with the more severe clinical course . fatal outcomes are seen with csp , where renal , t - cell lymphoma , or interstitial pneumonia have been the cause of death . regarding treatment options available for cp , psoralen and ultraviolet a , radiotherapy , systemic chemotherapy ( cyclophosphamide , epirubicin , vincristine , and prednisone ) , intralesional steroids have all been tried with variable success rates . recently , topical 5-aminolaevulinic acid photodynamic therapy using long - pulsed ruby laser has been described as a novel treatment option . we present the case due to its rarity and its unique distribution of lesions . moreover , on a closer look , we can appreciate well- to ill - defined plaque lesions which partly involve areola but mainly the peri - areolar skin . similarly , in vulval region , although the lesion distribution simulates hs , these types of lesions are different . hence , a very meticulous observation of the lesions is very important as is very well highlighted in this case . whenever cases of cp are encountered , search for underlying diseases leading to plasma cell infiltration as well as systemic plasmacytosis is warranted . we report the first case from indian region with lesions of cutaneous plasmacytosis masquerading as hidradentis suppurativa , which has not been previously reported . we report the first case from indian region with lesions of cutaneous plasmacytosis masquerading as hidradentis suppurativa , which has not been previously reported . we report the first case from indian region with lesions of cutaneous plasmacytosis masquerading as hidradentis suppurativa , which has not been previously reported .

isolated cutaneous plasmacytosis ( cp ) is a rare entity with few cases reported in world literature . cp masquerading as hidradenitis suppurativa like presentation is a unique case with some features differentiating it clinically from it which were further confirmed by histopathology and immunostaining . our case showed hyperplasia of mature plasma cells and polyclonal hypergammaglobulinemia , immunostaining for cd138 positivity and kappa : lambda ratio more than 3:1 . extensive clinical and laboratory investigations failed to reveal any underlying pathology , presence of any underlying disease accompanying the hypergammaglobulinemia and/or plasma cell proliferation .

Introduction Case Report Discussion Conclusion None Financial support and sponsorship Conflicts of interest

care provision is the essence of nursing profession and nursing researchers have repeatedly linked the concept of health with care provision ( 1 ) . in fact , meeting patient needs is the core of nursing care and providing excellent care is the ultimate goal of nursing ( 2 ) . today , use of complex technological interventions , especially in intensive care units ( icus ) , is increasing ( 3 ) . in other words , all these developments and use of novel therapies have delayed disease progression to death . however , the question arises as to whether these treatment strategies are actually life - saving or they only prolong survival for patients without enhancing their quality of life ( 5 ) . today , shortage of icu beds and presence of different stressors in icus have sparked discussions on diverse issues including futile care ( 6 ) . futile care refers to the provision of medical care with futile therapeutic outcomes for the patient ( 7 ) . according to statistics , 1 out of 5 patients , hospitalized in icus , dies in the united states ( 8) , and nearly half of patients who die in u.s . nurses definition of futile care varies depending on the patient s condition and the personal perspective of nurses . the diversity of criteria for defining this phenomenon and care providers different opinions on this issue reflect the subjectivity of personal judgments , which are rooted in one s emotions , personal beliefs , and culture . some experts explain futile care only in terms of patient survival , while others consider quality of life , in addition to patient survival ( 3 ) . futile care does not only entail end - of - life care , but involves any type of care which neither enhances patients survival or hospital discharge nor helps them maintain or promote their quality of life ( 10 ) . a significant portion of resources in icus is allocated to futile care ( 9 ) . the unspecified time of patients need for such care imposes significant costs on patients , their families , and healthcare systems and indirectly affects nurses ( 11 ) . according to a previous study , the rate of futile care in icus is estimated at approximately 40 - 60% ( 12 ) . generally , futile care provision is costly and nearly 16% of the annual budget for medical care is spent on futile care during the last 60 days of patients lives ( 13 ) . the cost of futile care for hospitals is estimated at 23,000 dollars for each patient , requiring mechanical ventilation for at least 72 hours ( 14 ) . in addition , insurance costs and extra healthcare expenses should be taken into account ( 15 ) . besides health organizations , families are also obliged to incur heavy costs , which may give rise to a sense of helplessness . based on previous studies , there is a significant relationship between futile care and moral distress ( 17 , 18 ) . moral distress is mostly observed among icu physicians and nurses , as they realize the futility of care provision . overall , moral distress can lead to decreased job satisfaction , particularly among nurses , and may have negative impacts on their quality of life ( 17 ) . futile care can lead to nurses indifference towards patients , lack of attention to patients pain , limited efforts in providing optimal care , failure in timely treatment , increased treatment costs , and waste of time and energy . also , there is a significant relationship between the frequency of stressful situations ( as a result of futile care ) and emotional exhaustion , which is one of the main outcomes of occupational burnout among medical teams in icus ( 18 ) . in addition , these stressful situations may intensify turnover intention among physicians , particularly nurses ( 19 ) . overall , nurses are faced with complex conflicts due to futile care . by identifying and understanding these conflicts , nurses may be enabled to overcome such circumstances and plan for patient management ( 3 ) . therefore , planning for quality improvement of nursing care and enhancing access to counseling services for decision - making about futile care are essential ( 12 ) . in general , nurses play a key role in withholding or withdrawing futile care , and they can greatly influence patients and their families if they have the required experience to overcome such circumstances ( 1 ) . according to our literature search , considering the importance of care providers viewpoints on the concept of futile care , the significance of these opinions in the quality of medical care , and the ensuing physical and mental impacts on the members of medical teams ( 19 ) , we aimed to review and evaluate articles with an emphasis on nurses perceptions of futile care . in the present study , we reviewed articles , which focused on nurses perceptions of futile care . available scientific databases including medline , pub med , proquest , sid , iran medex , science direct , noormags , magiran , isi , and scopus were searched , using the following english keywords and their farsi equivalents ( mesh terms ) : futile care , perception of futile care , nurses , intensive care unit , and the selected studies were published from 1994 to 2015 . among the retrieved articles , 16 studies , which were more aligned with our study subject and objectives , were selected and evaluated in this study . by consensus , studies which overlapped each other in terms of content were integrated . since some of the included studies were related to seminars and conferences , we had no access to the full manuscripts and the abstracts were reviewed instead . the term futile care was first defined in 1980 and entered the medical ethics literature in 1990 ( 7 ) . although issues surrounding futile care have been discussed in medicine over the years , there has been a growing interest in this phenomenon in recent decades and futile care has appeared as a serious concern in medical circles . this may be related to the advancing age of human population , advances in technology , modern medical equipment , increasing healthcare costs , and extreme attention to patient autonomy ( 15 ) . some of the selected articles , their titles , methodologies , and findings are presented in table 1 . moral distress and futile care icu nurses and physicians experience moral distress , as they realize the futility of care provision . moral distress may reduce the quality of patient care and job satisfaction , particularly among nurses , and negatively affect their quality of life ( 17 ) . previous research has indicated a significant relationship between moral distress and futile care ( 17 , 18 ) . performed a cross - sectional study , entitled the relationship between moral distress and perception of futile care in the critical care unit . they evaluated 100 ccu nurses in the united states and revealed the high rate of moral distress among nurses who realized the futility of care provision . also , in their study , moral distress , caused by futile care , apparently , different strategies need to be developed to reduce the negative effects of moral distress in icus . in this regard , ferrell et al . performed a study , entitled understanding the moral distress of nurses witnessing medically futile care on 108 nurses working in icus , emergency rooms , and operating rooms ; moreover , nurses who were responsible for care provision of terminally ill patients , were included . the results showed that moral distress arising from futile care has significant impacts on the emotions and feelings of nurses ; therefore , these members of healthcare teams require full support for coping with this issue ( 20 ) . considering the ethical dilemmas surrounding futile care and the complexity of this phenomenon , eslami et al . conducted a cross - sectional study in kerman , entitled moral distress and nurses perception of futile care in intensive care units . this study was performed on 126 icu nurses and the results showed an average level of moral distress , associated with futile care ; also , nurses had a poor understanding of futile care ( 21 ) . critical care nurses perceptions of futile care and its effect on burnout on 60 nurses working in icus , ccus , and neuro - icus of two hospitals in southern california , usa . they found that the frequency of moral distress , caused by futile care , was significantly associated with emotional distress and job burnout among icu nurses ( 18 ) . additionally , borhani et al . performed a descriptive study in kerman , iran , entitled moral distress and perception of futile care in intensive care nurses . this study was carried out on 300 nurses working in ccus , icus , nicus , dialysis units , and oncology wards and showed a positive relationship between moral distress and futile care ; therefore , futile care could lead to moral distress among nurses ( 22 ) . in a study by dunwoody et al . , nurses knowledge of futile care was relatively high and adverse conditions caused by futile care were considered as the main cause of moral distress ( 23 ) . based on various studies on the relationship between moral distress and futile care , we can conclude that repeated occurrence of futile care can affect nurses , as well as their perceptions of medical futility . therefore , support should be provided for nurses to facilitate proper decision - making and reduce their work - related concerns . nurses perception and experience of futile care yekefallah et al . performed a qualitative study , entitled nurses experiences of futile care at intensive care units on 25 icu nurses in qazvin , iran . futile care was defined as useless and inconclusive care , leading to the squandering of financial resources and patient / nurse discomfort , with both nursing and medical aspects . according to their study , since nurses play a key role in futile care management , awareness of their experiences with regard to futile care is the first step to establish effective therapeutic , educational , and research programs in icus ( 1 ) . sibbald et al . in a qualitative study , entitled perceptions of futile care among caregivers in intensive care units , surveyed 14 physician directors , 16 nurse managers , and 14 respiratory therapists in 16 icus in ontario , canada . according to their study , predisposing factors for the occurrence of futile care were as follows : family s insistence to pursue futile care , lack of necessary skills or inadequate time for effective communication within the medical team , and disagreements among the members of healthcare teams in the decision - making process . in the mentioned study , causes of futile care could be effectively eradicated by allowing families to accept the conditions of their patients . also , based on the findings , efforts to limit futile care should focus on public and professional education on the role and use of icus and available alternatives such as palliative care ( 24 ) . moreover , they put a great emphasis on professional discussions about patients resuscitation status , instructions on patient admission in icus , and the necessity of providing ethical and legal support for physicians in face of challenges ( 24 ) . in a qualitative study , entitled end - of - life decisions : nurses perceptions , feelings and experiences , evaluated eight icu nurses . they showed the pivotal role of nurses in patient care and end - of - life decisions and highlighted the importance of support for nurses on their tasks and responsibilities . based on their findings , ethical issues surrounding patient care are very complex and further studies are required to support patients , their families , and nurses ( 25 ) . heland et al . in a qualitative study , entitled fruitful or futile : intensive care nurses experiences and perceptions of medical futility , assessed seven icu nurses and showed that medical futility can not be easily defined . to decide on the futility or efficacy of care services , we should inquire patients about withdrawing or withholding care provision . based on their findings , nurses play a key role in the continuation or discontinuation of therapeutic measures and have significant impacts on the attitudes of patients and their families . experienced nurses play a key role in overcoming the challenges of futile care and can assist unskilled nurses in the decision - making process . , nurses play a mediating and conciliating role in futile care for the members of medical teams and patients families . also , nurses sympathetic support for the patients and their families is among the main tasks of experienced nurses for reducing futile care ( 3 ) . moreover , calvin et al . in a qualitative study , entitled the cardiovascular intensive care unit nurse s experience with end - of - life care evaluated 19 icu nurses . in this study , they aimed to evaluate nurses perceptions at cardiovascular icus about the role and responsibilities of nurses in decisions about medical treatments and end - of - life care for patients . , promoting family presence , acknowledging physician authority , and walking a fine line . calvin et al . believed that these findings can be used as a basis to improve nursing knowledge about end - of - life care ( 26 ) . perceptions of appropriateness of care among european and israeli intensive care unit nurses and physicians , assessed 1,953 physicians and nurses , attending 82 icus in 9 european countries and israel . the imbalance between the provided care and patient prognosis was the most commonly stated cause of futile care . in the mentioned study , presence of organizational factors such as professional autonomy , fixed workload , and high systematic teamwork in icus could also lead to decreased perception of futile care . therefore , planning for the improvement of these factors in icus can lead to decreased understanding of futile care . also , the comparison of physicians and nurses perceptions showed the higher understanding of nurses about futile care ( 19 ) . also , perceptions of physicians and nurses were compared in an analytical study by teixeira et al . , entitled medical futility and end - of - life decisions in critically ill patients : perception of physicians and nurses in central region of portugal . the study sample size consisted of 147 nurses and 36 physicians . in the mentioned study , the major causes of ineffective and futile decisions were as follows : non - acceptance of treatment failure , insufficient training on ethical issues , , the need for developing strategies to improve communication and narrow the gap between what is thought to be the correct choice and what is actually done was highlighted . also , incorporating the opinions of all medical team members , especially nurses , about end - of - life decisions could improve the outcomes and reduce the risk of futile care . as the results indicated , there was a statistically significant difference between the opinions of physicians and nurses about the involvement of medical team members in the decision - making process ( 27 ) . according to a qualitative study by rafii et al . on 10 icu nurses in erbil , iraq , nurses in interaction with terminally ill patients experienced various emotions ranging from emotional stress to optimism due to limited icu resources . further studies are required to explore the experiences of nurses about end - of - life care in other cultures . based on the reported findings , since end - of - life care in icus is associated with emotional challenges , nurses need psychological support in order to provide optimal care for the patients ( 28 ) . finally , according to a study by mohammadi et al . on 170 nurses working in ccus , icus , nicus , oncology wards , and dialysis units of teaching hospitals in south khorasan , iran , there was a significant relationship between the average score of futile care and nurses age , years of service , and type of hospital ward ( 29 ) . overall , according to various studies on the perceptions and experiences of nurses about futile care , adequate training is required to improve the use of coping mechanisms among nurses and provide psychological support to ensure optimal nursing care . since nurses play a key role in patient care and end - of - life decision - making and can significantly influence the attitudes of patients and their families , understanding their experiences about futile care is the first step for designing effective care programs in icus . since futile care leads to the squandering of financial resources , moral and emotional conflicts , job burnout , and turnover intentions among icu nurses , nursing authorities can improve nurses productivity in icus by gaining knowledge about the conducted studies and providing full support for nurses .

the increasing progress in medical and health sciences has enhanced patient survival over the years . however , increased longevity without quality of life in terminally ill patients has been a challenging issue for care providers , especially nurses , since they are required to determine the futility or effectiveness of treatments . futile care refers to the provision of medical care with futile therapeutic outcomes for the patient . interest in this phenomenon has grown rapidly over the years . in this study , we aimed to review and identify nurses perceptions of futile care , based on available scientific resources . in total , 135 articles were retrieved through searching scientific databases ( with no time restrictions ) , using relevant english and farsi keywords . finally , 16 articles , which were aligned with the study objectives , were selected and evaluated in this study . overlapping studies were excluded or integrated , based on the research team s opinion . according to the literature , futile care can not be easily defined in medical sciences , and ethical dilemmas surrounding this phenomenon are very complex . considering the key role of nurses in patient care and end - of - life decision - making and their great influence on the attitudes of patients and their families , support and counseling services on medical futility and the surrounding ethical issues are necessary for these members of healthcare teams .

1. INTRODUCTION 2. MATERIALS AND METHODS 3. RESULTS 4. DISCUSSION 5. CONCLUSION

the ability to evolve through the combined effects of inherited variation and natural selection is the unifying principle of biology . the most elementary cellular system capable of darwinian evolution requires two components : a self - replicating informational molecule , such as an rna polymerase ribozyme ( replicase ) , and a mechanism for spatial localization such as compartmentalization . without compartmentalization or some other mechanism for restricting the diffusion of the genetic material , a superior mutant replicase would act to propagate unrelated sequences more efficiently , while having no effect on its own fitness . the physical proximity of related sequences , which can be readily maintained by the random segregation of sequences within replicating compartments , is therefore necessary for the evolution of improved replicase activity through natural selection . membranes provide the major mechanism for compartmentalization in modern biology and also mediate the chemical fluxes between the cell and its environment . to construct the simplest possible protocell , the membrane boundary should be capable of growth and division without complex biochemical machinery and should allow the entry of ions and small substrates by passive diffusion . to have potential prebiotic relevance , the membrane should also be formed from chemicals that can be synthesized abiotically . fatty acids are simple amphiphiles that form bilayer membrane vesicles when the solution ph is near the apparent pka of the membrane - incorporated fatty acid . they can be synthesized under a variety of conditions , including simulated hydrothermal vent chemistry , and have been detected in carbonaceous chondrite meteorites . clay surfaces that catalyze rna polymerization also promote the self - assembly of fatty acid micelles into vesicles , suggesting a route for enhancing rna encapsulation by colocalizing vesicles and rna . in addition to their chemical simplicity , fatty acid membranes have dynamic properties that are not exhibited by phospholipid membranes . for example , fatty acid vesicles show autocatalytic growth , and they can undergo repeated cycles of growth and division in the laboratory . these vesicles can also exhibit a primitive form of competition for limited resources , as vesicles encapsulating a high concentration of rna grow larger at the expense of empty vesicles ; this is referred to below as the exchange pathway for growth . under certain conditions , growth can drive the formation of a transmembrane ph gradient , thereby storing energy for several hours . these protocellular behaviors are facilitated by the fast time scales of monomermicellevesicle transitions and the relatively small energetic barriers between these phases , as compared to phospholipid membranes , which do not share these dynamic properties . the major disadvantage of using fatty acid membranes to build protocells is their instability under the ionic conditions necessary for catalytic rna activity . for example , decanoic acid vesicles aggregate at moderate concentrations of monovalent ions ( 0.2 m nacl ) , and divalent cations cause aggregation and precipitation even at quite low concentrations ( < 1.5 mm mgcl2 , or 1:65 ratio of cation to lipid ) . this is an important problem because divalent cations are often required for the formation of tertiary contacts in rna folding and also commonly participate directly in the catalytic mechanism . consequently , the activity of many ribozymes , such as the hammerhead ribozyme , is highly dependent on divalent cation concentration . for a protocell to use rna - based biochemistry , vesicle membranes must be stable under conditions enabling ribozyme activity . we therefore sought to encapsulate catalytically active rna in simple vesicles that were stable and capable of growth . the addition of fatty acid glycerol esters stabilizes fatty acid vesicles in the presence of ionic solutes . although a variety of cations can be utilized by ribozymes , we focused on mg because of its common use by ribozymes and its abundance on the earth , particularly in seawater . we characterized the growth properties , mg tolerance , and mg permeability of such mixed composition vesicles . by varying the composition of mixed vesicles , we were able to increase the tolerance of vesicles to mg and to demonstrate that mg could rapidly enter vesicles by passive diffusion . remarkably , the presence of mg increased the permeability of the membrane to small , negatively charged solutes such as nucleotides . on the other hand , vesicle growth by the exchange pathway was slowed , and vesicle growth following micelle addition was only possible after further modification of the membrane composition . finally , we encapsulated a hammerhead ribozyme in mixed vesicles and showed that the ribozyme is active under conditions consistent with vesicle stability and growth . ( i.e. , monomyristolein , the glycerol ester of myristoleic acid ) were purchased from nuchek prep ( elysian , mn ) . pyrene was from fluka ( buchs sg , switzerland ) ; n-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)-1,2-dihexadecanoyl - sn - glycero-3-phosphoethanolamine ( nbd - pe ) , lissamine rhodamine b 1,2-dihexadecanoyl - sn - glycero-3-phosphoethanolamine ( rh - dhpe ) , calcein , and mag - fura-2 ( tetrapotassium salt ) were from molecular probes ( eugene , or ) . ( austin , tx ) , and rnasin was from promega ( madison , wi ) . rna labeled with fluorescein ( 5-6-fam - aaaaaaaaaa-3 ) was synthesized at the w. m. keck facility at yale university . all other chemicals were purchased from sigma - aldrich ( st . louis , mo ) . micelles were prepared by dissolving neat myristoleic acid oil in 1 equiv of naoh solution ( 80 mm ) , as described . vesicles 100 nm in diameter were prepared by resuspending 1 equiv of the oil in 0.2 m bicine buffer , ph 8.5 , to which 0.5 equiv of naoh had been added ( resulting in a final ph of 8.5 ) . resuspension was followed by several freezethaw cycles and extrusion to 100 nm diameter using the mini - extruder system ( avanti polar lipids , inc . ) , as described . mixed composition micelles and vesicles were prepared by mixing the appropriate neat oils before resuspension . vesicles labeled by the fret dyes ( nbd - pe and rh - dhpe ) were prepared by mixing the dyes with fatty acid / ester in methanol , and then removing the solvent by rotary evaporation before resuspension . encapsulation of rna or water - soluble fluorescent dyes was achieved by mixing the solute with the resuspension buffer before adding the oil . vesicles were purified from unencapsulated solutes on a gravity - flow size exclusion column ( sepharose 4b ) . the fluorescent dyes ( 1 kd ) and rna ( 19 kd ) used in these experiments elute at the low molecular weight range of the resin ( 30 kd ) , while vesicles ( 100 nm in diameter ) elute with the void volume . purification and dilution buffers contained a concentration of amphiphiles approximately equal to the critical aggregate concentration , to avoid disintegration of the vesicles . vesicle growth . vesicles labeled with fret dyes were diluted to 3 mm amphiphile and added to a cuvette . growth from addition of micelles was initiated by adding micelles from an 80 mm stock solution , with mixing by pipetting for 5 s. fret was measured using the fluorescence ratio between donor ( em 530 nm ) and acceptor ( em 586 nm ) dyes , with excitation at 430 nm , as described . to convert fret signal into relative surface area , a standard curve was prepared for each vesicle composition ( figures s1 , s2 ) . growth by intermembrane transfer of amphiphiles from empty vesicles to vesicles encapsulating trna was performed as described previously , with the addition of 3.2 mm mgcl2 to the reaction buffer containing 2 mm amphiphile . the concentration of free mg in this solution was 2 mm , as measured by mag - fura-2 fluorescence . dye leakage assay . extruded vesicles encapsulating calcein or h - ump were added to a small volume of a stock solution of mgcl2 ( 100 mm ) to achieve the desired concentration of mg . to determine the extent of dye leakage , vesicles were separated from free dye by size - exclusion chromatography as described above . the integrated fluorescence intensity of each peak was determined by summing the fluorescence intensity of the fractions , as measured on a spectramax gemini em ( molecular devices ) . for vesicles of this size ( 100 nm ) , the concentration of vesicles was low enough ( < 10 mm lipid ) to avoid effects on the fluorescence from turbidity . radioactivity was measured on a beckman ls 6500 scintillation counter . for time courses , the percent of free dye in the initial time point was used as the background and subtracted from subsequent time points . calcein fluorescence was measured at ex 415 nm , em 600 nm ; when appropriate , values were corrected for self - quenching using a standard curve . initial rates of leakage were determined by fitting a straight line to the data for leakage over time . mg concentration was related to the ratio of the fluorescence intensity at ex 340 nm and ex 370 nm ( at constant em 500 nm ) through a standard curve prepared with varying concentrations of mgcl2 in 0.2 m bicine , ph 8.5 . to determine mg permeability , vesicles containing encapsulated mag - fura-2 were diluted to 4 mm amphiphile and mixed by stopped - flow with 1/25 volume of 50 mm mgcl2 ( final [ mg ] = 2 mm ) , as described . because the counter - transport of na , required for charge neutrality , is fast relative to the transport of mg , the mg permeability coefficient was calculated by p = k*v / a , where k is the first - order rate constant , and v and a are the volume and surface area of the vesicle , respectively . the pyrene excimer / monomer ratio was determined from the ratio of fluorescence intensity at em 374 nm ( monomer ) and em 470 nm ( excimer ) , as described . the transcription template for the hammerhead ribozyme n15min7 ( 5- gggacgcagtttcgcttagctcatcagagtaaattcctttcggaatttac tgactgcgt - ccctatagtgagtcgtattacagatc-3 ) was pcr amplified using the primers ( 5-gatctgtaatacgactcac-3 and 5-gggacgcagtttcgcttag-3 ) for 20 cycles . the pcr product was purified using agarose gel electrophoresis , ethanol precipitated , dissolved , and stored in 10 mm tris - cl , ph 8.5 . rna was transcribed from double - stranded n15min7 template by t7 rna polymerase in a solution containing 0.5 mm ntps , 20 ci -p - utp , 40 mm tris - hcl , ph 7.9 , 6 mm mgcl2 , 2 mm spermidine , 10 mm dtt , and 0.2 u/l rnasin . the reaction also included 25 m of two oligonucleotides complementary to the ribozyme sequence , to block ribozyme self - cleavage during transcription ( 5-tcgcttagctcatcag-3 and 5-ggaatttactgactgc-3 ) . transcribed rna was purified by denaturing page , ethanol precipitated , dissolved in water , and stored at 80 c . the reaction was stopped at each time point by removing an aliquot and adding 1.12.3 volumes of 10 mm tris - cl , ph 7.5 , containing 314 mm edta . for encapsulated reactions , the amphiphile concentration was 15 mm and the rna concentration was 40300 nm ( less than one molecule per vesicle on average ) . vesicles were disrupted by the addition of 0.3% triton x-100 , and the rna was precipitated in 0.3 m sodium acetate , ph 7 , 73% ethanol , with 10 g of glycoblue . the extent of cleavage observed before addition of mgcl2 ( t = 0 ) was subtracted from subsequent time points . vesicles were prepared by mixing ma : gmm : dodecane ( 2:1:0.3 ) oil with buffer consisting of 0.2 m bicine , ph 8.5 , 3 mm mgcl2 , and 40 nm n15min7 ( final amphiphile concentration = 20 mm ) . vesicle suspensions were allowed to equilibrate for at least 1 h before staining with 10 mm rhodamine 6 g ( max , ex = 528 nm ; max , em = 551 nm ) for microscopy . conventional epifluorescence images were collected using a zeiss axioplan 2 microscope ( 100 objective lens ; rhodamine filter ) . confocal images were collected using a leica tcs sp confocal laser scanning microscope equipped with ar , arkr , and hene lasers ( 100 objective lens ; 514 nm laser line ) . we assessed the stability of vesicles composed of myristoleic acid ( ma ) and glycerol monomyristoleate ( gmm ) in the presence of mg by monitoring the retention of encapsulated dye and macroscopic turbidity changes . pure ma vesicles showed low mg tolerance , but vesicles of mixed composition , ma : gmm ( 2:1 ) , showed increased stability in the presence of mg , as previously reported on the basis of light microscopy . an intermediate composition of ma : gmm ( 4:1 ) showed intermediate stability ( table 1 ) . higher proportions of gmm led to the appearance of oil droplets mixed with vesicles . table 1mgcl2 tolerance of simple vesiclesma : gmm ratio[mgcl2 ] tolerated , assayed by dye leakage ( mm)[mgcl2 ] at turbidity change ( mm ) 1:0 0.5 1 4:1 2 3 2:1 4 6 dye leakage was assessed < 1 h after addition of mgcl2 , and onset of leakage defined the maximum [ mgcl2 ] tolerated . turbidity change was visible as a sudden increase in the opacity of the solution . mgcl2 tolerance of simple vesicles dye leakage was assessed < 1 h after addition of mgcl2 , and onset of leakage defined the maximum [ mgcl2 ] tolerated . turbidity change was visible as a sudden increase in the opacity of the solution . to determine whether vesicles exposed to relatively high concentrations of mgcl2 are only transiently destabilized by the sudden addition of mgcl2 , we followed the leakage of encapsulated calcein over time . dye leakage continued to increase over the course of at least 1 day ( figure 1a , b ) , indicating that the vesicles remained permeabilized throughout the experiment . the initial rate of dye leakage from ma : gmm ( 2:1 ) vesicles increased by a factor of 27 in the presence of 4 mm mg . to determine whether this enhanced permeability was due to large - scale membrane destabilization by mg , we encapsulated a fluorescently labeled rna decamer in vesicles exposed to 4 mm mg . we expected that large - scale membrane defects would cause rna leakage at a rate similar to small molecule leakage , but no rna leakage was detected after 19 h ( figure 1c ) . h - ump showed a 4-fold permeability enhancement in the presence of 4 mm mg ( figure 1d ) . thus , exposure to mg increased the permeability of an rna mononucleotide but not of rna itself , perhaps by neutralizing the negative charge and/or stabilizing the interaction between the solute and small - scale transient defects in the membrane . even so , more than 95% of encapsulated calcein was retained in ma : gmm ( 2:1 ) vesicles for at least 3 h. this is much longer than the hammerhead ribozyme cleavage reactions described below , which were completed within a few minutes . figure 1leakage from ma : gmm vesicles ( 2:1 ) in 0.2 m bicine , ph 8.5 , 4 mm mgcl2 . ( a ) vesicles were initially purified away from unencapsulated calcein , and dye leakage was measured over time with ( blue ) or without ( black ) the addition of 4 mm mgcl2 . ( b ) calcein leakage assayed by size - exclusion chromatography after 22 h in the presence of 4 mm mgcl2 . ( c ) rna leakage assayed by size - exclusion chromatography after 19 h , with ( red ) or without ( black ) the addition of 4 mm mgcl2 . ( d ) vesicles encapsulating 0.1 mm 5-ump and a trace amount of h - ump were initially purified , and then leakage of h - ump was measured over time , with ( red ) or without ( black ) the addition of 4 mm mgcl2 . leakage from ma : gmm vesicles ( 2:1 ) in 0.2 m bicine , ph 8.5 , 4 mm mgcl2 . ( a ) vesicles were initially purified away from unencapsulated calcein , and dye leakage was measured over time with ( blue ) or without ( black ) the addition of 4 mm mgcl2 . ( b ) calcein leakage assayed by size - exclusion chromatography after 22 h in the presence of 4 mm mgcl2 . ( c ) rna leakage assayed by size - exclusion chromatography after 19 h , with ( red ) or without ( black ) the addition of 4 mm mgcl2 . ( d ) vesicles encapsulating 0.1 mm 5-ump and a trace amount of h - ump were initially purified , and then leakage of h - ump was measured over time , with ( red ) or without ( black ) the addition of 4 mm mgcl2 . because we wished to eventually measure the activity of encapsulated rna , we also determined the permeability of mg through the vesicle membrane . we encapsulated mag - fura-2 , a magnesium - sensitive fluorescent dye ( figure 2a ) , in ma : gmm vesicles ( 2:1 ) and added mgcl2 using a stopped - flow device . the internal concentration of mg equilibrated within several seconds ( permeability coefficient = 2 10 cm / s ) to 1.4 mm , a concentration lower than the added concentration ( 2 mm ; figure 2b ) . because ma is partially negatively charged at ph 8.5 , it may associate with mg , thereby reducing the amount of free mg detected by the mag - fura-2 dye . using size - exclusion chromatography , we verified that < 5% of encapsulated mag - fura-2 leaked from vesicles after 30 min of exposure to 2 mm mg ( figure 2c ) , consistent with the results obtained for calcein leakage . when we mixed phospholipid ( popc ) vesicles with mgcl2 , we saw no detectable change in the internal mg concentration over several hours ( figure 2d ) , demonstrating that equilibration of both mg and mag - fura-2 across popc membranes is quite slow . ( a ) standard curve of mag - fura-2 fluorescence ratio as a function of [ mg ] in 0.2 m bicine , ph 8.5 . mgcl2 was added to a final concentration of 2 mm , by stopped - flow mixing , to ma : gmm ( 2:1 ) vesicles ( b ) or popc vesicles ( d ) encapsulating mag - fura-2 . the internal concentration of mg at each time point was calculated from the standard curve . the solid line ( b ) indicates a curve fit to a single - exponential equation , where k = 0.11 s. ( c ) size - exclusion chromatography shows that no mag - fura-2 dye has leaked out of the ma : gmm vesicles after equilibration of mg . ( a ) standard curve of mag - fura-2 fluorescence ratio as a function of [ mg ] in 0.2 m bicine , ph 8.5 . mgcl2 was added to a final concentration of 2 mm , by stopped - flow mixing , to ma : gmm ( 2:1 ) vesicles ( b ) or popc vesicles ( d ) encapsulating mag - fura-2 . the internal concentration of mg at each time point was calculated from the standard curve . the solid line ( b ) indicates a curve fit to a single - exponential equation , where k = 0.11 s. ( c ) size - exclusion chromatography shows that no mag - fura-2 dye has leaked out of the ma : gmm vesicles after equilibration of mg . although the addition of gmm to ma vesicles increased their tolerance for mg , we suspected that the increase in the stability of the vesicles might come at the expense of dampened dynamic behaviors , such as growth , that rely on the rapid insertion and dissociation of molecules from the membrane . growth of the surface area of vesicles can be monitored using nonexchanging fret dyes , whose fluorescence depends on the surface density of the dyes . we have previously studied the growth of osmotically swollen vesicles due to intermembrane transfer of amphiphiles from empty vesicles . while transfer was slower in ma : gmm ( 2:1 ) membranes , the total amount of transfer was comparable in ma : gmm ( 2:1 ) and pure fatty acid membranes . to determine whether mg affected the intermembrane transfer of amphiphiles , we measured the transfer between ma : gmm ( 2:1 ) vesicles ( 2 mm amphiphile ) in the presence of 3.2 mm mgcl2 ( 2 mm free mg ) . the rate ( k = 0.05 min ) and amount of transfer ( 28% ) were not substantially affected by the presence of mg . another way to achieve vesicle growth is by the addition of micelles , prepared at high ph , to preformed vesicles buffered at ph 8.5 . when 0.5 equiv of pure fatty acid in micelle form is rapidly added to preformed vesicles , the surface area of preformed vesicles grows by 50% , indicating a very high yield of incorporation . in contrast , 4:1 ma : gmm vesicles showed only 35% growth upon addition of 0.5 equiv of micelles of the same composition . dynamic light scattering ( dls ) indicated that ma : gmm ( 4:1 ) micelle solutions contained particles 30 nm in diameter , much larger than pure fatty acid micelles ( diameter = 3 nm ) . aggregation can also be detected by the excimer / monomer ratio of the hydrophobic dye pyrene when present at low molar ratio ( 1:200 ) . when dissolved in small micelles , pyrene is distributed among the separate volumes and exists primarily as a monomer . however , lipid aggregation allows multiple pyrene molecules to share a contiguous volume , forming excimers with a red - shifted fluorescence emission spectrum . consistent with the dls data , pyrene fluorescence indicated the presence of large aggregates in ma : gmm ( 4:1 ) micelles ( figure 3a ) . ( a ) pyrene fluorescence shifts from monomer to excimer if aggregates are present . shown are the spectra of pyrene in pure ma micelles ( green ) , pure ma vesicles ( blue ) , and ma : gmm ( 4:1 ) micelles ( red ) . ( b ) growth of 2:1:0.3 ma : gmm : dodecane vesicles over time , after addition of 1 equiv of micelles , in 0.2 m bicine , ph 8.5 , 1 mm mgcl2 . the solid line indicates a curve fit to a single - exponential equation , with k = 1.5 min . a similar yield was obtained if 1 equiv of micelles was added at once or in up to five separate aliquots . ( a ) pyrene fluorescence shifts from monomer to excimer if aggregates are present . shown are the spectra of pyrene in pure ma micelles ( green ) , pure ma vesicles ( blue ) , and ma : gmm ( 4:1 ) micelles ( red ) . ( b ) growth of 2:1:0.3 ma : gmm : dodecane vesicles over time , after addition of 1 equiv of micelles , in 0.2 m bicine , ph 8.5 , 1 mm mgcl2 . the solid line indicates a curve fit to a single - exponential equation , with k = 1.5 min . a similar yield was obtained if 1 equiv of micelles was added at once or in up to five separate aliquots . ma : gmm ( 2:1 ) vesicles , which had the greatest magnesium tolerance , showed no growth when micelles of the same composition were added , either rapidly or slowly over 4 h. however , these vesicles were able to grow following the rapid addition of pure fatty acid micelles . thus , 2:1 ma : gmm micelles ( which are also large by the pyrene excimer assay and by dls ) appeared to be unusually stable , perhaps due to the large headgroup of gmm , which may stabilize areas of high curvature in micellar aggregates and which would also provide h - bond donors at high ph . to destabilize these micelles , we added dodecane ( 9 mol % ) to act as a hydrophobic spacer , reducing the preferred curvature and decreasing the surface charge density . the rapid addition of 0.5 equiv of 2:1:0.3 ma : gmm : dodecane micelles to vesicles of the same composition resulted in 20% growth , and the rapid addition of 1 equiv of micelles resulted in 40% growth ( figure 3b ) . the rate and total amount of growth were similar in the presence or absence of 1 mm free mg . we determined the activity of a self - cleaving hammerhead ribozyme encapsulated in ma : gmm : dodecane vesicles . the hammerhead ribozyme is widespread in nature and also arises during in vitro selection for self - cleaving rnas . this ribozyme can catalyze both cleavage and ligation of rnas , activities that may be important for simple rna - based replicating systems . furthermore , because of its small size , the hammerhead ribozyme may function robustly under error - prone replication conditions . n15min7 is an artificially evolved 62 nucleotide hammerhead ribozyme , which is cleaved into two fragments ( 11 and 51 nucleotides ) in the presence of mg . n15min7 was encapsulated in 2:1:0.3 ma : gmm : dodecane vesicles during amphiphile resuspension . multiple freezethaw cycles , used to equilibrate vesicle formation , did not affect self - cleavage activity . the self - cleavage reaction was initiated by adding mgcl2 ( 4 mm ) , and the extent of self - cleavage was monitored as a function of time ( figure 4a , b ) . we found that 60% of the rna was cleaved whether the ribozyme was encapsulated or free in solution . the observed first - order rate constant of the encapsulated reaction was reduced 4-fold as compared to the unencapsulated reaction at both 1 and 4 mm added mgcl2 ( table 2 ) . as expected , the rate of the encapsulated reaction in 4 mm added mgcl2 was 5-fold higher than that in 1 mm added mgcl2 . the top band corresponds to the uncleaved ribozyme ; the bottom band is the cleavage product . ( a ) unencapsulated ribozyme activity in 0.2 m bicine , ph 8.5 , 4 mm mgcl2 . time points , from left to right : 0 ( no mgcl2 ) , 0.2 , 0.4 , 0.6 , 0.8 , 1.1 min . the solid line indicates a curve fit to a single - exponential equation , y = a(1 e ) , where the extent of cleavage a = 0.66 , and the observed rate constant k = 7.9 min . ( b ) activity of ribozymes encapsulated in 2:1:0.3 ma : gmm : dodecane vesicles ( 15 mm amphiphile ) , in 0.2 m bicine , ph 8.5 , 4 mm mgcl2 . time points , from left to right : 0 ( no mgcl2 ) , 0.33 , 0.63 , 1 , 1.3 , 1.7 , 3 , 4.7 min . ( c ) size - exclusion chromatography of ma : gmm : dodecane vesicles shows that all radiolabeled n15min7 rna remained encapsulated 15 min after the addition of mgcl2.table 2hammerhead cleavage in vesicles[mgcl2 ] ( mm)kunencapsulated ( min)kencapsulated ( min ) 1 1.3 0.4 4 7.9 1.7 self - cleavage activity of the hammerhead ribozyme n15min7 . the top band corresponds to the uncleaved ribozyme ; the bottom band is the cleavage product . ( a ) unencapsulated ribozyme activity in 0.2 m bicine , ph 8.5 , 4 mm mgcl2 . time points , from left to right : 0 ( no mgcl2 ) , 0.2 , 0.4 , 0.6 , 0.8 , 1.1 min . the solid line indicates a curve fit to a single - exponential equation , y = a(1 e ) , where the extent of cleavage a = 0.66 , and the observed rate constant k = 7.9 min . ( b ) activity of ribozymes encapsulated in 2:1:0.3 ma : gmm : dodecane vesicles ( 15 mm amphiphile ) , in 0.2 m bicine , ph 8.5 , 4 mm mgcl2 . time points , from left to right : 0 ( no mgcl2 ) , 0.33 , 0.63 , 1 , 1.3 , 1.7 , 3 , 4.7 min . curve fit : a = 0.6 , and k = 1.7 min . ( c ) size - exclusion chromatography of ma : gmm : dodecane vesicles shows that all radiolabeled n15min7 rna remained encapsulated 15 min after the addition of mgcl2 . hammerhead cleavage in vesicles this decreased rate of self - cleavage of the encapsulated ribozyme may be partly due to the time scale of mg permeation into gmm - ma - dodecane vesicles ( k 1 min ) , particularly in 4 mm mgcl2 . however , for the encapsulated ribozyme in 1 mm mgcl2 , the rate of mg entry is faster than the observed self - cleavage , indicating that mg entry was not the rate - limiting step in this case . the decrease in free mg concentration ( kd 10 mm amphiphile , considering both the inner and the outer leaflets of the bilayer ) , as determined by mag - fura-2 fluorescence , accounts for about one - half of the observed decrease in rate . to confirm that the observed self - cleavage activity reflected encapsulated ribozyme , rather than ribozyme adsorbed to the membrane , n15min7 rna after purification by size - exclusion chromatography , these preparations contained < 3% of the radioactivity of the encapsulated reaction , indicating that only a small amount of rna was adsorbed to the membrane . we also used size - exclusion chromatography to confirm that the ribozyme still co - purified with vesicles after the self - cleavage reaction ( figure 4c ) . we confirmed that the 2:1:0.3 ma : gmm : dodecane mixture formed vesicles in the presence of mg and rna by fluorescence microscopy before extrusion ( figure 5 ) . dls of these vesicles after extrusion indicated an average particle diameter of 65 nm , similar to the size of extruded vesicles made from myristoleic acid alone . furthermore , self - cleavage of n15min7 was neither catalyzed nor inhibited by the presence of vesicles alone . in the absence of mg , no self - cleavage was detected after 30 min , and the self - cleavage rate of unencapsulated n15min7 upon addition of mg was not affected by the presence of vesicles . figure 5fluorescence microscopy of 2:1:0.3 ma : gmm : dodecane vesicles containing hammerhead ribozyme in the presence of 3 mm mgcl2 , prior to extrusion . membranes were stained using rhodamine 6 g for visualization by ( a ) epifluorescence or ( b ) laser scanning confocal microscopy . fluorescence microscopy of 2:1:0.3 ma : gmm : dodecane vesicles containing hammerhead ribozyme in the presence of 3 mm mgcl2 , prior to extrusion . membranes were stained using rhodamine 6 g for visualization by ( a ) epifluorescence or ( b ) laser scanning confocal microscopy . the [ mg]1/2 ( concentration of mg corresponding to half - maximal activity ) of the n15 construct used in our studies is 9 mm , and hammerhead ribozymes of biological origin have even lower mg optima of < 1 mm . other complex natural ribozymes that function under physiological conditions ( < 1 mm ) have evolved low mg requirements . for example , the [ mg]1/2 for folding and catalysis of a number of self - splicing group i introns is 4 mm . an rna polymerase ribozyme with a similarly low mg requirement could function inside ma : gmm vesicles . however , currently available ribozymes with polymerase or ligase activity have much higher mg requirements . for example , the class i ligase , discovered by in vitro evolution in the presence of high concentrations of mg , has a [ mg]1/2 of 70100 mm , as does a variant that can catalyze limited rna polymerization . the discrepancy between the mg requirement of this ribozyme and the mg tolerance of the simple vesicles studied here suggests that observing ribozyme polymerase activity inside vesicles that can grow and divide may not be trivial in practice . further optimization of existing ribozymes , or isolation of new ones , may yield rna polymerases active at lower mg concentrations that could be compatible with the vesicles described here . an independent reason for focusing on low to moderate mg concentrations is that high mg concentrations promote rna degradation . mg - catalyzed rna degradation is in fact thought to limit the extent of polymerization obtainable by the polymerase derived from the class i ligase . we have shown that vesicles composed of chemically simple amphiphiles can be stable , grow , and retain contents in the presence of sufficient mg to activate encapsulated ribozymes . because these membranes , unlike phospholipid membranes , are quite permeable to mg , encapsulated ribozymes can be activated by the external addition of mg . other rna - catalyzed reactions , including rna replication , may ultimately be possible within similar vesicles , enabling the experimental construction of evolvable protocells . the permeability of these simple membranes to mg means that the internal mg concentration of a population of growing and dividing vesicles could be maintained indefinitely , from generation to generation , solely by passive trans - membrane diffusion in the absence of permeases . our experiments also illustrate that there are tradeoffs in the search for conditions compatible with both rna and vesicle replication . while the addition of gmm confers stability on ma vesicles , it also causes a decrease in the yield of growth following micelle addition . this decrease could be partially offset by the addition of another simple component , dodecane . on the other hand , the yield of growth of osmotically swollen vesicles was not affected by the addition of gmm . indeed , this mode of growth may be more likely to occur in natural situations , because the source of lipid , empty vesicles , is the same physical phase as the growing vesicles , readily permitting their coexistence . an unexpected effect of mg was to increase the permeability of small , negatively charged solutes , including uridine monophosphate . this effect would be advantageous to an encapsulated replicating rna that was polymerizing nucleic acid monomers into longer strands of rna . the increase in monomer permeability might enhance polymerization , while the polymeric product would continue to be retained . many selective pressures are likely to have influenced the evolution of the phospholipid membranes of modern biology , which are much more stable to divalent cations and can maintain ph and ionic gradients for long periods . however , the evolution of such membranes would have required the co - evolution of numerous ion and substrate - specific permeases , as well as the biochemical machinery for membrane growth . our results show that membranes made from simple amphiphiles can be stable enough to retain rna , yet dynamic enough to grow and allow the spontaneous entry of mg and mononucleotides . we are continuing to search for membrane compositions with similar dynamic properties , but greater tolerance to mg and possibly ca ( another abundant divalent cation on earth ) , as well as ribozyme polymerases active at lower mg concentrations , with the goal of observing rna - catalyzed rna synthesis within model protocell vesicles . standard curve for fret signal prepared using 4:1 ma : gmm vesicles ( figure s1 ) and 2:1 ma : gmm vesicles ( figure s2 ) .

we are engaged in a long - term effort to synthesize chemical systems capable of darwinian evolution , based on the encapsulation of self - replicating nucleic acids in self - replicating membrane vesicles . here , we address the issue of the compatibility of these two replicating systems . fatty acids form vesicles that are able to grow and divide , but vesicles composed solely of fatty acids are incompatible with the folding and activity of most ribozymes , because low concentrations of divalent cations ( e.g. , mg2 + ) cause fatty acids to precipitate . furthermore , vesicles that grow and divide must be permeable to the cations and substrates required for internal metabolism . we used a mixture of myristoleic acid and its glycerol monoester to construct vesicles that were mg2 + -tolerant and found that mg2 + cations can permeate the membrane and equilibrate within a few minutes . in vesicles encapsulating a hammerhead ribozyme , the addition of external mg2 + led to the activation and self - cleavage of the ribozyme molecules . vesicles composed of these amphiphiles grew spontaneously through osmotically driven competition between vesicles , and further modification of the membrane composition allowed growth following mixed micelle addition . our results show that membranes made from simple amphiphiles can form vesicles that are stable enough to retain encapsulated rnas in the presence of divalent cations , yet dynamic enough to grow spontaneously and allow the passage of mg2 + and mononucleotides without specific macromolecular transporters . this combination of stability and dynamics is critical for building model protocells in the laboratory and may have been important for early cellular evolution .

Introduction Materials and Methods Results and Discussion Conclusions None Supplementary Material

cutaneous crohn 's was first described by parks et al . , in 1965 , refers to extra intestinal mucocutaneous manifestations of crohn 's disease in which there are noncaeseating , granulomatous mucocutaneous lesions preceding or manifesting after systemic manifestations of intestinal crohn 's disease . other dermatological conditions found to be associated with crohn 's disease include pyoderma gangrenosum , erythema nodosum , erythema multiforme , epidermolysis bullosa acquisita , polyarteritis nodosa and vitiligo . here , we report a case of anogenital crohn 's and its rare association with vitiligo . the case we present here is about a 23-year - old female , presented with vitiligo patch on legs and back for 1 year and vulval swelling with anogenital and oral erosions for 9 months [ figure 1 ] . there were multiple , painful , nonhealing erosions seen on anogenital area and oral cavity [ figures 2 and 3 ] . she also had on- and off - history of loose stools for last 1 month . investigations on admission had shown low hemoglobin 10 gm% , total count of 7100/cumm , differential count of n : 58 , l : 34 , m : 4 , e : 4 , b : 0 , platelet count 4.89l acs / cumm . erythrocyte sedimentation rate was 40 mm in 1 h , blood urea 10 mg / dl , serum creatinine 1 mg / dl , random blood sugar 80 mg / dl . serum glutamic pyruvic transaminase 10 u / l , serum glutamate - oxaloacetate transaminase 54 u / l , serum bilirubin 0.8 mg / dl , prothrombin time 14 s , activated partial thromboplastin time 34 s , total protein 5.3 g , albumin : globulin 2.9:2.4 . koh smear was taken from vaginal discharge , which was negative and report of gram - stain is not available . ultrasonography ( usg ) of patient showed 17 cm bowel segment with 15 mm thickened wall and narrowing of the lumen with the diagnosis of inflammatory bowel disease . multislice computed tomography ( ct ) scan of the abdomen with pelvis showed mild circumferential wall thickening with stratification and increased enhancement . findings were in favor of crohn 's with early sacroillitis . colonoscopy showed dilated bowel segment with edema , erythema , telangiectasia , and few ulcers [ figure 4 ] . biopsy from anal wall showed acute as well as chronic inflammation with noncaseating granulomas suggestive of crohn 's disease [ figure 5 ] . patient was treated with tablet mesalamine ( 800 mg ) eight hourly and capsule doxycycline ( 100 mg ) and neomycin cream on ulcers . clinical photograph of vitiligo patches on legs clinical photograph of patient showing vulval edema clinical photograph showing anal erosions colonoscopy showing erosions in the terminal ileum histopathological picture crohn 's disease , first described by sir crohn et al . in 1932 , is a type of inflammatory bowel disease that may affect any part of the gastrointestinal tract from mouth to anus . it affects 1 in 400,000 - 600,000 people globally with male : female ratio of 1:1.2 . the age of onset of cutaneous crohn 's is 10 - 69 years . in our case , the basic underlying etiology of crohn 's is currently unknown , though various theories suggest an interaction between environmental , immunological and bacteriological factors in genetically susceptible individuals ( nod2 gene ) . the lesions in cutaneous crohn 's can be classified as : ( 1 ) specific lesions of cutaneous crohn 's disease , ( 2 ) reactive dermatoses , ( 3 ) cutaneous manifestations secondary to malabsorption , and ( 4 ) cutaneous manifestations secondary to treatment . cutaneous crohn 's disease can also be divided clinically into two forms : genital ( 56% ) and extra genital ( 44% ) . approximately , two - third of children and half of adults with crohn 's disease present with genital involvement . anogenital signs and symptoms ( in approximately 25% in illeal and 80% in colonic involvement ) may appear before the other systemic manifestations and may be the first sign in the diagnosis of crohn 's disease . cutaneous manifestations associated with crohn 's disease are erythema nodosum , pyoderma gangrenosum , epidermolysis bullosa acquisita , polyarteritis nodosa , and vitiligo . in our case , association of crohn 's disease and vitiligo has been seen in other studies also . in the study by tanusin et al . mcpoland and moss have reported a case of crohn 's disease and vitiligo . in both studies , the differentials of chronic vulval edema with erosions are granulomatous vulvitis , sarcoidosis , and chronic lymphedema due to obstruction , tuberculosis , subcutaneous mycoses , hidradenitis suppurativa and langerhans cell histiocytosis . clinically , presence of chronic erosions , swelling , and erythematous discoloration of genitals with gastrointestinal symptoms and on investigation typical findings in usg , ct scan and colonoscopy favors diagnosis of crohn 's disease . absence of lymphadenopathy , vegetating growth , scarring , and negative x - ray findings excludes other differential conditions . although histological picture of cutaneous crohn 's may be indistinguishable from other granulomatous diseases , but histopathology of skin along with colonoscopy findings together leads to diagnosis of crohn 's disease . many treatment modalities are available as systemic steroids , sulfasalazine , mesalamine ( active moiety of sulfasalazine ) , oral metronidazole , hyperbaric oxygen , and antitumor necrosis factor- antibody ( infliximab ) . our patient was treated symptomatically with tablet mesalamine ( 800 mg ) eight hourly , capsule doxycycline ( 100 mg ) and topically neomycin cream and was referred to higher center for operative procedures .

cutaneous crohn 's or anogenital granulomatosis is a rare disorder , which presents commonly as swelling and erosions on anogenital area and associated with features of intestinal crohn 's disease . we report a case of 23-year - old female who presented with vitiligo patches on back and legs for 1-year , painful edema and ulcers on anogenital area and oral cavity for 9 months and diarrhea with bleeding per annum for 1 month . features on ultrasonography , multislice computed tomography scan , colonoscopy , and biopsy from nodule on anal wall were suggestive of granulomatous crohn 's disease . thus , we present the case due to its rarity .

INTRODUCTION CASE REPORT DISCUSSION

we report a case of colonic perforation following the administration of neostigmine for the treatment of pseudo - obstruction . neostigmine is a prokinetic agent that is increasingly being used in the treatment of pseudo - obstruction . there is limited evidence of its efficacy and due to its side - effect profile it should be used with caution . the patient , a 34-year - old female , developed symptoms consistent with pseudo - obstruction on day 3 post - emergency caesarean section , which was performed for foetal distress and possible placenta abruption . an abdominal x - ray was performed which showed a significantly dilated colon ( fig . 1 ) , and the diagnosis of pseudo - obstruction was again confirmed on computer tomography ( ct ) scan of the abdomen which showed a caecum measuring 9.8 cm transversely ( fig . 2 ) . emergency colonoscopic decompression with the insertion of a flatus tube was performed and medical management , including cessation of opioids , anticholinergics and correction of electrolyte abnormalities , was commenced . the patient failed to have a return of normal bowel function post - decompression and after 3 days was administered 500 g of neostigmine via subcutaneous injection in an attempt to improve bowel motility . that evening she developed fever , and abdominal pain and erect chest x - ray confirmed free gas under her diaphragms ( fig . 3 ) . she was found to have two sites of caecal perforation with a moderate faecal contamination in the right paracolic gutter . it is possible that the serosal tears of the caecum had occurred secondary to either administration of neostigmine or dilatation in the post - caesarean period . neostigmine is an agent that inhibits the effects of acetylcholinesterase thereby acting as a prokinetic . the first use of it in the treatment of pseudo - obstruction is attributed to hutchinson and griffiths in 1992 .subsequently , there have been several small studies that report it as a safe and effective treatment in pseudo - obstruction [ 24 ] . it has several well - documented side effects including bradycardia , hypotension , headache , dizziness , muscle cramps , bronchospasm and salivation . there are however only two other reported cases in the literature of colonic perforation in association with the use of neostigmine for the treatment of colonic pseudo - obstruction [ 5 , 6 ] . patients with pseudo - obstruction are often unwell with up to 95% of cases associated with significant infection , trauma or recent surgery . whilst the documented risk of colonic perforation is low , being reported at 3% , these patients have a high risk of mortality due to these co - existing factors . the use of neostigmine is not without risk due to its well - documented side - effect profile . further work is required to examine whether the risk of perforation is increased in patients with pseudo - obstruction who are treated with neostigmine .

neostigmine is an acetylcholinesterase inhibitor that is increasingly used as a medical treatment in cases of pseudo - obstruction . it has a well - recognized side - effect profile that includes bradycardia and bronchospasm . we present a case of colonic perforation after administration of neostigmine in the treatment of pseudo - obstruction .

INTRODUCTION CASE REPORT DISCUSSION

it is required to tolerate intubation and other icu related procedures , to lie down in the same position for a long time , to prevent ventilator dysynchrony , for optimization of oxygenation and for patients safety . attaining an optimal level of sedation is a challenging act for the icu clinician . both inadequate sedation and oversedation compromise patient 's recovery and may prolong icu stay along with associated complications and increased cost . many of the currently used agents have specific drawbacks that limit their practical utility along the full spectrum of patients and clinical situations that intensivists face every day . the discovery that clonidine has an opioid sparing property and attenuated withdrawal symptoms , sparked further interest in the use of alpha - 2 ( 2 ) agonists as intravenous ( iv ) sedatives . a resurgence in the research of 2 agonists for sedation developed after the approval of dexmedetomidine for icu sedation . unlike most other sedative drugs , 2 agonists produce both sedation and analgesia with minimal respiratory depression . we therefore planned this study to compare sedative , analgesic and cardiovascular effects and safety profile of two 2 agonists , clonidine , and dexmedetomidine for patients requiring short - term sedation in icu . after approval from the institutional review board and informed written consent , 70 adult patients of either sex were enrolled for this study . the main inclusion criteria were age > 18 years , mechanical ventilation with endotracheal intubation and clinical need for light or moderate sedation for < 24 h. we excluded pregnant females , patients with a neurological condition , central nervous system trauma , asthma or chronic obstructive pulmonary disease , hemodynamically unstable patients , known cases of conduction defects , cardiac failure , those with a creatinine clearance < 30 ml / min , and those requiring neuromuscular blockade and prior use of 2 agonists . the patients were predominantly postsurgical who were operated for major abdominal , gynecological or urological procedures under general anesthesia on an elective basis . the anesthetic technique was individualized by the anesthetist in - charge ; however , fentanyl alone was used for intraoperative analgesia and the dose was recorded . epidural or spinal technique was not used in any patient . on arrival to the icu , patients were randomly allocated into two groups , group c and d , based on computer generated random number tables . clonidine was supplied in 1 ml ampoules , containing 150 g / ml and diluted with normal saline to a concentration of 3 g / ml . dexmedetomidine was supplied in 2 ml ampoules that contained 100 g / ml diluted with normal saline to a concentration of 4 g / ml . physical examination , baseline vitals , electrocardiogram and central venous pressure ( cvp ) was noted on admission to the icu . hematological ( complete blood count , coagulation profile ) and biochemical profile ( electrolytes , glucose , urea , creatinine , and liver function test ) were obtained prior to the administration of sedatives and 24 h after the study period . patients were ventilated with oxygen enriched air to obtain acceptable arterial blood gas ( abg ) levels . heart rate , cvp , noninvasive blood pressure ( bp ) , respiratory rate , and oxygen saturation ( measured by pulse oximetry ) were monitored continuously over 24 h. hemodynamic parameters were recorded at 10 min , 30 min after the commencement of sedative infusions and then 2 hourly for the study period . if systolic bp reduced below 80 mmhg or increased above 180 mmhg , diastolic bp reduced below 50 mmhg or increased above 100 mmhg or heart rate was below 50 or above 120 bpm , they were labeled as adverse cardiovascular events . any change > 30% from the baseline in bp and heart rate were also considered as adverse cardiovascular event . the degree of sedation was assessed by ramsay sedation score ( rss ) ( 1 : patient anxious , agitated or restless , 2 : cooperative , oriented and tranquil , 3 : responds to commands only , 4 : exhibits brisk response to light glabellar tap or loud auditory stimulus , 5 : sluggish response to light glabellar tap or loud auditory sound , 6 : no response ) obtained on arrival in the icu , at 10 and 30 min after commencement of the infusion and 2 hourly thereafter for the study period . rss of 3 - 4 was considered as target sedation and the infusion rates were titrated within their respective range until target sedation was achieved . rss was also assessed prior to and 10 min after any titration in the study drug infusion rate or the use of additional sedation . group c patients were administered an iv infusion of clonidine 1 g / kg / h and titration was achieved with dosage increments up to 2 g / kg / h . patients in group d received dexmedetomidine as a loading dose of 0.7 g / kg over a period of 10 min followed by maintenance of 0.2 g / kg / h with dosage increments titrated up to 0.7 g / kg / h . additional sedation with iv diazepam bolus of 0.1 mg / kg was given if the patient did not achieve target sedation on titrating the sedative to the maximum selected dose ( 2 g / kg / h for clonidine and 0.7 g / kg / h for dexmedetomidine ) or if the patient experienced side - effects ( hypotension ) with the drugs . assessment of pain was by direct communication of the patient and fentanyl was given prior to anticipate noxious stimulus . inadequate analgesia was treated with iv bolus of 20 g of fentanyl or infusion if pain persisted . a sample size of minimum 32 patients / group was expected to have an 80% power to detect a 30% reduction in additional sedation requirements ( primary endpoint ) with a significance level of 5% . all data were recorded and noted on observation charts and were analyzed at the end of the study . data were expressed as mean standard deviation ( sd ) or as median and interquartile range ( iqr ) and comparisons made using the unpaired t - test . medians were quoted for skewed data and were compared using the mann - whitney u - test . analysis was carried out using the spss 18.0 software ( ibm ( pasw statistics 18 ) ) . after approval from the institutional review board and informed written consent , 70 adult patients of either sex were enrolled for this study . the main inclusion criteria were age > 18 years , mechanical ventilation with endotracheal intubation and clinical need for light or moderate sedation for < 24 h. we excluded pregnant females , patients with a neurological condition , central nervous system trauma , asthma or chronic obstructive pulmonary disease , hemodynamically unstable patients , known cases of conduction defects , cardiac failure , those with a creatinine clearance < 30 ml / min , and those requiring neuromuscular blockade and prior use of 2 agonists . the patients were predominantly postsurgical who were operated for major abdominal , gynecological or urological procedures under general anesthesia on an elective basis . the anesthetic technique was individualized by the anesthetist in - charge ; however , fentanyl alone was used for intraoperative analgesia and the dose was recorded . epidural or spinal technique was not used in any patient . on arrival to the icu , patients were randomly allocated into two groups , group c and d , based on computer generated random number tables . clonidine was supplied in 1 ml ampoules , containing 150 g / ml and diluted with normal saline to a concentration of 3 g / ml . dexmedetomidine was supplied in 2 ml ampoules that contained 100 g / ml diluted with normal saline to a concentration of 4 g / ml . physical examination , baseline vitals , electrocardiogram and central venous pressure ( cvp ) was noted on admission to the icu . hematological ( complete blood count , coagulation profile ) and biochemical profile ( electrolytes , glucose , urea , creatinine , and liver function test ) were obtained prior to the administration of sedatives and 24 h after the study period . patients were ventilated with oxygen enriched air to obtain acceptable arterial blood gas ( abg ) levels . heart rate , cvp , noninvasive blood pressure ( bp ) , respiratory rate , and oxygen saturation ( measured by pulse oximetry ) were monitored continuously over 24 h. hemodynamic parameters were recorded at 10 min , 30 min after the commencement of sedative infusions and then 2 hourly for the study period . if systolic bp reduced below 80 mmhg or increased above 180 mmhg , diastolic bp reduced below 50 mmhg or increased above 100 mmhg or heart rate was below 50 or above 120 bpm , they were labeled as adverse cardiovascular events . any change > 30% from the baseline in bp and heart rate were also considered as adverse cardiovascular event . the degree of sedation was assessed by ramsay sedation score ( rss ) ( 1 : patient anxious , agitated or restless , 2 : cooperative , oriented and tranquil , 3 : responds to commands only , 4 : exhibits brisk response to light glabellar tap or loud auditory stimulus , 5 : sluggish response to light glabellar tap or loud auditory sound , 6 : no response ) obtained on arrival in the icu , at 10 and 30 min after commencement of the infusion and 2 hourly thereafter for the study period . rss of 3 - 4 was considered as target sedation and the infusion rates were titrated within their respective range until target sedation was achieved . rss was also assessed prior to and 10 min after any titration in the study drug infusion rate or the use of additional sedation . group c patients were administered an iv infusion of clonidine 1 g / kg / h and titration was achieved with dosage increments up to 2 g / kg / h . patients in group d received dexmedetomidine as a loading dose of 0.7 g / kg over a period of 10 min followed by maintenance of 0.2 g / kg / h with dosage increments titrated up to 0.7 g / kg / h . additional sedation with iv diazepam bolus of 0.1 mg / kg was given if the patient did not achieve target sedation on titrating the sedative to the maximum selected dose ( 2 g / kg / h for clonidine and 0.7 g / kg / h for dexmedetomidine ) or if the patient experienced side - effects ( hypotension ) with the drugs . assessment of pain was by direct communication of the patient and fentanyl was given prior to anticipate noxious stimulus . inadequate analgesia was treated with iv bolus of 20 g of fentanyl or infusion if pain persisted . a sample size of minimum 32 patients / group was expected to have an 80% power to detect a 30% reduction in additional sedation requirements ( primary endpoint ) with a significance level of 5% . all data were recorded and noted on observation charts and were analyzed at the end of the study . data were expressed as mean standard deviation ( sd ) or as median and interquartile range ( iqr ) and comparisons made using the unpaired t - test . medians were quoted for skewed data and were compared using the mann - whitney u - test . analysis was carried out using the spss 18.0 software ( ibm ( pasw statistics 18 ) ) . after approval from the institutional review board and informed written consent , 70 adult patients of either sex were enrolled for this study . the main inclusion criteria were age > 18 years , mechanical ventilation with endotracheal intubation and clinical need for light or moderate sedation for < 24 h. we excluded pregnant females , patients with a neurological condition , central nervous system trauma , asthma or chronic obstructive pulmonary disease , hemodynamically unstable patients , known cases of conduction defects , cardiac failure , those with a creatinine clearance < 30 ml / min , and those requiring neuromuscular blockade and prior use of 2 agonists . the patients were predominantly postsurgical who were operated for major abdominal , gynecological or urological procedures under general anesthesia on an elective basis . the anesthetic technique was individualized by the anesthetist in - charge ; however , fentanyl alone was used for intraoperative analgesia and the dose was recorded . epidural or spinal technique was not used in any patient . on arrival to the icu , patients were randomly allocated into two groups , group c and d , based on computer generated random number tables . clonidine was supplied in 1 ml ampoules , containing 150 g / ml and diluted with normal saline to a concentration of 3 g / ml . dexmedetomidine was supplied in 2 ml ampoules that contained 100 g / ml diluted with normal saline to a concentration of 4 g / ml . physical examination , baseline vitals , electrocardiogram and central venous pressure ( cvp ) was noted on admission to the icu . hematological ( complete blood count , coagulation profile ) and biochemical profile ( electrolytes , glucose , urea , creatinine , and liver function test ) were obtained prior to the administration of sedatives and 24 h after the study period . patients were ventilated with oxygen enriched air to obtain acceptable arterial blood gas ( abg ) levels . heart rate , cvp , noninvasive blood pressure ( bp ) , respiratory rate , and oxygen saturation ( measured by pulse oximetry ) were monitored continuously over 24 h. hemodynamic parameters were recorded at 10 min , 30 min after the commencement of sedative infusions and then 2 hourly for the study period . if systolic bp reduced below 80 mmhg or increased above 180 mmhg , diastolic bp reduced below 50 mmhg or increased above 100 mmhg or heart rate was below 50 or above 120 bpm , they were labeled as adverse cardiovascular events . any change > 30% from the baseline in bp and heart rate were also considered as adverse cardiovascular event . the degree of sedation was assessed by ramsay sedation score ( rss ) ( 1 : patient anxious , agitated or restless , 2 : cooperative , oriented and tranquil , 3 : responds to commands only , 4 : exhibits brisk response to light glabellar tap or loud auditory stimulus , 5 : sluggish response to light glabellar tap or loud auditory sound , 6 : no response ) obtained on arrival in the icu , at 10 and 30 min after commencement of the infusion and 2 hourly thereafter for the study period . rss of 3 - 4 was considered as target sedation and the infusion rates were titrated within their respective range until target sedation was achieved . rss was also assessed prior to and 10 min after any titration in the study drug infusion rate or the use of additional sedation . group c patients were administered an iv infusion of clonidine 1 g / kg / h and titration was achieved with dosage increments up to 2 g / kg / h . patients in group d received dexmedetomidine as a loading dose of 0.7 g / kg over a period of 10 min followed by maintenance of 0.2 g / kg / h with dosage increments titrated up to 0.7 g / kg / h . additional sedation with iv diazepam bolus of 0.1 mg / kg was given if the patient did not achieve target sedation on titrating the sedative to the maximum selected dose ( 2 g / kg / h for clonidine and 0.7 g / kg / h for dexmedetomidine ) or if the patient experienced side - effects ( hypotension ) with the drugs . assessment of pain was by direct communication of the patient and fentanyl was given prior to anticipate noxious stimulus . inadequate analgesia was treated with iv bolus of 20 g of fentanyl or infusion if pain persisted . a sample size of minimum 32 patients / group was expected to have an 80% power to detect a 30% reduction in additional sedation requirements ( primary endpoint ) with a significance level of 5% . all data were recorded and noted on observation charts and were analyzed at the end of the study . data were expressed as mean standard deviation ( sd ) or as median and interquartile range ( iqr ) and comparisons made using the unpaired t - test . medians were quoted for skewed data and were compared using the mann - whitney u - test . analysis was carried out using the spss 18.0 software ( ibm ( pasw statistics 18 ) ) . over a period of 18 months , 70 patients were enrolled in the study to receive sedation with either dexmedetomidine ( n = 35 ) or clonidine ( n = 35 ) . these included 59 postsurgical , 7 medical and 4 polytrauma patients evenly distributed in each group [ table 1 ] . demographic data and intraoperative details such as operative time , fentanyl requirements , apache ii scores , and duration of sedative infusions in the icu were comparable [ table 1 ] . demographic and intraoperative details : median ( iqr ) or number additional sedation with diazepam ( primary endpoint ) was needed by eight patients in dexmedetomidine treated and by 14 patients in clonidine treated patients ( p = 0.034 ) . of these patients , three patients of group d and 11 of group c could not attain target sedation due to development of significant hypotension on increasing infusion rate . median dose of diazepam required in group c was significantly higher compared to group d ( 15 mg , iqr : 5 - 22 mg in group c and 8.5 mg , iqr : 2 - 10 mg in group d , p = 0.043 ) . need for additional sedation was about 43% less in group d. the mean sd maintenance infusion dose was 0.47 0.27 g / kg / h for dexmedetomidine and 1.67 8.6 g / kg / h for clonidine . median infusion dose was 0.4 g / kg / h ( group d ) and 1.4 g / kg / h ( group c ) . a total of 373 observations of rss were obtained for group c , of which 235 ( 62% ) observations were in the target sedation range ( rss : 3 - 4 ) . in group d , a total of 403 observations were obtained , of which 347 ( 86% ) were in the target sedation range . the proportion of time spent in the target sedation range was greater in group d ( p = 0.04 ) . a score 1 - 2 was observed on 86 ( 23% ) occasions in group c and 36 ( 9% ) occasions in group d ( p = 0.047 ) . rss : 5 - 6 was achieved in 52 ( 14% ) observations in group c and 20 ( 5% ) observations in group d ( p = 0.048 ) . the baseline hemodynamic parameters were comparable in both groups . a significant reduction in systolic and diastolic bp from the baseline ( p < 0.05 ) occurred after bolus infusion in group d but in none of the patients fall was > 30% from baseline . thereafter , mean values remained well within range throughout study period [ figures 1 and 2 ] . mean heart rate also decreased from baseline 2 h after commencement of sedative infusion in group d , but at none of the observation times fall was significant ( p = 0.079 ) [ figure 3 ] . in group c significant fall from baseline values in bp were noted 2 and 4 h after sedative infusion was started ; but thereafter , it showed minimal change figures [ 1 and 2 ] . patients receiving clonidine ( group c ) had significantly lower heart rates from baseline ( p < 0.05 ) [ figure 3 ] . on comparison , the hemodynamic parameters were comparable between the two groups during the study period ( p > 0.05 ) . systolic blood pressure ( mean standard error of the mean ) during dexmedetomidine and clonidine infusion and after discontinuation diastolic blood pressure ( mean standard error of the mean ) during dexmedetomidine and clonidine infusion and after discontinuation heart rate ( mean standard error of the mean ) during dexmedetomidine and clonidine infusion and after discontinuation bradycardia occurred in 3 of the 35 patients in group c and 4 of the 35 patients in group d ( p = 0.64 ) . hypotension occurred in 11 of the 35 patients in group c ( 31% ) and 3 of the 35 patients in group d ( 9% ) ( p = 0.01 ) . about 50% of the hypotensive episodes occurred within 2 - 4 h in group c and at 2 h in group d. no patient experienced hypotension after 14 h in group c and after 6 h in group d. sustained increase in systolic and diastolic pressure and heart rate occurred after cessation of infusion in group d , but there were no clinically significant rebound phenomena in any patient . in group c , rebound hypertension was seen in four patients after cessation of clonidine infusion . in two patients , it increased above 180 mmhg about 2 h after discontinuation of clonidine . the median 24 h fentanyl requirement was 162 g ( range : 105 - 175 ) for group c and 171 g ( range : 110 - 185 ) for group d ( p = 0.73 ) . a median of 3 ( range : 2 - 5 ) boli of fentanyl was required in both groups over the study period . mean time for extubation was similar in both groups , being 19 h ( range : 14 - 30 h ) in group d patients and 18 h ( range : 16 - 32 h ) in group c. there were no adverse respiratory events after extubation in any patient in either group . biochemical and hematological parameters were not different between two groups at arrival in icu and 24 h after admission . the chief results of this study showed that target sedation was achieved in more number of patients receiving dexmedetomidine with lesser need for additional sedation . this study and many previous studies have documented dexmedetomidine to be a safe and effective agent for icu sedation of postsurgical patients . although mean cumulative sedation scores over the study period were not significantly different in two groups ( 3.37 + 1.37 vs. 3.20 + 0.75 in groups c and d , respectively ) , percentage of patients who attained target sedation was significantly higher in group d compared with group c ( 86 vs. 62% in groups d and c , respectively , p = 0.04 ) . dexmedetomidine is 8 times more specific for 2 receptors than clonidine and the improved specificity for the 2 adrenoreceptors , especially for the 2a subtype may make it to be a much more effective sedative than clonidine . however , our findings are in contrast with those of riker et al . who suggested that dexmedetomidine attained target sedation less frequently . a rss of 1 - 2 or 5 - 6 occurred in more number of observations in group c than in group d. the short distribution half - life of dexmedetomidine ( 6 min ) makes it an ideal drug for iv titration . this could be the reason for the rapid titration to target sedation and the lesser number of observations pertaining to inadequate sedation in group d. although more than 60% patients of both groups attained acceptable sedation , significantly more number of patients in clonidine treated group required additional sedation by diazepam on account of fall of bp on increasing infusion rate to maximum set level . requirement of additional sedation in this group was about 43% more than dexmedetomidine treated group . in a retrospective analysis of patients receiving clonidine for icu sedation , gillison et al . have reported that clonidine reduces requirement of additional sedation and analgesia , but at the cost of higher than routinely prescribed dose . only 8/35 patients ( 23% ) patients in group d needed additional sedation which agrees with findings of martin et al . there is no consensus on appropriate dose regimen of clonidine during icu sedation and is extremely variable when given by continuous infusion . however , the usual dose is in the order of 100 g / h . we used an initial dose of 1 g / kg / h of clonidine for infusion titrated to 2 g / kg / h as the maximum dose . the dose of dexmedetomidine for icu sedation varies greatly ranging between 0.2 and 2.5 g / kg / h . in our study , we used a loading dose of 0.7 g / kg followed by 0.2 - 0.7 g / kg / h . a meta - analysis by tan and ho ( 2010 ) observed that incidence of bradycardia requiring intervention increased in studies that used both a loading dose and maintenance doses of dexmedetomidine in excess of 0.7 g / kg / h . transient hypertensive responses have also been observed with higher doses due to initial stimulation of 2b receptors present in vascular smooth muscles . baseline heart rates which were high in both groups settled to an optimal range over the study period . hypotension was more commonly seen in group c compared with group d. 50% of the hypotensive episodes occurred within 2 - 4 h in group c and after bolus infusion and within 2 h after maintenance infusion in group d , as the steady state plasma concentration of the drugs are achieved at this time duration , causing vasodilatation and hypotension . in general , hemodynamic stability was preserved in most patients receiving dexmedetomidine , a finding in agreement with many previous studies . eleven out of 14 patients in group c requiring additional sedation to achieve target sedation experienced hypotension on increasing the dose from 1 up to 2 g / kg / h . this observation was consistent with previous studies of clonidine where adverse hemodynamic effects occurred at doses required for sedation . previous studies of icu sedation with dexmedetomidine have found no or minimal increase in heart rate and bp following abrupt cessation , the finding similar to this study . in group c , a small study group containing patients mostly postsurgical precluded an extensive study on a heterogeneous icu population . a short study period was considered as dexmedetomidine has been approved by food and drug administration as a sedative in the icu for patients undergoing mechanical ventilation of < 24 h duration . being an open - label study , there is an inherent potential for observer bias . due to the unavailability of bispectral index ( bis ) at our center we restricted our assessment of the degree of sedation to rss . it is a highly reliable and well - validated sedation scale for use in icu and has also been shown to have a good correlation with bis . both dexmedetomidine and clonidine can be used as sedative agents for short term icu sedation of postsurgical patients . on the basis of our study data further trials with both drugs may define their exact role for sedation of icu patients .

background and objectives : patients on mechanical ventilation in intensive care unit ( icu ) are often uncomfortable because of anxiety , pain , and endotracheal intubation ; therefore , require sedation . alpha-2 agonists are known to produce sedation . we compared clonidine and dexmedetomidine as sole agents for sedation.study design : prospective , randomized , controlled open - label study.materials and methods : a total of 70 patients requiring a minimum of 12 h of mechanical ventilation with concomitant sedation , were randomly allocated into two groups . group c ( n = 35 ) received intravenous ( iv ) clonidine ( 1 g / kg / h titrated up to 2 g / kg / h to attain target sedation ) , and group d ( n = 35 ) received iv dexmedetomidine for sedation ( loading 0.7 g / kg and maintenance 0.2 g / kg / h titrated up to 0.7 g / kg / h to achieve target sedation ) . a ramsay sedation score of 3 - 4 was considered as target sedation . additional sedation with diazepam was given when required to achieve target sedation . the quality of sedation , hemodynamic changes and adverse effects were noted and compared between the two groups.results:target sedation was achieved in 86% observations in group d and 62% in group c ( p = 0.04 ) . additional sedation was needed by more patients in group c compared with group d ( 14 and 8 in groups c and d , respectively , p = 0.034 ) , mainly due to concomitant hypotension on increasing the dose of clonidine . hypotension was the most common side - effect in group c , occurring in 11/35 patients of group c and 3/35 patients of group d ( p = 0.02 ) . rebound hypertension was seen in four patients receiving clonidine , but none in receiving dexmedetomidine.conclusion:both clonidine and dexmedetomidine produced effective sedation ; however , the hemodynamic stability provided by dexmedetomidine gives it an edge over clonidine for short - term sedation of icu patients .

Introduction Materials and Methods None Patients Study drugs Monitoring Protocol for sedation and analgesia Statistical analysis Results Discussion Conclusion

somalia , the easternmost nation in the horn of africa,1 is classified as a fragile state . the recurrent civil conflict for over 20 years has impeded progress toward improving health care in somalia.2 its capital mogadishu has been a haven for armed gangs , islamic militants , and pirates , and for more than two decades , the country has been characterized by insecurity and outbreaks of hunger and inadequate access to basic needs and services.3 according to a recent united nations population fund report , somalia s population stands at 12.3 million people with 45.6% of its people < 15 years of age.4 it is a youthful population , with a growth rate of 2.8% , which is among the highest in the world.5 on average , every woman bears 6.6 children6 and each household in somalia has a mean of 5.9 persons.4 the current insecurity has undermined the impact of humanitarian assistance in somalia , a country where half of the population is dependent on health relief and food aid . the government has been unable to implement the rule of law , and external aid including medical supplies constantly faces the threat of diversion.7 the increase and continuous influx of injured people has created conflict of interest for health care resources and prioritization of allocating funds . monitoring of progress in the public health arena has deteriorated , hence the need to provide progressive assessment of health outcomes . since 2008 , demographic surveillance and birth and death registration systems have come to a standstill , and this limits tracking of progress of health indicators . through the multiple indicator cluster survey , the united nations international children s fund established a platform to monitor child and maternal indicators ; however , this was only possible until 2006.8 there has been a census recently ; however , there is no demographic and health surveillance data which are informative about the county s health indicators . it is mainly urban with a population of 1.6 million people , and it had the highest number of internally displaced persons in the country by 2014.4 banadir hospital,9 also known as the only national referral hospital in somalia , has since its establishment been the center of health care delivery in mogadishu . the hospital comprises both maternity and pediatric departments where mothers and children are treated , respectively ; however its emergency department offers routine medical and surgical services . in this article , our primary objective was to explore morbidity and mortality patterns of the presenting conditions in the different units at the hospital such that an overview of somalia can be inferred . sex is a multidimensional social construct10 and investigation of this precedent would provide an insight into health outcomes for males in a male - dominated community at war . the gender inequality index11 for somalia is 0.776 ( with a maximum of 1 , meaning complete inequality ) , which is the fourth highest position globally,12 and studies have shown that gender inequality index is positively associated with under-5 mortality rates.13 we also highlight the hospital s performance , gaps in management , and progress made during this study period . banadir hospital is a teaching hospital located in the wadajir district of mogadishu in somalia . it consists of four main sections : a pediatric section , a maternity section , a laboratory , and a section for general medicine with a bed capacity of 700 . the hospital offers medical and surgical services and also voluntary counselling and testing ( vct ) for human immunodeficiency virus ( hiv ) , prevention of mother - to - child transmission ( pmtct),14 and the expanded program on immunization ( epi ) services.15 patients are usually admitted through the out - patient department ; however , emergencies are received at the accident and emergency unit . admission and medicines are free , but laboratory tests and x - ray services are priced . the hospital is mainly funded by nongovernmental organizations , and they equally provide training to staff including doctors , nurses , and nurses assistants . data were collected between january 2008 and december 2012 . all patients that were diagnosed and attended to at the hospital were included in the study . patient consent was not required as this was aggregated data that was anonymous and had no patient identifying information . for 5 years , aggregated data were obtained from patients records and it included age ( dichotomized as < 5 or > 5 years ) , sex , their presenting diagnosis , and outcomes . diagnoses were made by the doctors who attended to the patients in each unit in accordance with somalia s clinical guidelines and also laboratory confirmation . data completeness were not ascertained ; however , data of all patients treated at the hospital were recorded . annual data were compiled into a report and recorded on a morbidity and surveillance form . total number of admissions , discharges , and deaths were also compiled for every month . data obtained from the maternity ward included numbers of live births and stillbirths , deliveries , and cases of tetanus . data from the pediatric section and the laboratory were also obtained . patients that died before diagnosis were diagnosed through post mortem done at the hospital by hospital staff , and those that lacked a diagnosis were included in a category of others . this data were compiled weekly and monthly figures were compiled using the mortality and morbidity surveillance form by the data manager of the hospital . proofreading to ascertain correct figures was done for the data collected from all the respective units for quality control . ethical clearance for the study was obtained from the staff in charge of hospital since the hospital has no ethics review board . data obtained during the 5 years were summarized according to the presented conditions with respect to age groups and stratified by sex . univariate analyses were carried out to examine the association between sex and mortality . in these analyses , a two - tailed p - value of 0.1 or less was considered to be significant . crude odds ratios ( cors ) were obtained for years in which outcomes were significantly associated with sex . banadir hospital is a teaching hospital located in the wadajir district of mogadishu in somalia . it consists of four main sections : a pediatric section , a maternity section , a laboratory , and a section for general medicine with a bed capacity of 700 . the hospital offers medical and surgical services and also voluntary counselling and testing ( vct ) for human immunodeficiency virus ( hiv ) , prevention of mother - to - child transmission ( pmtct),14 and the expanded program on immunization ( epi ) services.15 patients are usually admitted through the out - patient department ; however , emergencies are received at the accident and emergency unit . admission and medicines are free , but laboratory tests and x - ray services are priced . the hospital is mainly funded by nongovernmental organizations , and they equally provide training to staff including doctors , nurses , and nurses assistants . all patients that were diagnosed and attended to at the hospital were included in the study . patient consent was not required as this was aggregated data that was anonymous and had no patient identifying information . for 5 years , aggregated data were obtained from patients records and it included age ( dichotomized as < 5 or > 5 years ) , sex , their presenting diagnosis , and outcomes . diagnoses were made by the doctors who attended to the patients in each unit in accordance with somalia s clinical guidelines and also laboratory confirmation . data completeness were not ascertained ; however , data of all patients treated at the hospital were recorded . annual data were compiled into a report and recorded on a morbidity and surveillance form . total number of admissions , discharges , and deaths were also compiled for every month . data obtained from the maternity ward included numbers of live births and stillbirths , deliveries , and cases of tetanus . data from the pediatric section and the laboratory were also obtained . patients that died before diagnosis were diagnosed through post mortem done at the hospital by hospital staff , and those that lacked a diagnosis were included in a category of others . this data were compiled weekly and monthly figures were compiled using the mortality and morbidity surveillance form by the data manager of the hospital . proofreading to ascertain correct figures was done for the data collected from all the respective units for quality control . ethical clearance for the study was obtained from the staff in charge of hospital since the hospital has no ethics review board . data obtained during the 5 years were summarized according to the presented conditions with respect to age groups and stratified by sex . univariate analyses were carried out to examine the association between sex and mortality . in these analyses , a two - tailed p - value of 0.1 or less was considered to be significant . crude odds ratios ( cors ) were obtained for years in which outcomes were significantly associated with sex . major diagnoses across all age groups included uncomplicated malaria , acute watery diarrhea , anemia , presence of intestinal parasites , and urinary tract infection ( table 1 ) . the main diagnoses among children age < 5 years were malaria , acute watery diarrhea , and respiratory tract infections . meningitis , tetanus , whooping cough , and conjunctivitis presented the least cases during the study period . there was an exponential increase in measles cases every other year and a decrease in the year that followed , by 2012 . the reported number of patients with sexually transmitted diseases ( stds ) almost doubled each year making a sixfold increase by 2012 . these cases were , however , reported only among girls > 5 years of age . the percentage of complicated cases among the cases of malaria that presented reduced from 30% to 20% by 2012 . trauma cases reported increased across the study period with a higher number of males than females across the study period . between 2008 and 2010 , the number of cases at the diarrhea treatment center declined ( figure 1 ) . there was an exponential increase from september 2010 to november 2011 and cases there after reduced gradually toward the end of 2012 . monthly reporting of cases throughout the study period indicated that cases were higher between april and august each study year . mortality due to diarrhea followed a similar pattern in both age groups ( table 2 ) . between 2008 and 2009 , mortality declined in both age groups and increased between 2009 and 2011 . the number of live births at banadir hospital increased between 2008 and 2012 ; however , the number of stillbirths remained constant . the ratio of stillbirths to live births therefore declined over the study period ( figure 2 ) . there was a consistent decline in the rate of stillbirths from 272 ( per 1,000 live births ) in 2008 to 102 in 2009 . this reduced further to 71 , 85 , and 48 in 2010 , 2011 , and 2012 , respectively . death from neonatal tetanus stagnated at a mean rate of 27% for all the cases of neonatal tetanus presented . the sum of total cases that were attended to at the hospital by the end of 2012 was four times the number at the baseline year of the study in 2008 ( figure 3 ) , an increase from 15,324 to 64,588 . the overall mortality rate among those admitted declined between 2008 and 2012 ( table 3 ) . at a significant level of 0.1 , however , mortality in the age group > 5 years was consistently associated with sex across the study period ( table 4 ) . the odds of dying for males compared to females in the age group > 5 years were as follows : cor = 1.98 ( 95% confidence interval [ ci ] : 0.94.3 , p<0.1 ) in 2008 ; cor = 1.85 ( 95% ci : 0.93.7 , p<0.1 ) in 2009 ; cor = 1.80 ( 95% ci : 0.83.7 , p<0.1 ) in 2010 ; cor = 1.77 ( 95% ci : 1.03.1 , p<0.1 ) in 2011 ; and cor = 1.52 ( 95% ci : 1.12.1 , p<0.1 ) in 2012 . given the lack of data on a population level , this analysis aimed at understanding the patterns of conditions presented at banadir hospital in order to make inference and conclusions about the general health status of banadir region . it is evident from the results that malaria , acute watery diarrhea , and respiratory tract infections dominated the continuum of causes of admissions despite the integrated community case management , a result that is consistent with world health organization findings.16 although measles cases were on the rise , current data indicates that banadir region is a high endemic area and findings could not be generalized to the entire population.17 measles is one of the leading killers of young children particularly in the malnourished , a situation that is consistent with findings in somalia . measles immunization coverage remains low with less than one - third of children under 1 year vaccinated against measles.17 according to the african union mission in somalia,18 cases of hiv are on the rise with low case detection due to the absence of diagnostics and stigma from the community.18 this could explain the annual doubling of std cases although the rate of stds was normal . absence of std cases among boys age > 5 years , however , shows a gap in case detection since females are usually investigated at the maternity section . the reduction in the proportion of complicated cases of malaria indicates that there is improvement in early case detection and diagnosis for malaria within the catchment area for banadir hospital ; however , data on case fatality were not available . at the beginning of 2008 , the gradual increase in the number of patients at banadir hospital was consistent with the country s population increment.19 this trend ; however , changed in mid-2010 ( figure 4 ) with an increase in the rate of hospitalization in relation to the population . this can be explained by the famine and hunger associated illnesses that the country faced during that time . between 2010 and 2012 , the united nations reported the worst drought that ever hit somalia in the last 60 years.20 the increased rate of hospitalization also implies that the hospital provides much more care now than before . there was a clear relation between the annual rainfall pattern and that of diarrhea cases.21 in 2012 , mdecins sans frontires documented the increased cases of acute watery diarrhea in southern somalia,22 in line with findings of this study . the increase in cases observed between 2011 and 2012 could also be attributed to the cholera outbreak in the region . this was essentially due to poor sanitation , shortage of safe water , and overcrowding , which were exacerbated by the seasonal flooding of the shebelle river . a recent report by world health organization shows that trauma cases are on the rise,17 which has been highlighted in findings at the hospital . violence and conflict continue to take a heavy toll on civilians in somalia with escalating numbers of weapon - related injuries . despite the conflict , the cause of trauma cases among children age < 5 years needs to be investigated . the role of males in the civil strife has led to the increased numbers of trauma cases among males compared to the females . there was no consistent association between sex and under-5 mortality in this study in contrast to previous studies.13,23 these studies found that male sex was not an independent predictor of mortality among hospitalized children < 5 years of age in the presence of risk factors like age , associated comorbidities , and severity of respective illnesses.24 for the age group > 5 years , sex was consistently associated with higher mortality among males . it was not possible to highlight possible risk factors because of the nature of the data . although studies have shown that conflict overshadows the social and sex issues , rendering them secondary to the primary concern of safety and survival,25 further research in this area would yield better explanations . it is possible that males presented with more critical conditions than females ; however , this could not be ascertained from the study data . the overall reduction in hospital mortality despite the increased number of patients attended to over the years is indicative of the improvement in performance of the hospital . although the world bank reports an under-5 mortality rate of 146 in somalia,26 this study was not able to highlight changes in mortality rate over time . it is important to reflect on the fact that the overall hospital under-5 mortality among admitted cases has reduced and to highlight the progress that has been made . the increase in the number of patients can also be attributed to the observed number of live births that was much higher than the death rate . the increase in live births at the hospital with no significant increase in stillbirths could explain the increase in the region s population and also an increase in the number of patients attended to at the hospital during the study period . somalia s birth rate stands at 41 births per 1,000 population and the death rate reduced from 15.9 to 13.9 deaths per 1,000 population despite the fact that the country is at war.27 owing to this , information from banadir hospital could be essential in evaluating health system performance and provide reliable facts on planning for this catchment area . according to the performance assessment tool for quality improvement in hospitals model , the increase in the number of patients attended to at the hospital with reduction in mortality is indicative of positive performance.28 the study involved a large data set for making good comparisons and detecting trends over time , for the first time in 2 decades of war ; however , the data were aggregated making it hard to perform detailed analyses and making more concrete conclusions . categories had been prefixed before the data were collected , which could not allow flexibility in the data analysis . analyzing trends in this context disease - specific mortality was not possible in the study , which would have provided a better analysis of conditions . there may have been a selection of more serious cases being admitted to the hospital , which may also distort the results ; however , sufficient information on the primary health care system in this war setting was not readily available to back up some of our arguments . given the lack of data on a population level , this analysis aimed at understanding the patterns of conditions presented at banadir hospital in order to make inference and conclusions about the general health status of banadir region . it is evident from the results that malaria , acute watery diarrhea , and respiratory tract infections dominated the continuum of causes of admissions despite the integrated community case management , a result that is consistent with world health organization findings.16 although measles cases were on the rise , current data indicates that banadir region is a high endemic area and findings could not be generalized to the entire population.17 measles is one of the leading killers of young children particularly in the malnourished , a situation that is consistent with findings in somalia . measles immunization coverage remains low with less than one - third of children under 1 year vaccinated against measles.17 according to the african union mission in somalia,18 cases of hiv are on the rise with low case detection due to the absence of diagnostics and stigma from the community.18 this could explain the annual doubling of std cases although the rate of stds was normal . absence of std cases among boys age > 5 years , however , shows a gap in case detection since females are usually investigated at the maternity section . the reduction in the proportion of complicated cases of malaria indicates that there is improvement in early case detection and diagnosis for malaria within the catchment area for banadir hospital ; however , data on case fatality were not available . at the beginning of 2008 , the gradual increase in the number of patients at banadir hospital was consistent with the country s population increment.19 this trend ; however , changed in mid-2010 ( figure 4 ) with an increase in the rate of hospitalization in relation to the population . this can be explained by the famine and hunger associated illnesses that the country faced during that time . between 2010 and 2012 , the united nations reported the worst drought that ever hit somalia in the last 60 years.20 the increased rate of hospitalization also implies that the hospital provides much more care now than before . there was a clear relation between the annual rainfall pattern and that of diarrhea cases.21 in 2012 , mdecins sans frontires documented the increased cases of acute watery diarrhea in southern somalia,22 in line with findings of this study . the increase in cases observed between 2011 and 2012 could also be attributed to the cholera outbreak in the region . this was essentially due to poor sanitation , shortage of safe water , and overcrowding , which were exacerbated by the seasonal flooding of the shebelle river . a recent report by world health organization shows that trauma cases are on the rise,17 which has been highlighted in findings at the hospital . violence and conflict continue to take a heavy toll on civilians in somalia with escalating numbers of weapon - related injuries . despite the conflict , the cause of trauma cases among children age < 5 years needs to be investigated . the role of males in the civil strife has led to the increased numbers of trauma cases among males compared to the females . there was no consistent association between sex and under-5 mortality in this study in contrast to previous studies.13,23 these studies found that male sex was not an independent predictor of mortality among hospitalized children < 5 years of age in the presence of risk factors like age , associated comorbidities , and severity of respective illnesses.24 for the age group > 5 years , sex was consistently associated with higher mortality among males . it was not possible to highlight possible risk factors because of the nature of the data . although studies have shown that conflict overshadows the social and sex issues , rendering them secondary to the primary concern of safety and survival,25 further research in this area would yield better explanations . it is possible that males presented with more critical conditions than females ; however , this could not be ascertained from the study data . the overall reduction in hospital mortality despite the increased number of patients attended to over the years is indicative of the improvement in performance of the hospital . although the world bank reports an under-5 mortality rate of 146 in somalia,26 this study was not able to highlight changes in mortality rate over time . it is important to reflect on the fact that the overall hospital under-5 mortality among admitted cases has reduced and to highlight the progress that has been made . the increase in the number of patients can also be attributed to the observed number of live births that was much higher than the death rate . the increase in live births at the hospital with no significant increase in stillbirths could explain the increase in the region s population and also an increase in the number of patients attended to at the hospital during the study period . somalia s birth rate stands at 41 births per 1,000 population and the death rate reduced from 15.9 to 13.9 deaths per 1,000 population despite the fact that the country is at war.27 owing to this , information from banadir hospital could be essential in evaluating health system performance and provide reliable facts on planning for this catchment area . according to the performance assessment tool for quality improvement in hospitals model , the increase in the number of patients attended to at the hospital with reduction in mortality is indicative of positive performance.28 the study involved a large data set for making good comparisons and detecting trends over time , for the first time in 2 decades of war ; however , the data were aggregated making it hard to perform detailed analyses and making more concrete conclusions . categories had been prefixed before the data were collected , which could not allow flexibility in the data analysis . analyzing trends in this context disease - specific mortality was not possible in the study , which would have provided a better analysis of conditions . there may have been a selection of more serious cases being admitted to the hospital , which may also distort the results ; however , sufficient information on the primary health care system in this war setting was not readily available to back up some of our arguments . diseases of infectious origin dominated the continuum of cases attended to at the hospital , and hospital - based mortality reduced across the study period . data from banadir hospital were consistent with findings from banadir region although figures from hospital - based studies are higher than those in the general population . this data can be used to describe the health status of the community in the absence of credible demographic surveillance in banadir region as earlier stated . hospital - based studies would work as early surveillance tools in a sentinel site , since hospital cases may be observed to increase before the outbreak . there was an association between mortality in the age group > 5 years and sex with a protective advantage for females compared to males . our results only reflect that there is a difference in outcome of patient admissions with respect to sex in the age group > 5 years but do not show that the female sex is positioned better than the male . the situation of war and increased risk of injury for males should be put into context in this study . there are better outcomes at the hospital with progressive improvement during the study period ; however , these outcomes are still low in comparison to global standards .

backgroundthe recurrent civil conflict in somalia has impeded progress toward improving health and health care , with lack of data and poor performance of health indicators . this study aimed at making inference about banadir region by exploring morbidity and mortality trends at banadir hospital . this is one of the few functional hospitals during war.methodsa retrospective analysis was conducted with data collected at banadir hospital for the period of january 2008december 2012 . the data were aggregated from patient records and summarized on a morbidity and mortality surveillance form with respect to age groups and stratified by sex . the main outcome was the number of patients that died in the hospital . chi - square tests were used to evaluate the association between sex and hospital mortality.resultsconditions of infectious origin were the major presentations at the hospital . the year 2011 recorded the highest number of cases of diarrhea and mortality due to diarrhea . the stillbirth rate declined during the study period from 272 to 48 stillbirths per 1,000 live births by 2012 . the sum of total cases that were attended to at the hospital by the end of 2012 was four times the number at the baseline year of the study in 2008 ; however , the overall mortality rate among those admitted declined between 2008 and 2012.conclusionthere was reduction in patient mortality at the hospital over the study period . data from banadir hospital are consistent with findings from banadir region and could give credible public health reflections for the region given the lack of data on a population level .

Background Data and methods Study design and setting Data collection Ethical clearance Data management and analysis Results Discussion Disease patterns Health system implications Limitations Conclusion

mandibular nerve block is commonly used for diagnosis and treatment of trigeminal neuralgia involving the mandibular division . neurolytic blockade with absolute alcohol / phenol is usually required after diagnostic block to provide long term pain relief . common complications of this block are hypoesthesia , dysesthesia , chemical neuritis , sensory loss in mandibular nerve distribution and very rarely facial and occulomotor palsy and masseter muscle weakness leading to difficulty in chewing . we report a rare complication in a patient with mandibular neuralgia , who developed prolonged severe vertigo and ataxia after neurolytic blockade of mandibular nerve with absolute alcohol . a 65 year old male patient presented to our pain clinic with complaint of right sided facial pain for the last 2 years . the pain was excruciating and confined to right lower jaw . he was diagnosed as a case of right sided trigeminal neuralgia involving the mandibular division ( v3 ) . he was on regular medication with oral carbamazepine 200 mg three times daily and gabapentin 300 mg twice daily . his symptoms had worsened in last few days and the pain became refractory to treatment . clinical examination revealed pulse rate 70/minute and blood pressure of 140/90 mmhg . as the pain distribution was in the mandibular division , involving whole right lower jaw up to ear , neurolytic block of the right mandibular nerve was planned . the patient was placed in supine position with head tilted to left - side . after aseptic preparation and draping of the part , skin and subcutaneous tissue was infiltrated with 3 ml of 2% lignocaine . a 9.0 cm 22 gauge ( g ) needle was introduced perpendicularly in the middle of coronal process at midpoint of inferior border of right zygomatic arch . the needle was withdrawn slightly and directed posteriorly towards the ear so that it passed the posterior border of the pterygoid plate . the needle was then carefully advanced 0.5 cm each time till the patient reported paresthesia over mandibular region . after negative aspiration of blood , diagnostic block with 3 ml of 2% lignocaine was given . five minutes after eliciting hypoesthesia in mandibular distribution , 1 ml of absolute alcohol ( aa ) was given for the neurolytic block . after about 5 minutes of the block , when the patient was allowed to sit up , he complained of severe giddiness ( vertigo ) and was not able to sit and stand up . vertigo was associated with severe nausea and vomiting , however , patient`s hearing and speech was normal . the patient was immediately placed in supine position and vital examination revealed pulse rate of 60/minutes and blood pressure of 210/110 mmhg . the patient was given 500 ml of intravenous fluid ( dextrose /saline ) with 8 mg ondansetron intravenous and 10 mg nifedipine sublingually for treating vomiting and hypertension , respectively . after 30 minutes , the patient was reassessed and was found to have severe vertigo while sitting , and ataxia while walking . his blood pressure had decreased to 170/90 mmhg and his nausea and vomiting stopped . in view of persistent vertigo and ataxia , complete neurological evaluation was performed however , no significant abnormality was found except for vertigo and ataxia with tendency to fall on right side . it was decided to admit the patient in the ward for further investigation , observation and management . computerized tomography ( ct ) scan brain was performed to rule out any central cause of ataxia , which was found to be normal . patient slept well in the night and was reassessed the next morning . by this time , patient had improved significantly and was not having vertigo , ataxia or nausea and vomiting . as the patient`s vertigo and ataxia had significantly improved and he was able to walk normally , he was discharged from the hospital with advice to come for regular follow - up after one week . the patient was found to be pain free with slight hypesthesia in the right mandibular distribution . usual complications of mandibular nerve block are hypoesthesia , dysesthesia , sensory loss in mandibular nerve distribution , facial swelling and masseter muscle weakness . accidental injuries to the auditory tube while trying to locate or block the mandibular nerve are possible , as it is in close proximity . if this occurs during or after the test injection following local anesthetic , one should defer the injection of neurolytic agent . diagnostic test injection with 3 ml of 2% lignocaine was uneventful and there was no resistance to injection or symptom of auditory tube irritation , i.e. pain in ear , deafness etc . patient developed severe vertigo and ataxia five minutes after the aa injection when he was allowed to sit - up , stand and walk . he also developed hypertension ( blood pressure-210/110 mmhg ) and two episodes of severe nausea and vomiting . reported the first and only case report of vertigo during mandibular nerve block with aa . they attributed this to multiple factors : firstly their patient had received multiple neurolytic blocks before , which probably had resulted in tissue inflammation and adhesion formation ; secondly , the patient had pain in the ear during the advancement of the needle and there was high resistance to aa injection , indicating injury to auditory tube ; and lastly , their patient also developed prolonged horizontal nystagmus along with vertigo . the clinical manifestations in our patient were however different as he had not received any neurolytic block before , had no pain during injection and there was no resistance during injection of either lignocaine or aa . we used a 22 g , 9 cm sharp tip spinal needle for the block , due to the non availability of blunt tip needle . we may have inadvertently injured the cartilaginous part of auditory tube with the block needle and a small amount of aa might have entered the auditory canal and reached the vestibular apparatus resulting in vertigo and ataxia . in patients who receive repeated neurolytic mandibular nerve blocks , abnormal degeneration in the tissues surrounding the nerve should be considered and all agents should be injected precisely and slowly . whenever there is a suspicion of injury to auditory canal , it is advisable to defer neurolytic blockade with aa . patients should be closely observed for at least an hour after the block when aa is used because stimulation of the vestibular apparatus may be delayed . in the case reported , we did not observe any pain or resistance to injection to lignocaine or alcohol which may have alarmed us about the complication . vertebro basilar ischemia or posterior circulation stroke may present as vertigo , ataxia , diplopia , dysartheria and weakness of one or both side of body . our patient was 65 years old and developed vertigo , ataxia and hypertension after the neurolytic mandibular block . our patient did not have nystagmus , diplopia , and dysartheria and was not a known hypertensive . features favoring vestibular ataxia , and not the central cerebellar ataxia included : presence of severe vertigo , associated with body movement ; presence of severe nausea and vomiting ; severe ataxia with tendency to fall toward affected side ; and increase in imbalance while walking with closed eyes . neurology consultation was taken and ct scan brain was performed to rule out any possibility of stroke which was found to be normal . we have presented a patient of trigeminal neuralgia , who developed prolonged severe vertigo , ataxia and hypertension after the mandibular nerve block with aa , which gradually improved over 24 hours . we emphasize that in trigeminal neuralgia patients , who usually require repeated neurolytic mandibular block , the possibility of severe vertigo and ataxia should be kept in mind , as it may be associated with increased risk and complications , requiring prolonged observation and management . use of guided techniques ( nerve locator , fluoroscopy , ultrasound or ct guidance ) can be considered in some selected patients .

common complications of neurolytic mandibular nerve block are hypoesthesia , dysesthesia , and chemical neuritis . we report a rare complication , prolonged severe vertigo and ataxia , after neurolytic mandibular blockade in a patient suffering from trigeminal neuralgia . coronoid approach was used for right sided mandibular block . after successful test injection with local anesthetic , absolute alcohol was given for neurolytic block . immediately after alcohol injection , patient developed nausea and vomiting along with severe vertigo , ataxia and hypertension . neurological evaluation was normal except for the presence of vertigo and ataxia . computerised tomography scan brain was also normal . patient was admitted for observation and symptomatic treatment was given . vertigo and ataxia gradually improved over 24 hours .

Introduction Case Report Discussion

the psesame - cre expression vector was constructed by inserting a cre - encoding fragment into psesame via avrii and nhei restriction sites using standard cloning methods . psesame encodes a fusion protein consisting of a histidine - tag , tat - domain , nls sequence and cre , abbreviated htncre . for expression of htncre the psesame - cre was transformed into tuner ( de3 ) placi and used to prepare a glycerol stock . an over - night culture was inoculated using a pipet tip coated with transformed bacteria from the glycerol stock . the over - night culture consisted of lb media supplemented with 0.5% glucose [ v / v ] and carbenicillin at a final concentration of 50 g / ml and was allowed to grow at 37c for 16 hours . next day the densely grown over - night culture was used to inoculate the expression culture at a ratio of 1 to 40 and was put in an incubator at 37c . expression culture consisted of tb media supplemented with 0.5% glucose [ v / v ] and ampicillin at a final concentration of 100 g / ml . at an od595 of 1.5 the expression culture was induced with 0.5 mm iptg for 1 h. subsequently bacteria were collected by centrifugation at 5000 rpm for 10 minutes in a sla3000 rotor . frozen bacteria pellets were resuspended in 10 ml lysis buffer per liter flask culture for 15 minutes at room temperature . suspension was then incubated with 1 mg / ml lysozyme for additional 15 minutes while mixing at room temperature . 25 u / ml benzonase was added afterwards and incubated while mixing for 15 minutes at room temperature . after sonification on ice for 1.5 min with 0.5 s pulses at 45% of the power , 1 ml cold tartaric salt buffer ( tsb ) per ml suspension was carefully added while mixing and incubated for 5 min on ice . sds - page samples of soluble ( s ) and insoluble fractions ( i ) were taken . the supernatant was transferred into fresh 50 ml falcon tubes and was then gently mixed for 1 h at 4c with 2 ml of 50% ni - nta slurry per liter of initial expression culture . the suspension was packed into a gravity flow econopac column ( sds - page sample of flow - through fraction ( ft ) was taken ) and washed twice with 5 bed - volumes of washing buffer . sds - page samples of both washing fractions ( w1 & w2 ) were collected . htncre - containing fractions were eluted with 3 bed - volumes of elution buffer and sample of eluate fraction ( e ) for sds - page analysis was taken . the protein solution was further concentrated by dialyzing against glycerol buffer twice . in all dialysis steps this procedure resulted in a glycerol stock solution containing htncre at a usual concentration between 200 and 450 m , i.e. 1 liter of expression culture will result in ~12 mg of protein . figure 1 : sds - page analysis of the samples collected during the purification process of cre recombinase . although a part of the protein is insoluble the cre protein can be further enriched as seen in eluate and glycerol stock fractions . l : lysate , i : insoluble , s : supernatant , ft : flow - through , w : washing , e : eluate , gs : gylcerol stock . es cells carrying a conditional -galactosidase reporter construct were seeded as single cells using tryple express for dissociation of adherent cells . after 4 to 6 hours the cells had re - attached and the medium was removed . an appropriate amount of htncre protein ( corresponding to 10 m ) out of the glycerol stock was diluted into es medium and subsequently sterile filtrated ( 0.22 m ) . an appropriate amount of htncre protein ( corresponding to 10 m ) out of the glycerol stock was diluted into es medium and subsequently sterile filtrated ( 0.22 m ) . after protein transduction medium after two days cells were washed with pbs and fixed with 4% paraformaldehyde ( pfa ) for 10 minutes . two additional washing steps with pbs were executed before x - gal staining was performed . fixed cells were covered with a layer of x - gal staining solution and incubated over night at 37c . next day x - gal staining solution was aspired and the cells were covered with a layer of pbs for microscopy analysis . 80 to 100% of recombined cells could be observed within the murine es cells judged by -galactosidase activity . the psesame - cre expression vector was constructed by inserting a cre - encoding fragment into psesame via avrii and nhei restriction sites using standard cloning methods . psesame encodes a fusion protein consisting of a histidine - tag , tat - domain , nls sequence and cre , abbreviated htncre . for expression of htncre the psesame - cre was transformed into tuner ( de3 ) placi and used to prepare a glycerol stock . an over - night culture was inoculated using a pipet tip coated with transformed bacteria from the glycerol stock . the over - night culture consisted of lb media supplemented with 0.5% glucose [ v / v ] and carbenicillin at a final concentration of 50 g / ml and was allowed to grow at 37c for 16 hours . next day the densely grown over - night culture was used to inoculate the expression culture at a ratio of 1 to 40 and was put in an incubator at 37c . expression culture consisted of tb media supplemented with 0.5% glucose [ v / v ] and ampicillin at a final concentration of 100 g / ml . at an od595 of 1.5 the expression culture was induced with 0.5 mm iptg for 1 h. subsequently bacteria were collected by centrifugation at 5000 rpm for 10 minutes in a sla3000 rotor . frozen bacteria pellets were resuspended in 10 ml lysis buffer per liter flask culture for 15 minutes at room temperature . suspension was then incubated with 1 mg / ml lysozyme for additional 15 minutes while mixing at room temperature . 25 u / ml benzonase was added afterwards and incubated while mixing for 15 minutes at room temperature . after sonification on ice for 1.5 min with 0.5 s pulses at 45% of the power , 1 ml cold tartaric salt buffer ( tsb ) per ml suspension was carefully added while mixing and incubated for 5 min on ice . sds - page samples of soluble ( s ) and insoluble fractions ( i ) were taken . the supernatant was transferred into fresh 50 ml falcon tubes and was then gently mixed for 1 h at 4c with 2 ml of 50% ni - nta slurry per liter of initial expression culture . the suspension was packed into a gravity flow econopac column ( sds - page sample of flow - through fraction ( ft ) was taken ) and washed twice with 5 bed - volumes of washing buffer . sds - page samples of both washing fractions ( w1 & w2 ) were collected . htncre - containing fractions were eluted with 3 bed - volumes of elution buffer and sample of eluate fraction ( e ) for sds - page analysis was taken . the protein solution was further concentrated by dialyzing against glycerol buffer twice . in all dialysis steps this procedure resulted in a glycerol stock solution containing htncre at a usual concentration between 200 and 450 m , i.e. 1 liter of expression culture will result in ~12 mg of protein . figure 1 : sds - page analysis of the samples collected during the purification process of cre recombinase . although a part of the protein is insoluble the cre protein can be further enriched as seen in eluate and glycerol stock fractions . l : lysate , i : insoluble , s : supernatant , ft : flow - through , w : washing , e : eluate , gs : gylcerol stock . es cells carrying a conditional -galactosidase reporter construct were seeded as single cells using tryple express for dissociation of adherent cells . after 4 to 6 hours the cells had re - attached and the medium was removed . an appropriate amount of htncre protein ( corresponding to 10 m ) out of the glycerol stock was diluted into es medium and subsequently sterile filtrated ( 0.22 m ) . an appropriate amount of htncre protein ( corresponding to 10 m ) out of the glycerol stock was diluted into es medium and subsequently sterile filtrated ( 0.22 m ) . after protein transduction medium after two days cells were washed with pbs and fixed with 4% paraformaldehyde ( pfa ) for 10 minutes . two additional washing steps with pbs were executed before x - gal staining was performed . fixed cells were covered with a layer of x - gal staining solution and incubated over night at 37c . next day x - gal staining solution was aspired and the cells were covered with a layer of pbs for microscopy analysis . 80 to 100% of recombined cells could be observed within the murine es cells judged by -galactosidase activity . during the purification process of the cre fusion protein it is important not to omit the addition of ice cold tbs buffer prior to centrifugation . if the eluate fraction appears to become turbid due to the high concentration of fusion protein additional elution buffer should be added until the solution has cleared again . the application of 10 m of cre fusion protein typically results in a recombination efficiency of 80 to 100% . fetal calf serum ( fcs ) being a major component of es cell medium strongly inhibits protein transduction when working in serum - free conditions less protein ( 0.5 - 2 m ) can be used to achieve similar recombination efficiencies . with the psesame vector system at hand one can apply the technique of protein transduction to other proteins including transcription factors such as oct4 and sox2 and scl / tal1 .

the protein transduction technique enables the direct delivery of biologically active material into mammalian cells [ for review see 1,2 ] . for this one can make use of the translocating ability of so - called cell penetrating peptides ( cpps ) , also designated as protein transduction domains ( ptds ) . the tat - cpp derived from the human immunodeficiency virus type 1 ( hiv-1 ) tat ( trans - activator of transcription ) protein has been widely used . the positively charged tat promotes cell permeability thereby overcoming the barriers of the cellular membrane by endocytosis or / and direct membrane penetration2 . in combination with a nuclear localization signal ( nls ) fusion proteins are able to enter the nucleus exhibiting functionality . our video presentation demonstrates , as an exemplification for the engineering of cell - permeable proteins , the construction , production and application of a cell - permeable version of the dna - modifying enzyme cre.cre is a site - specific recombinase that is able to recognize and recombine 34 base pair loxp sites in mammalian cells in vitro and in vivo . therefore the cre / loxp system is widely used to conditionally induce mutations in the genome of living cells3,4 . the delivery of active cre recombinase to cells , however , represents a limitation.we describe the psesame vector system , which allows a direct insertion of the gene - of - interest and provides a platform to rapidly clone different domains and tags used within the vector in a convenient and standardized manner . rearranging of the different tags has been shown to modify the biochemical properties of the fusion proteins providing a possibility to achieve higher yield and better solubility . we demonstrate how to express and purify recombinant cell - permeant proteins in and from e. coli . the functionality of the recombinant cre protein is finally validated in cell culture by assessing its intracellular recombinase activity .

Protocol Construction of expression vector and expression: Purification of cell-permeable protein: Protein transduction into murine embryonic stem (ES) cells: Representative Results: Discussion

the transporter classification ( tc ) system ( 1 ) , formally adopted by the international union of biochemistry and molecular biology ( iubmb ) in june 2001 , provides a guide to the known types of transport proteins present in living organisms on earth . the development of a classification system for transport proteins has allowed us to comprehensively view transport systems in a coherent and unified fashion from structural , functional and evolutionary standpoints , and to trace pathways taken for their evolutionary appearance ( 1,2 ) . this development has been strongly influenced by recent progress in computational biology and genome sequencing . since our last comprehensive description of tcdb ( 3 ) , we have expanded the transporter classification system by ( i ) introducing new classes and families of transporters , ( ii ) increasing the memberships of pre - existing families , ( iii ) providing more detailed annotations of these families and proteins , ( iv ) updating relevant reference citations , ( v ) creating a more interactive database and ( vi ) employing machine learning approaches that allow the semiautomated input of published information . the results of our analyses , made possible by these updates , are summarized here . more than 500 protein families are currently in the tc system , classified according to transporter class and subclass as presented in table 1 . affiliation with a family requires satisfying rigorous statistical criteria of homology . whereas the classes and subclasses distinguish functionally distinct types of transporters , the families and subfamilies provide a phylogenetic basis for classification . hyperlinks have been constructed to identify superfamilies , disease - related transporters , and sources of high resolution 3d structural data . table 1.classes and subclasses of transport systems included in tcdb ( 8 august 2008)1channels / pores1.a-type channels1.b-barrel porins1.cpore-forming toxins ( proteins and peptides)1.dnon - ribosomally synthesized channels1.eholins1.fvesicle fusion pores1.gparacellular channels2electrochemical potential - driven transporters2.aporters ( uniporters , symporters , antiporters)2.bnonribosomally synthesized porters2.cion-gradient-driven energizers3primary active transporters3.ap-p-bond-hydrolysis-driven transporters3.bdecarboxylation-driven transporters3.cmethyltransfer-driven transporters3.doxidoreduction-driven transporters3.elight absorption - driven transporters4group translocators4.aphosphotransfer-driven group translocators4.bnicotinamide ribonucleoside uptake transporters4.cacyl coa ligase - coupled transporters5transport electron carriers5.atransmembrane 2-electron transfer carriers5.btransmembrane 1-electron transfer carriers8accessory factors involved in transport8.aauxiliary transport proteins8.bribosomally synthesized protein / peptide toxins that target channels and carriers8.cnon-ribosomally synthesized toxins that target channels and carriers9incompletely characterized transport systems9.arecognized transporters of unknown biochemical mechanism9.bputative transport proteins9.cfunctionally characterized transporters lacking identified sequences classes and subclasses of transport systems included in tcdb ( 8 august 2008 ) recognition of a phylogenetic relationship based on sequence similarity allows certain conclusions to be drawn regarding 3d structural features . any two proteins that can be shown to be homologous ( i.e. that exhibit sufficient sequence similarity to establish that they arose from a common evolutionary ancestor ) can be expected to exhibit strikingly similar topological features and 3d structures , although a few exceptions have been noted ( 4 ) . therefore , extrapolation from one member of a family of known structure to other members becomes justifiable , and the degree of confidence in such an extrapolation is inversely related to the degree of sequence divergence . however , extrapolation of structural data to other proteins is never justified if homology has not been established . thus , the mechanism of solute transport is likely to be similar for all members of a permease family with variations on a specific mechanistic theme being greatest when the sequence divergence is greatest ( 5,6 ) . by contrast , for members of any two independently evolving permease families , the transport mechanisms may be entirely different . extensive experimental work has established that phylogenetic data can also be used to predict substrate specificity , polarity of transport and even intracellular localization , depending on the family and degree of sequence divergence observed ( 1,4 ) . since our last description of tcdb ( 3 ) , this database has expanded with the introduction of six new subclasses ( increase of 33% ) , 143 novel families ( increase of 34% ) , 2009 novel proteins ( increase of 67% ) and 167 novel subfamilies in the five largest superfamilies ( increase of 30% ) . the number of references cited in tcdb is now 4595 , a 40% increase since january 2006 . in the last 12 months thus tcdb is a rapidly growing database which is increasingly useful to the international scientific community . statistical algorithms are used to establish homology between two proteins , two families of proteins , or two repeat sequences within the proteins of a single family ( 7,8 ) . in general , these depend on the this principle simply states that if a is homologous to b , and b is homologous to c , then a is homologous to c ( 9 ) . care must be taken , however , that in establishing homology , corresponding domains or regions of the protein are being compared ( 11,12 ) . moreover , a reliable program must take into account unusual residue compositions , as , for example , occur with membrane proteins that have a disproportionate percentage of hydrophobic residues , or proteins with multiple short repeat sequences that comprise a substantial fraction of the proteins or protein segments compared ( 7,12 ) . an average protein domain is roughly 60 residues long , so we have set the minimal length of sequences to be compared for purposes of establishing homology as 60 residues ( 10 ) . we use the following rigorous criteria for the purpose of establishing common ancestry . to be homologous , two proteins , when correctly aligned to maximize identities and similarities and minimize gaps , must give a comparison score of 9 sd . this value corresponds to a probability of 10 that this degree of sequence similarity could have occurred by chance ( 13 ) . these criteria eliminate the possibility that convergent sequence evolution accounts for the degree of similarity observed ( 10,14 ) . the gap program ( 15 ) randomly shuffles the two sequences being compared 100 times and compares the actual aligned sequences with the shuffled sequences . this method eliminates artifacts due to unusual amino acid compositions , but 100 random shuffles are insufficient to give reliable values . we designed a modified program [ the intercompare program ( ic ) ; ( 7 ) and unpublished modifications ] , which has several advantages over gap . first , it automatically conducts five 100-shuffle runs and averages the results , and second , it can take any number of sequences known to be homologous to protein or protein domain a , and compares them to any number of sequences known to be homologous to protein or domain b. if protein / domain c ( homologous to a ) shows over 9 standard deviations with protein / domain d ( homologous to b ) , then by the superfamily principle , a must be homologous to b. the ic program can compare 100 homologues of a with 100 homologues of b to give 10 000 comparison scores . the third advantage is that the program presents the results as specified by the user , most usefully according to the values of the comparison scores . this allows the investigator to quickly identify the best comparisons for further examination ( 16 ) . if blast searches of proteins a and b yield 500 sequences each , this number must be reduced . this becomes possible due to availability of the cd - hit program ( 17 ) . this program eliminates all redundancies and all sequences with a percent identity greater than some specified value . thus , with this setting , only one protein of all the retrieved sequences with greater than 90% identity will be retained . if too many sequences are still retained , a lower cut - off value can be used . in this way a problem with the cd - hit program is that the retained sequences may be fragments of complete protein sequences rather than the full length sequences . we have therefore modified cd - hit so that only sequences of normal length are retained . the program works as follows : the script summarizes the sizes of all the proteins obtained in a blast search , and a decision is made to exclude presumed fragmentary sequences . when two sets of proteins are to be compared , two programs can be used : ic and gs ( get score ) . the ic program is described above ; the gs program functions as follows : the two lists of proteins are compared by ( i ) blast ( 18 ) and ( ii ) ssearch ( 19 ) . in the latter program , for any binary comparison , the two bit scores are averaged , and based on a standard curve , they are converted to a comparison score expressed in standard deviations . because ssearch compares the binary alignment with 500 randomly shuffled sequences , this program , like gap and ic , corrects for abnormal amino acid compositions . an advantage of gs over ic is that it takes only about 1% as much computer time . using programs to estimate integral membrane protein topologies ( what and avehas ; 20,21 ) , the parts of the proteins compared can be visualized . a major problem for phylogenetic tree construction arises when the sequences are so divergent that accurate multiple alignments can not be generated . a novel program is therefore required for quantitating increasingly distant relationships . first , the query protein sequences ( one for each family within the superfamily ) are blasted against the ncbi protein database . redundancies and sequences of greater than 70% identity ( another cut off point can be used ) are eliminated using the modified cd - hit program described above . a small number of sequences ( typically five ) from each set are randomly selected by the program . the blastall scores for all comparisons ( e.g. if five sequences are selected , this is 5 5 , or 25 ) are averaged , so a mean score is obtained for each family comparison . this process is conducted 100 times , and a consensus tree is generated using the program consense ( source code for both neighbor - joining and consense are available at http://evolution.genetics.washington.edu/phylip.html ) . finally , the tree is drawn using the treeview program ( 22 ) . in some cases , when sequence divergence is not great , the supertree method can be compared with approaches using traditional programs based on multiple alignments ( clustalx , t - coffee , etc . ) . in all such cases , the correlations have proven to be excellent . a major improvement to tcdb has involved the development and implementation of state - of - the - art machine learning techniques . machine learning is the field of artificial intelligence in computer science that uses computer programs to read specific data and use them to create a generalization called a model . we use proteins and cited articles present in tcdb ( and therefore known to be relevant to transport ) and create models that can identify novel proteins and articles that should be included in tcdb . since our training sets come from general protein databases such as swiss - prot and trembl , or medline articles available in pubmed , our techniques are general purpose and directly applicable to many of the databases listed in this issue . in order to keep tcdb constantly up - to - date , we need to identify new data that are relevant to transport but not already in tcdb . we consider two types of data , ( i ) uniprot protein records and ( ii ) medline documents . our techniques for working with each of these sources are largely similar , so we focus on medline documents here . for a detailed description of our research involving uniprot records , see ( 23 ) . the process of updating tcdb with new documents is as follows : choose the training set of documents.identify the features of those documents to be used to make classifications.train a model.use the model to identify new documents.verify that the predictions are correct.import the data into tcdb . as noted above , the positive instances in our training set are the documents currently referenced in tcdb . we do not , however , have a corresponding reliably labeled negative set which is typically also provided as part of the input to a learning algorithm . however , we recently showed why we were able to do almost as well by using unlabeled medline documents ( 24 ) . identify the features of those documents to be used to make classifications . use the model to identify new documents . the features that we use are words that are associated with each document , either by appearing in the document itself , or by being part of a set of keywords associated with the document . that is , each word is a numerical feature , and its value is proportional to the number of times it appears . this representation is sometimes called a bag of words , since the multiplicity of each word is considered , but not the order in which it appears . for instance , we consider the word transport as appearing in the title of an article to be a different feature than if this word were to appear in the document 's abstract . in fact , we do not typically consider words in the body of a document but limit our representation to words in the document 's title and abstract . we also weigh author names , affiliations , and keywords associated with the documents . to accomplish the third and fourth steps ( training a model and using it to identify novel documents ) , we use a classifier model called a support vector machine ( 25 ) and a standard associated learning algorithm . we use our derived models to rank a set of candidate articles according to a score that is proportional to the likelihood that the new article is related to membrane transport , given its features ( i.e. words ) . we then examine each article in order , starting with the most likely transport article according to our model . for each , we identify the appropriate proteins and associated information and insert these into tcdb . we continue this process until we determine that the frequencies of relevant articles are insufficient to be of use . in a period of less than 9 months , we have identified 1255 articles that are related to transport , 742 of which have been added to tcdb ( an increase of 21% ) . the remaining 513 articles were not added to tcdb because they described proteins that are very similar in sequence and function to proteins that were already in tcdb or because they were not important enough for some other reason . for further details about our learning approach and deployment statistics , see ( 26 ) . we focus on a set of about 100 journals that are the most cited in tcdb . in a month , we typically have about 6000 articles to consider as potential sources of transport information . we can not examine them all , but we expect about 23% of them to be relevant . for instance , if we look at the 10 highest - scoring articles , we observe an accuracy of nearly 100% . when we examine the top 100 , we observe about 48% accuracy , and if we look at the top 300 , we observe about 28% accuracy . this approach gives us a recall comparable to that of a human expert , but the human expert needs only to examine a relatively small number of false positives to find the relevant ones . we are currently developing a few additional methods to facilitate the introduction of new proteins and families into tcdb . in the next version of the database , we plan to allow users to submit their own sequenced proteins and descriptions for inclusion . we are also experimenting with novel ways to automatically identify proteins that are associated with our document examples . one source is ncbi 's curated databases , but these are incomplete and need to be supplemented with named entity recognition ( ner ) techniques . once protein names and other identifiers are found , one can look them up in general databases and extract the necessary information . first , it provides our learning algorithms with key additional features which should increase the accuracy of the models . second , it will help us identify and organize the data associated with a protein ( sequence , protein family , etc . ) the vast amount of protein sequence data now available renders data mining essential for maximizing output . tcdb development often depends on preexisting programs , but we must also design and update software in order to refine and optimize data input concerned with the functions , mechanisms , topologies , structures , phylogenetic relationship and evolutionary origins of transport proteins . tcdb can serve as a model system for the expansion of database technologies useful for many purposes . this work was supported by national institutes of health ( grant number gm1077402 ) . funding for open access charge : national institute of general medical sciences , national institutes of health ( r01 gm077402 ) .

the transporter classification database ( tcdb ) , freely accessible at http://www.tcdb.org , is a relational database containing sequence , structural , functional and evolutionary information about transport systems from a variety of living organisms , based on the international union of biochemistry and molecular biology - approved transporter classification ( tc ) system . it is a curated repository for factual information compiled largely from published references . it uses a functional / phylogenetic system of classification , and currently encompasses about 5000 representative transporters and putative transporters in more than 500 families . we here describe novel software designed to support and extend the usefulness of tcdb . our recent efforts render it more user friendly , incorporate machine learning to input novel data in a semiautomatic fashion , and allow analyses that are more accurate and less time consuming . the availability of these tools has resulted in recognition of distant phylogenetic relationships and tremendous expansion of the information available to tcdb users .

INTRODUCTION: THE TRANSPORTER CLASSIFICATION DATABASE (TCDB) ESTABLISHING HOMOLOGY BETWEEN PROTEINS ESTABLISHING SUPERFAMILY RELATIONSHIPS BETWEEN DISTANTLY RELATED FAMILIES DATA INPUT USING MACHINE LEARNING CONCLUSIONS AND PERSPECTIVES FUNDING

gastrointestinal stromal tumor ( gist ) is very rare tumor arisen from gastrointestinal tract that constitutes 0.1%~3.0% of gastrointestinal malignant tumor.1 - 5 gists may be occurred at the esophagus , stomach , small intestine , large intestine , anal canal , mesentery , greater omentum , and retorperitoneum.6 the small intestine constitutes 80% of the length , and 90% of the mucosal surface area of the digestive tract . however , the tumors originated from the small intestine are very rare because of various reasons , such as rare exposure to carcinogens due to rapid transit of food materials and rapid turnover of the epithelia , alkaline environment of bowel contents , richness of immunoglobulin a , and inconsiderable intestinal bacterial flora . the tumors arisen from the small intestine accounts for 5% of the tumors occurred in the digestive tract and the malignant tumors of the small intestine constitutes 1%~2% of the malignancies of the digestive tract . fifty percents of the small intestine derived malignant tumors are the adenocarcinoma , and less than 20% are the malignant gists.7 in some cases , the researchers classified the leiomyoma and the leiomyosarcoma into the smooth muscle cell derived tumors or gists derived from the interstitial cell of cajal.8 however , in recent years , the pathologists clearly discriminate between the smooth muscle cell derived tumors and gists according to the immunohistochemical results.9 gist is occurred under the mucosa as a single mass . gist may directly invade adjacent tissues or organs , and spread to other organs hematogenously , or metastasize to the liver or the omentum by peritoneal dissemination during the surgical operation . but lymphatic spread of gist is very uncommon.7 the authors experienced atypical case of gist has two primary tumors in the ileum and extensive metastasis to the greater omentum and adjacent lymph nodes during cadaver dissection for medical students . there was no evidence of trauma or surgery . during an autopsy , the authors observed morphological features and distribution of the tumors and took photographs . the histological samples were obtained and analysed by hematoxylin - eosin stain and immunohistochemistry and then consulted with pathologist on the microscopic findings of the tumors . after the opening of the anterior abdominal wall and peritoneum , a large number of round and various - sized tumors ( 0.5~2.4 cm in diameter ) were exposed on the greater omentum ( fig . the superior part of the greater omentum was stuck in the right iliac fossa and adhered to adjacent peritoneal surfaces . the authors examined the intestinal loop following the removal of the greater omentum , and then the first primary mass was detected on the ileum at 90 cm proximal to the ileocecal junction . a cutting plane of the mass was bright brown coloured and the cavity of the central necrosis was open to the lumen of the intestine ( fig . the second primary mass was detected at the middle of the small intestinal loop and 3.74.23.2 cm sized ( fig . it was adhered to adjacent small bowel and its cutting plane was bright brown coloured . the small foci of the central necrosis and a pattern of swirl were also observed on cutting planes . the tumor mass lied within the tunica muscularis of the intestinal wall and there was no evidence of mucosal invasion . the cytoplasm of the cells were eosinophilic and the nucleus did not show distinct mitotic figure . lymphatic spread was confirmed by identification of the subcapsular lymphatic sinus within the pathologic samples obtained from the greater omentum , mesentery , and posterior abdominal wall ( fig . the cd117 antigen was negative and the cd34 was partially positive in immunohistochemical assay ( fig . consequently , the authors diagnosed this tumor as the gist with lymph node metastasis on the basis of the diagnostic guide of hirota and isozaki.10 the stromal tumor developed in the gastrointestinal tract is very uncommon and that occurred within the small intestine is extremely rare . the most common site of gists in the digestive tract is the stomach and it comprises more than 50% . the second common site is the small intestine and the esophagus is the most rare primary lesion.8 within the small intestine , the jejunum is the most common region of primary gists and the ileum is the most uncommon region . the jejunal gists are half as many as that occurred in the duodenum and the ileum.8,11 in the past , the stromal tumors developed in the digestive tract had been regarded as the smooth muscle derived tumors and classified into subtypes base on the histological characteristics until the cellular origin was confirmed . since then , the researchers discovered that the cellular origin of gists was the interstitial cell of cajal and this cell mostly expressed c - kit gene product cd117.9 nowadays , gists are diagnosed by the immunohistochemical analysis of several tumor markers , such as cd117 , cd34 , desmin , and smooth muscle actin ( sma ) , and detection of the cd117 strongly supports confirm diagnosis of the gist.8,9 the cd117 is detected at 95% of the gists . the cd34 , sma , s-100 protein , and desmin are positive at 60%~70% , 30%~40% , 5% , and 1%~2% of gists , respectively.10 hirota and isozaki10 classified the stromal tumors into gists , smooth muscle tumors , and schwann cell tumors based on the above data . the stromal tumors without the cd117 and the cd34 were classified into the smooth muscle tumors which were positive for the desmin or the schwann cell tumors which were positive for the s-100 protein . in this case , the authors diagnosed the tumors as gist because it did not express the cd117 , desmin , and s-100 protein , but expressed cd34 in abundance . it is well known that the sma is detected around half of gists removed from the small intestine.12 in our case , the tumors also expressed the sma ( fig . 5 ) . recently , clinicians have been using the tyrosine kinase inhibitor sti-671 ( imatinib mesylate , gleevec ; novartis pharmaceuticals , basel , switzerland ) to cure gists and it brings good results . it is remarkable consensus that resection of lymph nodes are unnecessary because lymphatic spread of gists is very uncommon . morinaga et al.13 proposed that complete resection of gists , even if they are small in size , is compulsory , but routine lymph node dissection is unnecessory . pross et al.14 also reported that lymph node dissection was useless in treatment of gists of the stomach . according to the national institutes of health consensus classification system,9 our case falls under the intermediate grade , but it shows unusual feature that the tumor cells extensively metastasize to the lymph nodes and the greater omentum . in our case , two primary gist masses were found at the ileum and they showed clinically malignant features , such as size of the tumors , central necroses , lymphatic spread of the tumor cells , but they peculiarly did not show local invasion of the tumor cells and mitotic figures on high power field of microscopy . this specific case has not been reported in published literatures . therefore , the authors report this unusual case of gist with brief review of the literatures and we hope that this report will be helpful to the researchers engaged in the basic and clinical medical sciences .

gastrointestinal stromal tumor is a rare tumor which arises from the whole gastrointestinal tracts and most of it is detected in the stomach . it is uncommon with small intestine originated gastrointestinal stromal tumor and more uncommon with lymphatic metastasis . we experienced an unusual case of the small bowel gastrointestinal stromal tumor during experimental autopsy . two primary tumors with central necrosis were detected in the ileum . the sizes of each tumor were 6.13.44.0 cm and 3.74.23.2 cm . there was extensive lymphatic metastasis on the greater omentum and mesenteric , iliac lymph nodes were also involved . with histologic findings , the eosinophilic spindle cells were densely distributed . immunohistochemical findings were cd117 ( - ) , cd34 ( + ) , desmin ( - ) , and s-100 protein ( - ) . therefore , we diagnosed the tumors as small bowel gastrointestinal stromal tumors with broad lymph node mestasis .

Introduction Case Report Discussion

amissed monteggia fracture leading to a persistent radial head dislocation is a widely known entity.1257 the ignorance , lack of awareness and and medical facilities lead to inadequate treatment of such fractures . the neglected radial head dislocation is diagnosed several months after the injury when the patient complains of elbow pain , decreased elbow flexion , valgus deformity , or neurologic problems.14 if left untreated , the dislocated radial head loses its concave articular surface thereby limiting the range of motion.2 it also hampers the normal growth of the radius and give rise to distal radio ulnar instability.2 open reduction of the radial head is of clinical significance . but such late cases have various problems such as stiffness of joint , excessive fibrosis , and radial head distortion . in this study , we evaluate the results of open reduction by various techniques to assess the advantages and disadvantages of each . this retrospective study includes sixty - three missed monteggia fractures between june 2000 and june 2007 . all the cases were operated by same surgeon ( pg ) who switched to different types of surgeries in the course of 7 years as newer techniques evolved . the inclusion criterias were all missed monteggia fractures ( diagnosedclinicoradiologically ) with a persistent radial head dislocation in patients less than 18 years and demanding surgery for better functional or cosmetic results . a missed monteggia fracture was defined as any monteggia fracture not treated adequately for more than 4 weeks.157 the usual complaint was pain , swelling and loss of function at the elbow joint and a clicking sound on elbow motion . all 63 patients were counseled about the missed fracture , the treatment to be offered , its effectiveness , and complications . the average age of the patient was 15.5 years ( range 10 -18 years ) while most ( n=50 ) of them had nondominant hand fractures . the following parameters were recorded 1 ) range of motion 2 ) mayo elbow performance index ( mepi ) . the ulnar bow was determined in a united fracture to determine the angle of the bent plate while performing modified hirayama 's osteotomy . since the fractures were all old missed fractures it was difficult to exactly classify them according to paediatric classification . most common type was anterior ( type i : n=42 , 66% ) and antero lateral ( type iii : n=20 , 30% ) dislocations . there was only one case of posterior dislocation ( type ii : n=2 , 3% ) in group i. we performed four combinations of operations . group i ( n=22 ) modified hirayama ulnar osteotomy with annular ligament reconstruction with free palmaris longus graft.group ii ( n=18 ) modified hirayama ulnar osteotomy with annular ligament reconstruction by bell tawse 's procedure.group iii ( n=9 ) only modified hirayama 's osteotomy.group iv ( n=14 ) transverse osteotomy of ulna , with annular ligament reconstruction by bell tawse 's procedure . group i ( n=22 ) modified hirayama ulnar osteotomy with annular ligament reconstruction with free palmaris longus graft . group ii ( n=18 ) modified hirayama ulnar osteotomy with annular ligament reconstruction by bell tawse 's procedure . group iv ( n=14 ) transverse osteotomy of ulna , with annular ligament reconstruction by bell tawse 's procedure . they were assessed on basis of time of surgery , complications , range of motion achieved , and mepi . the condition of the radial head was also noted in all cases by radiographs and peroperaive visualization ( group iii had only radiographs ) . they were quantified radiologically according to the method of kim et al.89 skin incision was made beginning at the lateral epicondyle of the humerus continuing distally on the proximal metaphysis of the ulna , and extending to the middle part of the posterior aspect of the ulna . the ulna was then approached between the flexor carpi ulnaris and anconeus or the extensor carpi ulnaris . in all cases , a transverse osteotomy of ulna and fixation with a plate or rush nail was done in the first 15 cases which comprised our group iv patients . rest of them had a modified hirayama 's osteotomy done which is described below : modified hirayama 's osteotomy10 [ figure 1 ] : it is a bending osteotomy of the ulnar shaft using a prebent plate with the degree and site determined by preoperative drawings from the lateral radiographs . after the osteotomy at the proposed site , the prebent plate was placed over the posterior surface of ulna and a corticocancellous wedge shaped graft from the iliac crest was inserted in the gap thus created and the plate fixed in situ . this creates a posterior or lateral ( depending on the original deformity ) bend of around 15 ( 1025 ) and an elongation of around 1 cm ( 8 to 14 mm ) . this correction usually replaces the radial head in its original position and also lends an inherent stability . peroperative clinical photographs ( a , b , c , d ) and x - rays ( e , f ) of modified hirayama 's osteotomy with the wedge graft showing ( a ) osteotomy followed by bend creating an open wedge . ( f ) post op x ray annular ligament reconstruction : annular ligament reconstruction was performed for all groups except for group ii . first one is the well - known bell tawse 's procedure where a new annular ligament is reconstructed from a strip of the triceps fascia1112 [ figure 2 ] . the second procedure is the reconstruction of the remnant of the annular ligament with free palmaris longus graft . it requires identification of the remains of the torn annular ligament , clearance , and then reconstruction with a small free palmaris longus graft harvested from the same hand1 [ figure 3 ] . only in the cases of an absence of palmaris longus ( two cases ) we had to procure the graft from the opposite hand . peroperative clinical photographs of bell tawse 's procedure : ( left to right ) ( a ) harvesting the triceps sling . ( b ) encircling the radial head with the sling . ( c ) suturing the sling peroperative clinical photographs of annular ligament reconstruction with palmaris longus graft : ( left to right ) ( a ) harvesting palmaris longus . ( c ) reconstruction with palmaris longus wound was closed in layers over a drain and immobilized for 2 weeks in a plaster cast at 90 flexion in supination . the back slab and the wire were removed after 2 weeks and active elbow flexion and extension exercises were started . the patients were followed up at 3 , 6 , 12 months and then on yearly basis . skin incision was made beginning at the lateral epicondyle of the humerus continuing distally on the proximal metaphysis of the ulna , and extending to the middle part of the posterior aspect of the ulna . the ulna was then approached between the flexor carpi ulnaris and anconeus or the extensor carpi ulnaris . in all cases , a transverse osteotomy of ulna and fixation with a plate or rush nail was done in the first 15 cases which comprised our group iv patients . rest of them had a modified hirayama 's osteotomy done which is described below : modified hirayama 's osteotomy10 [ figure 1 ] : it is a bending osteotomy of the ulnar shaft using a prebent plate with the degree and site determined by preoperative drawings from the lateral radiographs . after the osteotomy at the proposed site , the prebent plate was placed over the posterior surface of ulna and a corticocancellous wedge shaped graft from the iliac crest was inserted in the gap thus created and the plate fixed in situ . this creates a posterior or lateral ( depending on the original deformity ) bend of around 15 ( 1025 ) and an elongation of around 1 cm ( 8 to 14 mm ) . this correction usually replaces the radial head in its original position and also lends an inherent stability . peroperative clinical photographs ( a , b , c , d ) and x - rays ( e , f ) of modified hirayama 's osteotomy with the wedge graft showing ( a ) osteotomy followed by bend creating an open wedge . ( f ) post op x ray annular ligament reconstruction : annular ligament reconstruction was performed for all groups except for group ii . first one is the well - known bell tawse 's procedure where a new annular ligament is reconstructed from a strip of the triceps fascia1112 [ figure 2 ] . the second procedure is the reconstruction of the remnant of the annular ligament with free palmaris longus graft . it requires identification of the remains of the torn annular ligament , clearance , and then reconstruction with a small free palmaris longus graft harvested from the same hand1 [ figure 3 ] . only in the cases of an absence of palmaris longus ( two cases ) we had to procure the graft from the opposite hand . peroperative clinical photographs of bell tawse 's procedure : ( left to right ) ( a ) harvesting the triceps sling . ( c ) suturing the sling peroperative clinical photographs of annular ligament reconstruction with palmaris longus graft : ( left to right ) ( a ) harvesting palmaris longus . ( c ) reconstruction with palmaris longus wound was closed in layers over a drain and immobilized for 2 weeks in a plaster cast at 90 flexion in supination . the back slab and the wire were removed after 2 weeks and active elbow flexion and extension exercises were started . the patients were followed up at 3 , 6 , 12 months and then on yearly basis . sixty - three patients were followed up for an average duration of 5 years and 6 months ( range 3 - 8 years ) through clinical examination , radiographs , questionnaires , and telephonic conversations . the average lapse to time from trauma to surgery was 1.6 years ( ranging between 6 months to 3 years ) for all four groups . fifty seven cases ( 85% ) had no distortion of the radial head while 6 cases ( 15% ) had a mild distortion of the radial head . of these six cases , two cases were each in groups i and iv while the other two groups had one each . the mean duration of radiological union for hirayama 's osteotomy ( groups i , ii , and iii ) was slightly less ( 8.5 weeks ) as compared to the mean duration of the transverse osteotomy of 9 weeks , but the difference was not significant ( p value > 0.1 ) . average time of surgery was the most for group ii , 90 mins ( range 60110 mins ) , 80 mins ( range 6090 mins ) for group i , 70 mins ( range 5080 mins ) for group iv , and was the least for group iii being only 40 mins ( range 3550 mins ) [ table 1 ] . observations on various parameters we observed five superficial infections , two each in groups ii and iv and one in group i , which recovered after appropirate antibiotics and removal of k wire . there was a case of tourniquet palsy in a group i patient that recovered fully in 3 months duration but had marginal loss of range of motion , but it led to some loss of range of motion . we believe it was due to the faulty application of the esmarch bandage tourniquet as other factors remained same during other surgeries . the mean range of motion increased by 45 in both groups i and iii ( 45 to 90 for group i and 35 to 80 for group iii ) . it increased only by 30 in group ii ( 45 to 65 ) while even less , 20 in group iv ( 40 to 60 ) . the average increase in the mepi scores were also almost on the same lines , being the maximum for group i ( 33 points , range 2839 ) then group iii ( 32 points , range 2535 ) followed by group ii ( 27 points , range 2033 ) and the least for group iv ( 18 points , range 1522 ) . we also compared the duration between the initial trauma and the surgery , and the condition of radial head at the time of surgery ( visually and radiologically ) , with the mepi scores . the average increase of mepi score for these five cases was only 23 but none of them dislocated . similarly the six cases with radial head distortion had a lower increase of the mepi score ( 24 ) than the average of 28 . both increased lapse of time from initial trauma to surgery , and distortion of the radial head , had a negative impact on the mepi scores but not on the dislocation rate . there was one case of frank dislocation in group iii and six cases of subluxation , two in groups ii , iii , and iv each . the frank dislocation in group iii took place 8 weeks postoperatively and decreased the range of motion considerably . there was also a fair incidence of subluxation of radial head in all other groups(11% , 22% , 14% for group ii , iii and iv respectively ) except group i ( 0% ) , though none of them was significant enough to cause restriction of movement or require a reoperation . for annular ligament reconstruction , amongst the two procedures , groups ii and iv ( bell tawse group ) had a significant extension lag contributing to the lower increase in range of motion ( 30 and 20 ) as compared to the palmaris longus reconstruction group ( 45 ) . the length of the scar and dissection required for annular ligament reconstruction using triceps fascia is much more than of that with palmaris longus . bell tawse groups also had a longer average duration of surgery ( 90 mins ) and infection rate ( 11.1% ) than the palmaris longus group ( 80 mins , 4.8% ) ( comparing groups i and ii to exclude the osteotomy factor ) . it results primarily due to inadequate or no primary treatment at the time of injury.2 the principle cause for the dislocation is the closed ring - like anatomy of the radius and ulna along with the interosseous membrane and the annular ligament.13 disruption and malunion of the ulna leads to shortening and angulation of one arm of the ring . this is compensated on the other side by the dislocation of the radial head from its position . this gives us insight to the necessity of correction the length and angular deformity of the ulna and how it acts as the primary stabilizer for the reduction of the radial head.1 world literature is filled with a plethora of osteotomies for correcting this deformity . they range between ulnar corrective osteotomy,61415 ulnar bending osteotomy,1622 radial rotation osteotomy,17 combined procedures of ulnar bending plus lengthening,110 and ulnar lengthening plus radial shortening.18 our study proves that an ulnar bending plus lengthening osteotomy like hirayama 's osteotomy provides for a more stable reduction of the radial head than a simple transverse osteotomy with better long - term results . this osteotomy takes up a little more operative time than the transverse one , but we found that preoperative planning with line drawing and cuts reduced the time to almost the same . preoperative planning also helps in accurate placement of the osteotomy and screws at the proper angle leading to a more anatomical , easier , and better reduction of the radial head . there is no consensus over the addition of reconstruction of annular ligament to the various osteotomies . some such as nakamura et al.1 and david - west et al.19 advocate it in all cases while others such as devanani7 and bhojraj et al.20 disregard it completely . others like bhaskar et al.5 go for an intraoperative decision based on the stability of reduction . as we always performed the ulnar osteotomy first , a common finding after the first few modified hirayama 's osteotomy was that the radial head reduced automatically just after fixing the plate without any direct intervention . this led us to falsely believe that anatomical reduction and correction of the deformity takes away the dislocation forces on the radial head , leading to a stable radial head . therefore , we skipped the annular ligament reconstruction in one group of patients ( group iii ) . this group had one dislocation and two subluxations which was clearly more than any other group . this made us realize that soft - tissue forces also play a major role in the stability of the radial head which can be achieved only by reconstruction of the annular ligament . thus , we believe that hirayama 's osteotomy is inherently more stable than the simple transverse osteotomy as evident by comparing the subluxation rate of groups ii and iv . the hirayama 's osteotomy alone is not sufficient for all cases ( group iii ) and should be combined with an annular ligament reconstructive procedure . historically there have been numerous methods of reconstruction of the annular ligament using the forearm facia,23 triceps facia112122 and most recently the palmaris longus graft.421 direct repair is not possible in these long - standing cases of chronic dislocations . however , the material of the sling is not the only difference in the two procedures . the bell tawse 's procedure involves using a triceps sling attached on the ulna to go around the radial head and forming a new sling around it by reattaching it with the ulna.1112 but the palmaris longs is a free graft , where we actually use the remnants of the annular ligament and just bridge the gap or defect with the free graft . palmaris longus free graft augmentation of the remnant is thus a more physiological procedure leading to better results in not only containing the head , but also providing better range of motion due to no morbidity of the triceps causing an extension lag as observed in most of our bell tawse cases . this procedure is more anatomical as it recreates the same shape and size of sling that originally existed for the radial head to remain in place.1 it also avoids the complication of too tight slings leading to notching and restriction of moment which is so common with the other procedures . the length of the scar and dissection required for annular ligament reconstruction using triceps fascia ( bell tawse 's procedure ) is much more than of that with palmaris longus . we believe that this also leads to an increases operative time and along with increased chances of infection as shown in our study ( comparing groups i and ii ) . we also found palmaris longus reconstruction to be technically easier than the bell tawse 's procedure especially after the identification of the remnants . one exception to this operation is the bilateral absence of palmaris longus which compels the surgeon to use some other method.1 we did not have any such case in this series . after comparing all these four groups we found that modified hirayama 's osteotomy with annular ligament reconstruction with palmaris longus free graft serves as the better option for chronic radial head dislocation in patient 's with missed monteggia fractures .

background : the dislocated radial head in missed monteggia fracture loses its concave articular surface and displays hypertrophic changes and flattened humeral capitellum configuration , thereby limiting the range of motion . we evaluated the results of open reduction in missed monteggia fractures by various techniques.materials and methods : sixty - three missed monteggia fractures were included in the analysis . we performed four combinations of operation : group i : 22 patients treated with modified hirayama ulnar osteotomy plus annular ligament reconstruction with free palmaris longus grafting ; group ii:18 patients treated with modified hirayama ulnar osteotomy plus annular ligament reconstruction by the bell tawse 's procedure ; group iii-9 : patients treated with only modified hirayama 's osteotomy ; and group iv : 14 patients treated with transverse osteotomy of ulna and annular ligament reconstruction by the bell tawse 's procedure . during followup these cases were assessed for the following parameters : 1 ) range of motion and 2 ) mayo elbow performance index ( mepi ) . results were noted on follow ups at 3 , 6 , 12 months and then on yearly basis . sixty - three patients were followed up for an average duration of 5.6 years ( range 3 - 8 years).results : the mean range of motion was increased by 45 , 30 , 45 , 20 for group i , ii , iii and iv respectively . the average increase in mepi scores was also almost on the same lines . there was one case of frank dislocation in group iii and six cases of subluxation , two each in groups ii , iii , and iv . for annular ligament reconstruction , amongst two procedures , groups ii and iv ( bell tawse group ) , had a significant extension lag contributing to the lower increase in the range of motion as compared to the palmaris longus reconstruction group ( group i).conclusion : hirayama 's osteotomy is inherently more stable than the simple transverse osteotomy and it should be combined with annular ligament reconstruction . palmaris longus graft for ligament reconstruction provides more stability as compare to bell towse 's procedure .

I M Operative procedure R D

although the occurrence of convulsion in pregnant women was noted around 2200 bc , the word eclampsia was first used in 1619 . in 1843 , the association of convulsion with edema and proteinuria was noted . in 1897 , hypertension was detected in pregnant women . in 1900s , taking into account the earlier manifestations of eclampsia , the word preeclampsia was considered during prenatal care ( 1 ) . although the exact mechanism regarding the induction of this disease remains enigmatic , vascular disorder characterized by generalized endothelial damage and vasospasm is a well - known pathology resulting in systemic complications during pregnancy ( 24 ) . apart from the pathogenesis , there is also uncertainty in its natural course , diagnosis and screening methods ( 3 ) . as a result , different experts in the field have given this spectrum of disease different names at different times : nephrotic toxemia , hypertensive toxemia , eclampsia , gestosis , pregnancy induced hypertension , preeclampsia - eclampsia and hypertensive disorders of pregnancy ( 1 ) . some authors also classified it as atypical when the course of the disease is eccentric ( development of advanced complications without evidences of preeclampsia ) ( 5 ) . the american college of obstetricians and gynecologists ( acog ) 2013 guidelines has also classified preeclampsia as with and without severe features ( 6 ) . detailed description about the proposed pathogenesis of this disease and its clinical manifestations are beyond the scope of this manuscript . neither hypertensive pregnancy disorders nor the current sub - classifications ( chronic hypertension , preeclampsia - eclampsia , gestational hypertension , superimposed preeclampsia on chronic hypertension ) is inclusive as these terminologies only partly describe the disease 's clinical manifestations . since endothelial damage is the unifying pathology behind all the clinical manifestations ( 24 ) , vascular disorder of pregnancy ( vdp ) is a simplified but comprehensive terminology to describe the spectrum of the disease . although the timing of occurrence varies , all the systemic complications ( cardiovascular , renal , hematologic , intracranial , hepatic , pulmonary and uteroplacental ) are the consequences of the generalized endothelial vascular damage resulting in vasospasm . other authors also noted that endothelial damage is considered central to the multiple - organ pathophysiology of this disease ( 7 ) . as schematically presented in figure 1 , in the natural course of this disease , the endothelial damage and the vasospasm are the the early maximum effect in any organ or system will result in the earliest clinical manifestation . they have been used as a baseline diagnostic criteria for preeclampsia for the past century until the most recent acog revision , which eliminates proteinuria as a must for diagnosis ( 6 ) . schematic representation of theories leading to maternal vascular endothelial damage and vasospasm ; vasospasm in turn leading to systemic manifestations vasospasm and resulting intravascular dehydration ( hypovolemia ) have the potential to effect any organ or system at any stage of the disease . the development of convulsion before hypertension , presentation with hematologic and hepatic abnormalities in normotensive women , and the occurrence of late postpartum eclampsia ( up to 4 weeks postpartum ) is evidence for the importance of the vascular disorder and the unpredictable course of this disease ( 811 ) . the most common severe symptoms ( headache , blurred vision , epigastric pain and vomiting ) also manifest very haphazardly ( 8) , likely due to underlying susceptibility and individual variation in the effect of the vascular disorder on certain organs . there is also evidence of the importance of the vascular disorder on disease susceptibility in later life . the vascular disorder during pregnancy was reported as strongly associated with later - life cardiovascular diseases ( hypertension , ischemic heart disease , myocardial infarction ) ( 6,12,13 ) . interestingly , both the cardiovascular disease and preeclampsia share common risk factors ( endothelial damage , obesity , hypertension , hyperglycemia , insulin resistance , dyslipidemia ) ( 13 ) . other investigators have reported an increased long - term risk of death due to cardiovascular disease in women who were diagnosed to have pre - eclampsia and gestational hypertension ( 14 ) . others also considered pre - eclampsia as a life - long disorder ( 15 ) . the finding of endothelial damage in both preeclampsia and metabolic syndrome and the increased risk of developing preeclampsia among women with metabolic syndrome and vice versa ( 16 ) lends evidence to the importance of this vascular disorder on this disease process . some investigators noted the possibility of metabolic syndrome as an underlying mechanism common to cardiovascular disease and preeclampsia ( 13 ) . the prominence of the vascular disorder was also observed in the association of later chronic hypertension and cardiovascular morbidity / mortality with early onset and recurrent preeclampsia ( 13 ) . unlike preeclampsia , which is characterized by endothelial damage of unknown mechanism , metabolic syndrome stresses the endothelium mechanically and biochemically to result in the dysfunction ( 17,18 ) . as pregnancy is known to be diabetogenic , it may also be vasculopathic . more than a quarter of pregnant women diagnosed to have gestational diabetes are likely to have type ii diabetes in less than twenty years ( 19 ) . similarly , women diagnosed to have preeclampsia are at increased risk of developing cardiovascular disease later in life . pregnancy may have an amplifying potential to unmask latent chronic medical disorders destined to manifest in later life . the importance of vasospasm for the occurrence of systemic complication has also been noted indirectly . although the mechanism is not completely understood , magnesium sulfate has become first - line therapy in preventing occurrence of convulsion because of its effect on cerebral and peripheral vasodilatation , which is an advantage to reduce the vasospasm , ischemia and hypertension found in these disorders ( 20,21 ) . a randomized clinical trial has also shown a significant increase in fetal umbilical artery and middle cerebral artery blood flow in women treated with magnesium sulfate ( 22 ) . some systemic complications occur late in the disease process but may appear early and present a puzzle for clinicians . for example , eclampsia and hellp syndrome ( hemolytic anemia , elevated liver enzymes , low platelet count ) ( 4,8 ) are expected to occur in advanced disease but can appear first . in other cases , the first disease manifestation may be hypertension , renal dysfunction , hematologic abnormalities , increased intracranial pressure or hepatic disorder . the most important determinant of the clinical manifestation of this disease is the severity of the vascular disorder on any particular organ or system . other authors also pointed out that the onset of symptoms and signs of this disease may be dictated by the degree and time course of the endothelial damage ( 23 ) . the association of early onset preeclampsia with persistent endothelial damage was also demonstrated ( 24 ) . although multiple pathways have been proposed , the exact etiology of the endothelial damage is not yet known ( 25 ) . what has been clearly described is first the primary pathology , vascular disorder , followed by secondary pathology , systemic complications with variable time course of onset . stekkinger and colleague from the netherlands first proposed vdp as an alternate expression for preeclampsia ( 26 ) . since the vascular disorder plays a pivotal role central to the disease process in all maternal and fetal complications , and none of the current terminology is inclusive of the whole disease picture , vdp represents the most appropriate terminology until such time as the underlying etiology is certainly identified . since vdp is a syndrome with a multisystem manifestation , we should avoid the use of jargons of names given by combining two or more clinical manifestations of vdp : hypertension with proteinuria ( preeclampsia ) ; anemia , hepatic dysfunction and thrombocytopenia ( hellp syndrome ) ; partial hellp syndrome any two of the three present ; hypertension with proteinuria and convulsion ( eclampsia ) ; isolated hypertension ( gestational hypertension ) ; and worsening chronic hypertension ( superimposed preeclampsia ) . hypertensive disorder of pregnancy is not accurate or inclusive since the disease process can present in the absence of hypertension : in this disease , hypertension is only one postential manifestation of the vascular disorder . the hypertension is thought to be due to the generalized vasospasm . in previous literature , hypertension has been considered as the hallmark for the diagnosis of preeclampsia - eclampsia ( 4,6,26 ) . there are also few authors who still use the term pregnancy induced hypertension probably to show the association of this disease with hypertension ( 27,28 ) . if this disease manifests with only hypertension in the second half of pregnancy , gestational hypertension is defined ( 6 ) . however , what is in common with both preeclampsia - eclampsia and gestational hypertension is the vasospasm or vascular stiffness , which shows improvement with anti - hypertensive drugs ( 29 ) . several recent investigations on this disease pathogenesis also showed that preeclampsia is not primarily a hypertensive disease ( 25,28,3033 ) . there are several circulating markers of endothelial cell injury ( endothelin , cellular fibronectin and plasminogen activator inhibitor-1 ) being found elevated before women became hypertensive and symptomatic for preeclampsia ( 34,35 ) . thus , hypertension is one of the secondary effects of the disease , developing after the vasospastic effect of the disease is severe enough . interestingly , in clinical practice , hypertension is not always present first or second in the disease process . the effect of the vascular disorder in other systems or organs may manifest earlier than the hypertension . as a result , it is not unusual to encounter preeclamptic women with severe features but still normotensive . in some cases , the severe features of the disease like hellp syndrome , hepatic subcapsular hematoma and eclampsia can also occur while the blood pressure is in the normal range ( 4,8,9,36 ) . since this disease is not always manifesting with hypertension , the phrase hypertensive disorder is not inclusive . therefore , the author 's opinion is that this disease should not be tagged with hypertensive disorder , in which hypertension is one of : 1 ) the relatively late phenomena appearing when the vasospasm is severe enough ; and 2 ) the signs of the disease but not must to make a diagnosis of this disorder . eclampsia is not predictably preceded by preeclampsia and can occur in isolation , so this terminology is inadequate at best : as described above , eclamptic women exhibit a wide spectrum of signs , ranging from severe hypertension and significant proteinuria to absent or minimal hypertension and no proteinuria . the classical course of illness ( characterized by a progressive edema , mild to severe hypertension and the onset of severe symptoms , which is followed by the occurrence of convulsion or coma ) may not be seen in several women ( 5,8,9 ) . specifically , large data including a series of eclamptic women from the united states and europe showed that about 20% of eclamptic women did not have any premonitory signs or symptoms before the onset of convulsions ( 9,3739 ) . another large systematic review of eclamptic women also indicated that about a quarter of women were normotensive and symptom free ( 8) . interestingly , retrospective studies from high income countries also showed that about 50% of convulsions with no signs and symptoms occurred while the women were in the hospital under close supervision ( 9,38,39 ) . these findings imply that eclampsia is not always after signs and symptoms of preeclampsia and the appropriateness of the term preeclampsia is thus questionable . in other words , eclampsia is not always the natural linear evolvement of pre - eclampsia as theorized before ( 40 ) . the argument is that convulsion or coma ( eclampsia ) is one of the severe signs of the disease . convulsion or coma indicates the severity of the effect of the acute endovascular injury on the cerebrum - not necessarily a continuum of the severe preeclampsia . pregnant women with acute endovascular injury may first manifest with convulsion , if the effect of the vasospasm is less in other organs and tissues , but more in the cerebrum . as a result , the signs and symptoms preceding the development of eclampsia are nonspecific and their presence may be taken as a marker of end - organ dysfunction and disease severity . if that is the case ; rather than giving a separate terminology ( eclampsia ) , which is not always after preeclampsia , why do not we omit this terminology and describe this disease ( vdp ) by its symptoms ( convulsion or coma ) ? the existence of hellp syndrome as a separate disease entity is debatable : although louis weinstein regarded hellp syndrome as a separate disease from severe preeclampsia in 1982 , many clinicians view it as an entity of preeclampsia ( 4143 ) . the hellp syndrome was also reported as occurring simultaneously with preeclampsia ( 42 ) and after the onset of signs and symptoms of preeclampsia ( 41,42 ) . others suggested that there is a predisposition for the occurrence of preeclampsia and hellp syndrome in early pregnancy ( 44 ) . as a result , there have been several debates and speculations about the existence of hellp syndrome as a separate disease entity or an integral part of preeclampsia ( 45 ) . the source of the debate is that since the pathophysiology of vascular injury is common for both , all the criteria used to diagnose the hellp syndrome can also be found in part or as a whole in women with preeclampsia - eclampsia . the presence of these manifestations in women with preeclampsiaeclampsia was also recognized long ago ( 42 ) . in the author 's opinion , the debate should not only be about putting it as a separate disease entity or as a severe form of preeclampsia . from the outset , why do we need to give a separate name when the triad of laboratory derangements present ( anemia , thrombocytopenia , elevated liver enzymes ) ? as described before , these are primarily clinical features of the vascular disorder in the hematologic and hepatic system . furthermore , the elevated plasminogen activator inhibitor-1 ( pai-1 ) , endothelial activation and damage are common characteristics and early phenomena in both preeclampsia and hellp syndrome without preeclampsia ( 10,46,47 ) . the other symptoms regarded as manifestations of hellp syndrome ( malaise , epigastric pain , nausea , vomiting , and weakness ) ( 48 ) are nonspecific and some are also manifestations of anemia and preeclampsia ( 9 ) . other authors also hypothesized an inborn error of the fatty acid oxidative metabolism for the etiopathogenesis of hellp syndrome ( 10 ) , but this could not be substantiated by other investigators . therefore , the author 's opinion is not to put the hellp syndrome aside or to maintain it as severe complication of preeclampsia - eclampsia ; it is to describe the disease with the original problems ( anemia , thrombocytopenia , elevated liver enzymes ) as clinical manifestations of vdp . the majority of women diagnosed as gestational hypertension will ultimately be diagnosed as preeclamptic : although several authors use gestational hypertension and preeclampsia interchangeably , the world health organization and acog put a distinction between the two ( 3,6 ) . however , it is noted that many women diagnosed as gestational hypertension actually have preeclampsia even before the development of proteinuria or any other organ manifestation . this may also be a sign of future chronic hypertension ( 6 ) . recently , one author suggests a new classification : preeclampsia superimposed on gestational hypertension as in the case of preeclampsia superimposed on chronic hypertension ( 49 ) . in conclusion , none of the currently used terminologies to describe this disease spectrum is inclusive or accurate . the disease process is not primarily a hypertensive disorder , but it rather is a vascular disorder of pregnancy ( vdp ) of unknown etiology . all systemic complications result from the microangiopathy ( endothelial damage and vasospasm ) , with variable severity and onset . the systemic manifestations of vdp ( convulsion , anemia , thrombocytopenia , hepatic dysfunction , acute renal failure , pulmonary edema , and hypertension ) are self - explanatory and can be used to describe the severity of the disease via a simple , uniform classification scheme [ table 1 ] . vascular disorder of pregnancy ( vdp ) classification , and the place of antihypertensive and anticonvulsant administration class 0 is suggested taking into consideration the occurrence of convulsion among several asymptomatic and normotensive pregnant women for whom we may not do anything till a noble biomarker or neurosignal is identified.in class iv , antihypertensive is optional for similar reason ( occurrence of any of the listed complications with mild to moderate hypertension or without hypertension).magnesium sulfate is recommended for all with the exception of class 0 because of large body of data showing the occurrence of convulsion in several women with mild to moderate hypertension.the simplified but comprehensive terminology ( vdp ) is also an advantage to avoid confusions with multiple and inconclusive terminologies in the formal education and training of health care workers . class 0 is suggested taking into consideration the occurrence of convulsion among several asymptomatic and normotensive pregnant women for whom we may not do anything till a noble biomarker or neurosignal is identified . in class iv , antihypertensive is optional for similar reason ( occurrence of any of the listed complications with mild to moderate hypertension or without hypertension ) . magnesium sulfate is recommended for all with the exception of class 0 because of large body of data showing the occurrence of convulsion in several women with mild to moderate hypertension . the simplified but comprehensive terminology ( vdp ) is also an advantage to avoid confusions with multiple and inconclusive terminologies in the formal education and training of health care workers . the main advantages of the current recommendation ( vdp ) : since the vascular disorder is central and common for all the clinical manifestations , vdp avoids confusion surrounding a misperception that there is a natural , linear progression of disease and avoids missing atypical presentations . vdp also avoids the different terminologies not consistently and conclusively used across the globe.criteria to diagnose vdp will be based on one or more of the secondary effects like hypertension , neurologic manifestations ( headache , blurred vision , visual loss , convulsion , stroke , vomiting ) , hepatic manifestations ( epigastric pain , vomiting , elevated enzymes and bilirubin , subcapsular hematoma / rupture ) , renal manifestations ( oliguria , elevated creatinine , bun , uric acid ) , hematologic manifestations ( thrombocytopenia , hemolytic anemia , elevated bilirubin and ldh ) , ascites , independent edema , and evidences of uteroplacental insufficiency ( poor biophysical profile , growth restriction , placental abruption ) . therefore , the diagnosis will be vdp with one or more of the above specific manifestations.once the diagnosis of vdp is made , differential treatment can be instituted to reflect the severity ( class ) of the disease . in other words , several unforeseen complications ( like convulsion ) encountered in women diagnosed as mild preeclampsia can be avoided with early initiation of anticonvulsants . however , it has been noted above that in some women convulsion can be the first symptom and thus may not be totally avoidable.the simplified but comprehensive terminology ( vdp ) is also an advantage to avoid confusions with multiple and inconclusive terminologies in the formal education and training of health care workers . since the vascular disorder is central and common for all the clinical manifestations , vdp avoids confusion surrounding a misperception that there is a natural , linear progression of disease and avoids missing atypical presentations . criteria to diagnose vdp will be based on one or more of the secondary effects like hypertension , neurologic manifestations ( headache , blurred vision , visual loss , convulsion , stroke , vomiting ) , hepatic manifestations ( epigastric pain , vomiting , elevated enzymes and bilirubin , subcapsular hematoma / rupture ) , renal manifestations ( oliguria , elevated creatinine , bun , uric acid ) , hematologic manifestations ( thrombocytopenia , hemolytic anemia , elevated bilirubin and ldh ) , ascites , independent edema , and evidences of uteroplacental insufficiency ( poor biophysical profile , growth restriction , placental abruption ) . therefore , the diagnosis will be vdp with one or more of the above specific manifestations . once the diagnosis of vdp is made , differential treatment can be instituted to reflect the severity ( class ) of the disease . in other words , several unforeseen complications ( like convulsion ) encountered in women diagnosed as mild preeclampsia can be avoided with early initiation of anticonvulsants . however , it has been noted above that in some women convulsion can be the first symptom and thus may not be totally avoidable . the simplified but comprehensive terminology ( vdp ) is also an advantage to avoid confusions with multiple and inconclusive terminologies in the formal education and training of health care workers . for management purpose , the severity of the vdp is classified and treatment modalities are suggested as presented in table 1 . detail description of mode of delivery , antihypertensive and anticonvulsant drugs is beyond the scope of this manuscript . lastly , the author would like to let the readers know that the suggested terminology and treatment options are open for discussion and further enrichment .

hypertensive disorders complicate 5%-10% of pregnancies with increasing incidence mainly due to upward trends in obesity globally . in the last century , several terminologies have been introduced to describe the spectrum of this disease . the current and widely used classification of hypertensive pregnancy disorders was introduced in 1972 and in 1982 , but has not been free of controversy and confusion . unlike other diseases , the existing terminology combines signs and symptoms , but does not describe the underlying pathology of the disease itself . in this commentary , a detailed account is given to vascular disorder of pregnancy ( vdp ) as an inclusive terminology taking into account the underlying pathology of the disease on affected organs and systems . a simple and uniform classification scheme for vdp is proposed .

Introduction

reticulohistiocytosis is a spectrum of disorders ranging from solitary and diffuse cutaneous forms without systemic involvement to multicentric reticulohistiocytosis ( mr ) . the primary skin lesion , reticulohistiocytoma , usually presents as a firm , skin colored , yellowish or reddish papule or nodule . in multiple cutaneous reticulohistiocytoma ( mcr ) , there is onset of multiple lesions without underlying systemic illness , whereas in mr there are extensive skin lesions in association with a severe , often destructive arthropathy , and systemic features . mcr is more common in young adult males and mr in middle aged women associated with systemic symptoms . both the variants are characterized in histo - pathology by the presence of large mononucleated or multinucleated histiocytes with an abundance of eosinophilic , homogenous to finely granular cytoplasm having a ground glass appearance . we report here a case of mcr in a middle aged female for its rarity and the importance of ruling out mr in such a patient . a 35-year - old female presented with gradual onset of multiple skin colored , asymptomatic pea sized swellings , which started with face and gradually involved back , arms , and legs . there was no history of preceding local trauma , discharge , pain in these lesions . there were no constitutional symptoms like fever , joint pain , and complaints referable to other systems . the patient 's main concern was regarding the cosmetic appearance as lesions were present over the face . her family history was negative and she had no history of any other chronic illness . mucocutaneous examination revealed multiple ( 20 in number ) , discrete , skin colored nodules , 12 cm in size scattered over her face , back , abdomen , thighs , and lower legs [ figure 1 ] . her complete blood count along with general blood picture , liver , and renal function tests , fasting lipid profile and urinalysis were normal . rheumatoid factor and antinuclear antibodies were found to be within normal limits . on the basis of history and clinical examination , differential diagnosis of xanthoma , reticulohistiocytoma , sarcoidosis , and histoid leprosy ( a ) multiple discrete skin colored nodular lesions over back ( arrow ) ( b ) discrete skin colored nodular lesions over face , ( c ) discrete skin colored nodular lesions over back , ( d ) discrete skin colored nodular lesions over posterior aspect of left thigh and leg excisional biopsy of a nodule over the trunk was done and histopathological examination revealed circumscribed large focus of diffuse dense infiltrate of large histiocytes and histiocytic giant cells with scattering of lymphocytes and a few neutrophils [ figure 2 ] . several histiocytic giant cells resembling the touton giant cells were also seen [ figure 3 ] . overlying epidermis showed flattening and thinning and was covered by parakeratosis containing collection of neutrophils . based on clinical and histopathological findings a diagnosis of multiple cutaneous reticulohistocytoma the nature of the disease was explained to the patient and was referred to the plastic surgeon for the cosmetic correction of the facial lesion . skin biopsy showing lymphocytic infiltrate with histiocytes and giant cells [ h and e , 100 ] skin biopsy showing multinucleated giant cells ( arrow ) with an amorphous eosinophilic cytoplasm [ h and e , 400 ] non - langerhans cells histiocytosis represents a broad group of different disorders characterized commonly by proliferation of histiocytes other than langerhans cells . mcr represents a unique pattern in the spectrum of the reticulohistiocytoses , characterized by histiocytic proliferations of the skin and soft tissues . it may represent an abnormality histiocytic reaction to different stimuli . local trauma may play a role in the pathogenesis of solitary cutaneous histiocytoma , whereas in diffuse forms , the association with internal malignancies and autoimmune diseases suggest an immunologic basis . reticulohistiocytomas are usually solitary lesions of less than 1 cm in diameter . however , multiple lesions and large reticulocytomas have been rarely reported . histopathology of reticulohistiocytoma often shows mid - dermal infiltration of mononuclear histiocytes and multinucleated histiocytes with a ground - glass appearance and a variable number of vacuolated , spindle shaped , and xanthomatized mononuclear histiocytes . vimentin is universally positive but all other markers like s-100 , desmin , and smooth muscle - specific actin remain negative . pulsed dye laser , oral corticosteroids , and methotrexate has been tried in the treatment of extensive lesions . the only concern in our patient was regarding the physical appearance of the lesions as they were also present over the face . however , patient of mcr needs to be followed up regularly for long time to look for the development of mr which has various life threatening systemic complications . this case thus lays emphasis on considering mcr in the differential diagnosis of asymptomatic skin colored papulo - nodular lesions and adequate systemic evaluation and follow up of such patients .

multiple cutaneous reticulohistiocytoma ( mcr ) and multicentric reticulohistiocytosis ( mr ) are rare , idiopathic histiocytic granulomatous disorders presenting in a spectrum . a 35-year - old female presented with multiple , firm , discrete , asymptomatic nodules , 1 - 2 cm in size over face , back , abdomen , thighs , and legs . there were no systemic symptoms . histopathology of a nodule over trunk showed diffuse , dense infiltrate of large histiocytes , and histiocytic giant cells . the histiocytes had rounded vesicular nuclei and abundant pink homogenously stained ground glass cytoplasm . the diagnosis of mcr was made . systemic evaluation did not reveal any abnormality . considering the cosmetic appearance of facial lesions , patient was referred to the plastic surgeon . no treatment was advised for rest of lesions and patient was asked to review every 6 months or if any new complaints develop .

INTRODUCTION CASE REPORT DISCUSSION

in 1992 , the us centers for disease control ( cdc ) revised its definition of wound infection , creating the definition surgical site infection ( ssi ) to prevent confusion between the infection of a surgical incision and the infection of a traumatic wound . surgical wound infection is a serious hazard to patients , with incidence according to cdc was 15.45% , and according to the uk nosocomial infection surveillance was 11.32% , and according to asepsis was 8.79% . ssis are classified into incisional ssis , which can be superficial or deep , or organ / space ssis . a complex interplay between host , microbial , and surgical factors ultimately determines the prevention or establishment of a wound infection . the emergence of resistant strains has increased the morbidity and mortality associated with wound infections . these strains are beginning to develop resistance to vancomycin in north india found in study of tiwari et al . and they suggested to do such study in other parts of india also because the emergence of vrsa / visa ( vancomycin resistant staphylococcus aureus / vancomycin intermediate styphylococcus aureus ) might also be prevalent as antibiotic misuse is equally common there . this new resistance has arisen because another species of bacteria like acinetobacter commonly express vancomycin resistance . pseudomonas aeruginosa is an epitome of opportunistic nosocomial pathogen , which causes a wide spectrum of infections and leads to substantial morbidity in immuno compromised patients . despite therapy the mortality due to nosocomial pseudomonal pneumonia is approximately 70% . unfortunately , pseudomonas aeruginosa developed resistance to most of antibiotics thereby jeopardizing the selection of appropriate treatment . therefore , in present study , we also find out the antibiotic susceptibility patterns of pseudomonas aeruginosa . risk factors other than microbiology can be due to systemic factors affecting the patient 's healing response , local wound characteristics , or operative characteristics . its risk depends on bleeding , the amount of devitalized tissue created , the need for drains within the wound , obesity and diabetes mellitus . they are the third most frequent nosocomial infection , associated with increased hospital stay , costs , and use of antimicrobial agents . antibiotic resistance can be controlled by appropriate antimicrobial prescribing , prudent infection control , new treatment alternatives , and continued surveillance . due to significant changes in microbial genetic ecology , as a result of indiscriminate use of anti - microbials , the spread of antimicrobial resistance is now a global problem . present study was carried out to find out common bacterial pathogens responsible for postoperative wound infection and antibiotic susceptibility of various isolates . this prospective , observational , hospital - based cohort study was carried out after prior approval by institutional ethics committee . total 938 patients of either gender in different age groups admitted to the general surgery wards of guru gobindsingh hospital , jamnagar , were enrolled in the study between january and september 2006 . in all cases , information was collected in a case record form for age , sex , date of admission , associated co - morbid condition , reason for admission , type of surgery : emergency or planned , procedure , duration of surgery , preoperative and postoperative stay , preoperative antibiotic prophylaxis and type of wound clean , potentially infected and frankly infected wound . samples for wound infections were collected from the patients with complaints of discharge , pain , swelling , foul smelling , delayed and non healing wound by using a sterile swab , taking care to avoid contamination of the specimen with commensals from the skin , and were immediately transported to the laboratory . they were studied for identification of isolates by gram stains and culture growth on nutrient , blood and macconkey agar . colonies from nutrient agar were used for biochemical tests and antibiotic sensitivity . on isolation of gram positive cocci , catalase , and gram negative bacilli were distinguished using biochemical tests imvic ( indole , methyl red , voges - proskauer , citrateutilization),oxidase and triple sugar iron ( tsi ) agar tests.after confirmation of the organism , culture growth was tested for in vitro antibiotic susceptibility testing performed by disc diffusion method ( modified kirby bauer method ) on muller hinton agar . the disc ( eos l0 aboratories , mumbai ) contents are shown in table 1 . out of 938 surgeries , 110 ( 11.73% ) cases developed postoperative wound infections . maximum number of patients ( 62.73% ) were from 5 , 6 , and 7 decade of age group . higher infection rate was noted in males ( 12.78% ) as compared to females ( 10.60% ) . postoperative wound infection rate was 7.28% in clean surgeries , 9.63% in potentially infected surgical wounds and 19.19% in frankly infected wounds . the rate was higher in gangrene ( 30.0% ) , diabetic foot ( 22.45% ) , surgeries on large bowel ( 20.0% ) , abscess ( 18.18% ) , and in cellulites ( 15.52% ) . following antibiotics were used for pre - surgical prophylaxis : crystalline penicillin , ampicillin , cloxacillin , cefadroxil , cefotaxime , ceftriaxone , ceftazidime , cotrimoxazole , ciprofloxacin , norfloxacin , gentamicin , amikacin , and metronidazole . most commonly used combinations were : beta lactum antibiotics ( crystalline penicillin / ampicillin / cefotaxime ) cloxacillin / aminoglycosides ( gentamicin , amikacin ) / metronidazole and fluroquinolone ( ciprofloxacin ) cloxacillin / aminoglycosides ( gentamicin , amikacin ) / metronidazole . total 183 organisms were identified by gram staining , 57 were gram positive ( 31.15% ) and 126 were gram negative ( 68.85% ) . predominant organisms isolated were : staphylococcus aureus 48 ( 26.23% ) klebsiella pneumoniae 38(20.77% ) , pseudomonas aeruginosa 37 ( 20.22% ) , and escherichia coli 29 ( 15.85% ) . staphylococcus aureus was sensitive to rifampicin ( 89.58% ) followed by levofloxacin ( 60.42% ) and vancomycin(54.17% ) , while it was resistant to oxacillin ( 29.17%)and penicillin ( 25% ) . in one case , staphylococcus aureus was resistant to all antibiotics used for sensitivity testing . vancomycin resistant staphylococcus aureus was sensitive to rifampicin ( 95% ) , levofloxacin ( 35% ) , tetracycline ( 25% ) , erythromycin ( 25% ) , ciprofloxacin ( 20% ) , and roxithromycin ( 20% ) . staphylococcus epidermis was 100% sensitive to cefazolin , levofloxacin , oxacillin , rifampicin , and vancomycin , while it was less sensitive to gentamicin ( 77.78% ) , ciprofloxacin ( 77.78% ) , erythromycin ( 77.78% ) , penicillin ( 55.56% ) , and clindamycin ( 44.44% ) . pseudomonas aeruginosa was sensitive to ciprofloxacin ( 83.78% ) followed by gatifloxacin ( 51.35% ) , meropenem ( 51.35% ) , ceftazidime ( 45.95% ) and linezolid ( 43.24% ) . about 34.37% of isolated strains were resistant to both ceftazidime and meropenem . in these resistant strains , sensitivity of ciprofloxacin , gatifloxacin , cefazolin , and linezolid were 81.18% , 27.27% , 27.27% , and 18.18% , respectively . escherichia coli was sensitive to levofloxacin ( 72.41% ) and ciprofloxacin ( 62.07% ) , while it was less sensitive to ceftazidime ( 27.59% ) , cefuroxime ( 20.69% ) and cefdinir ( 13.79% ) . klebsiella pneumoniae was sensitive to gatifloxacin ( 63.16% ) , levofloxacin ( 63.16% ) , ciprofloxacin ( 63.16% ) , and linezolid ( 56.52% ) , while it was resistant to ceftazidime ( 36.84% ) , cefuroxime ( 34.21% ) and cefdinir ( 15.79% ) . proteus mirabilis was sensitive to ciprofloxacin ( 75% ) and linezolid ( 62.50% ) , while it was resistant to cefdinir ( 25% ) , cefuroxime ( 25% ) , co - trimoxazole ( 25% ) , and ampicillin+sulbactam ( 12.50% ) . proteus vulgaris was sensitive to ampicillin+sulbactam ( 57.14% ) followed by levofloxacin ( 50% ) , meropenem ( 42.86% ) , and ciprofloxacin ( 42.86% ) , while it was resistant to cefdinir ( 7.14% ) and cefuroxime ( 7.14% ) . among the studied antibiotics the gram positive isolates were sensitive to rifampicin ( 91.23% ) , levofloxacin ( 66.67% ) and vancomycin ( 61.40% ) , whereas they were resistant to penicillin ( 29.82% ) , gentamicin ( 29.82% ) , and clindamycin ( 22.81% ) [ figure 1 ] . the gram negative isolates were sensitive to ciprofloxacin ( 67.46% ) , levofloxacin ( 56.35% ) , gatifloxacin ( 51.59% ) , and linezolid ( 50.79% ) , and were resistant to cefuroxime ( 24.6% ) , co - trimoxazole(19.84% ) and cefdinir ( 16.67% ) [ figure 2 ] . sensitivity of commonly used antibiotics for gram positive bacteria sensitivity of commonly used antibiotics for gram negative bacteria in present study , rate of postoperative wound infection was 11.73% , that is similar to the other studies conducted in india . we had observed higher infection rate for clean ( 7.28% vs 2.6% to 2.9% ) , potentially infected ( 9.63%vs 5.4% to 14% ) , and frankly infected ( 19.19%vs 3.4% to 9% ) post - operative wounds as compared to previous studies . present study supports the conclusion of malone et al . that diabetes is a significant preoperative risk factor for surgical site infections . on gram stain examination , 31.15% pathogens were gram positive and 68.85% were gram negative , as against 69% for gram positive and 29% for gram negative organisms in other setups . this difference may be due to variation in common nosocomial pathogens inhabitant in different hospital set up . though percentage of gram negative bacilli from the wounds was more , staphylococcus aureus was predominant organism isolated followed by klebsiella pneumoniae , pseudomonas aeruginosa , and escherichia coli ; similar findings were observed in the studies done previously . the organisms most frequently involved in surgical infections change from time to time , and also vary with hospital settings . our study had shown reduced sensitivity of staphylococcus aureus to most of antibiotics : rifampicin ( 89.58% vs. 99% ) , levofloxacin ( 60.42% vs. 73 % ) , vancomycin(54.17% vs. 98.7% to 100%),[1720 ] oxacillin ( 29.17% vs. 28% to 61% ) , ciprofloxacin ( 41.67% vs. 25% to 66.7% ) , erythromycin ( 33.33% vs. 14% ) , cefazolin ( 31.25% vs. 61% to 71.8% ) , and gentamicin ( 20.83% vs. 77% ) as compared to previous studies . this should be cautiously interpreted as this might be because of false positive result by bacteria like acinetobacter and the resistance to vancomycin was not counterchecked by other laboratory . other study also shows false positive result by using same disc diffusion method , like iyerrn ( 2008 ) studied that styphylococcus aureus was also capable of transformation into the homogenously resistant strains and adhering to artificial surfaces , 20-fold higher than the usually encountered mrsa isolates . the bsac ( british society for antimicrobial chemotherapy ) has standardized method for disc diffusion testing to evaluate vancomycin susceptibility for mrsa isolates . a screening method developed by hiramatsuet al . appeared to show promise a few years ago , but was found to yield both false positives and false negative results . there is a need for the modern day clinical laboratory to develop a definitive method to confirm hetero - resistance to vancomycin among mrsa isolates as this could direct antibiotic therapy . the chief options in this direction are modified pap method , gradient plates , and the addition of mu 3 cell wall material to media . additionally , in 2009 , the clinical and laboratory standards institute ( clsi ) altered the guidelines for staphylococci such that disc diffusion was no longer an acceptable means for testing vancomycin susceptibility in these organisms . this certainly has implications in the management of infections caused by these strains in the nosocomial setting . it is essential for clinical laboratories to screen for and confirm vancomycin resistance in the clinical laboratory . however , there is need for active vrsa surveillance by healthcare institutions in india to enforce infection control measures , rational use of antibiotics and to prevent development of further resistance against this organism . rifampicin is highly active against staphylococci , but like mycobacterium tuberculosis resistance develops rapidly if is used as a monotherapy . it should be use with linezolid , quinupristin / dalfopristin , newer fluoroquinolones or other agents to prevent further resistance . in our study , staphylococcus epidermis was 100% sensitive to vancomycin , cefazolin , rifampicin , levofloxacin , and ofloxacin , followed by ciprofloxacin ( 77.78% ) , tobramycin ( 77.78% ) , gentamicin ( 77.78% ) , and erythromycin ( 66.67% ) . other studies had shown variable sensitivity pattern with vancomycin ( 96% to 100%),[1719 ] ciprofloxacin ( 75.8% ) , erythromycin ( 43% to 60%),[1819 ] and cefazolin ( 35% to 79.2% ) . as compared to other studies , in our study pseudomonas aeruginosa showed reduced sensitivity to commonly used antibiotics except ciprofloxacin ( 83.78% vs. 76% ) , meropenem ( 51.35% vs. 90.5% ) , ceftazidime / clavulanic acid ( 45.95% vs. 71.5% ) , levofloxacin ( 43.24% vs. 72.5 % ) , and ofloxacin ( 32.43% vs. 62.5 % ) . ciprofloxacin has been stated to be the most potent drug available for the treatment of p. aeruginosa infections . this report is in conformity with the result of this study in which ciprofloxacin recorded the least resistance ( 26.22% ) to p. aeruginosa isolates from wound infection patients . similar reduced resistance of p. aeruginosa to ciprofloxacin has been reported in jamaica(19.6% ) ( brown and izundu,2004 ) , latin america ( 28.6% ) , ilorin nigeria ( 24.7% ) and in kuala lumpur , malaysia ( 11.3% ) . it is undoubtable that at the present time , ciprofloxacin is the most effective antibiotics against p. aeruginosa involved in wound infection relative to most other commonly used drugs . in fact , the irrational and inappropriate use of antibiotics is responsible for the development of resistance of pseudomonas species to antibiotic monotherapy . periodic susceptibility testing should be carried out over a period of two to three years to detect the resistance trends . also , a rational strategy on the limited and prudent use of antipseudomonal agents is urgently required . the incidence of pseudomonas aeruginosa in postoperative wound infection is becoming more serious in developing countries because of relaxation in general hygienic measures , mass production of low quality antiseptic , and medicinal solutions for treatment , difficulties in proper definition of the responsibility among the hospital staff . sensitivity pattern of escherichia coli in our study as compared to others were levofloxacin ( 72.41% vs. 97 % to 100% ) , ciprofloxacin ( 62.07% vs. 97% to 100% ) , meropenem ( 51.72% vs. 100% ) , ampicillin+sulbactam ( 51.72% vs.83% to 84% ) , cefazolin ( 41.38% vs. 92% to 94% ) , ceftazidime / clavulanic acid ( 27.59% vs. 91% to 99% ) , ofloxacin ( 27.59% vs. 97% ) , cefuroxime ( 20.69% vs. 91% ) , cefdinir ( 13.79% ) , and cotrimoxazole ( 10.34% ) . so , reduced antibiotic sensitivity pattern noted for e. coli suggests its importance for hospital acquired infection . klebsiella pneumoniae was sensitive to linezolid ( 65.79% ) followed by levofloxacin ( 63.16% ) , ciprofloxacin ( 63.16% ) , and gatifloxacin ( 63.16% ) . however , our study had shown reduced sensitivity to ciprofloxacin ( 63.16% vs. 100% ) , cefazolin ( 44.74% vs. 100% ) , ceftazidime /clavulanic acid ( 36.84% vs. 100% ) , cefuroxime ( 34.21% vs. 100% ) , cotrimoxazole ( 26.32% vs. 100% ) as compared to previous studies . proteus mirabilis was sensitive to ciprofloxacin ( 75% ) and linezolid ( 62.50% ) , its sensitivity pattern were reduced for ciprofloxacin ( 75% vs. 95% to 100% ) , cefazolin ( 37.50% vs. 98% to 100% ) , ceftazidime / clavulanic acid ( 37.50% vs. 100% ) , levofloxacin ( 37.50% vs. 95% ) , cefuroxime ( 25% vs. 100% ) , co - trimoxazole ( 25% vs.97% to100% ) , ampicillin+sulbactam ( 12.50% vs. 80% to 95% ) as compared to previous studies . in our study , proteus vulgaris was sensitive to ampicillin+sulbactam ( 57.14% ) followed by levofloxacin ( 50% ) , meropenem(42.86% ) , and ciprofloxacin ( 42.86% ) . however , compared to previous study sensitivity of organism to most commonly used antibiotics were reduced for levofloxacin ( 50% vs. 100% ) , meropenem ( 42.86% vs. 100% ) , ceftazidime / clavulanic acid ( 28.57% vs. 100% ) , and ofloxacin ( 28.57% vs.100% ) . so , our finding supports the undesirable trends in antibiotic resistance , indicating decreasing efficacy of antibiotic classes such as second and third generation cephalosporins , extended - spectrum beta - lactamase inhibitor , carbapenems , and fluoroquinolones against gram negative bacilli . the increased prevalence of extended - spectrum beta - lactamases may contribute to the finding of multidrug resistance . linezolid , which is commonly used antibiotic for gram positive bacteria also showing sensitivity against gram negative bacteria in our study . this shows need to further study for in vivo effectiveness of linezolid against gram negative bacterial infections . postoperative sepsis rate in any hospital depends much on the case material , hospital environment , irrational use , and availability of antibiotics . so the trend now a day is comparative studies in the same hospital over years . lack of uniform antibiotic policy and indiscriminate use of antibiotics may have lead to emergence of resistant bacterial strains . particularly pseudomonas resistance to third generation cephalosporin and meropenem and vrsa / visa are real threat to control hospital acquired infection . hence , there should be an immediate response from the concerned authorities to check further emergence and spreading of these notorious vrsa strains and also there is a need to emphasize the rational use of antimicrobials and strictly adhere to the concept of reserve drugs to minimize the misuse of available antimicrobials . in our study linezolid shows good sensitivity against gram negative organism so further studies are required to check it . in addition , regular antimicrobial susceptibility surveillance is essential for area - wise monitoring of the resistance patterns . an effective national and state level antibiotic policy and draft guidelines should be introduced to preserve the effectiveness of antibiotics and for better patient management . shah medical college and guru gobindsingh hospital , jamnagar and eos laboratory , mumbai for providing antibiotic sensitivity disc .

objective : to find out the most common bacterial pathogens responsible for post - operative wound infection and their antibiotic sensitivity profile.materials and methods : this prospective , observational study was carried out in patients of postoperative wound infection . samples from wound discharge were collected using a sterile swab and studied for identification of isolates by gram stains and culture growth followed by in vitro antibiotic susceptibility testing performed by disc diffusion method on mueller hinton agar.results:out of 183 organisms , 126 ( 68.85% ) isolated organisms were gram negative . staphylococcus aureus , 48 ( 26.23% ) , was the predominant organism . s. aureus was sensitive to rifampicin ( 89.58% ) , levofloxacin ( 60.42% ) , and vancomycin ( 54.17% ) . pseudomonas aeruginosa was sensitive to ciprofloxacin ( 83.78% ) , gatifloxacin ( 51.35% ) , and meropenem ( 51.35% ) . escherichia coli was sensitive to levofloxacin ( 72.41% ) and ciprofloxacin ( 62.07% ) . klebsiella pneumoniae was sensitive to ciprofloxacin ( 63.16% ) , levofloxacin ( 63.16% ) , gatifloxacin ( 63.16% ) , and linezolid ( 56.52% ) . proteus mirabilis was sensitive to ciprofloxacin ( 75% ) and linezolid ( 62.50 ) . proteus vulgaris was sensitive to ampicillin+sulbactam ( 57.14% ) followed by levofloxacin ( 50%).conclusions : there is an alarming increase of infections caused by antibiotic - resistant bacteria , particularly in the emergence of vrsa / visa , meropenem , and third generation cephalosporin resistant pseudomonas aeruginosa . linezolid showing sensitivity against gram negative bacteria .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSIONS Acknowledgment

therefore , on a conventional mammogram , fat appears dark , whereas fibroglandular tissue appears white . in 1976 , wolfe was one of the first to demonstrate an association between breast density and the risk of developing breast cancer . this association was confirmed by mccormack et al . in a large meta - analysis including 42 studies , they showed that the risk of developing breast cancer is increased in dense breasts . the magnitude of this risk can be as high as 4.6-fold for the most dense breasts compared with the least dense category . recently , boyd et al . found similar results , showing that women with fibroglandular tissue in more than 75% of the mammogram had an increased risk of developing breast cancer when compared with women with less than 10% breast density in the mammogram ( odds ratio 4.7 ) . in addition to this association , several studies have shown that the sensitivity of the mammogram for detecting breast cancer is decreased in dense breasts [ 5 , 6 ] . for example , carney et al . demonstrated in a study of 463,372 screening mammograms that the sensitivity and specificity for fatty breast mammography were 88 and 97% respectively . however , these numbers decreased in extremely dense breasts ( sensitivity 62% , specificity 90% ) . several qualitative methods to assess breast density have been proposed in the past years , for example the wolfe and tabar classifications [ 2 , 7 ] . in 2003 , the breast imaging reporting and data system ( bi - rads ) quantitative classification was introduced . of these different breast density classification systems , bi - rads guidelines recommend an assessment of breast composition to be included in the analysis of the mammogram . according to the quantitative bi - rads breast density classification , breast density on mammogram can be divided into four categories : ( 1 ) almost entirely fat ( 24% ) , ( 2 ) scattered fibroglandular densities ( 2549% ) , ( 3 ) heterogeneously dense ( 5074% ) , and ( 4 ) extremely dense ( 75% ) . in the past nonetheless , they have not yet attained a strong hold in screening or clinical settings , mainly because these systems are time and labour intensive and require dedicated software programs and operator training . in screening and clinical settings , radiologists therefore generally assess breast density in a visual manner ( eyeballing ) as part of the total evaluation of the mammogram . in this study , we aimed to evaluate the accuracy of visual assessment of breast density ( on standard digital mammograms ) for both experienced and inexperienced readers as compared to the semi - automated assessment of breast density using a dedicated software program . consecutive digital mammograms of 200 women ( mean age 51.6 years , range 23.991.2 years ) were included . for this study , ethics approval and informed consent for the use of the ( coded ) images was waived according to dutch law . all images were acquired on a dedicated mammography system ( senographe essential , ge healthcare , waukesha , wi , usa ) . the standard craniocaudal ( cc ) and mediolateral oblique ( mlo ) imaging projections were used . additionally excluded were mammograms of breasts that had undergone surgery of any kind , for instance lumpectomy because of breast cancer or benign breast diseases or breast reduction . in the netherlands , research covered by the medical research involving human subjects act must be submitted to an accredited medical ethics committee for approval . however , the act does not cover retrospective research using ( coded ) data from patient s medical record or patient images . therefore , our medical ethics committee concluded that the research proposal of the current study does not , under dutch law , require medical ethics approval because there is no extra burden placed on research subjects for this study ( decision number : metc 11 - 4 - 049 ) . breast density was visually assessed on our dedicated mammographic workstations by an experienced mammoradiologist ( c.b . , 18 years experience ) and by an ( inexperienced ) senior resident in radiology ( c.f . breast densities had to be scored in one of the four quantitative bi - rads categories . both readers did not receive any specific training in assessing breast density and were blinded to each other s results , as well as to the results of the semi - automated analysis . breast density was analysed by using a so - called operator - dependent thresholding technique ( leica qwin version 3 , leica microsystems , cambridge , uk ) . this approach is an extensively evaluated method for assessing breast density on standard mammograms [ 1012 ] . more importantly , the association between increased risk for breast cancer in dense breasts has been demonstrated using the thresholding approach . in short , this technique translates the brightness of each pixel in a digitised mammographic image into a grey - level value . the grey - level value of this pixel is obtained , and appropriate threshold grey - level values are selected by the same operator to create an overlay representing the fibroglandular tissue within the breast . next , the total breast area is automatically identified , since regions outside of the breast tissue area are completely black , i.e. they have a grey - level pixel value of 0 . in the mediolateral oblique projections of the breast , the number of pixels is calculated for both the colour overlay of the fibroglandular tissue and the total area of the breast . breast density is presented as the area percentage of the fibroglandular tissue within the breast and is calculated by dividing the number of pixels in the colour overlay by the number of pixels in the total breast area and multiplying by 100 ( fig . 1 ) . the semi - automated analysis was performed by a experienced operator and radiologist ( m.b.i.l . , 5 years of experience using the thresholding approach and this software program ) , who was blinded to the results of both mammography readers . intra - observer reproducibility was assessed by re - analysing a subgroup of randomly selected mammograms ( n = 50 ) with an appropriate interval between these analyses of > 6 months . for this purpose , patients received a different coding . to determine inter - observer reproducibility , the same sample of mammograms was evaluated by an inexperienced operator , m.j.l . ( no experience in using the thresholding technique and the software programme , and receiving only 1 h of operator training by m.b.i.l . ) . the latter was blinded to the results of both mammography readers and the semi - automated analysis performed.fig . d graphic overlay of ( b ) and ( c ) . in this particular example , the mammographic breast density was 22% ( bi - rads density category 1 ) semi - automated detection of mammographic breast density . d graphic overlay of ( b ) and ( c ) . in this particular example , the mammographic breast density was 22% ( bi - rads density category 1 ) statistical analyses were performed by using spss 17.0 ( spss , chicago , il , usa ) and the sas statistical package ( sas institute , cary , nc , usa ) . the correlation between breast densities of both breasts ( as determined by the semi - automated analysis ) and of both cc and mlo projections was assessed by calculating the intra - class correlation coefficient ( icc ) . for the final analysis , the cc projection was used , since it avoids the need for additional segmentation to exclude the pectoral muscle in the mlo projection , which might create bias within the measurements . mean values of the breast density in the cc projections were assessed and translated into one of the four corresponding quantitative bi - rads categories . the inter- and intra - observer reproducibility of the semi - automated analyses was also calculated by using the icc . bland - altman plots were used to show the agreement between the various semi - automated analyses . furthermore , the agreement of the quantitative bi - rads categorisation between the experienced and inexperienced reader was compared and expressed as the weighted kappa value . finally , the accuracy of this quantitative bi - rads categorisation between the readers was evaluated ( with the semi - automated analysis as reference standard ) and again expressed as weighted kappa value . consecutive digital mammograms of 200 women ( mean age 51.6 years , range 23.991.2 years ) were included . for this study , ethics approval and informed consent for the use of the ( coded ) images was waived according to dutch law . all images were acquired on a dedicated mammography system ( senographe essential , ge healthcare , waukesha , wi , usa ) . the standard craniocaudal ( cc ) and mediolateral oblique ( mlo ) imaging projections were used . additionally excluded were mammograms of breasts that had undergone surgery of any kind , for instance lumpectomy because of breast cancer or benign breast diseases or breast reduction . in the netherlands , research covered by the medical research involving human subjects act must be submitted to an accredited medical ethics committee for approval . however , the act does not cover retrospective research using ( coded ) data from patient s medical record or patient images . therefore , our medical ethics committee concluded that the research proposal of the current study does not , under dutch law , require medical ethics approval because there is no extra burden placed on research subjects for this study ( decision number : metc 11 - 4 - 049 ) . breast density was visually assessed on our dedicated mammographic workstations by an experienced mammoradiologist ( c.b . , 18 years experience ) and by an ( inexperienced ) senior resident in radiology ( c.f . breast densities had to be scored in one of the four quantitative bi - rads categories . both readers did not receive any specific training in assessing breast density and were blinded to each other s results , as well as to the results of the semi - automated analysis . breast density was analysed by using a so - called operator - dependent thresholding technique ( leica qwin version 3 , leica microsystems , cambridge , uk ) . this approach is an extensively evaluated method for assessing breast density on standard mammograms [ 1012 ] . more importantly , the association between increased risk for breast cancer in dense breasts has been demonstrated using the thresholding approach . in short , this technique translates the brightness of each pixel in a digitised mammographic image into a grey - level value . the grey - level value of this pixel is obtained , and appropriate threshold grey - level values are selected by the same operator to create an overlay representing the fibroglandular tissue within the breast . next , the total breast area is automatically identified , since regions outside of the breast tissue area are completely black , i.e. they have a grey - level pixel value of 0 . in the mediolateral oblique projections of the breast , the number of pixels is calculated for both the colour overlay of the fibroglandular tissue and the total area of the breast . breast density is presented as the area percentage of the fibroglandular tissue within the breast and is calculated by dividing the number of pixels in the colour overlay by the number of pixels in the total breast area and multiplying by 100 ( fig . 1 ) . the semi - automated analysis was performed by a experienced operator and radiologist ( m.b.i.l . , 5 years of experience using the thresholding approach and this software program ) , who was blinded to the results of both mammography readers . intra - observer reproducibility was assessed by re - analysing a subgroup of randomly selected mammograms ( n = 50 ) with an appropriate interval between these analyses of > 6 months . for this purpose , patients received a different coding . to determine inter - observer reproducibility , the same sample of mammograms was evaluated by an inexperienced operator , m.j.l . ( no experience in using the thresholding technique and the software programme , and receiving only 1 h of operator training by m.b.i.l . ) . the latter was blinded to the results of both mammography readers and the semi - automated analysis performed.fig . d graphic overlay of ( b ) and ( c ) . in this particular example , the mammographic breast density was 22% ( bi - rads density category 1 ) semi - automated detection of mammographic breast density . d graphic overlay of ( b ) and ( c ) . in this particular example , the mammographic breast density was 22% ( bi - rads density category 1 ) statistical analyses were performed by using spss 17.0 ( spss , chicago , il , usa ) and the sas statistical package ( sas institute , cary , nc , usa ) . the correlation between breast densities of both breasts ( as determined by the semi - automated analysis ) and of both cc and mlo projections was assessed by calculating the intra - class correlation coefficient ( icc ) . for the final analysis , the cc projection was used , since it avoids the need for additional segmentation to exclude the pectoral muscle in the mlo projection , which might create bias within the measurements . mean values of the breast density in the cc projections were assessed and translated into one of the four corresponding quantitative bi - rads categories . the inter- and intra - observer reproducibility of the semi - automated analyses was also calculated by using the icc . bland - altman plots were used to show the agreement between the various semi - automated analyses . furthermore , the agreement of the quantitative bi - rads categorisation between the experienced and inexperienced reader was compared and expressed as the weighted kappa value . finally , the accuracy of this quantitative bi - rads categorisation between the readers was evaluated ( with the semi - automated analysis as reference standard ) and again expressed as weighted kappa value . using the semi - automated analysis , the icc of the left - sided breast density in both cc and mlo projection was excellent : 0.91 [ 95% confidence interval ( ci ) 0.880.93 ] . similar excellent results were acquired for the right breast in both projections : icc 0.91 ( 95% ci 0.880.93 ) . the breast densities of the left and right breast were comparable ( icc 0.92 , 95% ci 0.890.94 ) in the cc projection . for the mlo projection , the icc for the breast densities of the left and right breast was excellent ( 0.91 , 95% ci 0.890.93 ) . all these results were highly significant ( all p < 0.0001 ) and comparable with results previously published . bland - altman plots of all these analyses showed very good agreement ( fig . 2 ) . although there is a slightly larger disagreement for more dense breasts , the observed differences are still acceptable.fig . 2bland - altman plots for the semi - automated analyses of breast densities of both breasts in two projections . intra - class correlation coefficients ( icc ) of the measurements were highly significant ( all p < 0.0001 ) . solid lines represent the mean of the differences between the two analyses , dotted lines represent the boundaries of two times the standard deviation of the difference bland - altman plots for the semi - automated analyses of breast densities of both breasts in two projections . intra - class correlation coefficients ( icc ) of the measurements were highly significant ( all p < 0.0001 ) . solid lines represent the mean of the differences between the two analyses , dotted lines represent the boundaries of two times the standard deviation of the difference reproducibility of the semi - automated analysis in a subset of mammograms ( n = 50 ) proved to be good as well . the icc of both cc and mlo projections of the left and right breast were all highly significant ( p < 0.0001 ) with values ranging from 0.82 to 0.88 . even more interesting is the inter - observer comparison of the semi - automated analysis . in these analyses , the icc of both cc and mlo projections of the left and right breast were also highly significant ( p < 0.0001 ) with values ranging from 0.80 to 0.88 . although the observed differences in breast densities were slightly higher than in the initial semi - automated analyses , bland - altman plots still showed good agreement of all these analyses with acceptable differences in breast density measurements ( figs . 3 and 4).fig . intra - class correlation coefficients ( icc ) were highly significant ( all p < 0.0001 ) . solid lines represent the mean of the differences between the two analyses , dotted lines represent the boundaries of two times the standard deviation of the differencesfig . intra - class correlation coefficients ( icc ) of the measurements were highly significant ( all p < 0.0001 ) . solid lines represent the mean of the differences between the two analyses , dotted lines represent the boundaries of two times the standard deviation of the differences intra - observer agreement of the semi - automated analyses . intra - class correlation coefficients ( icc ) were highly significant ( all p < 0.0001 ) . solid lines represent the mean of the differences between the two analyses , dotted lines represent the boundaries of two times the standard deviation of the differences inter - observer agreement of the semi - automated analyses . intra - class correlation coefficients ( icc ) of the measurements were highly significant ( all p < 0.0001 ) . solid lines represent the mean of the differences between the two analyses , dotted lines represent the boundaries of two times the standard deviation of the differences table 1 shows the inter - observer agreement of the quantitative bi - rads classification of both mammographic readers . there was a disagreement between the quantitative bi - rads categorisations of the experienced and inexperienced reader . in 83 of the 200 cases ( 42% ) , the agreement of the experienced and inexperienced reader was therefore only moderate with a kappa value of 0.52 ( table 1).table 1inter - reader agreement of breast density according to bi - rads classifications . results of the experienced reader are presented in the columns , results of the inexperienced reader are presented in the rowsexperienced readerbi - rads 1bi - rads 2bi - rads 3bi - rads 4totalinexperienced readerbi - rads 166 ( 33.0%)2 ( 1.0%)2 ( 1.0%)0 ( 0.0%)70 ( 35.0%)bi - rads 219 ( 9.5%)36 ( 18.0%)1 ( 0.5%)0 ( 0.0%)56 ( 28.0%)bi - rads 35 ( 2.5%)38 ( 19.0%)10 ( 5.0%)0 ( 0.0%)53 ( 26.5%)bi - rads 41 ( 0.5%)3 ( 1.5%)14 ( 7.0%)3 ( 1.5%)21 ( 10.5%)total91 ( 45.5%)79 ( 39.5%)27 ( 13.5%)3 ( 1.5%)200 ( 100.0%)the overall weighted kappa was 0.521 , a moderate value ( 95% confidence interval 0.4460.597 ) inter - reader agreement of breast density according to bi - rads classifications . results of the experienced reader are presented in the columns , results of the inexperienced reader are presented in the rows the overall weighted kappa was 0.521 , a moderate value ( 95% confidence interval 0.4460.597 ) when compared with the results of the semi - automated analyses , the experienced reader agreed with the quantitative bi - rads category in 58.5% of the cases . the classification was overestimated in 35.5% of the cases and underestimated in 6.0% of the cases . in comparison , the inexperienced reader agreed less ( 42.0% ) and generally overestimated the quantitative bi - rads classification more than the experienced reader ( 56.0% ) . agreement between the classification of both readers versus the semi - automated analysis was poor to moderate with weighted kappa values of 0.367 ( experienced reader ) and 0.232 ( inexperienced reader , table 2).table 2classification of the results of the experienced and inexperienced readers and the software analysis . the agreement of the respective readers results and the semi - automated software is presented as the weighted kappa valueexperienced readerinexperienced readersoftware analysistotal patients classified200 ( 100.0%)200 ( 100.0%)200 ( 100.0%)bi - rads 1 classification ( % ) 91 ( 45.5%)70 ( 35.0%)127 ( 63.5%)bi - rads 2 classification ( % ) 79 ( 39.5%)56 ( 28.0%)68 ( 34.0%)bi - rads 3 classification ( % ) 27 ( 13.5%)53 ( 26.5%)5 ( 2.5%)bi - rads 4 classification ( % ) 3 ( 1.5%)21 ( 10.5%)0 ( 0.0%)correct classification ( % ) 117 ( 58.5%)84 ( 42.0%)classification overestimated ( % ) 71 ( 35.5%)112 ( 56.0%)classification underestimated ( % ) 12 ( 6.0%)4 ( 2.0%)weighted kappa0.3670.232 classification of the results of the experienced and inexperienced readers and the software analysis . the agreement of the respective readers results and the semi - automated software is presented as the weighted kappa value in this study , reliability of visual assessment of breast density for both experienced and inexperienced readers was evaluated , as compared to the semi - automated assessment of breast density using a dedicated software program . our results showed that there was disagreement between the quantitative bi - rads categorisation of the experienced and inexperienced readers . when compared to the semi - automated analysis , the experienced reader agreed with the quantitative bi - rads classification in 58.5% of the cases . the classification was overestimated in 35.5% of the cases , and underestimated in 6.0% of the cases . furthermore , the semi - automated assessment of breast density showed good intra- and interobserver reproducibility . breast density is an important risk factor for breast cancer development , independent of other breast cancer risk factors . also , breast cancer is more difficult to detect in mammographically dense breasts [ 5 , 6 ] . in our institution , mammograms are evaluated by radiologists and/or ( supervised ) residents , using the bi - rads classification for breast density . however , our study results showed disagreement between radiologist ( experienced reader ) and resident ( inexperienced reader ) and that breast density is frequently overrated ( even by a highly experienced reader ) . these findings are in line with previously published results . in the majority of cases , although this may seem a negligible overestimation , a speculative ( but nonetheless plausible ) assumption is that overrating breast density might lead to more imaging [ e.g. additional mammographic projections , ultrasound , or contrast - enhanced magnetic resonance ( mr ) mammography ] , more costs , and more patient anxiety . due to the improvements in mr mammography , it is worth considering which patients are at increased risk of developing breast cancer ( i.e. patients with mammographically dense breasts ) and who might benefit from a shorter screening interval or additional mr mammography . despite the fact that this information is enclosed within the images , it is not used in current clinical settings or screening to identify high - risk patients , since the ( visual ) bi - rads density classification is not suitable for the expression of breast cancer risk . based on our current observations ( which show a substantial disagreement between the visual and semi - automated assessment of breast density ) , we would prefer a ( workstation ) integrated ( semi-)automated analysis of breast density to identify patients at high risk for developing breast cancer or in whom breast cancer is likely to be missed . for this purpose , several ( semi-)automated systems to assess breast density have been proposed in the past . of these , the so - called thresholding approach using ( commercially available ) software packages has been extensively studied in the past and is therefore frequently used in quantitative assessment of breast density . using this thresholding technique , boyd et al . showed that women with mammographic breast density 75% had an increased risk of developing breast cancer when compared to women with breast density less than 10% ( odds ratio 4.7 , 95% confidence interval 3.07.4 ) . we also used a thresholding approach using the leica qwin software package and showed similar results in breast densities of both breasts and in both projections . in addition , our software demonstrated a good intra - observer agreement ( fig . a major advantage of our semi - automated analysis is that even analysts with hardly any experience using our software can achieve good reproducibility ( fig . 4 ) . the assessment of the mammographic breast density using this technique is time and labour intensive . for example , our time for the assessment of breast density in a single patient study was estimated to be 58 min . recently , stone et al . demonstrated that assessing breast density of one breast in one projection is sufficient this suggestion is supported by the findings of our current study and enables the inclusion of women that have undergone unilateral breast surgery of any kind . furthermore , the thresholding approach requires proper operator - training to use the software , although our current results ( based on our software program ) suggest otherwise . in screening or clinical settings , this software needs to be integrated in the mammographic work stations . because of these disadvantages , mammographic breast density is usually assessed visually , especially in screening / clinical settings and large studies in which a great number of mammograms need to be evaluated . performed a similar study using a fully automated software package . in this study mammograms of 65 women however , on close inspection , five of the radiologists had already interacted with the software programme , leaving two radiologists ( albeit experienced in mammography reading ) untrained for the breast density analysis . the breast density was overestimated by these two radiologists in 37% of the cases , as compared to 36% overestimation by the experienced radiologist in our study . so although it might be difficult to generalise our study results based on the results of two readers , they are in line with previously published results . in addition , there were other interesting differences in the analyses performed by us and martin et al . in the study of martin et al . , 6% of the images could not be analysed due to technical difficulties versus no technical difficulties in our study . furthermore , the 95% limits of agreement between the trained radiologists and the automated analyses of the study of martin et al . were rather large : 16% to + 27% . visual inspection of the bland - altman plots of our study show that our limits of agreement were much smaller ( fig . 2 ) . our study included relatively small numbers of dense breasts , i.e. quantitative bi - rads categories 3 and 4 . the study of martin et al . described similar results and included 15 additional women with dense breasts in their study after their initial inclusion of 50 women . previously published larger studies show slightly higher numbers of dense breasts in their populations , presumably owing to the larger size of the populations used when compared to our study population . for our study , we opted not to include additional women with dense breasts to prevent inclusion bias . there is no accurate way to determine breast density other than histopathologic analysis of mastectomy specimens . it is obvious that these specimens are not available for this study , and previously published studies assessing breast density with various computerised methods also lack this ( true ) golden standard . as we have shown in this study , our software programme acquired similar results to other , more validated programmes . this is why we have chosen to use our software programme as the reference standard ( not golden standard ) to which we compared the visual assessment of breast density . a second limitation of our study is that the association between mammographically dense breasts and risk of developing breast cancer has not yet been demonstrated with our software programme . due to the comparability of acquired results with more validated software programs , we expect that breast density ( as assessed by our software program ) is also associated with increased breast cancer risk . however , larger studies using our software programme are in progress to prove this hypothesis . finally , our analysis remains a semi - automated ( and not fully automated ) technique , requiring input from an operator and is therefore at risk of introducing observer - dependent bias . recently , a commercially available software tool ( quantra , hologic , bedford , ma , usa ) to automatically assess breast density was compared to the cumulus software program . this study showed a strong density correlation between both breasts and for both methods , suggesting that fully automated assessment of breast density could also aid in breast cancer risk estimation . this was confirmed in another study by pinker et al . , demonstrating that breast density , as assessed with this automated analysis , was strongly associated with breast cancer risk in women younger than 50 years , but not older than 50 years . in line with these developments , another fully automated software program was launched earlier this year : volpara ( matakina international , wellington , new zealand ) . however , the major drawback of these recently available programs is their limited availability on only ge or hologic digital mammography systems . in summary , our results showed that there is a disagreement in quantitative bi - rads breast density classification between experienced and inexperienced readers and the semi - automated software analysis . in order to accurately assess breast density in a reproducible and observer - independent manner , we would recommend the use of an integrated software tool , which can be applied in both screening and clinical settings . this semi - automated analysis of breast density might aid in identifying patients at high risk for developing breast cancer and/or patients who can benefit from additional mr mammography because of an unreliable mammogram . currently , the thresholding approach to assess breast density on standard mammograms is preferable , for instance as assessed by the dedicated software program used in this study or any other commercially available software package . in order to rapidly assess breast density and to include patients who have undergone mastectomy , assessment of a single breast in one projection ( preferably the cc projection ) is sufficient . this proposal is also supported by our current findings . in turn , future studies could investigate whether patients with mammographically dense breasts ( i.e. those at high risk of developing breast cancer ) can benefit from this accurate breast density assessment , for instance by shortening the screening interval or by performing additional ( mr ) imaging . the results of our study showed that visual assessment of breast density on mammograms is inaccurate and observer - dependent . semi - automated analysis of breast density reduces inter - observer variation of breast density classification on mammograms .

objectivesvisual inspection is generally used to assess breast density . our study aim was to compare visual assessment of breast density of experienced and inexperienced readers with semi - automated analysis of breast density.methodsbreast density was assessed by an experienced and an inexperienced reader in 200 mammograms and scored according to the quantitative bi - rads classification . breast density was also assessed by dedicated software using a semi - automated thresholding technique . agreement between breast density classification of both readers as well as agreement between their assessment versus the semi - automated analysis as reference standard was expressed as the weighted kappa value.resultsusing the semi - automated analysis , agreement between breast density measurements of both breasts in both projections was excellent ( icc > 0.9 , p < 0.0001 ) . reproducibility of the semi - automated analysis was excellent ( icc > 0.8 , p < 0.0001 ) . the experienced reader correctly classified the bi - rads breast density classification in 58.5% of the cases . classification was overestimated in 35.5% of the cases and underestimated in 6.0% of the cases . results of the inexperienced reader were less accurate . agreement between the classification of both readers versus the semi - automated analysis was considered only moderate with weighted kappa values of 0.367 ( experienced reader ) and 0.232 ( inexperienced reader).conclusionvisual assessment of breast density on mammograms is inaccurate and observer - dependent .

Introduction Materials and methods Study inclusion Statistical analysis Results Discussion Conclusion

eikenella corrodens is a slow growing , nonmotile , facultative anaerobic , gram - negative bacillus which is commensal of the oral cavity , intestinal and genital tracts [ 13 ] . the most common clinical sources of this organism are human bite wounds , head and neck infections and respiratory tract infections [ 1 , 2 , 4 ] . eikenella species have also been shown to cause endocarditis , intraabdominal infection , pancreatic abscess , arthritis , vertebral osteomyelitis , discitis , orbital cellulites , thyroid abscess , brain abscess , liver abscess and genitourinary infections [ 13 , 58 ] . according to our research , this is the first report of eikenella corrodens causing vulvar abscess in a diabetic patient in english literature . a diabetic 55 year old woman was admitted to zonguldak karaelmas university emergency clinic with a complain of an insidious onset of swelling in the left part of vulva , a pain radiating to the left inguinal region , chills and high fever over a week . she has had hypertension and type ii diabetes mellitus and has used oral anti - diabetic and anti - hypertension drugs for 8 years . she had no history of previous trauma , operation , underlying skin lesion , use of foreign body or human bite on her vulvar region . two days after onset , her left part of the vulva became swelling and the lesions color turned to red . even though she had used amoxicilline - clavulanic acid and ornidasole for three days , the lesion on the vulva and pain worsened . in clinical examination her fever 38c , pulse 96/dk , blood pressure 160/80 mmhg , in the left part of the vulva there was an erode lesion in the certain part of the inflammatory halo . the lesion was 5 4 cm in size , red , hot , swollen , and painful and fluctuant . laboratory values were as follows : wbc count , 18200/ mm ( 82% neutrophils , 8% lymphocyte , 8% monocytes ) [ 400010000/mm ] ; erythrocyte sedimentation rate ( esr ) , 122 mm / hour [ 020 mm / hour ] ; c - reactive protein , ( + + + + ) [ negatif ] ; and blood glucose , 235 mg / dl [ 70110 mg / dl ] . vulvar abscess was diagnosed and it was drained . in gram stain of the pus , granulocytes ( 80% neutrophil ) , ampicilline - sulbactam 4 1 gr iv / day , ciprofloxacin 2 400 mg iv / day and local care with 2% eau borique fluid were started empirically . following drainage , her fever , leucocyt count became normal and , edema , pain and erythema of the lesion subsided . eikenella corrodens and metisilline sensitive staphylococcus epidermidis ( msse ) were isolated from culture of the pus . after 3 days of the treatment her fever , white blood cell count was normal , esr was 100 mm / hour . the patient completed 14 days of treatment with resolution of signs and symptoms . the esr was 72 mm / hour in the first week of the treatment , 30 mm / hour at the end of the treatment . an informed consent was obtained from the patient to use of her photographs . a break in barriers , such as mucous membranes or the skin , can lead to hematogenous spread and serious eikenella infections . it is described that previous or concomitant illness had a greater association with eikenella infections than did a previously healthy status . diabetes mellitus is one of these underlying conditions ; our case is also type ii diabetic patient . eikenella is typically susceptible to many antibiotics , including penicillin g , ceftriaxone , amoxicillin - clavulonic acid , and fluoroquinolones . some of the -laktamases produced by eikenella are inhibited by clavulonate and sulbactam , however -laktamase production is uncommon at present . surgical drainage may be more important than antibiotics alone in the management of eikenella infections . our patient was started on amoxicillin - clavulonate and ornidasole before admitting to our hospital and not responded well until drainage of the abscess . depending on the location of infection , treatment choice is a combination of surgical management and antibiotics . our patient has been successfully treated with ampicilline - sulbactam and ciprofloxacin for 14 days . there are a few literatures reporting that esr is a valuable test in genital abscess [ 9 , 10 ] . however , we could not find any study showing correlation between esr level and vulvar abscess . on the other hand , in a study reported by paul and patel including 54 children and adolescents with e. corrodens infections elevated esr was detected for most of the patients and the authors considered that esr was a better indicator than wbc count for e. corrodens infections . in this case , esr was 122 mm / hour at the onset of the illness and esr level reduced to 30 mm / hour at the end of the treatment . e. corrodens causes various clinical manifestations especially in diabetic patients and esr may be a good indicator of eikenella corrodens infections .

we report a case of eikenella corrodens causing vulvar abscess in a diabetic patient . eikenella corrodens is a slow growing , nonmotile , facultative anaerobic , gram - negative bacillus which is commensal of the oral cavity , intestinal and genital tracts . the most common clinical sources of this organism are human bite wounds , head and neck infections and respiratory tract infections . in our knowledge , the presented case is the first report of eikenella corrodens causing vulvar abscess in a diabetic patient .

1. INTRODUCTION 2. CASE 3. DISCUSSION

mycotic aneurysms are rare inflammatory neurovascular lesions first described in 1855.6 ) mycotic aneurysms account for approximately 2.5 ~ 4.5% of all intracranial aneurysms and are unique in their natural history , pathologic findings , location and common multiplicity.6)8)26)27)34 ) their spontaneous rupture mostly results in subarachnoid and intracerebral hemorrhage , accompanied by morbidity and mortality as high as 60 ~ 90% in older case reports , and 12 ~ 32% in more recent reports.17)29 ) ruptured mycotic aneurysm manifesting as subdural hematoma ( sdh ) is extremely rare ; only 10 cases have been reported.2 - 4)13 - 15)20)26)31)34 ) we present a case of mycotic aneurysm associated with sdh , which was resolved with medical treatment . he slipped and suffered from blunt traumas to his head 10 days before his visit to the hospital . he showed right hemiparesis with a motor power of grade iv / v in the right upper and lower limbs . the initial glasgow coma scale score was 12 ( eye response - 3 , verbal response - 4 , motor response - 5 ) . he had no extracranial wounds and the vital signs were stable , but his body temperature was mildly elevated . the patient had a history of type 2 diabetes mellitus and hypertension , and he was a heavy alcoholic . enhanced computer tomography ( ct ) of the brain showed subacute subdural hematomas on both fronto - parietal areas and an enhancing nodule in the left parietal area ( fig . ct angiography revealed that the enhancing nodule was a saccular aneurysm located at the m4 segment of the left middle cerebral artery ( mca ) . cerebral angiogram showed 2 aneurysms ; one located at the distal left mca and the other at the bifurcation of the left mca ( fig . 2 ) . laboratory studies revealed an elevated erythrocyte sedimentation rate ( esr , 49 mm / hr ) , white blood cell count ( wbc , 12,990/l ) and c - reactive protein ( crp , 9.28 mg / l ) , but other hematological and biochemical parameters were within normal range . blood cultures were negative and there was no evidence of infective endocarditis in the echocardiography . the enhanced ct 10 days after admission revealed disappearance of the aneurysm located at the m4 segment and partial resolution of sdh ( fig . antibiotics were continuously given for 4 weeks with moderate improvement of his symptoms and the patient was discharged . because the aneurysm located at the bifurcation of the left mca was small and had no interval change , we decided to observe it in our outpatient department . mycotic aneurysms are rare inflammatory neurovascular lesions , comprising 0.7 - 5.4% of all intracranial aneurysms.1 ) sixty five percent of patients of mycotic aneurysms have underlying endocarditis.1 ) other common sources of infection are intravenous drug abuse ( 6.3% ) , bacterial meningitis ( 5.2% ) , poor dental hygiene ( 4.2% ) and cavernous sinus thrombosis ( 2.8%).1 ) in this case , no infective endocarditis or infectious diseases were found . however , the patient was old , a heavy alcoholic and had a history including diabetes mellitus . this can increase the risk of infectious diseases , but the origin of the mycotic aneurysm was not found . there are several limitations in diagnosing mycotic aneurysms , because the infectious pathological lesions can be identified histopathologically only in resected specimens . it is possible to diagnose mycotic aneurysm when the lesion was resolved completely under treatment . the recently published diagnostic criteria enable early diagnosis of mycotic aneurysm ( table 1).12 ) these criteria are easy to apply and have 96% sensitivity and 100% specificity to differentiate mycotic aneurysm from a noninfectious aneurysm.12 ) in our case , the patient had a fever at presentation , multiplicity and distal location of the aneurysm . the distal mca aneurysm completely disappeared in angiography after antibiotic therapy . following the criteria mentioned above , the aneurysm located at the m4 segment of left mca can be diagnosed with a mycotic aneurysm . the rupture of mycotic aneurysm causes intraparenchymal ( 28% ) , subarachnoid ( 22% ) and intraventricular hemorrhage ( 5%).1 ) a mycotic aneurysm associated with sdh is a rare case.16 ) only 10 cases have been reported.2 - 4)14 - 16)20)26)31)34 ) in this case , his head trauma may have caused the rupture of the underlying mycotic aneurysm . on the other hand , the trauma could directly cause bilateral subdural hematomas and the mycotic aneurysm could be found incidentally . ct angiography is a useful non - invasive tool in the diagnosis of mycotic aneurysms and detecting intracranial hemorrhage and edema.1 ) cerebral angiography is the gold standard for the diagnosis of mycotic aneurysms and is often used in determining treatment method and prognosis.5 ) laboratory studies are typically suggestive of an underlying inflammatory process and may include leukocytosis , elevated esr , crp , and anemia.6 ) elevated esr , crp and leukocytosis provide supporting evidences of mycotic aneurysms.35 ) blood cultures are positive in only 35.6% of patients.1 ) in our case , wbc count , esr and crp were elevated but blood cultures were negative . there is no randomized controlled trial or prospective cohort study evaluating treatment approaches to mycotic aneurysms . because there is no standard recommendation about clinical decision making , treatment of mycotic aneurysms is highly individualized and varied.18 ) treatment approach is usually dependent on the rupture status . in the case of unruptured mycotic aneurysms , the treatment was generally initiated with antibiotic therapy alone.1 ) antibiotic therapy should be guided by culture results obtained from blood or cerebrospinal fluid samples , but if cultures are negative , empirical antibiotics should be initiated according to the suspected predisposing infection . the existing literature generally supports a minimum of 4 to 6 weeks of antibiotic therapy.18 ) serial ct scan or angiography should be followed to monitor the status of the aneurysm during conservative care . in the case of ruptured mycotic aneurysms , definitive treatment relies on surgical clipping , endovascular coiling , or trapping of the aneurysm . frazee recommended antibiotic therapy as the first line of treatment for mycotic aneurysm.9 ) some studies suggested that standard recommendations of treatment were to initiate intravenous antibiotics on an empirical basis.7)28)30 ) in kanoth 's study , 25 patients were treated with medical , surgical and endovascular method , and some cases with intracranial hemorrhage were completely resolved by antibiotic therapy alone.24 ) some cases required surgery because the lesions were not resolved or enlarged.24 ) in our case , the treatment was started with antibiotics alone because he did n't have significant mass effect from the subdural hematomas and no signs of tentorial herniation . the subdural hematomas in initial ct were subacute types and there was no presence of midline shift . both subdural hematomas were resolved in later ct and the follow - up cerebral angiography revealed disappearance of the distal mca aneurysm . we experienced a rare case of ruptured mycotic aneurysm associated with sdh without infective endocarditis and any other infectious disease . after treatment with antibiotics for 4 weeks , the patient was nearly relieved of symptoms .

mycotic aneurysms are rare inflammatory neurovascular lesions . ruptured mycotic aneurysm manifesting as subdural hematoma is extremely rare . a 72-year - old male patient was admitted to our hospital with headache and drowsiness . computer tomography ( ct ) of brain and ct angiography revealed subdural hematoma and an aneurysm located at the m4 segment of the left middle cerebral artery ( mca ) . cerebral angiogram revealed 2 aneurysms ; one located at the left distal mca and the other at the bifurcation of left mca . laboratory studies showed leukocytosis and elevated inflammatory factors . the patent was treated with antibiotic therapy for 4 weeks . the follow - up ct and cerebral angiography showed that the mycotic aneurysm was completely resolved , and the patient was nearly free of symptoms .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION

the protocols for flim sample preparation do not differ from those for confocal or wide - field intensity - based fluorescence microscopy . the data acquisition is followed by the main task of data analysis , i.e. extracting the fluorescence lifetimes from the raw data . prepare a stock solution ( 10 ml ) by dissolving approximately 1 mg / ml of the dye in an appropriate solvent ( e.g. methanol for bodipy - c12 ) using an accurate balance and a pipette . the cells ( a model cancer cell line , hela in our case ) to be stained are grown on in a multiwell plate with a coverslide underside for microscopy , in an incubator at 37 c with a 5 % co2 atmosphere until ~ 80% confluent . add 10 - 20 l of the stock solution to the living cells growing in a multi - well plate ( smartslide 50 micro - incubation system , wafergen ) in 4 ml of opti - mem medium ( gibco ) per well for a 6-well plate . return the multi - well plate to an incubator at 37 c with a 5 % co2 atmosphere for 10 - 45 mins for staining . remove the multiwell plate from the incubator and wash the cells 3 - 4 times with 4 ml optically clear cell culture medium ( e.g. opti - mem ) to remove excess dye . transfer the multiwell plate to the microscope stage and connect to a temperature controller / 5 % co2 gas inlet as required , in preparation for imaging . place the sample on the microscope stage and obtain a transmission and fluorescence image to identify fluorescent cells . a schematic diagram of the experimental set - up is shown in fig . 1.verify that the fluorescence emanates from the locations expected ( e.g. cell membrane , cytoplasm ) . obtain a fluorescence emission spectrum , and verify that it is that of the dye or protein expected , in this case the spectrum of the molecular rotor . as a negative control , although this step is not essential specifically for flim , it is good practice in general and does help to verify that the sample is what you think it is . switch to flim mode - this is easily accomplished by moving a mirror out of the fluorescence detection beam path ( " external detector " button on " beam path setting " panel on the leica tcs sp2 acquisition control software ) . an appropriate fluorescence emission filter to block any exciting light from reaching the detector must be in the fluorescence detection beampath . figure 1 . experimental arrangement for time - domain flim using a confocal laser scanning microscope . scan the sample and check , on the computer controlling the flim acquisition , that the detector count rate ( black bar labeled cfd on acquisition control software of the becker & hickl spc 830 board ) is no more than about 1% of the laser repetition rate ( green bar labeled sync acquisition control software ) . if it is , reduce the laser excitation intensity , e.g. by placing a neutral density filter in the laser beam path , to avoid collecting pile - up distorted fluorescence decay curves . acquire a flim image , typically for 3 - 5 min , stop scanning and save the raw data ( a 3d data " cube " consisting of spatial coordinates x and y , and time ) . open the raw data in the fluorescence decay analysis software package , for example tri-2 or commercial software , to display the fluorescence intensity image . this is simply the integrated fluorescence decay , i.e. the area under the fluorescence decay curve , in each pixel . select a typical pixel by placing the cursor on it , and inspect the fluorescence decay in that pixel . the counts of adjacent pixels ( e.g. 3x3 or 5x5 ) are added into the central pixel , so that a higher peak count is obtained there . alternatively , the measurement could be repeated for a longer acquisition time ( step 5 ) . for 30 - 50min , an approximately 10 times higher peak count ( and total counts ) is obtained , but this is far too long an acquisition time for most biological samples because of the danger of introducing artifacts due to sample movement , microscope drift , phototoxicity and photobleaching . select a global pixel threshold value ( above which the decay in a pixel is fitted ) and apply a single exponential decay fit to the image . the result yields a fluorescence lifetime for each pixel above the threshold , which is then encoded in color . each pixel is colored with the result of the fit , and a flim map is obtained . check the reduced chi - squared values for various pixels - around 1 ( and up to 1.3 ) indicates a good fit . the fluorescence lifetime histogram plots how often certain fluorescence lifetimes occur versus the fluorescence lifetime itself . adjust the colour range such that the fluorescence lifetime distribution fits into the colour range . if a monoexponential fit does not yield a chi - squared value of around 1 ( and up to 1.3 ) , and there is a systematic deviation of the residuals from zero , a more sophisticated model is required . for example , try fitting a double exponential model to the fluorescence decays , to account for two different environments the probe may be in . the fit will also yield the pre - exponential factors or amplitudes which give an indication of the relative amount of dye in one environment or the other . alternatively , a stretched exponential function may be appropriate to account for a distribution of fluorescence lifetimes . the results for the fluorescence lifetimes , pre - exponential factors , and the lifetime ratio and the pre - exponential factor ratio for each pixel can then be encoded in color . each pixel is coloured according to its value , and contrast due to fluorescence lifetimes , pre - exponential factors and their ratios is obtained . again , check the reduced chi - squared values ( which can also be encoded in colour and displayed as an image ) - around 1 ( and up to 1.3 ) indicates a good fit . inspect the residuals , which should be randomly distributed around zero . fluorescence lifetime histograms should accompany all images for easy visualisation of average fluorescence lifetime values , and the fluorescence lifetime distribution . fluorescence decays measured for the fluorescent molecular rotor at increasing viscosity in methanol / glycerol mixtures are shown in fig . the fluorescence decays are monoexponential , and the fluorescence lifetime varies markedly as a function of viscosity . it increases from around 300 ps in methanol ( viscosity 0.6 cp ) to 3.4 ns in 95% glycerol ( viscosity 950 cp ) . fluorescence decay profiles for bodipy - c12 in methanol / glycerol mixtures of varying viscosity . the logarithmic calibration plot of fluorescence lifetime versus viscosity for the fluorescent molecular rotor is shown in fig . 3 . it is a straight line as demanded by the frster hoffman equation where k0 is the radiative rate constant , and z and x are constants , with 0<x<1 . taking the logarithm on both sides yields where x is the gradient of the straight line . figure 3 . a plot of log fluorescence lifetime vs log viscosity for bodipy - c12 yields a straight line in accordance with the frster - hoffmann equation . following incubation of living cells with the fluorescent molecular rotor a punctate dye distribution flim images of hela cells incubated with a meso - substituted bodipy dye are shown in fig . the fluorescence decays in every pixel of the image can be adequately fitted using a single exponential decay model . ( a ) fluorescence intensity and ( b ) flim images of hela cells stained with bodipy - c12 . this shorter liftime corresponds to a lower viscosity in the puncta , probably lipid droplets , according to the frster - hoffmann equation . by plotting the lifetimes extracted from every pixel , we obtain a fluorescence lifetime histogram of the whole image as shown in fig . histograms of fluorescence lifetimes from flim images of hela cells stained with meso - substituted bodipy molecular rotors . prepare a stock solution ( 10 ml ) by dissolving approximately 1 mg / ml of the dye in an appropriate solvent ( e.g. methanol for bodipy - c12 ) using an accurate balance and a pipette . the cells ( a model cancer cell line , hela in our case ) to be stained are grown on in a multiwell plate with a coverslide underside for microscopy , in an incubator at 37 c with a 5 % co2 atmosphere until ~ 80% confluent . add 10 - 20 l of the stock solution to the living cells growing in a multi - well plate ( smartslide 50 micro - incubation system , wafergen ) in 4 ml of opti - mem medium ( gibco ) per well for a 6-well plate . return the multi - well plate to an incubator at 37 c with a 5 % co2 atmosphere for 10 - 45 mins for staining . remove the multiwell plate from the incubator and wash the cells 3 - 4 times with 4 ml optically clear cell culture medium ( e.g. opti - mem ) to remove excess dye . transfer the multiwell plate to the microscope stage and connect to a temperature controller / 5 % co2 gas inlet as required , in preparation for imaging . place the sample on the microscope stage and obtain a transmission and fluorescence image to identify fluorescent cells . a schematic diagram of the experimental set - up is shown in fig . 1.verify that the fluorescence emanates from the locations expected ( e.g. cell membrane , cytoplasm ) . obtain a fluorescence emission spectrum , and verify that it is that of the dye or protein expected , in this case the spectrum of the molecular rotor . as a negative control , image a non - stained sample and verify that it does not fluoresce . although this step is not essential specifically for flim , it is good practice in general and does help to verify that the sample is what you think it is . switch to flim mode - this is easily accomplished by moving a mirror out of the fluorescence detection beam path ( " external detector " button on " beam path setting " panel on the leica tcs sp2 acquisition control software ) . an appropriate fluorescence emission filter to block any exciting light from reaching scan the sample and check , on the computer controlling the flim acquisition , that the detector count rate ( black bar labeled cfd on acquisition control software of the becker & hickl spc 830 board ) is no more than about 1% of the laser repetition rate ( green bar labeled sync acquisition control software ) . if it is , reduce the laser excitation intensity , e.g. by placing a neutral density filter in the laser beam path , to avoid collecting pile - up distorted fluorescence decay curves . acquire a flim image , typically for 3 - 5 min , stop scanning and save the raw data ( a 3d data " cube " consisting of spatial coordinates x and y , and time ) . open the raw data in the fluorescence decay analysis software package , for example tri-2 or commercial software , to display the fluorescence intensity image . this is simply the integrated fluorescence decay , i.e. the area under the fluorescence decay curve , in each pixel . select a typical pixel by placing the cursor on it , and inspect the fluorescence decay in that pixel . the counts of adjacent pixels ( e.g. 3x3 or 5x5 ) are added into the central pixel , so that a higher peak count is obtained there . alternatively , the measurement could be repeated for a longer acquisition time ( step 5 ) . for 30 - 50min , an approximately 10 times higher peak count ( and total counts ) is obtained , but this is far too long an acquisition time for most biological samples because of the danger of introducing artifacts due to sample movement , microscope drift , phototoxicity and photobleaching . select a global pixel threshold value ( above which the decay in a pixel is fitted ) and apply a single exponential decay fit to the image . the result yields a fluorescence lifetime for each pixel above the threshold , which is then encoded in color . each pixel is colored with the result of the fit , and a flim map is obtained . check the reduced chi - squared values for various pixels - around 1 ( and up to 1.3 ) indicates a good fit . the fluorescence lifetime histogram plots how often certain fluorescence lifetimes occur versus the fluorescence lifetime itself . adjust the colour range such that the fluorescence lifetime distribution fits into the colour range . if a monoexponential fit does not yield a chi - squared value of around 1 ( and up to 1.3 ) , and there is a systematic deviation of the residuals from zero , a more sophisticated model is required . for example , try fitting a double exponential model to the fluorescence decays , to account for two different environments the probe may be in . the fit will also yield the pre - exponential factors or amplitudes which give an indication of the relative amount of dye in one environment or the other . alternatively , a stretched exponential function may be appropriate to account for a distribution of fluorescence lifetimes . the results for the fluorescence lifetimes , pre - exponential factors , and the lifetime ratio and the pre - exponential factor ratio for each pixel can then be encoded in color . each pixel is coloured according to its value , and contrast due to fluorescence lifetimes , pre - exponential factors and their ratios is obtained . again , check the reduced chi - squared values ( which can also be encoded in colour and displayed as an image ) - around 1 ( and up to 1.3 ) indicates a good fit . fluorescence lifetime histograms should accompany all images for easy visualisation of average fluorescence lifetime values , and the fluorescence lifetime distribution . fluorescence decays measured for the fluorescent molecular rotor at increasing viscosity in methanol / glycerol mixtures are shown in fig . the fluorescence decays are monoexponential , and the fluorescence lifetime varies markedly as a function of viscosity . it increases from around 300 ps in methanol ( viscosity 0.6 cp ) to 3.4 ns in 95% glycerol ( viscosity 950 cp ) . fluorescence decay profiles for bodipy - c12 in methanol / glycerol mixtures of varying viscosity . the logarithmic calibration plot of fluorescence lifetime versus viscosity for the fluorescent molecular rotor is shown in fig . 3 . it is a straight line as demanded by the frster hoffman equation where k0 is the radiative rate constant , and z and x are constants , with 0<x<1 . taking the logarithm on both sides yields where x is the gradient of the straight line . figure 3 . a plot of log fluorescence lifetime vs log viscosity for bodipy - c12 yields a straight line in accordance with the frster - hoffmann equation . following incubation of living cells with the fluorescent molecular rotor a punctate dye distribution is observed in the fluorescence images . flim images of hela cells incubated with a meso - substituted bodipy dye are shown in fig . the fluorescence decays in every pixel of the image can be adequately fitted using a single exponential decay model . ( a ) fluorescence intensity and ( b ) flim images of hela cells stained with bodipy - c12 . this shorter liftime corresponds to a lower viscosity in the puncta , probably lipid droplets , according to the frster - hoffmann equation . by plotting the lifetimes extracted from every pixel , we obtain a fluorescence lifetime histogram of the whole image as shown in fig . histograms of fluorescence lifetimes from flim images of hela cells stained with meso - substituted bodipy molecular rotors . it can report on photophysical events that are difficult or impossible to observe by fluorescence intensity imaging , because it can separate them from fluorophore concentration effects . the fluorescence lifetime can readily be converted into a viscosity using a calibration graph , as shown in fig . instrumental artifacts include scattered light which will show up as a peak on top of the beginning of the fluorescence decay and may be confused with a short decay time , or a small peak after the irf which may be caused by reflections inside the microscope . these scattered light artifacts can be identified as such because they can be distinguished with spectral discrimination they are always at the same wavelength as the exciting light . remembering that in air , light travels 30 cm in 1 nanosecond helps to pinpoint the origin of reflections . filter or glass fluorescence could also cause an artifact , especially at low sample fluorescence , but this can easily be identified by taking a measurement without the sample : if a decay is obtained under these circumstances , it is due to the instrument and has nothing to do with the sample ! on the other hand , note that sample autofluorescence may also contribute to a fluorescence decay . in time - correlated single photon counting ( tcspc ) , time - to - amplitude converter ( tac ) non - linearities may cause poor fits , but can be identified by blocking the excitation and shining ambient light , e.g. from the transmitted light source onto the sample and measuring the timing . a constant background should be obtained in each pixel of the image . regions where deviations from a constant background occur , will never yield a good fit and should be avoided for the measurement if they can not be eliminated by adjusting the parameters for the tcspc card . one infamous artifact in tcspc is photon pile - up which is caused by too high a photon detection rate . this leads to only the first photon being timed , ignoring any subsequent photons because the electronics are busy timing and processing the first photon . pile - up leads to a shortening of the fluorescence lifetime , and the best way to avoid this is to keep the photon count rate at around 1% of the laser repetition rate . there are various implementations of flim , and , depending on the application , each has its advantages and drawbacks . the ideal fluorescence microscope would acquire the entire multidimensional fluorescence emission contour of intensity , position , lifetime , wavelength and polarization in a single measurement , with single photon sensitivity , maximum spatial resolution and minimum acquisition time . there is presently no technology with this unique combination of features , and to build one remains a challenge for instrumentation developers . the application of new physical techniques to important problems in cell biology is often the path to unexpected discoveries , and there is a long way to go before we are close to saturating the capabilities of fluorescence imaging for cell biology . indeed , imaging fluorescence parameters such as lifetime , spectrum and polarization , as well as imaging more rapidly in 3d at higher spatial resolution , are certain to reveal new aspects in cell biology . there are various implementations of flim , and , depending on the application , each has its advantages and drawbacks . the ideal fluorescence microscope would acquire the entire multidimensional fluorescence emission contour of intensity , position , lifetime , wavelength and polarization in a single measurement , with single photon sensitivity , maximum spatial resolution and minimum acquisition time . there is presently no technology with this unique combination of features , and to build one remains a challenge for instrumentation developers . the application of new physical techniques to important problems in cell biology is often the path to unexpected discoveries , and there is a long way to go before we are close to saturating the capabilities of fluorescence imaging for cell biology . indeed , imaging fluorescence parameters such as lifetime , spectrum and polarization , as well as imaging more rapidly in 3d at higher spatial resolution , are certain to reveal new aspects in cell biology .

diffusion is often an important rate - determining step in chemical reactions or biological processes and plays a role in a wide range of intracellular events . viscosity is one of the key parameters affecting the diffusion of molecules and proteins , and changes in viscosity have been linked to disease and malfunction at the cellular level.1 - 3 while methods to measure the bulk viscosity are well developed , imaging microviscosity remains a challenge . viscosity maps of microscopic objects , such as single cells , have until recently been hard to obtain . mapping viscosity with fluorescence techniques is advantageous because , similar to other optical techniques , it is minimally invasive , non - destructive and can be applied to living cells and tissues.fluorescent molecular rotors exhibit fluorescence lifetimes and quantum yields which are a function of the viscosity of their microenvironment.4,5 intramolecular twisting or rotation leads to non - radiative decay from the excited state back to the ground state . a viscous environment slows this rotation or twisting , restricting access to this non - radiative decay pathway . this leads to an increase in the fluorescence quantum yield and the fluorescence lifetime . fluorescence lifetime imaging ( flim ) of modified hydrophobic bodipy dyes that act as fluorescent molecular rotors show that the fluorescence lifetime of these probes is a function of the microviscosity of their environment.6 - 8 a logarithmic plot of the fluorescence lifetime versus the solvent viscosity yields a straight line that obeys the frster hoffman equation.9 this plot also serves as a calibration graph to convert fluorescence lifetime into viscosity.following incubation of living cells with the modified bodipy fluorescent molecular rotor , a punctate dye distribution is observed in the fluorescence images . the viscosity value obtained in the puncta in live cells is around 100 times higher than that of water and of cellular cytoplasm.6,7 time - resolved fluorescence anisotropy measurements yield rotational correlation times in agreement with these large microviscosity values . mapping the fluorescence lifetime is independent of the fluorescence intensity , and thus allows the separation of probe concentration and viscosity effects . in summary , we have developed a practical and versatile approach to map the microviscosity in cells based on flim of fluorescent molecular rotors .

Protocol 1. Staining cells with molecular rotors 2. FLIM of fluorescent molecular rotors in cells 3. Representative Results Discussion Outlook Disclosures

the stanford microarray database ( smd ) ( 1 ) ( http://smd.stanford.edu ) was initially developed in 1999 to serve a small team of researchers using spotted dna microarrays for human and yeast research at stanford university . since then , it has become a research tool for a much larger scientific community using multiple microarray platforms to study a myriad of biomedical research problems . smd now supports the research of more than 1000 users in over 260 laboratories at stanford and around the world . these users have entered data generated from more than 50 000 microarrays used to study the biology of 34 organisms , published more than 190 papers referring to data in smd and have made the complete raw data from more than 7000 microarrays freely available via the smd website . the public data can be selected , viewed , downloaded and analyzed by the public using most of the tools that are available to registered smd users . the source code for smd has been downloaded and installed at several academic and private locations . here , we discuss some of the recent developments at smd that have enabled us to accept microarray data from additional platforms and image analysis software , export data in mage - ml format and permit greater data sharing between researchers . in addition , we present information about the latest release of the smd source code . until 2003 , all data in smd were obtained from two - channel cdna microarrays extracted from scanned images using either genepix ( www.axon.com ) or scanalyze ( http://rana.lbl.gov/eisensoftware.htm ) . the increased interest among smd users in other microarray platforms and other data acquisition software provided impetus to accommodate new data formats in smd . specifically , we have added the ability to accept data from agilent arrays acquired by agilent 's feature extraction software , gene expression data from affymetrix arrays acquired by the affymetrix microarray analysis suite v5.0 ( mas5 , affymetrix ) , gene chip operating system ( gcos , affymetrix ) or dna - chip analyzer ( dchip ) ( 2 ) and two - color data acquired using spotreader ( http://www.nilesscientific.com/ ) software . in order to accept data from additional microarray platforms and software packages , first , the data models used to describe both the microarray designs and the associated results had to be re - designed andre - implemented . we decided to store all fields available from every software package that we supported , which can be up to several dozen , rather than store only the data fields common to many different software packages . second , we modified the software for entry and retrieval of array designs and for microarray data entry , retrieval , display and analysis . the design and implementation are object - oriented and relatively easy to extend , so that additional platforms and data formats can be accommodated in the future . these features are available in the 11/04 software release . in close collaboration with the staff of arrayexpress , a public repository for microarray data ( 3 ) ( http://www.ebi.ac.uk/arrayexpress/ ) , we have constructed and implemented a pipeline that converts sets of microarray data within smd into mage - ml files that support the miame standards for information content ( 4,5 ) that can be directly deposited to arrayexpress , and more recently geo ( 6 ; http://www.ncbi.nlm.nih.gov/geo ) . we took advantage of software developed by members of the microarray informatics community ( mage - stk ; http://mged.sourceforge.net/ ) , to create this pipeline , which translates data from smd into the mage - om structure , export it as mage - ml , and then test its formatting with the arrayexpress mage - ml validator ( ftp://ftp.ebi.ac.uk/pub/databases/arrayexpress/magevalidator-distrib/ ) . the mage - ml files are then transferred via ftp to arrayexpress and geo where they can be immediately entered . several new tables and user interfaces were designed and added to allow smd users to provide the annotation of their experiments and biological samples that are required for miame compliance . using mged ontology terms ( http://mged.sourceforge.net/ontologies/mgedontology.php ) , smd users can describe the overall experimental design and how each member of a set of microarrays fits into that design , such as time points in a time series experiment or tumor samples from many individuals in a molecular survey of a type of cancer . users can also describe the biological properties and parameters , including hipaa - compliant clinical data , of each sample and the procedures and protocols used to treat the sample , extract the rna or dna , amplify and label the nucleic acids , hybridize the arrays , and scan and acquire data from the resulting microarray image . in this way , each set of microarrays associated with a publication in smd can be adequately annotated and easily submitted to a public data repository smd 's tools for sharing data facilitate collaboration and accurate communication of experimental details . to complement existing tools for organizing and annotating shared data , data repository that allows users to save and share the results of data analysis ( figure 1 ) . users are able to save the results of data selection , filtering , transformation and analysis at each of these different steps and then specify other users or groups who should be able to view the datasets . in addition to providing a means to help users save their work and facilitate collaboration , the data repository provides a jumping - off point for various analysis tools , such as hierarchical clustering and singular value decomposition . an updated version of the source code for smd , including all the functions described in this paper , was made publicly available in november 2004 ( http://smd.stanford.edu/download/ ) . the source code is freely available under the liberal , open - source mit license ( http://www.opensource.org/licenses/mit-license.php ) . in the future , we will update and release our software with greater frequency and with better support for users who are upgrading their smd installations and must therefore migrate data from one database schema to another . in this way , other installations of smd will be able to benefit from improvements and new tools in a timely manner that will require less work to deploy . we also plan to provide web services through biomoby ( 7 ) to allow for more creative and flexible use of smd by researchers or data miners who wish to be able to automate complex queries of the available data . finally , techniques for determining data quality in an automated fashion remain an active area of research at smd . automatically recognizing problematic data will allow researchers to reject it from analysis , correct errors and , ideally , identify and prevent potential sources of poor - quality data . the large body of data in smd will provide excellent training and test sets for quality assurance studies . until 2003 , all data in smd were obtained from two - channel cdna microarrays extracted from scanned images using either genepix ( www.axon.com ) or scanalyze ( http://rana.lbl.gov/eisensoftware.htm ) . the increased interest among smd users in other microarray platforms and other data acquisition software provided impetus to accommodate new data formats in smd . specifically , we have added the ability to accept data from agilent arrays acquired by agilent 's feature extraction software , gene expression data from affymetrix arrays acquired by the affymetrix microarray analysis suite v5.0 ( mas5 , affymetrix ) , gene chip operating system ( gcos , affymetrix ) or dna - chip analyzer ( dchip ) ( 2 ) and two - color data acquired using spotreader ( http://www.nilesscientific.com/ ) software . in order to accept data from additional microarray platforms and software packages , first , the data models used to describe both the microarray designs and the associated results had to be re - designed andre - implemented . we decided to store all fields available from every software package that we supported , which can be up to several dozen , rather than store only the data fields common to many different software packages . second , we modified the software for entry and retrieval of array designs and for microarray data entry , retrieval , display and analysis . the design and implementation are object - oriented and relatively easy to extend , so that additional platforms and data formats can be accommodated in the future . in close collaboration with the staff of arrayexpress , a public repository for microarray data ( 3 ) ( http://www.ebi.ac.uk/arrayexpress/ ) , we have constructed and implemented a pipeline that converts sets of microarray data within smd into mage - ml files that support the miame standards for information content ( 4,5 ) that can be directly deposited to arrayexpress , and more recently geo ( 6 ; http://www.ncbi.nlm.nih.gov/geo ) . we took advantage of software developed by members of the microarray informatics community ( mage - stk ; http://mged.sourceforge.net/ ) , to create this pipeline , which translates data from smd into the mage - om structure , export it as mage - ml , and then test its formatting with the arrayexpress mage - ml validator ( ftp://ftp.ebi.ac.uk/pub/databases/arrayexpress/magevalidator-distrib/ ) . the mage - ml files are then transferred via ftp to arrayexpress and geo where they can be immediately entered . several new tables and user interfaces were designed and added to allow smd users to provide the annotation of their experiments and biological samples that are required for miame compliance . using mged ontology terms ( http://mged.sourceforge.net/ontologies/mgedontology.php ) , smd users can describe the overall experimental design and how each member of a set of microarrays fits into that design , such as time points in a time series experiment or tumor samples from many individuals in a molecular survey of a type of cancer . users can also describe the biological properties and parameters , including hipaa - compliant clinical data , of each sample and the procedures and protocols used to treat the sample , extract the rna or dna , amplify and label the nucleic acids , hybridize the arrays , and scan and acquire data from the resulting microarray image . in this way , each set of microarrays associated with a publication in smd can be adequately annotated and easily submitted to a public data repository . smd 's tools for sharing data facilitate collaboration and accurate communication of experimental details . to complement existing tools for organizing and annotating shared data , data repository that allows users to save and share the results of data analysis ( figure 1 ) . users are able to save the results of data selection , filtering , transformation and analysis at each of these different steps and then specify other users or groups who should be able to view the datasets . in addition to providing a means to help users save their work and facilitate collaboration , the data repository provides a jumping - off point for various analysis tools , such as hierarchical clustering and singular value decomposition . an updated version of the source code for smd , including all the functions described in this paper , was made publicly available in november 2004 ( http://smd.stanford.edu/download/ ) . the source code is freely available under the liberal , open - source mit license ( http://www.opensource.org/licenses/mit-license.php ) . in the future , we will update and release our software with greater frequency and with better support for users who are upgrading their smd installations and must therefore migrate data from one database schema to another . in this way , other installations of smd will be able to benefit from improvements and new tools in a timely manner that will require less work to deploy . we also plan to provide web services through biomoby ( 7 ) to allow for more creative and flexible use of smd by researchers or data miners who wish to be able to automate complex queries of the available data . finally , techniques for determining data quality in an automated fashion remain an active area of research at smd . automatically recognizing problematic data will allow researchers to reject it from analysis , correct errors and , ideally , identify and prevent potential sources of poor - quality data . the large body of data in smd will provide excellent training and test sets for quality assurance studies . this work was supported by grants from the us national institutes of health to p.o.b .

the stanford microarray database ( smd ) ( http://smd.stanford.edu ) is a research tool for hundreds of stanford researchers and their collaborators . in addition , smd functions as a resource for the entire biological research community by providing unrestricted access to microarray data published by smd users and by disseminating its source code . in addition to storing genepix ( axon instruments ) and scanalyze output from spotted microarrays , smd has recently added the ability to store , retrieve , display and analyze the complete raw data produced by several additional microarray platforms and image analysis software packages , so that we can also now accept data from affymetrix genechips ( mas5/gcos or dchip ) , agilent catalog or custom arrays ( using agilent 's feature extraction software ) or data created by spotreader ( niles scientific ) . we have implemented software that allows us to accept mage - ml documents from array manufacturers and to submit miame - compliant data in mage - ml format directly to arrayexpress and geo , greatly increasing the ease with which data from smd can be published adhering to accepted standards and also increasing the accessibility of published microarray data to the general public . we have introduced a new tool to facilitate data sharing among our users , so that datasets can be shared during , before or after the completion of data analysis . the latest version of the source code for the complete database package was released in november 2004 ( http://smd.stanford.edu/download/ ) , allowing researchers around the world to deploy their own installations of smd .

INTRODUCTION RESULTS Microarray platforms and software Data export to public repositories Tools for collaboration Availability Future directions ACKNOWLEDGEMENTS

acromegaly is a systemic , chronic , and slowly progressing condition resulting from excess growth hormone ( gh ) and insulin - like growth factor 1 ( igf-1 ) . patients with acromegaly have a 1.6- to 3.3-fold increase in age - related mortality and a 10-year reduction in life expectancy , and cancer is the third most common cause of mortality . the role of the gh - igf-1 axis in the development of malignancy has been continuously investigated , and igf-1 is thought to enhance cell proliferation and to inhibit apoptosis . breast cancer is epidemiologically linked to igf-1 levels in premenopausal women , and an increased igf-1 level may increase the relative risk of developing colon cancer . multiple myeloma ( mm ) is a malignant proliferative disease of monoclonal plasma cells that produce monoclonal immunoglobulins . diagnosis of mm is made based on the clonal plasmacytosis of at least 15% on bone marrow examination or biopsy - proven clonal plasmacytoma , the presence of m protein in serum or urine , and any evidence of end - organ damage ( i.e. , hypercalcemia , renal insufficiency , anemia , and bone disease ) attributable to myeloma involvement . although acromegaly is associated with malignancy , its association with mm has not been thoroughly investigated . earlier reports demonstrated the role of gh and igf-1 in b lymphocyte activation and the universal expression of igf-1 receptors in mm cells in vitro . also , in several cases , acromegaly was associated with the malignant transformation of monoclonal gammopathy of undetermined significance ( mgus ) into overt mm . however , only a few actual cases of mm associated with acromegaly have been reported . here we describe the first asian patient , who was diagnosed with acromegaly and mm , simultaneously . a 58-year - old woman was admitted to our department for diagnostic workup of acromegalic features . she had noticed the enlargement of her face , hands , and feet 8 years prior to her visit , and these were associated with hyperhidrosis , a thicker and deeper voice , and decreased libido . at that time , she had also undergone uvulectomy because of obstructive sleep apnea that had caused severe snoring . she had a heart rate of 86 per minute , a respiratory rate of 20 per minute , and a body temperature of 36.5. during physical examination , the facial enlargement with frontal bossing was noticed , as was the disproportionate enlargement of the tongue , nose , lips , hands , and feet ( fig . the serum protein level was 10.5 g / dl ( reference range , 6 to 8) and the serum albumin level was 2.5 g / dl ( reference range , 3.5 to 5.2 ) , reflecting a reversed albumin / globulin ( a / g ) ratio . serum creatinine and calcium levels were 0.63 mg / dl ( reference range , 0.70 to 1.40 ) and 8.6 mg / dl ( reference range , 8.6 to 10.2 ) , respectively . the fasting plasma glucose level was 109 mg / dl and the 2-hour postprandial plasma glucose level was 280 mg / dl . hemoglobin a1c was 7.8% and the c - peptide level was 4.8 ng / ml . the thyroid - stimulating hormone level was 1.5 u / ml ( reference range , 0.4 to 5.0 ) and the free thyroxine level was 1.3 ng / dl . basal levels of adrenocorticotropic hormone , prolactin , luteinizing hormone , follicle - stimulating hormone , and estradiol were 23.0 pg / ml , 6.8 ng / ml , 17.1 miu / ml , 44.4 miu / ml , and 10.0 pg / ml , respectively , which were all within normal ranges . serum levels of igf-1 and human growth hormone ( hgh ) were elevated to 898 ng / ml ( age - adjusted reference range , 71 to 284 ) and 42 ng / ml ( reference range , < 16.0 ) , respectively ( tables 1 , 2 ) . because these laboratory findings strongly suggested acromegaly and associated diabetes mellitus , we performed a 75 g oral glucose tolerance test ( ogtt ) to confirm gh hypersecretion ( table 2 ) . to confirm the presence of a gh - secreting pituitary adenoma , we performed magnetic resonance imaging of the sella turcica . it revealed a 1.00.6-cm pituitary adenoma on the left side of the pituitary gland ( fig . 2 ) . the markedly reversed a / g ratio and anemia led us to suspect a monoclonal gammopathy such as mm . 3 ) . protein electrophoresis ( pep ) and immunofixation electrophoresis ( ife ) of serum samples revealed a monoclonal gammopathy ( m peak 4.9 g / dl ) of immunoglobulin g ( igg)- type ; pep and ife of urine samples were inadequate because of low urinary protein . the patient 's serum igg level was elevated to 5,860.0 mg / dl , and the and lambda free light chain ratios were 7.16 and 34.50 mg / l , respectively . to confirm the diagnosis of mm , we performed bone marrow aspiration and biopsy with plasma cell phenotyping . 4a , b ) , and packed bone marrow with neoplastic plasma cells ( 35.6% of the clonal plasma cells ) was observed in the bone marrow biopsy specimen ( fig . 4c - f ) . in an attempt to find myeloma - related organ damage , we took simple x - rays of the entire body , and they did not reveal any osteolytic lesions . according to the diagnostic criteria for symptomatic mm , one should exhibit more than one of the parameters reflecting myeloma - related organ dysfunction ( table 3 ) . because the m peak was > 3 g / dl and the proportion of monoclonal plasma cells in the bone marrow was > 10% without myeloma - related orgam damages , the patient was diagnosed with asymptomatic ( smoldering ) mm . however , it is of note that her serum hemoglobin level was at the cutoff value for diagnosis of symptomatic mm and that her serum calcium level was slightly below the cutoff ( table 3 ) . in accordance with the treatment guidelines for asymptomatic mm , we planned close follow - up , with deferral of chemotherapy until the disease became symptomatic . to treat the gh - secreting pituitary adenoma , the patient underwent tumor resection via a transsphenoidal approach . there were no immediate postoperative complications . three days after surgery , the serum igf-1 level was measured and the 75 g ogtt was repeated . although the serum hgh level was lower than it had been before surgery , the results indicated incomplete remission immediately after surgery ( table 2 ) . however , after the surgery , the patient exhibited clinical improvements in acromegalic features , such as decreased skin thickness and reduced size of the extremities . therefore , we decided to closely monitor the clinical and biochemical responses to the removal of the gh - secreting pituitary adenoma and to continuously determine the need for further treatment . acromegaly is an uncommon endocrinologic disorder caused by overproduction of gh , most commonly by a gh - secreting pituitary adenomas . earlier epidemiological studies have indicated a possible increase in malignancy risk in patients with acromegaly because gh and igf - i may promote proliferation and inhibit apoptosis of neoplastic cells . nabarro found a markedly increased incidence of breast cancer in patients with acromegaly . also , a large retrospective cohort study conducted by orme et al . to determine mortality and cancer incidence in 1,362 subjects with acromegaly reported a significant increase in the colon cancer mortality rate and a nonsignificant increase in mortality due to breast cancer . the authors also found that mortality due to all malignant disease and colon cancer increased with higher posttreatment gh levels , which suggests that gh hypersecretion may have modified the progression of coexisting malignancies , particularly colonic carcinomas . there have been sporadic case reports of hematologic malignancies such as lymphoma and leukemia associated with acromegaly . however , the causal relationship between acromegaly and mm has not been clearly proven in clinical settings . despite the complexity of the interactions between the bone marrow microenvironment and surrounding stromal cells , attempts have been made to determine the exact mechanisms of gh and igf-1 in the development and proliferation of myeloma . murphy et al . demonstrated that treatment with hgh had stimulatory effects on b - cell proliferation . demonstrated the universal expression of igf-1 receptors in mm cells and postulated that igf-1 might act like a growth factor in human mm . also , ge and rudikoff demonstrated a stimulatory effect of igf-1 on six of eight myeloma cell lines , one of two b lymphoma cell lines , and neither of two t leukemia cell lines , where all cell lines expressed similar levels of igf-1 receptors . the authors suggested that the igf-1 pathway is biologically relevant in the later stages of b - cell development . there is neither an established therapeutic guideline nor a prognosis specific for acromegaly with mm . however , several cases illustrate that treatment of acromegaly improves the progression of mgus or mm . kanazawa et al . reported a case of mgus in a patient with acromegaly in which the serum igg level , as well as the gh and igf-1 levels , decreased after the removal of the gh - secreting pituitary adenoma . moreover , tucci et al . described a patient with acromegaly in whom a longstanding mgus had transformed into overt mm . in this patient , serum and urine m components indicated that mm activity was correlated with serum igf-1 levels . these findings are solid evidence supporting the hypothesis that elevated gh and igf-1 levels promote the proliferation of malignant plasma cells in mm and that maintaining low levels of gh and igf-1 through intensive treatment might be a key therapeutic approach in treating coexistent mm . in our case , the patient 's serum hemoglobin level ( 10.0 g / dl ) was at the cutoff level for symptomatic mm and her serum calcium level ( 9.2 mg / dl ) was slightly below the cutoff , suggesting that the risk of transformation into symptomatic mm would have been very high had the acromegaly been left untreated . follow - up measurement of serum and urine m proteins and simultaneous measurement of serum gh levels would be necessary to determine the long - term effect of the removal of the gh - secreting tumor on mm . although these measurements were unavailable in our study because of the recent diagnosis , we expect a favorable prognosis because of the prompt surgical treatment of the acromegaly before the mm became symptomatic . likewise , the lack of long - term follow - up data from previously reported cases makes it difficult to predict the prognosis of acromegaly with mm . further long - term observational studies with a larger data set will allow us to specifically suggest appropriate therapeutic guidelines and to extrapolate the prognosis in patients with acromegaly and mm . in summary our case strengthens the hypothesis of prior studies that acromegaly plays a significant role in the development of mm . considering previous studies that have demonstrated the role of igf-1 in plasma cell proliferation and the correlation between serum igf-1 levels and the progression of monoclonal gammopathy , prompt efforts to lower circulating gh and igf-1 levels are an important therapeutic approach . further research with a larger set of longer term data is needed to develop treatment guidelines specific for mm accompanying acromegaly and to predict prognosis .

acromegaly is a slowly progressing condition resulting from excess growth hormone ( gh ) , generally caused by a gh - secreting pituitary adenoma . cancer is the third most common cause of mortality in patients with acromegaly , and insulin - like growth factor 1 ( igf-1 ) is known to influence tumor formation by increasing cell proliferation and inhibiting apoptosis . multiple myeloma ( mm ) is a plasma cell neoplasm , and previous studies have suggested the possible role of igf-1 in its development of mm . however , no cases of acromegaly accompanied with mm have been reported in asia to date . we here report the case of a 58-year - old woman with acromegaly accompanied with mm who presented with longstanding acromegalic manifestations resulting from a gh - secreting pituitary adenoma and also exhibited anemia , a reversed albumin / globulin ratio , and plasmacytosis on bone marrow examination . because igf-1 has been suggested to play an important role in the development and progression of mm , the patient promptly underwent surgical removal of the pituitary adenoma via a transsphenoidal approach . since there is currently no consensus on therapeutic guidelines and suggested prognosis for mm with acromegaly , long - term follow - up of such cases is needed .

INTRODUCTION CASE REPORT DISCUSSION

the appearance of cs implants at the radiopharmaceutical market and its clinical use in brachytherapy has made a breakthrough in prostate cancer treatment . the repopulation rate of the prostate cancer cells is 1.5 % a day , and it doubles in 67 days . the absorption of 90 % of radiation doze by cancer cells will require three half - life periods of radionuclides . therefore , the destruction rate of cancer cells by cs ( t1/2 = 9.6 days ) is essentially higher than repopulation rate , and practically does not give a chance for their survival , as opposed to pd ( 17 days ) and i ( 59.9 days ) [ 1 , 2 ] . to obtain cs , the most useful nuclear reaction with thermal neutrons is : 1\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ ^{130}{\text{ba } } ( n,{{\upgamma}})^{131}{\text{ba } } \to^{131}{\text{cs } } $ $ \end{document}130ba(n,)131ba131csparent radionuclide ba with t1/2 = 11.8 days decays to daughter radionuclide cs which decays to stable xe . in table 1 , nuclear - physical characteristics and radioactivity values of radionuclides at the irradiation of 1 gram of natural barium by a thermal neutron flux of 3.5 10 cm s for 5 days on ( n , ) reaction are shown [ 7 , 8].table 1nuclear - physical characteristics of the ba radionuclides produced by ( n , ) reaction [ 7 , 8]isotope ( abundance , % ) radionuclide t 1/2 cross section , barnactivity , bq ba ( 0.106 ) ba11.8 days104.38 10 ba14.6 min2.54.1 10 ba ( 0.097 ) ba10.5 year79.7 10 ba ( 2.42 ) ba1.2 days0.165.7 10 ba ( 7.85 ) ba2.55 min0.0111.34 10 ba ( 71.7 ) ba1.38 h0.363.94 10 cs cs6.47 days250 5.5 10 nuclear - physical characteristics of the ba radionuclides produced by ( n , ) reaction [ 7 , 8 ] as shown in table 1 , radioactivity yield is only 4.38 10 bq ba , since the nuclear reaction is limited by the low - abundance isotope of the ba ( 0.1 % ) . the discharge of cs essentially leads to the separation of some tens of nanograms of cs from very high amount of highly - active barium radionuclides [ 4 , 5 ] . in scientific literature and patents , some radiochemical methods of extraction of cs from irradiated baco3 , ba(no3)2 are described [ 37 ] . and also there are the studies of mutual extraction of cesium and barium radionuclides from the radioactive wastes by calcium alginate beads . in our case , barium oxide has been taken as a target material , since a percent share of natural barium in compounds consists of 89.5 % in bao , 52 % in ba(no3)2 , 69 % in baco3 and 65 % in bacl22h2o . therefore , irradiation of bao yields a higher radioactivity of ba than irradiation with identical mass of ba compounds . the reason why barium oxide has not been used as a target material is the long irradiation of large amounts of bao at the nuclear reactor for 57 days which leads to some structural changes . as a result , the further process of solution becomes very difficult at heating and takes a long time in acid medium . from this point of view , the process of dissolution of a sparingly - soluble radioactive samples under influence of microwave radiation represents scientific and practical interest . it studies chemical processes in solid and liquid materials , connected with the use of energy of the microwave radiation . therefore , different compounds convert microwave radiation to heat by different amounts . the aim of this work was to study the solubility dependence of irradiated barium oxide on various concentration of a hydrochloric acid under influence of microwave radiation . as a source of mwr , a normal domestic mwr oven was used , with following technical parameters : model nikai nmo-517 ; voltage of 220 - 240 volt at 50 hz ; mwr power of 120700 w at operating frequency 2.450 ghz . for dissolution of irradiated samples in a microwave oven , the special vessel and auxiliary accessories were made of teflon material ( a cup , a lid , a mixer and a holder ) . it is known that at the certain frequency and temperature the dielectric material and solution have different capacities of absorption of microwave radiation and various abilities to convert it in thermal energy , which is characterized by the concept of a dissipation coefficient . at frequency 2.450 ghz and temperature 25 c , the value of dissipation coefficient varies 1,000 times depending of the compound material . for example , dissipation coefficient is equal to 157 for water , and it is 1 for teflon . in fig . 1 , the schematic view of experimental mwr oven for dissolution of the irradiated samples is shown.fig . 1 microwave oven , 2 rotary quarts plate , 3 cup for radioactive solution , 4 lid , 5 mixer , 6 mixer holder schematic view of mwr oven and teflon accessories for dissolution of irradiated samples . 1 microwave oven , 2 rotary quarts plate , 3 cup for radioactive solution , 4 lid , 5 mixer , 6 mixer holder as shown in fig . 1 , in mwr oven ( 1 ) on the center of a quartz plate ( 2 ) a cup with a solution of irradiated bao in a hydrochloric acid ( 3 ) is fixed . the mixer ( 5 ) is installed into the solution and closed by a lid ( 4 ) , the end of mixer is fastened to the motionless holder ( 6 ) . the mixing process of baric solution is carried out by rotating the cup with quartz plate , while mixer is fixed . the studied barium oxide ( mba = 20 g ) is sealed in quartz vessel and is located in aluminum block - containers . it is irradiated at a thermal neutron flux of 5 10 cm s for 5 days , at the wwr sm reactor of inp as ruz . the irradiated samples of bao were aged for 10 days for the maximal accumulation of radioactivity of cs and decay of radionuclides with t1/2 < 1 days . to determine optimum power of mwr and necessary time for a full dissolution of the radioactive bao , the sample of bao , weighing 3 g , in stehiometric quantity ( 14 ml ) 1 m hcl was taken , and its dissolution at five various power levels of mwr was carried out . in fig . 2 , the dependence of dissolution of irradiated bao on the power of mwr oven was shown . at 120 and 230 w , 50 and 75 % dissolution of bao in 1 m hcl were observed , respectively . the full dissolution of bao was occurred at 385 w in 150 s , and the further increase in mwr power did not give desirable effect . 2dependence of dissolution of irradiated bao on power of mwr dependence of dissolution of irradiated bao on power of mwr at 540 w , the solution gets white - yellow coloration and then , at 700 w , becomes dark yellow . as it is shown in fig . 2 , for full dissolution of irradiated bao , an optimal power of mwr is 385 w. the study of influence of the hydrochloric acid concentration on solubility of irradiated bao showed that the increase of hcl concentration from 1 to 5 m reduces the dissolution time from 150 to 60 s ( fig . however , dissolution of bao in strongly concentrated mediums is undesirable , since the release of radioactive solution from the cups to the mwr oven occurs.fig . 3dependence of dissolution time of irradiated bao on concentrations of hcl dependence of dissolution time of irradiated bao on concentrations of hcl the times of the full dissolution of the radioactive samples were established , as at the usual and mwr heating , the results are shown in fig . 4dependence of dissolution of an irradiated bao on heating time for : 1 microwave and 2 electric ovens dependence of dissolution of an irradiated bao on heating time for : 1 microwave and 2 electric ovens it is established that at usual heating on the electric oven the full dissolution of bao occurs in 20 min , and at mwr heating it occurs in 2.5 min . besides , at dissolution under the influence of mwr , strictly a stoichiometric volume of hydrochloric acid is used , which leads to the decrease of the volumes of highly radioactive solutions and of the reprocessing time of irradiated samples . therefore , the technological process of obtain cs is simplified as well . after a full dissolution of the bao , cs is extracted by adding of 1 m na2co3 solution to sedimentation ions of ba , as a carbonate form , in the alkalescent medium according to reaction:2\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { \text{bacl } } _ { 2 } + { \text{na } } _ { 2 } { \text{co } } _ { 3 } \to { \text{baco } } _ { 3 } + { \text { 2nacl } } $ $ \end{document}bacl2+na2co3baco3 + 2nacl the obtained solution of cs was extracted from the precipitate of baco3 by filtration and was rinsed with 0.1 m ammonium hydrate solution . the traces of barium ions in the filtrate were removed with the addition of 35 ml 5 m h2so4 solution for precipitation in barium sulfate form . because the cs ( t1/2 = 9.6 days ) is daughter radionuclide of the ba ( t1/2 = 11.8 days ) , the equilibrium radioactivity between ba and cs is established in 1015 days . in our experiments , four cycles of branching of cs from ba or the milking process were held every 10 days by dissolution of the precipitate of baco3 in hydrochloric acid each time . the radionuclidic purity of cs product and its radiochemical yield were investigated by gamma - ray spectrometry using hpge and si(li ) detectors from canberra ( usa ) after each cycle of separation of the cs from barium solution . when analyzing at the x - ray spectrometer ( si(li ) detector ) , only two lines of cs xe transitions 29.67 and 33.61 kev were recognized . the measurements of the background and solution radioactivity were carried out on hpge detector in 6004000 s. the activity value of the radionuclide was determined by the formula:3\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ a \ , = \ , s \cdot k_{1 } \cdot k_{2 } /t_{\text{ms } } \cdot \alpha_{\text{eff } } \cdot \eta_{\gamma } $ $ \end{document}a = sk1k2/tmseffwhere a radionuclide activity , bq ; s peak area , imp ; k1 correction on geometry of measurements ; k2 correction on aliquot ; tms measuring time activity , s ; eff registration efficiency of detectors for gamma and x - ray radiations , relative unit ; intensity of gamma and x - ray radiations , relative unit . the root - mean - square error of this method is no more than 10 % . in table 2 , the results of radionuclide activity measurements are presented on four cycles of separation of the cs at a rate per 1 g of barium.table 2the radionuclidic purity of the cs solutionstargetradio - nuclidei - cycleii - cycleiii - cycleiv - cyclea , bqa , bqa , bqa , bqbao ba9401,460810357 cs1.4 10 3.9 10 1.2 10 3.6 10 cs1,690 sb3,9809,000770190 the radionuclidic purity of the cs solutions as shown in table 2 , the radionuclide sb is presented in all cycles of separations . apparently , it may be explained by the presence of natural antimony in basic samples of bao . its contents in cesium solutions were determined by relative method in an interval 2.5 108.7 10 the percent ratio of radioactivity of the sb / cs in the 1th4th cycles of extractions was 0.028 , 0.023 , 0.0064 and 0.0052 % , respectively . in all cesium solutions , cs has been found only at the first cycle of extraction and its contribution to the cs activity accounted to 0.012 % . the contribution of the parent radionuclide ba to the cs solutions was on the average 0.0067 % . the radionuclidic purity of cs product and its radiochemical yield were investigated by gamma - ray spectrometry using hpge and si(li ) detectors from canberra ( usa ) after each cycle of separation of the cs from barium solution . when analyzing at the x - ray spectrometer ( si(li ) detector ) , only two lines of cs xe transitions 29.67 and 33.61 kev were recognized . the measurements of the background and solution radioactivity were carried out on hpge detector in 6004000 s. the activity value of the radionuclide was determined by the formula:3\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ a \ , = \ , s \cdot k_{1 } \cdot k_{2 } /t_{\text{ms } } \cdot \alpha_{\text{eff } } \cdot \eta_{\gamma } $ $ \end{document}a = sk1k2/tmseffwhere a radionuclide activity , bq ; s peak area , imp ; k1 correction on geometry of measurements ; k2 correction on aliquot ; tms measuring time activity , s ; eff registration efficiency of detectors for gamma and x - ray radiations , relative unit ; intensity of gamma and x - ray radiations , relative unit . the root - mean - square error of this method is no more than 10 % . in table 2 , the results of radionuclide activity measurements are presented on four cycles of separation of the cs at a rate per 1 g of barium.table 2the radionuclidic purity of the cs solutionstargetradio - nuclidei - cycleii - cycleiii - cycleiv - cyclea , bqa , bqa , bqa , bqbao ba9401,460810357 cs1.4 10 3.9 10 1.2 10 3.6 10 cs1,690 sb3,9809,000770190 the radionuclidic purity of the cs solutions as shown in table 2 , the radionuclide sb is presented in all cycles of separations . apparently , it may be explained by the presence of natural antimony in basic samples of bao . its contents in cesium solutions were determined by relative method in an interval 2.5 108.7 10 the percent ratio of radioactivity of the sb / cs in the 1th4th cycles of extractions was 0.028 , 0.023 , 0.0064 and 0.0052 % , respectively . in all cesium solutions , cs has been found only at the first cycle of extraction and its contribution to the cs activity accounted to 0.012 % . the contribution of the parent radionuclide ba to the cs solutions was on the average 0.0067 % . thus , the use of the mwr accelerates the dissolution process of the radioactive sample , almost an order of magnitude compared to the heat of electric oven , and takes 2.5 min at 385 w and at concentration 1 m hcl , which considerably simplifies technological process . the increase of solution concentrations from 1 to 5 m hcl also leads to the reduction of dissolution time from 150 to 60 s of irradiated bao . the percentage relations of impurity activities to cs product were sb / cs 0.015 % ; cs / cs 0.012 % and ba / cs0.0067 % . this work was supported by a11-fa - f131 grant of committee for coordination of science and technology development under the cabinet of ministers of uzbekistan .

in this work , the solubility dependence of radioactive baric samples under influence of microwave radiation ( mwr ) has been investigated at various concentrations of hcl after irradiation of bao target at a flux of thermal neutrons . it is established that the use of mwr for dissolution of a sparingly - soluble barium oxide will accelerate a dissolution process at almost an order of magnitude in comparison with usual heating . each time after separation of the 131cs from radioactive barium solution analyses on radionuclide purity of the 131cs product solutions were carried out .

Introduction Experimental Results and discussions Radionuclidic purity Conclusion

back pain is a common problem with annual prevalence of activity limiting low back pain at 38%1 . of individuals with chronic low back pain , rehabilitation programs that include stabilization exercises reduce pain and disability in individuals with chronic low back pain3 . both lumbar iliocostalis ( li ) and lumbar multifidus ( lm ) have a role in stabilization of the spine . the li provides stabilization globally at a multi - segmental region whereas lm is viewed to provide stability at a local segmental level4 . both li and lm electromyographic ( emg ) activity have been described for stabilization exercises performed in prone5,6,7 , and quadruped8 . in standing , the emg output of lm but not li was reported during maximum effort shoulder and trunk motions9 . seated position stabilization exercise studies are limited to reports of emg activity for erector spinae7 and lm6 during shoulder flexion . while standard stabilization exercises are performed in prone and quadruped , medical or musculoskeletal conditions10 may limit an individual s ability to assume these positions . seated dynamic exercise programs are comfortable and safe for individuals ( e.g. , those with osteoarthritis ) who can not exercise in upright11 . investigation of emg activity of li and lm during performance of seated stabilization exercise using multiple shoulder motions has not been performed . the purpose of this study was to compare the emg activity of lm and li during full range and stabilization exercises performed in prone , quadruped , and sitting to identify an exercise hierarchy of percent ( % ) maximum voluntary contraction ( mvc ) as well as optimal recruitment exercises for both li as a global multi - segmental stabilizer and lm as a segmental stabilizer . twelve healthy volunteers ( six male and six female ) aged 24 to 45 participated in the study . the average age of subjects was 31.4 7.48 years . mean height and weight were 171.08 8.22 cm and 66.67 13.10 kg , respectively . participants who demonstrated full active shoulder flexion motion , at least 50% active trunk extension motion , no spinal deformities , and absence of pregnancy , neuromuscular disease , past spine surgery , or back pain within the past three months were included in the study . all subjects correctly performed the exercises at a training session after instruction by a physical therapist . the study was conducted at the gait laboratory at helen hayes hospital , west haverstraw , ny , usa . the emg data were recorded with surface electrodes ( iomed inc . , salt lake city , ut , usa ) . the electrodes have a differential preamplifier with three stainless steel sensing elements ( 13 mm in diameter spaced 5 mm apart with the center acting as a ground plate ) with a gain of 300 , common mode rejection ratio of > 100 db , input impedance of 100,000 megohms , and a bandwidth of 8 hz to 27 khz . data were collected with a vax 3200 computer work station and stored for further analysis . placement for lm was consistent with methods described by others12,13,14,15 at 1 to 2 cm lateral to the midline to the spine and adjacent to the fourth and fifth lumbar vertebral bodies . electrode placement for li was similar to ng and colleagues16 at just proximal to the posterior superior iliac spine , parallel to the line of the lateral most bulk of the erector spinae . prone active trunk hyperextension was used to visualize and mark the outline of this muscle bulk . additionally , prone resisted isometric shoulder extension confirmed no activity at this electrode during latissimus dorsi muscle contraction . we predicted that all participants could achieve full extension with 7.3 kg as the resistance . therefore , active prone hyperextension against a 7.3 kg weight positioned mid scapula was defined as a maximum voluntary contraction ( mvc ) . all exercises lasted six seconds , using a metronome and verbal cues for three equal phases : a two second build up , 2 second hold , and 2 second release . after the preamplifier gain of 300 , the emg signals were sampled at 1,200 hz and band pass filtered from 40 to 500 hz . the data were full - waved rectified and the three repetitions averaged for the three phases of the exercises . these exercise data were normalized to a percentage of the average of the mvc . subjects were instructed as follows : ( a ) in prone , move through full active prone trunk extension ( pte ) range of motion without extremity motion , full active trunk extension with left arm / right leg lift and with right arm / left leg lift , ( b ) maintain quadruped with isometric fixed neutral pelvis for quadruped opposite arm / leg lift ( qoall ) both combinations , and ( c ) sit and hold erect posture with isometric fixed neutral pelvis with right arm outstretched at 90 degrees shoulder flexion for isometric arm exercises . sitting arm exercise was performed using the right arm with a 1.8 kg force applied at the wrist using a strain gauge held perpendicular to the arm in the sagittal plane to produce flexion / extension , and transverse plane for horizontal abduction / adduction isometric shoulder muscle contractions . the sequence of categories was chosen randomly by slips of paper drawn from a box . each exercise was repeated three times . a two - way anova ( exercise x side ) with repeated measures was performed for each muscle to assess differences in emg activity level among exercises and across sides . tukey hsd confidence intervals =0.05 were used to determine which exercises resulted in significant left / right asymmetry . statistical analysis was performed using ibm statistical package for the social sciences ( spss ) version 23 . identical hierarchies were identified for normalized data and are shown in table 1table 1.mean percentage mvc with standard deviation of iliocostalis and multifidus musclesmusclepepoallr ue liftpoalll ue liftqoallr ue liftqoalll ue liftsflexr uesextr uesabdr uesaddr ueiliocostalis r0.93 0.23 * 1.06 0.48*0.80 0.33 * 0.36 0.180.27 0.200.13 0.080.08 0.50.20 0.070.09 0.05iliocostalis l0.95 0.28 * 0.85 0.28 * 1.02 0.31*0.25 0.110.38 0.260.24 0.080.07 0.050.08 0.030.23 0.06multidifus r0.88 0.28 * 0.90 0.29 * 0.83 0.24 * 0.26 0.220.46 0.170.20 0.130.08 0.030.14 0.060.17 0.09multifidus l0.90 0.16 * 0.90 0.24 * 0.87 0.19 * 0.43 0.090.23 0.100.25 0.130.09 0.070.17 0.090.16 0.08r : right ; l : left ; ue : upper extremity ; pe : prone extension ; poall : prone opposite arm leg lift ; qoall : quadruped opposite arm leg lift ; sflex : sitting flexion ; sext : sitting extension ; sabd : sitting horizontal abduction ; sadd : sitting horizontal adduction ; * statistically significant difference from quadruped and sitting position exercises ; statistically significant difference from sitting position exercises ; statistically significant difference for noted exercise and muscle left and right comparison ; p<0.05 . two - way anova analysis showed that significant main effect of % of emg activity for li and lm muscles was observed , suggesting that % of emg activities varies with exercise position ( ( f1,11)=106 , ( f1,11)=150 , p<0.05 ) . post hoc tests revealed that prone extension , prone right ue / left le , and prone left ue / right le produces a statistically significant difference with greater li and lm emg activity compared to quadruped and sitting positions exercises ( p<0.05 ) ( table 1 ) . additionally , quadruped arm lifting exercise generated a statistically significant difference in lm emg activity that was greater than that produced in sitting exercises ( p<0.05 ) . r : right ; l : left ; ue : upper extremity ; pe : prone extension ; poall : prone opposite arm leg lift ; qoall : quadruped opposite arm leg lift ; sflex : sitting flexion ; sext : sitting extension ; sabd : sitting horizontal abduction ; sadd : sitting horizontal adduction ; * statistically significant difference from quadruped and sitting position exercises ; statistically significant difference from sitting position exercises ; statistically significant difference for noted exercise and muscle left and right comparison ; p<0.05 a statistically significant interaction between exercise and side was found for li and lm muscles activities ( ( f1,11)=106 , p<0.05 ) . muscle activity was greatest ipsilateral to side of arm activity for li for prone and quadruped . in contrast , lm activity was higher on side opposite to arm lift ( side of leg lift ) during qoall . sitting exercises did not show consistency in favoring either left or right side muscle activity for either muscle ( table 1 ) . the purpose of this study was to compare full range and stabilization exercises performed in prone , quadruped , and sitting and establish a hierarchy of % mvc of emg activity of li and lm , as well as to identify optimal recruitment exercises for both li as a global multi - segmental stabilizer and lm as a segmental stabilizer . all core muscles are important for providing trunk stability18 , with stabilization of the lumbar spine accomplished by the interaction of local and multi - segmental muscle contraction4 . the long multi - segmental global muscles function as guy wires during trunk motion while the deep segmental back muscles provide neuromuscular control at a vertebral level , with the lm viewed as a primary segmental stabilizer of the lumbar spine19 . a high resistance generates the need for a large force , produced by the stronger global muscles ( e.g. , li)18 . smaller muscles ( e.g. , lm ) are more efficient in generating a segmental stabilization force and may be sufficient for resisting lighter loads18 . trunk extensor muscle weakness can be addressed via strengthening by using prone extension exercises through full range against resistance19 . in this study pte recruited both li and lm maximally and symmetrically , which is consistent with their primary action in extension of the lumbar spine and consistent with the results of emg studies by others20,21,22 . the high muscle recruitment of 80 to 106% mvc produced during the bilateral recruitment of li and lm during this exercise indicate it is an optimal exercise for strengthening . high compressive forces on the spine may be hazardous to individuals with low back pain23 . decreased compressive forces can be accomplished using quadruped exercises with a neutral spine position19 . asymmetry during qoall was observed for both li and lm , with greater activity occurring ipsilateral and contralateral to arm lift respectively . previous studies report mixed results for li with no asymmetry24 , asymmetry of muscle activity with li greater ipsilateral to arm lift8 , 25 , and contralateral to arm lift23 . prior studies of quadruped exercise for lm activity have also reported varied asymmetry with greater ipsilateral to arm lift and contralateral to arm lift23 , 25 , 26 . in this study , during qoall the li and lm produced 24 to 38% and 23 to 46% mvc , respectively . this is less than the recommended 60 to 70% of a 1 repetition maximum ( and similar % mvc ) advocated to achieve a strengthening effect for novice exercisers27 . consistent with its proposed role as a postural muscle4 , the lm is composed of mostly type 1 fibers28 . in this role , the lm will perform tonic contractions4 . low load exercise of 30 to 40% mvc is recommended for targeted endurance training of type 1 muscle fibers4 . additionally , success has been achieved using an exercise program for patients with clinical instability , which included targeted recruitment of lm , resulting in decreased pain and improved function29 . these results indicate that qoall will produce low levels of spinal compression and optimally train lm to support its role as a postural muscle . some individuals can not assume a prone or quadruped position to perform spine strengthening exercise . the exercises performed in sitting demonstrated that recruitment of li was dependent on direction of force . motions of sitting flexion and adduction produced higher li emg values contralateral , while abduction demonstrated a greater ipsilateral li force . behm and colleagues7 reported a similar pattern of greater contralateral lumbosacral es emg activity when performing a unilateral shoulder press using a dumbbell while seated . they proposed that unilateral resisted exercise creates a disruptive torque moment thereby creating an unstable condition with a response by the contralateral es . however , their use of a swiss ball as an unstable base did not increase recruitment of contralateral es when compared to a stable sitting environment during unilateral shoulder press with a dumbbell . our results demonstrated that recruitment of lm in sitting was symmetrical , with greatest % mvc during shoulder flexion . aronski and coauthors6 also reported lm produced symmetrical contraction during alternating flexion with dumbbells in high sitting . this study is the first to describe the emg production of back stabilizing muscles while performing multiple unilateral resisted shoulder exercises in a seated position . our results indicate that seated arm exercises as performed in this study are insufficient to produce a strengthening or endurance training effect on the trunk stabilizers . the superficial and deep fibers of lm may exhibit differing emg recruitment patterns which are not observable with surface electrodes . results may vary in persons with back pain , older adults , when using different extremity positions or different amounts of resistance . whereas a standardized mvc of prone extension against 7.3 kg was utilized , an isometric resistance in trunk extension may produce a higher emg reading . in conclusion , our study indicates that full range prone exercises generate sufficient emg output to provide a strengthening stimulus for both li and lm . for the healthy individual , pte generates the greatest emg production , thus providing the best exercise for strengthening the trunk extensors . the quadruped stabilization exercise best trains the lm in its role as a segmental stabilizer . the qoall exercise produces low spinal loading and recommended % mvc activity for training lm in its role as a segmental stabilizer , thus making this the optimal exercise for an individual with low back pain . lastly , sitting isometric arm exercises , at the loads used in this study , generate insufficient load for any training effect for either li or lm . further research is needed to determine optimal exercise dosage for strengthening and endurance of both global and segmental muscles in a sitting position .

[ purpose ] the purposes of this study were : 1 ) describe a hierarchy of electromyographic activity production , using percentage maximum voluntary contraction of lumbar iliocostalis and lumbar multifidus muscles during prone , quadruped and sitting exercises ; and 2 ) identify optimal recruitment exercises for both lumbar iliocostalis as a global multi - segmental stabilizer and lumbar multifidus as a segmental stabilizer . [ subjects ] twelve healthy volunteers ( six male and six female ) aged 24 to 45 participated . [ methods ] surface electromyographic activity data were collected bilaterally from lumbar iliocostalis and lumbar multifidus muscles during exercises . [ results ] two - way anova showed that prone extension , and prone alternate arm and leg lifting exercises produce a statistically significant difference in percent maximum voluntary contraction of lumbar iliocostalis and lumbar multifidus bilaterally compared to other exercises . quadruped alternate arm and leg lifting exercises produce greater activity in lumbar multifidus muscle than sitting exercises [ conclusion ] prone exercises generate the greatest electromyographic activity and may be the most effective exercises for strengthening both lumbar iliocostalis and lumbar multifidus muscles . quadruped alternate arm and leg lifting produces electromyographic activity at the recommended percent maximum voluntary contraction for training the lumbar multifidus in its role as a segmental stabilizer and is an effective training exercise for this goal .

INTRODUCTION SUBJECTS AND METHODS RESULTS DISCUSSION

humans tend to assume that our vision represents the world as it is ; that , for example , an object appears red because that object is red . however , the colours that objects appear depend on the colour vision of the observer , and humans actually have a rare form of colour vision among all animals ( e.g. bowmaker , 1998 ; jacobs , 1993 ) . the early vertebrates were probably tetrachromatic and many fish , reptiles and birds remain so meaning they have four types of cone receptor . early mammals lost this multidimensional colour vision and became dichromatic , retaining only the cone classes sensitive to the longest and shortest wavelengths . an ancestor to african and asian primates , with which we share our type of colour vision , reinvented full trichromatic vision from these dichromatic ancestors , so that we now have three types of cone shortwave ( s ) , mediumwave ( m ) and longwave ( l)two of which , l and m , remain similar to each other in many ways because they are the offspring of the same ancestral mammalian longwave cone . most placental mammals have remained dichromatic , possessing s and l cones , while some groups have reduced to just l cones ( and rods ) . the reason why primates bucked this trend has been the focus of a long - running debate . the main theories have suggested that the key selective advantage of trichromacy for primates lay in foraging , either for fruit ( allen , 1879 ; mollon , 1989 ; osorio & vorobyev , 1996 ; polyak , 1957 ; regan et al . , 1998 , 2001 ; riba - hernandez , stoner , & osorio , 2004 ; steward & cole , 1989 ) or for young leaves ( dominy & lucas , 2001 ; sumner & mollon , 2000a ) among the ubiquitous forest background of mature leaves . , we ask whether the key task might have been spotting food from a distance , or efficiently picking food once it is within reach ( i.e. food detection or food selection ; lucas et al . , 2003 ) . parraga , troscianko , and tolhurst ( 2002 ) compared the spatiochromatic properties of calibrated natural images , including those of fruit on leafy backgrounds with the properties of the three early channels of human vision : the lm colour pathway , which compares l cone signals with m cone signals ( this pathway is often called red green , but this is slightly misleading ) ; the s - lm pathway comparing s cone signals with pooled l and m signals ( this pathway is often called blue yellow , but this is highly misleading ) , and an achromatic pathway . it is the ability to compare l with m signals that was new in primate trichromacy , and parraga et al . ( 2002 ) found that the spatiochromatic properties of this channel are optimized for encoding reddish or yellowish fruit or leaves on a background of foliage at relatively small viewing distances . in other words , our lm system is optimized for picking fruit or edible leaves , rather than for spotting them from a distance . does it follow that picking food was the critical task driving the natural selection of primate trichromacy ? we can not necessarily make this inference because natural selection is not driven by what a phenotype might be best at , but by the advantage that phenotype offers over other competing phenotypes . even though the lm pathway may be best at selecting food close up , the biggest advantage over dichromacy might still be at spotting fruit at a distance . in fact , other authors have explicitly assumed that the biggest advantage lay in spotting food from a distance ( dominy , lucas , osorio , & yamashita , 2001 ; lucas et al . , 2003 ; regan et al . , 1998 , 2001 ; sumner & mollon , 2000a , 2000b ) . for example , regan et al . and sumner & mollon modelled the task of finding fruit or young leaves in foliage for all plausible sensitivity functions that the l and m cones might take , in order to work out which combination of potential l and m cones would be optimal . it turned out that the optimal pair are very close to what we actually possess , supporting the argument that finding important objects amongst foliage was a driving force in the evolution of the lm colour channel . this approach did not incorporate the spatial properties of the system , unlike parraga et al . ( 2002 ) but a component of the modelling the estimation of quantum noise did require the viewing distance of the stimuli to be specified . these studies explicitly assumed the key task was spotting food from a distance rather than picking food close up , and thus chose distances of about 10 m. behavioural evidence in favour of either task is circumstantial . south american monkeys have been the main focus of study because they are polymorphic in their colour vision ( mollon , bowmaker , & jacobs , 1984 ) ; within the same species , some individuals can have trichromacy , while others have dichromacy ( we will return to this in the discussion section ) . these species offer the opportunity of natural experiments , comparing the behaviour of trichromatic individuals with dichromatic individuals , either in zoos or in the wild . caine and mundy ( 2000 ) tested marmosets in visual search tasks in a naturalized captive setting . in one task , they scattered edible orange or green cereal balls in the cage , which required viewing from up to 6 m away , while in the other task the targets were placed on a tray among green wood shavings and viewed close up ( < 0.5 m ) . an advantage for trichromats was evident only for the longer distance task , but the backgrounds for the visual search were not matched across tasks ( the primary aim of the study was to establish whether the trichromats had an advantage in any task rather than to formally test the distance manipulation ) . since then , there has been no distance manipulation within the same study , and it has been surprisingly difficult for researchers to observe any significant behavioural differences between trichromatic and dichromatic monkeys in the wild . in a captive environment , the foraging advantage of trichromats has been replicated with tamarins finding simulated fruits in simulated leaves , but there was no distance manipulation ( smith , buchanan - smith , surridge , osorio , & mundy , 2003b ) . in the wild , smith et al . ( 2003b ) found a hint that trichromatic moustached tamarins might be more likely to lead the troop into fruiting trees than dichromats , consistent with an advantage in spotting fruit , but this was not consistent and it was not the case that all troops of tamarins were led by trichromats ( saddleback tamarins were mainly male - led , who are all dichromats ) . similarly , bunce , isbell , grote , and jacobs ( 2011 ) found a hint that wild trichromatic titi monkeys found small patches of red or yellow fruit more often than their dichromatic conspecifics . however , the only significant observed advantage in wild monkeys has been capuchins selecting fruit at arms ' reach ( melin et al . , 2009 ) , where trichromats accepted ( i.e. ate ) more of the fruit they picked , sniffed fruit less , and had shorter foraging sequences than dichromats did . however , this apparent advantage for picking fruit does not appear to translate into consuming more food overall in trichromatic capuchins or spider monkeys ( hiramatsu et al . , 2008 ; melin et al . , 2009 ; vogel , neitz , & dominy , 2007 ) . moreover , hiramatsu et al . ( 2008 ) found that luminance , rather than colour , was the cue that best predicts foraging efficiency at grasping distance ( for the fruits in their study at least ) . additionally , olfaction and tactile cues can be available , reducing the importance of trichromacy ( hiramatsu et al . , 2009 ; lucas et al . , 2003 ; steward & cole , 1989 ) . thus , it remains unclear whether we should expect the greatest advantage of human - like trichromacy to be in the longer distance task of spotting food , or the close - up task of picking it . the aim of our experiment was to simulate the competition to find fruit between two primates ( in this case humans ) in a naturalistic visual search task of real fruit in real foliage . we tested normal trichromats , dichromats and anomalous trichromats who have less separation between the l and m cone sensitivity functions than do we included anomalous trichromats both to boost colour - deficient participant numbers ( dichromats are relatively rare , 2% of the male population ) , and because evolutionarily the competing state to what we now consider normal trichromacy has almost certainly been anomalous trichromacy as well as dichromacy . the task was to count the number of ripe fruit hanging in a real bush from a distance of 1 , 4 , 8 or 12 m ( figure 1 ) . we used segments of yellow pepper as targets because they display spectral and thus chromatic properties representative of many fruit favoured by primates in a ugandan rainforest ( figures 2 and 3 ) . the task was performed simultaneously by a pair of participants , one dichromat or anomalous trichromat and one normal trichromat matched as closely as possible for age , sex , experience of visual experiments and knowledge of colour vision . each pair performed the task simultaneously so that they were exposed to the identical trial sequence and lighting conditions ( cloudy or sunny ) . this set - up also engendered some aspect of competition between the pair , simulating the competition for fruit of two primates simultaneously foraging in the same tree . the upper panel shows two participants during a trial at 4 m with three targets . both have removed their blindfolds and opened their eyes in order to search the shrub . the lower panel shows the shrub with the eight potential target positions marked with red circles . e.g. panel a : samples of unripe , green , and ripe , yellow , chrysophyllum albidum ) , we chose segments yellow pepper as targets and green pepper as distractors ( b ) , because they have similar reflectance spectra ( c ) and chromatic properties ( figure 3 ) . stimuli ( b ) subtended approximately 2 , 0.5 , 0.25 and 0.16 degrees of visual angle for distances 1 , 4 , 8 , 12 m. in panel ( c ) , thin orange and green lines are ripe and unripe ugandan fruit chrysophyllum albidum , orange and green thick lines are ripe and unripe segments of yellow / orange and green pepper used as targets and distractors overlap in their chromatic properties ( orange and green filled circles ) with some fruits eaten by primates in uganda ( unfilled circles ) . the leaves from the experimental bush ( grey squares ) also show similar properties to leaves in a ugandan rainforest ( open squares ) . normal trichromats made faster responses and fewer errors than their colour - deficient competitors , as expected ( mean rts 4.7 vs. 6.4 s ; error score 0.17 vs. 0.54 ; all errors were misses , our unit of analysis is the pairwise comparison between the members of each matched pair . as shown in figures 4(a and b ) , the relative advantage increased with distance , both for response time and errors [ one - way anovas , f(3,21 ) = 9.7 , p < 0.001 and f(3,30 ) = 4.0 , p < 0.02 ; see the methods section for subject numbers and other details ] . in figures 4(a and b ) , the difference in performance ( rt or error ) between the colour - deficient member and the colour - normal member of each pair was divided by the overall mean rt or error of that pair , in order to control for different overall performance and speed accuracy trade - offs ( range in mean rt , 3.412.8 s and in mean error score 0.150.57 ; the behaviour of each member was correlated , r = 0.76 for rt and r = 0.32 for errors , probably because they influenced each other in this regard , as would be expected , and/or because they had correlated age , experience and testing conditions ) . a and b ) , the difference in performance ( rt or error ) between the colour - deficient member and the colour - normal member of each pair was divided by the overall mean rt or error of that pair , in order to control for different overall performance and speed accuracy trade - offs . in panel ( c ) , the rt for the colour - deficient member of each pair in each condition is simply divided by the rt of the colour - normal member ( which is a simpler analysis and also controls for differences in baseline speed with distance ) . this analysis could not be done reliably for error scores because there were many instances of dividing by zero or near - zero bins . the dashed and dotted lines show the subsets of results for dichromats and anomalous trichromats ( each compared with their matched normal trichromat ) . figure 4(c ) shows that the same pattern [ f(3,21 ) = 5.6 , p = 0.005 ] occurred for the mean ratio of response times of the colour - normal and colour - deficient members of each pair . the dashed and dotted lines in figures 4(a c ) show the subsets of results for dichromats and anomalous trichromats ( each compared with their matched normal trichromat ) , indicating that the effect on response time is greater for full dichromats [ interaction f(3,18 ) = 3.4 , p < 0.05 ] , as would be expected . the same pattern is not evident in the error scores , but this could be a simple lack of power or a difference in speed accuracy strategy between groups . note that the key comparison was between the colour - deficient and normal trichromatic member of each pair , not between dichromats and anomalous trichromats , because although the dichromats and anomalous trichromats were each matched in age and relevant experience to their control trichromats , dichromats and anomalous trichromats could not be matched in age or experience with each other . the mean age of the dichromats was 10 years older than that of the anomalous trichromats . our results show that in our naturalistic visual search task with human observers , the advantage of normal trichromacy over dichromacy or anomalous trichromacy increased with distance ( even without the additional cues of smell and touch available to foraging monkeys ) . the advantage was greatest when the stimuli subtended no more than 0.2 degrees at the eye . this is likely to be because visual cues such as shape and the s/(l+m ) dimension of colour vision decrease with distance for small targets . for very small stimuli , the absence of s cones in the very centre of the fovea ( about the central 1/3 of a degree of visual angle ) , precludes information in the s/(l+m ) pathway for fixated targets ( known as small field tritanopia ) , although the effect of this is less when observers scan a scene , as in the present task ( e.g. mccree , 1960 ) . although we used fruit not young ( reddish or yellowish ) leaves as targets , we see no reason that our findings would not extend to such leaves , which are also important sources of food for some species of primate . our results imply that the more important task for the natural selection of primate trichromacy may have been spotting food from a distance rather than picking it at arms ' length . this in no way challenges the previous finding that the lm colour channel is optimal at the close - up task ( parraga et al . , 2002 ) . the biggest advantage of one phenotype over competing phenotypes does not have to arise for the task that the phenotype is best at . however , while the spatial - frequency sensitivity of the lm system undoubtedly makes it optimal at the close - up task , our results do raise the question of whether it has been optimized by that task . rather , its optimality may have emerged as a side effect of the combined pressures of the longer distance task and other constraints , such as the random layout of l and m cones on the retina ( deeb , 2006 ) and the unavoidable fact that both colour resolution and achromatic resolution can not be equally high because they are conflated in the most fine scale comparison of neighbouring cones . one general puzzle is why it has been so difficult to observe any behavioural advantages for trichromats over dichromats in the wild , when they have been apparent as expected in experiments such as this one and those on captive tamarins and marmosets ( caine & mundy , 2000 ; smith et al . , 2003b ) . most studies in the wild have concentrated on observing monkeys picking fruit ( e.g. hiramatsu et al . , 2008 ; melin et al . , 2009 ; vogel et al . , 2007 ) , where our results predict the advantage is smallest , even without the extra tactile and olfactory cues available in the wild but not in our experiment . unfortunately , it is very difficult to discern and quantify the longer distance task except by observing troop leadership , which is known to be influenced by other social factors which might mask any effect of colour vision ( smith , buchanan - smith , surridge , & mundy , 2003a ) . another possibility is that the colour properties of fruits consumed in the forests where these studies have taken place are not fully representative of the gamut of fruits eaten by our ancestors . it is difficult to do more than speculate here , but the chromaticity diagrams in hiramatsu et al . ( 2008 ) , who found no differences in feeding behaviour between dichromatic and trichromatic spider monkeys , show a higher ratio of cryptic fruits ( those that stay green ; see also de araujo , lima , & pessoa , 2006 ) and fruits that turn dark brownish purple ( as do many types of fig ) , and fewer orange or yellow fruit than are found in the diet of primates in uganda ( sumner & mollon , 2000a , 2000b ) . cryptic fruits are detected from afar by smell or shape ( and memory ) , and close up by shape , position , smell or feel ( e.g. hiramatsu et al . , 2009 ; melin et al . , 2009 ) , all of which dichromats can do at least as well as trichromats . dark fruits have , by definition , a strong achromatic signal , which again dichromats can detect at least as well as trichromats ( and possibly are better attuned to ) . however , viewed amongst foliage from a distance , dark fruits ( unless in a clump ) could easily be mistaken for shadow or gaps , so the use of achromatic cues in fruit foraging remains unclear ( as does the extra cue of glossiness often present in dark fruits ) . it would be interesting to test human dichromats and trichromats with fruits showing these properties , such as green and red grapes . note that our targets did also contain a strong luminance signal relative to the foliage background , and of course wild monkeys have a lifetime of practice in fruit picking which acts to diminish any behavioural differences between them . field studies have concentrated on polymorphic species of monkey where some individuals are trichromatic and some are dichromatic , both because this situation makes an ideal natural experiment and because the polymorphism is interesting and rare in itself . it arises through there being different alleles of the gene coding the l cone pigment , which give the pigment different sensitivities ( akin to our l and m cones ) . if a monkey is homozygous for this gene , they can only have one type of l cone ( in addition to s cones ) , and are thus dichromatic . but if they are heterozygous , and the alleles are expressed in different cones cells , then they possess two types of l cone ( i.e. l and m cones ) and can be trichromatic ( mollon et al . , 1984 ) . the polymorphic gene is on the x chromosome , which means that only females get the opportunity to be heterozygous and thus trichromatic . in many species , there are three alleles present in different frequencies , which means that approximately 60% of females are trichromatic ( jacobs , neitz , & neitz , 1993 ; williams , hunt , bowmaker , & mollon , 1992 ) . because trichromacy arises from heterozygosity , rather than from possessing a single advantageous allele , it can not be simply passed on to offspring . in fact , there is about equal chance of a dichromatic or trichromatic mother having a trichromatic daughter ( in - breeding avoidance can complicate this , and possibly make dichromats more likely to have trichromatic daughters ; surridge , suarez , buchanan - smith , & mundy , 2005 ) . however , rare alleles tend to be lost to populations if their presence provides no advantage ( e.g. surridge & mundy , 2002 ) , so it is assumed that to maintain the polymorphism there must be some advantage to trichromacy in the wild that translates into improved fitness ( the potential advantage of having different types of dichromacy in a population has not been given any support ; riba - hernandez et al . , 2004 ) . on the other hand , if this advantage was very large , there is the obvious question of why full trichromacy has not emerged in these species , as it did for asian and african primates , and has done also for howler monkeys ( jacobs , neitz , deegan , & neitz , 1996 ) . one possibility is that the genetic event required to allow this is vanishingly rare and simply never happened in those species that remain polymorphic ( regan et al . , 2001)a gene duplication is required that puts two different alleles onto the same chromosome alongside working promoter regions and a mechanism for expressing these genes differentially in different cones . the other possibility is that the advantage of trichromacy is much subtler than originally expected when combined with social factors within a polymorphic population ( e.g. bunce et al . , 2011 ; , 2003a ) , and may also be offset by some advantages for dichromacy , such as breaking camouflage of cryptic insects ( melin , fedigan , hiramatsu , sendall , & kawamura , 2007 ; regan et al . , 2001 ; saito et al . , 2005 ) . either way , given that many species of monkey have successfully survived and diversified over millions of years in which the majority of individuals ( and all the males ) have been dichromatic ( e.g. surridge & mundy , 2002 ) , it should not be surprising that dichromats are not glaringly deficient at any crucial task in the wild that would dramatically harm their chances of survival . from this perspective , the advantage of trichromacy is bound to be quite subtle and hard to measure in free - ranging wild monkeys . lastly , some authors have suggested that the selective advantage of trichromacy might have been in signalling ( changizi , zhang , & shimojo , 2006 ) . many monkeys have red faces ( and sometimes red sexual signals ) or orange fur markings ( sumner & mollon , 2003 ) . more recent evidence suggests that such signalling post - dates the invention of trichromacy , and thus took advantage of trichromacy once it had arisen , rather than driving its natural selection initially ( fernandez & morris , 2007 ) . however , it may form part of the selection pressure maintaining it in current populations , as might predator detection ( smith , buchanan - smith , surridge , & mundy , 2005 ; sumner & mollon , 2003 ) . in conclusion , we found that in a naturalistic visual search task of finding food in foliage , humans with normal colour vision diverged in performance from dichromats or anomalous trichromats most for the longest viewing distance ( 12 m ) . this implies that in the natural selection of trichromacy , the task of spotting fruit from a distance was a greater driving force than picking fruit close up . colour - deficient participants were recruited through advert and tested using the ishihara test ( 24 plate edition ) and nagel anomaloscope to determine their type of colour vision . following this screening , 12 participants with clearly defined colour deficiency ( 3 protanopes , 4 deuteranopes , 2 protanomalous and 3 deuteranomalous ) performed the visual search task . each was paired with control participant with normal trichromacy ( tested using the ishihara plates ) , matching as closely as possible for age , sex , experience of visual experiments and knowledge of colour vision . each pair performed the task simultaneously so that they were exposed to the identical trial sequence in identical lighting conditions ( cloudy or sunny ) . this set - up also engendered some aspect of competition between the pair , simulating the competition for fruit of two primates simultaneously foraging in the same tree . for the first three pairs of participants , accuracy was recorded , but not reaction time due to a technical error . one participant opened his eyes prematurely on some of the visual search trials , and so that pair was excluded from all analyses . therefore , there were 16 participants ( 8 pairs ) for the analysis of response time and 22 participants ( 11 pairs ) for the analysis of error scores . participants had to count the number of ripe fruit hanging in a bush from a distance of 1 , 4 , 8 or 12 m ( figure 1 ) . on each trial , the two participants were positioned at the appropriate distance and blindfolded while the experimenter positioned four fruit between zero and four of these stimuli were targets ( ripe fruit ) and the rest were distractors ( unripe fruit ) . when the stimuli were positioned , the experimenter instructed the participants to remove their blindfold keeping their eyes closed ( compliance was monitored by the experimenter ) . then , on the instruction go the participants simultaneously opened their eyes and viewed the stimuli . their task was to press one of the five keys ( labelled 0 , 1 , 2 , 3 , 4 ) on a keyboard as quickly and accurately as possible to indicate the number of targets they could see . the keyboards were positioned on a trolley between the participants , which also contained the computer and could be moved to each distance as appropriate ( figure 1 , lower panel ) . the side of the trolley taken by the colour - deficient participant was counterbalanced across pairs . rt was recorded ( except for the first three participants ) as well as the difference between the answer given and the correct answer ( error score ) . while there was no barrier to entirely rule out participants seeing each other 's responses , behaviour was watched by the experimenter . furthermore , if a participant based their response on that of their competitor , by definition they would have longer reaction times , but consistently across distances . the effect this might have on results there were 40 trials per pair ( 10 per distance ) , taking approximately one hour to complete . on each trial , the number of each stimulus type and their positions , as well as the viewing distance , all followed a randomized sequence that ensured two trials with each number of targets ( 04 ) were conducted for each distance . the aim was to use real fruit as target and distractor stimuli , positioned amongst real leaves . we located a suitable bush ( aucuba japonica ) in an unused courtyard on the university campus , which could be viewed from between 1 and 12 m. we measured the reflected spectra ( spectrocal , cambridge research systems ) from 25 of the leaves in situ under natural overcast conditions in order to compare their chromaticity coordinates ( figure 3 ) with leaves measured in a ugandan rainforest , also under overcast conditions , by sumner and mollon ( 2000a ) . to calculate chromaticities , we used cone fundamentals from stockman and sharpe ( 2000 ) and corresponding scaling factors ( http://www.cvrl.org ) . to choose target and distractor stimuli , we measured the reflectance spectra of a range of fruits obtained from local supermarkets and specialist shops , in order to compare them with the fruit in a ugandan forest ( sumner and mollon ( 2000a , b ) . highly favoured by the primates in the kibale forest , including monkeys and chimpanzees , from the cambridge database of natural spectra ( see figure 2 ) . to be used in our task , target and distractor fruit had to satisfy three conditions : ( 1 ) the chromaticities had to be representative of the rainforest fruit ( to calculate chromaticities , we used a natural illuminant in overcast conditions from near the experimental bush for experimental stimuli , and from uganda for ugandan fruit , http://vision.psychol.cam.ac.uk/spectra/ ) ; ( 2 ) the stimuli had to be light enough to hang on the bush ; ( 3 ) the stimuli must not change ( e.g. change colour through oxidization ) during the course of an experimental session . the fruit that best satisfied these criteria were green ( unripe ) and yellow / orange ( ripe ) peppers , which could be cut into equal - sized segments and hung on the bush with small green hooks . although peppers are not indigenous to africa , natural spectra are constrained by the pigments available to plants . finding segments of pepper amongst leaves is a task highly representative of the chromatic visual search task facing primates in uganda , which in turn is the environment most likely to represent that of our shared ancestors . segments 3 5 cm were used ( figure 2 ) , subtending the following degrees of visual angle for distances 1 , 4 , 8 , 12 : 1.7 2.3 , 0.43 0.57 , 0.21 0.29 , 0.14 0.19 . before performing the visual search trials , each participant was shown the yellow and green pepper segments intermingled on a plate and asked to categorize them into two piles . they were then informed that the yellow peppers , but not the green , were the targets for the visual search . colour - deficient participants were recruited through advert and tested using the ishihara test ( 24 plate edition ) and nagel anomaloscope to determine their type of colour vision . following this screening , 12 participants with clearly defined colour deficiency ( 3 protanopes , 4 deuteranopes , 2 protanomalous and 3 deuteranomalous ) performed the visual search task . each was paired with control participant with normal trichromacy ( tested using the ishihara plates ) , matching as closely as possible for age , sex , experience of visual experiments and knowledge of colour vision . each pair performed the task simultaneously so that they were exposed to the identical trial sequence in identical lighting conditions ( cloudy or sunny ) . this set - up also engendered some aspect of competition between the pair , simulating the competition for fruit of two primates simultaneously foraging in the same tree . for the first three pairs of participants , accuracy was recorded , but not reaction time due to a technical error . one participant opened his eyes prematurely on some of the visual search trials , and so that pair was excluded from all analyses . therefore , there were 16 participants ( 8 pairs ) for the analysis of response time and 22 participants ( 11 pairs ) for the analysis of error scores . participants had to count the number of ripe fruit hanging in a bush from a distance of 1 , 4 , 8 or 12 m ( figure 1 ) . on each trial , the two participants were positioned at the appropriate distance and blindfolded while the experimenter positioned four fruit ( see the stimuli section below ) amongst the leaves of the bush . between zero and four of these stimuli were targets ( ripe fruit ) and the rest were distractors ( unripe fruit ) . when the stimuli were positioned , the experimenter instructed the participants to remove their blindfold keeping their eyes closed ( compliance was monitored by the experimenter ) . then , on the instruction go the participants simultaneously opened their eyes and viewed the stimuli . their task was to press one of the five keys ( labelled 0 , 1 , 2 , 3 , 4 ) on a keyboard as quickly and accurately as possible to indicate the number of targets they could see . the keyboards were positioned on a trolley between the participants , which also contained the computer and could be moved to each distance as appropriate ( figure 1 , lower panel ) . the side of the trolley taken by the colour - deficient participant was counterbalanced across pairs . rt was recorded ( except for the first three participants ) as well as the difference between the answer given and the correct answer ( error score ) . while there was no barrier to entirely rule out participants seeing each other 's responses , behaviour was watched by the experimenter . furthermore , if a participant based their response on that of their competitor , by definition they would have longer reaction times , but consistently across distances . the effect this might have on results there were 40 trials per pair ( 10 per distance ) , taking approximately one hour to complete . on each trial , the number of each stimulus type and their positions , as well as the viewing distance , all followed a randomized sequence that ensured two trials with each number of targets ( 04 ) were conducted for each distance . the aim was to use real fruit as target and distractor stimuli , positioned amongst real leaves . we located a suitable bush ( aucuba japonica ) in an unused courtyard on the university campus , which could be viewed from between 1 and 12 m. we measured the reflected spectra ( spectrocal , cambridge research systems ) from 25 of the leaves in situ under natural overcast conditions in order to compare their chromaticity coordinates ( figure 3 ) with leaves measured in a ugandan rainforest , also under overcast conditions , by sumner and mollon ( 2000a ) . to calculate chromaticities , we used cone fundamentals from stockman and sharpe ( 2000 ) and corresponding scaling factors ( http://www.cvrl.org ) . to choose target and distractor stimuli , we measured the reflectance spectra of a range of fruits obtained from local supermarkets and specialist shops , in order to compare them with the fruit in a ugandan forest ( sumner and mollon ( 2000a , b ) . for this comparison highly favoured by the primates in the kibale forest , including monkeys and chimpanzees , from the cambridge database of natural spectra ( see figure 2 ) . to be used in our task , target and distractor fruit had to satisfy three conditions : ( 1 ) the chromaticities had to be representative of the rainforest fruit ( to calculate chromaticities , we used a natural illuminant in overcast conditions from near the experimental bush for experimental stimuli , and from uganda for ugandan fruit , http://vision.psychol.cam.ac.uk/spectra/ ) ; ( 2 ) the stimuli had to be light enough to hang on the bush ; ( 3 ) the stimuli must not change ( e.g. change colour through oxidization ) during the course of an experimental session . the fruit that best satisfied these criteria were green ( unripe ) and yellow / orange ( ripe ) peppers , which could be cut into equal - sized segments and hung on the bush with small green hooks . although peppers are not indigenous to africa , natural spectra are constrained by the pigments available to plants . finding segments of pepper amongst leaves is a task highly representative of the chromatic visual search task facing primates in uganda , which in turn is the environment most likely to represent that of our shared ancestors . segments 3 5 cm were used ( figure 2 ) , subtending the following degrees of visual angle for distances 1 , 4 , 8 , 12 : 1.7 2.3 , 0.43 0.57 , 0.21 0.29 , 0.14 0.19 . before performing the visual search trials , each participant was shown the yellow and green pepper segments intermingled on a plate and asked to categorize them into two piles . they were then informed that the yellow peppers , but not the green , were the targets for the visual search .

the spatiochromatic properties of the red green dimension of human colour vision appear to be optimized for picking fruit in leaves at about arms ' reach . however , other evidence suggests that the task of spotting fruit from a distance might be more important . this discrepancy may arise because the task a system ( e.g. human trichromacy ) is best at is not necessarily the same task where the largest advantage occurs over the evolutionary alternatives ( dichromacy or anomalous trichromacy ) . we tested human dichromats , anomalous trichromats and normal trichromats in a naturalistic visual search task in which they had to find fruit pieces in a bush at 1 , 4 , 8 or 12 m viewing distance . we found that the largest advantage ( in terms of either performance ratio or performance difference ) of normal trichromacy over both types of colour deficiency was for the largest viewing distance . we infer that in the evolution of human colour vision , spotting fruit from a distance was a more important selective advantage than picking fruit at arms ' reach .

Introduction Results Discussion Conclusion Methods Participants Visual search task Stimuli

euthyroid graves ' ophthalmopathy ( go ) is a go without thyroid dysfunction and antithyroid treatment and is known to be a mild eye disease [ 13 ] . measuring thyroid antibodies . however , tsh - receptor ( trab ) and thyroid peroxidase antibodies ( tpoab ) are negative in approximately 25% of euthyroid patients and elevated in , respectively , 1 - 2% and 415% of healthy individuals [ 46 ] . in euthyroid go cases without elevated antibodies , orbital imaging is indicated to support the diagnosis [ 7 , 8 ] . it is believed that euthyroid go is always associated with some degree of thyroid abnormality , as shown with second generation antibody assays [ 9 , 10 ] , thyroid scintigrams , and thyrotropin releasing hormone and t3 suppression testing [ 1216 ] . within the group of euthyroid go patients , there is a subset of patients who have experienced thyroid dysfunction in the past . as severity of go is linked to thyroid dysfunction , we hypothesized that previous exposure to elevated thyroid hormones in euthyroid go patients may have an effect on the severity compared to those who never had had thyroid dysfunction [ 2 , 3 , 17 ] . the present study retrospectively analyses the clinical presentation and outcome of the different groups of euthyroid go . the medical records of all patients with the diagnosis of go referred to the orbital clinic of the university hospitals leuven between june 1999 and june 2009 , examined and treated by the same ophthalmologist ( i m ) , were analysed retrospectively . the patients who developed go under biochemical euthyroid conditions were divided into two groups : group a in the case of no reported history of thyroid dysfunction and group b in the case of a previous history of graves ' hyperthyroidism , in remission for more than 6 months after completion of antithyroid therapy ( i.e. thiamazol , propylthiouracil , or treatment with radioactive iodine ) . of the latter group , patients who developed hypothyroidism were substituted with levothyroxine . go was diagnosed if one of the following findings were present : upper eyelid retraction ( upper eyelid margin in the 12 o'clock position above the superior corneoscleral limbus in primary gaze ) ; hertel exophthalmometer reading > 16 mm for women and > 18 mm for men , anteriorly displaced globe on axial and coronal ct scan , or clinical proptosis when compared to predisease clinical photographs ; or extraocular muscle restriction . eyelid swelling was excluded from analysis , since , as a solitary finding , it is a weak argument in the diagnosis of euthyroid go . corneal dryness was also excluded from analysis , as it is a too variable finding , depending on the use of ocular lubricants . axial and coronal orbital computed tomography scans were performed in all euthyroid go patients at the first or second visit . the go was graded using the eugogo severity criteria and mourits ' clinical activity score ( cas ) [ 19 , 20 ] . the grading of nospecs class 4 was based on the limitation of ductions and the subjective diplopia score after bahn and gorman . the cas was graded out of 7 items during the first visit and out of 10 items from the second visit onwards . the highest severity and activity grade from at least 2 visits between a 2-month interval thyroid function was biochemically analysed just prior to referral by the referring physician or at the time of the first visit at the orbital clinic and was repeated at each visit . serum analysis included measurement of serum t4 , t3 , and tsh concentrations by electrochemiluminescence based assays ( in our institution until november 2003 with the immuno-1 analyzer ( bayer diagnostics , tarrytown , new york , usa ) , later with the modular analytics e ( roche diagnostics , basel , switzerland ) ) . euthyroidism was defined as serum values of the thyroid hormones within the laboratory reference range , in combination with normal tsh values . subnormal tsh levels were allowed in the secondary euthyroid group , since tsh - receptor - binding inhibitory immunoglobulins can cause a long lasting downregulation of tsh release despite normal t3 and t4 levels . tsh - receptor antibody ( trab ) and thyroid peroxidase antibody ( tpoab ) were measured as markers of graves ' disease ( in our institution first with a radioimmunoassay ( b.r.a.h.m.s . diagnostica , berlin , germany ) , later with a electrochemiluminescence based assay , for tpoab the modular analytics e ( roche diagnostics , basel , switzerland ) and for trab the trak human ( b.r.a.h.m.s . statistical significance was based on the mann - whitney test for continuous variables and on the fisher 's exact test for dichotomized variables . the influence of gender , age , and smoking on significant differences between groups was studied using a logistic regression analysis . a p value of < 0.050 was regarded as significant and of < 0.010 as highly significant . statistical evaluations were performed by spss software ( statistical package for the social sciences ; version 16.0 , spss inc . from june 1999 to june 2009 , 788 patients with go were seen in one orbital center . fifty - seven patients were excluded for insufficient laboratory findings ( 54 ) or insufficient follow - up ( 3 ) . from the remaining 731 patients , 37 ( 5% ) were included in group a and 41 ( 6% ) in group b. all patients were caucasian except one black male in group a and one asian female in group b. table 1 outlines the patients ' characteristics . the median age was higher in the secondary euthyroid group ( p = 0.004 ) . the median follow - up was 1 year in both groups with a mean of 3 years in group a and 2 years in group b ( p = 0.018 ) . during follow - up , 3 ( 8% ) patients of group a developed hyperthyroidism , at 1 , 5 , and 6 years , respectively . the median time interval between the onset of hyperthyroidism and the onset of go in group b was 4 years ( range 134 years ) . relapse of hyperthyroidism occurred in 1 ( 2% ) patient of group b , 11 months after the onset of go . hypothyroidism due to inadequate substitution therapy occurred in 1 ( 2% ) patient of group b , 21 months after onset of go . for instance there was no significant increase in upper eyelid retraction as solitary finding in unilateral go . of all the clinical go signs , only the presence of ocular motility restriction and the amount of proptosis were statistically different ( highly significant ) between both groups , with group a being less affected . group a presented significantly more often with normal eye motility ( 46% ) compared to group b ( 22% ) ( p = 0.032 ) . using the eugogo criteria for go severity antibodies were determined in 97% ( 36/37 ) of the patients of group a and in 80% ( 33/41 ) of group b. the prevalence of positive trabs was significantly higher in group b ( 94% ) compared to group a ( 17% ) ( p < 0.001 ) ( table 3 ) . there was no significant correlation between the prevalence of trabs and the disease severity of euthyroid go nor between the prevalence of trabs and the clinical presentation of euthyroid go . the latter correlation was calculated for each subset of the nospecs score but was not significant for any parameter . of the 33 patients of group b who received radioiodine , 27 ( 82% ) received substitution therapy . all patients who received oral corticosteroid treatment for go had the treatment prior to referral to us . the number of patients who underwent strabismus surgery was not significantly different among both groups . our findings of a mild , often unilateral go in euthyroid patients are in agreement with studies on euthyroid go that deal mostly with patients without a dysthyroid past , labelled by us as group a [ 1 , 3 , 12 ] . we found that a prior history of hyperthyroidism in euthyroid go is associated with extraocular muscle restriction and proptosis . the higher prevalence of muscle restriction and proptosis in group b , however , was not reflected in a higher amount of strabismus or orbital decompression surgery . the onset of go coincides with the onset of hyperthyroidism in 2043% of patients [ 16 , 24 , 25 ] . go precedes the diagnosis of hyperthyroidism in 1428% of the cases and follows it in 2857% , mainly within 18 months [ 16 , 24 , 25 ] . in true euthyroid go , however , the orbital disease develops without a present or past hyperthyroidism . repeated measurements of thyroid function are essential during the follow - up , since euthyroid go can be the initial stage of thyroid disease . in this study the follow - up in group a was significantly longer than in group b with a mean of 3 and 2 years , respectively . this is probably because the examiner did not want to miss subsequent development of dysthyroidism in group a. the latter occurred in only 8% of the patients of group a.it is , however , possible that this is underestimated , as the patients may have transient undetected episodes of dysthyroidism in between the follow - up visits . furthermore , the follow - up might be too short to detect late onsets of dysthyroidism . there was a long time interval between the development of thyroid and eye disease in group b ( median of 4 and a maximum of 34 years ) . this suggests that previous exposure to elevated thyroid hormones may have a sustained effect on the eye . the higher prevalence of extraocular muscle restriction and proptosis in group b compared to group a may reflect a delayed result of previous exposure to elevated thyroid hormones . however , it is unlikely that the eye disease takes as much as 4 years to manifest itself clinically . previous studies have shown that only 58% of the hyperthyroid patients develop go more than 3 and 4 years after onset of hyperthyroidism , whilst approximately 8185% develop go within 18 months before or after the onset of hyperthyroidism [ 16 , 24 ] . it is believed that the majority of the patients with onset of graves ' disease develop some degree of go , often subclinically , not noticed by the patient nor the treating physician . in the latter case , reactivation of dysthyroid go would be the preferred diagnosis rather than euthyroid go with previous exposure to elevated thyroid hormones . several factors may have influenced the difference of clinical presentation of go between both groups . firstly , 80% of the patients of group b received radioiodine therapy , while by definition none of group a did . however all patients at risk for radioiodine - induced activation of go , received oral corticosteroid prophylaxis during radioiodine treatment and adequate levothyroxine substitution afterwards . we feel that the influence of radioiodine was hence existent but minimal in this study . a second epidemiological factor that may have influenced our results is the older age in group b. go tends to be more severe in older age , especially with a higher risk of optic neuropathy . the potential relation between age and extraocular muscle restriction in go is controversial in the literature [ 28 , 29 ] . the older age in group b was , however , not reflected in a more severe go with optic neuropathy . disease severity is also higher in smokers , with more disease progression and poorer outcome of therapy . the incidences of smoking in both euthyroid groups were , however , similar to those reported for go in general , that is , approximately 40% . the study design is a retrospective , observational case series , which has inherent disadvantages . some patients received endocrinological follow - up in other hospitals and different laboratory analysis methods might have been used . therefore we divided the patient groups into those with normal and those with elevated antibody levels . the diagnosis of euthyroid go without elevated thyroid antibodies was based on the clinicoradiological picture . there was a higher prevalence of elevated trabs in group b. this may be attributed to the frequent use of radioiodine therapy that may be accompanied with an elevation of trabs . the higher prevalence of elevated trabs in group b compared to group a was correlated with more proptosis and extraocular muscle involvement , however , not with eye disease severity . this is probably because the significant differences in clinical presentation between both groups were not large enough to assign higher nospecs severity grades to group b. eckstein et al . found , however , that trabs can be predictors of disease severity in go in general . if elevated in euthyroid go , trabs can also be the predictors for future development of hyperthyroidism . finally , since euthyroid unilateral go patients without previous thyroid dysfunction are more often referred to a specialist center like our orbital clinic , there may be a selection bias . , this study shows a different clinical spectrum of euthyroid go according to previous exposure to elevated thyroid hormones . we found euthyroid go with previous exposure to elevated thyroid hormones to have more extraocular muscle involvement and proptosis , as well as more frequently elevated trabs , compared to euthyroid go without previous thyroid dysfunction . as euthyroid go can develop several years after previous dysthyroidism , a constant awareness of this late onset go is warranted . a better understanding of the development of euthyroid go can minimize the delay of diagnosis , which is one of the 5-year targets in the amsterdam eugogo declaration .

background . to investigate the influence of previous exposure to elevated thyroid hormones in euthyroid graves ' ophthalmopathy . design . retrospective , observational case series in university setting median follow - up of 1 year with ranges of 0,87,6 years . study performance of 10 years . participants . we reviewed the clinical records of 731 graves ' ophthalmopathy patients . there were 88 ( 12% ) patients with onset of graves ' ophthalmopathy during euthyroidism : 37 ( 5% ) patients had ophthalmopathy without known history of thyroid dysfunction ( group a ) and 51 patients ( 6% ) had onset of ophthalmopathy 6 months or more euthyroid after completion of antithyroid therapy ( group b ) . main outcome measures . graves ' ophthalmopathy was graded using the eugogo severity criteria . unilaterality was investigated . tsh receptor antibody and thyroid peroxidase antibody were measured as markers of graves ' disease . results . group a had more often a normal ocular motility ( 46% ) and less proptosis ( 14 4 mm ) compared to group b ( 22% , 16 4 mm ) ( p = 0.032 and 0.028 , resp . ) . tsh receptor antibody was more frequently elevated in group b ( 94% ) than in group a ( 17% ) ( p < 0.001 ) . conclusion . patients with euthyroid graves ' ophthalmopathy present more often with ocular muscle restriction and proptosis when previously exposed to elevated thyroid hormones .

1. Introduction 2. Methods 3. Results 4. Discussion

nematodes are very diverse , with entomopathogenic nematodes ( epns ) receiving a lot of interest in nematology and entomology studies because of their ability to infect and kill insects . epns reside naturally in the soil and are obligate parasites of a wide variety of insect species . three genera of epns which are able to fulfill the role of vectors for entomopathogenic bacteria have been identified and reported on so far . their ability to infect insects is dependent on their symbiotic association with pathogenic bacteria belonging to the genera photorhabdus , xenorhabdus , and serratia , respectively , , , . the oscheius genus was acknowledged as an independent genus and later supported the recognition of oscheius as an autonomous genus . examples of described oscheius species include oscheius maqbooli , oscheius shamimi , oscheius carlianonsis and oscheius amsactae . not all nematodes belonging to the oscheius genus are entomopathogenic such as o. insectivorus . this may be due to the absence of a symbiotic pathogenic bacteria association , which is the main characteristic of insect - killing nematodes . several insect pathogenic strains or species of serratia bacteria have also developed successful endosymbiotic relationships with some nematodes belonging to the caenorhabditis and oscheius species , . for example , serratia species scbi associated with caenorhabditis briggasae isolated from south africa in the kwazulu - natal province was found to have entomopathogenic potential as it caused mortality of the insect larvae galleria mellonella . in this paper the infective juveniles of this entomopathogenic nematode were collected from freshly prepared white traps and surface sterilised with 0.1% sodium hypochlorite for 3 h in sterile 1.5 ml eppendorf tubes . the nematodes were rinsed 3 times with sterile distilled water under sterile conditions in a laminar flow hood . whole genomic dna was extracted from the sterile nematodes using a protocol adopted from puregene dna purification kit , gentra systems 2003 . 0.5% agarose gel was prepared in order to confirm the quality and integrity of the extracted dna . a polymerase chain reaction was employed to amplify the 18s rdna region using tw81 forward primer 5-gcggatccgtttccgtaggtgaacctgc -3 , tm ( c ) = 71.94 and ab28 reverse primer 5-gcggatccatatgcttaagttcagcgggt -3 , tm ( c ) = 68.87 . the sequence obtained was subjected to ncbi blast under the default settings for highly similar alignments . the analysis revealed that among all the matches for the 18s rdna gene sequences , the unknown sequence differed sufficiently from other submissions and thus the species was registered as a novel entomopathogenic nematode based on the originality of the 18s rdna sequence . a phylogenetic tree was constructed using mega 6 to show the evolutionary relationship of oscheius sp . tel-2014 with selected species from genera oscheius , steinernema and heterorhabditis shown in fig . 1 . genomic dna paired - end libraries were generated with the nextera dna sample preparation kit ( illumina ) and indexed using the nextera index kit ( illumina ) . paired - end ( 2 * 125 bp ) sequencing was performed on a illumina hiseq 2500 using the illumina sbs v4 chemistry at the agricultural research council biotechnology platform . quality control was done using fastqc version 0.11.3 and adapter trimming was performed using trimmomatic version 0.32 . quast version 3.1 was used for the assessment of the assembly and busco version 1.1 was used to assess the completeness of the assembly . the n50 value was 3 019 and the total genome size was 110,599,558 bp , which is on the same size range as caenorhabditis elegans . the genome might contain some amount of novel genes and genomic regions which busco would not have been able to align to the reference sequence of c. elegans . retroelements , long terminal repeats ( ltr elements ) , dna transposons , small rna , satellites and simple repeats were some of the features identified . 49 947 genes were predicted using blastx and augustus version 2.5.5 protein sequences of the predicted genes were subjected to swissprot and ncbi blastp to identify the proteins . these gene prediction and protein identification tools have revealed the presences of protein domains , hypothetical protein and other proteins also found in nematodes . for example , the wd40 repeat domain ( fig . 2 ) was predicted and found on position 5208 ( start ) to 5385 ( end ) . this protein was identified from haemonchus contortus also known as barber pole worm which also belongs to the phylum nematoda , chromadorea , rhabditida . another protein predicted in oscheius sp . topoisomerase ii large subunit originally found in escherichia phage pbeco 4 was predicted to be present i the oscheius nematodes genome . the toprim superfamily also comprises of numerous atp - binding proteins such as histidine kinase , dna gyrase b , topoisomerases , heat shock protein hsp90 , phytochrome - like atpases and dna mismatch repair proteins ( fig . 3 ) . the heat shock protein hsp90 may be hypothesised to be involved in desiccation tolerance of these entomopathogenic nematodes . the genome data described in the present study offers a valuable platform for future studies of oscheius nematodes and possesses momentous importance in the agricultural industries and scientific research . this whole - genome shotgun project has been deposited at ddbj/ embl / genbank under the accession lnbv00000000 . the authors declare that there is no conflict of interest on any work published in this paper .

we present the annotation of the draft genome sequence of oscheius sp . tel-2014 ( genbank accession number km492926 ) . this entomopathogenic nematode was isolated from grassland in suikerbosrand nature reserve near johannesburg in south africa . oscheius sp . strain tel has a genome size of 110,599,558 bp and a gc content of 42.24% . the genome sequence can be accessed at ddbj / embl / genbank under the accession number lnbv00000000 .

Direct link to deposited data Experimental design, materials and methods Nucleotide sequence accession numbers Conflict of interest

infantile hemangiomas represent the most common type of benign tumors of the infancy , with a prevalence estimated at 110% of the infants worldwide . even though the disorder is mostly harmless these tumors develop in the period of infancy , only 20% of them being present at birth , with an increased frequency in the female gender , the white race and in low birth weight infants . some studies reported the disorder in many siblings of the same family , with non - affected parents , pointing out a possible genetic immixture . the hypothesis of pathogenesis supports the idea that hemangiomas develop by cellular hyperplasia and by the proliferation of endothelial cells . important research has shown that angiogenic and vasculogenic factors stimulate their proliferation and these markers influence all the evolutionary phases of hemangiomas . to date , the most used therapeutic agents were represented by corticotherapy , either systemic or topical . their effects on the evolution of hemangioma are beneficial , but the side - effects are significant . since the discovery in 2008 by laute - labreze , propranolol has been used in infantile hemangioma therapies , with good results and few adverse effects , which are of minimal severity . still , there are multiple possibilities of therapeutic approaches that include surgery , radiotherapy , laser therapy , embolization , imiquimod or vincristine , therapies that need to be individualized . infantile hemangiomas remain a current challenge for the medical science , raising constant questions about risk factors , prognostic factors , pathogenesis , evolution and treatment . researchers worldwide presently consider the disorder a pressing issue , and that is why several studies have been conducted in order to elucidate the exact mechanism of developing infantile hemangioma . hypoxia and acidosis are known to create a disturbance of the equilibrium between proangiogenic and antiangiogenic factors . in addition to the proliferation of endothelial cells , intrauterine or perinatal hypoxia and acidosis , both stimulate angiogenesis by increasing the secretion of vegf ( vascular endothelial growth factor ) . alpha ( hypoxia - inducible factor 1 alpha ) induces the gene - transcription of vegf , which is the most powerful angiogenic factor . the injury of placenta is supposed to cause the embolization of endothelial cells and the consecutive overflow of these into the fetal circulation . through the pof ( patent foramen ovale ) the cells the placenta releases angiostatic factors ( sflt1 ) , but after birth these inhibitory factors are wasted , which allows the development of the infantile hemangioma by endothelial cell proliferation . a high number of cd133 + , cd34 + endothelial cells have been detected in the blood of children with proliferative infantile hemangiomas . high levels of 17-beta - estradiol were noted in several studies , simultaneously with high numbers of estradiol receptors at hemangioma tissue - surfaces in their proliferative phase . the injury of placenta is supposed to cause the embolization of endothelial cells and the consecutive overflow of these into the fetal circulation . through the pof ( patent foramen ovale ) the cells the placenta releases angiostatic factors ( sflt1 ) , but after birth these inhibitory factors are wasted , which allows the development of the infantile hemangioma by endothelial cell proliferation . a high number of cd133 + , cd34 + endothelial cells have been detected in the blood of children with proliferative infantile hemangiomas . high levels of 17-beta - estradiol were noted in several studies , simultaneously with high numbers of estradiol receptors at hemangioma tissue - surfaces in their proliferative phase . infantile hemangiomas present as one or more tumors of variable dimensions and aspects , with predilection in the head and neck area . other areas , as well as organs , can be affected . in the majority of cases they are singular , only in 1025% of cases they are multiple tumors . a tight connection between these has been observed , a proportion of 83% cases with multiple hemangiomas are with concurrent visceral involvement . superficial hemangiomas present as round or oval tumors , lobulated or with a fine surface , more often in the head - neck area , 1 to 25 cm in size . deep hemangiomas come as soft , bluish masses , some with superficial telangiectasia , and are the rarest type - 15% . i ) in most of the cases , hemangiomas develop in the first 24 weeks of life , but 20% of them can be present at birth . the lesion is at first a pale - white to blue - grey macula , depending on its profoundness , or a papule with the same characteristics . they grow during a variable period of time until 69 months , after which they involute , following the characteristic evolution . thus 50% regress by the age of 5 years and 90% regress by the age of 9 . the regression is established by the reduction of dimensions , the colour intensity ; the skin comes back to normal , or remains with a residue of telangiectasia , hypopigmentation , scars or fiber - fatty deposits . an airway hemangioma is accompanied by feeding difficulty , stridor , loud breathing and a typical cry , all of them representing signs of airway obstruction . visceral hemangiomas , for example hepatic ones , present with hepatomegaly and an abdominal compartment syndrome . concurrent thyroid damage , often seen in hepatic hemangiomatosis , manifests with the specific symptoms of hypothyroidism , and is a high - mortality risk emergency . usually , with the resolution of the hemangioma hypothyroidism also subsides , but in some cases intravenous substitute thyroid hormones are necessary . anogenital hemangiomas associate with malformations in the area , such as the absence of small or big labia , hemiclitoris or the absence of the anal canal . hemangiomas of the auditory canal lead to obstructive hearing loss and can destroy the helix or the auricular pavilion . systemic complications come with kassabach meritt syndrome , characterized by the association of cutaneous and visceral lesions of variable aspects and dimensions , and with extracutaneous manifestations , such as consumption coagulopathy . consumption coagulopathy is accompanied by thrombocytopenia , hypofibrinogenemia , low d - dimmers and low coagulation factors . phace syndrome ( posterior fossa abnormalities , hemangiomas , arterial lesions , cardiac abnormalities , eye abnormalities ) or lumber syndrome are also disorders seen with infantile hemangiomas and are characterized by the association with several other anomalies in the upper or lower part of the body . most of the infantile hemangiomas lend themselves to the wait - and - see therapy , but some of them need immediate treatment . hemangiomas in the periocular , eyelid , airway or ano - genital area , are at high risk of complications and need an early individualized therapy approach ( see fig . corticotherapy has been used as a first - line therapy for a long time , using its inhibitory effects on angiogenesis . prednisolone is of choice , in a dose of 25mg / kg / day , once a day , for 48 weeks . if no effect is seen in the first 4 weeks , the hemangioma is considered corticoresistant and other options are taken into consideration . an important aspect of steroid therapy is that of adverse reactions , which are frequent and significant . growth retardation , gastro - esophageal reflux , vomiting , behavior disorders , high blood pressure , acne , cushingoid facies , increased appetite which leads to weight gain [ 4 , 24 ] , obstructive hypertrophic cardiomyopathy are some of the adverse effects of steroids . this highlights the importance of follow - up of patients taking this kind of treatment . topical steroids or intralesional steroids can also be used in order to avoid systemic effects , but these can only be used in small hemangiomas and without serious complications . nowadays , the therapeutic options are multiple and can be individualized based on the hemangioma characteristics . since 2008 , therapy with propranolol has been a first - option therapy in most of the situations . several studies have pointed out its use in infantile hemangiomas treatment , even in situations with complications . it may be used in every type of hemangioma , even in big , complicated ones . the usual dose starts with 0.5 mg / kg / day with a possibility to increase the dose up to 2 mg / kg / day . the duration is based on dimensions , location and complications , but on average is of 1 year . as with corticotherapy , if there are no responses in the first 4 weeks , they are considered to be non - responsive to propranolol . however , there are studies suggesting that there might be a slow rhythm of healing and propose a longer period of therapy until declaring a hemangioma non - responsive . severe allergic reactions are rarely seen , and present themselves as lingual edema , dyspnea and angina pectoris . conversely , blood pressure and heart rate variations are considered markers of good response to the treatment . in some cases , used once or twice a day by applying it on the surface of the lesion , it has increased compliance to the treatment . severe life - threatening hemangiomas , corticoresistant ones or kassabach meritt syndrome sometimes need a more aggressive therapy , such as vincristine . this an antineoplastic agent with antiangiogenic actions , that leads to tumoral cell apoptosis . it is administered orally , a dose a week of 0.52mg / m for 15 weeks . adverse reactions consist of peripheral neuropathy , mandibular pain , anemia , leucopenia or constipation and an inadequate secretion of adh . other therapeutic options for small , superficial and uncomplicated hemangiomas are imiquimod , an immune mediator or laser - therapy of different types ( e.g. laser - argon , nd - yag laser , co2 laser , fractionate photothermolisis or dye - pulsed laser . both types can present with disfiguring side effects , such as disfiguring scars , or ulceration . laser therapy can also be used for residual hemangiomas with fibro - fatty tissue remnants . hemangiomas localized periocularly can cause serious damage to vision , disorders like amblyopia , caused by deprivation or astigmatism . the most important advantage is that it leads to nearly the complete resolution of the hemangioma , but entails risks of bleeding . each type of therapy has its indications , contraindications , side effects and risks ; therefore , the treatment of hemangiomas remains a challenge . because the exact mechanisms of action of several therapies remain unknown , the subject is of great interest for researchers . therefore a high number of studies are performed and more are need to be conducted in order to achieve target - therapies .

infantile hemangiomas as frequent infancy tumors have been a controversial issue of medical scientists worldwide . their clinical aspects are various and their physiopathology is yet to be fully understood . numerous publications outline the characteristics , causes , evolution possibilities and therapeutic approaches . deciding whether to treat or not is the main question of this kind of pathology . hemangiomas that have complications or can cause irreversible damage need therapy . this is a brief review of up - to - date information regarding the presentation of infantile hemangiomas and target - therapies .

Introduction Ethiopathogenesis None Placental hypothesis: The vasculogenesis theory: The hormonal theory: Clinical aspects and evolution Treatment

the occurrence of myocardial infarction in newborns has been associated with cardiac malformations and abnormalities of the coronary arteries or thromboembolism . the syndrome of hypoxemia - related myocardial dysfunction in newborns occurs in about 30% of asphyxiated infants and is usually more relevant in preterm infants , due to immature myocardial contractility and respiratory distress syndrome . myocardial ischemia in full term infants with normal heart is an extremely rare and serious event . we report a case of a full term newborn affected by neonatal asphyxia and severe anemia , with normal heart and coronary arteries anatomy , who developed a massive myocardial infarction . after delivery , the baby needed immediate cardiopulmonary resuscitation with intubation , external cardiac massage , ventilatory assistance ( a / c with pip 20 , peep + 5 , ti 350 msec , fr 50/minute , map 9.9 , fio2 0.80 ) , and an immediate blood transfusion for severe anemia ( hb 2.5 g / dl ) . severe metabolic acidosis was present ( ph 6.81 ) , with arterial hypotension ( 41/19 mmhg ) . correction of acidosis and treatment with dopamine , dobutamine , hydrocortisone , and furosemide was started . on ecg there were small q waves in d2 - 3 and marked signs of subendocardial ischemia - lesion with diffused st - t segment elevation ( figure 1c ) . echocardiography ( figure 1b ) showed normal anatomy with the coronary arteries originated from the aorta ; dilated and hypocontratile left ventricle ( lv ) , with hypertrophic walls , mitral regurgitation , dilated right ventricle with tricuspid regurgitation and estimated pulmonary pressure of 35 mmhg , left - to - right shunt at atrial and ductal level , and moderate pericardial effusion . serum enzymes , at 10 hours of life , were : ck = 14.895 u / l , ck - mb = 2.472 rh isoimmunization was excluded and no specific infective agents were found by laboratory tests . despite of the treatment , the clinical conditions of the baby worsened , with appearance of anuria , hepatic insufficiency , massive haemorrhage of the right cerebral hemisphere , and disseminated intravascular coagulation . post - mortem examination ( figure 2 ) showed massive subendocardial infarction of the lv , diffused parenchymal hemorrhages in lungs , kidneys , adrenal glands , and brain ; with histological appearance of myocardial hypertrophy , increase of eosinophilia and polymorphonucleated cells . myocardial ischemia is a rare event in childhood and can occur in the immediate postnatal period , usually due to perinatal asphyxia and respiratory problems . this complication is more frequent in premature infants with severe respiratory distress that present abnormal left ventricular function and abnormal values of ck and ck - mb . previously , a rare case of myocardial necrosis - infarction was reported in a premature infant with asphyxia , and the infant recovered , using the conventional treatment . in full term infants , the etiology of myocardial dysfunction - ischemia is mostly related to asphyxia . another case was reported of a full term infant who presented at 12 days of age with myocardial infarction complicated by late mitral regurgitation and heart failure that improved after mitral valve annuloplasty at 6 months of age . our case suffered apparently from a longstanding anemia of unknown etiology , also due to a lack of routine controls in pregnancy ; this fact induced a compensatory mechanism of myocardial hypertrophy that was observed at echocardiography and at post - mortem examination . the entity of anemia has worsened toward the end of pregnancy ( as evident from the very low value of haemoglobin ) and led to a severe fetal and postnatal distress due to the severe hypoxia . myocardial - subendocardial necrosis was very diffused and the general state was very severe since the moment of birth , and all the therapeutic measures remained inefficacious . neither a hypothetical use of ecmo , reported to be employed in another full term infant who presented however later on , at 9 days of age , could have saved our infant with a more precocious and severe symptomatology . our case regards a very unusual event of a massive myocardial infarction in a full term neonate that occurred on the basis of a longstanding fetal anemia of unknown etiology leading to the perinatal distress with severe hypoxia and multiorgan failure not improvable by the treatment .

a full - term female newborn with neonatal asphyxia and severe anemia ( hb 2.5 g / dl ) with normal heart developed a massive myocardial infarction . no examinations were performed during pregnancy for parental nomadism . the baby had immediate external cardiac massage , ventilatory assistance , and blood transfusion . cardiomegaly was evident at chest x - ray and marked signs of ischemia - lesion at ecg . echocardiography showed dilated , hypertrophic , and hypocontractile left ventricle ( lv ) , mitral and tricuspid regurgitation , and moderate pericardial effusion . rh isoimmunization and infective agents were excluded at laboratory tests . despite the treatment with inotropes , hydrocortisone , and furosemide , the baby worsened and died at 45 hours of life . postmortem examination showed diffuse subendocardial infarction of lv and diffuse parenchymal hemorrhages and myocardial hypertrophy , increase of eosinophilia , and polymorphonucleated cells at histology . our patient suffered apparently from longstanding fetal anemia of unknown etiology that led to perinatal distress , severe hypoxia , and massive myocardial infarction , unresponsive to the therapy .

1. Introduction 2. Case Report 3. Discussion 4. Conclusions

encephalomeningocele is a herniation of the brain and meninges through a congenital bone defect resulting from the failure of normal midline fusion of the cranial neural tube . it is an uncommon clinical entity occurring in less than 1/35,000 persons . in caucasians , more than 70% of the encephalomeningoceles are located on the occipital / posterior part of the brain , however various sites are possible . as congenital disorders , they are usually diagnosed in childhood as a result of midfacial anomaly , optic disc anomaly , brain anomaly , cerebrospinal fluid rhinorrhea , recurrent meningitis , visual and endocrinologic disturbance or mental retardation . in this case we present a 72-year - old female patient complaining of mild cephalgia for the last 4 years localized in the right hemicranium . a magnetic resonance imaging ( mri ) has been performed which showed a suspicious mass on the right skull base . she was introduced to the department of ear , nose , throat ( ent ) and since the mass did not look like a typical mucocele , admission to our department followed . in the medical history she reported a head trauma in the age of 16-year - old which was treated ambulatory and was not severe . in the mri of the brain a multiple septated mass in the right sphenoidal corpus could be identified with migration through the infratemporal area and to the ala major of the sphenoidal bone . the impression was made that there was a communication of the mass with the subarachnoid space . an encephalomeningocele was suspected and an operative treatment with removal of the mass was indicated and offered to the patient ( figure 1 ) . figure 1(a ) the coronal section of the magnetic resonance imaging shows the penetration and the size of the cele ( left ) which is shown more clearly in the sagittal section ( right ) as well as in the magnified image . the arrows show the inferior limit and the asterisk the penetration area through the bone . on the right side ( b ) these intra - operative images show the encephalocele penetrating the scull base . the cele is multi - chambered and after opening , cerebrospinal fluid was contained in it . ( c ) after the cele has been removed abdominal fat was used to fill the area . ( a ) the coronal section of the magnetic resonance imaging shows the penetration and the size of the cele ( left ) which is shown more clearly in the sagittal section ( right ) as well as in the magnified image . the arrows show the inferior limit and the asterisk the penetration area through the bone . on the right side ( b ) these intra - operative images show the encephalocele penetrating the scull base . the cele is multi - chambered and after opening , cerebrospinal fluid was contained in it . ( c ) after the cele has been removed abdominal fat was used to fill the area . immediately after craniectomy a bluish cystic mass was seen under the excessively thinned bone of the sphenoidal wing . in the temporal area dural degeneration with a penetration was identified and arachnoidea was herniated through the lesioned dura which lead to the encephalomeningocele . the bone of the temporal skull base was very thin and the area where the mass protruded was found . liberation of adhered brain tissue from the cele followed and the cele was completely removed . it had contact to it , explaining the hypesthesia the patient suffered from , but was not adherent to it . inspection of the mass identified cerebrospinal fluid ( csf ) , some regions were hemorrhagic and others had solid material . the dura was closed with poly - p - dioxanon pds foil and tissue glue . the space the cele occupied , was filled with abdominal fat ( figure 1 ) . the postoperative mri of the brain showed a complete removal of the histologically proved encephalomeningocele . in this case we present a 72-year - old female patient with a big temporobasal encephalomeningocele that was diagnosed in a routine imaging control because of headaches . the preoperative diagnostic procedures included mri brain scans , thin - sliced ct of the cranial base and mri cisternography and are similar to that described in other studies . a clear communication with the csf space was noticed ; therefore the existence of an encephalomeningocele was suspected . none of the known causes like congenital or infectious were present , therefore the present case is one of an idiopathic and rare encephalomeningocele . most of the celes occur in children and rarely there are cases describing encephalomeningoceles in adults . the majority of encephalomeningoceles are located in the frontobasis and treatment needs a transfacial approach resulting in facial disfigurement . the frontoethmoidal type as an example can be cured through a bifrontal craniotomy and dural plastic for the csf rhinorrhea . in the present case here we present another rare case of encephalomeningocele in an adult which occurred without apparent etiologic cause in an atypical area in the skull and the appropriate treatment method .

in the present case we report about an encephalomeningocele in an adult female . since the cause of this medical entity is a congenital fusion defect of the neural tube of the cranial base , most of the encephaloceles occurs in children leading to facial disfigurement . in the rare cases described in adults , rhinorrhea is usually present . here we present a case of temporobasal encephalomeningocele in a 72-year - old female patient suffering from headaches in the last 45 years . no rhinorrhea or other significant neurological symptoms were noticed . no congenital cause was apparent . after diagnostic steps including brain magnetic resonance imaging ( mri ) , cranial computed tomography ( ct ) and mr cisternography , an encephalomeningocele was diagnosed . through a pterional approach this was completely removed . the only symptom the patient complaint about , headache , was eliminated after surgery .

Introduction Case Report Discussion Conclusions

the phenomenon of population aging has been observed throughout the world and brazil is one of the countries with the fastest rates of aging . in 2025 , brazil will be the 6th country in number of elderly people worldwide . there was a decrease of acute processes that evolve to cure or death and an increase in chronic degenerative non - communicable diseases ( ncds ) , which nowadays are primarily responsible for disability and mortality in our population . elderly has the highest prevalence of comorbidity , disability , and frailty of any age group . because of these characteristics the treatment of older adults with pain is complex and affected by age - related changes in pharmacokinetics and pharmacodynamics . polypharmacy , defined as either the use of multiple medications or the use of unnecessary medications , is common in older people and increases the risk of adverse drug reactions , nonadherence , and increased cost . nowadays most elderly people die after a period of deterioration caused by one or more chronic progressive illnesses and the suffering that characterizes the period before death can be related , at least in part , to the experience of unrelieved symptoms . pain is among the most prevalent of these symptoms and management of chronic nonmalignant and malignant pain prevents disability and improves quality of life in elderly at the end of life . despite this , pain management is reported to be poor in elderly . chronic pain encompasses a complex array of sensory - discriminatory , motivational - affective , and cognitive - evaluative components . because of this complexity , both pharmacologic and nonpharmacologic approaches should be considered to treat pain . given the large number of older persons with pain at the end of life and the few data about this issue , the objective of this article is to review the pharmacologic and nonpharmacologic approaches of the pain treatment in this population . we searched the cochrane library , medline and lilacs from 1990 to 2011 and the references in retrieved manuscripts . the two most commonly used scales for adults are a verbal descriptor scale ( i.e. which word best describes your pain ; none , mild moderate , severe or excruciating ? ) or a numerical scale ( i.e. on a scale from 0 to 10 , where 0 indicates no pain and 10 indicates the worst pain you can imagine , how would you rate your pain ? ) . however , elderly patients often have significant cognitive , motor , visual , or auditory impairments that must be considered when evaluating the presence and intensity of symptoms , and the assessment method should be modified accordingly . some signs and symptoms are suggestive of the presence of pain and can be used to assess non - communicative elderly and patients with cognitive impairment or delirium ( table 1 ) . assessment of pain in the confused non - communicative elderly pain can be alleviated in elderly through the careful use of analgesic drags combined with nonpharmacologic strategies . the nonpharmacological treatment of pain at the end of life has been little explored and yet little used . lack of a scientific support for the use of these resources has hindered their implementation as effective tools for the treatment of pain . however , these non invasive methods can be of great help to patients suffering from pain . the association of nonpharmacologic resources with the pharmacological treatment can help reduce the use of analgesics minimizing the side effects of long term medication . physical therapiesthe role of physiotherapists in palliative care is primarily defined by expert opinion , which is not backed up by good quality evidence . however , an absence of research evidence does not mean that a service or treatment is ineffective , just that we do nt know for certain yet . the maintenance or improvement of the functional component of quality of life and significant improvements in pain are noted in patients who received optimized levels of physiotherapy time and resources.physical therapy techniques used in pain control : massage : touch is probably the oldest method of relieving pain and discomfort . therapeutic massage using stroking and gentle kneading may be used to reduce muscle spasm , relieve pain , aid relaxation , and maintenance of joint range.cold/heat : where local skin sensation is normal and tissue is intact , local applications of heat and ice may be used to reduce spasm , for acute inflammatory conditions , and over myofascial trigger points.electrophysical modalities : transcutaneous electrical nerve stimulation ( tens ) is the only electrical modality currently recommended for use in the presence of active neoplastic disease . therapeutic ultrasound , interferential or pulsed shortwave diathermy relieves pain and muscle spasm and may be used over normal tissue and for non - cancer patients.exercise : systematic reviews of observational and randomized controlled clinical trials conclude that there is strong evidence that participation in regular physical activity reduces the pain and enhances the functional capacity of older adults with persistent pain . because persistent pain is commonly associated with prolonged physical inactivity , these effects may be partly due to the reversal of the physiologic consequences of reconditioning . psychological therapiesformal cognitive - behavioral therapies are helpful for many older adults with persistent pain . oriented therapy may provide patients and families with the support , knowledge , and skills they need to cope with cancer treatment , pain , and death . patients and families learn to utilize their preexisting coping abilities and to develop new ones for difficult situations , including uncontrolled pain[1315 ] . delirium and cognitive impairment are obstacles to psychotherapy.complementary and alternative therapiesunrelieved persistent pain commonly causes patients to seek relief with alternative medicine , including homeopathy , acupuncture , healing touch , and music therapy . although there is little scientific evidence for the efficacy of most of these strategies for controlling persistent pain , it is important that clinicians not leave patients with a sense of hopelessness as a result of their efforts to discourage unapproved but benign therapies or to debunk healthcare quackery and fraud . the effectiveness of homeopathy as a symptomatic treatment for acute and chronic pain remains unproven . recent neuroscience research suggested that acupuncture induces clinical responses though the modulation of the nervous system . a cochrane 's review concluded that touch therapies may have a modest effect in pain relief and more studies on healing touch and reiki in relieving pain are needed . another cochrane 's review showed that listening to music reduces pain intensity levels and opioid requirements , but the magnitude of these benefits is small and , therefore , its clinical importance unclear . table 2 shows the national center for complementary and alternative medicine ( nccam ) classification of available complementary and alternative medicine ( cam ) . the role of physiotherapists in palliative care is primarily defined by expert opinion , which is not backed up by good quality evidence . however , an absence of research evidence does not mean that a service or treatment is ineffective , just that we do nt know for certain yet . the maintenance or improvement of the functional component of quality of life and significant improvements in pain are noted in patients who received optimized levels of physiotherapy time and resources . physical therapy techniques used in pain control : massage : touch is probably the oldest method of relieving pain and discomfort . therapeutic massage using stroking and gentle kneading may be used to reduce muscle spasm , relieve pain , aid relaxation , and maintenance of joint range.cold/heat : where local skin sensation is normal and tissue is intact , local applications of heat and ice may be used to reduce spasm , for acute inflammatory conditions , and over myofascial trigger points.electrophysical modalities : transcutaneous electrical nerve stimulation ( tens ) is the only electrical modality currently recommended for use in the presence of active neoplastic disease . therapeutic ultrasound , interferential or pulsed shortwave diathermy relieves pain and muscle spasm and may be used over normal tissue and for non - cancer patients.exercise : systematic reviews of observational and randomized controlled clinical trials conclude that there is strong evidence that participation in regular physical activity reduces the pain and enhances the functional capacity of older adults with persistent pain . because persistent pain is commonly associated with prolonged physical inactivity , these effects may be partly due to the reversal of the physiologic consequences of reconditioning . therapeutic massage using stroking and gentle kneading may be used to reduce muscle spasm , relieve pain , aid relaxation , and maintenance of joint range . cold / heat : where local skin sensation is normal and tissue is intact , local applications of heat and ice may be used to reduce spasm , for acute inflammatory conditions , and over myofascial trigger points . electrophysical modalities : transcutaneous electrical nerve stimulation ( tens ) is the only electrical modality currently recommended for use in the presence of active neoplastic disease . therapeutic ultrasound , interferential or pulsed shortwave diathermy relieves pain and muscle spasm and may be used over normal tissue and for non - cancer patients . exercise : systematic reviews of observational and randomized controlled clinical trials conclude that there is strong evidence that participation in regular physical activity reduces the pain and enhances the functional capacity of older adults with persistent pain . because persistent pain is commonly associated with prolonged physical inactivity , these effects may be partly due to the reversal of the physiologic consequences of reconditioning . psychological therapies formal cognitive - behavioral therapies are helpful for many older adults with persistent pain . oriented therapy may provide patients and families with the support , knowledge , and skills they need to cope with cancer treatment , pain , and death . patients and families learn to utilize their preexisting coping abilities and to develop new ones for difficult situations , including uncontrolled pain[1315 ] . complementary and alternative therapies unrelieved persistent pain commonly causes patients to seek relief with alternative medicine , including homeopathy , acupuncture , healing touch , and music therapy . although there is little scientific evidence for the efficacy of most of these strategies for controlling persistent pain , it is important that clinicians not leave patients with a sense of hopelessness as a result of their efforts to discourage unapproved but benign therapies or to debunk healthcare quackery and fraud . the effectiveness of homeopathy as a symptomatic treatment for acute and chronic pain remains unproven . recent neuroscience research suggested that acupuncture induces clinical responses though the modulation of the nervous system . a cochrane 's review concluded that touch therapies may have a modest effect in pain relief and more studies on healing touch and reiki in relieving pain are needed . another cochrane 's review showed that listening to music reduces pain intensity levels and opioid requirements , but the magnitude of these benefits is small and , therefore , its clinical importance unclear . table 2 shows the national center for complementary and alternative medicine ( nccam ) classification of available complementary and alternative medicine ( cam ) . the two most commonly used scales for adults are a verbal descriptor scale ( i.e. which word best describes your pain ; none , mild moderate , severe or excruciating ? ) or a numerical scale ( i.e. on a scale from 0 to 10 , where 0 indicates no pain and 10 indicates the worst pain you can imagine , how would you rate your pain ? ) . however , elderly patients often have significant cognitive , motor , visual , or auditory impairments that must be considered when evaluating the presence and intensity of symptoms , and the assessment method should be modified accordingly . some signs and symptoms are suggestive of the presence of pain and can be used to assess non - communicative elderly and patients with cognitive impairment or delirium ( table 1 ) . assessment of pain in the confused non - communicative elderly pain can be alleviated in elderly through the careful use of analgesic drags combined with nonpharmacologic strategies . the nonpharmacological treatment of pain at the end of life has been little explored and yet little used . lack of a scientific support for the use of these resources has hindered their implementation as effective tools for the treatment of pain . however , these non invasive methods can be of great help to patients suffering from pain . the association of nonpharmacologic resources with the pharmacological treatment can help reduce the use of analgesics minimizing the side effects of long term medication . physical therapiesthe role of physiotherapists in palliative care is primarily defined by expert opinion , which is not backed up by good quality evidence . however , an absence of research evidence does not mean that a service or treatment is ineffective , just that we do nt know for certain yet . the maintenance or improvement of the functional component of quality of life and significant improvements in pain are noted in patients who received optimized levels of physiotherapy time and resources.physical therapy techniques used in pain control : massage : touch is probably the oldest method of relieving pain and discomfort . therapeutic massage using stroking and gentle kneading may be used to reduce muscle spasm , relieve pain , aid relaxation , and maintenance of joint range.cold/heat : where local skin sensation is normal and tissue is intact , local applications of heat and ice may be used to reduce spasm , for acute inflammatory conditions , and over myofascial trigger points.electrophysical modalities : transcutaneous electrical nerve stimulation ( tens ) is the only electrical modality currently recommended for use in the presence of active neoplastic disease . therapeutic ultrasound , interferential or pulsed shortwave diathermy relieves pain and muscle spasm and may be used over normal tissue and for non - cancer patients.exercise : systematic reviews of observational and randomized controlled clinical trials conclude that there is strong evidence that participation in regular physical activity reduces the pain and enhances the functional capacity of older adults with persistent pain . because persistent pain is commonly associated with prolonged physical inactivity , these effects may be partly due to the reversal of the physiologic consequences of reconditioning . psychological therapiesformal cognitive - behavioral therapies are helpful for many older adults with persistent pain . oriented therapy may provide patients and families with the support , knowledge , and skills they need to cope with cancer treatment , pain , and death . patients and families learn to utilize their preexisting coping abilities and to develop new ones for difficult situations , including uncontrolled pain[1315 ] . delirium and cognitive impairment are obstacles to psychotherapy.complementary and alternative therapiesunrelieved persistent pain commonly causes patients to seek relief with alternative medicine , including homeopathy , acupuncture , healing touch , and music therapy . although there is little scientific evidence for the efficacy of most of these strategies for controlling persistent pain , it is important that clinicians not leave patients with a sense of hopelessness as a result of their efforts to discourage unapproved but benign therapies or to debunk healthcare quackery and fraud . the effectiveness of homeopathy as a symptomatic treatment for acute and chronic pain remains unproven . recent neuroscience research suggested that acupuncture induces clinical responses though the modulation of the nervous system . a cochrane 's review concluded that touch therapies may have a modest effect in pain relief and more studies on healing touch and reiki in relieving pain are needed . another cochrane 's review showed that listening to music reduces pain intensity levels and opioid requirements , but the magnitude of these benefits is small and , therefore , its clinical importance unclear . table 2 shows the national center for complementary and alternative medicine ( nccam ) classification of available complementary and alternative medicine ( cam ) . the role of physiotherapists in palliative care is primarily defined by expert opinion , which is not backed up by good quality evidence . however , an absence of research evidence does not mean that a service or treatment is ineffective , just that we do nt know for certain yet . the maintenance or improvement of the functional component of quality of life and significant improvements in pain are noted in patients who received optimized levels of physiotherapy time and resources . physical therapy techniques used in pain control : massage : touch is probably the oldest method of relieving pain and discomfort . therapeutic massage using stroking and gentle kneading may be used to reduce muscle spasm , relieve pain , aid relaxation , and maintenance of joint range.cold/heat : where local skin sensation is normal and tissue is intact , local applications of heat and ice may be used to reduce spasm , for acute inflammatory conditions , and over myofascial trigger points.electrophysical modalities : transcutaneous electrical nerve stimulation ( tens ) is the only electrical modality currently recommended for use in the presence of active neoplastic disease . therapeutic ultrasound , interferential or pulsed shortwave diathermy relieves pain and muscle spasm and may be used over normal tissue and for non - cancer patients.exercise : systematic reviews of observational and randomized controlled clinical trials conclude that there is strong evidence that participation in regular physical activity reduces the pain and enhances the functional capacity of older adults with persistent pain . because persistent pain is commonly associated with prolonged physical inactivity , these effects may be partly due to the reversal of the physiologic consequences of reconditioning . therapeutic massage using stroking and gentle kneading may be used to reduce muscle spasm , relieve pain , aid relaxation , and maintenance of joint range . cold / heat : where local skin sensation is normal and tissue is intact , local applications of heat and ice may be used to reduce spasm , for acute inflammatory conditions , and over myofascial trigger points . electrophysical modalities : transcutaneous electrical nerve stimulation ( tens ) is the only electrical modality currently recommended for use in the presence of active neoplastic disease . therapeutic ultrasound , interferential or pulsed shortwave diathermy relieves pain and muscle spasm and may be used over normal tissue and for non - cancer patients . exercise : systematic reviews of observational and randomized controlled clinical trials conclude that there is strong evidence that participation in regular physical activity reduces the pain and enhances the functional capacity of older adults with persistent pain . because persistent pain is commonly associated with prolonged physical inactivity , these effects may be partly due to the reversal of the physiologic consequences of reconditioning . psychological therapies formal cognitive - behavioral therapies are helpful for many older adults with persistent pain . oriented therapy may provide patients and families with the support , knowledge , and skills they need to cope with cancer treatment , pain , and death . patients and families learn to utilize their preexisting coping abilities and to develop new ones for difficult situations , including uncontrolled pain[1315 ] . complementary and alternative therapies unrelieved persistent pain commonly causes patients to seek relief with alternative medicine , including homeopathy , acupuncture , healing touch , and music therapy . although there is little scientific evidence for the efficacy of most of these strategies for controlling persistent pain , it is important that clinicians not leave patients with a sense of hopelessness as a result of their efforts to discourage unapproved but benign therapies or to debunk healthcare quackery and fraud . the effectiveness of homeopathy as a symptomatic treatment for acute and chronic pain remains unproven . recent neuroscience research suggested that acupuncture induces clinical responses though the modulation of the nervous system . a cochrane 's review concluded that touch therapies may have a modest effect in pain relief and more studies on healing touch and reiki in relieving pain are needed . another cochrane 's review showed that listening to music reduces pain intensity levels and opioid requirements , but the magnitude of these benefits is small and , therefore , its clinical importance unclear . table 2 shows the national center for complementary and alternative medicine ( nccam ) classification of available complementary and alternative medicine ( cam ) . the two most commonly used scales for adults are a verbal descriptor scale ( i.e. which word best describes your pain ; none , mild moderate , severe or excruciating ? ) or a numerical scale ( i.e. on a scale from 0 to 10 , where 0 indicates no pain and 10 indicates the worst pain you can imagine , how would you rate your pain ? ) . however , elderly patients often have significant cognitive , motor , visual , or auditory impairments that must be considered when evaluating the presence and intensity of symptoms , and the assessment method should be modified accordingly . some signs and symptoms are suggestive of the presence of pain and can be used to assess non - communicative elderly and patients with cognitive impairment or delirium ( table 1 ) . pain can be alleviated in elderly through the careful use of analgesic drags combined with nonpharmacologic strategies . the nonpharmacological treatment of pain at the end of life has been little explored and yet little used . lack of a scientific support for the use of these resources has hindered their implementation as effective tools for the treatment of pain . however , these non invasive methods can be of great help to patients suffering from pain . the association of nonpharmacologic resources with the pharmacological treatment can help reduce the use of analgesics minimizing the side effects of long term medication . physical therapiesthe role of physiotherapists in palliative care is primarily defined by expert opinion , which is not backed up by good quality evidence . however , an absence of research evidence does not mean that a service or treatment is ineffective , just that we do nt know for certain yet . the maintenance or improvement of the functional component of quality of life and significant improvements in pain are noted in patients who received optimized levels of physiotherapy time and resources.physical therapy techniques used in pain control : massage : touch is probably the oldest method of relieving pain and discomfort . therapeutic massage using stroking and gentle kneading may be used to reduce muscle spasm , relieve pain , aid relaxation , and maintenance of joint range.cold/heat : where local skin sensation is normal and tissue is intact , local applications of heat and ice may be used to reduce spasm , for acute inflammatory conditions , and over myofascial trigger points.electrophysical modalities : transcutaneous electrical nerve stimulation ( tens ) is the only electrical modality currently recommended for use in the presence of active neoplastic disease . therapeutic ultrasound , interferential or pulsed shortwave diathermy relieves pain and muscle spasm and may be used over normal tissue and for non - cancer patients.exercise : systematic reviews of observational and randomized controlled clinical trials conclude that there is strong evidence that participation in regular physical activity reduces the pain and enhances the functional capacity of older adults with persistent pain . because persistent pain is commonly associated with prolonged physical inactivity , these effects may be partly due to the reversal of the physiologic consequences of reconditioning . psychological therapiesformal cognitive - behavioral therapies are helpful for many older adults with persistent pain . oriented therapy may provide patients and families with the support , knowledge , and skills they need to cope with cancer treatment , pain , and death . patients and families learn to utilize their preexisting coping abilities and to develop new ones for difficult situations , including uncontrolled pain[1315 ] . delirium and cognitive impairment are obstacles to psychotherapy.complementary and alternative therapiesunrelieved persistent pain commonly causes patients to seek relief with alternative medicine , including homeopathy , acupuncture , healing touch , and music therapy . although there is little scientific evidence for the efficacy of most of these strategies for controlling persistent pain , it is important that clinicians not leave patients with a sense of hopelessness as a result of their efforts to discourage unapproved but benign therapies or to debunk healthcare quackery and fraud . the effectiveness of homeopathy as a symptomatic treatment for acute and chronic pain remains unproven . recent neuroscience research suggested that acupuncture induces clinical responses though the modulation of the nervous system . a cochrane 's review concluded that touch therapies may have a modest effect in pain relief and more studies on healing touch and reiki in relieving pain are needed . another cochrane 's review showed that listening to music reduces pain intensity levels and opioid requirements , but the magnitude of these benefits is small and , therefore , its clinical importance unclear . table 2 shows the national center for complementary and alternative medicine ( nccam ) classification of available complementary and alternative medicine ( cam ) . the role of physiotherapists in palliative care is primarily defined by expert opinion , which is not backed up by good quality evidence . however , an absence of research evidence does not mean that a service or treatment is ineffective , just that we do nt know for certain yet . the maintenance or improvement of the functional component of quality of life and significant improvements in pain are noted in patients who received optimized levels of physiotherapy time and resources . physical therapy techniques used in pain control : massage : touch is probably the oldest method of relieving pain and discomfort . therapeutic massage using stroking and gentle kneading may be used to reduce muscle spasm , relieve pain , aid relaxation , and maintenance of joint range.cold/heat : where local skin sensation is normal and tissue is intact , local applications of heat and ice may be used to reduce spasm , for acute inflammatory conditions , and over myofascial trigger points.electrophysical modalities : transcutaneous electrical nerve stimulation ( tens ) is the only electrical modality currently recommended for use in the presence of active neoplastic disease . therapeutic ultrasound , interferential or pulsed shortwave diathermy relieves pain and muscle spasm and may be used over normal tissue and for non - cancer patients.exercise : systematic reviews of observational and randomized controlled clinical trials conclude that there is strong evidence that participation in regular physical activity reduces the pain and enhances the functional capacity of older adults with persistent pain . because persistent pain is commonly associated with prolonged physical inactivity , these effects may be partly due to the reversal of the physiologic consequences of reconditioning . therapeutic massage using stroking and gentle kneading may be used to reduce muscle spasm , relieve pain , aid relaxation , and maintenance of joint range . cold / heat : where local skin sensation is normal and tissue is intact , local applications of heat and ice may be used to reduce spasm , for acute inflammatory conditions , and over myofascial trigger points . electrophysical modalities : transcutaneous electrical nerve stimulation ( tens ) is the only electrical modality currently recommended for use in the presence of active neoplastic disease . therapeutic ultrasound , interferential or pulsed shortwave diathermy relieves pain and muscle spasm and may be used over normal tissue and for non - cancer patients . exercise : systematic reviews of observational and randomized controlled clinical trials conclude that there is strong evidence that participation in regular physical activity reduces the pain and enhances the functional capacity of older adults with persistent pain . because persistent pain is commonly associated with prolonged physical inactivity , these effects may be partly due to the reversal of the physiologic consequences of reconditioning . psychological therapies formal cognitive - behavioral therapies are helpful for many older adults with persistent pain . oriented therapy may provide patients and families with the support , knowledge , and skills they need to cope with cancer treatment , pain , and death . patients and families learn to utilize their preexisting coping abilities and to develop new ones for difficult situations , including uncontrolled pain[1315 ] . complementary and alternative therapies unrelieved persistent pain commonly causes patients to seek relief with alternative medicine , including homeopathy , acupuncture , healing touch , and music therapy . although there is little scientific evidence for the efficacy of most of these strategies for controlling persistent pain , it is important that clinicians not leave patients with a sense of hopelessness as a result of their efforts to discourage unapproved but benign therapies or to debunk healthcare quackery and fraud . the effectiveness of homeopathy as a symptomatic treatment for acute and chronic pain remains unproven . recent neuroscience research suggested that acupuncture induces clinical responses though the modulation of the nervous system . a cochrane 's review concluded that touch therapies may have a modest effect in pain relief and more studies on healing touch and reiki in relieving pain are needed . another cochrane 's review showed that listening to music reduces pain intensity levels and opioid requirements , but the magnitude of these benefits is small and , therefore , its clinical importance unclear . table 2 shows the national center for complementary and alternative medicine ( nccam ) classification of available complementary and alternative medicine ( cam ) . inferences about the type and mechanisms that may be responsible for the pain are helpful in the evaluation and the management of pain syndromes . a)nociceptive pain : may be visceral or somatic and is most often derived from the stimulation of pain receptors . nociceptive pain may arise from tissue inflammation , mechanical deformation , ongoing injury or destruction . nociceptive mechanisms usually respond well to traditional approaches to pain management , including common analgesic medications and nonpharmacologic strategies.b)neuropathic pain : results from a pathophysiologic process that involves the peripheral or central nervous system . examples include diabetic neuropathy , trigeminal neuralgia , post - herpetic neuralgia , poststroke central or thalamic pain , and postamputation phantom limb pain . these pain syndromes do not respond as predictably as do nociceptive pain to conventional analgesic therapy . however , they have been noted to respond to unconventional analgesic drugs , such as tricyclic antidepressants , anticonvulsants , or antiarrhythmic drugs . nociceptive pain : may be visceral or somatic and is most often derived from the stimulation of pain receptors . nociceptive pain may arise from tissue inflammation , mechanical deformation , ongoing injury or destruction . nociceptive mechanisms usually respond well to traditional approaches to pain management , including common analgesic medications and nonpharmacologic strategies . neuropathic pain : results from a pathophysiologic process that involves the peripheral or central nervous system . examples include diabetic neuropathy , trigeminal neuralgia , post - herpetic neuralgia , poststroke central or thalamic pain , and postamputation phantom limb pain . these pain syndromes do not respond as predictably as do nociceptive pain to conventional analgesic therapy . however , they have been noted to respond to unconventional analgesic drugs , such as tricyclic antidepressants , anticonvulsants , or antiarrhythmic drugs . the use of analgesics for the treatment of acute pain is the same as for non - palliative care patients . according to world health organization treatment is escalated in an orderly manner from non - opioid to weak opioid to strong opioid - analgesic ladder(tables 3 and 4 ) . world health organization ( who ) analgesic ladder adjuvant drugs . adapted from doyle d , 2008 the only international guidelines that are available are from the american geriatric society , the most recent being from 2002 which made a number of important recommendations ( table 5 ) . however , the approach may require modification because of comorbidities or physiologic changes associated with aging . polypharmacy , defined as either the use of multiple medications or the use of unnecessary medications , is common in older people and increases the risk of adverse drug reactions , nonadherence , and increased cost . several drugs used to treat pain , such as opioids , tricyclic antidepressants , gabapentin , and pregabalin , are among those associated with sedation , dizziness , and falls , particularly in frail or vulnerable elderly patients . drug absorption is generally unchanged , but studies of drug distribution reveal increased plasma concentration of water - soluble drugs and increased half - life of fat - soluble drugs in older adults . for all opioids half - life of the active drug and metabolites is increased in the elderly . it is , therefore , recommended that doses be reduced , a longer time interval be used between doses , and creatinine clearance be monitored . age - related changes in hepatic metabolism and renal excretion ( adapted from schmader et al ) a)non - opwids : the non - opioid analgesics include acetylsalicylic acid ( asa ) , other nsaids , and acetaminophen . 1)nsaids : the gastrointestinal harm induced by nsaids may be the most prevalent adverse event associated with this drug . gastrointestinal adverse events are more likely to occur with long - term use and with higher doses of the nsaid . advanced age is a risk factor for gastrointestinal complications and a proton pump inhibitor or misoprostol should be used during the treatment with the nsaids . the use of cox-2 inhibitors may reduce the risk for gastrointestinal events ; however , this benefit is negated if the patient is using aspirin , even at low doses . the patient populations most likely to be prescribed nsaids for pain relief are often the same populations with cardiovascular risk factors and it does not appear that the toxic effects can be avoided by restricting their use to short durations . selection of therapy must weigh cardiovascular risk as well as benefit , other risks of therapy , and costs . the cardiovascular risks first appeared to be a class effect of the cox-2 ( cycloxygenase-2 ) inhibitors . naproxen and ibuprofen appear to be the safest with respect to cardiovascular risk , when specifically measuring cardiovascular events and mortality . naproxen appears to convey a statistically significant protective outcome in terms of cardiovascular events however for those with cardiovascular disease or risk factors for ischemic heart disease the american heart association recommends acetaminophen , aspirin , tramadol , and opioid analgesics as firstline therapy . although the rate of nsaid - induced nephrotoxicity has been estimated to be low ( 1 - 5% ) the nsaids , including cox-2 inhibitors , must be used cautiously or not at all in patients with predisposing renal conditions . it is important to monitor blood pressure , weight , and serum creatinine and potassium concentrations when appropriate , use the lowest dose possible , and consider limiting dietary salt intake.2)acetaminophen : the adverse effects are liver and renal toxicity and caution is necessary in patients with liver damage . both tramadol and codeine require dose adjustment for renal impairment.c)strong opioids : all opioids are considered effective in cancer and non - cancer pain management , but no well designed specific studies in the elderly patient are available . higher opioid doses are often needed for neuropathic pain than for nociceptive pain . with all opioids , the adverse reactions and events can be limited by using lower starting doses , longer dose intervals , and slow titration ; however , constipation , nausea , and vomiting often require prophylaxis or therapy . other common adverse reactions with opioids use include sedation , impaired judgment , impaired psychomotor function and respiratory depression.d)adjuvant drugs : the adjuvant drugs ( table 4 ) may be necessary for one of three reasons : to treat the adverse effects of analgesics ( e.g. antiemetics and laxatives);to enhance pain relief ( e.g. a corticosteroid in nerve compression pain and a anticonvulsant in neuropathic pain);to treat concomitant psychological disturbances such as insomnia , anxiety and depression ( e.g. night sedatives , anxiolytics , antidepressants ) . non - opwids : the non - opioid analgesics include acetylsalicylic acid ( asa ) , other nsaids , and acetaminophen . 1)nsaids : the gastrointestinal harm induced by nsaids may be the most prevalent adverse event associated with this drug . gastrointestinal adverse events are more likely to occur with long - term use and with higher doses of the nsaid . advanced age is a risk factor for gastrointestinal complications and a proton pump inhibitor or misoprostol should be used during the treatment with the nsaids . the use of cox-2 inhibitors may reduce the risk for gastrointestinal events ; however , this benefit is negated if the patient is using aspirin , even at low doses . the patient populations most likely to be prescribed nsaids for pain relief are often the same populations with cardiovascular risk factors and it does not appear that the toxic effects can be avoided by restricting their use to short durations . selection of therapy must weigh cardiovascular risk as well as benefit , other risks of therapy , and costs . the cardiovascular risks first appeared to be a class effect of the cox-2 ( cycloxygenase-2 ) inhibitors . naproxen and ibuprofen appear to be the safest with respect to cardiovascular risk , when specifically measuring cardiovascular events and mortality . naproxen appears to convey a statistically significant protective outcome in terms of cardiovascular events however for those with cardiovascular disease or risk factors for ischemic heart disease the american heart association recommends acetaminophen , aspirin , tramadol , and opioid analgesics as firstline therapy . although the rate of nsaid - induced nephrotoxicity has been estimated to be low ( 1 - 5% ) the nsaids , including cox-2 inhibitors , must be used cautiously or not at all in patients with predisposing renal conditions . it is important to monitor blood pressure , weight , and serum creatinine and potassium concentrations when appropriate , use the lowest dose possible , and consider limiting dietary salt intake.2)acetaminophen : the adverse effects are liver and renal toxicity and caution is necessary in patients with liver damage . nsaids : the gastrointestinal harm induced by nsaids may be the most prevalent adverse event associated with this drug . gastrointestinal adverse events are more likely to occur with long - term use and with higher doses of the nsaid . advanced age is a risk factor for gastrointestinal complications and a proton pump inhibitor or misoprostol should be used during the treatment with the nsaids . the use of cox-2 inhibitors may reduce the risk for gastrointestinal events ; however , this benefit is negated if the patient is using aspirin , even at low doses . the patient populations most likely to be prescribed nsaids for pain relief are often the same populations with cardiovascular risk factors and it does not appear that the toxic effects can be avoided by restricting their use to short durations . selection of therapy must weigh cardiovascular risk as well as benefit , other risks of therapy , and costs . the cardiovascular risks first appeared to be a class effect of the cox-2 ( cycloxygenase-2 ) inhibitors . naproxen and ibuprofen appear to be the safest with respect to cardiovascular risk , when specifically measuring cardiovascular events and mortality . naproxen appears to convey a statistically significant protective outcome in terms of cardiovascular events however for those with cardiovascular disease or risk factors for ischemic heart disease the american heart association recommends acetaminophen , aspirin , tramadol , and opioid analgesics as firstline therapy . although the rate of nsaid - induced nephrotoxicity has been estimated to be low ( 1 - 5% ) the nsaids , including cox-2 inhibitors , must be used cautiously or not at all in patients with predisposing renal conditions . it is important to monitor blood pressure , weight , and serum creatinine and potassium concentrations when appropriate , use the lowest dose possible , and consider limiting dietary salt intake . acetaminophen : the adverse effects are liver and renal toxicity and caution is necessary in patients with liver damage . strong opioids : all opioids are considered effective in cancer and non - cancer pain management , but no well designed specific studies in the elderly patient are available . higher opioid doses are often needed for neuropathic pain than for nociceptive pain . with all opioids , the adverse reactions and events can be limited by using lower starting doses , longer dose intervals , and slow titration ; however , constipation , nausea , and vomiting often require prophylaxis or therapy . other common adverse reactions with opioids use include sedation , impaired judgment , impaired psychomotor function and respiratory depression . adjuvant drugs : the adjuvant drugs ( table 4 ) may be necessary for one of three reasons : to treat the adverse effects of analgesics ( e.g. antiemetics and laxatives);to enhance pain relief ( e.g. a corticosteroid in nerve compression pain and a anticonvulsant in neuropathic pain);to treat concomitant psychological disturbances such as insomnia , anxiety and depression ( e.g. night sedatives , anxiolytics , antidepressants ) . to treat the adverse effects of analgesics ( e.g. antiemetics and laxatives ) ; to enhance pain relief ( e.g. a corticosteroid in nerve compression pain and a anticonvulsant in neuropathic pain ) ; to treat concomitant psychological disturbances such as insomnia , anxiety and depression ( e.g. night sedatives , anxiolytics , antidepressants ) . elderly is a population at risk for developing side effects of drugs acting on central nervous system . dizziness , somnolence or sedation , and peripheral edema are reported common side effects of anticonvulsants . dry mouth and somnolence or sedation are reported side effects of tricyclic antidepressants and benzodiazepines . the exclusion of older adults with comorbidities and the underrepresentation of the old old ( people > 80 years ) are phenomena seen in clinical trials of medications for neuropathic pain . table 7 shows drug classes , examples and adverse reactions of the pharmacological treatment of the neuropathic pain . when other treatments fail to relieve suffering in the imminently dying patient , pst may be a valid palliative care option . pst is defined as the use of specific sedative medications to relieve intolerable suffering from refractory symptoms by a reduction in patient consciousness , using appropriate drugs carefully titrated to the cessation of symptoms . the initial dose of sedatives should usually be small enough to maintain the patients ability to communicate periodically . in the case of continuous and deep pst , the disease should be irreversible and advanced , with death expected within hours to days . both pharmacologic and nonpharmacologic approaches should be considered to treat pain in elderly at the end of life . it is difficult to make specific recommendations about the long - term use of complementary and alternative therapies but it is important that clinicians not leave patients with a sense of hopelessness as a result of their efforts to discourage unapproved but benign therapies . the sequential use of analgesics drugs according the who ladder is a relatively inexpensive yet effective method for relieving pain . all opioids are considered effective and are used in cancer and non - cancer pain management , but no well designed specific studies in the elderly patient are available . to relieve suffering in the imminently dying patient palliative sedation may be a valid palliative care option .

background : the treatment of older adults with pain is complex and affected by age - related changes in pharmacokinetics and pharmacodynamics . chronic pain encompasses a complex array of sensory - discriminatory , motivational - affective , and cognitive - evaluative components . because of this complexity , both pharmacologic and nonpharmacologic approaches should be considered to treat pain.aims:given the large number of older persons with pain at the end of life and the few data about this issue , the objective of this article is to review the treatment of pain in this population.patients and methods : we searched the cochrane library , medline and lilacs from 1990 to 2011 and the references in retrieved manuscripts . the search terms were pain and elderly and end of life.results:there are evidences of undertreatment among elderly people . the association of nonpharmacologic resources with the pharmacological treatment can help reduce the use of analgesics minimizing the side effects of long term medication . pharmacological treatment is escalated in an orderly manner from non - opioid to weak opioid to strong opioid . adjuvant drugs like anticonvulsants and antidepressants may be necessary.conclusions:the sequential use of analgesics drugs and opioids are considered effective and relatively inexpensive for relieving pain , but no well designed specific studies in the elderly patient are available . there are not specific recommendations about the long - term use of complementary and alternative therapies and although their effectiveness remains unproven they should not be discouraged . palliative sedation may be a valid palliative care option to relieve suffering in the imminently dying patient .

Introduction Methods None Pain assessment in the elderly Nonpharmacologic therapy of pain Pharmacologic therapy of pain Nociceptive pain Elderly's particularities and cautions Neuropathic pain Palliative sedation Conclusions

for the past 35 years , hybridoma technology has enhanced our capacity for research and diagnostics by providing monoclonal antibody reagents allowing tracking , detection and quantitation of target molecules in cells and serum . recently , a number of more advanced methods to harness the immune response have also been developed1,2,3 that significantly increase the number of antibody producing cells that can be screened . alongside these traditional method of making monoclonal antibodies , a quiet revolution has been brewing in the generation of antibodies using in vitro display technologies , which offer a number of advantages , including a greater degree of control over the nature of the derived antibodies . the success of these technologies has relied upon many previous advances , including the conception and implementation of phage display4,5 , the expression of antibody fragments in bacteria6 and pcr - mediated amplification of antibody genes and libraries7,8,9,10,11 . the most popular technologies , antibody phage8,12,13 and yeast display14,15 , which are complementary in their properties , can be used with nave , immunized or synthetic repertoires . as a direct consequence of genome sequencing , and the advent of high throughput biology , the demand for large numbers of renewable high quality affinity reagents , recognizing ever - greater numbers of proteins , for affinity reagent based proteomic scale experiments , furthermore , it is generally accepted that , irrespective of the source , there is an urgent need to improve antibody quality , as reflected by a raft of recent papers16,17,18,19,20,21,22 showing an alarmingly high proportion of commercial antibodies demonstrating poor specificity , or even failing to recognize their targets at all . given that much of modern biological research relies on the fidelity of commercially supplied antibodies , there is an urgent need to resolve this problem . the high throughput potential of in vitro technologies make them ideal platforms for large scale projects to derive antibodies for all human proteins , which once completed are likely to have impacts perhaps as great as the completion of the human genome . by carefully controlling selection and screening conditions , display technologies allow the generation of antibodies to defined antigen conformations or epitopes , for example , by the presentation of specific antigen conformations , or the inclusion of competitors to direct selection towards specific targets or epitopes ( figure 1 ) . moreover , when variable regions from immunized sources are used with display technologies , specificities not detectable by traditional immunological techniques can often be selected23 . during the process of in vitro antibody selection , the gene encoding the antibody is cloned at the same time as the antibody is selected , providing many advantages to the recombinant approach ( fig . 1 ) . the availability of the antibody gene allows the creation of alternative constructs with added functionality by simple subcloning ( see below ) . libraries of mutagenized variants can be created and the same selection process repeated to yield variants that are improved , both in terms of specificity and affinity . the improvement of antibody affinity to picomolar levels24,25,26,27,28 has become relatively routine , with one study describing an antibody in the femtomolar range29 . these affinities are far higher than those of antibodies obtained by immunization , which are limited to ~100 pm by the physiological mechanism of b cell activation30,31 . in addition , antibody specificities can be broadened or narrowed by appropriate selection and screening . as these in vitro methods are based on microbial systems , selection and screening also overcome immunological tolerance , allowing the selection of affinity reagents that recognize highly conserved targets such as ubiquitin34 , histones35 , hemoglobins36 and post - translational modifications37,38,39 . while tricks can be used to overcome tolerance during immunization40,41 , none are required to select antibodies against conserved proteins using in vitro display methods . remarkably , the selection of hundreds of different antibodies from nave human antibody repertoires against many different individual human targets has not been problematic32,42,43 . most of the examples described below relate to antibody fragments . however , display technologies have allowed the development of alternative , non - antibody scaffolds and they too will provide affinity reagents with similar , or in some applications , superior properties to those described here . selection platforms44,45,46 and different scaffold proteins47,48,49 , including antibody fragments50 , have been widely dealt with in previous reviews . our goal here is not to reiterate the ways in which such libraries are made or used , but to illustrate how in vitro display methods have yielded antibodies with remarkable properties some of which have rarely , if ever , been obtained by immunization . this will be carried out by describing a number of different classes of unique and interesting antibodies , as well as outlining the enormous advantages provided by immediate access to cloned antibody genes . monoclonal and polyclonal antibodies with specificities for small molecules have been obtained by traditional immunization51,52,53,54,55 . however , the ability of display methods to tailor both affinity and specificity has led to significantly better antibodies than can be obtained by immunization ( table 1 and fig . sulfotyrosine is a post - translational modification ( ptm ) predicted to occur in 30% of all secretory and membrane proteins65 . despite decades of immunization this is probably due to the innate tolerance immune systems have for such ubiquitous protein modifications , as well as the presence of the recognized target in the secretory pathway , resulting in retention and an inability to secrete the antibody . using phage display , two groups recently selected antibodies recognizing proteins containing sulfotyrosine ( but not tyrosine phosphate ) , independently of protein context or sequence38,39 . these antibodies recognized sulfotyrosinated proteins in western blotting , immunofluorescence , elisa and immunoprecipitation , and recognition could be abolished by sulfatase treatment or preincubation with free tyrosine sulfate . this represents an enormous advance in the analysis of this modification , which has traditionally required thin - layer chromatography of radiolabeled protein hydrolysates66 or mass spectrometry ( ms)67 , with the presence of sulfate groups often inferred , rather than proven . phage display allows the generation of antibodies against nearly any target , including toxins , pathogens , non - immunogenic , or highly conserved antigens . with respect to protein targets , antibodies have been selected with exquisite specificity , differentiating , for example , between chicken and quail lysozyme68 that differ by a single surface amino acid , and the sh2 domains of abl1 and abl269,70 . these include antibodies that discriminate between different strains of hantavirus71 , dengue virus72 , influenza73,74 , ebola75 and venezuelan equine encephalitis virus76 . given that many of these viruses are classified serologically , the ability to select phage antibodies with similar specificities is not surprising , but unlike antibodies generated by immunization , these have the potential to be used therapeutically . human antibodies , some of which are protective in animal models77,78,79 , have also been selected against a number of bacterial biothreat targets , including brucella melitensis80 , burkholderia mallei and burkholderia pseudomallei81 , anthrax toxins77,82,83 and spores84 , and botulinum toxin24,85 . one library79 was generated from servicemen vaccinated against a plethora of different biothreat agents , reflecting the additional ability of display technologies to exploit antibodies generated during traditional immunization . the in vitro nature of phage display technology has been exploited to target particular features of blood cells . in one study36 , antibodies recognizing fetal hemoglobin but not adult hemoglobin , were selected by depleting high affinity cross - reactive antibodies followed by a selection against the fetal protein . notably , the selected discriminatory antibody was of much lower affinity than cross - reactive antibodies , demonstrating the power of negative selections to favor clones with desirable binding specificities , even if their affinity is lower . similar methods applied to cells have been used to select antibodies specifically recognizing fetal nucleated red blood cells95 . protein allostery is a common means for the regulation of protein function , and many signaling proteins exist in alternative conformational states that mediate different cellular responses . antibodies that recognize specific proteins conformers are powerful tools for probing the details of cell signaling . however , the generation of such antibodies by immunization is complicated by the difficulty of maintaining a particular protein conformation in an immunized animal . in contrast , in vitro selection technologies are ideally suited for these applications . negative selections can be used to deplete non - specific binders , and affinity maturation strategies can be employed to fine - tune specificity . in one study , scfvs specific to the gtp - bound form of the small guanosine triphosphatase ( gtpase ) rab6 were generated by performing selections against a gtp - locked mutant96 . in another study97 , small molecules were used to covalently lock caspase-1 in either the active or inactive form and the locked antigens were used to select fabs that were highly selective for either the on or off form of the protease . the concept of using in vitro selections to generate conformation specific antibodies has also been combined with selections on whole cells in a powerful strategy that enables the probing the cell surfaces for conformational changes in response to various stimuli101 . finally , phage display has enabled the generation of antibodies recognizing structured rna molecules100 , which are essentially non - immunogenic , and not as amenable to simple nucleotide probes . by ensuring a nuclease - free in vitro environment and selecting under conditions optimized for the structural stability of the rna , high affinity fabs were isolated against a structured domain from the tetrahymena group i intron . these results hold great promise , as they establish general methods applicable to the generation of antibodies against other structured rnas , and will be useful to decipher the biological roles of the vast numbers of noncoding rnas found in metazoan transcriptomes . communication between cells is driven and controlled by interactions between cell surface receptors and the ligands they recognize . antibodies can modify such interactions and many therapeutic antibodies exert their effect by interfering in communications at the cell surface using different mechanisms ( fig . 3 ) . in vitro display technologies provide a powerful route to generating functional antibodies that interfere in normal or pathological extracellular signaling . although it is usually difficult to select for function directly , display technologies have the ability to generate thousands of independent binders , each of which can then be screened for functional activity . for example , over 1200 different antibodies directed towards b lymphocyte stimulator ( blys ) were generated by phage display102 . this large panel was subsequently screened in biochemical and cellular assays to identify antibodies that bound to blys , preventing its interaction with the receptor ( fig . 3a ) , and thereby blocking b cell activation . in some cases blocking antibodies with sub - nanomolar affinities one of these antibodies , specific only for the secreted form of blys ( benlysta ) , was affinity matured103 and is close to approval for treatment of systemic lupus erythematosus . similar results have been reported for the selection of phage antibodies against a panel of 28 different potentially therapeutic targets , with an average of 120 functionally active ( i.e. antagonistic or agonistic ) antibodies selected per target43 . an alternative strategy to block receptor signaling is to target the ligand binding sites on the receptors , thereby preventing the natural ligand from acting ( fig . this was used in a recent study , where antibodies were selected that prevented the interaction of insulin - like growth factor type 1 ( igf-1 ) with the igf-1 receptor106 . several groups of receptor binders were generated that competed with ligand binding and blocked cell growth in vitro and in vivo . studies on a panel of therapeutic antibodies targeting the egf receptor ( erb - b1 ) have also shown competition with ligand binding . erb - b1 has four extracellular domains , which adopt a mainly closed conformation in the absence of ligand , and a more extended conformation allowing dimerization , and subsequent phosphorylation of the intracellular domain , in the presence of ligand . structural studies have shown that antibodies such as cetuximab stabilize the receptor in the closed conformation ( fig . , pertuzumab appears to work by preventing dimerization while trastuzumab ( herceptin ) prevents receptor shedding and forms inactive tetramers120 . while the original blocking antibodies in these examples were generated from mice , they demonstrate the therapeutic approaches that could benefit from human antibodies isolated directly from display technologies . following ligand binding , a conformational change occurs at the juxta - membrane negative regulatory region ( nrr ) exposing a protease cleavage site resulting in the release and translocation to the nucleus of the intracellular domain . in addition to generating antibodies that block the interaction with ligand , antibodies recognizing the nrr domains stabilized the closed dimeric antibodies targeting ligand - binding domains sometimes mimic the natural ligand , causing receptor activation rather than inhibition . this is the case for antibodies recognizing met109 , with monomeric antibodies being antagonistic . however , in the case of trail receptor 1 ( trail - r1 ) and trail receptor 2 ( trail - r2)119 , an analysis of over 500 distinct selected antibodies , revealed some that were agonistic even as monomeric scfvs or fabs . this is difficult to reconcile with the mode of action of trail , which is a homotrimeric ligand that causes multimerization of the trail receptor leading to apoptosis , particularly in tumor cells over - expressing the receptor . antibodies also have great potential in blocking protein interactions associated with viral entry into target cells , illustrated by antibodies selected from nave antibody libraries against recombinant h5 hemagglutinin influenza ectodomain112,113 . structural analysis of one of the antibodies showed it bound to hemagglutinin at a highly conserved previously unrecognized pocket , found in many different influenza viruses . although antibodies have not been generated against this epitope by traditional immunization or infection , antibodies with similar vh gene usage and neutralizing activity have been selected from phage antibody libraries created from recently infected individuals23 , showing that phage display can access the diversity of immune responses in ways not possible by traditional immunological means . in vitro selection schemes this was carried out by incubating phage libraries with target cells and isolating those phage antibodies found within the cell after removing phage antibodies bound to the cell surface . however , the use of mammalian cells transfected with the target of interest 118 , or yeast displaying targets of interest on their surface114 , provides a means of carrying this out on predetermined targets . this approach is particularly suitable for the selection of antibodies used for specific targeting of chemotherapeutics121,122 . in summary , antibodies and other binding molecules provide a means of modulating biological function by specifically interfering in protein interactions . in vitro display systems provide a means of presenting targets in appropriate conformations , including on cell surfaces , which facilitate rapid screening for potentially rare functional binders . while initial leads can be used directly as affinity reagents , a major advantage of in vitro methods is that it is possible to further improve function by constructing secondary libraries that introduce additional mutations . the most prevalent application of secondary libraries is the improvement of affinity , and all three major display formats ( phage , yeast and ribosome ) have been applied to develop extremely tight affinities that exceed those possible with natural antibodies ( table 4 ) . both stepwise123 and computational124 methods have also been developed that are able to generate similarly high affinity antibodies , but they have not been as widely used as the in vitro display methods . there are many examples of in vitro affinity maturation , and here we highlight some key studies . in ribosome display , each selection cycles involves a pcr amplification step , which is ideal for introducing additional mutations by error prone pcr . this strategy has been used to simultaneously select and affinity mature anti - insulin antibodies with affinities in the sub - nanomolar range26 . while yeast - displayed libraries are smaller than phage and ribosome libraries , they allow quantitative and exhaustive screening by fluorescence activated cell sorting ( facs ) . coupled with sequential rounds of error - prone pcr , modest libraries of 1010 unique clones were sufficient to affinity mature an anti - fluoroscein scfv into the low femtomolar range29 . species cross - reactivity allows better assessment of therapeutic efficacy and toxicity in animal models . unfortunately , cross - reactive antibodies are often difficult to obtain by hybridoma methods , due to tolerance . in contrast , in vitro libraries are unaffected by immune tolerance and antibodies targeting conserved sites across species have proven to be the rule rather than the exception . in the case of highly conserved proteins , such as vascular endothelial growth factor ( vegf ) , human / mouse cross - reactive antibodies have been obtained directly from nave libraries128,129 . in the case of less conserved orthologs , such as baff / blys receptor 3 ( br3 ) , initial anti - human antibodies with weak cross - reactivity to the mouse protein have been obtained from nave libraries and evolved to be highly cross - reactive130 . similar approaches have been used to generate antibodies recognizing two closely related chemokines ( cxlc10 and cxcl9)125 thereby permitting neutralization of 2 human chemokines with a single antibody . most specificity engineering examples involve the improvement of pre - existing weak recognition , due to homology between the recognized targets . in perhaps the most extreme case of engineered cross - reactivity , herceptin has been evolved to recognize a very different protein , vegf , as well as its original target , erb - b2126 . after significant evolution the affinities for both targets were comparable to those of therapeutic antibodies ( kd = 3/0.2 nm for vegf / erb - b2 ) . the antibody inhibited both vegf and erb - b2-mediated cell proliferation in vitro and tumor progression in mouse models . the structures of the bispecific fab in complex with erb - b2 or vegf revealed a common paratope , with the erb - b2 functional paratope located predominantly on vh , and that for vegf on vl ( fig . 4 ) . the ability to design antigen - binding sites with dual specificity against structurally unrelated antigens may be important in therapeutic strategies targeting two distinct signaling pathways with a single antibody . the ability to improve affinity and broaden specificity also has major implications for the development of antibodies against pathogens . for the effective inhibition of viral infection and bacterial toxins , antibodies would ideally recognize a variety of antigen subtypes with high affinity , to afford broad protection against pathogen variants . furthermore , several studies have shown that multiple antibodies targeting distinct epitopes provide synergistic effects necessary for effective neutralization of pathogens131,132 . in vitro antibody technologies provide an effective means for achieving these demanding criteria , as exemplified by a long - term study of neutralizing antibodies against the botulinum neurotoxin ( bont ) . phage antibody libraries from immunized mice and humans resulted in the isolation of three antibodies recognizing non - overlapping epitopes on bont133 . the use of these three antibodies together as an oligoclonal igg provided strong synergy that dramatically increased toxin neutralization . a long series of affinity and specificity maturation cycles using yeast display , resulted in the final development of a remarkable antibody able to recognize botulinum toxins a , b , e and f , all the serotypes afflicting man127 . all in vitro selection systems immediately provide the genes , and corresponding sequences , of antibodies selected against a particular target , providing ready access to additional antibody formats by simple sub - cloning . functions adopted using this gene - based approach include dimerization134 , multimerization135,136 , and fusions to enzymes137 , tags138 or fluorescent proteins139 . as this is a dimeric enzyme , fusing antibodies , either individually or as libraries , to alkaline phosphatase simultaneously provides dimerization and alkaline phosphatase activity , greatly facilitating screening32,137 . short peptides acting as in vivo biotinylation tags138 , placed at the carboxy terminus of antibody fragments , allow stoichiometrically defined site specific antibody biotinylation , as well as a straightforward multimerization method140 . antibody fragments can also be transformed into full - length antibodies141 , or scfv - fc fusions , which are very similar in many aspects142 . the use of engineered fc regions can result in improved pharmacokinetics and effector functions ( for reviews see 143,144 ) , including bispecific igg , in which engineering of two different fc regions allow only heterologous pairing145,146 . other approaches to generate bispecific antibodies build upon the observation that some scfv fragments form bivalent dimers ( diabodies)147 , trimers148,149 and even tetramers150 when the vh / vl linker is shortened . various other bispecific antibody designs have also been created ( see 151 for a review ) . even more radically , completely novel biochemical entities have been added to antigen binding fragments . fusions of scfv and fab fragments to heterologous proteins , such as interleukins and cytokines152,153 , apoptotic ligands , enzymes , toxins or rnases ( see 154,155 for reviews ) have allowed novel therapeutic paradigms . many of the above candidate therapeutic antibody constructs arose from antibody genes initially isolated from mouse hybridomas , but this is expected to change as more human antibodies are made available from engineered repertoires . antibody fragments can be expressed within target cells and targeted to various subcellular compartments141,157 by adding suitable signal sequences , allowing visualization or functional modification of proteins in different compartments . removing the standard leader sequence results in cytoplasmic expression while the addition of a nuclear localization signal targets to the nucleus . the combination of a leader sequence and the endoplasmic reticulum ( er ) retention sequence retains expressed antibodies in the er and has been used to prevent the expression of membrane proteins by sequestration in the er . these include human interleukin 2 receptor , the erbb-2 receptor , s - amyloid precursor protein , vascular adhesion molecule 1 and many others158,159,160,161 . the advantage of this strategy is that it requires antibodies that bind to any accessible epitope to provide the functional knockout , as opposed to the functional activity required of cytoplasmically expressed antibodies . functional studies of membrane receptors or secreted proteins can thus be attempted by a single standardized subcloning step immediately after in vitro antibody selection , providing equivalence to rnai knockdowns at the protein level . while expression in the secretory pathway is straightforward , folding of antibody fragments in the cytoplasm is far more challenging , due to the absence of specific chaperones , and the reducing environment , which prevents disulfide bond formation162 . despite these problems , the success of this approach has been improved by the creation of libraries of particularly stable scfvs164,165,166 , preselecting antibodies for functional cytoplasmic expression167,168 , or by using binder libraries based on molecular scaffolds that do not rely on disulphide bond formation , such as engineered ankyrin repeat proteins169,170 . one major advantage of such protein based allosteric blockers is the ability to generate very specific binders , able to distinguish between closely related family members . while the need to genetically modify the target cell is a major disadvantage , this has been partly alleviated by fusion to internalizing sequences that allow antibodies to enter the cell from the outside171 . the ease with which antibodies can be selected , screened and produced by in vitro display technologies , makes generation and screening of antibodies rapid and simple compared to hybridomas . typically a panel of elisa positive monoclonal antibody fragments can be generated within two weeks . early experiments demonstrated the feasibility of semi - automated selection / screening of phage antibody libraries172,173,174 on small numbers of targets . more recently , selections on over 400 different antigens were successful with 54% of bacterial , and 88% of mammalian - produced antigens32 yielding antibodies , with the differences between the two protein classes probably due to the levels of correct folding . in a recent international comparative study antibodies were raised to 20 different human sh2 domains using hybridoma or phage display . results from two of the participating phage display labs69,70 , show that antibodies ( some with sub - nanomolar affinities ) were generated to all antigens , with 55% of positive antibodies specific for target sh2 domains when assessed against the entire sh2 panel . these antibodies were validated in a broad range of assays , including microarrays , immunoblots , immunofluorescence and immunoprecipitation . if antibodies selected by in vitro methods are so powerful , why are they not more widely perceived as valuable research reagents ? part of the answer lies in the difficult patent situation , which resulted in restriction of this technology to the high margin therapeutic markets for commercial use . it is perhaps significant in this regard that hybridoma technology was never patented , and achieved relatively wide acceptance within a short period . the situation for some of the core phage display patents is in the process of rapid change as most platform patents have either expired , or will do so over the next few years175 , and it is possible that the technology will become more widely disseminated as a result . are actually recombinant antibodies selected by phage display , reformatted to look like traditional murine antibodies by the fusion of fc regions to human variable regions ( e.g. the sulfotyrosine antibody described above38 ) . it therefore seems that the most important impediments to widespread adoption are a lack of knowledge of the capabilities of this technology , coupled with limited expertise and library availability . furthermore , the number of companies willing to carry out in vitro selection as a fee for service is vanishingly small compared to the 180 companies willing to generate antibodies by immunization16 . while the specificities obtained , and described herein , are remarkable , the expression and stability of antibody fragments varies enormously , from exceptionally stable scfv fragments used in clinical trials176 to other fragments that are poorly expressed . a typical selection almost always generates a number of different binders to any well - folded antigen . among these there is usually at least one that is sufficiently stable and well produced for research use . furthermore , it is expected that stability and expression levels will improve as libraries are based on more stable scaffolds177 . the studies described above indicate that this goal can now be met in highly parallelized screening setups with low effort per antigen69,70 , provided that libraries of sufficient diversity and optimized protocols are used . furthermore , stability and expression screening can be easily included as part of the ht screening process . an additional issue with in vitro derived antibodies is that they are either not glycosylated if expressed in bacteria , or incorrectly glycosylated if expressed in standard yeast strains . if correct glycosylation is necessary , this can be overcome by expression in human cells or yeast modified to give human glycosylation patterns178 . once an antibody is generated , it can be defined precisely by sequence and even distributed in this way . gene synthesis is progressing at a remarkable pace , with the cost per base of synthesized genes falling dramatically . in fact , genes corresponding to the sequences of specific antibody fragments can now be synthesized for less than the cost of purchase of some antibodies from traditional vendors . the present state of this field can be compared to the situation with sequencing technologies at the start of the human genome project . just as enormous technical advances occurred in the human genome project once it was started and rigorous industrial processes were applied , so we anticipate dramatic improvement in all aspects of selection , screening , downstream use and distribution of in vitro derived affinity reagents once a proteomic scale project is initiated and financed . in summary , in vitro display technologies permit the facile generation of antibodies by providing access to billions of potential binders in large universal , or immune , display libraries . the technologies facilitate production , screening and maturation of selected binders , allowing selection on target conformations and formats not possible by more traditional routes based on immunization . furthermore , the easy availability of the gene sequence not only provides a definitive description of the product but also allows electronic sharing and recreation of the binding molecule through gene synthesis . over the last 20 years display technologies have been applied successfully to the development of therapeutic antibody candidates . in the coming decade we expect to see increased realization of the benefits of this technology within the research and diagnostic markets as well .

in vitro display technologies , best exemplified by phage and yeast display , were first described for the selection of antibodies some twenty years ago . since that time a large number of antibodies , some with remarkable properties , have been selected and improved upon using these methods . the first antibodies derived using in vitro display methods are now in the clinic , with many more waiting in the wings . here we discuss the scope of the technology , some of the powerful antibodies selected , and the future potential in a post - genomic world . unique advantages offered by in vitro display technologies include the ability to carefully define selection conditions , allowing the derivation of antibodies recognizing predefined epitopes or conformations , the further improvement of selected antibodies , the potential for high throughput applications and the immediate availability of genes encoding the selected antibody . we anticipate that the high throughput potential of these technologies will soon lead to their use to select antibodies against all human proteins .

Introduction Recognition of chemical modifications and small molecules Specificity for protein sequences and conformations Antibodies to cell surface receptors Improving antibody affinity and specificity Exploiting the recombinant nature of in vitro selected antibodies High throughput selection by in vitro display methods The future vision of affinity reagents generated by display technologies

earlier , the cyst was referred by many names , e.g. , nasoalveolar cyst , nasal vestibule cyst , nasal wing cyst , and mucoid cyst of the nose . rao revised the nomenclature and defined nasolabial cysts as lesions located entirely within soft tissue , different from nasoalveolar cysts , which cause maxillary bone erosion . previous reports suggest an adult onset , higher incidence among women and preponderance on left side . it usually presents as an asymptomatic swelling beneath the ala of nose . in the previous reports and literature , it was mentioned that nasolabial cyst clinical features of an asymptomatic swelling beneath the ala of nose and characteristic lip swelling are diagnostic . however , this case report describes a 36-year - old male , who reported to our department with the chief complaint of swelling lateral to right ala of nose since 4 months . a 36-year - old male patient , reported to our department with the chief complaint of swelling lateral to right ala of nose since 4 months . there was mild pain and associated white watery discharge intraorally from the swelling on pressure application . extra oral examination revealed an ovoid swelling measuring 4 3 cm , lateral to right ala of nose [ figure 1 ] . swelling was soft , fluctuant , movable with diffuse margins with slight local rise in temperature . intraorally , the swelling was soft , extending from canine to first molar and overlying mucosa was normal . radiographic investigations included opg [ figure 2 ] and water 's view [ figure 3 ] which revealed no significant findings . on aspiration , diagnosis included canine space infections , salivary gland cyst and tumors , lipoma , epidermoid inclusion cysts and sebaceous cysts . microscopic examination [ figure 4 ] revealed epithelial lining of varied thickness showing cuboidal to polyhedral cells arranged in a stratified manner . nasolabial cysts represent about 0.7% of all cysts in the maxillofacial region , and 2.5% of non odontogenic cysts . many authors believe that its prevalence is actually higher than presented in the literature ; however , due to misdiagnosis , indexes remain low . nasolabial cysts are usually unilateral , but bilateral cases have been also reported . swelling in this case was also unilateral . there is a sex predilection of incidence in females ( 3.7:1 ) and age predilection in 2 to 7 decade though it frequently occurs during middle age . some authors suggest that lesion arises from misplaced epithelium of nasolacrimal rod or duct remnants and others suggest that it is a fissural cyst arising from epithelial remnants entrapped in the developmental fissures between the lateral nasal , globular , and maxillary processes . because of the location of the cyst in this case , the second theory seems to be more acceptable . extraorally , patients usually complain of a swelling adjacent to the nose , and sometimes the cyst may be observed on routine examination . intraorally , swelling is usually present in the maxillary labial sulcus but may reach great dimensions and extend to the buccal sulcus , causing discomfort with the use of dentures , breathing obstruction and facial asymmetry . swelling in this case cyst lies in soft tissues with usually no radiographic findings , but it can sometimes cause erosion of the underlying maxillary bone which may be observed in radiographic examination . because nasolabial cyst is a soft - tissue mass , histologically , the cyst may be lined by pseudostratified columnar epithelium which is sometimes ciliated often with goblet cells and mucous cells , or by stratified squamous epithelium . the lining in this case was also stratified squamous with goblet cells and mucous cells . treatment of choice is enucleation which has low recurrence rate . the cyst in this case was also enucleated with no recurrence . this case is unique in that respect as none of the earlier case report has mentioned a similar location of the entity . the unusual location in this case imply that nasolabial cyst may manifest in a location different from its common position beneath the ala of nasi or some unrecognized entity exists in a lateral location with features similar to nasolabial cyst .

the nasolabial cyst is a rare nonodontogenic cyst originating in maxillofacial soft tissues . in the previous reports and literature , it is mentioned that nasolabial cyst clinical features of an asymptomatic swelling beneath the ala of nose and characteristic lip swelling are diagnostic . this is a case report of a 36-year - old male , who reported to our department with the chief complaint of swelling lateral to right ala of nose since 4 months . characteristic lip swelling was missing . the reason for this unusual finding is not documented in the literature .

INTRODUCTION CASE REPORT DISCUSSION

the liver is the most common site of distant metastasis from colorectal cancer.1 the standard curative treatment for colorectal liver metastasis in colorectal cancer patients is surgical resection or local treatment with radiofrequency ablation.2 , 3 on the other hand , adjuvant therapy , including chemotherapeutic regimens , can induce a favorable response and a longer survival period in patients with unresectable liver metastases by decreasing the tumor extent and rendering the tumor resectable.4 however , if chemotherapy is effective , micrometastases may be undetectable by imaging and may be incorrectly judged to have disappeared . to prevent such misjudgment , recently , the emergence of contrastenhanced ultrasonography ( ceus ) with sonazoid ( daiichisankyo , tokyo , japan ) and enhanced mri with gadoliniumethoxybenzyldiethylenetriamine pentaacetic acid ( gdeobdtpa ) ( primovist ; bayer healthcare , berlin , germany)known as eobmri has improved the detection and diagnosis of malignant liver tumors . detection of hepatocellular carcinoma ( hcc ) and liver metastases using ceus with sonazoid , dynamic ct , super paramagnetic iron oxide ( spio)mri , and eobmri has been compared,5 , 6 , 7 , 8 , 9 , 10 but a prospective comparison of the detection of liver metastasis in colorectal cancer using only ceus with sonazoid and eobmri has not been reported . in this study , we performed this comparison and investigated the utility of ceus for diagnosis of liver metastasis of colorectal cancer . sixtynine patients were diagnosed with colorectal cancer at our hospital between january 2011 and october 2014 and were suspected of having a malignant lesion in the liver on routine grayscale ultrasonography ( us ) or dynamic ct and underwent ceus with sonazoid and eobmri . these patients included 46 males and 23 females and had a mean age of 66 years ( range , 3486 ) . the primary lesion was located in the rectum in 27 cases , sigmoid colon in 22 , transverse colon in 10 , ascending colon in 8 , and cecum in 2 . all ceus was performed by two sonographers using an aplio xg ( toshiba medical systems , tokyo , japan ) with a convex probe ( pvt375bt , 3.75mhz center frequency ) . the mechanical index ( mi ) for the acoustic output was set to 0.2 . in patients in whom lesions were detected by grayscale us , the single focus point was set at the lower margin of the lesion . an intravenous bolus injection of sonazoid ( 0.5 ml ) was administered via a left cubital venous line followed by flushing with 10 ml of normal saline . the dynamics of enhancement of the lesion were observed in the vascular phase ( arterial phase [ 040 seconds ] , portal venous phase [ 40120 seconds ] , late phase [ > 120 seconds ] ) , and in all patients , including those with no lesion visualized on grayscale us , the whole liver was observed in the postvascular phase 10 minutes after injection , and the presence of defects was evaluated . visualized defects were examined using defect reperfusion imaging,11 in which sonazoid ( 0.5 ml ) was reinjected intravenously and the enhancement dynamics were observed to diagnose metastatic liver cancer . video images in the vascular and postvascular phases were recorded and analyzed by an offline procedure . diagnostic criteria for liver metastases were early washout , usually in the portal venous phase , and hypoenhancement during the portal venous and late phases.12 eobmri was performed with a 1.5t superconducting magnet ( signa lx ; ge healthcare , milwaukee , wi ) and an 8channel phasedarray coil . fast spoiled gradientecho t1weighted images ( t1wi ) , respiratorytriggered fatsaturated fast spinecho t2weighted images ( t2wi ) , and singleshot spinecho echoplanar diffusionweighted images ( dwi ) were obtained before contrast administration . dynamic fatsuppressed gradientecho t1wi with a threedimensional acquisition sequence ( liver acquisition with volume acceleration ) were obtained before ( precontrast ) and at 20 and 60 seconds and 2 , 5 , 10 , and 20 minutes after administration of eob . the contrast material ( 0.025 mmol / kg of body weight ) was then administered intravenously via a cubital line , which was flushed with 20 ml of saline using a power injector . images in the sagittal plane were also obtained for the hepatobiliary phase ( hbp ) 20 minutes after injection of the contrast agent . on eobmri , a lesion was considered a metastasis if it had an intermediately intense signal on t2weighted images , a hypointense signal on t1wi , high signal intensity on diffusionweighted images , a faint peripheral ringlike enhancement on the arterial and portal phases , and a hypointense signal on the hbp.13 the final diagnosis of liver metastasis was made by histopathological examination of surgically resected specimens or based on course observation ( changes of size , such as tumor enlargement and shrinkage ) using various imaging modalities . the presence ( number of tumors ) and qualitative diagnoses of the finally diagnosed metastatic lesions all ceus and eobmri images were reviewed by a hepatologist with 30 years of experience and a radiologist with 15 years of experience . for qualitative diagnosis , tumors were evaluated using the following fivepoint confidence scale : 1 = definitely not metastasis or absence ; 2 = probably not metastasis ; 3 = indeterminate ; 4 = probably metastasis ; 5 = definitely metastasis . both imaging diagnoses were subjected to receiver operating characteristic ( roc ) curve analysis , and the area under the roc curve ( auc ) was calculated . the roc curves were analyzed using a twotailed student 's t test for paired data . based on a score of 4 or 5 on the confidence scale indicating liver metastasis , the sensitivity , specificity , positive predictive value ( ppv ) , negative predictive value ( npv ) , and accuracy of the diagnosis were calculated and compared between ceus and eobmri , with p < 0.05 regarded as significant . the study was performed after approval by the ethics committee of toho university medical center omori hospital . there were 133 lesions found in the 69 patients , giving a mean number of 1.9 lesions per patient . of these lesions , 109 were diagnosed as metastases and 24 as nonmetastasis , with 61 diagnosed histopathologically and 72 diagnosed based on followup of at least 6 months using various imaging modalities . the 24 lesions diagnosed as nonmetastasis were 11 hemangiomas , 9 cysts , 2 hccs ( figure 1 ) , 1 bile duct adenoma , and 1 focus of necrosis after treatment . regarding the location , 2 , 7 , 11 , 23 , 14 , 25 , 20 , and 31 lesions were present in the segments s1 , s2 , s3 , s4 , s5 , s6 , s7 , and s8 , respectively . the mean interval between performance of ceus and eobmri was 11 13 days ( table 1 ) . of all 69 patients with 133 liver tumors , patients ' characteristics , locations of primary lesions and liver tumors , size of liver tumors , diagnosis of liver tumors , methods of final diagnosis of liver tumors , and interval between performances of contrastenhanced ultrasonography ( ceus ) and gdeobdtpaenhanced mri ( eobmri ) abbreviations : ceus , contrastenhanced ultrasonography ; eobmri : gdeobdtpa enhancedmri . of the 133 lesions , 107 ( 80.5% ) were detected on grayscale us , 120 ( 90.2% ) on ceus , and 131 ( 98.5% ) on eobmri , showing that the detection rate was higher on eobmri . the mean diameters were 22 18 mm for 118 lesions detected by both ceus and eobmri , 6 mm for 2 lesions detected only by ceus , and 6 3 mm for 13 lesions detected only by eobmri . the mean diameter of lesions detected only by eobmri was significantly smaller than that for those detected by both ceus and eobmri ( p = 0.016 ) ( table 2 ) . comparison of the detected number of hepatic lesions on ceus and eobmri and the tumor diameter abbreviations : ceus , contrastenhanced ultrasonography ; eobmri : gdeobdtpa enhancedmri . ceus and eobmri versus eobmri , p = 0.016 . p < 0.05 ; statistically significant . a 70yearold man with a history of nonalcoholic steatohepatitis underwent surgical resection of transverse colon cancer . ( a ) gdeobdtpaenhanced mri ( eobmri ) shows a hypointense lesion in t1weighted images ( arrow ) . ( f ) contrastenhanced us ( ceus ) in arterial phase ( 40 seconds ) shows hyperenhancing lesion ( arrow ) . the lesion had a diagnosis of not liver metastasis ( confidence scale 1 ) from diagnostic criteria of ceus , which was diagnosed hepatocellular carcinoma histopathologically . of the 109 lesions diagnosed as liver metastases histopathologically or based on the followup , the aucs for diagnosis were 0.906 for ceus and 0.851 for eobmri , with no significant difference ( p = 0.41 ) ( figure 2 ) . based on a rating of 4 or 5 on the confidence scale on ceus and eobmri , 109 lesions were diagnosed as metastatic disease with sensitivity , specificity , ppv , npv , and accuracy of 90.8% , 84.5% , 97.1% , 67.1% , and 90.2% , respectively , for ceus , and 95.4% , 70.8% , 93.7% , 77.3% , and 91% , respectively , for eobmri . the specificity and ppv of ceus were higher than those of eobmri , but the overall diagnostic accuracy was equivalent for both methods ( table 3 ) . sensitivity , specificity , positivepredictive value ( ppv ) , negativepredictive value ( npv ) , and accuracy of ceus and eobmri based on confidence scale of 4 or 5 abbreviations : ceus , contrastenhanced ultrasonography ; eobmri , gdeobdtpa enhancedmri ; npv , negative predictive value ; ppv , positive predictive value . receiver operating characteristic analysis curves for the diagnosis of liver metastasis of colorectal cancer using contrastenhanced ultrasonography ( ceus ) and gdeobdtpa enhancedmri ( eobmri ) . sonazoid is a contrast agent that consists of microbubbles of perfluorobutane gas stabilized by phospholipid monolayer shells with a median volume diameter of 23 m . it is stable and resistant to sonographic exposure and radiates harmonic signals due to its low mi ( 0.20.3 ) at sufficient transmission power to allow continuous realtime imaging . sonazoid is also taken up by kupffer cells,14 , 15 which have reduced function in malignant liver tumors such as hcc and liver metastases.16 , 17 , 18 therefore , the presence of a hypoechoic area ( defect ) in the liver parenchyma in the postvascular phase 10 minutes after sonazoid injection is useful for diagnosis of malignant liver tumors such as hcc and metastases . for a tumor that was not visualized on initial grayscale us but is observed as a defect in the postvascular phase , the dynamics of the contrast imaging of the lesion can be observed by reinjecting sonazoid , enabling qualitative diagnosis.11 on the other hand , eob is a contrast medium for mri , which combines gddtpa with an ethoxybenzyl group . a dynamic study can be performed using eob , similarly to that with gadolinium contrast medium . in addition , the uptake of eob is achieved by functional hepatocytes , which have the cloned organic anion transporting polypeptides ( oatp1b3).19 contrast enhancement of hepatocytes reaches a maximum about 20 minutes after administration , and hypovascular hepatocellular nodules and small malignant tumors that are undetectable in a dynamic study can be detected in this phase.20 , 21 , 22 , 23 the recent development of ceus with sonazoid and eobmri has improved the detection of malignant liver tumors such as hcc and metastatic disease.24 , 25 , 26 hatanaka et al7 have compared the diagnostic performance of ceus with sonazoid and contrastenhanced ct in 113 patients with intrahepatic lesions that were likely to be malignant and found significantly higher sensitivity and diagnostic accuracy of ceus . because lesions are observed by low mi transmission power on ceus with sonazoid , as described above , hemodynamics can be repeatedly observed in real time . evaluation in the vascular phase may be insufficient , but echo image dynamics can be reevaluated using defect reperfusion imaging11 by repeated intravenous injection of sonazoid , which may explain the higher diagnostic sensitivity and accuracy . hammerstingl et al26 found that eobmri was superior to contrastenhanced ct for detection , diagnosis , and evaluation of treatment of liver tumors . thus , both ceus and eobmri have been found to be superior to contrastenhanced ct,7 , 26 but to our knowledge , there has been no prospective comparison of ceus and eobmri in patients with liver metastasis of colorectal cancer . there was no significant difference in auc between ceus and eobmri , but the tumor detection rate and sensitivity were higher with eobmri and the mean diameter of tumors detected by eobmri alone was significantly smaller than that of tumors visualized by both ceus and eobmri . huppertz et al25 have compared the performance of eobmri in the preoperative detection of lesions with the findings of intraoperative us and histopathological analysis in 131 patients with malignant liver tumors , including metastatic disease , and found that detection was improved by performing eobmri before surgery , particularly for lesions of 10 mm or smaller . on ceus , there are regions that are likely to become blind spots , such as the lateral segment of the left hepatic lobe near the stomach and segment s8 near the diaphragm . ceus is also influenced by patient factors , such as obesity and inability to hold breath , as well as operatordependent factors . in contrast , the whole liver can be objectively observed on eobmri , which may account for the higher detection rate and sensitivity compared with ceus . muhi et al10 have compared the diagnostic accuracy of contrastenhanced ct , ceus with sonazoid , super paramagnetic iron oxide mri , and eobmri in the evaluation of colorectal liver metastases retrospectively . they evaluated 113 patients with 112 colorectal liver metastases and found eobmri was more accurate than ceus for the evaluation of colorectal liver metastases . in our prospective study , ceus has a superior temporal resolution and also permits repeated intravenous sonazoid injection when lesions not visualized by grayscale us are observed as defects in the postvascular phase . moreover , hemodynamics of the tumor can not be evaluated in real time on eobmri , unlike on ceus . thus , it may be difficult to make a definite diagnosis when the tumor is small . the higher specificity and ppv of ceus the npv for diagnosis of liver metastasis by eobmri was 77.3% in our study , which is lower than those in other reports.27 , 28 of the 133 lesions analyzed , 24 were diagnosed as tumors other than liver metastasis , including 11 hepatic hemangiomas . the mean tumor diameter of these 11 lesions was 13 mm , which suggests that the low npv was due to the difficulty of diagnosis of smalldiameter hemangiomas on eobmri in contrast with the use of defect reperfusion imaging in the postvascular phase with ceus . second , the final diagnosis of metastatic disease was also made based on imaging followup . this study showed that eobmri is useful for the detection of liver metastases of colorectal cancer , whereas ceus with sonazoid is useful for specific diagnosis of tumors thanks to realtime hemodynamics evaluation and defect reperfusion imaging . a combination of these two methods may improve detection and diagnosis of liver metastatic lesions of colorectal cancer .

abstractpurposeto compare contrastenhanced ultrasonography ( ceus ) using sonazoid with gdeobdtpaenhanced mri ( eobmri ) in the diagnosis of liver metastases in patients with colorectal cancer.methodsa total of 69 patients diagnosed with or suspected of having liver metastasis were enrolled . these hepatic lesions were diagnosed by histopathological examination after surgical resection or based on followup using various imaging modalities . the diagnostic accuracies of ceus and eobmri were compared.resultsone hundred thirtythree lesions were detected . of these lesions , 109 were diagnosed as liver metastases . of the 133 lesions , 90.2% were detected on ceus , and 98.5% on eobmri . one hundred nine lesions were diagnosed as liver metastasis . the areas under the receiver operating characteristic curve for diagnosis were 0.906 and 0.851 on ceus and eobmri , respectively ( p = 0.41 ) . sensitivity , specificity , positive predictive value ( ppv ) , negative predictive value , and overall accuracy were 90.8% , 84.5% , 97.1% , 67.1% , and 90.2% , respectively , for ceus , and 95.4% , 70.8% , 93.7% , 77.3% , and 91% , respectively , for eobmri.conclusionsceus has a higher specificity and ppv for the diagnosis of liver metastasis than eobmri . 2016 wiley periodicals , inc . j clin ultrasound 45:138144 , 2017

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION

the incidence of inguinal hernia continues to increase , with 500,000 new inguinal hernias diagnosed annually . the most recent data available show that approximately 800,000 inguinal hernia operations , not including bilateral or recurrent repair , were performed in 2003 . inguinal hernia repair is one of the cornerstones of general surgery practice , and in some practices , the most commonly performed elective procedure . because the procedure is common , surgeons continue to look for innovative ways to improve outcomes . several open techniques are still being used , and many surgeons believe that those are the most appropriate techniques for hernia repair in general . the most commonly used open techniques include herniotomy ( in children ) and the bassini , shouldice , mcvay , and lichtenstein methods . increasingly , both physicians and patients prefer minimally invasive inguinal hernia repair to open procedures , most likely because of the association of laparoscopic operations with decreased pain , quicker return to work , better cosmesis , less inflammation , lower rates of infection , and higher rates of overall satisfaction . it has been estimated that 15% to 20% of inguinal hernia surgeries in the united states are repaired using a laparoscopic technique . tension - free repair has become the gold standard for inguinal hernias because of lower recurrence rates and improved patient comfort . the two common variations of laparoscopic inguinal hernia repair are the transabdominal preperitoneal ( tapp ) and the total extraperitoneal ( tep ) approaches . of the two , tep is the preferred approach because tapp , which involves entry through the abdomen into the peritoneal cavity , has been shown to have more postsurgical complications . as minimally invasive inguinal hernia repair becomes more common , the surgical community now debates the utility of mesh fixation versus nonfixation . the type of mesh that has been used most often is a smooth polyester or polypropylene mesh , which may move or slide if not secured . fixation of mesh with tacks , screws , or clips has led to numerous postoperative complications , including bowel obstruction , vascular injury , and migration into the bladder . more commonly , fixation devices are strongly implicated as a cause of postherniorrhaphy pain and chronic inguinodynia ( inguinal pain ) . glues , such as cyanoacrylate and fibrin tissue glue , have also been proposed as viable alternatives to the more standard tissue - disrupting fixation method . they have been on the market since 2006 and have been used in both open and laparoscopic operations . their use eliminates the complication risk , increased operation time , and expense that come with the mechanical fixation of implanted mesh . the popularity and increased use of self - adhesive mesh have been attributed to growing evidence of low rates of recurrence and postsurgical pain . a recent meta - analysis comparing progrip ( self - adhesive ) mesh ( covidien , north haven , ct , usa ) to suture mesh revealed that self - adhesive mesh outcomes are equivalent to those obtained with suture mesh in open inguinal hernia repair . based on these considerations , many surgeons regard the use of mesh in inguinal hernia repair as beneficial , and advances in this area will benefit the field . however , there are limited published data on the use of self - adhesive mesh during tep hernia repair . we wanted to investigate this specific question , and thus , the purpose of this study was to present our experience and evaluate early outcomes of patients who had undergone tep inguinal hernia repair with self - adhesive mesh . patients for the study were identified by staff from the surgical group 's database by using laparoscopic hernia repair , parietex progrip mesh , preperitoneal inguinal hernia repair , and total extraperitoneal as search terms . for this retrospective study , data were collected for all patients who underwent elective tep laparoscopic inguinal hernia repair with parietex progrip mesh from april 4 , 2010 , through july 22 , 2014 . patients were further screened by using the international classification of diseases , ninth version , code 550.90 ( 550.92 in recurrent hernia repairs ) and the current procedural terminology code 49650 for inguinal hernia repair . emergent cases , minors ( age , < 18 years ) , and patients who had not undergone tep with progrip mesh were excluded from the study . relative contraindications include lack of fitness for general anesthesia because of comorbidities ( ie , severe chronic obstructive pulmonary disease or severe coronary arterial disease ) , pregnancy , and a history of lower abdominal surgery . patient variables included demographics , body mass index ( bmi ) , indication for hernia repair , surgical approach , type of hernia , conversion from laparoscopic surgery to open , and complications . a routine follow - up appointment was defined as a clinic appointment scheduled 2 weeks after the operation . outcomes assessed included postoperative complications ( infection , hematoma , notable perioperative pain , paresthesia , numbness , and early recurrence ) , hospital length of stay , time to return to work , and patient satisfaction . the primary end point was a composite score , which was the sum of events , including early recurrence , conversion , infection , paresthesia , postoperative pain , and mortality . all patients were catheterized to empty the bladder before the abdomen was prepped and draped . 2 . a 2-cm transverse infraumbilical skin incision was made , and dissection was carried down to identify the anterior rectus sheath , which was then penetrated . a finger was placed just below the anterior rectus sheath which was penetrated and passed inferiorly , staying above the rectus muscle . the spacemaker dissection balloon ( covidien ) was inserted through a port , followed by the camera . under direct visualization with a 10-mm laparoscope , the blunt - tip balloon was inserted in the same plane and connected to the co2 supply , and the preperitoneal space was distended , allowing visualization of all anatomic landmarks : the inferior epigastric vessels , cooper 's ligament , poupart 's ligament , the pubic symphysis , and the lateral abdominal wall the spermatic cord , with the vas deferens medially and testicular vessels laterally , was identified . the hernia sac was then visualized , identified as direct or indirect , and reduced . 7 . the sac was dissected completely and mobilized posteriorly until the psoas muscle was identified . the abdominal wall was exposed laterally , the psoas muscle posteriorly , and cooper 's ligament medially . a previously rolled 3.5 6-inch portion of progrip mesh was placed through the camera port directed toward the lateral abdominal wall . brief steady pressure was applied by the surgeon to allow self - fixation while the mesh was unrolled . the mesh was affixed to the anterior abdominal wall , medial to the midline , covering the direct defect . the surgeon then proceeded to open the entire mesh to cover the internal ring , femoral ring , and touch the psoas muscle posteriorly . most important , the surgeon ensured adherence of the mesh to the psoas muscle , to prevent the hernia sac from slipping beneath the mesh , which would have caused a recurrence . descriptive statistical analysis was performed with spss , version 16 ( spss inc . , chicago , il , usa ) statistical software . the test was used for categorical variables , and logistic regression was used to analyze data with dichotomous outcomes . patients for the study were identified by staff from the surgical group 's database by using laparoscopic hernia repair , parietex progrip mesh , preperitoneal inguinal hernia repair , and total extraperitoneal as search terms . for this retrospective study , data were collected for all patients who underwent elective tep laparoscopic inguinal hernia repair with parietex progrip mesh from april 4 , 2010 , through july 22 , 2014 . patients were further screened by using the international classification of diseases , ninth version , code 550.90 ( 550.92 in recurrent hernia repairs ) and the current procedural terminology code 49650 for inguinal hernia repair . emergent cases , minors ( age , < 18 years ) , and patients who had not undergone tep with progrip mesh were excluded from the study . relative contraindications include lack of fitness for general anesthesia because of comorbidities ( ie , severe chronic obstructive pulmonary disease or severe coronary arterial disease ) , pregnancy , and a history of lower abdominal surgery . patient variables included demographics , body mass index ( bmi ) , indication for hernia repair , surgical approach , type of hernia , conversion from laparoscopic surgery to open , and complications . a routine follow - up appointment was defined as a clinic appointment scheduled 2 weeks after the operation . outcomes assessed included postoperative complications ( infection , hematoma , notable perioperative pain , paresthesia , numbness , and early recurrence ) , hospital length of stay , time to return to work , and patient satisfaction . the primary end point was a composite score , which was the sum of events , including early recurrence , conversion , infection , paresthesia , postoperative pain , and mortality . all patients were catheterized to empty the bladder before the abdomen was prepped and draped . 2 . a 2-cm transverse infraumbilical skin incision was made , and dissection was carried down to identify the anterior rectus sheath , which was then penetrated . a finger was placed just below the anterior rectus sheath which was penetrated and passed inferiorly , staying above the rectus muscle . the spacemaker dissection balloon ( covidien ) was inserted through a port , followed by the camera . under direct visualization with a 10-mm laparoscope , the blunt - tip balloon was inserted in the same plane and connected to the co2 supply , and the preperitoneal space was distended , allowing visualization of all anatomic landmarks : the inferior epigastric vessels , cooper 's ligament , poupart 's ligament , the pubic symphysis , and the lateral abdominal wall . the spermatic cord , with the vas deferens medially and testicular vessels laterally , was identified . the hernia sac was then visualized , identified as direct or indirect , and reduced . 7 . the sac was dissected completely and mobilized posteriorly until the psoas muscle was identified . the abdominal wall was exposed laterally , the psoas muscle posteriorly , and cooper 's ligament medially . 9 . a previously rolled 3.5 6-inch portion of progrip mesh was placed through the camera port directed toward the lateral abdominal wall . brief steady pressure was applied by the surgeon to allow self - fixation while the mesh was unrolled . the mesh was affixed to the anterior abdominal wall , medial to the midline , covering the direct defect . the surgeon then proceeded to open the entire mesh to cover the internal ring , femoral ring , and touch the psoas muscle posteriorly . most important , the surgeon ensured adherence of the mesh to the psoas muscle , to prevent the hernia sac from slipping beneath the mesh , which would have caused a recurrence . descriptive statistical analysis was performed with spss , version 16 ( spss inc . , chicago , il , usa ) statistical software . the test was used for categorical variables , and logistic regression was used to analyze data with dichotomous outcomes . the initial database search identified 1281 patients for laparoscopic hernia repair from april 4 , 2010 , through july 22 , 2014 , of which 543 were excluded because they had undergone other types of hernia repair ( figure 1 ) . seven hundred ten patients were screened for tep eligibility , and 70 were excluded because they had undergone tep with marlex mesh ( phillips petroleum co. , bartlesville , ok , usa ) , were under the age of 18 , or had incomplete data . further review excluded 7 patients because of conversion to open during surgery due to severe adhesions , an irreducible hernia sac , or a densely attached rectus sheath . thus , 640 patients who underwent tep hernia repair with progrip self - adhesive mesh were analyzed . the percentage of obese patients ( bmi 30 ) in the study was 24.4% , and 75.6% were not obese ( bmi < 30 ) . there were 94 patients with direct hernia , 462 with indirect hernia , and 84 with a combination of direct and indirect hernias . the more frequent indication for repair was primary hernia ( 601 ; 93.9% ) compared to recurrent hernia ( 39 ; 6.1% ) . average operation time from incision to closure was 43.9 minutes ( 17 ; range , 2090 ) . all patients were discharged the same day and were scheduled for a 2-week follow - up . cohort study flow diagram showing patient selection and exclusion criteria and the number of patients included in the study analysis . characteristics of patients who underwent tep inguinal hernia repair with self - adhesive , velcro - type progrip mesh ( covidien , north haven , ct , usa ) . unless otherwise specified , data are the number of patients , with the percentage of the study sample in parentheses . group sizes for categories that are less than the total sample are shown . abbreviations : chf , congestive heart failure ; copd , chronic obstructive pulmonary disease ; mi , myocardial infarction ; tep , totally extraperitoneal . early recurrence was reported by 1 patient ( 0.2% ) , who had recurrence within 2 weeks caused by slippage of the mesh and underwent reoperation . seventeen had hematoma ; of those , 2 underwent drainage at 2 weeks , 19 were treated expectantly , and 2 underwent drainage later . at the 2-week follow - up , most of the patients ( 92.2% ) reported no more than minimal pain , whereas 7.8% had notable pain that was managed conservatively with oral analgesics . data are for hernia procedure outcomes in patients treated with tep inguinal hernia repair with self - adhesive , velcro - type progrip mesh . unless otherwise specified , data are the number of patients , with the percentage of the study sample in parentheses . binary logistic regression analysis was performed to determine the relationship between the patient variables and composite score end points . we found that age , ethnicity , bmi , and type of insurance were not associated with composite score . recurrent hernia , unilateral versus bilateral hernia , and anatomic side were associated with composite score . compared with the left - side hernia group , patients who had right - side hernia were 1.54 times more likely to have 1 or more complications ( composite end point ) , but the difference was not statically significant . however , when unilateral occurrence was used as the reference point , patients who had bilateral hernia were 2.8 times more likely to have 1 or more complications ( 95% ci 1.395.80 ; p < .004 ) . the initial database search identified 1281 patients for laparoscopic hernia repair from april 4 , 2010 , through july 22 , 2014 , of which 543 were excluded because they had undergone other types of hernia repair ( figure 1 ) . seven hundred ten patients were screened for tep eligibility , and 70 were excluded because they had undergone tep with marlex mesh ( phillips petroleum co. , bartlesville , ok , usa ) , were under the age of 18 , or had incomplete data . further review excluded 7 patients because of conversion to open during surgery due to severe adhesions , an irreducible hernia sac , or a densely attached rectus sheath . thus , 640 patients who underwent tep hernia repair with progrip self - adhesive mesh were analyzed . the percentage of obese patients ( bmi 30 ) in the study was 24.4% , and 75.6% were not obese ( bmi < 30 ) . there were 94 patients with direct hernia , 462 with indirect hernia , and 84 with a combination of direct and indirect hernias . the more frequent indication for repair was primary hernia ( 601 ; 93.9% ) compared to recurrent hernia ( 39 ; 6.1% ) . average operation time from incision to closure was 43.9 minutes ( 17 ; range , 2090 ) . all patients were discharged the same day and were scheduled for a 2-week follow - up . cohort study flow diagram showing patient selection and exclusion criteria and the number of patients included in the study analysis . characteristics of patients who underwent tep inguinal hernia repair with self - adhesive , velcro - type progrip mesh ( covidien , north haven , ct , usa ) . unless otherwise specified , data are the number of patients , with the percentage of the study sample in parentheses . group sizes for categories that are less than the total sample are shown . abbreviations : chf , congestive heart failure ; copd , chronic obstructive pulmonary disease ; mi , myocardial infarction ; tep , totally extraperitoneal . early recurrence was reported by 1 patient ( 0.2% ) , who had recurrence within 2 weeks caused by slippage of the mesh and underwent reoperation . seventeen had hematoma ; of those , 2 underwent drainage at 2 weeks , 19 were treated expectantly , and 2 underwent drainage later . at the 2-week follow - up , most of the patients ( 92.2% ) reported no more than minimal pain , whereas 7.8% had notable pain that was managed conservatively with oral analgesics . data are for hernia procedure outcomes in patients treated with tep inguinal hernia repair with self - adhesive , velcro - type progrip mesh . unless otherwise specified , data are the number of patients , with the percentage of the study sample in parentheses . binary logistic regression analysis was performed to determine the relationship between the patient variables and composite score end points . we found that age , ethnicity , bmi , and type of insurance were not associated with composite score . recurrent hernia , unilateral versus bilateral hernia , and anatomic side were associated with composite score . compared with the left - side hernia group , patients who had right - side hernia were 1.54 times more likely to have 1 or more complications ( composite end point ) , but the difference was not statically significant . however , when unilateral occurrence was used as the reference point , patients who had bilateral hernia were 2.8 times more likely to have 1 or more complications ( 95% ci 1.395.80 ; p < .004 ) . the laparoscopic tapp approach was first used in 1982 and was modified in the early 1990s . its rapid rise in popularity worldwide was tempered by increased postoperative complications especially nerve and vascular injuries . with the increasing trend toward laparoscopic repair of inguinal hernia , few studies , either retrospective or prospective , have reported the efficacy of tep repair with progrip mesh . the present study represents a large private practice group 's experience in patients with inguinal hernia who underwent this procedure . the principal finding of the study is that the tep approach is safe and effective . comparison of complications such as nerve damage , small bowel obstruction , bladder injury , vascular injury , chronic pain , and hernia recurrence in both open and laparoscopic inguinal hernia repair with fixation are well chronicled . progrip is a polyester mesh with a top layer of resorbable polylactic acid microgrips that integrates into the tissue , providing an alternative to mesh fixation complications in both open and laparoscopic inguinal hernia repair . furthermore , the anticipated challenge in obtaining the technical skill ( increased learning curve for tep compared with that for lichtenstein and tapp ) needed for the tep method did not result in a significant increase in complication rates . we agree in our surgical practice that the learning curve for tep is longer than that needed for tapp and open inguinal hernia repair . as reported by others , once the tep method was mastered , the learning curve for the placement of progrip mesh was reduced considerably . , there was one case of conversion to open due to adhesion , with operation time from incision to closure ranging from 17 to 80 minutes . the surgical appeal of the laparoscopic tep approach is the low rate of postoperative pain and a faster return to work . the repair is much more durable than that of open approaches ( recurrence range , 6.2%10% ) . in our study the major downsides of laparoscopic hernia repair are reported to be the increased risk of specific complications , including vascular injury , nerve injury , and migration of mesh ; the necessity for mesh fixation with clips or screws ; and increased operative time . it provides an alternative to mesh fixation , thereby eliminating possible glue or hardware complications with no increase in the recurrence rate . the findings in our study contribute to the growing body of knowledge that mesh can be used effectively most of the time without tacking , suturing , or fixation by other devices . in our experience , deployment of self - adhesive mesh did not require additional time compared to fixation of nongripping meshes . we chose progrip mesh to circumvent mesh migration , which can result in early recurrence . progrip is a lightweight ( 38 g / m ) , macroporous ( 1.1 1.7 mm ) , polyester mesh with resorbable polylactic acid microgrips . its hydrophilic , macroporous , polyester monofilament features enhance fast and durable tissue ingrowth . also its characteristic stickiness offers the crucial advantage that it can adhere to the psoas muscle posteriorly and the peritoneum can not slip beneath the mesh , which is one of the principal causes of early recurrence . the follow - up period in this study was 2 weeks ; mesh migration usually appears as an early recurrence , as in the case of 1 patient in this series . morrison and jacobs examined recurrence at 1 , 3 , and 52 weeks after surgery . only one patient had recurrence at 1 week , with no additional recurrence in the 3- and 52-week follow - ups . another study , however , showed no recurrence at 2 weeks , 1 month , and 1 year after surgery . koch et al reported that nonfixation ( self - adhesive ) mesh was not associated with an increased recurrence rate , postoperative complications , or increased cost . messaris et al reported that general laparoscopic surgeons using the tep approach can obtain improved patient outcomes with less pain , low recurrence rates , and a low prevalence of chronic pain . these results are not limited to specialized hernia centers but appear to be consistent with the observations described in our study . the study is limited in that it is retrospective , without a long - term follow - up . the typical long - term follow - up after inguinal hernia repair is from 2.5 to 5 years . our evaluation of the short - term recurrence rate is a measure of the surgeon 's technical skill , which may be a proxy indicator for long - term effectiveness of the repair , since a poorly performed surgical repair with short - term recurrence is unlikely to have a favorable outcome 2 to 3 years after the surgery . however , the studies referenced in this paper demonstrate that recurrence with the tep procedure occurs early , with no additional recurrence during long - term follow - up . in routine surgical practice , these procedures are performed as elective outpatient surgeries , and most patients have a 2-week follow - up . our patients were counseled before and after surgery by one of our authors ( c.j.s . ) , who is a nurse practitioner . at their 2-week follow - up , the patients were given instructions by the nurse to return as needed with any problems , such as hematoma , infection , numbness , paresthesia , pain , seroma , or any recurrent or new bulge . we purport that our outcome would have been the same if we had observed the patients up to a year or longer . we did not perform a head - to - head comparison of progrip mesh to other meshes in our study . in a limited study comparing progrip and polypropylene mesh in 60 patients , there was no statistically significant difference between the two meshes in recurrence , vessel injury , hematoma , infection , and complications from anesthesia . however , patients with progrip hernia repair returned to daily activities earlier than those having polypropylene repair ( 4 days vs 20 days ) . in our recent single - practice experience using progrip mesh , we conclude that the use of self - adhesive , velcro - type mesh in laparoscopic tep hernia repair is associated with reduced pain , low rates of early recurrence , infection , hematoma , and improved patient satisfaction . in our experience , this study lays the foundation for prospective and long - term follow - up studies that could include application of innovative technologies such as single - port tep in hernia repair .

background and objectives : laparoscopic preperitoneal hernia repair with mesh has been reported to result in improved patient outcomes . however , there are few published data on the use of a totally extraperitoneal ( tep ) approach . the purpose of this study was to present our experience and evaluate early outcomes of tep inguinal hernia repair with self - adhesive mesh.methods:this cohort study was a retrospective review of patients who underwent laparoscopic tep inguinal hernial repair from april 4 , 2010 , through july 22 , 2014 . data assessed were age , sex , body mass index ( bmi ) , hernia repair indications , hernia type , pain , paresthesia , occurrence ( bilateral or unilateral ) , recurrence , and patient satisfaction . descriptive and regression analyses were performed.results:six hundred forty patients underwent laparoscopic preperitoneal hernia surgery with self - adhesive mesh . the average age was 56 years , nearly all were men ( 95.8% ) , and the mean bmi was 26.2 kg / m2 . cases involved primary hernia more frequently than recurrent hernia ( 94% vs 6% ; p < .05 ) . after surgery , 92% of the patients reported no more than minimal pain , < 1% reported paresthesia , and 0.2% had early recurrence . there were 7 conversions to an open procedure . the patients had no adverse reactions to anesthesia and no bladder injury . postoperative acute pain or recurrence was not explained by demographics , bmi , or preoperative pain . there were significant associations of hernia side , recurrence , occurrence , and sex with composite end points . nearly all patients ( 98% ) were satisfied with the outcome.conclusion:the use of self - adhesive , velcro - type mesh in laparoscopic tep inguinal hernia repair is associated with reduced pain ; low rates of early recurrence , infection , and hematoma ; and improved patient satisfaction .

INTRODUCTION METHODS Data Collection and Analysis Details of the Operative Technique Entrance Into the Preperitoneal Space Dissection Steps Mesh Placement Statistical Analysis RESULTS Patient Characteristics and TEP Hernia Operation Variables TEP Outcome Variables Relationship Between Patient Variables and TEP Outcomes DISCUSSION CONCLUSION

this tissue is specialized in storing lipids and supplying fuel to the whole body whenever it is necessary . in order to face energetic requirements , however , adipose tissue is not only a reserve organ ; it is also an endocrine organ able to release hormones , peptides , and cytokines ( adipokines ) that affect both the energetic status and the immune system . leptin is one of the most important hormones secreted by adipose tissue and its implication in energetic homeostasis at central level has been largely described . rather than a fasting signal , leptin is a signal of starvation , in that a falling serum leptin concentration leads to neurohumoral and behavioural changes , trying to preserve energy reserves for vital functions . thus , during fasting period and after reduction of body fat mass , there is a decrease in leptin levels that leads to a reduction in total energy expenditure to provide enough energy for the function of vital organs , that is , the brain , the heart , and the liver . even though these effects of leptin decrease are aimed to improve the survival chances under starving conditions , the fall in leptin levels may lead to immune suppression , in addition to other neuroendocrine alterations affecting adrenal , thyroid , and sexual / reproductive function . at least , these alterations observed during fasting parallel the decrease in circulating leptin levels . in fact , both ob / ob mice ( lacking leptin secretion ) and db / db mice ( lacking leptin receptor ) are not only obese but they also show the immune / endocrine deficiencies observed during starvation [ 5 , 7 ] . moreover , it has been recently shown that leptin withdrawal during 8 days in experimental animals leads to the same effects regarding central control of endocrine systems including sexual function . even in humans , it has been found that leptin levels are associated with immune response in malnourished infants , which have low plasma leptin and impaired immune response . the leptin receptor ob - rb is expressed by b and t lymphocytes , suggesting that leptin regulates directly the b and t cell responses . the leptin modulation of the immune system is also mediated by the regulation of hematopoiesis and lymphopoiesis [ 7 , 11 ] thus , seven days of provision of recombinant leptin promoted substantial lymphopoiesis , with a twofold increase of the numbers of b cells in the marrow of obese mice while doubling and tripling , respectively , the numbers of pre - b and immature b cells . leptin treatment also facilitated myelopoiesis such that the marrow of the obese mice contained normal numbers of monocytes and granulocytes after 7 days . modulation of the immune system by leptin is exerted at the development , proliferation , antiapoptotic , maturation , and activation levels . in fact , leptin receptors have been found in neutrophils , monocytes , and lymphocytes , and the leptin receptor belongs to the family of class i cytokine receptors . moreover , leptin activates similar signaling pathways to those engaged by other members of the family . the overall leptin action in the immune system is a proinflammatory effect , activating proinflammatory cells , promoting t - helper 1 responses , and mediating the production of the other proinflammatory cytokines , such as tumor necrosis factor- , interleukin ( il)-2 , or il-6 . , we will summarize data from literature that demonstrate the positive regulation of the immune response by leptin ( figure 1 ) . the primary amino acid sequence of leptin indicated that it could belong to the long - chain helical cytokine family , such as il-2 , il-12 , and gh . in fact , leptin receptor ( ob - r ) shows sequence homology to members of class i cytokine receptor ( gp130 ) superfamily that includes the receptor for il-6 , leucocyte inhibitory factor ( lif ) , and granulocyte colony - stimulating factor ( g - csf ) . moreover , ob - r has been shown to have the signaling capabilities of il-6-type cytokine receptors , activating jak - stat , pi3k , and mapk signaling pathways . in this context , a role for leptin in the regulation of innate immunity has been proposed [ 14 , 17 ] . consistent with this role of leptin in the mechanisms of immune response and host defense , circulating leptin levels are increased upon infectious and inflammatory stimuli such as lps , turpentine , and cytokines [ 18 , 19 ] . on the other hand , unlike other members of the il-6 family , it is not clear that leptin may induce the expression of acute phase proteins , and contradictory data have been provided [ 19 , 20 ] . studies of rodents with genetic abnormalities in leptin or leptin receptors revealed obesity - related deficits in macrophage phagocytosis and the expression of proinflammatory cytokines both in vivo and in vitro , whereas exogenous leptin upregulated both phagocytosis and the production of cytokines . besides , phenotypic abnormalities in macrophages from leptin - deficient , obese mice have been found . more importantly , leptin deficiency increases susceptibility to infectious and inflammatory stimuli and is associated with dysregulation of cytokine production . more specifically , murine leptin deficiency alters kupffer cell production of cytokines that regulate the innate immune system . in this context , leptin levels increase acutely during infection and inflammation , and may represent a protective component of the host response to inflammation . human leptin was found to stimulate proliferation and activation of human circulating monocytes in vitro , promoting the expression of activation markers : cd69 , cd25 , cd38 , and cd71 , in addition to increasing the expression of monocytes surface markers , such as hla - dr , cd11b , and cd11c . besides , leptin potentiates the stimulatory effect of lps or pma on the proliferation and activation of human monocytes . moreover , leptin dose - dependently stimulates the production of proinflammatory cytokines by monocytes , that is , tnf- and il-6 and enhances cc - chemokine ligand expression in cultured murine macrophage , through activation of a jak2-stat3 pathway . the presence of both isoforms of the leptin receptor was also assessed . later , it was found that leptin directly induces the secretion of interleukin 1 receptor antagonist in human monocytes and upregulates ip-10 ( interferon - gamma - inducible protein ) in monocytic cells . moreover , in human monocytes it has been shown that leptin increased both statin - inhibitable free radical and cholesterol productions in vitro . in addition , it accelerates cholesteryl ester accumulation in human monocyte - derived macrophages by increasing acat-1 expression via jak2 and pi3k , thereby suppressing cholesterol efflux . in alveolar macrophages leptin a possible role of leptin as a trophic factor to prevent apoptosis has also been found in serum - depleted human monocytes , which is further supporting the role of leptin as a growth factor for the monocyte . moreover , leptin regulates monocyte function as assessed by in vitro experiments measuring free radical production . thus , leptin was shown to stimulate the oxidative burst in control monocytes , and binding of leptin at the macrophage cell surface increases lipoprotein lipase expression through oxidative stress- and pkc - dependent pathways . in this line finally , leptin could act as a monocyte / macrophage chemoattractant inducing in vitro maximal chemotactic responses at 1 ng / ml , mediating the inflammatory infiltrate , and inducing tissue factor expression in human peripheral blood mononuclear cells . on the other hand , human leptin seems to downregulate oxidative burst in previously activated monocytes . dendritic cells belong more to the same cell lineage than to monocytes / macrophages and also present leptin receptors ( obrb ) on the cell surface . thus , leptin has also been found to increase the production of il-8 , il-12 , il-6 , and tnf- , whereas it decreases mip-1- production by dendritic cells . similar to leptin effect on monocytes , it may increase the survival of dendritic cells , and it may also increase the expression of surface molecules , such as cd1a , cd80 , cd83 , or cd86 . leptin induces functional and morphological changes in human dendritic cells ( dcs ) , directing them towards th1 priming and promoting dc survival via the pi3k - akt signaling pathway . the involvement of leptin signaling in dcs survival and maturation has been observed in leptin receptor- ( ob - r- ) deficient db / db mice . db / db mice displayed markedly reduced expression of costimulatory molecules and a th2-type cytokine profile , with poor capacity to stimulate allogenic t cell proliferation . consistent with their impaired dcs phenotype and function , db / db dcs showed significantly downregulated activities of the pi3k / akt pathway as well as stat-3 and ikappab - alpha . moreover , the reduced dcs yielded in db / db bone marrow culture was attributed to significantly increased apoptosis , which was associated with dysregulated expression of bcl-2 family genes . the expression of leptin and leptin receptors has been demonstrated on mast cells , suggesting paracrine and/or autocrine immunomodulatory effects of leptin on mast cells . human polymorphonuclear neutrophils ( pmn ) have been found to express leptin receptor in vitro and in vivo [ 41 , 42 ] . however , zarkesh - esfahani et al . demonstrated that neutrophils only express the short form of the leptin receptor , which is enough to signal inside the cell , enhancing the expression of cd11b and preventing apoptosis [ 42 , 43 ] . leptin delayed the cleavage of bid and bax , the mitochondrial release of cytochrome c and second mitochondria - derived activator of caspase , as well as the activation of both caspase-8 and caspase-3 in these cells . therefore , leptin seems to behave as a survival cytokine for pmn , similar to g - csf . in fact , the chemoattractant effect is comparable to that of well - known formyl - methionyl - leucyl - phenylalanine ( fmlp ) . otherwise , when leptin acts as a uremic toxin it interferes with neutrophil chemotaxis and inhibits neutrophil migration in response to classical neutrophilic chemoattractants and leptin is endowed with chemotactic activity toward neutrophils . the two activities , inhibition of the cell response to chemokines and stimulation of neutrophil migration , could be detected at similar concentrations . on the contrary , neutrophils exposed to leptin did not display detectable [ ca2+]i mobilization , oxidant production , or beta2-integrin upregulation . moreover , leptin also has a stimulating effect on intracellular hydrogen peroxide production in pmn although this effect seems to be mediated by the activation of monocytes . more specifically , leptin modulates neutrophil phagocytosis of klebsiella pneumoniae and in diabetic patients ' neutrophils , an increase in leptin serum levels has been correlated with the degree of cd11b expression . on eosinophils , leptin could upregulate cell surface expression of adhesion molecules icam-1 and cd18 but suppress icam-3 and l - selectin . moreover , leptin could also stimulate the chemokinesis of eosinophils and induce the release of inflammatory cytokines il-1beta and il-6 and chemokines il-8 , growth - related oncogene - alpha , and mcp-1 . moreover , the leptin receptors can signal in nk cells , since leptin activates stat3 phosphorylation in nk cells . moreover , leptin increases il-2 and perforin gene expression at the transcription levels in nk cells . consistent with this role of leptin regulating nk cells , db / db mice have been found to have impaired nk cell function [ 50 , 51 ] . leptin actions in nk cells include cell maturation , differentiation , activation , and cytotoxicity . leptin enhances both the development and the activation of nk cells , increasing il-12 and reducing the expression of il-15 . besides , leptin mediates the activation of nk cells indirectly by modulation of il-1 , il-6 , and tnf- by monocytes and macrophages . the role of leptin in cell - mediated immunity has been obtained working with ob / ob mice . , these animals show atrophy of lymphoid organs [ 57 ] , with a decrease in the number of circulating t cells and an increase in the number of monocytes . besides , ob / ob mice have a decrease in the number of tnkcd4 + in the liver . the ability of leptin preventing thymic atrophia is due to a direct antiapoptotic effect on t cells . thus , leptin treatment increases thymic expression of interleukin-7 , an important soluble thymocyte growth factor produced by medullary thymic epithelial cells ( tecs ) . the hormone leptin has an intrathymic role in maintaining healthy thymic epithelium and promoting thymopoiesis , which is revealed when thymus homeostasis is perturbed by endotoxemia . in this case , leptin treatment decreases in vivo apoptosis of double positive thymocytes and promotes proliferation of double negative thymocytes . in the thymus , fyn acts as a tyrosine kinase that transduces the leptin signal independently of jak2 activation and mediates some of the immunomodulatory effects of leptin in this tissue . the tyrosine kinase , fyn , is constitutively associated with the ob - r in thymic cells . following a leptin stimulus , fyn undergoes an activating tyrosine phosphorylation and a transient association with irs1 . acute deficiency of leptin has a potent effect on the immune system , which is even higher than that observed in ob / ob mice ( genetic defect ) . acute hypoleptinemic mice show a higher decrease in the total number of thymocytes , and double number of apoptotic cells than ob / ob mice . moreover , the acute deficiency of leptin also causes a decrease in splenic cellularity , which does not occur in ob / ob mice , even though they have a smaller spleen than control mice . both ob / ob and db / db mice show defects in cell - mediated immune response which lead to impaired reaction of delayed hypersensibility , suppression of skin allograft rejection , and inhibition of footpad swelling by recall antigens [ 6 , 5557 ] . in recent studies , leptin enhanced in vivo lymphocyte proliferation in siberian hamsters ( phodopus sungorus ) and increased splenocyte proliferation in mice as well as it increased percentage of t cells , particularly cd4 + th cells , in peritoneal fluid of patients with endometriosis . lord et al . 1998 , demonstrated that mouse lymphocytes express the long form of leptin receptor , and that leptin modulates in these cells cytokine production . the proliferative response to leptin in mice seems to be produced in naive t cells ( cd4+cd45ra+ ) , whereas it has been shown that leptin inhibits proliferation of memory t cells ( cd4+cd45ro+ ) . leptin provides a survival signal in double positive t cells ( cd4+cd8 + ) and simple positive cd4+cd8 thymocytes during thymic maturation . in addition , leptin promotes the expression of adhesion molecules in cd4 + t cells , such as vla-2 ( cd49b ) or icam-1 ( cd54 ) [ 5 , 18 ] . more recently , we have reviewed the role of human leptin on t cell response . human leptin alone is not able to activate human peripheral blood lymphocytes in vitro even though leptin receptor is present and activated in t lymphocytes upon leptin stimulation , fully triggering the intracellular signal transduction , as we have also assessed [ 60 , 61 ] . however , when t lymphocytes are costimulated with pha or concanavalin a ( con a ) , leptin dose - dependently enhances the proliferation and activation of cultured t lymphocytes , achieving maximal effect at 10 nm concentration . thus , leptin increases the expression of early activation markers such as cd69 , as well as the expression of late activation markers , such as cd25 , or cd71 in both cd4 + and cd8 + t lymphocytes in the presence of suboptimal concentrations of activators such as pha ( 2 g / ml ) and after stimulation with pma - ionomycin . however , when maximal concentrations of pha or con a are employed , leptin has no further effect . these effects of leptin on t lymphocytes are observed even in the absence of monocytes , suggesting a direct effect of human leptin on circulating t lymphocytes when they are costimulated . the activation of t cells induces the expression of the long isoform of the ob receptor . the need for costimulation with mitogens to get the effect of leptin in lymphocytes may be partly explained by this effect of activation , increasing leptin receptor expression in t lymphocytes . besides , these data suggest that the leptin receptor may be regulated in a similar way to other cytokine receptors , such as the il-2 receptor ( cd25 ) . human leptin not only modulates the activation and proliferation of human t lymphocytes but also enhances cytokine production induced by submaximal concentrations of pha . thus , human leptin enhances the production of il-2 and ifn- in stimulated t lymphocytes . it had been previously shown in mice that leptin can enhance cognate t cell response , skewing cytokine responses towards a th1 phenotype in mice . these data are in agreement with the observation of the leptin effect on anti - cd3 stimulation of t cells , which increases the production of the proinflammatory cytokine ifn- . the effect of leptin polarizing t cells towards a th1 response seems to be mediated by stimulating the synthesis of il-2 , il-12 , and ifn - gamma and the inhibition of the production of il-10 and il-4 [ 36 , 62 ] . th1 polarization has been correlated with hyperleptinemia in hemodialysis patients and the protection of ob / ob mice in th1- as well as in th2-dependent inflammation is provided by a decreased expression of the key transcription factors for th1 and th2 polarization , t - bet and gata-3 in naive ob / ob t cells . in this case , leptin was found to be necessary in t - helper 1- ( th1- ) dependent inflammatory processes acting as a critical regulator of cd4 + t cell polarization in vitro and in vivo . these data regarding leptin modulation of th1-type cytokine production are in line with the observed effects of leptin stimulating tnf- and il-6 production by monocytes , further suggesting the possible role of human leptin in the regulation of the immune system inducing a proinflammatory response . on peripheral blood mononuclear cells of patients with ankylosing spondylitis , leptin exerts proinflammatory effect as well as it enhances the proinflammatory cytokines in normal colonocytes and in ht29 xenografted tumor colonocytes . colonocyte - derived products after leptin treatment stimulated perforin and granzyme b expressions in normal cd8 ( + ) t cells in vitro . in addition , leptin alone or in combination with il-1 enhanced the expression of inos and cox-2 and production of no , pge ( 2 ) , il-6 , and il-8 . the effects of leptin are mediated through activation of transcription factor nuclear factor - kappab ( nf - kappab ) and mitogen - activated protein kinase ( mapk ) pathway c - jun nh ( 2)-terminal kinase ( jnk).the increased synthesis of proinflammatory mediators is mediated by nitric oxide ( no ) in human osteoarthritic cartilage . on the other hand , leptin promotes t cell survival and jurkat t lymphocytes survival by modulating the expression of antiapoptotic proteins , such as bcl - xl in stress - induced apoptosis . this trophic effect of leptin on t cell is consistent with the reduction in lymphocyte numbers observed in fasted mice , that might be explained by the acute decrease in leptin levels [ 7 , 19 ] . the role of leptin modulating t cell function in humans has been finally defined by clinical studies in specific and rare cases of patients with monogenic obesity . in human obesity due to congenital leptin deficiency , there is a t cell hyporesponsiveness ( in addition to the expected neuroendocrine / metabolic dysfunction ) , and not only leptin treatment in these patients is an effective lowering body weight but it can also revert t cell response to mitogen activation in vitro . in addition , leptin has been necessary in nonagenarians ( 90 years old ) to maintain functional naive cd8 t cells and a healthy immune system . leptin can act as a negative signal for the proliferation of human foxp3 ( + ) cd4 ( + ) cd25 ( + ) regulatory t ( t(reg ) ) cells . in vitro , neutralization with leptin monoclonal antibody ( mab ) , during anti - cd3 and anti - cd28 stimulation , resulted in t(reg ) cell proliferation , which was interleukin-2 ( il-2 ) dependent . together with the finding of enhanced proliferation of t(reg ) cells observed in leptin- and obr - deficient mice , these results suggest a potential for therapeutic interventions in immune and autoimmune diseases . in conclusion , leptin plays a role in the activation of the immune system , and it is a mediator of inflammation . in this context , leptin may be one of the mediators responsible for the low - level systemic inflammation that may be present in metabolic syndrome - associated chronic pathologies such as atherosclerosis , which is associated with obesity , especially central obesity . therefore , leptin may be considered as a therapeutic target in some clinical situations , such as proinflammatory states or autoimmune diseases , to control an excess of immune response , as well as in other clinical situations , such as starving , to control an excess of exercise , or immune deficiencies , to improve the impaired immune response . that is why the investigation of the role of leptin in the regulation of the immune response remains a challenge for the future .

adipose tissue is an active endocrine organ that secretes various humoral factors ( adipokines ) , and its shift to production of proinflammatory cytokines in obesity likely contributes to the low - level systemic inflammation that may be present in metabolic syndrome - associated chronic pathologies such as atherosclerosis . leptin is one of the most important hormones secreted by adipocytes , with a variety of physiological roles related to the control of metabolism and energy homeostasis . one of these functions is the connection between nutritional status and immune competence . the adipocyte - derived hormone leptin has been shown to regulate the immune response , innate and adaptive response , both in normal and pathological conditions . the role of leptin in regulating immune response has been assessed in vitro as well as in clinical studies . it has been shown that conditions of reduced leptin production are associated with increased infection susceptibility . conversely , immune - mediated disorders such as autoimmune diseases are associated with increased secretion of leptin and production of proinflammatory pathogenic cytokines . thus , leptin is a mediator of the inflammatory response .

1. Introduction 2. Leptin Activation of Innate Immunity 3. Leptin Modulation of Adaptive Immune Response 4. Conclusions

metanephric stromal tumour ( mst ) , first described in 2000 by argani et al . , is a rare , purely stromal specific renal neoplasm that mainly affects children . its characteristic microscopic appearance and immunohistochemical profile helps to differentiate it from congenital mesoblastic nephroma ( cmn ) and clear cell clear cell sarcoma of kidney ( ccsk ) . since then , there have been only five case reports of this tumour in the english literature . its recognition is essential as it spares the patient from unnecessary potentially toxic adjuvant chemotherapy . a case of paediatric metanephric stromal tumour is described and the clinical presentation , radiological and pathological findings , differential diagnoses and biological behaviour are discussed . he had one episode of hematuria at two years of age but no other complaints such as abdominal pain , fever , loss of appetite or weight loss . on systemic examination as part of the initial work up , an ultrasonography of abdomen was performed , this showed a partly exophytic hypo - echoic mass arising from the interpolar region , measuring 4.7 4.8 5.3 cm . ultrasound guided biopsy of the renal mass was performed , which on microscopic examination showed a tumour composed of sheets of spindle shaped cells with oval to elongated nuclei and moderate amounts of cytoplasm . sectioning revealed a firm white tumour , 7.5 5.5 4.5 cm replacing most of the kidney . the neoplasm appeared to abut the pelvis but there was no infiltration into pelvic or perirenal fat [ figure 1 ] . microscopically the tumour had a slightly nodular architecture due to varying cellularity and was composed of spindle cells with thin tapered bland nuclei an indistinct cytoplasm [ figure 2 ] . focally , a concentric arrangement around entrapped tubules and vessels , imparting the onion skin morphology , was noted [ figure 3 ] . the tumour was well demarcated from the adjacent kidney , but without a definite capsule [ figure 4 ] . some blood vessels showed hypercellularity around the endothelium with thickened walls but there were no features of dysplasia [ figure 5 ] . there was no evidence of capsular or vascular invasion , heterologous differentiation or neoplastic epithelium . on immunohistochemistry , the cells were positive for vimentin , focally positive for cd-34 [ figure 6 ] and negative for wt-1 , desmin and smooth muscle actin . gross pathological findings : cut surface of the kidney shows that the tumour was firm grey white , 7.5 5.5 4.5 cm in size , replacing most of the kidney microphotograph of neoplasm showing slightly nodular architecture due to varying cellularity and was composed of spindle cells with thin tapered bland nuclei an indistinct cytoplasm ( hematoxylin and eosin stain , 100 ) microphotograph of neoplasm showing concentric arrangement around entrapped tubules , imparting onion skin appearance ( hematoxylin and eosin stain , 200 ) microphotograph of neoplasm showing well demarcation from the adjacent kidney but without a definite capsule ( hematoxylin and eosin stain , 200 ) microphotograph of neoplasm showing blood vessels having hypercellularity around endothelium with thickened walls but there were no features of dysplasia ( h and e stain , 200 ) immunohistochemical staining for cd 34 showing focal positivity ( 200 ) the origin of mst is not entirely clear , but it is thought to be related to wilm 's tumour , unlike other renal stromal tumours such as cmn , ccsk and rhabdoid tumour of kidney ( rtk ) . beckwith has postulated that mst may represent the result of maturation of intralobar nephrogenic rests ( inr ) with the loss of any active blastemal component . characteristic histological features of mst include ( a ) alternating cellularity that imparts a nodular low power appearance ( b ) onion skin cuffing around entrapped renal tubules ( c ) heterologous differentiation and vascular alterations ( d ) juxta glomerular cell hyperplasia and ( e ) patchy positivity of tumour cells for cd 34 , though variable . the last three features are not present in all the cases.[14 ] our case did not show heterologous differentiation , angiodysplasia of the vessel wall or juxta glomerular cell hyperplasia . however , the other histological features and patchy positivity for cd34 and negativity for desmin helped to exclude other neoplasms in the differential diagnosis . mst is differentiated from cmn by its scalloped , subtly infiltrative border , in contrast with the deeply invasive nature of most cmn . also mst stains for cd34 , while cmn is reported to be positive for desmin . clinically , patients of mst are older than the known upper limit for those with cmn ( cmn is usually a tumour of infancy ) . mst can be differentiated from ccsk by the regular branching capillary vascular pattern which is characteristic of ccsk but absent in mst . the distinction between mst and metanephric adenofibroma ( maf ) was possible due to the absence of discrete epithelial nodules , more characteristic of maf . is an abdominal mass followed by hematuria , recurrent urinary tract infection ( uti ) , incontinence , fever , anemia and hypertension . our patient presented with the complaint of dribbling of urine . as part of the initial work up , ultrasound of the abdomen mst is a benign tumour that is centered in medulla , but , in one case continous extension through bladder into the prostatic urethra has been reported . only three cases , out of the thirty one cases described by argani et al . had a maximum dimension greater than 7.5 cm , the largest in his series measuring 10 cm . none of the five cases reported thereafter [ table 1 ] were larger than 5.5 cm in diameter . most msts were previously classified as congenital mesoblastic nephroma until recently , when beckwith and others re - characterized this neoplasm after reviewing the files of the national wilm 's tumour study pathology centre . an accurate radiological diagnosis is impossible and the role of partial nephrectomy is unclear at this time . at present , all clinical mst should be fully excised in order to establish a definitive diagnosis . once the diagnosis is confirmed , no further adjuvant therapy is required . summary of the 5 cases of metanephric stromal tumour described in the literature after the report of argani et al.:[26 ]

a case of incidentally detected metanephric stromal tumour ( mst ) is reported here . this is a rare , recently recognized pediatric benign stromal specific renal neoplasm . a review of the english literature revealed only five cases after its original description by argani et al . recognition of this entity can spare a child from potentially toxic adjuvant chemotherapy that might be used to treat malignant lesions which are part of the differential diagnosis , particularly clear cell sarcoma of kidney ( ccsk ) .

INTRODUCTION CASE REPORT DISCUSSION

f ) hokkaido sika deer ( cervus nippon yesoensis ) were kept in a pen of about 80 m with a stag and examined between september 20 , 2007 , and january 17 , 2008 , at asahiyama zoological park , hokkaido , japan . three of them ( females a , b and f ) were multiparous females over 3 years old that weighed 81.3 2.1 kg ( mean sd ) and had suckling fawn until august . the others ( females c , d and e ) were nulliparous 1-year - old females that weighed 67.0 1.3 kg . about 1 kg of concentrated feed was supplied daily per animal , with hay and water ad libitum . behaviors of the animals were observed for estrus and copulation visually or by video recording all day long . also , chasing , licking , sniffing , touching and placing the chin on the back were considered as estrous symptoms . the present study was conducted in accordance with the hokkaido university guidelines for the care and use of laboratory animals . the animals were immobilized for examination by intramuscular administration of a mixture containing medetomidine - hcl ( 60 g / kg ; domitor , zenoaq nippon zenyaku kogyo , fukushima , japan ) and ketamine - hcl ( 3 mg / kg ; ketalar , sankyo , tokyo , japan ) using a blow dart . after examination , they were awakened with an intramuscular administration of atipamezole - hcl ( 150 g / kg ; antisedan , zenoaq nippon zenyaku kogyo ) . females were examined at two- or three - day intervals , except for one female that was examined at five- or six - day intervals until december 15 , 2007 ( female f ) . following immobilization , the females were laid in lateral recumbency , and the feces were removed from the rectum manually prior to examination . the ovaries and uteri were examined using ultrasonography ( hs-1500v , honda electronics , aichi , japan ) by insertion into the rectum of a linear transducer ( 10 mhz , hlv-375 m , honda electronics , aichi , japan ) attached to a rigid plastic pipe extender ( length , 60 cm ; diameter , 3.5 cm ) . the transducer was covered with rubber cover filled with conductivity gel , and conductivity gel was also infused into the rectum before transducer insertion . detailed drawings of the ovaries were made to record the diameter and relative position of follicles and the cls . the drawings were used to tabulate follicles 3 mm in diameter within the pair of ovaries of each female for each day of the examination and to construct diameter profiles of uniquely identified follicles from their first appearance at 3 mm in diameter , due to 3 mm being the minimum size observable by ultrasonography , until they could no longer be uniquely identified ( regressed to 3 mm ) . a follicular wave was defined as the synchronous growth of a group of small follicles , and the dominant follicle was defined as a follicle that attained a diameter 7 mm and exceeded the diameter of all others , as the diameter of the ovulated follicle 12 days before ovulation was at least 7 mm . ovulation was defined as the disappearance of the dominant follicle identified during the previous examination , and was confirmed by detection of a cl at the same location afterward . pregnancies were confirmed by the presence of fetuses with a heartbeat , which could be detected on day 20 of pregnancy at the earliest . plasma samples were collected by jugular venipuncture ( edta - loaded vacuum tubes ) at each examination and stored at 20 c until assayed . a pair of ovaries was collected from a female that died in an accident during transportation after the study period . the plasma concentrations of estradiol-17 and progesterone were determined using competitive double - antibody enzyme immunoassays . for the estradiol-17 assay , then the diethyl ether was decanted into a new tube after freezing the plasma . after evaporating the diethyl ether , thereafter , 1 ml of hexane was added again , and all the hexane was discarded using an aspirator . samples were reconstituted with 100 l of assay buffer ( 145 mm nacl , 40 mm na2hpo4 , 0.1% bsa ( w / v ) , ph 7.2 ) . for the progesterone assay , 200 l of plasma were extracted with 2 ml of diethyl ether , and reconstituted with 200 l of assay buffer without delipidation using acetonitrile and hexane . twenty microliters of samples were incubated for 1618 h at 4 c with the primary antisera and hrp - labeled hormone , 100 l each , in the well of a 96-well microplate ( costar 3590 , corning , ny , usa ) coated with the secondary antiserum . after washing all the wells for 4 times with 300 l of washing buffer ( 0.05% tween 80 ) , 150 l of tmb solution ( 5 mm citric acid , 50 mm na2hpo4 , 500 mm uhp , 1 mm tmb and 2% dmso ) was added to each well and incubated for 40 min at 37 c. absorbance of the solution in the wells was read by a microplate reader ( model 550 , bio - rad laboratories , tokyo , japan ) set to 450 nm after stopping the chromogenic reaction with 50 l of 4 n h2so4 . the primary antisera used for assay of estradiol-17 and progesterone were anti - estradiol-17-6-cmo - bsa [ 26 , 27 ] and anti - progesterone-3-cmo - bsa ( 7720 - 0504 , biogenesis , poole , england ) . the antiserum against estradiol-17 cross - reacted with estrone ( 1.0% ) , estradiol-17 ( 1.0% ) , and estradiol-3-benzoate ( 50.0% ) . goat anti - rabbit serum ( 270335 , seikagaku , tokyo , japan ) was used as the secondary antiserum . the assay sensitivities were 4.2 pg / well for estradiol-17 and 4.3 pg / well for progesterone . the intra- and inter - assay coefficients of variation were 3.5 and 12.7% for estradiol-17 and 3.2 and 6.8% for progesterone , respectively . the plasma progesterone concentrations on the day that a dominant follicle was last observed before postconception ovulation in females that formed an acl and on the day that a dominant follicle of the first wave emerged after the first and second copulations reached its maximum size in females that did not form an acl were compared by one - way anova followed by tukey - kramer s hsd as a post hoc test . all analyses were performed using a jmp pro ( version 10.0.0 , sas institute , cary , nc , usa ) . in three females ( group 1 : a , b and c ) , at the first estrus of the breeding season , the dominant follicle of the first wave that emerged after copulation ovulated in the presence of the cl of pregnancy , and an acl formed after postconception ovulation ( figs . 1 and 2fig . 1 . hormonal and ovarian dynamics in female sika deer that conceived at the first estrus ( group 1 : a , b and c ) and second estrus ( group 2 : d , e and f ) of the breeding season . p4 : progesterone . e2 : estradiol-17. ) . postconception ovulations ( disappearance of the dominant follicle ) were confirmed between 820 days after copulation ( fig . 1 ) . there was no return of estrus in the three females , and pregnancies were confirmed by 2629 days after copulation . hormonal and ovarian dynamics in female sika deer that conceived at the first estrus ( group 1 : a , b and c ) and second estrus ( group 2 : d , e and f ) of the breeding season . e2 : estradiol-17. in the other three females ( group 2 : d , e and f ) , estrus returned 1828 days after copulation at the first estrus of the breeding season , and the females copulated again . the cl that formed at the first estrus regressed before the second estrus ( fig . pregnancies were confirmed by 2027 days after the second copulation , and one cl was observed until the end of the study period . in two females of group 1 ( females a and c ) , postconception ovulation was observed before detecting the diameter of the dominant follicle starting to retrocede by observation at the intervals used in the present study . on the other hand , the dominant follicle of the first wave ovulated after detecting that the size had started to decrease in the female b. the dominant follicle of the second wave did not ovulate even though it was bigger at the time of postconception ovulation and reached as big as 16.8 mm in female b ( fig . an increase in plasma estradiol-17 concentrations was observed in all females of group 1 ( 30.6 30.7 pg / ml : table 1 table 1 . estradiol-17 ( e2 ) concentrations of female sika deer in group 1 ( with an acl ) ) . however , there were no estrous symptoms , estrous behavior , or stag interest observed around the days of postconception ovulation . on the other hand , the estradiol-17 concentrations in group 2 did not exceed 10 pg / ml after fertile copulation ( fig . the concentrations of progesterone just before the time of postconception ovulation in group 1 ( 1.4 0.3 ng / ml , table 2table 2 . progesterone ( p4 ) concentrations of female sika deer in groups 1 ( with an acl ) and 2 ( without an acl ) at certain days after copulation ) were significantly lower than that on the day when the dominant follicle of the first wave that emerged after the second copulation attained its maximum size in group 2 ( 2.3 0.2 ng / ml : p < 0.05 ) . the plasma progesterone concentration at the time when the first dominant follicle reached its maximum size after the first copulation in group 2 ( 1.6 0.5 ng / ml ) did not differ from those of the other two periods described above but tended to be low compared with that after the second estrus in group 2 ( p = 0.10 , table 2 ) . after acl formation , the progesterone concentration decreased and increased thereafter in females a and c. in female b , the progesterone concentration dynamics were similar to those of females a and c except that the progesterone concentration had already started to decrease before acl formation . in group 2 , the progesterone concentration increased linearly to a plateau level ( 3.35.1 ng / ml ) after copulation ( fig . all females delivered a healthy fawn normally except female a , which died on day 85 of pregnancy during transportation to another institution after the examination period . in the left ovary of female a , two cls similar to those observed in ultrasonographic images ultrasonographic and macroscopical images of an ovary in female sika deer a. ( a ) ultrasonographic image of an ovary with a corpus luteum ( cl ) and dominant follicle of the first wave on day 8 of pregnancy . ( b ) ultrasonographic image of the same ovary with two cls on day 11 of pregnancy . ( c ) macroscopical images of an ovary with two cls on day 85 of pregnancy obtained after accidental death . ultrasonographic and macroscopical images of an ovary in female sika deer a. ( a ) ultrasonographic image of an ovary with a corpus luteum ( cl ) and dominant follicle of the first wave on day 8 of pregnancy . ( b ) ultrasonographic image of the same ovary with two cls on day 11 of pregnancy . ( c ) macroscopical images of an ovary with two cls on day 85 of pregnancy obtained after accidental death . in present study , acls formed only in females that conceived at the first estrus of the breeding season in the sika deer . this may be due to the low progesterone concentrations in the females in group 1 at the time of postconception ovulation compared with the progesterone level at the time that the first dominant follicle after fertile copulation ( at the second estrus ) reached an ovulatory size in group 2 . therefore , a low level of progesterone could not suppress the increase in lh pulse frequency that leads to an estradiol-17 surge , which was observed in group 1 , and probably a subsequent lh surge . in a previous study , the presence of an increase in estrogen and the effect of estrogen after conception in pregnant females with an acl were already predicted based on the prolonged existence of the estrogen receptor in the uteri of pregnant sika deer with an acl . even though there was no significant difference in the progesterone concentrations at the time of postconception ovulation period in group 1 and the first dominant follicle after unfertile copulation ( at the first estrus ) reached the ovulatory size in group 2 , ovulation of the first dominant follicle after the first copulation did not occurr in group 2 . the reason for this inconsistency is not clear , but the variation in follicular response to gonadotropin was also reported in ewes , which was suggested to be due to difference in intraovarian regulatory mechanisms , such as gonadotropin receptor populations . for further discussion , more detailed and precise hormonal research , including research pertaining to gonadotropin , and research of follicular conditions the dominant follicle of the first wave ovulated after decreasing in diameter , and the dominant follicle of the second wave did not ovulate even though it was bigger than the dominant follicle of the first wave . the mean maximum follicular size in the cyclic cervid was reported to not exceed 12 mm [ 20 , 22 ] , and the same trend was observed in other follicles in the present study . therefore , the dominant follicle of the second wave in female b in the present study can be considered as a cystic follicle , and it may have had an abnormality in response to lh . also , because it is known that there is hypothalamus - pituitary function disorder in cows with a cystic follicle , abnormality in lh secretion may have delayed the timing of the ovulation of first dominant follicle in female b. however , there is no previous report about cystic follicles in cervid species , and more cases and information needs to be gathered for further discussion . in group 1 , the progesterone concentration decreased once or did not increase much after copulation . in ewes , it is known that luteal function at the first estrus of the season is insufficient compared with that during the mid - breeding season . therefore , similar to the case in ewes , cl function at the first estrus of the season in sika deer may also be insufficient . however , even though the progesterone concentration was relatively low after the first estrus in the female of group 2 , it increased linearly thereafter and reached as high as the peak level of cyclic cervid species previously reported [ 22 , 34 ] . the reason for this inconsistency between the two groups is not clear , but one possibility is the presence of an increase in estradiol-17. estradiol reportedly triggers the release of hypophysial oxytocin , and this stimulates release of a small quantity of uterine prostaglandin f2 , which leads to luteolysis . the reason why the cl of pregnancy did not regress completely is unclear , but it might be supported by interferon tau , which is known as the factor of maternal recognition of pregnancy and is also found in cervid species , since it is involved in regulation of luteolysis . this might be due to a low ability to produce progesterone in the acl during the early pregnancy period because it is reported that 3-hydroxysteroid dehydrogenase , the steroidogenic enzyme that synthesizes progesterone , could be detected only in luteal cells located in the peripheral region of the acl until it was fully developed in mid - pregnancy . even though the acl has a low ability to produce progesterone in early development , it can be an additive or assured source of progesterone in the case that the function of the cl of pregnancy is decreased , and it may be able to help to maintain the progesterone level required for maintenance of pregnancy by supporting the cl of pregnancy . in further studies , detailed examinations and analyses using more animals are needed to confirm the present speculations . interestingly , about 80% of the female sika deer conceived at the first estrus of the breeding season , and this number is consistent with the rate of acls found in the wild population . this consistency supports the present results showing that only females that conceived at the first estrus formed an acl and suggests that the timing of conception is related to acl formation . moreover , pregnant females with an acl have heavier fetuses than pregnant females without an acl in those harvested from the same population during the same period , which indicates that females with an acl conceived relatively earlier . the ecological advantage of acl formation is that it enables females to conceive early in the breeding season , as delayed conception leads to delayed parturition , which negatively influences fawn survivability and fertility of the females in the subsequent breeding season . the present study showed the process of acl formation in pregnant sika deer and that the origin of the acl is postconception ovulation , which may occur due to a relatively low ability to produce progesterone in the cl during the first estrous cycle of the breeding season . since lh support the cl ability and also destine follicle to ovulate , measurement of lh is necessary for further study .

generally , sika deer conceive a single fetus , but approximately 80% of pregnant females have two corpora lutea ( cls ) . the function of the accessory cl ( acl ) is unknown ; moreover , the process of acl formation is unclear , and understanding this is necessary to know its role . to elucidate the process of acl formation , the ovarian dynamics of six adult hokkaido sika deer females were examined ultrasonographically together with peripheral estradiol-17 and progesterone concentrations . acls formed in three females that conceived at the first estrus of the breeding season , but not in those females that conceived at the second estrus . after copulation , postconception ovulation of the dominant follicle of the first wave is induced by an increase in estradiol-17 , which leads to formation of an acl . a relatively low concentration of progesterone after the first estrus of the breeding season is considered to be responsible for the increase in estradiol-17 after copulation .

Materials and Methods Results Discussion

the polymorphism of the antimicrobial drug 4-amino - n-(thiazol-2-ylidene)-benzene sulfonamide 1 ( trivial name sulfathiazole ) has been extensively studied and is now a classic example of this phenomenon . to date , five crystalline polymorphs of unsolvated 1 are fully characterized by single - crystal x - ray diffraction and over 100 crystalline solvates . although compound 1 can exist as imino ( 1a ) and amido tautomers ( 1b ) , in the crystal phase it is exclusively found as the imino tautomer 1a . the literature on the polymorphism of 1 can be confusing and contradictory , especially as different authors have used different polymorph numbering schemes . herein we adopt the csd enumeration scheme , and to avoid any possible confusion , this scheme is detailed in table s1 ( supporting information ) , together with the standard unit cell and reduced cell constants . a detailed overview of the preparation and characterization of the polymorphs of 1 has been recently been given by nagy and co - workers , in which they emphasize the difficulties of reproducibly obtaining the pure polymorphic forms by crystallization techniques . all forms crystallize in the monoclinic space group p21/c , although for convenience the alternative setting of p21/n is used in the literature for forms iv and v. forms ii and iv crystallize with one molecule in the asymmetric unit , and the remaining forms have two molecules . a large number of wide - ranging studies on the polymorphism of 1 have been undertaken . even answering the vexed , if important , question of the relative thermodynamic stabilities of the polymorphs of 1 has proved a challenge , due in part to the interconversion between the phases , but also because of their closely similar energies . it is now clear that the order of thermodynamic stability is quite temperature - dependent , and the inconsistencies in the literature regarding this matter have been pointed out recently by croker and co - workers . their own solubility and differential scanning calorimetric measurements suggest that in the temperature range 283323 k the stability order is i < v < iv < ii < iii . above 373 k , the relative order changes and form i becomes progressively more stable . close to the melting points , the relative order is ii < iii < iv < v < i , that is , almost a complete reversal of the room temperature order . in this study , we report high - resolution single crystal x - ray studies on forms i iv and single crystal neutron diffraction studies on forms ii iv at 100 k. we were unable to obtain single crystals of form v of sufficient quality to merit similar investigations on this polymorphic form . multipole refinements and topological analysis of the resulting density models were undertaken using the experimental x - ray structure factors and theoretical static structure factors obtained from periodic density functional theory ( dft ) calculations , and lattice energies were derived from the multipole populations . these results agree reasonably well with theoretical calculations on the lattice energies and intermolecular interaction energies but are insufficiently accurate to determine the relative polymorph stabilities . compound 1 was obtained from commercial sources and recrystallized according to literature procedures to afford the various polymorphs . as discussed previously , these procedures do not consistently afford the pure polymorphs , and in our hands we also found this to be the case . in some cases , we observed concomitant crystallization , and crystals had to be separated by hand and their polymorphic form confirmed by x - ray diffraction . single crystal x - ray diffraction data were collected near 100 k on a bruker - nonius kappaccd ( forms i , ii , and iv ) or bruker axs apex - ii ( form iii ) diffractometer , running under nonius collect or apex-2 software . after collection of the low - order reflection data , the same scan - sets were repeated with 1/10th of the exposure time . these rapid images were used to record the intense low - order data more accurately , including all reflections that were overexposed in the first set of images . the unit cell dimensions used for refinement purposes were determined by postrefinement of the setting angles of a significant portion of the data set , using the scalepack or saint software . the kappaccd frame images were integrated using denzo(smn ) with a sufficiently large spot size ( < 0.85 ) to account for the k1-2 splitting , which becomes quite significant at 50. the resultant raw intensity files from denzo(smn ) were processed using a locally modified version of denzox . an absorption correction by gaussian quadrature was then applied to the reflection data ( except for form iii ) . a second semiempirical correction ( without a theta - dependent correction ) was then applied to remove any residual absorption anisotropy due to the mounting medium and account for other errors such as machine instabilities . the data were scaled and merged using sortav to provide a set of unique reflections without systematic absences . all data sets were essentially complete and highly redundant . a spherical atom refinement using shelxl-2013 was initially undertaken , with full - matrix least - squares on f and using all the unique data . all non - h atoms were allowed anisotropic thermal motion . details of these refinements are given in table 1 . rw = { (w(fo fc))/(w(fo))}. rw = { (w(fo fc))/(w(fo))}. r = [ (fo)]/ [ fo ] . fo ( mean)|/fo ( summation carried out when more than one symmetry equivalent is averaged ) . neutron diffraction data were collected for forms ii , iii , and iv at 100 k on the sxd instrument at the isis spallation neutron source , using the time - of - flight ( tof ) laue diffraction method . reflection intensities were reduced to structure factors ( shelx style hklf 2 ) using standard sxd procedures , as implemented in the computer program sxd2001 . the unit cells used for refinements with shelxl-2013 were taken from the x - ray determinations . anisotropic displacement parameters were used for all atoms , including the h atoms . in the final cycles , the merged and extinction - corrected reflection data obtained from a converged shelxl refinement was used as the input reflection file . rw = { (w(fo fc))/(w(fo))}. rw = { (w(fo fc))/(w(fo))}. r = [(fo)]/ [ fo ] . rint = {n/(n 1}|fo fo(mean)|/fo ( summation is carried out only where more than one symmetry equivalent is averaged ) . the multipole formalism of hansen and coppens as implemented in the xd-2006 program suite was used . the function minimized in the least - squares procedure was w(|fo| the multipole expansion was truncated at the hexadecapole level for the s atoms , the octupole level for the o , n , and c atoms , and the quadrupole level for the h atoms . the importance of employing anisotropic displacement parameters ( adp s ) for h atoms in multipole refinements has been emphasized recently by several authors . the method of madsen ( shade2 program ) is known to provide an excellent approximation to h - atom adp s . for those forms of 1 for which neutron diffraction data were available , models using h atom adp s from the shade2 calculated or the scaled experimental neutron values were carefully compared , and little difference was found . in the final refinements for forms iv , the scaled experimental neutron adp s were used with fixed contributions , while for form i , the shade determined parameters were used in the same way . each pseudoatom was assigned a core and spherical - valence scattering factor derived from the relativistic dirac fock wave functions of su and coppens expanded in terms of the single- functions of bunge , barrientos and bunge . the radial fit of these functions was optimized by refinement of the expansion - contraction parameter . the valence deformation functions for the c , o , and h atoms used a single- slater - type radial function multiplied by the density - normalized spherical harmonics . the radial fits for the chemically distinct atoms were optimized by refinement of their expansion contraction parameters , . the radial functions used for the s atoms were those recommended by dominiak and coppens . for all forms , anharmonic motion for the sulfur atoms examination of the resultant pdf s using the xdpdf module in xd2006 indicated that this modeling was physically reasonable . the successful deconvolution of thermal motion was judged by the hirshfeld rigid bond criterion . scatter plots of the scale factor fobs / fcalc against sin()/ were flat across almost the entire resolution range , while difference fourier maps and residual density analysis showed that , for forms iii and iv , essentially no unmodeled features remained in the data ( figures s1s3 , supporting information ) . for forms i and ii however , some positive residuals were observed , which could be attributed to minor disorder or possibly minor twinning . for form i , there is a single residual peak close to the inversion center at ( 0.5 , 0.5 , 0 ) with an integrated electron density of 0.15 e , while for form ii there are two peaks that could be attributable to the s atoms from a second orientation . there are no previous reports of disorder in any polymorph of 1 , but if it is present for forms i and ii , then it is certainly present at no greater than the 12% level . there is no evidence in the neutron diffraction study for any disorder in ii , and no disorder model was used in the final refinements of the x - ray data . a careful comparison of the resultant multipole models and topological properties shows no evidence of discrepancies between forms i and ii and forms iii and iv which could be attributed to any putative disorder ( see below ) . gas - phase dft calculations on 1 were undertaken with the program gaussian09 at both the experimental and optimized geometries , using several functionals and basis sets . we quote here the results from the optimized geometry with the m02 - 2x functional and using the def2-tzvp basis for all atoms . fully periodic b3lyp calculations based on the experimental crystallographic parameters were also undertaken with crystal09 , using standard 6 - 31 g * * basis sets for all centers . lattice energies were calculated from the multipole models using the xd2006 suite and also using the gavezzotti atom atom coulomb london topological analysis on the gas - phase wave function was undertaken using the aimall software package , while hirshfeld surface analysis was conducted using the crystalexplorer program . to obtain a benchmark interaction energy , an mp2 complete basis set ( cbs ) limit was estimated using results from aug - cc - pvtz and aug - cc - pvqz basis sets . the hf component of the energy was extrapolated using the formula of karton , and the correlation energies were extrapolated using the formula of halkier . correlation was also performed at the df - lccsd(t0)/aug - cc - pvdz level , comparing the correlation energy with that from df - lmp2/aug - cc - pvdz . the difference in correlation energy was then added to the mp2/cbs total energies , and the resultant energies are referred to as cbs(t ) . counterpoise corrections were not used , as the local correlation methods are bsse free . the molecular structure , crystal packing , and h - bonding intermolecular interactions in polymorphs i iv of 1 are very well established , and only salient features will be discussed here . the two independent molecules for forms i and iii are denoted here as ia / b and iiia / b respectively . thermal ellipsoid plots for ia and ib are shown in figure 1 , and plots for the other forms are in figures s3s7 ( supporting information ) . are essentially identical , while ia and ib have a different conformation , as is clearly visible from the overlay plot shown in figure 2 and the characterizing torsion angles given in table 3 . these differences arise from differing torsions within the two rings and also a 180 rotation of the nh2 group . the differing molecular conformations in form i result in a distinct h - bonding arrangement and crystal packing compared with the other forms , as was previously discussed in detail by blagden et al . and , however , the sulfur atom of the thiazole ring lies close to one of the oxygen atoms of the sulfone group , with an s12o11 distance in the range 2.8734(4)2.9848(5 ) , significantly shorter than the sum ( 3.3 ) of their van der waals radii . the gas - phase structure ( optimized from the experimental geometry , figure s8 , supporting information ) has the same short so = s interaction ( 2.74 ) . this intramolecular interaction is clearly detectable in the topological analysis of the electron density in all forms , and its importance in locking the molecular conformation in 1 is discussed in further detail below . ortep plots of molecules ia ( top ) and ib ( bottom ) showing the atomic labeling scheme , with thermal ellipsoids drawn at the 50% probability level . anisotropic thermal parameters for h atoms were calculated using the shade procedure . molecular best - fit overlay plot ( a ) forms green , mol . 2 yellow ; form ii , red ; form iii mol . 1 , purple , mol . conformation 10 ( see text ) . in principle , neutron diffraction studies should provide more accurate anisotropic displacement parameters ( adp s ) than conventional x - ray studies , though in practice this is not always the case , for well - known reasons . on the basis of the hirshfeld rigid bond criterion , the x - ray derived adp s ( after multipole refinement ) appear slightly more reliable . for form ii , the average mean - square displacement amplitudes ( -msda s ) are 0.0019 ( 0.0026 ) for x - ray ( neutron ) , and for form iv they are 0.0017 ( 0.0020 ) for the atoms with anisotropic thermal parameters . several features are consistently observed for all polymorphs , in both the x - ray and neutron refinements . the adp of the thiazole sulfur atom is consistently larger and more anisotropic than that of the sulfone sulfur atom . the elongation perpendicular to the ring is clearly visible in figure 1 and figures s4s7 ( supporting information ) [ mean ueq - thiazole / ueq - sulfone = 1.73 , mean 1/3 for thiazole and sulfone are 3.30 , 1.64 respectively ] . this feature of the thiazole s atom is also observed in some other structures containing thiazole rings , for which adp s are available ( see figure s9 , supporting information ) . to ascertain whether this was due to genuine thermal motion , rather than a disguised disorder ( and nonplanarity ) in the thiazole ring , variable temperature x - ray diffraction data on form ii in the temperature range 100200 k were obtained . the same crystal was used for all data sets and the resolution ( sin / = 0.7 ) and data processing protocols were identical . analysis of the uij tensors of both sulfur atoms showed a linear dependence of components between 200 and 100 k ( figure s10 , supporting information ) . this is the expected behavior for a quantum oscillator and suggests that the adp for the thiazole s atom is representative of true thermal motion rather than a convolution of static or dynamic disorder . in our case , the msda s are not zero when extrapolated to 0 k , presumably due to systematic errors in the adp s ( possibly due to some anharmonicity ) . while the thiazole ring in the imino tautomer 1a is not formally aromatic , the sp hybridization of all three c atoms imposes planarity on the ring , and the contributions to the atomic displacement parameters from the computed frequencies of the internal modes are shown in figure s11 ( supporting information ) . they are consistent with an extended thermal motion of the s atom perpendicular to the ring , but it should be stressed that for heavy atoms such as sulfur , the internal modes make quite minor contributions to the observed adp , which is dominated by the low frequency modes s for all non - h atoms in the x - ray structures is their general similarity in all the polymorphic forms , suggesting the observed adp s reflect molecular vibrations that are hardly differentiated by the potential field due to the crystal packing . whitten and spackman have compared adp s using a quantitative similarity index s12 = 100(1 r12 ) , where r12 measures the overlap between the probability densities functions described by two displacement tensors u1 and u2 . this procedure has been coded into the simadp routine of wingx , in which the two molecules or fragments to be compared are rotated to minimize the discrepancy in their positional coordinates , and the orthogonalized uij tensors are then compared . since s12 does not provide a direct measure of the relative orientation of the eigenvectors of the tensors ( particularly if the tensors are close to isotropic ) , a combined figure of merit ( fom ) based on the similarity index s12 , reigval ( an r value based on the magnitudes of corresponding eigenvalues ) and rmseigvec ( the rms angles between corresponding eigenvectors ) is also computed . a perfect fit gives a fom of 0.0 and a value less than 0.05 indicates a very close fit . these results provide quantitative confirmation that corresponding atomic adp s in forms ii , iii , and iv are extremely similar the noticeably worse fits associated with comparisons involving form i may be due in part to its different conformation . the hirshfeld surface , defined as the surface where wa(r ) = promolecule(r)/procrystal(r ) = 0.5 , has been proposed as a useful graphical tool for examining the differing intermolecular interactions in polymorphic systems . one such example of its use in characterizing the differences in polymorphs is the case of carbamazepine . this surface is , of course , just one of many possible molecular surfaces , but it has the unique property of encoding the intermolecular contacts from its very definition . the hirshfeld surfaces for all individual molecules of 1 are shown in figure 3 , where the normalized contact distance ( dnorm ) is color - mapped onto the surface . red points mark intermolecular atomic contacts shorter than , while blue points mark contacts longer than the van der waals contact . it is immediately visually obvious that the sulfathiazole molecules in forms ii iv have similar intermolecular contacts , while those in form i are different from each other and also from forms ii iv . the so - called fingerprint plots , where the di and de distribution of surface points is shown as a frequency - coded scatter plot , are capable of providing useful quantitative information about the relative proportions of differing types of intermolecular contact . the fingerprint plot for form iv is shown in figure 4 , specifically broken down into contributions from the ch , hh , nh , oh , and sh contacts which together make up 91.2% of the surface . the fingerprint plots for all forms are shown in figure s12 ( supporting information ) . the differing types of h - bonding intermolecular interactions are indicated as types 18 and average distances given in table s12 , supporting information . iv compared with form i are clearly obvious from this graphical representation . in particular , although the n ho and n hn hydrogen bonding networks in the various polymorphs of 1 have been discussed in detail with reference to the different packing arrangements , it is clear from these fingerprint plots that the ch and hh contacts also make up a significant portion of the hirshfeld surface and so may make a considerable contribution to the intermolecular interaction energies and lattice energies . fingerprint plots of form iv showing the contributions from ( a ) all intermolecular contacts , ( b ) ch contacts ( 22.4% ) , ( c ) hh contacts ( 26.2% ) , ( d ) nh contacts ( 11.2% ) , ( e ) oh ( 22.2% ) , and ( f ) sh contacts ( 9.2% ) . de and di represent the distances from the surface to nearest external and internal atoms , respectively . the color coding gray - blue - cyan represents increasing numbers of surface contributors at individual de / di points . the electron density in the six independent experimental molecules ( ia , ib , ii , iiia , iiib , and iv ) and the theoretical optimized structures were subjected to a quantum theory of atoms in molecules ( qtaim ) analysis . the topological properties at the bond critical points ( bcp s ) for a few selected bonds are given in table 5 , and a full list is given in table s13 ( supporting information ) . since in this study we have effectively six different experimental determinations of these properties , the sample mean and standard deviation were computed and are also given in the tables . the experimental molecular graphs are all homeomorphic , and a representative plot for form iv is shown in figure 5a . bond paths and associated bcp s were detected for all the conventional covalent bonds . the experimental electron densities at the bcp s for all forms agree surprisingly well , and the theoretical value is within three standard deviations of the experimental sample mean in virtually all cases . as is commonly observed , the laplacian values , especially for the polar covalent bonds , show slightly greater discrepancies between theory and experiment . this is primarily due to differences in 3 , arising from the slightly differing positions of the bcp along the bond path . in particular for the s(11)n(10 ) bond , the magnitude of the laplacian is very sensitive to the position of the bcp , and there is a linear dependence of the laplacian on the percentage displacement of the bcp along the bond vector ( see figure s13 , supporting information ) . molecular graphs of ( a ) experimental form iv , ( b ) theoretical conformer 10 , ( c ) theoretical conformer 1180 . atomic color coding : h pale blue , c gray , n blue , o red , s orange ; bond critical points are shown as small red spheres , and ring critical points are shown as small yellow spheres . first six lines correspond to experimental forms ia , ib , ii , iiia , iiib , iv , respectively ; the next line ( italic ) corresponds to reference density from wave function of optimized geometry , and the final two lines ( bold ) are the sample mean and sample standard deviation for the experimental data . perhaps the most interesting feature in the molecular graphs is the bond path associated with the s12o11 intramolecular interaction . this feature was observed in all molecules and suggests it may be responsible for the observed molecular conformation . a representative plot of the laplacian in the plane of this interaction is shown in figure 6 , while a complete set of plots is given in the supporting information ( figure s14 ) . a local charge concentration at the o atom is linked , via the bond path , to an area of relative charge depletion on the s atom , suggesting that this interaction is primarily electrostatic in nature , that is , so(=s ) . this view is confirmed by the electrostatic potential shown in figure 7 and s15 ( supporting information ) where a relatively positive zone on the s atom ( in green ) is close to the negatively charged o atom ( in red ) . the source function at the so bcp as a reference point is also consistent with this view , as almost all atomic basins have a noticeable influence on the electron density ; that is , the source is highly delocalized ( see figure s16a , supporting information ) . plot of the laplacian function in form iiia through the s12n1o11 plane , showing the bond paths and bond ( red circles ) and ring ( yellow circles ) critical points associated with the s12o11 intramolecular interaction . electrostatic potential ( e ) for form iv mapped onto the 0.5 e electron density isosurface . the potential at + 1.495 e is shown in purple and 0.044 e in red . in a charge density study by guru row and co - workers on the closely related molecule 2-(4-amino - benzosulfonimido)-5-methyl-3h-1,3,4-thiadiazole ( trivial name sulfamethizole ) and its salts , a closely similar intramolecular so(=s ) interaction has been observed . recently , jackson et al . have discussed the importance of so ( and similar ) interactions in locking the molecular configuration in a number of thiophene based systems . they conclude that in general this so interaction is not the dominating factor in determining the molecular conformation , and x ho interactions were shown , in certain cases , to be energetically more favorable . in view of these results , we have examined the conformation of 1 in more detail , specifically the effect of driving the s11n10c11s12 torsion angle . two low energy conformations were observed ( figure s8 , tables s14 and s15 , supporting information ) , one where is close to zero ( as found in the experimental structures , conformation 10 ) , and one where is 180 , conformation 1180 engendering a significant n ho interaction . the molecular graphs for these two conformations are shown in figure 5b , c and demonstrate the presence of bond paths for the respective weak intramolecular interactions . the source function for conformation 1180 ( figure s16b , supporting information ) is consistent with the interpretation of the n the evolution of the total energy and the adjacent c111s11n10c11 torsion angle as a function of is shown in figure s17 ( supporting information ) and indicates a barrier of 50 kj mol to interconversion between conformers . this barrier presumably arises because of partial loss of character in the iminium c11n10 bond ( mean experimental distance 1.327(1 ) , optimized theoretical distance 1.292 ) during the rotation . the c11n10 internuclear distance increases by less than 0.01 during the rotation , but the delocalization index (c11,n10 ) decreases from 1.325 to 1.275 , consistent with a small loss of character . interaction is marginally more stable by 6 kj mol in the gas phase but has never been observed in an experimental structure . it is interesting to speculate why this is the case , but the most likely reason is that the various intermolecular interactions involving this h atom in the crystal structures [ n hn(imine ) in form i , n n ho in form v ] provide a greater stabilization than can be achieved from the involvement of this group in an intramolecular interaction . this is certainly borne out by the analysis of the h - bond contributions to the lattice energies discussed below . with regard to the idea that the intramolecular so ( and n ho ) interactions have a locking effect on the molecular conformation , some clear evidence for this is provided by the evolution of the c s n - c torsion and the associated so and ho distances , shown in figure s17 ( supporting information ) . this evolution is not smooth , but significant jumps in the torsion are observed , which can be traced to the energetic favorability of these intramolecular interactions . as soon as the driving torsion approaches a value whereby the so ( or n ho ) interactions become sterically feasible , the torsion immediately adjusts to accommodate the interaction . as a result , the so ( or ho ) distances remain quite short , 2.7 ( 1.9 ) , over a significant range of . the calculated barrier indicates that both conformers of the imine tautomer ought to be detectable and their interchange observable by nmr spectroscopy . finally , some mention should be made of the effect of minor disorder on derived topological parameters . as intimated in the experimental section , there are residual density features present for forms i and ii , which could be attributed to some minor disorder . the accepted wisdom is that any disorder in a data set renders that data very suspect , at least in terms of a charge density analysis . in our case , the level of disorder was so low that it could not be satisfactorily modeled by a secondary site and was effectively ignored . one way of quantifying the global effect that any such disorder has on a derived parameter p is through an r(par ) value : where p(model ) is the refined parameter value from the experimental data and p(theor ) is that obtained from theory and the summation is over all experimental measurements of the parameter . table 6 lists the r(par ) values for the derived topological parameters prho = bcp and pdelrho = (bcp ) , where the wave function density is used as the reference theoretical density . as expected , the global agreements between experiment and theoretical parameters are much better for bcp than for (bcp ) , but there is no obvious worsening for forms i and ii ( with minor disorder ) , compared with forms iii and iv ( with no detectable disorder ) . similar results are obtained for other derived topological parameters . in this study at least , we find no evidence that the proposed minor disorder has any detectable deleterious effect on the derived static density . the multipole populations obtained from the least - squares process seem relatively insensitive to errors in the structure factors from the minor disorder . the difficulties in predicting whether a molecule will exhibit polymorphism ( and if so , which form is the thermodynamically most stable one ) are well - known and have been recently summarized by price . since the energy differences between polymorphs may only be on the order of a few kj mol , any prediction of rank - order stabilities is very challenging indeed . the unit cell volumes we obtain for forms i iii at 100 k agree extremely well ( < 0.15% discrepancy ) with the previously reported 100 k cell volumes . solely on the basis of the crystal densities at 100 k ( 150 k for form v ) the expected relative order of thermodynamic stability is v < i < ii < iii < iv , but the presence of strong h - bonding in 1 is very likely to change this ordering . as stated in the introduction , the lattice energy calculation ( laten option in xd2006 ) relies on the estimation of the total intermolecular interaction energies eint , which is decomposed into several terms : the electrostatic term is estimated using the ep / mm method and is considered to be essentially accurate . the induction term is included in the experimentally determined multipole populations ( since these are determined in the crystal environment ) , while the exchange - repulsion and dispersion terms are approximated by atom atom potentials of williams and cox . initial publications by volkov and coppens were very encouraging regarding the comparability of this method with theoretical estimates of the interaction energy , and we were interested to use this approach to determine the relative lattice energies of the polymorphs of sulfathiazole from the charge density analysis . to reassess the accuracy of interaction energies determined from experimental multipole models , we have compared the interaction energies between the two independent molecules in the asymmetric unit of form iii using the interen option in xd2006 and computational methods , including a complete basis set limit calculation ( see experimental section ) , which may be taken as providing a bench mark value . the results are listed in table 7 and demonstrate the importance of including dispersion effects , since the dispersion - corrected functional b97-d gives a value much closer to the bench mark than the standard b3lyp functional . the multipole - derived value is reasonably close to the bench mark value but is clearly not as good as the dispersion - corrected dft method . the lattice energies computed from the experimental multipoles are highly dependent on the exact refinement model used ( table s16 , supporting information ) , in particular on the treatment of the h atom thermal motion . in table 8 , values obtained from the best multipole model are compared with several theoretical estimates , including gavezotti s pixel methodology . all these methods provide estimates of the lattice energy at 0 k , that is , only the enthalpic component . it is clear that they do not even agree on the relative order of stabilities , except that most methods indicate that form i is the least stable . although error estimates for the derived lattice energies are not available in the xd2006 program suite , a study by destro et al . suggests a typical error in the region of 10 kj mol . the discrepancies between experimental lattice energies from our multipole models and several theoretical approaches are in line with this estimate , but it is equally clear that no method is sufficiently accurate to allow a definitive stability order to be determined , at least for sulfathiazole . other methods of using information on the electron density topology to obtain a relative ranking of lattice energies in polymorphs are even more approximate and hence ( generally ) less useful . one such method involves identifying the intermolecular interactions through their qtaim signature the bond path . these bond paths are generally related to well established bonding situations , such as strong and weak h - bonds , and the individual h - bond bonding energies may be estimated using the approximation of espinosa et al . recently , abramov has employed this method to estimate the stability ranking of several polymorphic compounds , including sulfathiazole , for which the relative ranking was ii iii > i > v. given the approximate nature of this method , it is not surprising that the stability ranking differs from other estimations . to investigate this methodology in more detail , the intermolecular interactions that contribute to the total lattice energy calculations provided by the pixel method were analyzed in more detail . the results are summarized in tables s17 and s18 ( supporting information ) . only the intermolecular interactions of the first shell , that is , the closest neighbor h - bond interactions , were taken into consideration . the total intermolecular interaction energies of the first shell are greatest in form i , followed by iii , iv , and ii . however , the total interaction energy within the crystal lattice shows a different ranking stability of ii > iii > iv > i. in the first shell , the intermolecular interactions were limited only to the h - bonds ; however , there are also repulsive interactions that contribute to the total lattice energy . in the case of form i , for example , there is a considerable repulsive interaction of 15.4 kj mol between two iaia molecules ; this is also observed in forms iii and iv , where values of 17 kj mol and 19.0 kj mol , respectively , are found . in form ii , the intermolecular repulsive interaction energies are much smaller , at 3.9 kj mol . these are of comparable magnitudes to the h - bond energies , and we conclude that it is not possible to estimate the relative stability of the polymorphic forms of sulfathiazole only on the basis of the h - bond interactions . the topological analysis of the electron density for the polymorphs of sulfathiazole shows an essentially identical set of properties for all forms , indicating that the potential fields due to the differing crystal packings have little effect on the examined molecular properties . an intramolecular so(=s ) interaction between the thiazole sulfur atom and an oxygen in the sulfone group is consistently observed in all polymorphs . two low energy conformers in the gas phase have been identified , one being very similar to that found in the crystalline phase , while the other exhibiting an n ho interaction of the ring nh proton with a sulfone oxygen atom . the lattice energies obtained from the experimental multipole populations , although in reasonable agreement with those obtained theoretically , do not have the precision and accuracy required to rank the polymorph stabilities of sulfathiazole .

high resolution x - ray diffraction data on forms i iv of sulfathiazole and neutron diffraction data on forms ii iv have been collected at 100 k and analyzed using the atoms in molecules topological approach . the molecular thermal motion as judged by the anisotropic displacement parameters ( adp s ) is very similar in all four forms . the adp of the thiazole sulfur atom had the greatest amplitude perpendicular to the five - membered ring , and analysis of the temperature dependence of the adps indicates that this is due to genuine thermal motion rather than a concealed disorder . a minor disorder ( 12% ) is evident for forms i and ii , but a statistical analysis reveals no deleterious effect on the derived multipole populations . the topological analysis reveals an intramolecular s os interaction , which is consistently present in all experimental topologies . analysis of the gas - phase conformation of the molecule indicates two low - energy theoretical conformers , one of which possesses the same intramolecular s os interaction observed in the experimental studies and the other an s oh n intermolecular interaction . these two interactions appear responsible for locking the molecular conformation . the lattice energies of the various polymorphs computed from the experimental multipole populations are highly dependent on the exact refinement model . they are similar in magnitude to theoretically derived lattice energies , but the relatively high estimated errors mean that this method is insufficiently accurate to allow a definitive stability order for the sulfathiazole polymorphs at 0 k to be determined .

Introduction Experimental Section Results and Discussion Conclusions

lupus anticoagulant ( lac ) , anticardiolipin antibodies ( acl ) and anti-2 glycoprotein i antibodies ( a2gpi ) are associated with thrombosis and are included in the international classification criteria for antiphospholipid syndrome ( aps).1 these antiphospholipid antibodies ( apl ) are also associated with obstetrical morbidity , such as recurrent early miscarriage , otherwise unexplained fetal death and preterm delivery for pre - eclampsia or placental insufficiency.2 however , the association between specific apl and pregnancy complications has not been precisely defined , and results from published studies have varied.3 also , the prognostic value of the three accepted apl in the prediction of pregnancy outcome is not well established . the promisse study ( predictors of pregnancy outcome : biomarkers in antiphospholipid antibody syndrome and systemic lupus erythematosus ) , a prospective multicentre observational study of pregnancies in women with systemic lupus erythematosus ( sle ) and/or apl , was designed to identify clinical features , laboratory tests and biomarkers that could be used to predict adverse pregnancy outcomes ( apos ) after the first trimester of pregnancy . the initial analysis of data from promisse , published in 2012 , reported that lac , but not acl or a2gpi , was a strong independent predictor of apo in apl - positive patients.4 in this study , we aimed to validate the predictive value of different apls in an independent group of patients enrolled subsequent to those reported in our previous paper . all consecutive promisse patients with apl who finished their pregnancies between april 2011 and january 2015 are included ; the previous study reported apl - positive patients who delivered between september 2003 and march 2011.4 inclusion and exclusion criteria are described elsewhere.4 5 briefly , consecutive patients , aged 1845 years , with singleton intrauterine pregnancy were enrolled before 18 weeks of gestation at six sites in north america and one in the uk . the screening visit included medical history , physical examination and laboratory tests , including apl . laboratory tests were repeated during the second ( 2023 weeks of gestation ) and third trimesters ( 3235 weeks of gestation ) of pregnancy and at 3 months post partum . apl assays were performed in core laboratories as previously described and following the international guidelines for aps laboratory criteria.4 5 for lac determination , three screening tests ( dilute russell 's viper venom time ( drvvt ) , dilute prothrombin time ( dpt ) and lac - sensitive test for activated partial thromboplastin time ( aptt ) ) with confirmation were performed . our previous report4 included patients with low apl titre , defined as being negative for lac and having acl or a2gpi titres < 40 iu / ml . in the present study , only the presence of acl and/or a2gpi titres igg or igm 40 gpl or mpl units , respectively , and/or lac was considered positive , in accordance with sapporo criteria.1 apos were determined as reported by the patients obstetrician and included in the medical record . in equivocal cases , obstetrical members of the promisse team adjudicated causes of fetal demise . apos in promisse were defined as : fetal death after 12 weeks of gestation , neonatal death before hospital discharge due to complications of prematurity , preterm delivery before 36 weeks of gestation due to gestational hypertension , pre - eclampsia or placental insufficiency and small - for - gestational - age ( sga ) neonate ( birth weight , fifth percentile).4 5 other aetiologies for apos were not included in the analyses . data are expressed as number ( percentage ) , mean ( sd ) or median ( interquartile ) . the association of patient characteristics with apos was evaluated using the fisher 's exact or mann whitney tests . all consecutive promisse patients with apl who finished their pregnancies between april 2011 and january 2015 are included ; the previous study reported apl - positive patients who delivered between september 2003 and march 2011.4 inclusion and exclusion criteria are described elsewhere.4 5 briefly , consecutive patients , aged 1845 years , with singleton intrauterine pregnancy were enrolled before 18 weeks of gestation at six sites in north america and one in the uk . the screening visit included medical history , physical examination and laboratory tests , including apl . laboratory tests were repeated during the second ( 2023 weeks of gestation ) and third trimesters ( 3235 weeks of gestation ) of pregnancy and at 3 months post partum . apl assays were performed in core laboratories as previously described and following the international guidelines for aps laboratory criteria.4 5 for lac determination , three screening tests ( dilute russell 's viper venom time ( drvvt ) , dilute prothrombin time ( dpt ) and lac - sensitive test for activated partial thromboplastin time ( aptt ) ) with confirmation were performed . our previous report4 included patients with low apl titre , defined as being negative for lac and having acl or a2gpi titres < 40 iu / ml . in the present study , only the presence of acl and/or a2gpi titres igg or igm 40 gpl or mpl units , respectively , and/or lac apos were determined as reported by the patients obstetrician and included in the medical record . in equivocal cases , obstetrical members of the promisse team adjudicated causes of fetal demise . apos in promisse were defined as : fetal death after 12 weeks of gestation , neonatal death before hospital discharge due to complications of prematurity , preterm delivery before 36 weeks of gestation due to gestational hypertension , pre - eclampsia or placental insufficiency and small - for - gestational - age ( sga ) neonate ( birth weight , fifth percentile).4 5 other aetiologies for apos were not included in the analyses . data are expressed as number ( percentage ) , mean ( sd ) or median ( interquartile ) . the association of patient characteristics with apos was evaluated using the fisher 's exact or mann whitney tests . forty - four new apl - positive patients were enrolled in this study between april 2011 and january 2015 ( table 1 ) . baseline characteristics of the study population * fisher 's exact or mann whitney tests compared patients with apos to patients without apos . comparison was done between groups < 25 vs 25 . apl positivity for each test was defined as lupus anticoagulant : rvvt , dilute tti or ptt la with confirmation ; acl : igg 40 gpl units ; igm 40 mpl units ; and anti-2gpi : igg 40 gpl units ; igm 40 mpl units . to be considered positive , each test met these criteria at least twice between 6 weeks and 5 years apart of which one must be during the promisse pregnancy at a core lab.4 triple apl positivity was defined as having all three apl tests positive . acl , anticardiolipin antibodies ; apl , antiphospholipid antibodies ; apos , adverse pregnancy outcomes ; aps , antiphospholipid syndrome ; a2gpi , anti-2 glycoprotein i antibodies ; bmi , body mass index ; iu , international unit ; ivig , intravenous immunoglobulin therapy ; lac , lupus anticoagulant ; sle , systemic lupus erythematosus . thirteen patients had any apos ( table 2 ) , which occurred primarily during the second trimester of pregnancy . description of the 13 patients with adverse pregnancy outcomes acl , anticardiolipin antibodies ; apl , antiphospholipid antibodies ; apos , adverse pregnancy outcomes ; aps , antiphospholipid syndrome ; asa , aspirin ; a2gpi , anti-2 glycoprotein i antibodies ; hcq , hydroxychloroquinine ; hellp , haemolysis elevated liver enzyme and low platelet count syndrome ; hep , low molecular weight heparin ; iugr , intrauterine growth restriction ; ivig , intravenous immunoglobulin therapy ; lac , lupus anticoagulant ; sga , small for gestational age neonate ( birth weight below the fifth percentile ) ; sle , systemic lupus erythematosus ; wg , weeks of gestation . age , race and ethnicity were similar in patients with and without apos . patients with apos had higher body mass index ( bmi ) than patients without apos ( p=0.04 ) . clinical aps and history of thrombosis were significantly associated with apos ( p=0.004 ) , whereas the diagnosis of sle was not associated with apos ( table 1 ) . the majority of the patients were treated with aspirin and/or low molecular weight heparin ( n=42 ) . given that few patients were untreated , no differences in pregnancy outcomes were evident in patients receiving these therapies . only two patients in this study did not receive antithrombotic prophylaxis ; both were lac negative and had successful pregnancies . the frequency of treatment with hydroxychloroquine was similar in those with and without apos . among lac - positive patients , 53% ( 9/17 ) had apos , including 29% with fetal death , while in lac - negative patients 17% ( 4/24 ) had apos with no fetal deaths . lac was present at screening in 69% of the apo group compared with 27% of the non - apos group ( p=0.01 ; table 1 ) . adverse pregnancy outcomes among lac - positive and lac - negative patients preterm delivery due to placental - related diseases : delivery before 36 weeks of gestation due to gestational hypertension , pre - eclampsia or placental insufficiency . apos , adverse pregnancy outcomes ; lac , lupus anticoagulant ; sga , small for gestational - age neonate ( birth weight below the fifth percentile ) . the subgroup of patients with both prior thrombosis and lac positivity were at very high risk of apos ( occurring in 78% in those patients ) . there was no difference in the frequency of acl igg between patients with and without apos ( 69% vs 55% , respectively , p=0.37 ) . moreover , lac was also present in six of nine patients who were acl igg positive and had apos . a similar result was found for a2gpi igg ( 61% vs 50% , p=0.48 ) , and lac was present in five of eight patients who were a2gpi positive and had apos . apos occurred in five of the six patients who were positive for all three apl tests . of laboratory tests measured during the second trimester , when the majority of apos occurred , lac remained the only apl associated with apos . of note , five patients had pregnancy complications ( two hellp pre - eclampsia after 36 weeks of gestation and three sga < 10th percentile ) that did not fulfil the promisse study definition of apos . among those patients , four of five were lac positive . when the definition of apos is expanded to include these five patients yielding a total of 18 apo , the rate of apos was significantly higher in lac - positive patients compared with lac - negative patients ( 76% vs 21% , p=0.01 ) . forty - four new apl - positive patients were enrolled in this study between april 2011 and january 2015 ( table 1 ) . baseline characteristics of the study population * fisher 's exact or mann whitney tests compared patients with apos to patients without apos . comparison was done between groups < 25 vs 25 . apl positivity for each test was defined as lupus anticoagulant : rvvt , dilute tti or ptt la with confirmation ; acl : igg 40 gpl units ; igm 40 mpl units ; and anti-2gpi : igg 40 gpl units ; igm 40 mpl units . to be considered positive , each test met these criteria at least twice between 6 weeks and 5 years apart of which one must be during the promisse pregnancy at a core lab.4 triple apl positivity was defined as having all three apl tests positive . acl , anticardiolipin antibodies ; apl , antiphospholipid antibodies ; apos , adverse pregnancy outcomes ; aps , antiphospholipid syndrome ; a2gpi , anti-2 glycoprotein i antibodies ; bmi , body mass index ; iu , international unit ; ivig , intravenous immunoglobulin therapy ; lac , lupus anticoagulant ; sle , systemic lupus erythematosus . thirteen patients had any apos ( table 2 ) , which occurred primarily during the second trimester of pregnancy . description of the 13 patients with adverse pregnancy outcomes acl , anticardiolipin antibodies ; apl , antiphospholipid antibodies ; apos , adverse pregnancy outcomes ; aps , antiphospholipid syndrome ; asa , aspirin ; a2gpi , anti-2 glycoprotein i antibodies ; hcq , hydroxychloroquinine ; hellp , haemolysis elevated liver enzyme and low platelet count syndrome ; hep , low molecular weight heparin ; iugr , intrauterine growth restriction ; ivig , intravenous immunoglobulin therapy ; lac , lupus anticoagulant ; sga , small for gestational age neonate ( birth weight below the fifth percentile ) ; sle , systemic lupus erythematosus ; wg , weeks of gestation . patients with apos had higher body mass index ( bmi ) than patients without apos ( p=0.04 ) . clinical aps and history of thrombosis were significantly associated with apos ( p=0.004 ) , whereas the diagnosis of sle was not associated with apos ( table 1 ) . the majority of the patients were treated with aspirin and/or low molecular weight heparin ( n=42 ) . given that few patients were untreated , no differences in pregnancy outcomes were evident in patients receiving these therapies . only two patients in this study did not receive antithrombotic prophylaxis ; both were lac negative and had successful pregnancies . among lac - positive patients , 53% ( 9/17 ) had apos , including 29% with fetal death , while in lac - negative patients 17% ( 4/24 ) had apos with no fetal deaths . lac was present at screening in 69% of the apo group compared with 27% of the non - apos group ( p=0.01 ; table 1 ) . adverse pregnancy outcomes among lac - positive and lac - negative patients preterm delivery due to placental - related diseases : delivery before 36 weeks of gestation due to gestational hypertension , pre - eclampsia or placental insufficiency . apos , adverse pregnancy outcomes ; lac , lupus anticoagulant ; sga , small for gestational - age neonate ( birth weight below the fifth percentile ) . the subgroup of patients with both prior thrombosis and lac positivity were at very high risk of apos ( occurring in 78% in those patients ) . there was no difference in the frequency of acl igg between patients with and without apos ( 69% vs 55% , respectively , p=0.37 ) . moreover , lac was also present in six of nine patients who were acl igg positive and had apos . a similar result was found for a2gpi igg ( 61% vs 50% , p=0.48 ) , and lac was present in five of eight patients who were a2gpi positive and had apos . apos occurred in five of the six patients who were positive for all three apl tests . of laboratory tests measured during the second trimester , when the majority of apos occurred , lac remained the only apl associated with apos . of note , five patients had pregnancy complications ( two hellp pre - eclampsia after 36 weeks of gestation and three sga < 10th percentile ) that did not fulfil the promisse study definition of apos . among those patients , four of five were lac positive . when the definition of apos is expanded to include these five patients yielding a total of 18 apo , the rate of apos was significantly higher in lac - positive patients compared with lac - negative patients ( 76% vs 21% , p=0.01 ) . in this report , we show that lac was the only apl associated with apos after the first trimester , confirming the findings from our previous study in an independent group of apl - positive patients.4 we also confirmed that clinical aps and history of thrombosis are strong risk factors for apos.4 despite the small sample size , the present study has strengths , including prospective design and multicentre recruitment of a precisely characterised , homogeneous study population with regard to apl determinations . all apl assays were performed in core laboratories and international classification criteria were strictly followed . we determined lac to be present if any of three screening tests ( drvvt , dpt or aptt ) followed by confirming tests were abnormal , because any single positive test was not predictive of outcomes and no single test was superior.4 hence , in clinical practice , excluding lac with a single screening test may be insufficient , but this approach may be impractical . the main limitation was the inability to perform a multivariate analysis to adjust for potential confounders because of the small number of patients and apos . our previous report described findings from a prospective cohort of 144 patients from promisse.4 differences in study design make comparison of our results with those published in other studies difficult . consistent with our findings , helgadottir et al6 reported that lac , but not a2gpi nor acl , was the only apl associated with a history of fetal death after 26 weeks of gestation in a retrospective study , which included 105 cases compared with 262 controls with live births . data prospectively and retrospectively collected on 247 patients with obstetrical aps from the european registry of aps showed that lac and triple apl positivity , but not single apl positivity , was associated with early and late obstetrical complications.7 others have argued that lac alone is not as significant a risk factor as is the presence of triple apl positivity suggested to be the independent predictor of poor pregnancy outcomes.8 9 in contrast , our findings show that in two separate prospective cohorts , lac positivity was sufficient to predict risk of apos regardless of the association with acl or a2gpi positivity . because medications were at the discretion of the treating physician , our study was not designed to evaluate treatment . nonetheless , both of the current and our previous report did not show a beneficial effect of low molecular weight heparin . this result may reflect the bias of physicians to treat patients they consider at higher risk for apos more intensely , or that low molecular weight heparin is not effective.10 11 others reported , in a meta - analysis , no preventive effect of heparin against obstetrical complications . of note , only asymptomatic apl carriers ( patients without any history of thrombosis or obstetrical morbidity ) were included in this meta - analysis , whereas in our study only 40% were asymptomatic carriers.12 this study independently confirmed that lac is the only apl predictor of poor pregnancy outcomes after the first trimester of pregnancy in apl - positive patients .

objectivewe previously reported that lupus anticoagulant ( lac ) is the main predictor of poor pregnancy outcome in antiphospholipid antibody ( apl)-positive patients . we sought to confirm this finding in an independent group of patients who were subsequently recruited into the promisse study.methodsthe promisse study is a multicentre , prospective , observational study of pregnancy outcomes in women with apl and/or systemic lupus erythematosus ( sle ) that enrolled patients from 2003 to 2015 . all consecutive , apl - positive patients from the promisse study who completed their pregnancy between april 2011 and january 2015 ( after the previous promisse report ) are included in the current report . patients were followed monthly until delivery , and apl was tested at first , second and third trimesters of pregnancy and at 12 weeks post partum . adverse pregnancy outcomes ( apos ) were defined as fetal death after 12 weeks of gestation , neonatal death , delivery prior to 36 weeks of gestation due to pre - eclampsia or placental insufficiency or small - for - gestational age ( birth weight < 5th percentile).resultsforty - four apl - positive patients are included in this paper . thirteen patients had apos , which occurred in 80% of cases during the second trimester of pregnancy . lac was present in 69% of patients with apos compared with 27% of patients without apos ( p=0.01 ) . no association was found between anticardiolipin antibodies ( acl ) or anti-2 glycoprotein i antibodies ( a2gpi ) igg or igm positivity and apos . definite antiphospholipid syndrome ( history of thrombosis and/or pregnancy morbidity and apl ) was found in 92% of patients with any apos compared with 45% of patients without apos ( p=0.004 ) . conversely , the frequency of sle was not statistically different between those with and without apos ( 30% vs 39%).conclusionsour findings , in an independent group of apl - positive patients from the promisse study , confirm that lac , but not acl and a2gpi , is predictive of poor pregnancy outcomes after 12 weeks of pregnancy.trial registration numbernct00198068 .

Trial registration number Introduction Patients and methods Study population Data collection and follow-up aPL assays Adverse pregnancy outcomes assessment Statistical analysis Results Baseline characteristics of the study population Analysis of clinical and demographic predictors of APOs Analysis of laboratory variables predictive of APO Discussion Conclusion

les enqutes portant sur les complications associes aux interventions anesthsiques sont une mthode de contrle de la qualit qui identifie les domaines o les soins cliniques et la scurit des patients peuvent tre amliors . la plupart des recherches se sont jusquici bases sur les registres des plaintes rgles et les comptes rendus anonymes , ce qui entrane certaines limites spcifiques . par consquent , afin dvaluer le systme de dclaration des incidents dun hpital , notre tude a t conue de faon dcrire les incidents critiques que les anesthsiologistes ont rapport de faon volontaire et non anonyme via un systme de gestion de linformation en anesthsie . il sagit dune tude de cohorte observationnelle historique portant sur des patients ( gs de plus de 18 ans ) subissant des interventions anesthsiques dans un hpital central de soins tertiaires . une liste de complications comprenant 20 lments , telle que mise au point par la socit nerlandaise des anesthsiologistes , a t complte de faon prospective lors de chaque intervention . tous les incidents critiques enregistrs dans le systme de gestion de linformation en anesthsie ont ensuite t reclasss en 92 incidents critiques diffrents dune manire reproductible . au total , 110 310 interventions ont t ralises chez 65 985 patients , et aprs avoir exclus 158 comptes rendus qui ne dcrivaient pas dincident critique , il restait 3904 incidents critiques dans le cadre de 3807 ( 3,5 % ) interventions anesthsiques . les difficults techniques lies lanesthsie rgionale ( n = 445 ; 40 par 10 000 anesthsies ; intervalle de confiance [ ic ] 95 % , 36 44 ) , lhypotension ( n = 432 ; 39 par 10 000 anesthsies ; ic 95 % , 35 43 ) , et les intubations difficiles non anticipes ( n = 216 ; 20 par 10 000 anesthsies ; ic 95 % , 18 23 ) constituaient les incidents critiques les plus frquemment documents . la mesure prcise et la surveillance des incidents critiques sont essentielles la scurit des patients . malgr le risque de sous - documentation et de mauvaise classification probable des systmes de dclaration manuels , nos rsultats donnent une vue densemble complte concernant la survenue dincidents critiques lis lanesthsie et rapports de faon volontaire . cette vue densemble peut guider la mise au point dun nouveau systme de dclaration des incidents et de stratgies de prvention afin de rduire la survenue future dincidents critiques . the institutional review board ( irb ) of the university medical center utrecht reviewed the study protocol and found that it was not subject to the dutch medical research in human subjects act . therefore , the irb waived the need for informed consent ( 11 - 271/c ; july 5 , 2011 ) . this observational study describes prospectively reported critical incidents and complications relating to anesthesia in patients 18 years and older undergoing any type of anesthetic procedure in a tertiary referral university hospital ( university medical center utrecht , the netherlands ) from january 1 , 2005 to may 18 , 2011 . anesthesiologists and anesthesia registrars voluntarily reported complications and critical incidents on a non - anonymous basis via the 20-item complication list of the netherlands society of anesthesiologists . the reporting system was implemented in september 2004 ; therefore , we chose to evaluate critical incidents reported as of january 1 , 2005 to allow an optimization period of three months . we defined a critical incident as an event that could have led ( if not discovered or corrected in time ) or did lead to an undesirable outcome , i.e. , ranging from increased length of hospital stay to death or permanent disability . we included all anesthesia - related critical incidents that occurred at a time when the patient was under the care of an anesthesiologist and were described in clear detail by a person who either observed or was involved in the critical incident . we included critical incidents that not only seemed preventable ( i.e. , inadequate preoperative screening ) or involved human error ( i.e. , medication error)21 but also were non - preventable ( i.e. , unexpected difficult intubation).3,15,22 critical incidents were reported by anesthesiologists and anesthesia registrars ( reporters ) in the aims on a voluntary and non - anonymous basis . during every anesthetic procedure , a menu item in the aims termed complication is presented by pressing the standard event key start skin closure , at which time , a reporter can complete a standardized computerized audit form . if a critical incident is reported , a drop down menu displays the 20-item complication list ( with miscellaneous as an additional option ) developed by the netherlands society of anesthesiologists ( table 1 ) . thereafter , the incident s grade of severity can be reported and , if deemed necessary , free text can be added . if the complication report is not entered into the database by the end of the day , the anesthesiologist involved receives a reminder e - mail . upon completion , the critical incident report is stored in a database within the aims along with the patient characteristics . the registry also includes a means to assign a pop - up warning for subsequent anesthetic procedures ( i.e. , difficult intubation).table 1classification of critical incidents according to netherlands society of anesthesiologists complication no . incidents ( % of total number of incidents , n = 4,062 ) aspiration54 ( 1.3%)laryngospasm374 ( 9.2%)hypoxemia226 ( 5.6%)hypoventilation195 ( 4.8%)hypertension76 ( 1.9%)hypotension700 ( 17.2%)myocardial ischemia / infarction114 ( 2.8%)cardiac arrhythmia302 ( 7.4%)acute cardiac decompensation26 ( 0.6%)dental lesion36 ( 0.9%)nerve / skin / cornea lesion141 ( 3.5%)lesion through needle puncture127 ( 3.1%)hypothermia79 ( 1.9%)conversion of regional anesthesia / inadequate block416 ( 10.2%)urinary retention19 ( 0.5%)inadequate postoperative analgesia12 ( 0.3%)postoperative agitation18 ( 1.7%)awareness51 ( 1.3%)allergic reaction111 ( 2.7%)transfusion / mediation error106 ( 2.6%)miscellaneous879 ( 21.6% ) classification of critical incidents according to netherlands society of anesthesiologists the currently used 20-item complication list of the netherlands society of anesthesiologists facilitates a generalized classification of critical incidents . after reviewing the critical incident reports , we concluded that we could not base firm conclusions on the classification system as it was too generalized ; therefore , we reclassified all critical incidents . based on the initial classification and comments added by the reporter , we reclassified the critical incidents in keeping with a classification system of the german society of anaesthesiology and intensive care13 which is a more detailed classification system on which to base our conclusions . if no comment was available or the comment was unclear , we consulted the aims to investigate the critical incident in detail . when information was inconsistent , consensus was reached by discussion with two researchers ( j.d.g . and b.v.z . ) . if more than one category was possible for one critical incident , the most appropriate or most severe category was chosen . if different critical incidents occurred during one anesthetic procedure , these were categorized as separate critical incidents . all reports involving death as grade of severity were discussed with all observers ( k.m . chicago , il , usa ) , except for the calculation of the 95% confidence interval ( ci ) according to wilson s formula ( epitools : http://epitools.ausvet.com.au ) . where appropriate , a chi square test or an independent samples student s t test was carried out to display differences between groups . the institutional review board ( irb ) of the university medical center utrecht reviewed the study protocol and found that it was not subject to the dutch medical research in human subjects act . therefore , the irb waived the need for informed consent ( 11 - 271/c ; july 5 , 2011 ) . this observational study describes prospectively reported critical incidents and complications relating to anesthesia in patients 18 years and older undergoing any type of anesthetic procedure in a tertiary referral university hospital ( university medical center utrecht , the netherlands ) from january 1 , 2005 to may 18 , 2011 . anesthesiologists and anesthesia registrars voluntarily reported complications and critical incidents on a non - anonymous basis via the 20-item complication list of the netherlands society of anesthesiologists . the reporting system was implemented in september 2004 ; therefore , we chose to evaluate critical incidents reported as of january 1 , 2005 to allow an optimization period of three months . we defined a critical incident as an event that could have led ( if not discovered or corrected in time ) or did lead to an undesirable outcome , i.e. , ranging from increased length of hospital stay to death or permanent disability . we included all anesthesia - related critical incidents that occurred at a time when the patient was under the care of an anesthesiologist and were described in clear detail by a person who either observed or was involved in the critical incident . we included critical incidents that not only seemed preventable ( i.e. , inadequate preoperative screening ) or involved human error ( i.e. , medication error)21 but also were non - preventable ( i.e. , unexpected difficult intubation).3,15,22 critical incidents were reported by anesthesiologists and anesthesia registrars ( reporters ) in the aims on a voluntary and non - anonymous basis . during every anesthetic procedure , a menu item in the aims termed complication is presented by pressing the standard event key start skin closure , at which time , a reporter can complete a standardized computerized audit form . if a critical incident is reported , a drop down menu displays the 20-item complication list ( with miscellaneous as an additional option ) developed by the netherlands society of anesthesiologists ( table 1 ) . thereafter , the incident s grade of severity can be reported and , if deemed necessary , free text can be added . if the complication report is not entered into the database by the end of the day , the anesthesiologist involved receives a reminder e - mail . upon completion , the critical incident report is stored in a database within the aims along with the patient characteristics . the registry also includes a means to assign a pop - up warning for subsequent anesthetic procedures ( i.e. , difficult intubation).table 1classification of critical incidents according to netherlands society of anesthesiologists complication no . incidents ( % of total number of incidents , n = 4,062 ) aspiration54 ( 1.3%)laryngospasm374 ( 9.2%)hypoxemia226 ( 5.6%)hypoventilation195 ( 4.8%)hypertension76 ( 1.9%)hypotension700 ( 17.2%)myocardial ischemia / infarction114 ( 2.8%)cardiac arrhythmia302 ( 7.4%)acute cardiac decompensation26 ( 0.6%)dental lesion36 ( 0.9%)nerve / skin / cornea lesion141 ( 3.5%)lesion through needle puncture127 ( 3.1%)hypothermia79 ( 1.9%)conversion of regional anesthesia / inadequate block416 ( 10.2%)urinary retention19 ( 0.5%)inadequate postoperative analgesia12 ( 0.3%)postoperative agitation18 ( 1.7%)awareness51 ( 1.3%)allergic reaction111 ( 2.7%)transfusion / mediation error106 ( 2.6%)miscellaneous879 ( 21.6% ) classification of critical incidents according to netherlands society of anesthesiologists the currently used 20-item complication list of the netherlands society of anesthesiologists facilitates a generalized classification of critical incidents . after reviewing the critical incident reports , we concluded that we could not base firm conclusions on the classification system as it was too generalized ; therefore , we reclassified all critical incidents . based on the initial classification and comments added by the reporter , we reclassified the critical incidents in keeping with a classification system of the german society of anaesthesiology and intensive care13 which is a more detailed classification system on which to base our conclusions . if no comment was available or the comment was unclear , we consulted the aims to investigate the critical incident in detail . when information was inconsistent , consensus was reached by discussion with two researchers ( j.d.g . and b.v.z . ) . if more than one category was possible for one critical incident , the most appropriate or most severe category was chosen . if different critical incidents occurred during one anesthetic procedure , these were categorized as separate critical incidents . all reports involving death as grade of severity were discussed with all observers ( k.m . , j.d.g . , and b.v.z . ) . all statistical analyses were performed using spss 17.0 for windows ( spss inc . , chicago , il , usa ) , except for the calculation of the 95% confidence interval ( ci ) according to wilson s formula ( epitools : http://epitools.ausvet.com.au ) . where appropriate , a chi square test or an independent samples student s t test was carried out to display differences between groups . the complication status of 104,133 ( 94.4% ) of 110,310 anesthetic procedures was known ( 95% ci , 94.2 to 94.5 ) ( figure ) . in total , 4,062 events were reported in the aims , and 158 ( 3.9% ) reports were classified as not being a critical incident ( 95% ci , 3.3 to 4.5 ) because they consisted of surgical complications and warnings for a subsequent anesthetic procedure . the remaining 3,904 critical incidents were found in 3,807 of the 110,310 anesthetic procedures ( 354 per 10,000 anesthetics ; 95% ci , 343 to 365 ) . the 3,904 critical incidents consisted of one single critical incident in 3,715 ( 97.6% ) anesthetic procedures , two critical incidents in 87 ( 2.3% ) anesthetic procedures , and three critical incidents in five ( 0.1% ) anesthetic procedures . table 2 shows demographic data of the study population ; no clinically significant differences were found . the largest critical incident categories were cardiovascular incidents , with 1,164 incidents ( 106 per 10,000 anesthetics ) , respiratory problems with 851 incidents ( 77 per 10,000 anesthetics ) , and lesions with 820 incidents ( 74 per 10,000 anesthetics ) ( table 3 ) . the cardiovascular critical incidents consisted mainly of hypotension ; the respiratory problems critical incidents consisted mainly of difficulties to ventilate ( with or without hypoxemia ) , difficulties to intubate , bronchospasm , and laryngospasm ; and the lesion critical incidents consisted mainly of technical difficulties with regional anesthesia ( table 4 ) . the largest groups of reported critical incidents were technical difficulties with regional anesthesia ( 40 per 10,000 anesthetics ) and hypotension ( 39 per 10,000 anesthetics ) ( table 5).figureflow diagram for reclassification of critical incidentstable 2characteristics of study populationtotal number of anestheticsanesthetics with critical incidentscritical incidents per 10,000 anesthetics ( 95% ci ) p value110,3103,807 mean age 52 ( 95% ci , 33 to 69)55 ( 95% ci , 38 to 72)<0.001 sex 0.001 male53,741 ( 48.7%)1,903 ( 50.0% ) female56,569 ( 51.3%)1,904 ( 50.0% ) asa classification < 0.001 i22,148687310 ( 288 to 334 ) ii31,9481,387434 ( 412 to 457 ) iii7,274434597 ( 545 to 654 ) iv25318711 ( 454 to 1,096 ) v100 ( 0 to 7,935 ) not specified48,6861,281263 ( 249 to 278 ) urgent surgery < 0.001 elective89,9233,138349 ( 337 to 361 ) emergency21,210669315 ( 292 to 339)asa = american society of anesthesiologists ; ci = confidence intervaltable 3incidence of critical incidents in the different categories with reported consequence consequence of critical incident critical incident categoryno consequencetemporary consequence without interventionrecovery after intervention(probable ) permanent damagedeathdeath from another causenone specifiedtotal ( per 10,000 anesthetics ; 99% ci)largest individual contribution of an anesthesiologist ( % ) respiratory43828115420111851 ( 77 ; 71 to 84)49 ( 5.8)cardiovascular39737640414002701,164 ( 106 ; 98 to 114)99 ( 8.5)laboratory results620000311 ( 1 ; 0 to 2)4 ( 36.4)central nervous system4541000026112 ( 10 ; 8 to 13)11 ( 9.8)equipment / organization141803102102329 ( 30 ; 26 to 34)30 ( 9.1)detriment / injury44322111700138820 ( 74 ; 68 to 81)36 ( 4.3)medication16795210058323 ( 29 ; 25 to 34)18 ( 5.6)miscellaneous113135111043294 ( 27 ; 23 to 31)44 ( 15.0)total ( per 10,000 anesthetics ; 99% ci)1,750 ( 159 ; 149 to 169)1,231 ( 112 ; 104 to 120)72 ( 7 ; 5 to 9)55 ( 5 ; 4 to 7)43 ( 4 ; 3 to 6)2 ( 0.2 ; 0 to 0.9)751 ( 68 ; 62 to 75)3,904 ( 354 ; 340 to 369)288 ( 7.4)largest individual contribution of an anesthesiologist ( % ) 88 ( 5.0)143 ( 11.6)8 ( 11.3)7 ( 13.7)4 ( 9.3)1 ( 50.0)111 ( 14.7)288 ( 7.4)-the results are limited to those critical incidents for which no greater than 15.0% of the reported incidents were attributed to one anesthesiologistci = confidence intervaltable 4incidence of the various critical incidents after reclassification critical incident no consequencetemporary consequence without interventionrecovery after intervention(probable ) permanent damagedeathdeath from another causenone specifiedtotal ( per 10,000 anesthetics ) respiratory 438 281 15 4 2 0 111 851 ( 77 ) disconnection70000007 ( 1 ) kinking of tube32000016 ( 1 ) accidental extubation1850000225 ( 2 ) unexpected difficult intubation13338100044216 ( 20 ) impossible intubation1374010328 ( 3 ) failed intubation1261000221 ( 2 ) mainstem intubation23000016 ( 1 ) re - intubation262000313 ( 1 ) laryngospasm49431000699 ( 9 ) bronchospasm314100001082 ( 7 ) aspiration7160110833 ( 3 ) hypoventilation / hypoxemia5865110012137 ( 12 ) difficult ventilation * 27241100760 ( 5 ) pulmonary edema01100013 ( 0 ) vomiting with laryngeal mask airway * 560000112 ( 1 ) failure of laryngeal mask airway * 56110000673 ( 7 ) other respiratory disturbances1683100432 ( 3 ) cardiovascular 397 376 40 41 40 0 270 1,164 ( 106 ) hypotension1681219300131432 ( 39 ) hypertension181221001548 ( 4 ) arrhythmia5251203035143 ( 13 ) tachycardia36000009 ( 1 ) bradycardia25110000137 ( 3 ) hypovolemia2468171217025163 ( 15 ) heart failure2132440227 ( 2 ) pulmonary embolism00011002 ( 0.2 ) circulatory arrest40362125014109 ( 10 ) myocardial infarction1635501333 ( 3 ) temporary st - segmental changes * 274131002597 ( 9 ) hemodynamic instability due to sepsis * 330240517 ( 2 ) vagal response to needle puncture * 3380000445 ( 4 ) other cardiovascular disturbances00001001 ( 0.1 ) laboratory results 6 2 0 0 0 0 3 11 ( 0.3 ) anemia10000001 ( 0.1 ) disturbances of electrolytes30000025 ( 0.5 ) disturbances of serum glucose12000003 ( 0.3 ) other disturbances in laboratory results10000012 ( 0.2 ) central nervous system 45 41 0 0 0 0 26 112 ( 10 ) central anticholinergic syndrome01000001 ( 0.1 ) cerebral ischemia10000012 ( 0.2 ) seizure680000519 ( 2 ) awareness * 22000037 ( 1 ) postoperative agitation * 990000321 ( 2 ) reaction of patient during anesthesia without awareness * 242000001357 ( 5 ) transurethral resection ( tur ) syndrome * 21000014 ( 0.4 ) other neurological disturbances10000001 ( 0.1 ) equipment / organization 141 80 3 1 0 2 102 329 ( 30 ) anesthetic machine1860000226 ( 2 ) ecg - monitor10000001 ( 0.1 ) monitor of blood pressure420101917 ( 2 ) external pacemaker10000001 ( 0.1 ) pulse oximeter00000011 ( 0.1 ) intubation set21000014 ( 0.4 ) drug application23000027 ( 1 ) insufficient documentation * 14400001634 ( 3 ) inadequate preoperative screening * 15500001535 ( 3 ) inadequate preoperative preparation * 252200001966 ( 6 ) organizational problem * 3830300129101 ( 9 ) failure of electronic anesthesia information management system * 820000111 ( 1 ) electricity failure * 32000016 ( 1 ) other kind of equipment1030000619 ( 2 ) detriment / injury 443 221 11 7 0 0 138 820 ( 74 ) technical difficulties with regional anesthesia29573200075445 ( 40 ) total spinal * 31100000243 ( 4 ) spinal tap * 19240000447 ( 4 ) failed or repeated puncture ( blood vessels)1570000830 ( 3 ) accidental puncture of artery * 24132000746 ( 4 ) teeth475600527 ( 2 ) vessels43000029 ( 1 ) muscles / soft tissue330000410 ( 1 ) skin / lip17250000547(4 ) airway23000016 ( 1 ) eyes03010026 ( 1 ) epistaxis15150000333 ( 3 ) pneumothorax / hemothorax05100017 ( 1 ) nerves080000412 ( 1 ) failed urinary catheter * 6110000825 ( 2 ) accidental removal of intravenous catheter * 780000419 ( 2 ) other detriment / injury12100037 ( 1 ) medication 167 95 2 1 0 0 58 323 ( 29 ) inappropriate drug * 1840000527 ( 2 ) overdosage * 32150000451 ( 5 ) side effect * 450000615 ( 1 ) wrong drug * 2160000431 ( 3 ) intravenous injection given subcutaneously * 343711001487 ( 8) inadequate administration of medication * 301210001861 ( 6 ) residual muscle paralysis after extubation * 19110000333 ( 3 ) accidental intravenous administration of local anesthetic * 41000005 ( 0.5 ) other * 540000413 ( 1 ) miscellaneous 113 135 1 1 1 0 43 294 ( 27 ) nausea / vomiting1160000825 ( 2 ) anaphylactic shock2210010327 ( 2 ) allergic reaction * 453810001195 ( 9 ) shivering10000001 ( 0.1 ) hypothermia28470000479 ( 7 ) transfusion reaction14000027 ( 1 ) oliguria / acute renal failure10000012 ( 0.2 ) urinary retention * 460000616 ( 1 ) insufficient postoperative pain management * 25000029 ( 1 ) positioning * 1140000015 ( 1 ) failed gavage * 11000002 ( 0.2 ) other630100616 ( 1 ) total 1,750 1,231 72 55 43 2 751 3,904 ( 354 ) ecg = electrocardiogram*categories added to the critical incident list of the german society of anaesthesiology and intensive caretable 5top ten most frequently reported critical incidentscritical incidentcritical incident categoryno of critical incidents ( per 10,000 anesthetics ; 99% ci ) n = 3,904technical difficulties with regional anesthesiadetriment / injury445 ( 40 ; 36 to 6)hypotensioncardiovascular432 ( 39 ; 35 to 44)unexpected difficult intubationrespiratory216 ( 20 ; 16 to 23)hypovolemiacardiovascular163 ( 15 ; 12 to 18)arrhythmiacardiovascular143 ( 13 ; 11 to 16)hypoventilation / hypoxemiarespiratory137 ( 12 ; 10 to 16)circulatory arrestcardiovascular109 ( 10 ; 8 to 13)organizational problemequipment / organization101 ( 9 ; 7 to 12)laryngospasmrespiratory99 ( 9 ; 7 to 12)allergic reactionmiscellaneous95 ( 9 ; 7 to 11)ci = confidence interval flow diagram for reclassification of critical incidents characteristics of study population asa = american society of anesthesiologists ; ci = confidence interval incidence of critical incidents in the different categories with reported consequence the results are limited to those critical incidents for which no greater than 15.0% of the reported incidents were attributed to one anesthesiologist ci = confidence interval incidence of the various critical incidents after reclassification ecg = electrocardiogram * categories added to the critical incident list of the german society of anaesthesiology and intensive care top ten most frequently reported critical incidents ci = confidence interval critical incidents with ( probable ) permanent damage consisted primarily of respiratory and cardiovascular critical incidents . forty - three ( 1.1% of all critical incidents ) critical incidents led to the death of a patient receiving an anesthetic procedure ; forty of those critical incidents comprised a cardiovascular incident ranging from arrhythmia to myocardial infarction ( table 6).table 6critical incidents with ( probable ) permanent damage or death as consequencecritical incidentpermanent damage ( per 10,000 anesthetics)death ( per 10,000 anesthetics ) respiratory 4 ( 0.4)2 ( 0.2 ) impossible intubation01 ( 0.1 ) aspiration1 ( 0.1)1 ( 0.1 ) hypoventilation / hypoxemia1 ( 0.1)0 difficult ventilation1 ( 0.1)0 other respiratory disturbances1 ( 0.1)0 cardiovascular 41 ( 3.7)40 ( 3.6 ) hypotension3 ( 0.3)0 hypertension1 ( 0.1)0 arrhythmia03 ( 0.3 ) hypovolemia12 ( 1.1)17 ( 1.5 ) heart failure4 ( 0.4)4 ( 0.4 ) pulmonary embolism1 ( 0.1)1 ( 0.1 ) circulatory arrest12 ( 1.1)5 ( 0.5 ) myocardial infarction5 ( 0.5)5 ( 0.5 ) temporary st - segmental changes1 ( 0.1)0 hemodynamic instability due to sepsis2 ( 0.2)4 ( 0.4 ) other cardiovascular disturbances01 ( 0.1 ) equipment / organization 1 ( 0.1)0 monitor of blood pressure1 ( 0.1)0 detriment / injury 7 ( 0.6)0 teeth6 ( 0.5)0 eyes1 ( 0.1)0 medication 1 ( 0.1)0 intravenous injection given subcutaneously1 ( 0.1)0 miscellaneous 1 ( 0.1)1 ( 0.1 ) anaphylactic shock01 ( 0.1 ) other1 ( 0.1)0 total ( per 10,000 anesthetics ; 99% ci ) 55 ( 5 ; 4 to 7)43 ( 4 ; 3 to 6)ci = confidence interval critical incidents with ( probable ) permanent damage or death as consequence ci = confidence interval the voluntary and non - anonymous critical incident registration system in this study proved to be very effective ( response rate 94.4% ) . this high response was achieved by way of a reminder in the aims for reporting during skin closure and an e - mail reminder after completion of the anesthetic procedure . furthermore , the non - anonymous registration allowed feedback through a twice weekly complication meeting in which action regarding a critical incident was discussed and initiated , thereby encouraging clinicians to report critical incidents . in 3.5% ( 354 per 10,000 anesthetics ; 95% ci , 343 to 365 ) of anesthetic procedures a critical incident was reported , which is similar to the incidence reported in children using the same methodology.23 the present voluntary and non - anonymous reporting system is unique and has its advantages and disadvantages . voluntarily reported critical incidents may suffer from underreporting.3,24 previous studies have shown a low level of compliance when voluntary reporting was compared with automatically detected critical incidents,25 - 27 and in a different study , an incidence of 28% was reached when researchers completed a retrospective evaluation of all anesthetic procedures.13 nevertheless , the response rate in the present system was very high ( 94% ) , and the advantage of the present system is the fact that anesthesiologists reported only those critical incidents considered to be clinically relevant . the non - anonymous system of reporting may also cause underreporting because a reporter might refrain from reporting due to fear of consequences.6,10,24 nevertheless , a strong advantage of non - anonymous reporting is the ability to discuss the critical incident with detailed information from the involved anesthesiologist , which can lead to a teaching moment.3 the reporting system used in this study was based on the 20-item complication list of the netherlands society of anesthesiologists . this 20-item complication list was not sufficient for detailed analysis and required extension as 21.6% of reported events could not be classified within the original list and were reported as miscellaneous ( tables 1 and 4 ) . nevertheless , the limited number of items in the classification system of the netherlands society of anesthesiologists and the large amount of critical incidents in the miscellaneous category might have induced underreporting of the items not in the original list . for example , some might judge certain events as a critical incident , while others might judge the same event as not being a critical incident , and vice versa.24,28 it could be argued that not every critical incident that we present is truly a critical incident , e.g. , technical difficulties with regional anesthesia are an inevitable occurrence when performing regional anesthesia . furthermore , for the present study , all critical incidents were reclassified retrospectively to allow detailed analyses , and lack of information may have caused misclassification . cardiovascular incidents ( 106 per 10,000 anesthetics ) , in particular hypotension ( 40 per 10,000 anesthetics ) , comprised the majority of critical incidents ( tables 3 and 5 ) . previous studies showed the same level of cardiovascular incidents,13,29 whereas some studies indicated that difficulty with airway management11,14,16,29,30 or wrong drug / wrong drug - dose / wrong drug - labelling14 was the critical incident that occurred most frequently . this variance in number and type of critical incident might be due to the diversity of methods in the reporting systems and differences in definitions . for example , closed claims studies report death ( 26% ) , nerve injuries ( 22% ) , and permanent brain damage ( 9% ) as the most common complications.11 the present study identified the most frequently reported and most severe anesthetic critical incidents in our hospital on which to base future improvements for patient safety . the technical difficulties with regional anesthesia ( table 5 ) are being addressed in part by implementation of ultrasound guidance,31 but we propose a thorough investigation to determine which regional technique results in the most technical difficulties . furthermore , the administration of the wrong drug ( table 4 ) is being tackled by strictly double - checking medication before administration.32 in conclusion , the present study shows that the present reporting system in aims along with e - mail feedback leads to a very high response rate in reporting critical incidents . even so , the complication lists of the netherlands society of anesthesiologists proved to be too limited , and therefore , the present list of complications can be used as an alternative .

purposeinvestigation of adverse events associated with anesthetic procedures is a method of quality control that identifies topics to improve clinical care and patient safety . most research to date has been based on closed claim registries and anonymous reports which have specific limitations . therefore , to evaluate a hospital s reporting system , the present study was designed to describe critical incidents that anesthesiologists voluntarily and non - anonymously reported through an anesthesia information management system.methodsthis is a historical observational cohort study on patients ( age > 18 yr ) undergoing anesthetic procedures in a tertiary referral hospital . a 20-item list of complications , as developed by the netherlands society of anesthesiologists , was prospectively completed for each procedure . all critical incidents registered in the anesthesia information management system were then reclassified into 95 different critical incidents in a reproducible way.resultsthere were 110,310 procedures performed in 65,985 patients , and after excluding 158 reports that did not depict a critical incident , 3,904 critical incidents in 3,807 ( 3.5% ) anesthetic procedures remained . technical difficulties with regional anesthesia ( n = 445 ; 40 per 10,000 anesthetics ; 95% confidence interval [ ci ] , 36 to 44 ) , hypotension ( n = 432 ; 39 per 10,000 anesthetics ; 95% ci , 35 to 43 ) , and unexpected difficult intubation ( n = 216 ; 20 per 10,000 anesthetics ; 95% ci , 18 to 23 ) were the most frequently documented critical incidents.conclusionaccurate measurement and monitoring of critical incidents is crucial for patient safety . despite the risk of underreporting and probable misclassification of manual reporting systems , our results give a comprehensive overview on the occurrence of voluntarily reported anesthesia - related critical incidents . this overview can direct development of a new reporting system and preventive strategies to decrease the future occurrence of critical incidents .

Objectif Mthode Rsultats Conclusion Methods Study design Definitions Data acquisition Statistical analysis Results Discussion Funding Conflicts of interest

the immune system is delicately balanced between immunity and tolerance to protect the host from pathogens while minimizing local damage to tissues . indoleamine 2,3-dioxygenase ( ido ) is an endogenous molecular mechanism that contributes to this immune regulation in a variety of settings . ido seems to be critical in limiting potentially exaggerated inflammatory reactions in response to danger signals and in assisting regulatory t - cell effector function . in addition , ido is an important component of a regulatory system that allows long - term control of immune homeostasis as may be required by tolerance to self or during pregnancy . ido is a major inhibitor of the effector phase of the immune response [ 45 , 50 ] . ido expression can suppress effector t cells directly by degradation of the essential amino acid tryptophan . some of the biological effect of ido is mediated through local depletion of tryptophan , but is in addition mediated via immune modulatory tryptophan metabolites [ 4 , 30 ] . thus , regulation of tryptophan metabolism by ido in dendritic cells ( dc ) is a highly adaptable modulator of immunity . when ido dc are injected in vivo , they create suppression and anergy in antigen - specific t cells in the ln draining the injection site [ 3 , 25 ] . effector t cells starved of tryptophan are unable to proliferate and go into g1 cell cycle arrest . an ido - responsive signaling system in t cells has been identified , comprising the stress kinase gc non - derepressing 2 kinase ( gcn2 ) . gcn2 responds to elevations in uncharged trna , as would occur if the t cell were deprived of tryptophan . another effect of ido is mediated through enhancement of local treg - mediated immune suppression . constitutive ido expression in dc provides t cells with regulatory properties that block t - cell responses to antigenic stimulation . the b7 receptors on ido dc bind to ctla4 on tregs causing them to proliferate and induce antigen - specific anergy . thus , ido does not only suppress effector t cells directly but also influence tregs bystander suppressor activity [ 2 , 32 , 39 ] . it has been described that exposure of tregs to pro - inflammatory cytokines like il-6 induce reprogramming of mature tregs to acquire a phenotype resembling pro - inflammatory th17 cells [ 6 , 49 , 51 ] . ido stimulates treg bystander suppressor activity and simultaneously blocks the il-6 production that is required to convert tregs into th17-like t cells [ 2 , 39 ] . the phenotype of reprogrammed tregs after ido - blocking have been described as similar to that of polyfunctional t - helper cells co - expressing il-17 , il-22 , il-2 as well as tnf- . thus , ido suppression of pro - inflammatory processes may dominantly block effector t - cell responses to antigens encountered . conversely , absence of ido activity may not elicit local treg suppression even when strong pro - inflammatory stimuli are present . finally , it was recently shown that ido has a non - enzymic function that contributes to tgf- driven tolerance in non - inflammatory contexts . ido may contribute in a critical manner to inhibit or terminate inflammation and are highly overexpressed in cancer [ 14 , 22 ] . in cancer patients , ido elevation occurs in a subset of plasmacytoid dc in tumor - draining lymph nodes . in addition , ido may be expressed within the tumor by tumor cells as well as tumor stromal cells , where it inhibits the effector phase of immune responses . activation of ido in either tumor cells or nodal regulatory dc each appears to be sufficient to facilitate immune escape of tumors . in this regard , it has been described that expression of ido in tumor cells is associated with an impaired prognosis . in a murine model , it was observed that tumor cells transfected with ido became resistant to immune eradication , even in mice in which a fully protective immune response had been established by immunization . ido - expressing cd19 plasmacytoid dc isolated from tumor - draining ln mediate profound immune suppression and t - cell anergy in vivo [ 25 , 37 ] , whereas plasmacytoid dc from normal lns and spleen do not express ido . in this respect , it should be noted that very few cells constitutively express ido in normal lymphoid tissue except in the gut . it is believed that constitutive ido expression in dc in tumor - draining ln is induced by stimulation from tregs migrating from the tumor to the draining ln . the induction of ido converts the tumor - draining ln from an immunizing into a tolerizing milieu . all in all , ido is a critical cellular factor contributing to immune suppression and as such is a crucial mechanism in cancer . hence , ido has become a very attractive target for the design of new anticancer drugs and several ido inhibitors are under investigation in preclinical as well as in clinical studies . in particular , the compound 1-methyl - tryptophan ( 1mt ) has been widely studied as an inhibitor of ido activity . interestingly , recent studies have shown that the racemer d-1-mt has superior antitumor activity compared to the racemer l-1-mt . ido2 functions like ido in tryptophan catabolism , but it has been found that d-1mt but not the l-1mt isomer selectively and potently inhibits ido2 activity suggesting that ido2 activity may have a role in the inhibition of immune responses to tumors . in this respect , ido2 expression has been found in human tumors , including gastric , colon , renal , and in pancreatic tumors ido2 expression have been found both in tumor cells as well as in immune cells in tumor - draining ln . it is not yet known to what extent each isoform of ido contributes to tumor - related immune suppression and how much clinical benefit ( or autoimmune toxicity ) targeting one isoform over another confers . despite the fact that neoplastic transformation is associated with the expression of immunogenic antigens , the immune system often fails to respond effectively and becomes tolerant toward these antigens . as described above ido plays a critical role in the tolerance induction and immune suppression of anti - cancer immune responses . we sat out to determine if and how ido itself serve as target for specific t - cell responses , which may be exploited for immune therapy . this was done by identifying and characterizing specific t cells spontaneously present among peripheral blood mononuclear cells ( pbmc ) isolated from cancer patients of different origin . in this regard , we described that peptides comprised in the ido protein sequence are spontaneously recognized by cytotoxic t cells ( ctl ) in cancer patients ( fig . 1principle of the processing pathway of ido peptides by ido - expressing cells ( red ) , for example , tumor cells or dendritic cells and the subsequent recognition by specific cd8 t cells ( green ; here entitled a supporter t cell ( tsup).the epitopes recognized by the t cells are short ido - derived peptides resulting from the degradation of intracellular ido protein , which are presented on the cell surface of hla molecules . t cells receive an activation signal through their t - cell receptor complex , leading to a variety of functional consequences , including release of cytokines and cytotoxic molecules principle of the processing pathway of ido peptides by ido - expressing cells ( red ) , for example , tumor cells or dendritic cells and the subsequent recognition by specific cd8 t cells ( green ; here entitled a supporter t cell ( tsup).the epitopes recognized by the t cells are short ido - derived peptides resulting from the degradation of intracellular ido protein , which are presented on the cell surface of hla molecules . t cells receive an activation signal through their t - cell receptor complex , leading to a variety of functional consequences , including release of cytokines and cytotoxic molecules first , we identified hla - restricted peptides within the ido protein to which spontaneous t - cell reactivity were detected in patients suffering from unrelated tumor types , i.e. , melanoma , renal cell carcinoma and breast cancer by flow cytometry using hla / peptide tetramers as well as in elispot assays after in vitro stimulation but also in direct ex vivo assays . such ido - reactive cd8 t cells were peptide - specific , cytotoxic effector cells . thus , ido - specific t cells effectively lysed ido cancer cell lines of different origin , such us colon carcinoma , melanoma , and breast cancer as well as directly ex vivo enriched leukemia cells . ido driven immune suppression is a general mechanism that has been described in a variety of human cancers and the immune responses against ido seem likewise to be relevant in cancers of unrelated origin , which emphasize the immunotherapeutic potential of ido . however , even more distinctive was our finding that ido - specific ctl recognized and killed ido , mature dc ; hence , ido - specific t cells were in addition able to kill immune - regulatory cells . we could at first not detect spontaneous responses against ido in the control group of healthy individuals . thus , although ido has immune suppressive functions , the constitutive up regulation of ido expression in cancer patients seemed to induce ido - specific t - cell responses . ido is playing a crucial role in immune regulation and is inducible under normal physiological conditions . thus , we found the apparent lack of tolerance against ido intriguing , since it suggested a more general role of ido - specific t cells in the regulation of the immune system . we hypothesized that such cells could take part in the control of immune homeostasis ; ido - specific cd8 t cells could play an important role by eliminating ido cells thereby suppressing and/or delaying local immune suppression . hence , we continued our search for possible ido - specific t - cell responses in healthy donors and found that circulating ido - specific , cytotoxic cd8 t cells indeed were present in healthy donors although not as frequent as in patients with cancer . furthermore , we were able to directly link the up regulation of ido with ido - specific t cells by showing that the addition of ido - inducing mediators like ifn- and cpg odn generated measurable numbers of cd8 ido - specific t cells among pbmc . to examine a possible immune - regulatory effect of ido - specific t cells , we examined their effect on t - cell immunity against viral or tumor - associated antigens . in this respect , we found that the presence of ido - specific cd8 t cells boosted cd8 t - cell responses against other antigens probably by eliminating ido suppressive cells ( fig . 2 ) . supporter t cells ( tsup ) due to their immune enhancing function .fig . 2ido - specific t cells are able to boost specific immunity against virus or tumor antigens in human pbmc . a when stimulating pbmc with a known hla - restricted t - cell virus epitope and il-2 , epitope - specific t cells begin to expand due to activation by antigen presenting cells ( apc ) . in response to the subsequent production of cytokines like inf- , ido expression is induced and ido - expressing apc inhibit further expansion of virus - specific t cells both directly and indirectly through activation of tregs . b the addition of cytotoxic , ido - specific t cells ( tsup ) removes immune suppressive cells from the pbmc culture thereby facilitating further expansion of virus - specific t cells ido - specific t cells are able to boost specific immunity against virus or tumor antigens in human pbmc . a when stimulating pbmc with a known hla - restricted t - cell virus epitope and il-2 , epitope - specific t cells begin to expand due to activation by antigen presenting cells ( apc ) . in response to the subsequent production of cytokines like inf- , ido expression is induced and ido - expressing apc inhibit further expansion of virus - specific t cells both directly and indirectly through activation of tregs . b the addition of cytotoxic , ido - specific t cells ( tsup ) removes immune suppressive cells from the pbmc culture thereby facilitating further expansion of virus - specific t cells ido expression contributes to the strength and duration of a given immune response due to its inflammation - induced counter - regulatory function . thus , any supportive effect of ido - specific t cells on other immune cells may well be mediated in several direct and indirect manners . in this respect , the level of tryptophan was elevated , the frequency of tregs decreased , and the frequency of il-17 producing cells increased when ido - specific t cells were present , which taken together suggest an overall decrease in ido activity . furthermore , ido - specific t cells increased the overall production of both il-6 as well as the other pro - inflammatory cytokine tnf-. in contrast , we observed a decrease in il-10 . another possible effect of ido - specific t cells could be mediated through the metabolites of tryptophan , which have been shown to be directly toxic to cd8 t cells and cd4 th1 cells , but not th2 cells . hence , increased ido activity seems to tilt helper t - cell polarization toward a th2 phenotype . the presence of activated ido - specific , cytotoxic t cells may screw the th - response in a th1-direction . finally , it should be noted that ido cells may be immune suppressive by other means than by the expression of ido . hence , the same cells might express , for example , arginase , pd - l1 or immune - regulatory cytokines ( e.g. , il-10 and tgf- ) . hence , ido - specific , cytotoxic t cells may not only reduce ido - mediated suppression directly but in addition further immune suppression mediated by ido regulatory cells . recently , we identified spontaneous cd8 t - cell reactivity against the ido analogue ido2 in peripheral blood of both healthy donors and cancer patients . furthermore , we confirmed that ido2-reactive cd8 t cells were peptide - specific , cytotoxic effector t cells . hence , isolated and expanded ido2-specific t cells effectively lysed cancer cell lines of different origin , that is , colon carcinoma cells as well as breast cancer cells . however , ido2-specific t cells did not seem to kill melanoma cells although they expressed ido2 . at least , we did not observe killing of three different ido2 melanoma cell lines . likewise , ido2-specific t cells did not seem to support other immune responses in the same way as ido - specific , cytotoxic t cells . hence , the function and potential role of the ido2-specific class - i - restricted lymphocytes present in peripheral blood still need to be resolved . we speculated that cd4 ido - specific t cells releasing pro - inflammatory cytokines may play a role in the early phases of an immune response as a counter - response to the induced immune suppression facilitated by ido cells . hence , ido - specific th1-cells may delay local immune suppression if the activation of an ido - specific cd4 th1-response could overcome the immune suppressive actions of the ido protein , which are otherwise a result of the early expression of ido in maturing dc or macrophages . indeed , identified detectable numbers of specific cd4 t cells both in cancer patients as well as healthy individuals . we found that such ido - specific cd4 t cells released inf- as well as tnf-. although , we were able to detect both inf- and tnf- response toward ido in healthy donors , the responses were more frequent in cancer patients . the cancer relevance of these cd4 t cells were further underlined , since ido - reacting t cells in addition react toward dc pulsed with ido tumor lysates . interestingly , we detected a correlation between patients harboring cd4 and cd8 responses against ido , which that class - i- and class - ii - restricted ido responses co - develop . furthermore , we detected frequent ido - specific cd4 t - cell responses when examining for il-17 release upon stimulation with the ido - derived cd4 epitope . il-17 has been the focus of great interest recently since the production of il-17 is characterized to a subset of cd4 t - helper cells ( th17 cells ) . one of the main roles of th17 cells is believed to be promoting host defense against infectious agents . th17 cells are thought to be particularly important in maintaining barrier immunity at mucosal surfaces such as in the lungs , gut , and skin . interestingly , ido is expressed at high levels in the gastrointestinal tract , although its precise role in intestinal immunity is not well understood . one could speculate that a fraction of the th17 that are highly prevalent at the mucosal tissues of healthy individuals is recognizing ido ; however , this is yet to be established . , th17 cells might have a protective role in tumor immunopathology by promoting antitumor immunity . tumor - infiltrating th17 cells express other cytokines in addition to il-17 , which might be functionally relevant . a large fraction of th17 cells produce high levels of effector cytokines such as il-2 , inf- as well as tnf . ido - specific th17 cells seemed to exhibit a similar effector t - cell cytokine profile . we could in contrast not detect any release of the th2 cytokine il-4 in response to the ido - derived peptide . it was recently suggested that the foxp3 treg cell lineage in addition to immune suppression have an unappreciated helper role . th17-like effector cells were distinguished by their unique ability to deliver help immediately and spontaneously , without needing prior priming or pre - activation . it was suggested that these cd4 lineage cells correspond to a pool of constitutively primed first responder cells . ido plays an important role in this conversion of foxp3 tregs to th17-like effector cells [ 2 , 39 ] . thus , it is possible that ido - specific t cells could in addition belong to a foxp3 lineage of constitutively primed first responder th17-like t cells ; however , it should be strengthen that this is speculation . naturally , some cd4-positive ido - specific t cells could in addition be immune suppressive tregs . it would be obvious that ido - specific tregs may enhance the ido - mediated immune suppression protecting cells from an immune attack . in this regard , we have previously described specific regulatory cd8 t cells in cancer patients , which recognized the immune suppressive heme oxygenase-1 . il-10 is mainly expressed by tregs that have been defined as a specialized subpopulation of t cells that act to suppress activation of the immune system and thereby maintain immune system homeostasis and tolerance to self - antigens [ 34 , 35 ] . we could in addition in some donors detect il-10 release in response to the ido - derived cd4 epitope peptide . hence , the role of ido - specific cd4 t cells in immune - regulatory networks may be a complex balance between activation and inhibition depending on the microenvironment . interestingly , in some donors we detected background il-10 release in in vitro pre - stimulated elispot assays . this enabled us to recognize that stimulation with the ido - derived peptide in two healthy donors triggered an overall suppression of il-10 . in this regard , we have previously observed a decrease in il-10 when ido - specific cd8 t cells were present . ido may exhibit its immune inhibitory functions both in the activation phases ( in the draining lymph node ) as well as in the effector phases ( at the site of the tumor ) . with regard to the latter , ido may even by induced as an inflammation - induced counter - regulatory mechanism . counter - regulatory responses are important in the immune system as they help to limit the intensity and extent of immune responses , which otherwise could cause damage to the host . however , with regard to anti - cancer immunotherapy , counter - regulatory responses antagonize the ability to create an intense immune response against the tumor . counter - regulation differs from tolerance in the sense that counter - regulation is a secondary event , elicited only in response to immune activation . ido is known to be induced by both type i and ii interferons , which are likely to be found at sites of immune activation and inflammation [ 31 , 36 ] . in this respect , it should be mentioned that the susceptibility of tumor cells to lysis by ido - reactive t cells were increased by pre - incubation with ifn- . hence , in cancer immune therapy , the boosting of ido - specific immunity could have both direct and indirect effects ( fig . first of all , ido - specific , cytotoxic t cells are able to directly recognize and kill ido cancer cells . in fact , it may even be speculated that the measurable reactivity to this antigen in normal individuals contributes to immune surveillance against cancer . furthermore , the induction of ido - specific immune responses by therapeutic measures could function highly synergistic with additional anti - cancer immune therapy not only by eliminating cancer cells but in addition immune suppressive cells . by definition , anti - cancer immune therapies aim at the induction of an immunological activation and inflammation . the therapy aims to induce as much immune activation as possible ( within the limits of acceptable toxicity ) , and , accordingly , immune suppressive counter - regulation is not desired.fig . 3vaccine induced ido - specific t cells might kill ido suppressive antigen presenting cells ( apc ) as well as ido cancer cells both at the tumor site and in the draining lymph nodes . ido may exhibit its immune inhibitory functions both in the activation phases ( in the draining lymph node ) as wells as in the effector phases ( at the site of the tumor ) . hence , an ido - based cancer vaccine might work directly at the tumor site by the attack of cancer cells as well as stromal cells as well as in the draining lymph node by the attack of ido - expressing regulatory cells vaccine induced ido - specific t cells might kill ido suppressive antigen presenting cells ( apc ) as well as ido cancer cells both at the tumor site and in the draining lymph nodes . ido may exhibit its immune inhibitory functions both in the activation phases ( in the draining lymph node ) as wells as in the effector phases ( at the site of the tumor ) . hence , an ido - based cancer vaccine might work directly at the tumor site by the attack of cancer cells as well as stromal cells as well as in the draining lymph node by the attack of ido - expressing regulatory cells adoptive transfer of ex vivo expanded tumor - infiltrating lymphocytes ( til ) after host lymphodepletion has the potential to significantly improve the prognosis of patients with metastatic melanoma . the impressive clinical responses associated with adoptive transfer of til urge that this strategy is pursued and investigated for the treatment of other types of cancer . in this regard , patient ido - specific t cells isolated and expanded from pbmc may well be an interesting supplement to the ongoing adaptive t - cell transfer strategies . it goes without saying that the possible introduction of autoimmunity and toxicity are the major worries when targeting a molecule like ido . however , the circulation of a measurable number of ido - specific t cells did not seem to cause autoimmunity . furthermore , since ido - specific t cells can be introduced by ifn or cpg this appears to be under solid control . in this regard , an interesting aspect of ido is that systemic inactivation at the organism level , either pharmacologically or genetically , does not appear to cause autoimmunity . we believe that the findings that presented here justified and warranted clinical testing to evaluate the efficiency and safety of ido - based vaccinations . hence , we initiated a phase i vaccination study , which is ongoing ( from june 2010 ) at center for caner immune therapy , copenhagen university hospital , herlev , in which patients with non - small cell lung cancer ( nsclc ) are vaccinated with a ido - derived peptide with montanide adjuvant ( www.clinicaltrials.gov ; nct01219348 ) . it has been suggested that ido may rather be involved in tolerance to non - self - antigens than self - antigens in situations where immune non - responsiveness may be important , for example , during pregnancy . in this respect , induction of ido immune - regulatory dendritic cells ( dc ) have been described to occur during infection of dcs with viruses and intracellular pathogens . in listeria monocytogenes infections , such ido dc seems to be involved in protection of the host from granuloma breakdown and pathogen dissemination in advanced human listeriosis . likewise , it was recently described that ido is increased in lymph nodes in cutaneous leishmania major infection . ido is implicated in suppressing t - cell immunity to parasite antigens and ido inhibition reduced local inflammation and parasite burdens , which suggest that ido were of benefit for the pathogen , not the host . during hiv infection , multiple mechanisms involving both viral and cellular components contribute to enhance ido expression and activity in an uncontrolled manner . among others , furthermore , it was recently described that ido is increased in hemodialysis ( hd ) patients compared to healthy donors . furthermore , ido suppresses adaptive immunity in hd patients as it is assessed by the response to hbv vaccination . hence , the targeting of ido could have synergistic effects in anti - viral immune therapy , for example , in hepatitis b vaccines . the fact that ido may be involved in tolerance to non - self - antigens might have major implications for ido - based immune therapy as boosting immunity to neoantigens , but not normal self - antigens , by triggering ido - specific t cells is very attractive . since ido - expressing cells might antagonize the desired effects of other immunotherapeutic approaches targeting ido - expressing cells by vaccination however , it was recently described that although ido might play biologically important roles in the host response to diverse intracellular infections like toxoplasma gondii , leishmaniasis , and herpes simplex virus , the nature of this role that being antimicrobial or immunoregulatory might depend on the pathogen . this should naturally been taken into account when exploring the possible use of ido - specific t cells in the clinic . finally , it should be mentioned that cd14 monocytes are major cmv target cells in vivo . cmv is the most immune dominant antigen to be encountered by the human immune system . monocytes are responsible for dissemination of the virus throughout the body during acute and late phase of infection . cmv has been shown to induce ido expression in monocytes , which has been suggested to confer an advantage to cmv - infected monocytes to escape t - cell responses . the cd8 t - cell response to cmv typically comprises a sizeable percentage of the cd8 t - cell repertoire in cmv - seropositive individuals . in light of this , it is possible that ido - specific t cells might function as support for the constitutive anti - cmv cd8 t - cell response . naturally , this can only be speculation , but notably we found that the presence of ido - specific cd4 t - cell responses correlated to the presence of cmv - responses . ido may exhibit its immune inhibitory functions both in the activation phases ( in the draining lymph node ) as well as in the effector phases ( at the site of the tumor ) . with regard to the latter , ido may even by induced as an inflammation - induced counter - regulatory mechanism . counter - regulatory responses are important in the immune system as they help to limit the intensity and extent of immune responses , which otherwise could cause damage to the host . however , with regard to anti - cancer immunotherapy , counter - regulatory responses antagonize the ability to create an intense immune response against the tumor . counter - regulation differs from tolerance in the sense that counter - regulation is a secondary event , elicited only in response to immune activation . ido is known to be induced by both type i and ii interferons , which are likely to be found at sites of immune activation and inflammation [ 31 , 36 ] . in this respect , it should be mentioned that the susceptibility of tumor cells to lysis by ido - reactive t cells were increased by pre - incubation with ifn- . hence , in cancer immune therapy , the boosting of ido - specific immunity could have both direct and indirect effects ( fig . first of all , ido - specific , cytotoxic t cells are able to directly recognize and kill ido cancer cells . in fact , it may even be speculated that the measurable reactivity to this antigen in normal individuals contributes to immune surveillance against cancer . furthermore , the induction of ido - specific immune responses by therapeutic measures could function highly synergistic with additional anti - cancer immune therapy not only by eliminating cancer cells but in addition immune suppressive cells . by definition , anti - cancer immune therapies aim at the induction of an immunological activation and inflammation . the therapy aims to induce as much immune activation as possible ( within the limits of acceptable toxicity ) , and , accordingly , immune suppressive counter - regulation is not desired.fig . 3vaccine induced ido - specific t cells might kill ido suppressive antigen presenting cells ( apc ) as well as ido cancer cells both at the tumor site and in the draining lymph nodes . ido may exhibit its immune inhibitory functions both in the activation phases ( in the draining lymph node ) as wells as in the effector phases ( at the site of the tumor ) . hence , an ido - based cancer vaccine might work directly at the tumor site by the attack of cancer cells as well as stromal cells as well as in the draining lymph node by the attack of ido - expressing regulatory cells vaccine induced ido - specific t cells might kill ido suppressive antigen presenting cells ( apc ) as well as ido cancer cells both at the tumor site and in the draining lymph nodes . ido may exhibit its immune inhibitory functions both in the activation phases ( in the draining lymph node ) as wells as in the effector phases ( at the site of the tumor ) . hence , an ido - based cancer vaccine might work directly at the tumor site by the attack of cancer cells as well as stromal cells as well as in the draining lymph node by the attack of ido - expressing regulatory cells adoptive transfer of ex vivo expanded tumor - infiltrating lymphocytes ( til ) after host lymphodepletion has the potential to significantly improve the prognosis of patients with metastatic melanoma . the impressive clinical responses associated with adoptive transfer of til urge that this strategy is pursued and investigated for the treatment of other types of cancer . in this regard , patient ido - specific t cells isolated and expanded from pbmc may well be an interesting supplement to the ongoing adaptive t - cell transfer strategies . it goes without saying that the possible introduction of autoimmunity and toxicity are the major worries when targeting a molecule like ido . however , the circulation of a measurable number of ido - specific t cells did not seem to cause autoimmunity . furthermore , since ido - specific t cells can be introduced by ifn or cpg this appears to be under solid control . in this regard , an interesting aspect of ido is that systemic inactivation at the organism level , either pharmacologically or genetically , does not appear to cause autoimmunity . we believe that the findings that presented here justified and warranted clinical testing to evaluate the efficiency and safety of ido - based vaccinations . hence , we initiated a phase i vaccination study , which is ongoing ( from june 2010 ) at center for caner immune therapy , copenhagen university hospital , herlev , in which patients with non - small cell lung cancer ( nsclc ) are vaccinated with a ido - derived peptide with montanide adjuvant ( www.clinicaltrials.gov ; nct01219348 ) . it has been suggested that ido may rather be involved in tolerance to non - self - antigens than self - antigens in situations where immune non - responsiveness may be important , for example , during pregnancy . in this respect , induction of ido immune - regulatory dendritic cells ( dc ) have been described to occur during infection of dcs with viruses and intracellular pathogens . in listeria monocytogenes infections , such ido dc seems to be involved in protection of the host from granuloma breakdown and pathogen dissemination in advanced human listeriosis . likewise , it was recently described that ido is increased in lymph nodes in cutaneous leishmania major infection . ido is implicated in suppressing t - cell immunity to parasite antigens and ido inhibition reduced local inflammation and parasite burdens , which suggest that ido were of benefit for the pathogen , not the host . during hiv infection , multiple mechanisms involving both viral and cellular components contribute to enhance ido expression and activity in an uncontrolled manner . among others , furthermore , it was recently described that ido is increased in hemodialysis ( hd ) patients compared to healthy donors . furthermore , ido suppresses adaptive immunity in hd patients as it is assessed by the response to hbv vaccination . hence , the targeting of ido could have synergistic effects in anti - viral immune therapy , for example , in hepatitis b vaccines . the fact that ido may be involved in tolerance to non - self - antigens might have major implications for ido - based immune therapy as boosting immunity to neoantigens , but not normal self - antigens , by triggering ido - specific t cells is very attractive . since ido - expressing cells might antagonize the desired effects of other immunotherapeutic approaches targeting ido - expressing cells by vaccination however , it was recently described that although ido might play biologically important roles in the host response to diverse intracellular infections like toxoplasma gondii , leishmaniasis , and herpes simplex virus , the nature of this role that being antimicrobial or immunoregulatory might depend on the pathogen . this should naturally been taken into account when exploring the possible use of ido - specific t cells in the clinic . finally , it should be mentioned that cd14 monocytes are major cmv target cells in vivo . cmv is the most immune dominant antigen to be encountered by the human immune system . monocytes are responsible for dissemination of the virus throughout the body during acute and late phase of infection . cmv has been shown to induce ido expression in monocytes , which has been suggested to confer an advantage to cmv - infected monocytes to escape t - cell responses . the cd8 t - cell response to cmv typically comprises a sizeable percentage of the cd8 t - cell repertoire in cmv - seropositive individuals . in light of this , it is possible that ido - specific t cells might function as support for the constitutive anti - cmv cd8 t - cell response . naturally , this can only be speculation , but notably we found that the presence of ido - specific cd4 t - cell responses correlated to the presence of cmv - responses .

indoleamine 2,3-dioxygenase ( ido ) is an immunoregulatory enzyme that is implicated in suppressing t - cell immunity in many settings including cancer . in recent years , we have described spontaneous cd8 + as well as cd4 + t - cell reactivity against ido in the tumor microenvironment of different cancer patients as well as in the peripheral blood of both cancer patients and to a lesser extent in healthy donors . we have demonstrated that ido - reactive cd8 + t cells were peptide - specific , cytotoxic effector cells , which are able to recognize and kill ido - expressing cells including tumor cells as well as dendritic cells . consequently , ido may serve as a widely applicable target for immunotherapeutic strategies with a completely different function as well as expression pattern compared to previously described antigens . ido constitutes a significant counter - regulatory mechanism induced by pro - inflammatory signals , and ido - based immunotherapy may consequently be synergistic with additional immunotherapy . in this regard , we have shown that the presence of ido - specific t cells boosted immunity against cmv and tumor antigens by eliminating ido+ suppressive cells and changing the regulatory microenvironment . the current review summarizes current knowledge of ido as a t - cell antigen , reports the initial results that are suggesting a general function of ido - specific t cells in immunoregulation , and discusses future opportunities .

IDO and immune suppression IDO and cancer CD8 responses against IDO CD4 responses against IDO Clinical perspectives Cancer Additional pathogenic settings

emergence of the a / h1n109 influenza virus in 2009 resulted in the first pandemic since 1968 . the significant role of bacterial coinfection in past pandemics , and in seasonal influenza , has been documented . , , , , , during the 19181919 influenza pandemic , the organisms most frequently recovered from the sputum , lung and blood of infected patients were haemophilus influenzae , streptococcus pneumoniae , streptococcus pyogenes and staphylococcus aureus . , in most cases , lung samples taken from patients dying during the 19181919 pandemic demonstrate bacteriologic and histopathologic evidence of severe acute bacterial pneumonia . during the asian and hong kong influenza pandemics of 1957 and 1968 , s. pneumoniae , h. influenzae and s. aureus were most frequently isolated from patients with bacterial pneumonia . , , , in 1957 , s. aureus and s. pneumoniae were isolated from 59% and 15% of lung cultures , respectively . most deaths from s. aureus were observed in adolescents and young adults . in 1968 , much of the excess mortality was attributed to the increased incidence of bacterial pneumonia : a threefold increase in the incidence of staphylococcal pneumonias and strong correlation between staphylococcal pneumonia and prior influenza infection was observed . during the 2009 influenza pandemic , initial clinical descriptions reported a severe respiratory illness with rapid progression to acute respiratory distress syndrome ( ards ) . codetection of clinically relevant bacteria with influenza a / h1n109 was infrequent , yet 31% of patients admitted to icu had a clinical diagnosis of sepsis and 95% received antibiotics . bacterial coinfection was documented using histopathological , immunohistochemical and molecular evidence in 22 of 77 ( 286% ) subjects with fatal pandemic influenza a / h1n1 2009 infection . streptococcus pneumoniae , s. pyogenes and s. aureus were the predominant bacterial pathogens detected . despite numerous studies examining coinfection in pandemic influenza a / h1n109 , many questions remain . , , , , , many published studies have limited number of critically ill patients enrolled , , , have not enrolled all age groups , , , have not examined the role of coinfecting respiratory viruses , , , and have not explored important risk factors such as obesity in those with and without coinfection . , , our objectives were ( i ) to determine the burden of bacterial and viral coinfections in adults and children admitted to icus in australia during the first wave of the a / h1n109 pandemic ( 1 june31 august 2009 ) using traditional and molecular techniques and ( ii ) to explore risk factors for and outcomes of those in whom bacteria and other viruses were detected concurrently with a / h1n109 . all icus contributed data to a multicentre inceptioncohort study involving 187 icus in australia and new zealand . patient demographics , risk factors , clinical data , complications and outcomes were collected prospectively . subjects admitted to 14 icus in new south wales and western australia with influenza a confirmed by polymerase chain reaction ( pcr ) were identified . laboratory results from prior to and following their influenza diagnosis ( 3 days ) were reviewed and collated . icu admission criteria , diagnostic sampling , antibiotic / antiviral therapy and laboratory processing of respiratory specimens were not standardised across all icus or laboratories . nucleic acid was extracted from clinical samples using nuclisens easymag ( biomrieux , durham , nc , usa ) . multiplexed tandem polymerase chain reaction ( mtpcr ; ausdiagnostics pty ltd , sydney , nsw , australia ) was performed on all samples to examine for other respiratory viruses including influenza b ( nucleoprotein gene ) , respiratory syncytial virus ( l gene ) , human parainfluenzaviruses 13 ( hemagglutininneuraminidase , nucleoprotein , nucleocapsid gene , respectively ) , adenovirus ( hexon gene ) , metapneumovirus ( nucleoprotein gene ) and picornaviruses ( 5 utr of picornavirus genome ) according to the manufacturer s instructions ( http://www.ausdiagnostics.com ) . mtpcr was performed on all lower respiratory tract samples for common coinfecting or colonising bacteria including s. aureus ( nuc , meca , sccmec genes ) , s. pneumoniae ( lyta , cpsab genes ) , pseudomonas spp . enterococci and other streptococci / staphylococci ( 16s rrna ) . serial dilution of s. aureus ( atcc 25923 ) , methicillin resistant s. aureus ( mrsa ; mrsamws1 ) , s. pneumoniae ( atcc 49615 ) , pseudomonas aeruginosa ( atcc 27853 ) , escherichia coli ( atcc 25922 ) and escherichia faecalis ( atcc 29212 ) were prepared , and standard mtpcr curves constructed . mtpcr was reported positive if the above bacteria were detected as the dominant signal and at a level equal to or greater than that in prepared control samples containing 10 cfu / ml . controls ( positive and negative ) were included in each mtpcr run . all samples positive by mtpcr , subjects were deemed to be assessable for viral coinfection if stored respiratory samples were available for viral mtpcr . subjects were deemed assessable for bacterial coinfection if ( i ) two or more of the following investigations were performed , ( a ) culture of lower respiratory tract specimen ( bronchoalveolar lavage ( bal)/washing , endotracheal aspirate and sputum ) , ( b ) blood culture and ( c ) urinary antigen detection for s. pneumoniae and legionella pneumophila or ( ii ) a lower respiratory tract specimen was available for bacterial mtpcr . communityacquired infection was defined by the onset of symptoms within 48 hours of hospital admission . the first group included all subjects assessable for both bacterial and viral coinfection ( group 1 ) . to ensure validity of the results , a second group was analysed including all subjects in group one and subjects assessable for either bacterial or viral coinfections only ( group 2 ) . to identify the risk factors for and the impact of viral and bacterial coinfection , subjects with and without coinfection data were analysed using spss version 19.0.0 ( spss inc . , chicago , il , usa ) . each centre obtained approval from their institutional ethics committee for the original cohort study . clinical data were available for 198/202 patients admitted to icu with pcrproven influenza a infection . this included 186 with communityacquired influenza a infection ( 939% ) and 174 ( 879% ) with a / h1n109 ( table 1 ) . the study population was comparable to the total australian and new zealand icu population diagnosed with influenza during 2009 except that seasonal influenza a infection was more common ( 103% versus 43% ; p < 001 ) and extracorporeal membrane oxygenation was less frequently required ( 42% versus 116% , p = 0016 ) in the study population . demographics , risk factors , clinical features and influenza a subtype of patients including those assessable for coinfection bmi , body mass index ( calculated as weight in kilograms divided by height in metres squared ) . * includes 93 subjects assessable for both bacterial and viral coinfection , 38 subjects assessable for viral infection only and 45 subjects assessable for bacterial infection only . * * any comorbidity : pregnancy , chronic lung disease , chronic heart disease , diabetes or obesity ( bmi > 35 ) . stored upper and/or lower respiratory specimens were available for viral mtpcr in 131/198 ( 662% ) of the study population ( see table s1a ) . investigations for bacterial coinfection included blood cultures ( 167/198 : 843% ) , culture of lower respiratory tract specimen ( 115/198 ; 581% ) , urinary antigen detection ( 80/198 ; 404% ) and bacterial culture of pleural fluid , pericardial fluid or lung tissue ( 3/198 ; 15% ) . lower respiratory tract specimens included bal or washing ( 32/115 ; 278% ) , endotracheal aspirates ( 28/115 ; 243% ) or sputum samples ( 55/115 ; 478% ) . lower respiratory tract specimens from 34 subjects were available for mtpcr including 21 bronchoscopic specimens , nine endotracheal aspirates and four sputum samples . in total , 138/198 ( 697% ) of the study population were deemed assessable for bacterial infection ( see table s1b ) . ninetythree subjects were assessable for both viral and bacterial coinfections ( group 1 ) , and 176 subjects assessable for any coinfection ( group 2 , table 1 ) . viral coinfection was infrequently observed in both groups : 3/93 ( 32% ) and 6/176 ( 34% ) , respectively ( table 2 ) . three of the six viral coinfections occurred in children : an infant with influenza a / h1n109 and rsv coinfection , and two children , aged between 3 and 5 , with influenza a and picornavirus coinfections ( one each of influenza a / h1n109 and a / h3 ) . only one subject had concurrent bacterial and viral coinfection with influenza a : a 50yearold female with concurrent influenza a / h1n109 , adenovirus and s. aureus infection . * one patient had coinfection with influenza a virus , human adenovirus and s. aureus . * * two patients had more than one bacterial coinfection identified : ( i ) s. pneumoniae , p. aeruginosa and b. pertussis and ( ii ) s. pneumoniae and b. pertussis . using both routine microbiological data and bacterial mtpcr , the rate of bacterial coinfection ranged between 23/93 ( 247% ) and 36/176 ( 205% ) , respectively ( table 2 ) . of patients with bacterial coinfection , 100% ( group 1 ) and 972% ( group 2 ) when only lower respiratory specimens were examined , bacterial coinfection was identified in 4/34 ( 118% ) by mtpcr compared with 2/26 by culture ( 77% ) . staphylococcus aureus and s. pneumoniae were the most frequent pathogens ( table 2 ) . samples with s. aureus coinfection ( n = 17 ) were detected using lower respiratory tract culture ( n = 14 ; 824% ) , blood cultures ( n = 3 ; 176% ) , mtpcr ( n = 2 ; 118% ) and culture of empyema fluid ( n = 1 ; 59% ) . samples with s. pneumoniae coinfection ( n = 10 ) were detected using urinary antigen detection ( n = 7 ; 70% ) , lower respiratory tract culture ( n = 1 ; 10% ) , blood cultures ( n = 1 ; 10% ) and mtpcr ( n = 2 ; 20% ) . samples with haemophilus coinfection ( n = 6 ) were detected by using lower respiratory tract culture ( n = 3 ; 50% ) and blood cultures ( n = 3 ; 50% ) , other bacterial coinfections ( n = 6 ) were detected using lower respiratory tract culture ( n = 2 ; 33% ) , blood culture ( n = 1 ; 17% ) and mtpcr ( n = 2 ; 33% ) . when those with and without coinfection were compared , no significant differences were observed in clinical course , influenza type and outcomes . ( group 1 : table 3 ; group 2 : table s2 ) . requirement for endotracheal intubation , positive pressure ventilation , vasopressors , extracorporeal membrane oxygenation ( ecmo ) and renal replacement therapy was not significantly different between patients with and without coinfection . the proportion of patients with influenza a / h1n109 infection was not significantly different between those with and without coinfection ( 20/25 , 800% versus 59/68 , 867% ) . despite a trend towards greater icu mortality in those with coinfection ( 160% versus 59% ) , no significant differences in icu mortality , inhospital mortality , length of icu stay and length of hospital stay risk factors for and impact of bacterial and viral coinfection in group 1 ( subjects assessable for bacterial and viral coinfection , n = 93 ) bmi , body mass index ( calculated as weight in kilograms divided by height in metres squared ) . * any comorbidity : pregnancy , chronic lung disease , chronic heart disease , diabetes or obesity ( bmi > 35 ) . * * the significance of these variables was maintained if only adults 18 years and older were examined ( p 003 ) : any comorbidity : 7/20 versus 45/68 , p = 002 ; mean bmi : 2717 versus 3301 , p = 003 . significant differences in the frequency of risk factors known to be associated with icu admission were revealed when subjects with and without coinfection were compared ( group 1 : table 3 ; group 2 : table s2 ) . when subjects in group 1 were compared , subjects with bacterial or viral coinfection were younger [ mean difference in age = 846 years ( 95% ci = 0181674 years ) , p = 0045 ] . subjects with coinfection were less likely to have significant medical comorbidities compared to those without coinfection ( 320% versus 662% , p = 0004 , table 3 ) . when individual comorbidities were examined , those with coinfection were less likely to be obese [ mean difference in body mass index ( bmi ; weight in kilograms divided by height in metres squared ) = 686 ( 95% ci = 1771196 ) , p < 001 ] . a trend towards fewer comorbidities in subjects requiring icu admission with coinfection was observed when compared to those without coinfection : pregnancy , 4% versus 119% ; chronic lung disease , 200% versus 433% ; chronic heart disease , 40% versus 164% ; diabetes , 43% versus 162% ( all not significant ) . similar differences were observed in subjects assessable for any infection ( group 2 , n = 176 , table s2 ) . despite the strong microbiological evidence for bacterial or viral coinfection , treating physicians most frequently identified the predominant clinical influenza syndrome as viral pneumonitis or ards in coinfected patients ( nine of 25 ; 360% ) . in the remaining subjects , the treating physician identified secondary bacterial infection ( 7/25 ; 280% ) , exacerbation of airflow limitation ( 2/25 ; 80% ) and other respiratory syndrome ( 6/25 ; 240% ) as the predominant clinical syndrome . bacterial and viral coinfection was identified in approximately one in four adults and children admitted to intensive care units in australia with confirmed influenza a infection in 2009 . . identified bacterial coinfection in 113/645 adults ( 175% ) admitted with confirmed pandemic influenza a / h1n109 . . identified coexisting bacterial pneumonia in 80/325 adults ( 25% ) requiring ventilation with suspected , probable or confirmed pandemic influenza a / h1n109 infection . a similar rate of bacterial coinfection was observed in pandemic influenza a / h1n109 fatalities ( 183290% ) , , significantly more than that observed when all hospitalised children and adults are examined ( bacterial coinfection < 5% ) . , , in our group , viral coinfection was infrequent and had little impact on morbidity and mortality . this is , to our knowledge , the largest study to examine both the burden and impact of respiratory virus coinfection in subjects with severe influenza a infection requiring icu admission during the first wave of the 2009 pandemic . in contrast , viral coinfection was observed in seven of 39 ( 179% ) patients with severe influenza a / h1n109 infection ( defined as infection resulting in hospitalisation or death ) in argentina by palacios et al . rsv was identified in 6/39 of patients with severe disease ( 154% ) compared with 5/160 ( 31% , p < 001 ) with mild disease . it is probable that the greater proportion of children and adolescents in the study by palacios et al . was reflected in a greater rate of respiratory virus coinfection ( mean age : palacios et al. 247 years and this study 380 years ) . variation in the proportion of coinfecting respiratory viruses may also result from seasonal variations in respiratory virus prevalence . demonstrated that s. pneumoniae coinfection was an independent predictor of hospital mortality yet this study and that by martinloeches et al . failed to identify any significant difference between coinfection and icu mortality . , martinloesches et al . found that coinfected patients were older and had higher apache scores , yet no differences in comorbidities were noted . our data demonstrate that those with coinfection were younger and had fewer comorbidities normally associated with an increased need for icu admission . the significance of this finding was preserved if children were included or excluded from the analysis . martinloesches et al . demonstrated that subjects with bacterial coinfection were more likely to require invasive ventilation and vasopressors . this was not demonstrated in this study . despite the failure to identify differences in the severity of illness in subjects with and without coinfection , it is still possible that coinfection was a contributory factor to severe disease . as enrolment in this study required severe influenza requiring icu admission , it is possible that coinfection was the precipitant that led to icu admission in younger people without comorbidities . to explore this hypothesis further , a clinically wellcharacterised control group not requiring icu admission would be required . a striking difference is the impact of s. aureus coinfection in australian icu patients with severe influenza a infection . staphylococcus aureus was the major pathogen identified in more than 40% of coinfected patients and 96140% of all patients . all subjects with staphylococcal coinfection in our study had communityacquired infection . similar rates of comorbidities were observed in patients with s. aureus coinfection compared with patients coinfected with other organisms . these findings are in contrast to other studies where s. pneumoniae was the major cause of bacterial coinfection . , , despite extensive investigations including pneumococcal urinary antigen testing in addition to respiratory cultures , blood cultures and nucleic acid detection , it is , however , possible that this is underestimated because of the frequent use of empiric antibiotics including ceftriaxone ( which has excellent antistreptococcal activity but is associated with increased incidence of s. aureus ) in patients admitted to icu with communityacquired pneumonia ( cap ) , viral pneumonitis or ards and failure to perform cultureindependent diagnostic tests ( e.g. pneumococcal urinary antigen ) on all patients . , , these findings have a significant impact on both management and prevention of complications in severe influenza infection . treatment recommendations for adults and children with severe influenza infection include parenteral antibiotics . , the infectious diseases society of america recommends a thirdgeneration cephalosporin and a macrolide / fluoroquinolone in critically unwell adults with influenza a / h1n109 influenza . , provision of cover against mrsa is recommended in those admitted to icu , with necrotising / cavitatory infiltrates , empyema or microscopy demonstrating grampositive cocci in clusters in a respiratory specimen . the british thoracic society recommends a betalactamase stable penicillin or second/thirdgeneration cephalosporin together with a macrolide in adults with severe influenzarelated pneumonia . empiric cover against mrsa is recommended in subjects hospitalised within the last few months or those not responding to empirical therapy . these data support the use of empiric antibiotics with activity against locally circulating clones of s. aureus in all patients admitted to icu with severe influenza infection . , only three patients diagnosed with invasive pneumococcal disease would have been recommended to receive pneumococcal vaccination using current australian guidelines . our data suggest that the impact of immunising young children , the elderly and those with underlying medical conditions would have little impact on morbidity and mortality in australians with severe influenza infection . the present study has several potential limitations . despite a uniform approach to diagnosis of cap the observational nature of this study means that the diagnostic approach varied between different patients and icus . , adequate lower respiratory specimens and samples for cultureindependent laboratory tests ( e.g. pneumococcal urinary antigen ) were not routinely submitted for microbiological analysis . in addition , it is likely that many subjects were administered antibiotics prior to specimen collection . it is therefore possible that the true burden of bacterial and viral coinfection is underestimated . despite the use of quantitative and/or semiquantitative laboratory methods , coinfecting and we have attempted to overcome this by further analysing lower respiratory tract specimens using quantitative nucleic acid amplification techniques , a test not routinely used for the diagnosis of cap . this approach was hampered by limited lower respiratory sampling in the 14 icus enrolling subjects . it is possible , however , that the detection of bacteria colonising the lower respiratory tract at high concentrations may falsely elevate the observed rate of bacterial pneumonia . furthermore , viral coinfection may have been underestimated as emerging viral pathogens , such as human bocavirus and coronaviruses , were not tested for . additional pathogens may have been detected if upper and lower respiratory samples were available for analysis on all patients . it is probable that the burden of coinfection would be higher in subjects with radiologically confirmed pneumonia and those examined prior to receipt of antibiotics . the burden of bacterial and viral coinfection in 198 adults and children admitted to icu during the first wave of the influenza a / h1n109 pandemic was estimated to be 233269% . coinfection had little impact on severity of illness or outcome in those admitted to intensive care but may have contributed to the need for icu admission in those without other risk factors . empiric parenteral antibiotics with antistaphylococcal activity should be strongly considered in those with severe influenza infection . to estimate the true burden and impact of bacterial and viral coinfection , a prospective study with uniform sampling using both culture and molecular assays further development of new diagnostic methods is urgently required , particularly to assist with diagnosing bacterial pneumonia . funding for the study was provided from a untied grant through the investigatorinitiated grants program of merck us grant # iisp3732 . ccb , sarw , ded , is and jri were involved in the design of the study . sarw , is and jri were involved in the nested cohort study ( webb et al . , nejm 2009 ) . ccb , jk , sjvh , hf , amk were involved in the processing and storage of laboratory specimens . ccb , jk and ang were involved in additional microbiological processing . statistical analysis and the original draft table s1 . differences between subjects assessable and not assessable for ( a ) viral coinfection and ( b ) bacterial coinfection . . risk factors for and impact of bacterial and viral coinfection in group 2 ( subjects assessable for any coinfection , n = 176 ) .

please cite this paper as : blyth et al . ( 2013 ) the impact of bacterial and viral coinfection in severe influenza . influenza and other respiratory viruses 7(2 ) 168176 . background many questions remain concerning the burden , risk factors and impact of bacterial and viral coinfection in patients with pandemic influenza admitted to the intensive care unit ( icu ) . objectives to examine the burden , risk factors and impact of bacterial and viral coinfection in australian patients with severe influenza . patients / methods a cohort study conducted in 14 icus was performed . patients with proven influenza a during the 2009 influenza season were eligible for inclusion . demographics , risk factors , clinical data , microbiological data , complications and outcomes were collected . polymerase chain reaction for additional bacterial and viral respiratory pathogens was performed on stored respiratory samples . results coinfection was identified in 233269% of patients with severe influenza a infection : viral coinfection , 3234% and bacterial coinfection , 205247% . staphylococcus aureus was the most frequent bacterial coinfection followed by streptococcus pneumoniae and haemophilus influenzae . patients with coinfection were younger [ mean difference in age = 846 years ( 95% ci : 0181674 years ) ] , less likely to have significant comorbidities ( 320% versus 662% , p = 0004 ) and less frequently obese [ mean difference in body mass index = 686 ( 95% ci : 1771196 ) ] compared to those without coinfection . conclusions bacterial or viral coinfection complicated one in four patients admitted to icu with severe influenza a infection . despite the coinfected patients being younger and with fewer comorbidities , no significant difference in outcomes was observed . it is likely that coinfection contributed to a need for icu admission in those without other risk factors for severe influenza disease . empiric antibiotics with staphylococcal activity should be strongly considered in all patients with severe influenza a infection .

Introduction Patients and methods Results Discussion Transparency declaration Author contributions Supporting information

, the prevalence of overweight children and adults has also increased , and diet choices affect both development of caries and contribute to weight gain . recent prevalence data estimate that overweight among children has more than tripled since 1970 and affects 32% of all children and adolescents [ 27 ] . excess body fat is the product of ingesting too many calories and reduced physical activity . but , the consumption of high - sugar , low - nutrient foods is of particular concern [ 911 ] . it is generally accepted that sugars and prepared starches in the diet are significant contributors to these two health issues [ 1218 ] . frequency of exposure to the teeth and food retention are important considerations when evaluating the caries potential of food products . sucrose , fructose , and maltose are sugars commonly used in beverages and food products and add about 4 calories per gram . consumption in developed countries is reported to be 4060 kg / person / year . dentists and other oral health professionals have been active in counseling their patients regarding general health issues , such as monitoring blood pressure , smoking and alcohol cessation , and detection of child abuse / neglect . in addition , dentists have collaborated with medical colleagues in drafting guidelines for referring children with early childhood caries for definitive care , application of fluoride varnish and sedation . it has now been suggested that the oral health provider become an active participant in screening their patients , especially children , for signs of overweight / obesity and offer appropriate counseling / referral . other measurement tools , such as waist circumference , may be more accurate indicators of obesity , but the body mass index ( bmi ) is the most convenient screening means [ 20 , 21 ] . this clinical tool measures body weight the ideal product would have few or no calories , be noncarcinogenic or mutagenic , be economical to produce , and would not be heat degradable but would provide sweetness and have no unpleasant aftertaste . numerous nonnutritive sweetening agents have been developed , but none have possessed all of the preferred properties . patients and parents / care givers of children often ask oral health professionals about common dietary sugars and alternative sweeteners . the purpose of this paper is to provide the dental professional information that will be helpful in counseling these individuals on diet , caries prevention , and weight control . currently , the food and drug administration ( fda ) of the united states has evaluated the data and other information and approved under the conditions of its use only aspartame , acesulfame potassium , saccharin , sucralose , and neotame as noncaloric sweeteners as food additives , figure 1 . however , the fda can also approve an agent under gras ( generally recognized as safe ) . for approval under gras , supporting data must have been provided and evaluated by qualified experts , and there is consensus that the substance is safe under the conditions of its intended use . initially granted gras status , saccharin is now approved as an additive to food and beverages . it is 300 times as sweet as sucrose by weight , non - cariogenic and noncaloric but can have a slightly bitter or metallic aftertaste . it is available as a tablet , powder , or liquid form and is widely used in food products including diet sodas , pharmaceuticals , and cosmetics . saccharin has been approved for use in more than 100 countries world - wide . in high doses , saccharin has been found to be associated with an increase frequency of bladder cancer in a strain of male rats . however , a relationship between saccharin consumption and health risk in humans , at normal consumption amounts , has not been demonstrated and it is not considered to be a carcinogen . aspartame was initially approved by the fda in 1981 for limited use as a table top sweetener and for use in breakfast cereals , gelatins , and puddings . but in 1983 , approval was extended to a larger group of food agents , including carbonated beverages . in 1996 , the fda approved aspartame as a general purpose sweetener for use in all foods and beverages . aspartame is the most widely utilized non - cariogenic artificial sweetener and is 160220 times more sweet than sucrose . it is often the manufacturer 's sweetener of choice in formulation of diet soft drinks , yogurt , puddings , gelatin , and snack foods . prior to approval of aspartame by the fda , a number of significant issues were raised by concerned individuals relative to aspartame 's potential undesirable effects with long term consumption on growth , glucose homeostasis , neurotoxic effects in animals , behavioral reactions , seizure susceptibility and liver functions but these concerns have been largely addressed [ 2631 ] . aspartame is claimed to be safe for type 2 diabetics but should be avoided by people with phenylketonuria as they can not metabolize phenylalanine , a component of aspartame . acesulfame potassium , a calorie - free , non - cariogenic , nonnutritive artificial sweetener , was initially approved by the fda in 1988 for use as a sweetener in dry food products . in 1994 , yogurt , refrigerated desserts , syrups , and baked goods were added to the approved list , and in 2002 it was accepted as a general purpose sweetener . more than thirty countries have approved the product to be used in foods , beverages , cosmetics , and pharmaceutical products . like saccharin , acesulfame potassium , has a slightly bitter aftertaste and is often blended with other sweeteners to mask this property . acesulfame potassium is stable at high cooking / baking temperatures , even under moderately acidic or basic conditions , which permits it to be used in baking or in products requiring a long shelf life . although considered safe by the fda for general consumption in food , there have been some concerns raised relative to dose - dependent cytogenetic toxicity [ 32 , 33 ] . it was first accepted by the fda as an eating table - top sweetener in 1998 and followed by acceptance as a general purpose sweetener in 1999 . sucralose is considered safe for use by diabetics and has been shown not to be metabolized into acids by oral microbiota . it is heat stable during cooking and baking and is widely used in many food products such carbonated and noncarbonated beverages , as a tea and coffee sweetener , and in baked goods , chewing gum and frozen desserts . to date no health issues have been established concerning the general dietary use of sucralose [ 34 , 35 ] . it received fda approval in 2002 for use as a general purpose sweetener in selected food products ( except not in meat and poultry ) and flavor enhancer . neotame is an intense nonnutritive sweetener that is not fermentable by the oral microbiota and possesses a crisp , clean taste with no detectable aftertaste . it is reported to be greater than 7,000 times more potent than sucrose on a weight basis depending on the food product and how it is prepared [ 36 , 37 ] . neotame is a derivative of a dipeptide and has a similar chemical structure to aspartame . it is also heat stable in baking applications and can be safely used by diabetics and pregnant women . neotame is stable in carbonated soft drinks , powdered soft drinks , yellow cake , yogurt , and hot - packed still drinks . the fda has approved as generally recognized as safe ( gras ) several additional nonnutritive non-/low caloric calorie sweeteners , figure 2 . although rather expensive to manufacturer , sorbitol is often used as a bulk sweetener in a variety of food substances such as chewing gum , chocolates , cakes and cookies , toothpaste , and mouthwash . on a weight basis , sorbitol is only half as sweet as sucrose . it is generally considered non - cariogenic , but sorbitol can be fermented slowly into acid by s. mutans . research has shown sorbitol to possess mild cariogenic potential when used over an extended period of time by patients with reduced salivary gland function , and it normally supports the formation of dental plaque and the growth of mutans streptococci . sorbitol is not easily digested or absorbed from the gastrointestinal tract , and diarrhea is a potential side effect if ingested in large quantities . xylitol , a five - carbon naturally occurring , nonfermentable , sugar alcohol , was first discovered in 1890 in birch and other hardwood tree chips , in wheat and oat straw in 1891 , and later in various fruits and vegetables [ 42 , 43 ] . xylitol is as sweet as sucrose and possesses a pleasant taste but is relatively expensive to manufacture . although not as calorie heavy as sucrose , xylitol does possess a calorie burden when consumed and has some potential for increasing blood glucose . it is used primarily in mints , chewing gum , and toothpaste but is also available for table use . studies have suggested that the regular use of xylitol containing chewing gum reduces the quantity of dental plaque , significantly reduced s. mutans levels , and increases saliva production [ 44 , 45 ] . reduction of caries incidence and remineralization of caries lesions have been reported in caries susceptible individuals when chewing gum containing xylitol was regularly used [ 4650 ] . xylitol has also been shown to inhibit cytokine expression by a lipopolysaccharide from one of the suspected periodontal pathogen bacteria , porphyromonas gingivalis . thus , its regular use could possibly aid in preventing periodontal disease and gingival inflammation . xylitol has been credited in lowering the risk of cariogenic bacteria transmission from mother to infant when compared to chlorhexadine and fluoride varnish treatments and reducing the incidence of ear infections among children at day - care centers [ 5255 ] . however , excessive use of xylitol can aggravate symptoms of crohn 's disease and irritable bowel syndrome resulting in diarrhea [ 56 , 57 ] . erythritol , a four - carbon sugar alcohol , has similar characteristics of sorbitol , mannitol , and xylitol . but , it is only slightly more than half as sweet ( 70% ) as sucrose and does not dissolve in water as well , but has significantly fewer calories by weight ( 0.2 calories per gram versus 4 calories per gram ) . erythritol has been used in japan since 1990 as a component of candies , soft drinks , chewing gum , jams , and yogurt . erythritol is heat stable and can be used in baking and as a sweetener in low carbohydrate / calorie diets . it is almost completely absorbed by the small intestine ( and excreted unchanged in the urine within 24 hours ) , has shown no toxic or carcinogenic effects , and is considered safe for consumption by diabetics . however , the daily use of erythritol has been shown to reduce mutans streptococci levels in plaque and saliva . erythritol does not cause bloating , flatulence , or diarrhea at normal consumptions levels but may have a laxative effect in both children and adults if consumed in excess . tagatose , a low - calorie natural sugar , has all the good qualities of erythritol plus it has about the same ( 92% ) sweetness as sucrose , performs better in cooking , and has been shown to actually improve blood sugar control in diabetics . it was granted gras status in 2001 and is used in a variety of drugs , foods such as chocolates , chewing gum , cakes , ice cream and frosted cereals , beverages , and dietary supplements . tagatose has been shown to have benefits treating noninsulin - dependent type 2 diabetes as it attenuates the rise of serum glucose after oral glucose intake . no significant adverse health effects have been associated with the ingestion of this product when consumed in reasonable amounts . stevia , a heat stable sweetener with little or no aftertaste , is an extract from the herb stevia rebaudiana bertoni . the herb is native to central and south america and has been used by the indigenous peoples of this area for centuries as a sweetener . it has been used extensively in china , brazil , and japan , and to a lesser extent in germany , malaysia , and israel , for many years as a sweetener in numerous food categories . originally banned by the fda , the use of stevia was approved in 1995 , as a dietary supplement but not as an additive . the argument to approve stevia as a food additive was heated , and it remained approved only as a food supplement for an extended period of time . however , in december 2008 , the fda responded favorably to gras status for the chemically refined derivative of stevia , the extract rebaudioside a ( rebiana ) , to be used as a general purpose sweetener . rebiana is also available in combination with dextrose and as an extract from stevia leaves . stevia has been shown to be safe for use by diabetics and has not been shown to be mutagenic [ 66 , 67 ] . new nonnutritive sweeteners have been introduced into human diets over the past few decades . oral health care professionals are often called upon to provide knowledgeable advice regarding the importance of diet and the role of sugars and nonnutritive sweeteners in caries formation and weight control . as such , they must be familiar with alternatives to sugar and the types of food products that are available with substitute non-/low caloric , non - cariogenic sweetening agents . an excellent literature review of the caries incidence and remineralization properties of the sugar alcohols ( xylitol , erythritol , sorbitol ) has been written by mkinen . although nonnutritive sweeteners do not generally promote dental caries , a program to prevent dental decay and promote oral health must also include good oral hygiene habits , regular dental professional care , and exposure to fluoride [ 69 , 70 ] . whether the use of nonnutritive sweeteners has a positive impact on weight loss by consumers remains controversial [ 7175 ] . it has been postulated that nonnutritive sweeteners encourage sugar craving and dependency because of their sweet nature , and flavor preference occurs with repeated exposures to sweet tasting foods and beverages . several studies have shown an increase in bmi with consumption of nonnutritive sweeteners [ 77 , 78 ] . but , others have found the evidence less compelling and more equivocal [ 7981 ] . whether nonnutritive sweetener use has a role in the current obesity and diabetes epidemic , whether beneficial , neutral , or not remains undetermined . in addition , consumption of two or more servings of nonnutritive sweetened sodas has been associated with a 2-fold increased odds for kidney function decline in women as measured by the egfr ( estimated glomerular filtration rate ) . however , it is well established that a reduction of fermentable sugars and carbohydrates in the diet coupled with good oral hygiene practices will reduce the incidence of dental decay . while it is difficult to totally avoid sugar in the diet , as it is often added to processed food to enhance the taste , reducing the amount and frequency of dietary exposure to sugar is an important adjunct in preventing caries and reducing calorie intake although not without some potential health concerns as previously described [ 8385 ] . however , nonnutritive sweeteners offer an attractive alternative to sugar in caries prevention and a possible adjunct in weight control when used appropriately and in concert with a balanced diet and exercise . the identification of safe , palatable , heat stable , non-/low - caloric , nonnutritive / non - cariogenic sweetener substitutes for the more dental decay promoting and calorie heavy sugars such as sucrose , glucose , fructose , and maltose continues to be actively pursued . in addition to annually updating the health history , dental professionals should determine annually the bmi percentile of their patients and refer those on unhealthy trajectories to their physician or a dietitian for additional counseling . it also behooves the dental professional to stay attuned to current information relative to alternative sweetener products that exist or are being developed and approved for dietary consumption by the fda and be prepared to be a source of counseling for their patients and families as they relate to reducing the incidence of caries and possible overweight [ 87 , 88 ] .

caries and obesity are two common conditions affecting children in the united states and other developed countries . caries in the teeth of susceptible children have often been associated with frequent ingestion of fermentable sugars such as sucrose , fructose , glucose , and maltose . increased calorie intake associated with sugars and carbohydrates , especially when associated with physical inactivity , has been implicated in childhood obesity . fortunately , nonnutritive artificial alternatives and non-/low - caloric natural sugars have been developed as alternatives to fermentable sugars and have shown promise in partially addressing these health issues . diet counseling is an important adjunct to oral health instruction . although there are only five artificial sweeteners that have been approved as food additives by the food and drug administration ( fda ) , there are additional five non-/low caloric sweeteners that have fda gras ( generally recognized as safe ) designation . given the health impact of sugars and other carbohydrates , dental professionals should be aware of the nonnutritive non-/low caloric sweeteners available on the market and both their benefits and potential risks . dental health professionals should also be proactive in helping identify patients at risk for obesity and provide counseling and referral when appropriate .

1. Introduction 2. FDA Approved Nonnutritive Sweeteners as Additives 3. FDA GRAS Approved Nonnutritive Sweeteners 4. Discussion

nigeria has one of the highest maternal mortality ratios ( mmr ) in the world . between 2010 - 2012 , the world health organization ( who ) estimated that the country has an mmr of 630 per 100,000 live births . this figure indicates that the country only surpassed war torned and or politically unstable countries like sierra leone ( 890 per 100,000 ) , liberia ( 777 per100 , 000 ) and chad ( 1,100 per 100,000 ) live births respectively . the poor maternal outcome might not be unrelated to the low utilization rates of maternal health care services . for example , about half of the estimated eight million annual numbers of pregnancies have not had antenatal care ( anc ) in 2010 . furthermore , among those that had anc , 45% have made less than the minimum four anc visits as recommended by the who . this national average does not reveal the disparities that exist within and between the six geopolitical zones of the country which are fairly heterogeneous in terms of religious and cultural affiliations . women from the north east zone of nigeria are more likely to die due to pregnancy related complications . for instance , while the north east zonal average for the proportion of women who had anc was 43% , yobe state had the lowest with only 36% anc utilization rate . these figures might even be lower since the state is largely rural , lowest number of skilled health workers , and poor records of vital events . further , the sensitivity of the surveillance system is low based on recent reports that indicated the state has low anc utilization and having mmr that is two fold higher than the reported national average of 630 per 100,000 live births . although yobe state has 528 public and private health facilities , however , these facilities lack both technical and institutional capacity , which invariability might have contributed to the low utilization of anc services . with an estimated annual number of pregnancies of 600,000 and only 45 public employed midwives , a midwife is expected to attend to more than 50 pregnancies per day which could compromise the quality of services rendered . considering the yobe state strategic health development plan 2010 2015 is in its final year , there is the need to assess the the predictors of anc utilization in the state in order to sustain the achievements recorded towards millenium development goal number five ( mdg 5 ) which is to reduce maternal deaths by two thirds compared to what was recorded in 1990 . unfortunately , there seems to be a dearth of local research studies on maternal mortality in nigeria . for instance , despite nigeria being among the areas with high mmr in the world,[8 - 10 ] reports of systematic reviews of 2,500 and 5,575 showed that only 3 ( 1.2% ) and 5 ( 0.5% ) articles respectively were from nigeria and non from yobe state . one of the plausible reasons for such findings is that most published studies in nigeria were hospital - based and focused more on medical causes of death such as hemorrhage , eclampsia , obstructed labor , ruptured uterus , sepsis , malaria and anemia in pregnancy , which does not provide information on antecedents before arrival to a health facility . this paper is an effort to bridge this gap aimed to find out whether women s individual and community level factors influence the utilization of anc services in yobe state as measured by number of antenatal care visits . this is a cross - sectional study using data from the 2008 nigeria demographic and health survey ( 2008 ndhs ) after receiving approval from orc macro and icf international based in calverton maryland , usa . a total of 967 women between 15 - 49 years who had given birth between january 2003 and december 2008 participated in the study . bivariate pearson s chi square test statistic and two stages of multivariate regression analysis were conducted in order to identify factors that predict the utilization of anc in yobe state . first , logistic regression of one variable at a time was conducted to get the unadjusted odds ratio and thereafter , a multivariate logistic regression was conducted to obtain adjusted odds ratios aimed at accounting for the effect of each of the study covariates . we utilized the anderson health behavior model as a framework for analyzing the determinants of utilization of health services . the model is composed of three sets of individual and community level factors that provide constructs to assess individuals capacity to access and use health services . the three main set of factors are a ) predisposing characteristics at individual level ; b ) enabling characteristics which focus on community level factors such as health care financing mechanism and health resources and c ) need characteristics which is the perceived state of health by individual and health workere . this unique characteristic of the anderson s model was underscored by its application in a range of medical research such as the utilization of health care services[15 - 17 ] and other social issues.[18 - 24 ] out of the 967 respondents , a total of 648 ( 67% ) had at least one anc visit during the last pregnancy before the 2008 ndhs survey . among those that had anc , only 328 had four or more recommended anc visits constituting only 33.9% of the total study sample . moreover , 319 ( 33% ) and 320 ( 33.1% ) of repondents had zero or less than four anc visits respectively . about 26.4% of the respondents commenced their anc visits in their third trimester ( table 1 ) . bio - socio - demographic characteristics of study respondents the age group 20 34 years old constituted the majority ( 44.9% ) of the respondents with a mean age of 27.2 + 3.2 years . the extreme of ages ( < 20 years and 35 years ) had the lowest proportion of women who had four or more anc visits . majority of the women ( 87% ) had at least two children ( table 1 ) . majority of the women were married ( 89.7% ) , belonging to kanuri / baribari ethnic group ( 42.2% ) , muslims ( 98.7% ) , lack any form of autonomy ( 79.8% ) and lived in rural areas ( 72.8% ) . living in urban areas ( 27.2% ) , yoruba ethnicity ( 60% ) , christians ( 30% ) and having full autonomy ( 30% ) had higher proportion of women that had four or more anc visits ( table 1 ) . majority of the respondents were illiterate ( 82% ) , unemployed ( 50% ) and belonged to the poorest / poor wealth quintile ( 78.3% ) , and only 11.7% , 14% and 24,7% , respectively of these categories of women had met the recommended minimum of four anc by the who ( table 1 ) . distance to the nearest health facility and lacking health insurance policy ( 99.6% ) showed lower proportion of women that had appropriate number of anc visits . majority of the respondents ( 91% ) were not attended by skilled health care workers and fewer still ( 19.8% ) had achieved the who recommendation of at least four anc visits ( table 1 ) . age is significantly associated with the number of anc visits ( = 43.11 ; df = 2 ; p < 0.00 ) . the age group 15 19 years were less likely to make four or more anc visits compared to women who were aged 20 34 years even after controlling for the covariates ( aor = 1.72 ; ci 0.75 3.91 ) ( table 2 ) . factors associated with the number of antenatal care visits attended . notes : or = odds ratio ; ci = confidence intervals ; attended at least one anc visit=648 parity of 2 ( aor = 0.47 ; ci 0.20 1.11 ) , religion ( aor = 0.99 ; ci 0.17 2.31 ) , distance to the nearest health facility ( aor = 0.99 ; ci 0.22 4.50 ) , availability of health insurance policy ( aor = 1.12 ; ci 0.99 1.71 ) and access to the media as a source of information on mhs ( aor = 0.99 ; ci 0.37 2.71 ) have no impact on the use of anc services after controlling for education , family wealth index , and availably of skilled health workers ( table 2 ) . place of domicile ( = 90.36 ; df = 1 ; p < 0.00 ) , ethnicity ( = 46.94 ; df = 5 ; p < 0.00 ) , level of education ( = 73.03 ; df = 3 ; p < 0.00 ) , occupation ( = 39.21 ; df = 3 ; p < 0.00 ) , family wealth index ( = 139.35 ; df = 4 ; p < 0.00 ) and availability of skilled health workers ( = 78.86 ; df = 1 ; p < 0.00 ) are associated with the number of anc visits ( table 2 ) . after adjusting for covariates , women of yoruba and igbo ethnic groups were 44 and 94 times respectively more likely to achieve the recommended four or more anc visits compared to women belonging to hausa ethnic group ( table 2 ) . women living in urban areas ( aor = 2.14 ; ci 1.23 3.73 ) , having some form of autonomy ( aor = 8.74 ; ci 0.62 12.45 ) and those in the highest wealth quintile ( aor = 4.44 ; ci 0.64 30.64 ) had four or more number of anc visits compared to their rural colleagues , those without any form of autonomy and belonging the poorest wealth quintile respectively ( table 2 ) . similarly , women with at least primary level education ( aor = 2.40 ; ci 1.24 4.67 ) , belonging to professional employment category such as lawyers , health workers , teachers etc ( aor = 12.07 ; ci 0.19 75.74 ) and those who have access to skilled health workers ( aor = 5.13 ; ci 2.50 10.52 ) are more likely to make the required number of anc visits compared to those who are illiterates , unemployed and had no access to skilled health workers respectively ( table 2 ) . the model contained six predictive variables ( age , family wealth quintile , religious affiliation , highest educational attainment , parity , and distance to health facilityr ) . these variables were selected based on the result of the bivariate pearson chi square test , binary logistic regression and or known theoretical facts . these variables were found to be statistically significant ( 28 , n=967 ) 53.10 ; p < 0.00 , indicating that , the model was able to distinguish between participants who have had less than four anc visits and those who had four or more anc visits . the variables accounted for 39.1% ( cox & snell r square ) and 54.4% ( nagelkerke r square ) of variability among participants , correctly classified 80.4% of cases and together with hosmer and lemeshow goodness of fit test indicated the model being useful ( p = 0.77 ) since the p - value is larger than the alpha level ( table not shown ) . out of the 967 respondents , a total of 648 ( 67% ) had at least one anc visit during the last pregnancy before the 2008 ndhs survey . among those that had anc , only 328 had four or more recommended anc visits constituting only 33.9% of the total study sample . moreover , 319 ( 33% ) and 320 ( 33.1% ) of repondents had zero or less than four anc visits respectively . about 26.4% of the respondents commenced their anc visits in their third trimester ( table 1 ) . the age group 20 34 years old constituted the majority ( 44.9% ) of the respondents with a mean age of 27.2 + 3.2 years . the extreme of ages ( < 20 years and 35 years ) had the lowest proportion of women who had four or more anc visits . majority of the women ( 87% ) had at least two children ( table 1 ) . majority of the women were married ( 89.7% ) , belonging to kanuri / baribari ethnic group ( 42.2% ) , muslims ( 98.7% ) , lack any form of autonomy ( 79.8% ) and lived in rural areas ( 72.8% ) . living in urban areas ( 27.2% ) , yoruba ethnicity ( 60% ) , christians ( 30% ) and having full autonomy ( 30% ) had higher proportion of women that had four or more anc visits ( table 1 ) . majority of the respondents were illiterate ( 82% ) , unemployed ( 50% ) and belonged to the poorest / poor wealth quintile ( 78.3% ) , and only 11.7% , 14% and 24,7% , respectively of these categories of women had met the recommended minimum of four anc by the who ( table 1 ) . distance to the nearest health facility and lacking health insurance policy ( 99.6% ) showed lower proportion of women that had appropriate number of anc visits . majority of the respondents ( 91% ) were not attended by skilled health care workers and fewer still ( 19.8% ) had achieved the who recommendation of at least four anc visits ( table 1 ) . age is significantly associated with the number of anc visits ( = 43.11 ; df = 2 ; p < 0.00 ) . the age group 15 19 years were less likely to make four or more anc visits compared to women who were aged 20 34 years even after controlling for the covariates ( aor = 1.72 ; ci 0.75 3.91 ) ( table 2 ) . notes : or = odds ratio ; ci = confidence intervals ; attended at least one anc visit=648 parity of 2 ( aor = 0.47 ; ci 0.20 1.11 ) , religion ( aor = 0.99 ; ci 0.17 2.31 ) , distance to the nearest health facility ( aor = 0.99 ; ci 0.22 4.50 ) , availability of health insurance policy ( aor = 1.12 ; ci 0.99 1.71 ) and access to the media as a source of information on mhs ( aor = 0.99 ; ci 0.37 2.71 ) have no impact on the use of anc services after controlling for education , family wealth index , and availably of skilled health workers ( table 2 ) . place of domicile ( = 90.36 ; df = 1 ; p < 0.00 ) , ethnicity ( = 46.94 ; df = 5 ; p < 0.00 ) , level of education ( = 73.03 ; df = 3 ; p < 0.00 ) , occupation ( = 39.21 ; df = 3 ; p < 0.00 ) , family wealth index ( = 139.35 ; df = 4 ; p < 0.00 ) and availability of skilled health workers ( = 78.86 ; df = 1 ; p < 0.00 ) are associated with the number of anc visits ( table 2 ) . after adjusting for covariates , women of yoruba and igbo ethnic groups were 44 and 94 times respectively more likely to achieve the recommended four or more anc visits compared to women belonging to hausa ethnic group ( table 2 ) . women living in urban areas ( aor = 2.14 ; ci 1.23 3.73 ) , having some form of autonomy ( aor = 8.74 ; ci 0.62 12.45 ) and those in the highest wealth quintile ( aor = 4.44 ; ci 0.64 30.64 ) had four or more number of anc visits compared to their rural colleagues , those without any form of autonomy and belonging the poorest wealth quintile respectively ( table 2 ) . similarly , women with at least primary level education ( aor = 2.40 ; ci 1.24 4.67 ) , belonging to professional employment category such as lawyers , health workers , teachers etc ( aor = 12.07 ; ci 0.19 75.74 ) and those who have access to skilled health workers ( aor = 5.13 ; ci 2.50 10.52 ) are more likely to make the required number of anc visits compared to those who are illiterates , unemployed and had no access to skilled health workers respectively ( table 2 ) . the model contained six predictive variables ( age , family wealth quintile , religious affiliation , highest educational attainment , parity , and distance to health facilityr ) . these variables were selected based on the result of the bivariate pearson chi square test , binary logistic regression and or known theoretical facts . these variables were found to be statistically significant ( 28 , n=967 ) 53.10 ; p < 0.00 , indicating that , the model was able to distinguish between participants who have had less than four anc visits and those who had four or more anc visits . the variables accounted for 39.1% ( cox & snell r square ) and 54.4% ( nagelkerke r square ) of variability among participants , correctly classified 80.4% of cases and together with hosmer and lemeshow goodness of fit test indicated the model being useful ( p = 0.77 ) since the p - value is larger than the alpha level ( table not shown ) . maternal and child health services ( mchs ) is among the top priority of yobe state government as enshrined in the state health strategic plan for 2010 - 2015 . despite significant progress in mchs the mmr in the state was reported to be 1,549 per 100 , 000 live births which is about three times higher than the national average of 545 per 100,000 live births . furthermore , the anc utilization rate was 36% and of these only 9.8% had access to appropriate skilled health workers . in general , wide disparities exist between the different parts of the country with the states in the north east zone which includes yobe state having the worst maternal health indicators . in order to identify the root issues for the abysmal performance of the state , this study disaggregated data in line with the social determinants of health as advanced by the who . the low anc utilization rates in the north eastern states of nigeria which include yobe state is consistent with areas with the high levels of poverty , low female literacy and empowerment this is a reflection of the socioeconomic development , access and utilization mchs rendered in the state . while it might have cultural connotations , however , mchs will only be used when geographical and economic access is guaranteed . for instance , the yobe state health strategic plan for 2010 2015 clearly indicated the lack of technical and institutional capacity which could have contributed to the low utilization of anc services . the worsening of the current boko haram islamist extremist insurgency particularly from 2011 to date , could have further decimated the availability of skilled health workers based on recent report that the doctor population ratio is 1 for every 54,000 people . furthermore , a study on the state of health system following the boko haram insurgency has indicated that health workers have been abducted and/or killed and many health facilities were closed . the findings of this study showed that few respondent have access to skilled health workers ( 9% ) , very high proportion of illiterates ( 82% ) , families living in poverty ( 78.3% ) , high risk pregnancies among teenagers ( 22.1% ) and women more than 34 years ( 33% ) and lack of female autonomy ( 79.8% ) in terms of decision making , economic independence and freedom of going out of their matrimonial home on health grounds . these findings suggest that these women are likely to have high proportion of complicated pregnancies , poor access and utilization of mchs , which might have contributed to the high mmr as was similarly observed in other studies.[29 - 33 ] furthermore , these high risk pregnancies coupled with short interval between births ( 25.3% ) and grand multipara ( 50.6% ) as observed in this study , could be the underlying root causes for most of the high proportion of preventable maternal deaths . however , the low proportion of women who had four or more number of anc visits means that , many high risk pregnant women may not be detected and may result in life threatening condition and in extreme cases could lead to the death of a woman and or her baby . the lack of autonomy further compound the scenario , since it may lead to delays to decide to seek modern medical care when early signs of danger are noticed . although , the low anc utilization rate could be influenced by place of domicile , ethnicity , religion and female autonomy , however , these factors were not found to be consistently statistically significant after controlling for covariates such as education and income levels . the low utilization of anc services as observed in this study is not in keeping with the findings of another study in nigeria that reported muslim women are less likely to have four or more number of anc visits compared to their christian counterparts . this assertion is not consistent when confounders such as tribe , income and level of education were controlled as was the case in this study . moreover , after controlling for age , wealth index , education and distance , parity and religion have no significant impact on the number of anc visits and its main effect associations shifted from been statistically significant to not significant ( table 2 ) . hence , the role of ethnicity and religion needs to be studied as both shape the attitude and behaviors of the populace . the reason been that , each of the major ethnic group particularly hausa , igbo , fulani and kanuris are predorminantly ( > 90% ) adherents of either christianity or islam and each has different ethnically driven norms on pregnancy and childbirth . it is important to underscore that the study being cross sectional design has only demonstrated the strength of associations rather than causal factors . moreover , dhs data is individual based and therefore might not fully represent community level factors and hence the need for studies with robust designs . this study demonstrated that , educational level , family wealth income , and availability of skilled health worker are consistently associated with the number of anc even after controlling for covariates . these three predicor variables are in tandem with mdg 1 ( eradication of extreme poverty and hunger ) , mdg 2 ( universal basic education ) , mdg 3 ( gender equality ) and mdg 4 ( maternal mortality ) . these three variables have significant impact on population health outcome and need for intersectoral collaboration with ministries of education , agricultural and other social services using primary health care as the springboard . a sustainable approach is to provide compulsory free universal basic education for girls ( mdg 2 ) to emhance uptake and retention of girl s up to secondary level of education . this will have a multiplier effect towards reduction in poverty ( mdg 1 ) , improve female autonomy and equality ( mdg 3 ) and improve health cultural capital that will ultimately reduce maternal deaths ( mdg 5 ) . hence , the provision of health care services should be driven by results based management approach in order to enhance realistic multipronged planning , ownership , commitment , accountability and transparency among various stakeholders . there is therefore , the need for an independent periodic program reviews to guide timely and appropriate interventions . more than 67% of pregnant women in yobe state , nigeria did not receive the recommended four antenatal care visits visits.lack of education is the most consistent variable associated with antenatal care utilization in yobe state , nigeria.educating all girls beyond primary school level could enhance improvement in female empowerment and ability to make the most appropriate healthcare related choices.girl-child education is among the most promising interventions to address global issues like extreme poverty and hunger ( mdg 1 ) , low female literacy rate ( mdg 2 ) , gender inequality ( mdg 3 ) , high maternal and infant morbidity and mortality ( mdg 4 & 5 ) in yobe state , nigeria . more than 67% of pregnant women in yobe state , nigeria did not receive the recommended four antenatal care visits visits . lack of education is the most consistent variable associated with antenatal care utilization in yobe state , nigeria . educating all girls beyond primary school level could enhance improvement in female empowerment and ability to make the most appropriate healthcare related choices . girl - child education is among the most promising interventions to address global issues like extreme poverty and hunger ( mdg 1 ) , low female literacy rate ( mdg 2 ) , gender inequality ( mdg 3 ) , high maternal and infant morbidity and mortality ( mdg 4 & 5 ) in yobe state , nigeria .

objective : in nigeria , wide disparities exist between the different parts of the country , with the states in the north east zone having poor health resources . the objective of this study is to assess whether women s biological , sociocultural , and economic characteristics are associated with utilization of ante natal care services as measured by number of antenatal care ( anc ) visits in yobe state.methods:this is a secondary data analysis of the 2008 nigeria demographic and health survey with records from 33,385 women between 15 - 49 years who had given birth between january 2003 and december 2008 in yobe state . bivariate pearson s chi square test and two stages of multivariate regression analysis were conducted.results:women with at least primary level education ( adjusted or ( aor ) = 2.40 ; ci 1.24 4.67 ) , belonging to professional employment category ( aor = 12.07 ; ci 0.19 75.74 ) and those who had access to skilled health workers ( aor = 5.13 ; ci 2.50 10.52 ) are more likely to make the required number of anc visits compared to those who are illiterates , unemployed and had no access to skilled health workers.conclusion and global health implications : this study demonstrated that educational level , family wealth income , and availability of skilled health worker were consistently associated with the number of anc visits even after controlling for covariates . these three covariates are in tandem with the millenium development goals ( mdg ) 1 - eradication of extreme poverty and hunger ; mdg 2 - universal basic education ; mdg 3 - gender equality ; and mdg 4 - maternal mortality . there is the need for inter - sectoral holistic intervention approach .

Background and Objective Methodology Results Descriptive Biological characteristics of respondents Cultural characteristics of respondents Economic characteristics of respondents Respondents health system characteristics Results of bivariate and logistic regression analysis Predictive model on the utilization of ANC services Discussions Conclusions and Global Health Implications

peroxisome proliferator - activated receptors ( ppars ) are a class of nuclear transcription factors that are activated by fatty acids and their derivatives . one of these , ppar , regulates responsiveness to insulin in adipose cells , and ppar-activating drugs such as pioglitazone are used in the treatment of type 2 diabetes . ppar acts in myeloid - lineage cells , including t - cells and macrophages , to suppress their activation and their elaboration of inflammatory molecules . ppar activation also suppresses the activated phenotype in microglia , suggesting that ppar-activating drugs may be of benefit in chronic neuroinflammatory diseases . some , but not all , nonsteroidal anti - inflammatory agents ( indomethacin and ibuprofen in particular ) also have activating effects on ppar. these observations suggest on the one hand a role for ppar-activating drugs in the treatment of chronic neuroinflammatory diseases - as shown for a patient with secondary progressive multiple sclerosis by pershadsingh et al . in this issue of the journal of neuroinflammation - and suggest on the other hand a possible explanation for confusing and contradictory results in trials of nonsteroidal anti - inflammatory agents in alzheimer 's disease . there are still times in modern medicine when a single patient can enlighten our understanding of a disease or disease process , and can serve as an impetus for further discovery . in this issue of journal of neuroinflammation , harrihar pershadsingh and his colleagues describe stabilization and , indeed , clinical improvement in a patient with progressive secondary multiple sclerosis who was treated with pioglitazone over a three - year period . the possible connection between pioglitazone and multiple sclerosis is a fascinating story in itself , and one that not only provides interesting parallels between chronic cns inflammatory diseases and chronic peripheral diseases , but also illuminates an area of current interest for diseases such as alzheimer 's disease as well . the mechanism of action involves activation of a nuclear transcription factor known as the peroxisome proliferator - activated receptor gamma , or ppar , that controls lipid metabolism in adipocytes , and sensitizes these cells to insulin . ppar agonists also suppress t - cell activation suggesting that they may be useful in treating inflammatory diseases . moreover , activation of ppar in microglia ( as well as in macrophages ) results in decreased activation of these cells , with decreased expression of pro - inflammatory cytokines and related molecules . this suggests that ppar agonists might be useful in a number of central nervous system diseases with inflammatory components . peroxisomes , or microbodies as they were originally known , were discovered by early electron microscopists in the 1950s . christian de duve , in brussels , belgium , subsequently isolated these structures , demonstrated hydrogen peroxide generation , and renamed them peroxisomes . a class of drugs was identified that promoted cancer - like growths in animals , but that did not cause dna damage . what these drugs did do was to stimulate proliferation of peroxisomes in target cells . at the time , this suggested a specific genetic trigger for tumorigenesis , and there ensued two decades of attempts to identify the receptor for these peroxisome proliferation - activating drugs . by the 1990s , when ppars were identified and shown to be transcription factors , interest had waned in cancer circles . ppars are a class of transcription factors that are activated by fatty acids and their derivatives . they were found to control a number of genes , most of which have little or nothing to do with peroxisomes . ppar is important both in fat cell metabolism and in modulating cellular responsiveness to insulin - hence the connection with diabetes . ppar-activating drugs were subsequently found to regulate t - cell responsiveness and to suppress macrophage and microglia activation [ 9 - 11 ] . both of these actions are relevant to multiple sclerosis , and may have implications for other chronic neurodegenerative diseases as well . in addition to pioglitazone , some ( but not all ) nonsteroidal anti - inflammatory drugs ( in particular indomethacin and ibuprofen ) have activating effects on ppar in addition to their effects on cyclooxygenase . nsaid use has been linked with decreased risk of alzheimer 's disease in epidemiological studies [ 13 - 15 ] , but prospective trials of nsaids in alzheimer patients have yielded contradictory and inconclusive results [ 16 - 18 ] . the nsaid - ppar connection might explain some of these contradictions , as the only one of these clinical trials that reported a benefit was also the only one that used a ppar-activating drug . there are currently two clinical trials in progress testing the efficacy of ppar agonists in ad patients . pioglitazone and related drugs activate ppar , and activation of ppar suppresses t - cell , macrophage , and microglial immune responses . if suppression of these immune responses is of potential benefit for inflammatory diseases of the brain , then pioglitazone should provide therapeutic benefit in multiple sclerosis . multiple sclerosis , of course , is notoriously variable in its course , but the secondary progressive variant is an exception to this . show clinical stabilization in such a patient , treated for three years with the ppar-activating drug pioglitazone . this single clinical case thus provides support for a link between ppar activation and suppression of neuroinflammation , and suggests avenues of research for the further treatment of multiple sclerosis as well as other chronic neuroinflammatory diseases . supported in part by nih po1 ag 12411 , nih p30 ag19606 , and nih ro1 ag 37989

backgroundperoxisome proliferator - activated receptors ( ppars ) are a class of nuclear transcription factors that are activated by fatty acids and their derivatives . one of these , ppar , regulates responsiveness to insulin in adipose cells , and ppar-activating drugs such as pioglitazone are used in the treatment of type 2 diabetes . ppar acts in myeloid - lineage cells , including t - cells and macrophages , to suppress their activation and their elaboration of inflammatory molecules . ppar activation also suppresses the activated phenotype in microglia , suggesting that ppar-activating drugs may be of benefit in chronic neuroinflammatory diseases . some , but not all , nonsteroidal anti - inflammatory agents ( indomethacin and ibuprofen in particular ) also have activating effects on ppar.discussion and conclusionsthese observations suggest on the one hand a role for ppar-activating drugs in the treatment of chronic neuroinflammatory diseases - as shown for a patient with secondary progressive multiple sclerosis by pershadsingh et al . in this issue of the journal of neuroinflammation - and suggest on the other hand a possible explanation for confusing and contradictory results in trials of nonsteroidal anti - inflammatory agents in alzheimer 's disease .

Background Discussion and conclusions Introduction Discussion Conclusions List of abbreviation used Competing interests Acknowledgments