article
stringlengths 402
128k
| abstract
stringlengths 155
2.46k
| section_names
stringlengths 1
672
|
|---|---|---|
ehlers - danlos syndrome ( eds ) is a clinically , genetically and biochemically heterogeneous group of inherited connective tissue disorders . the major manifestations of eds are skin fragility , skin hyperextensibility and joint hypermobility [ 1 , 2 ] .
the disorder was first reported in 1668 , but it was not until the early 1900s that the characteristics of the syndrome were described by ehlers and danlos .
six types of eds have been described on the basis of clinical , genetic and/or biochemical differences .
eds is now considered a heterogeneous group of disorders , the most lethal of which is the vascular type ( veds ) , formerly called type iv eds ( mim # 130050 ) .
it is caused mainly by glycine substitution mutation in the triple helix region of the type iii collagen gene ( col3a1 : mim # 120180 ) , leading to extreme fragility of blood vessels , bowel and uterus and thus leading to spontaneous rupture .
the following is an account of a previously undiagnosed veds patient with bowel complications who was managed at our institution .
a 20-year - old female patient was referred to our hospital with abdominal pain , nausea and vomiting .
her vital signs were a temperature of 37.9c , a heart rate of 98 beats per minute and a blood pressure of 97/49 mm hg .
a computed tomography scan showed notable dilatation of the sigmoid colon with intraperitoneal fluid ( fig .
1 ) . an emergent laparotomy revealed dilatation of the sigmoid colon , breakdown of the serosa and muscularis propria of the sigmoid colon with impending perforation , and intra - abdominal hemorrhage caused by breakdown of the mesenterium of the sigmoid colon ( fig .
2 ) . as the rest of the intestine was normal , resection of the sigmoid colon with hartmann 's pouch and an end colostomy were performed .
the macroscopic appearance of the resected colon showed strong alteration of the bowel wall , with some areas showing a complete lack of the lamina muscularis propria ( fig .
the postoperative course was uneventful , and the patient was discharged from the hospital 1 month after entry .
careful physical examination showed joint hypermobility , translucent skin with venous prominence and facial structure abnormalities ( crooked nose and large eyes ) .
because of the uncommon intraoperative and clinical findings , there was a high suspicion of connective tissue disorder .
genetic analysis using cdna extracted from the patient 's fibroblasts by a reverse transcriptase polymerase chain reaction direct sequencing method showed a nucleotide change at c.2150 g > a on exon 32 ( genbank i d : nm_000090.3 ) as the reference .
this nucleotide change resulted in the amino acid change of glycine at position 717 to aspartate within the triple helix region of col3a1 ( gly717asp ) , which confirmed a diagnosis of veds ( fig .
eds comprises a group of hereditary connective tissue disorders with different genetic backgrounds and heterogeneous clinical features .
common to all of these types is an underlying defect in either collagen production or processing .
the disease is caused by heterozygous germline mutations in the type iii procollagen gene ( col3a1 ) [ 10 , 11 , 12 , 13 ] .
the diagnosis of veds depends on the combination of clinical manifestations , family history and the demonstration of collagen type iii qualitative and/or quantitative defects . as type iii collagen is most abundant in vessels and hollow organ soft tissue , defects in type iii collagen production result in vascular and hollow organ complications .
the clinical features of veds include prematurity , low birth weight , congenital dislocation of the hips , club feet , easy bruising , thin and translucent skin displaying prominent venous patterns , hypermobility of small joints , constipation , arterial aneurysms and ruptures , spontaneous pneumothorax and colonic perforations .
since skin and joint manifestations are less prominent than in the other types of eds , the diagnosis of veds often is missed until the patient presents with a major complication such as spontaneous arterial or bowel rupture .
the first complication occurs by age 20 in 25% of cases , and in 80% of cases by age 40
. as the most common complications of the disease are in the gastrointestinal tract and vascular systems , surgical approaches are troublesome for surgical teams .
early diagnosis of peritonitis is critical so that an appropriate therapy can be instituted expeditiously , including correction of fluid and electrolyte abnormalities , institution of antibiotic therapy and surgical repair of the underlying lesion .
as the tissues are extremely fragile , it is essential to avoid invasive techniques . sutures tend to tear them out , bowel walls are extremely friable and anastomosis is arduous .
small vessels are equally fragile , occasioning difficult hemostasis , oozing and hematoma formation [ 19 , 20 , 21 ] . although spontaneous bowel perforation has been reported in the literature with more than 50 cases documented , the surgical management and outcomes of this manifestation of veds have varied considerably . in a retrospective review of the literature ,
41 colonic perforations were reported , 80% of which were in the sigmoid colon . of these patients ,
66% were treated with resection and diversion , with 18 eventually undergoing restoration of intestinal continuity .
a total of 55.6% of these patients suffered a re - perforation , some with three or four perforations .
different surgical procedures have been advocated , but there is no large serial study currently available to demonstrate the superiority of any one option .
women with veds have an increased risk of complications of pregnancy as well as a 50% risk of having an affected child . major complications of pregnancy can occur in the antenatal period , during labor and delivery , and postpartum .
a maternal mortality of up to 25% has been reported due to rupture of the artery , bowel or uterus .
the complications of pregnancy include rupture of the bowel , aorta , vena cava or uterus , vaginal laceration , postpartum uterine hemorrhage , varicose veins , uterine and/or bladder prolapse , joint laxity , abdominal herniation and wound dehiscence .
these patients who become pregnant should be considered at high risk and should receive regular follow - up at specialized centers .
no specific therapy has been shown to delay or prevent further complications , and the long - term natural history of this anatomy in veds is confrontational . however ,
kazuya okada , hitoshi okubo , mitsutoshi matsuo and hiroki kishikawa contributed equally to this work ; banyar than naing , atsushi watanabe and takashi shimada contributed new analytic tools ; akira yoneda wrote the paper . | ehlers - danlos syndrome , vascular type ( veds ) ( mim # 130050 ) is an autosomal dominant disorder caused by mutation in the type iii collagen gene , col3a1 , leading to fragility of blood vessels , bowel and uterus that leads to spontaneous rupture .
we report a previously undiagnosed veds patient with bowel complications .
a 20-year - old female patient was referred to our hospital with abdominal pain .
computed tomography showed notable dilatation of the sigmoid colon with intraperitoneal fluid .
laparotomy revealed dilatation of the sigmoid colon , breakdown of serosa and muscularis propria of the sigmoid colon with impending perforation , and intra - abdominal hemorrhage caused by breakdown of the mesenterium .
resection of the sigmoid colon with hartmann 's pouch and an end colostomy were performed .
physical examination showed joint hypermobility , translucent skin with venous prominence and facial structure abnormalities .
genetic analysis using cdna extracted from the patient 's fibroblasts by reverse transcriptase polymerase chain reaction direct sequencing showed a missense mutation within the triple helix region of col3a1 ( c.2150 g > a ; gly717asp ) . | Introduction
Case Report
Discussion
Disclosure Statement
Author Contributions |
crohn 's disease ( cd ) is a chronic , progressive , and potentially disabling disease , characterised by relapsing and remitting episodes of transmural inflammation of the gastrointestinal tract which might be associated with arthritic manifestations .
both cd and ulcerative colitis ( uc ) can be categorized under the name of inflammatory bowel disease ( ibd ) .
the differentiation between uc and cd is mainly based on clinical manifestations and the scale of bowel involvements .
patients with either cd or uc , however , are likely to have associated extraintestinal manifestations .
ibd is classified as one of the constituents of a group of diseases collectively termed spondyloarthropathies ( spas ) .
the other entities of this group include ankylosing spondylitis ( as ) , reactive arthritis , psoriatic arthropathy , and undifferentiated spa .
there are certain features frequently associated with this group of diseases and these include spinal / sacroiliac arthritis , oligoarthritis , enthesitis , uveitis , negativity for rheumatoid factors , and a positive family history . a positive family history and a high degree of association of spas with hla - b27 genetic markers have placed these conditions under the umbrella of what is called b27 diseases .
furthermore , patients with cd seem to share more genetic , clinical , laboratory , immunological , and pathological features with as patients [ 57 ] .
it has a high impact on the psychological condition , as well as the social status and work abilities in patients with this disease .
based on these negative effects on the general health and welfare of patients with cd and the drawbacks of the currently used medical treatments as well as the increased likelihood of surgical complications in these patients , a search for the causative factor(s ) together with a proposal for the use of an alternative therapeutic strategy involving eradication of the causative factors could be of crucial importance in the management of this disease .
the incidence of cd has been increasing substantially in the last few decades , where more than 40,000 new cases in europe and north america have been estimated to be diagnosed each year . in a more recent analytical review study
, it was shown that the incidence and prevalence of cd are increasing with time and in different regions around the world , particularly among the caucasians . the same increase in the incidence of cd
these rises in the occurrence of cd could largely be explained by altered lifestyles and environmental exposures and/or changes in the dietary habits among the patients with this disease .
at least three interacting elements including genetic factors , intestinal microbes , and immune - mediated inflammation are involved in the pathogenesis of cd . the most popular theory , however , is that the disease usually results from an abnormal immune response to certain enterobacterial pathogens present in the gut lumen .
evidence from twin and familial aggregation as well as genome - wide association studies indicates that genetic factors play an important role in the aetiopathogenesis of cd ( as shown in the lists below ) .
although many of the non - hla genes such as nod2/card15 , il23r , and ctla4 have been suggested to play a role in the susceptibility to develop cd until now , however , scientists have not been able to discover a gene which might solely contribute to the aetiology of this disease .
aetiopathogenetic evidence for the roles of genetic / microbial ( especially klebsiella ) factors in cd
evidence of the genetic involvement
positive family history.a considerable increase in the risk of developing the disease among monozygotic twin of patients with cd.higher risk of developing the disease among relatives of patients with cd or other entities of spas.presence of hla - b27 genetic markers in more than 50% of patients with cd having spondylitis.significant association with nod2/card15 and some other genetic mutations.transgenic rats carrying human hla - b27 genes are more prone to develop spontaneous bowel lesions .
positive family history . a considerable increase in the risk of developing the disease among monozygotic twin of patients with cd .
higher risk of developing the disease among relatives of patients with cd or other entities of spas .
presence of hla - b27 genetic markers in more than 50% of patients with cd having spondylitis .
transgenic rats carrying human hla - b27 genes are more prone to develop spontaneous bowel lesions .
evidence of the environmental / microbial factors
more than 80% of dizygotic twins of patients with cd fail to develop the disease.increased incidence of cd among friends and clustering of unrelated people as well as immigrants moving from low to high risk areas.associated bouts of remissions and exacerbations with spatial and temporal variations in the incidence and the clinical course of the disease in cd.increased gut mucosal leukocyte trafficking and enhanced microbial innate immune responses , as well as increased risk of developing the disease after appendectomy in patients with cd .
more than 80% of dizygotic twins of patients with cd fail to develop the disease .
increased incidence of cd among friends and clustering of unrelated people as well as immigrants moving from low to high risk areas .
associated bouts of remissions and exacerbations with spatial and temporal variations in the incidence and the clinical course of the disease in cd . increased gut mucosal leukocyte trafficking and enhanced microbial innate immune responses , as well as increased risk of developing the disease after appendectomy in patients with cd .
evidence of the role of klebsiella and crossreactive self antigens
increased load of klebsiella culture from fecal matter in the large bowel.occurrence of intercurrent klebsiella intestinal colitis in patients with cd.significantly enhanced antibody responses to klebsiella microbes were found on many occasions in patients with cd when compared to healthy subjects .
increased antibody levels against collagens i , iii , and iv , all crossreactive with klebsiella pullulanase enzymes , were found in patients with cd when compared to healthy controls.molecular similarities were found between different antigens present in klebsiella nitrogenase and pullulanase puld enzymes and hla - b27 self - antigens .
enzymes were found to possess a molecular structure similar to the trihelical shape of collagen i , iii , and iv fibres .
increased load of klebsiella culture from fecal matter in the large bowel .
occurrence of intercurrent klebsiella intestinal colitis in patients with cd . significantly enhanced antibody responses to klebsiella microbes were found on many occasions in patients with cd when compared to healthy subjects .
increased antibody levels against collagens i , iii , and iv , all crossreactive with klebsiella pullulanase enzymes , were found in patients with cd when compared to healthy controls .
molecular similarities were found between different antigens present in klebsiella nitrogenase and pullulanase puld enzymes and hla - b27 self - antigens .
enzymes were found to possess a molecular structure similar to the trihelical shape of collagen i , iii , and iv fibres .
the link between hla - b27 and cd on the other hand is relatively more obvious especially in patients with associated spondylitis .
for example , more than forty percent of patients with cd , especially those having spondylitis / sacroiliitis , were found to be positive for the hla - b27 markers , but the prevalence of this gene in patients with cd without spondylitis / sacroiliitis merely parallels its frequency in the caucasian general population .
furthermore , hla - b27 positive caucasians are 20 times more likely to develop one or other entities of the spas , including ibd .
there is also evidence of high risk and cross - risk ratios among the first- , second- , or third - degree relatives to develop ibd or as .
moreover , in an experimental study by a group from dallas , transgenic rats with high level of human hla - b27 expression were found to be more prone to develop bowel inflammation with arthritis , and the severity of intestinal features was correlating with concentration of the large bowel microbial flora .
extensive evidence supports the role of certain environmental and/or microbial factors in the aetiopathogenesis of ibd and particularly in the causation of cd ( as shown in the first three lists).a negative family history in more than 95% and a low concordance rate among twins of patients with cd support the role of environmental factors in the development of this disease.there is a report for an increased clustering of cd among unrelated individuals and closely living friends , as well as amid second - generation immigrants moving from low to high risk areas . in a previous study on a large moroccan family and one parent with cd emigrated to belgium
, 4 out of the 8 children were found to have subsequently developed the disease .
failure to find significant genetic variants with high incidence of cd among this family suggests the direct role of a major environmental factor which probably has been encountered in the new residing area and is not related to the sanitation in childhood .
patients with cd show intermittent variations in the clinical onset and activity during the disease course as well as during different seasons of the year with associated concurrent intestinal bacterial infections . increased incidence of cd after appendectomy , together with involvement of neutrophils and lymphocytes in the gut inflammation as well as enhanced general immune response to enterobacterial antigens in these patients ,
supports the role of gut microbes in the aetiopathogenesis of this disease.transgenic rats do not develop colitis under germ - free conditions , but when these rats are transferred into conventional environments , they develop signs of intestinal inflammation and colitis .
these results indicate that colonic microflora plays a key role in the development or exacerbation of the intestinal inflammation resembling that occurring in patients with cd . a negative family history in more than 95% and a low concordance rate among twins of patients with cd support the role of environmental factors in the development of this disease .
there is a report for an increased clustering of cd among unrelated individuals and closely living friends , as well as amid second - generation immigrants moving from low to high risk areas . in a previous study on a large moroccan family and one parent with cd emigrated to belgium ,
failure to find significant genetic variants with high incidence of cd among this family suggests the direct role of a major environmental factor which probably has been encountered in the new residing area and is not related to the sanitation in childhood .
patients with cd show intermittent variations in the clinical onset and activity during the disease course as well as during different seasons of the year with associated concurrent intestinal bacterial infections .
increased incidence of cd after appendectomy , together with involvement of neutrophils and lymphocytes in the gut inflammation as well as enhanced general immune response to enterobacterial antigens in these patients , supports the role of gut microbes in the aetiopathogenesis of this disease .
transgenic rats do not develop colitis under germ - free conditions , but when these rats are transferred into conventional environments , they develop signs of intestinal inflammation and colitis .
these results indicate that colonic microflora plays a key role in the development or exacerbation of the intestinal inflammation resembling that occurring in patients with cd . during the last few decades , various microbial agents , including also klebsiella pneumonia , have been implicated to have a role in the aetiopathogenesis of cd . a considerable amount of microbiological , molecular , and immunological evidence exists which supports the role of klebsiella microbes in the aetiology of cd ( figure 1 ) ( as shown in the first three lists ) .
it was reported that , in more than 20% of patients with cd , klebsiella microorganisms have been isolated from the large bowel specimens ( hring et al . , 1991 ) .
the disease relapses in patients with cd were found also to be associated with attacks of klebsiella oxytoca colitis . in a study on the biopsy specimens taken from 12 patients with cd , it has been shown that invasion of the bowel mucosa by microbial agents including also enterobacteriaceae spp .
was evident in 55.6% of the ileal and in 25% of the colonic specimens from the cd patients , but no bacteria were detected in the tissues of the non - cd controls . in another study using immunohistochemistry , however , the majority of biopsy specimens taken from the bowel mucosa of patients with ibd have shown negative staining for escherichia , listeria , and even klebsiella microbes .
this latter finding could indicate that it is the microbial bulk in intestinal lumen rather than at the sites of the pathological lesions , which is important in evoking both local mucosal and general antibacterial immune responses .
for example , nitrogenase reductase enzyme possesses a hexameric amino acid sequence , qtdred , which has been found to be homologous to another sequence present in hla - b27 molecules . in a later study , puld secretion protein from klebsiella pullulanase enzyme , which carries tetramer amino acid residues , drde , was found to be homologous to dred sequence present in hla - b27 molecules , whilst repeating gly - x - pro amino acid sequences present in the pula secretion components of klebsiella pullulanase enzyme were found to be similar to those present in the trihelical structures of collagen types i , iii , and iv .
significant cytotoxic reactions shown as percentage hemolysis for sheep red blood cells coated with hla - b2705 peptide were detected in the serum samples containing high anti - klebsiella antibodies concentrations taken from as patients when compared to control sera .
it was reported that , in more than 20% of patients with cd , klebsiella microorganisms have been isolated from the large bowel specimens ( hring et al . , 1991 ) .
the disease relapses in patients with cd were found also to be associated with attacks of klebsiella oxytoca colitis . in a study on the biopsy specimens taken from 12 patients with cd
, it has been shown that invasion of the bowel mucosa by microbial agents including also enterobacteriaceae spp .
was evident in 55.6% of the ileal and in 25% of the colonic specimens from the cd patients , but no bacteria were detected in the tissues of the non - cd controls . in another study using immunohistochemistry , however , the majority of biopsy specimens taken from the bowel mucosa of patients with ibd have shown negative staining for escherichia , listeria , and even klebsiella microbes .
this latter finding could indicate that it is the microbial bulk in intestinal lumen rather than at the sites of the pathological lesions , which is important in evoking both local mucosal and general antibacterial immune responses .
for example , nitrogenase reductase enzyme possesses a hexameric amino acid sequence , qtdred , which has been found to be homologous to another sequence present in hla - b27 molecules . in a later study
, puld secretion protein from klebsiella pullulanase enzyme , which carries tetramer amino acid residues , drde , was found to be homologous to dred sequence present in hla - b27 molecules , whilst repeating gly - x - pro amino acid sequences present in the pula secretion components of klebsiella pullulanase enzyme were found to be similar to those present in the trihelical structures of collagen types i , iii , and iv .
significant cytotoxic reactions shown as percentage hemolysis for sheep red blood cells coated with hla - b2705 peptide were detected in the serum samples containing high anti - klebsiella antibodies concentrations taken from as patients when compared to control sera .
collagen - induced enterocolitis as well as arthritis has been observed in experimental animals when immunized with homologous colonic extracts and collagen type ii together with klebsiella lipopolysaccharides .
elevated levels of humoral immune responses to klebsiella microbes in patients with cd as well as uc have been shown in several studies carried out at six different gastroenterology centres in the united kingdom.significantly increased levels of antibodies against klebsiella and yersinia enterobacterial agents were observed in patients with cd and uc from birmingham when compared to corresponding healthy controls .iga antibody levels against klebsiella microbes were found to be significantly increased in patients with ibd and as from glasgow when compared to corresponding control subjects .anti - klebsiella antibody levels were found to be significantly higher in patients with cd and as from edinburgh when compared to corresponding controls .in three consecutive studies carried out at different gastroenterology centres in london and winchester , similar results have been reported . in one study ,
klebsiella antibody levels were found to be significantly higher in patients with ibd and as when compared to healthy or other disease controls , whilst no such elevations were observed in the antibody levels against e. coli or other anaerobic intestinal microbes . in a second study , the levels of class - specific isotypic antibodies against many klebsiella antigens were found to be significantly elevated in patients with cd and as when compared to patients with coeliac disease or to healthy controls . in a third study , the levels of class - specific antibodies against klebsiella microbes and crossreactive collagens i , iii , iv , and v were found to be significantly increased in patients with early and late cd as well as in patients with as when compared to healthy controls .
moreover , a positive correlation was demonstrated between antibody levels to collagen types i , iii , and iv and klebsiella in both groups of patients with cd and as .
significantly increased levels of antibodies against klebsiella and yersinia enterobacterial agents were observed in patients with cd and uc from birmingham when compared to corresponding healthy controls .
iga antibody levels against klebsiella microbes were found to be significantly increased in patients with ibd and as from glasgow when compared to corresponding control subjects .
anti - klebsiella antibody levels were found to be significantly higher in patients with cd and as from edinburgh when compared to corresponding controls . in three consecutive studies carried out at different gastroenterology centres in london and winchester ,
klebsiella antibody levels were found to be significantly higher in patients with ibd and as when compared to healthy or other disease controls , whilst no such elevations were observed in the antibody levels against e. coli or other anaerobic intestinal microbes . in a second study ,
the levels of class - specific isotypic antibodies against many klebsiella antigens were found to be significantly elevated in patients with cd and as when compared to patients with coeliac disease or to healthy controls . in a third study , the levels of class - specific antibodies against klebsiella microbes and crossreactive collagens i , iii , iv , and v were found to be significantly increased in patients with early and late cd as well as in patients with as when compared to healthy controls .
moreover , a positive correlation was demonstrated between antibody levels to collagen types i , iii , and iv and klebsiella in both groups of patients with cd and as .
it is , therefore , plausible that cd disease could result from repeated subclinical infections by klebsiella microbes in the large bowel with the consequent inflammations and tissue damage in the bowel and joints resulting from the binding of anti - klebsiella and anti - self tissue antibodies to the crossreactive targeted antigens .
dietary macronutrients especially carbohydrates are considered as a major factor driving the composition and metabolism of the colonic microbiota .
recent evidence from molecular ecology has shown that the amount and type of nondigestible carbohydrates including starch influence the species composition of the gut microbiota both in short - term dietary intervention and in response to habitual long - term dietary intake [ 50 , 51 ] . in a recent study , a measure of 120 g / l of glucose
was found to be one of the optimal requirements for the cell growth and lipid synthesis of lipomyces starkeyi yeast .
it is composed of two types of structurally distinct -glucan polymer , amylase , and amylopectin .
amylose , which constitutes around 2030% of the starch particle , consists of long chains of several thousand -glucosyl units joined by (14)-linkages , whilst amylopectin , which constitutes the other 7080% part of starch , is a branched molecule comprising short chains of (14)-linked -glucosyl units , joined by (16 ) branch linkages .
degradation of the starch molecules is carried out by various catalytic enzymes , which are produced by plants , microbes , and human body . among these starch - debranching enzymes ,
however , pullulanases and -amylases are known to be among the potent groups .
klebsiella microbes can survive in harsh environments exploiting some of their enzymatic products , which are required for the protection , maintenance , and survival of these microbes . apart from nitrogenase reductases
these microbes can utilize starch as the sole carbon and energy source via two metabolic routes .
the first one involves the extracellular degradation into linear maltodextrins by hydrolysis of the glycosidic bonds via the cell - surface - associated pullulanase and then the subsequent cleavage of the glycosidic linkages by the action of the extracellular glycosyltransferase .
the large bowel in humans is described as a complex ecosystem , containing a large number of microbial species .
although the composition of the colonic microbiota in adults is relatively stable , its concentration , however , can be manipulated by dietary means . for example
, it has been reported that a high intake of carbohydrate , particularly oligosaccharides , can stimulate the growth of bifidobacterium spp .
a considerable part of the consumed starchy food escapes digestion in the human small intestine and directly enters the large bowel .
these starches that are not degraded in the small intestine and referred to as resistant starch can be used as substrate for bacterial fermentation .
it has been shown that up to 20% of the total starch materials consumed by normal individuals fail the absorption process when assessed by oral hydrogen excretion studies .
these starch materials are basically present in potatoes and wheat flour products such as pasta and bread ( as shown in the lists below ) .
recommended diet for crohn 's disease and ankylosing spondylitis patients
decreased intake of high - starch - containing foods
flour and related products : breads , biscuits , cakes , puddings , pies , and popcorn .
rice varieties : brown or white , boiled , fried , or in puddings .
potatoes : baked , boiled , fried , roasted , or mashed potatoes .
flour and related products : breads , biscuits , cakes , puddings , pies , and popcorn .
rice varieties : brown or white , boiled , fried , or in puddings .
potatoes : baked , boiled , fried , roasted , or mashed potatoes .
increased intake of none - low - starch - containing foods
meat : beef , pork , lamb , bacon , salami , corned beef , luncheon mean , potted meat , ham , and veal as well as chicken , turkey duck , or any other poultry meat .
fish : white fish such as cod , haddock , plaice , and sole ; shellfish such as crab , lobster , prawns , scampi , cockles , mussels , and oysters ; and other fish such as herring , salmon , mackerel , tuna , and sardines .
milk products : fresh , dried , or condensed milk , plain and flavoured yoghurts , and all types of cheese .
vegetables : green vegetables such as cabbages , cauliflowers , sprouts , courgettes , peppers , mushrooms , carrots , and spinach or all salad vegetables like lettuce , cucumber , tomatoes , and water cress .
meat : beef , pork , lamb , bacon , salami , corned beef , luncheon mean , potted meat , ham , and veal as well as chicken , turkey duck , or any other poultry meat .
fish : white fish such as cod , haddock , plaice , and sole ; shellfish such as crab , lobster , prawns , scampi , cockles , mussels , and oysters ; and other fish such as herring , salmon , mackerel , tuna , and sardines .
milk products : fresh , dried , or condensed milk , plain and flavoured yoghurts , and all types of cheese .
vegetables : green vegetables such as cabbages , cauliflowers , sprouts , courgettes , peppers , mushrooms , carrots , and spinach or all salad vegetables like lettuce , cucumber , tomatoes , and water cress .
the total colony counts in the bacterial population of bifidobacteria , lactobacilli , streptococci , and enterbacteria species were found to be increased significantly in the caecum and faeces of a group of rats which have been fed resistant potato starch when compared to those rats taking a diet made of rapidly digestible waxy maize devoid of resistant starch . in an in vitro study , it has been found that the mean number of klebsiella was ten times higher when incubated with simple carbohydrate products such as sucrose , lactose , and glucose than with eleven different amino acids .
furthermore , klebsiella microbes do not seem to survive or grow on plant cellulose materials . in a recent experimental study , rats which have been fed potato starch diet had higher colonic bacterial loads than those on cellulose only diet .
these results indicate that complex carbohydrates such as starch products are necessary for the growth , replication , and persistence of klebsiella as well as other enterobacterial agents in the gut .
the current treatment involving the use of anti - inflammatory , immunosuppressive , and biologic modalities has significant limitations due to lack of treatment response in some patients as well as the occurrence of adverse side effects , such as increased risk of infection and malignancy among some other patients especially in those taking antitumor necrosis factors .
some patients with cd , however , may also need surgical interventions . sustained therapeutic responses in patients with cd
, however , may require more radical and comprehensive approaches involving strategies which help in the modification of the intestinal bacterial microenvironments .
a solution for this medical predicament is the use of an alternative therapy , which should be harmless and aimed at the elimination of the most plausible microbial agent , such as klebsiella , in order to improve or even halt the inflammatory and pathological damage occurring in patients with cd . to achieve this therapeutic goal ,
the most likely strategy which could be added to the management of this disease is the use of antimicrobial agents and dietary manipulation .
manipulation of luminal content of the gut using antibiotics may represent a potentially effective therapeutic option . whilst antimicrobials were shown to be clinically effective mainly in preventing postoperative recurrence
, there could also be potential for their inclusion in the primary treatment of cd . in a review analysis ,
the trial of an antibacterial agent , rifaximin , has been shown to provide promising results in inducing remission of cd in up to 69% in open studies and significantly higher rates than placebo in double blind trials . in another meta - analysis review of randomized placebo - controlled studies
, it has been shown that there was a statistically significant effect of antibiotics being superior to placebo in patients with active and quiescent cd as well as active uc .
furthermore , the results of another study have shown that administration of 800 mg of the extended intestinal release form of rifaximin twice daily for 12 weeks has induced remission in patients with moderately active cd .
it is possible that the use of klebsiella sensitive antibiotics could reduce the bacterial loads in the bowel of cd patients and prevent production of further anti - klebsiella antibodies and tissue damaging autoantibodies .
although no studies have yet been carried out on patients with cd in regard to the use of low - starch diet , clinical trials , however , have been carried out in as patients with some encouraging results . in a longitudinal clinical study carried out on a group of patients with as receiving low - starch diet
, there was a significant drop in the erythrocyte sedimentation rate and total serum iga by the end of the 9-month period of the study .
most of these patients have reported positive responses to the diet involving partial to complete recovery , ranging from disappearance of symptoms to a drop or even cessation in the intake of anti - inflammatory drugs . from experience of recommending the low - starch diet in patients with as for the last 3 decades and
more recently in cd , it is concluded that normally it takes around six to eight months for the diet to show its effects .
it is plausible that a drop of the starch intake in the daily dietary consumption might reduce the bowel microflora by depleting the substrates necessary for enterobacterial growth .
for example , reducing starch intake could stop the growth of klebsiella , with a possibility of having beneficial effects on the disease outcome .
it is concluded that klebsiella has a pivotal role in the aetiopathogenesis of cd , as evidenced by enhanced anti - klebsiella immune responses and significant cross - reactivity and cytotoxic reactions .
low - starch diet could help in the eradication of klebsiella in the bowel and , hence , decreasing the disease activity and progress with eventual halt or regression of the pathological process in patients with cd and as . | there is a general consensus that crohn 's disease ( cd ) develops as the result of immune - mediated tissue damage triggered by infections with intestinal microbial agents .
based on the results of existing microbiological , molecular , and immunological studies , klebsiella microbe seems to have a key role in the initiation and perpetuation of the pathological damage involving the gut and joint tissues in patients with cd .
six different gastroenterology centres in the uk have reported elevated levels of antibodies to klebsiella in cd patients .
there is a relationship between high intake of starch - containing diet , enhanced growth of gut microbes , and the production of pullulanases by klebsiella .
it is proposed that eradication of these microbes by the use of antibiotics and low starch diet , in addition to the currently used treatment , could help in alleviating or halting the disease process in cd . | 1. Introduction
2. Aetiopathogenesis
3. Starch Digestion and Its Relation to Gut Microbes
4. Proposal for the Use of Antimicrobial Measures in Treatment of CD
5. Conclusion |
mitochondrial cytopathies ( mc ) are a rare and complex group of neuromuscular diseases due to a defect in the oxidative phosphorylation ( oxphos ) system .
symptomatic renal involvement in mc has been documented in the form of tubular defects ( complete de toni - debr - fanconi syndrome in severe cases to incomplete proximal tubular defects in milder cases ) , chronic tubulointerstitial nephritis , cystic renal diseases , rare glomerular diseases such as focal segmental glomerulosclerosis due to 3243 a > g trnaleu mutations and coenzyme q10 biosynthesis defects , hypermagnesuria and myoglobinuria
. acute kidney injury ( aki ) as the sole presenting manifestation of clinically latent mc is extremely rare .
we report a case of recurrent episodic aki caused by exercise induced rhabdomyolysis in a patient whose muscle biopsy revealed the diagnosis of mitochondrial myopathy ( mm ) .
a 53-year - old man presented with the complaints of oliguria , generalized bodyache and dark colored urine .
he gave an unusual history of three previous episodes of similar symptoms in the past , at 25 , 36 and 48 years of age .
he had been treated with peritoneal dialysis during the first episode and hemodialysis in the next two , following which he made a complete recovery .
all the four episodes had been preceded by a history of walking long distances prior to the onset of symptoms .
, there was no peripheral edema and his blood pressure was 130/80 mmhg , pulse rate was 100/min and systemic examination did not reveal any abnormality .
his laboratory parameters during the present episode were as follows : serum creatinine 10.2 mg / dl , blood urea 160 mg / dl , serum sodium 128 meq / l , serum potassium 6.1 meq / l and serum bicarbonate 17 meq / l . his packed cell volume was 36% , total white blood cell count was 5000 with normal distribution and no abnormalities detected on peripheral smear examination .
his liver function tests showed serum glutamic oxaloacetic transaminase of 2005 iu / l and serum glutamic pyruvic transaminase 880 iu / l .
the patient underwent three sessions of hemodialysis and attained complete recovery of his renal function .
in view of his clinical history and laboratory data , a provisional clinical diagnosis of metabolic myopathy possibly mcardle 's disease causing exercise induced rhabdomyolysis was considered and a muscle biopsy was performed .
histopathology revealed skeletal muscle fibers with preserved fascicular architecture and no evidence of necrosis or inflammation .
cryostat sections stained with modified gomorri trichrome stain revealed characteristic ragged red fibers ( rrf ) which on histochemical staining showed intense reaction in subsarcolemmal zone for succinic dehydrogenase and nicotinamide adenine dinucleotide tetrazolium reductase .
electron microscopy confirmed the presence of abnormal aggregates of mitochondria in the subsarcolemmal region corresponding to rrf .
a final diagnosis of mm was established based on light microscopy , enzyme histochemistry , special stains , and electron microscopy findings .
the patient was evaluated for other systemic manifestations of mitochondrial disease including progressive external ophthalmoplegia , cardiomyopathy , encephalopathy , hypogonadism , and motor neuron disease , which were negative .
he was counseled regarding his disease condition and urged to refrain from strenuous physical exercises .
he has been compliant and on regular follow - up for the last 10 years with no further recurrence of symptoms .
over the last decades , there has been immense development in the field of mitochondrial diseases with an ever expanding list of pathogenic mitochondrial and nuclear dna mutations causing a wide spectrum of clinically manifest diseases . since
the central nervous system and muscle are frequently involved in mitochondrial diseases , the term mitochondrial encephalomyopathy is commonly used .
acute renal failure is uncommon in mitochondrial diseases and it is extremely rare as a presenting manifestation of the disease . among the various syndromes associated with mitochondrial diseases , isolated myopathy due to defects in oxphos , fits the clinical picture in this patient as he has no other systemic manifestations . the oxphos system , which is embedded in the inner membrane of the mitochondria , is constituted by five enzyme complexes , encoded by two separate genomes , viz . ,
mutations in the nuclear dna show mendelian inheritance whereas primary mitochondrial dna mutations are sporadic or show maternal inheritance as mitochondrial dna is only transmitted from mother to child .
mm may also be acquired , as in the case of antiretroviral therapy for human immunodeficiency virus infection . to the best of our knowledge ,
this is the first report from india of isolated mm in an adult patient presenting as recurrent episodic aki .
irrespective of cause of mitochondrial dysfunction , exercise induced adenosine triphosphate depletion results in intracellular calcium accumulation and myocyte death or rhabdomyolysis , which causes acute renal failure by release of muscle cell contents , especially myoglobin into circulation .
myoglobinuria occurs when myoglobin exceeds 250 ng / ml ( normal 5 ng / ml ) and causes cast formation and accumulation of iron in proximal tubules .
aki ensues due to direct nephrotoxicity of myoglobin as well as its conversion to ferrihemate at a ph < 5.6 which is toxic to renal tubules .
in addition , generation of oxygen free radicals and sequestration of fluids in injured muscles results in volume depletion , aciduria , nitric oxide depletion , and renal hypoperfusion further contributing to acute tubular necrosis .
aki induced by rhabdomyolysis can occur in varied clinical settings such as crush syndrome , trauma , drug overdose , hyperthermia , alcohol abuse , etc .
, hence careful collation of history , clinical presentation and laboratory data are required to ascertain the etiology .
recurrent episodic aki is characteristic of rhabdomyolysis and heightened awareness of the possibility along with appropriate sensitivity to abnormal laboratory values is necessary to reach the diagnosis , which can be corroborated by muscle biopsy when indicated .
the diagnostic workup of renal mc involves amalgamation of multiple modalities , viz . , enzymology and biochemistry analyses including measurement of urine organic acids by gas chromatography / mass spectrometry , molecular genetics , pathology ( histology , histochemistry , and electron microscopy ) and neuroradiology studies , possibly coupled with magnetic resonance spectroscopy . in infants ,
podocyte mitochondrial abnormalities demonstrated by electron microscopy are highly evocative of coq10 defects in early onset steroid resistant nephrotic syndrome , which is a treatable mc .
patients with recurrent rhabdomyolysis related aki should be further evaluated by means of muscle biopsy . a diagnosis of mm warrants counseling of the patient regarding avoidance of physical stresses which may provoke relapses of the disease .
conversely , screening for subclinical renal involvement and monitoring for renal disorders is required in all patients with mc .
screening of family members , keeping in mind possible maternal as well as mendelian pattern of inheritance is also important .
this case is reported not only for its unusual presentation of a rare disorder , but also to highlight the value of reaching a correct etiological diagnosis of aki which can lead to prevention of further episodes of renal failure by counseling and institution of appropriate avoidance measures . | mitochondrial cytopathies ( mc ) are a rare heterogenous group of disorders with frequent multisystem involvement including uncommon renal manifestations
. acute kidney injury ( aki ) as the primary manifestation of mc is extremely rare . here
, we report a case of recurrent episodic aki in an adult male who was subsequently diagnosed to have mitochondrial disease . | Introduction
Case Report
Discussion
Conclusion |
this study was undertaken using data from the nsw department of health midwives data collection ( mdc ) dataset collected between 1995 and 2005 ( inclusive ) .
the dataset records information collected at all births of > 20 weeks gestation in nsw by attending midwives at public and private hospitals and home births .
information on infant 's date of birth , birth weight , maternal age , maternal country of origin , number of previous pregnancies of > 20 weeks , maternal postcode , maternal smoking status ( including average number of cigarettes smoked per day ) , presence of previously existing type 1 or type 2 diabetes , and presence of gdm was available .
gdm status was assigned according to information recorded on the nsw mdc form that was collected at the time of birth . in australia , the australasian diabetes in pregnancy society criteria for the diagnosis of gdm are usually applied .
a 75-g oral glucose tolerance test is performed , with a fasting plasma glucose level of > 5.5 mmol / l or a 2-h level > 8.0 mmol / l being diagnostic for gdm .
most centers practice universal screening for gdm with an initial nonfasting 50-g glucose challenge at 2628 weeks . if results of this test are positive ( 1-h glucose >
7.8 mmol / l ) or if there is strong clinical suspicion , an oral glucose tolerance test is performed ( 7 ) .
maternal country of birth was categorized into regions according to the health outcomes and information statistical toolkit , which is a collection of databases maintained by the epidemiology and surveillance branch of the nsw department of health ( 8) . the regions were as follows : australia and new zealand , europe and north america , northeast and southeast asia , south asia , middle east and north africa , the pacific , the rest of africa , and the caribbean and central and south america .
socioeconomic status was assigned according to maternal postcode , using the index of advantage / disadvantage from the australian bureau of statistics socio - economic indexes for areas ( seifa ) ( 9 ) .
maternal age was categorized as < 20 , 2024 , 2529 , 3034 , 3539 , and 40 years .
the nsw mdc has been validated by comparison with hospital medical records in 1993 and 1998 . in 1993 , it was found that reporting of gdm could be improved ( 10 ) and the mdc form was subsequently redesigned and first used in 1998 .
a further validation study was undertaken in 1998 , at which time there were excellent levels of agreement between mdc data and information obtained directly from medical records ( 99% ) , with high specificity and sensitivity ( 11 ) .
variables were compared using student 's t test for means and tests for proportions between women who had gdm and the whole population and between those who had gdm and those who did not have gdm .
women with identified preexisting type 1 or type 2 diabetes were excluded from the analysis .
the relationship between each of the potential explanatory variables with gdm was tested using binary logistic regression , and the odds ratios ( ors ) and 95% cis were reported .
variables that were significantly associated with gdm were subsequently tested in multivariate logistic regression models .
hosmer - lemeshow goodness - of fit tests and residual and influence analyses were performed .
the explanatory variables tested were socioeconomic status , maternal age - group , smoking status , parity , and region of maternal country of birth .
the reference group for each variable was of the highest socioeconomic status , aged 2024 years , nonsmoking in the third trimester , and born in australia or new zealand and had no previous pregnancies > 20 weeks .
analyses were carried out using sas ( version 9.1 ; sas institute , cary , nc ) .
information on infant 's date of birth , birth weight , maternal age , maternal country of origin , number of previous pregnancies of > 20 weeks , maternal postcode , maternal smoking status ( including average number of cigarettes smoked per day ) , presence of previously existing type 1 or type 2 diabetes , and presence of gdm was available .
gdm status was assigned according to information recorded on the nsw mdc form that was collected at the time of birth . in australia , the australasian diabetes in pregnancy society criteria for the diagnosis of gdm are usually applied .
a 75-g oral glucose tolerance test is performed , with a fasting plasma glucose level of > 5.5 mmol / l or a 2-h level > 8.0 mmol / l being diagnostic for gdm .
most centers practice universal screening for gdm with an initial nonfasting 50-g glucose challenge at 2628 weeks . if results of this test are positive ( 1-h glucose > 7.8 mmol / l ) or if there is strong clinical suspicion , an oral glucose tolerance test is performed ( 7 ) .
maternal country of birth was categorized into regions according to the health outcomes and information statistical toolkit , which is a collection of databases maintained by the epidemiology and surveillance branch of the nsw department of health ( 8) . the regions were as follows : australia and new zealand , europe and north america , northeast and southeast asia , south asia , middle east and north africa , the pacific , the rest of africa , and the caribbean and central and south america .
socioeconomic status was assigned according to maternal postcode , using the index of advantage / disadvantage from the australian bureau of statistics socio - economic indexes for areas ( seifa ) ( 9 ) .
maternal age was categorized as < 20 , 2024 , 2529 , 3034 , 3539 , and 40 years .
the nsw mdc has been validated by comparison with hospital medical records in 1993 and 1998 . in 1993 , it was found that reporting of gdm could be improved ( 10 ) and the mdc form was subsequently redesigned and first used in 1998 .
a further validation study was undertaken in 1998 , at which time there were excellent levels of agreement between mdc data and information obtained directly from medical records ( 99% ) , with high specificity and sensitivity ( 11 ) .
variables were compared using student 's t test for means and tests for proportions between women who had gdm and the whole population and between those who had gdm and those who did not have gdm .
women with identified preexisting type 1 or type 2 diabetes were excluded from the analysis . the relationship between each of the potential explanatory variables with gdm
was tested using binary logistic regression , and the odds ratios ( ors ) and 95% cis were reported .
variables that were significantly associated with gdm were subsequently tested in multivariate logistic regression models .
hosmer - lemeshow goodness - of fit tests and residual and influence analyses were performed .
the explanatory variables tested were socioeconomic status , maternal age - group , smoking status , parity , and region of maternal country of birth .
the reference group for each variable was of the highest socioeconomic status , aged 2024 years , nonsmoking in the third trimester , and born in australia or new zealand and had no previous pregnancies > 20 weeks .
analyses were carried out using sas ( version 9.1 ; sas institute , cary , nc ) .
women with type 1 or type 2 diabetes detected before pregnancy ( 0.47% ) and women with no information on age ( 0.4% ) , smoking status ( 0.1% ) , or parity ( 0.02% ) were excluded from the analysis .
1 . for each year , women with gdm were on average older , had a lower prevalence of cigarette smoking , and were more likely to have had a previous pregnancy compared with women without gdm ( p < 0.001 ) .
overall , the age- and ethnicity - adjusted incidence of gdm increased by 45% from 3.0 to 4.4% between 1995 and 2005 ( fig .
the associations of different risk factors with gdm adjusted for all other recorded risk factors are shown in table 1 .
age was strongly and positively associated with risk of gdm and increased with each successive age - group . compared with women aged 2024 years , women aged 3539 years had an approximately four times higher risk of gdm . in women
aged > 40 years , the risk of gdm was more than six times that of those aged 2024 years .
region of country of birth , as a proxy for ethnicity , was associated with an increased risk for gdm for all regions compared with women born in australia and new zealand ( table 1 ) .
women born in south asia had the greatest risk , with odds of developing gdm > 4 times greater than that of those born in australia and new zealand .
the risk of gdm was approximately two - thirds higher in women living in the lowest socioeconomic postcodes compared with women in the highest group .
the inverse relationship between socioeconomic status and risk of gdm was apparent across all ethnic groups when data were stratified by maternal region of birth , with women in the bottom half of seifa postcodes having at least a 30% higher risk of gdm relative to that for the highest quartile ( fig .
women in the lowest socioeconomic group aged > 40 years had a risk of 10.26 ( 95% ci 8.7512.03 ) compared with that of women aged 2024 years residing the highest quartile of seifa postcodes .
women who had reported a previous pregnancy of > 20 weeks gestation had a small but significantly reduced risk of gdm in subsequent pregnancies .
there was nearly a 10% reduction in risk in women who had a previous pregnancy compared with that in women having their first pregnancy .
a similar small protective effect was also apparent among women who had two or more previous pregnancies ( table 1 ) .
the associations of different risk factors with gdm adjusted for all other recorded risk factors are shown in table 1 .
age was strongly and positively associated with risk of gdm and increased with each successive age - group . compared with women aged 2024 years ,
women aged 3539 years had an approximately four times higher risk of gdm . in women
aged > 40 years , the risk of gdm was more than six times that of those aged 2024 years .
region of country of birth , as a proxy for ethnicity , was associated with an increased risk for gdm for all regions compared with women born in australia and new zealand ( table 1 ) .
women born in south asia had the greatest risk , with odds of developing gdm > 4 times greater than that of those born in australia and new zealand .
the risk of gdm was approximately two - thirds higher in women living in the lowest socioeconomic postcodes compared with women in the highest group .
the inverse relationship between socioeconomic status and risk of gdm was apparent across all ethnic groups when data were stratified by maternal region of birth , with women in the bottom half of seifa postcodes having at least a 30% higher risk of gdm relative to that for the highest quartile ( fig .
women in the lowest socioeconomic group aged > 40 years had a risk of 10.26 ( 95% ci 8.7512.03 ) compared with that of women aged 2024 years residing the highest quartile of seifa postcodes .
women who had reported a previous pregnancy of > 20 weeks gestation had a small but significantly reduced risk of gdm in subsequent pregnancies .
there was nearly a 10% reduction in risk in women who had a previous pregnancy compared with that in women having their first pregnancy .
a similar small protective effect was also apparent among women who had two or more previous pregnancies ( table 1 ) .
in this large , multiethnic , population - based study of nearly 1 million births over 11 years , we observed that the incidence of gdm increased and the prevalence was strongly correlated with socioeconomic status , ethnicity , and maternal age .
there was no relationship with smoking and a small , but significant , inverse relationship with parity .
this is the first large population study to show a strong correlation between gdm and socioeconomic status .
the relationships between the risk of gdm with maternal region of country of birth and maternal age are in agreement with other studies ( 5 ) .
age and ethnic or racial background have also been shown to be strongly related to risk of type 2 diabetes in previous studies ( 12 ) .
smoking , parity , maternal body weight , and family history of diabetes have also been reported to be associated with gdm ( 5 ) . maternal body weight and family history were not available in this dataset .
socioeconomic status , although well established as a risk for obesity and type 2 diabetes , has been less well correlated with gdm ( 1315 ) .
the reported increasing incidence of gdm , independent of ethnicity , socioeconomic status , or maternal age , has important public health implications in terms of short - term adverse pregnancy outcomes and long - term future risk of type 2 diabetes and its associated morbidities in these women and potential long - term morbidity in the children .
previous descriptive studies have shown an increased association between gdm and many ethnicities , with women from asian , african , and hispanic backgrounds being most at risk ( 5 ) .
our study supports these findings , and the size of the immigrant population in nsw allowed us to reliably compare the risks of gdm for women born all over the world . in the current study ,
women from across asia had an increased risk of gdm compared with women born in australia and new zealand .
asian australians are also found to have an increased risk for type 2 diabetes relative to caucasian australians ( 12 ) .
approximately 6% of australia 's population is composed of people born in asia , from where an increasing proportion of new migrants will continue to arrive , as well as from other regions where our study shows women have a greater risk of gdm , such as the middle east and africa . however , it is likely our study has underestimated the association of ethnicity and gdm , as women born in australia of non - caucasian backgrounds could not be identified in our study .
this group includes indigenous australians , who are also a group with a high risk for developing gdm ( 16 ) .
lower socioeconomic status is well recognized as a risk for chronic disease in developed and developing countries ( 17 ) .
the association between gdm and socioeconomic status is less well established , with conflicting results seen in previous studies .
these studies can not easily be compared because of different definitions of socioeconomic status , but three studies have used indexes of relative deprivation of the area of residence of the women as in the present study .
two found no association ( 14,18 ) , and one showed that living in an area of deprivation was positively associated with gdm ( 19 ) .
other factors used to determine socioeconomic status were public or private health care sector ( public sector increased association with gdm ) ( 15 ) , income , health insurance , residential zip code ( no association ) ( 20 ) , education and current employment ( inverse relationship , as in the present study ) ( 13 ) .
the strength of our study is the number of births over rural and urban sectors .
interestingly , the strong correlation was maintained when the database was stratified by region of country of birth of the women , with each group showing a very similar relationship between gdm and socioeconomic status .
for those women born in regions with the highest odds for gdm ( all of asia and the pacific ) , the socioeconomic status correlation was not as evident as that for other women , with only a 2338% increased risk for lower socioeconomic status ( compared with a risk of at least 55% in all other women ) .
the large difference in adjusted ors between the highest and all lower socioeconomic status quartiles but small difference between the three lower quartiles may be due to bias created by using the seifa of the postcode of residence as our socioeconomic indicator .
it is unlikely that women of low socioeconomic status can afford to live in high socioeconomic areas , whereas women of high income and educational status may live in areas with a lower seifa .
hence , the methodology we used may have clouded the relationship with gdm risk among the lower socioeconomic quartiles .
the australian institute for health and welfare estimates that women in the most disadvantaged socioeconomic group have double the rates of obesity of those in the most advantaged group ( 21 ) , and obesity is a recognized risk factor for gdm . the lack of data on pregestational weight or bmi of women is a limitation of this study but not unique to studies reporting the association of socioeconomic status with gdm ( 14,18,20 ) .
however , in those studies in which an adjustment for maternal weight was made , the inverse association with socioeconomic status was still evident ( 13,15,19 ) .
family history of diabetes has also been reported to be associated with gdm , though we were not able to include this factor in the present study . in clinical studies
, parity has been described as a risk factor for gdm ( 5 ) . however , although epidemiological studies have also demonstrated this relationship , it may not persist after adjustment for other risk factors such as age and obesity ( 15 ) .
our analysis showed a positive association with parity in univariate analysis that reversed to be a slight inverse association with adjustment for age .
this finding suggests that there are additional factors that influence the relationship between parity and gdm .
one possibility is that there is a large subgroup of women who have fewer children but have a high risk of gdm .
women with polycystic ovary syndrome might be in this group , as they comprise up to 10% of women of reproductive age , are subfertile , and are likely to develop gdm .
some studies have shown that nulliparous women are more likely to develop diabetes than multiparous women , and , indeed , it has been postulated that polycystic ovary syndrome contributes to this effect ( 22 ) . during the years examined in the current study ,
the median age of mothers also increased each year , and after adjustment for age and country of birth , the incidence of gdm still increased by 45% over the 11-year period .
this increase may be caused by other risk factors that we could not account for or may be partially due to variations in screening and reporting over the 11 years .
obesity is a major risk factor for gdm but was not recorded in this dataset and thus could not be included in our analyses ( 5 ) .
there is an increasing prevalence of overweight and obesity in australia , as there is elsewhere in the world , which is likely to contribute to the increase in incidence of gdm . in the u.s .
, studies have detailed the increasing prevalence of gdm by up to 68% in a similar period with no significant increase in screening ( 23 ) . over the 11 years
, there would also have been an increase in australian - born women of non - caucasian ethnicities whose parents were born elsewhere , and these could not be adjusted for when our incidence was adjusted for country of birth .
universal screening for gdm is recommended in nsw , but there are no published data on the actual screening rates .
the greatest increases in gdm incidence observed in this study occurred between 1997 and 1998 and between 2001 and 2002 .
possible contributors to the former may be the publication of the australasian diabetes in pregnancy society guidelines for gdm in 1998 , which strongly recommended universal screening and may have improved screening incidence ( 7 ) . reporting became more accurate after the mdc form redesign in 1998 ( 11 ) , and a subsequent study showed that the mdc underestimated the incidence of gdm in one area of nsw by 1% ( 24 ) . in 2002 , the australian diabetes , obesity and lifestyle study ( ausdiab ) study was published , detailing the increasing prevalence of type 2 diabetes in australia ( 25 ) .
this study raised awareness of diabetes and may also have stimulated some increase in screening and reporting of gdm in australia around that time .
the recent report on the outcomes of hyperglycemia during pregnancy highlights that adverse outcomes occur where there is suboptimal glucose control below the cutoff for gdm ( 6 ) .
the hyperglycemia and adverse pregnancy outcome ( hapo ) study did not use socioeconomic status as a possible confounder for poor pregnancy outcome .
clearly , a large - scale study is required to determine the combined impact of socioeconomic status and bmi , as well as age , ethnicity , family history , and parity , on glycemic control during pregnancy .
globally , the increase in gdm parallels the increase in type 2 diabetes in the general population . in australia , as for many other developed countries , the median age of women having their first pregnancy is now > 32 years , which equates to the majority of pregnancies being at higher risk of gdm .
these women , as well as those from lower socioeconomic areas and from all immigrant and indigenous populations , must be targeted for primary ( where possible ) and secondary prevention of gdm to reduce its morbidity and to reduce the prevalence or delay the onset of type 2 diabetes . | objective gestational diabetes mellitus ( gdm ) is an increasingly prevalent risk factor for the development of type 2 diabetes in the mother and is responsible for morbidity in the child . to better identify women at risk of developing gdm we examined sociodemographic correlates and changes in the prevalence of gdm among all births between 1995 and 2005 in australia 's largest state.research design and methods
a computerized database of all births ( n = 956,738 ) between 1995 and 2005 in new south wales , australia , was used in a multivariate logistic regression that examined the association between sociodemographic characteristics and the occurrence of gdm.resultsbetween 1995 and 2005 , the prevalence of gdm increased by 45% , from 3.0 to 4.4% .
women born in south asia had the highest adjusted odds ratio ( or ) of any region ( 4.33 [ 95% ci 4.124.55 ] ) relative to women born in australia .
women living in the three lowest socioeconomic quartiles had higher adjusted ors for gdm relative to women in the highest quartile ( 1.54 [ 1.501.59 ] , 1.74 [ 1.691.8 ] , and 1.65 [ 1.601.70 ] for decreasing socioeconomic status quartiles ) .
increasing age was strongly associated with gdm , with women aged > 40 years having an adjusted or of 6.13 ( 95% ci 5.796.49 ) relative to women in their early 20s .
parity was associated with a small reduced risk .
there was no association between smoking and gdm.conclusionsmaternal age , socioeconomic position , and ethnicity are important correlates of gdm .
future culturally specific interventions should target prevention of gdm in these high - risk groups . | RESEARCH DESIGN AND METHODS
Study design and assessment of GDM
Statistical analysis
RESULTS
Risk factors for GDM
CONCLUSIONS |
the persistent rise in the proportion of chronic dialysis patients resulting from diabetic kidney disease in asian countries , including japan , over the past 20 years has been associated with higher mortality and is widely recognized as a major public health concern . to combat this problem ,
intensive efforts are underway to clarify the evolving management contributing to the amelioration of the development and progression of diabetic kidney disease .
angiotensin system ( ras ) with either angiotensinconverting enzyme inhibitors ( acei ) or angiotensin receptor blockers ( arb ) , peroxisome proliferatoractivated receptor ( ppar ) alpha agonist and , recently , paricalcitol have been reported to prevent the development and progression of diabetic kidney disease .
we focus on the reason why a global pandemic of endstage renal disease ( esrd ) attributed to diabetes has continued , as well as how we can challenge diabetic kidney disease in clinical practice .
the world health organization ( who ) estimated that more than 300 million people will have diabetes by 2025 , resulting in a pandemic that threatens to collapse socioeconomic recourses .
more recently , the baker idi heart and diabetes institute estimated that the world prevalence of diabetes among adults ( aged 2079 years ) will increase to 7.7% , and 439 million adults by 2030 .
similarly , the number of people who have diabetes or who are suspected of having diabetes has increased by 1.6fold over the past decade , and this trend is suspected to continue in japan . as a result ,
the number of people who have diabetic kidney disease has increased and diabetic esrd , in particular , has been the main cause of newly introduced diseases to chronic dialysis since 1998 , and the trend is still continuing in japan .
in contrast , although the number of new cases of esrd with diabetes has increased , the rate of new cases of esrd requiring dialysis among americans diagnosed with diabetes fell 35% between 1996 and 2007 , according to a study by the us centers for disease control and prevention . here , we raise several reasons to explain the discrepancy between asian and western countries ( table 1 ) .
increased numbers of patients with diabetes ; patients higher ignorance when receiving treatment ; poorly controlled blood glucose , blood pressure and lipids ; lower rate of preventable screening for indication of developing diabetic kidney disease ; and the aging process could contribute to an increased rate of new cases of esrd requiring dialysis in japan . as compared with western countries , the proportion of patients with diabetes receiving a recommended medical evaluation , such as an annual urinary albumin measurement , has increased from 21.7% in 2000 to 27.2% in 2006 in the shiga prefecture , japan .
furthermore , even in hospitals and clinics where diabetes specialists were taking care of patients , almost half of the diabetic patients were not receiving the measurement of urinary albumin from january 2004 to july 2005 .
in other words , the measurement of urinary albumin is still neglected in clinical practice , although many clinicians know the importance of albuminuria as an indicator of diabetic kidney disease as well as a sensitive , accessible predictor of cardiovascular risk .
in addition , esrd in japan has been regarded as a geriatric disorder and the mean age of newly diagnosed esrd patients with diabetes was 2.5 years older than that in the usa ( mean age 65.7 years in japan vs 63.2 year in the usa ) , suggesting that the aging process could also contribute to an increased incidence of diabetic esrd in japan .
the earliest clinical sign of diabetic kidney disease is an elevated urinary albumin excretion , referred to as microalbuminuria .
microalbuminuria is defined as an albumin excretion rate ( aer ) of 20199 g / min in a timed or a 24h urine collection ( equivalent to urinary albumin creatinine ratio [ acr ] of 30299 mg / g creatinine in a random spot sample ) .
microalbuminuria progresses to overt proteinuria , leading to a decline in renal function defined as glomerular filtration rate ( gfr ) .
generally , overt proteinuria inexorably progresses to esrd 68 years after the detection of overt proteinuria .
thus , microalbuminuria in diabetic patients has been recognized as a predictor of progression to esrd .
based on the data from over 5000 patients who were followed from the first diagnosis of type 2 diabetes in the united kingdom prospective diabetes study ( ukpds ) , annual transition rates from one stage to another stage of diabetic kidney disease were approximately 2% at each stage .
furthermore , microalbuminuria has been shown to be closely associated with a higher risk for cardiovascular morbidity and mortality .
indeed , the cardiovascular mortality in type 2 diabetic patients with microalbuminuria has been reported to be twofold higher than that in patients with normoalbuminuria .
therefore , microalbuminuria is an important therapeutic target to improve the prognosis of renal and cardiovascular risk in diabetic patients .
based on landmark clinical trials , intensive regimens of glucose control have been shown to reduce the development and progression of diabetic kidney disease .
furthermore , the persistence of microvascular benefits in patients , who were previously intensively treated , was reported in the followup study of the diabetes control and complications trial ( dcct ) in the epidemiology of diabetes interventions and complications ( edic ) and of the ukpds , although their glycemic control has been equivalent to that of previous control arm subjects during follow up .
recent trials in patients with more longstanding type 2 diabetes have also confirmed the benefit of intensifying glucose control on development and/or progression of microvascular complications , including diabetic kidney disease .
the veterans affairs diabetes trial ( vadt ) showed significant reductions in albuminuria with intensive glycemic control ( achieved median hba1c 6.9% ) compared with standard glycemic control , although intensifying glucose control failed to affect other primary and secondary endpoints beneficially .
the action in diabetes and vascular disease : preterax and diamicron mr controlled evaluation ( advance ) trial has also shown that intensifying glucose control to achieve a hba1c level of < 6.5% did provide the benefit of reducing the risk of both the development and progression of diabetic kidney disease .
as compared with standard control , intensive control was associated with a significant reduction in newonset microalbuminuria by 9% .
furthermore , intensifying glucose control resulted in a significant reduction in renal events by 21% , including new or worsening diabetic kidney disease defined as the development of overt proteinuria , renal replacement therapy or death from renal causes , although the incidence of the doubling of serum creatinine level did not differ .
unfortunately , this study also failed to reduce the incidence of major macrovascular events defined as myocardial infarction , stroke or cardiovascular death with intensive control as compared with standard control .
nevertheless , the reduction in the incidence of diabetic kidney disease might have long term benefits on cardiovascular disease , because diabetic patients with kidney disease have a higher risk of macrovascular disease .
however , the results of action to control cardiovascular risk in diabetes ( accord ) showed that the risk of death was increased by nearnormal glycemic control with intensifying treatment as compared with standard control without the reduction of cardiovascular events , although recent analyses from the accord trial have shown that the risk of development of overt proteinuria was 31% lower with intensive therapy at transition and 28% lower at study end than with standard therapy .
as reported in the posthoc epidemiological analysis of the accord study , we need to pay attention to what the benefit of intensifying glucose control for diabetic patients is .
it must be weighed against the risks of intensive glycemic control , including allcause and cardiovascular diseaserelated mortality , weight gain , and incidence of severe hypoglycemic episodes .
furthermore , a recent subanalysis of the advance trial clearly showed that severe hypoglycemia was strongly associated with an increased risk of a range of adverse clinical outcomes , including macrovascular and/or microvascular events as well as death .
intensive glycemic treatment targeting a hba1c goal level of 6.0% or less could be beneficial for individuals who are younger and have newly diagnosed diabetes .
however , a conservative hba1c targeting the 7% range might be appropriate in older individuals who have established diabetes , cardiovascular disease and major risk factors for cardiovascular disease . therefore , the goals for managing elderly patients with diabetes , especially type 2 diabetes , should be individualized according to the patient s age , disease stage and other comorbid conditions .
indeed , the american diabetes association 2011 recommends a hba1c level below or around 7% to reduce microvascular and macrovascular complications of diabetes in patients soon after the diagnosis of diabetes . strict blood pressure control of < 130/80 mmhg is universally recommended in patients with diabetes to lower incidences of stroke , heart failure , diabetesrelated death , retinal photocoagulation and to reduce the risk of micro or overt proteinuria . in the recent advance study , the reduction of blood pressure from 140/73 mmhg ( control group ) to 136/73 mmhg ( indapamide perindopril group ) was shown to reduce the risks of a major macro or microvascular ( mostly new microalbuminuria ) event , death from cardiovascular disease and death from any cause after 4.3 years of follow up , extending the early findings of the ukpds to an even lower blood pressure . therefore ,
targeting blood pressure < 130/80 mmhg appears to be appropriate in type 2 diabetics to fight against the development and progression of diabetic kidney disease . in diabetic patients with microalbuminuria or overt
proteinuria , ras inhibitors play a pivotal role in the prevention and treatment of diabetic kidney disease .
landmark studies with type 1 and type 2 diabetic patients at various stages of diabetic kidney diseases have well provided the clinical evidence that treatment with ras inhibitors did slow the progressive decrease in gfr , reduce proteinuria and microalbuminuria , prevent progression from one stage of diabetic kidney disease to others , and reduce cardiovascular mortality and morbidity as shown in figure 1 . as described in the next section ,
recent studies have shown the effectiveness of arb , not only to reduce the progression of diabetic kidney disease to esrd , but also to revert the progressive course .
landmark studies showing the effectiveness of renin angiotensin system inhibitors on diabetic kidney disease , and cardiovascular mortality and morbidity .
dual ras blockade with acei and arb might be more effective in reducing proteinuria compared with monotherapy in patients with diabetic kidney diseases .
based on the ongoing telmisartan alone and in combination with the ramipril global endpoint trial ( ontarget ) , although combination therapy with ramipril and telmisartan reduces proteinuria than monotherapy , it worsens major renal outcomes including dialysis , doubling of serum creatinine and death .
thus , combination ras blockade should not be used in diabetic patients , especially elderly type 2 diabetic patients with normo and/or microalbuminuria .
first , acei or arb should be used and their dosage should be increased to obtain an optimal antialbuminuric and/or proteinuric response .
combination treatment with both acei and arb should be prescribed by a nephrologist , and given to those patients with overt proteinuria and/or massive proteinuria despite the use of maximum dosages of acei or arb . in those diabetic patients , monitoring of renal function
is needed , and the treatment should be stopped in the event of acute kidney injury , low blood pressure and/or high potassium level . however , the effect of combination treatment with aliskiren and arb in type 2 diabetic patients with overt diabetic kidney disease was recently reported . in the aliskiren in the evaluation of proteinuria in diabetes ( avoid ) study , 599 patients with diabetic kidney disease with overt proteinuria were treated with losartan 100 mg , followed by the addition of a placebo or aliskiren ( 300 mg ) . as a result , treatment with 300 mg of aliskiren daily reduced the mean urinary acr by 20% as compared with the placebo , with a reduction of 50% or more in 24.7% of the patients who received aliskiren as compared with 12.5% of those who received the placebo . at present , the aliskiren trial in type 2 diabetes using cardiorenal endpoints ( altitude ) to confirm the effectiveness of combination treatment with either an acei or an arb plus aliskiren on both renal and cardiovascular events is ongoing , in which diabetic patients with proteinuria and a history of cardiovascular disease were enrolled .
although ras inhibitors have become the mainstays of treating established diabetic kidney disease , the beneficial effects of these agents on the early phases of diabetic kidney disease is unclear .
bilous et al . examined the effect of candesartan on microalbuminuria and albumin excretion rates , either before renal disease began or in its earliest stages based on data from the diabetic retinopathy candesartan trials ( direct ) randomized trials .
the incidence of microalbuminuria in type 1 diabetes was 5% in both the candesartan and placebo groups , and that of microalbuminuria in type 2 diabetics was 12% in the candesartan group compared with 13% in the placebo group .
mann et al . also examined the longterm renal effects of another arb , telmisartan , in adults who were intolerant to acei , but had a high risk of vascular disease without albuminuria at baseline .
although treatment with telmisartan significantly reduced the risk for new microalbuminuria , overt proteinuria , or both , the reduction in albuminuria was not associated with less progression of renal disease , including dialysis or doubling of serum creatinine .
therefore , to decide whether we need to use ras inhibitors in hypertensive and diabetic patients , the degree of the patient s vascular and renal risk must be assessed in addition to taking into account the efficacy on the functions of the cardiovascular system and diabetic kidney disease .
based on landmark clinical trials , intensive regimens of glucose control have been shown to reduce the development and progression of diabetic kidney disease .
furthermore , the persistence of microvascular benefits in patients , who were previously intensively treated , was reported in the followup study of the diabetes control and complications trial ( dcct ) in the epidemiology of diabetes interventions and complications ( edic ) and of the ukpds , although their glycemic control has been equivalent to that of previous control arm subjects during follow up .
recent trials in patients with more longstanding type 2 diabetes have also confirmed the benefit of intensifying glucose control on development and/or progression of microvascular complications , including diabetic kidney disease .
the veterans affairs diabetes trial ( vadt ) showed significant reductions in albuminuria with intensive glycemic control ( achieved median hba1c 6.9% ) compared with standard glycemic control , although intensifying glucose control failed to affect other primary and secondary endpoints beneficially .
the action in diabetes and vascular disease : preterax and diamicron mr controlled evaluation ( advance ) trial has also shown that intensifying glucose control to achieve a hba1c level of < 6.5% did provide the benefit of reducing the risk of both the development and progression of diabetic kidney disease .
as compared with standard control , intensive control was associated with a significant reduction in newonset microalbuminuria by 9% .
furthermore , intensifying glucose control resulted in a significant reduction in renal events by 21% , including new or worsening diabetic kidney disease defined as the development of overt proteinuria , renal replacement therapy or death from renal causes , although the incidence of the doubling of serum creatinine level did not differ .
unfortunately , this study also failed to reduce the incidence of major macrovascular events defined as myocardial infarction , stroke or cardiovascular death with intensive control as compared with standard control .
nevertheless , the reduction in the incidence of diabetic kidney disease might have long term benefits on cardiovascular disease , because diabetic patients with kidney disease have a higher risk of macrovascular disease .
however , the results of action to control cardiovascular risk in diabetes ( accord ) showed that the risk of death was increased by nearnormal glycemic control with intensifying treatment as compared with standard control without the reduction of cardiovascular events , although recent analyses from the accord trial have shown that the risk of development of overt proteinuria was 31% lower with intensive therapy at transition and 28% lower at study end than with standard therapy .
as reported in the posthoc epidemiological analysis of the accord study , we need to pay attention to what the benefit of intensifying glucose control for diabetic patients is .
it must be weighed against the risks of intensive glycemic control , including allcause and cardiovascular diseaserelated mortality , weight gain , and incidence of severe hypoglycemic episodes .
furthermore , a recent subanalysis of the advance trial clearly showed that severe hypoglycemia was strongly associated with an increased risk of a range of adverse clinical outcomes , including macrovascular and/or microvascular events as well as death .
intensive glycemic treatment targeting a hba1c goal level of 6.0% or less could be beneficial for individuals who are younger and have newly diagnosed diabetes .
however , a conservative hba1c targeting the 7% range might be appropriate in older individuals who have established diabetes , cardiovascular disease and major risk factors for cardiovascular disease . therefore , the goals for managing elderly patients with diabetes , especially type 2 diabetes , should be individualized according to the patient s age , disease stage and other comorbid conditions .
indeed , the american diabetes association 2011 recommends a hba1c level below or around 7% to reduce microvascular and macrovascular complications of diabetes in patients soon after the diagnosis of diabetes .
strict blood pressure control of < 130/80 mmhg is universally recommended in patients with diabetes to lower incidences of stroke , heart failure , diabetesrelated death , retinal photocoagulation and to reduce the risk of micro or overt proteinuria . in the recent advance study ,
the reduction of blood pressure from 140/73 mmhg ( control group ) to 136/73 mmhg ( indapamide perindopril group ) was shown to reduce the risks of a major macro or microvascular ( mostly new microalbuminuria ) event , death from cardiovascular disease and death from any cause after 4.3 years of follow up , extending the early findings of the ukpds to an even lower blood pressure . therefore
, targeting blood pressure < 130/80 mmhg appears to be appropriate in type 2 diabetics to fight against the development and progression of diabetic kidney disease . in diabetic patients with microalbuminuria or overt
proteinuria , ras inhibitors play a pivotal role in the prevention and treatment of diabetic kidney disease .
landmark studies with type 1 and type 2 diabetic patients at various stages of diabetic kidney diseases have well provided the clinical evidence that treatment with ras inhibitors did slow the progressive decrease in gfr , reduce proteinuria and microalbuminuria , prevent progression from one stage of diabetic kidney disease to others , and reduce cardiovascular mortality and morbidity as shown in figure 1 . as described in the next section ,
recent studies have shown the effectiveness of arb , not only to reduce the progression of diabetic kidney disease to esrd , but also to revert the progressive course .
landmark studies showing the effectiveness of renin angiotensin system inhibitors on diabetic kidney disease , and cardiovascular mortality and morbidity .
dual ras blockade with acei and arb might be more effective in reducing proteinuria compared with monotherapy in patients with diabetic kidney diseases . based on the ongoing telmisartan alone and in combination with the ramipril global endpoint trial ( ontarget ) ,
although combination therapy with ramipril and telmisartan reduces proteinuria than monotherapy , it worsens major renal outcomes including dialysis , doubling of serum creatinine and death .
thus , combination ras blockade should not be used in diabetic patients , especially elderly type 2 diabetic patients with normo and/or microalbuminuria .
first , acei or arb should be used and their dosage should be increased to obtain an optimal antialbuminuric and/or proteinuric response .
combination treatment with both acei and arb should be prescribed by a nephrologist , and given to those patients with overt proteinuria and/or massive proteinuria despite the use of maximum dosages of acei or arb . in those diabetic patients , monitoring of renal function
is needed , and the treatment should be stopped in the event of acute kidney injury , low blood pressure and/or high potassium level . however ,
the effect of combination treatment with aliskiren and arb in type 2 diabetic patients with overt diabetic kidney disease was recently reported . in the aliskiren in the evaluation of proteinuria in diabetes ( avoid ) study , 599 patients with diabetic kidney disease with overt proteinuria were treated with losartan 100 mg , followed by the addition of a placebo or aliskiren ( 300 mg ) . as a result , treatment with 300 mg of aliskiren daily reduced the mean urinary acr by 20% as compared with the placebo , with a reduction of 50% or more in 24.7% of the patients who received aliskiren as compared with 12.5% of those who received the placebo . at present ,
the aliskiren trial in type 2 diabetes using cardiorenal endpoints ( altitude ) to confirm the effectiveness of combination treatment with either an acei or an arb plus aliskiren on both renal and cardiovascular events is ongoing , in which diabetic patients with proteinuria and a history of cardiovascular disease were enrolled .
although ras inhibitors have become the mainstays of treating established diabetic kidney disease , the beneficial effects of these agents on the early phases of diabetic kidney disease is unclear .
bilous et al . examined the effect of candesartan on microalbuminuria and albumin excretion rates , either before renal disease began or in its earliest stages based on data from the diabetic retinopathy candesartan trials ( direct ) randomized trials .
the incidence of microalbuminuria in type 1 diabetes was 5% in both the candesartan and placebo groups , and that of microalbuminuria in type 2 diabetics was 12% in the candesartan group compared with 13% in the placebo group .
mann et al . also examined the longterm renal effects of another arb , telmisartan , in adults who were intolerant to acei , but had a high risk of vascular disease without albuminuria at baseline .
although treatment with telmisartan significantly reduced the risk for new microalbuminuria , overt proteinuria , or both , the reduction in albuminuria was not associated with less progression of renal disease , including dialysis or doubling of serum creatinine .
therefore , to decide whether we need to use ras inhibitors in hypertensive and diabetic patients , the degree of the patient s vascular and renal risk must be assessed in addition to taking into account the efficacy on the functions of the cardiovascular system and diabetic kidney disease .
we carried out a prospective observational followup study including a total of 216 japanese type 2 diabetic patients with microalbuminuria . in our study , we used the definition of remission / regression of microalbuminuria similar to that of the perkins et al .
the remission was defined as a shift of the aer from microalbuminuria to normoalbuminuria , and the regression was defined as a 50% reduction in the aer from baseline .
the 6year cumulative incidence of progression from microalbuminuria to overt proteinuria was 28% ( 95% ci 1937 ) , whereas those for remission and regression were 51% ( 95% ci 4260 ) and 54% ( 95% ci 4563 ) , respectively ( figure 2 ) . in the pooled logistic regression analysis ,
each modifiable factor was trisected according to the number of patients and was applied as three categories in the analysis .
the results showed that microalbuminuria of short duration , the use of ras blockades , a hba1c level of < 7.35% and lower systolic blood pressure < 130 mmhg were identified to be independent factors associated with remission / regression of microalbuminuria .
angiotensinii receptor blockers have also been shown to induce remission and regression of microalbuminuria in japanese type 2 diabetic patients . in the shiga microalbuminuria reduction trial ,
150 patients with microalbuminuria were randomly assigned to either the valsartan group or the amlodipine group and followed for 24 weeks . during the study ,
however , the frequency of patients who achieved remission or regression of microalbuminuria was significantly higher in the valsartan group than in the amlodipine group ( remission 23 vs 11% , p = 0.011 ; regression 34 vs 16% , p = 0.008 ) . in another japanese incipient to overt : angiotensin ii blocker , telmisartan ,
investigation on type 2 diabetic nephropathy ( innovation ) study , microalbuminuria remission at final observation occurred in 21.2% of patients with 80 mg of telmisartan , 12.8% of patients with 40 mg of telmisartan and 1.2% of patients with a placebo ( both telmisartan doses vs placebo , p < 0.001 ) .
in addition , patients receiving 80 or 40 mg of telmisartan achieved superior renoprotection , shown by lower transition rates to overt nephropathy , compared with the placebo . taken together , these results strongly indicate that ras blockade by using arb not only prevent the progression of microalbuminuria to overt proteinuria , but also induce remission and regression of microalbuminuria in japanese type 2 diabetic patients . a prospective observational followup study including a total of 216 japanese type 2 diabetic patients with microalbuminuria was carried out to follow the change of stage of microalbuminuria for 6 years .
the remission was defined as a shift of the albumin excretion rate ( aer ) from microalbuminuria to normoalbuminuria , and the regression was defined as 50% reduction in the aer from baseline .
similar to ours , the steno2 study also reported that a high proportion of patients with microalbuminuria returned to normoalbuminuria with a multifactorial intervention in 151 type 2 diabetic patients with microalbuminuria .
after a mean of 7.8 years of follow up , 46 ( 31% ) patients returned to normoalbuminuria , 58 ( 38% ) patients still had microalbuminuria and 47 ( 31% ) patients progressed to overt proteinuria .
lower hba1c , starting antihypertensive therapy and starting ras inhibitor drugs during the follow up were independently associated with the remission of microalbuminuria .
recent analysis , especially regarding the effect of lowering blood pressure , clearly showed that more than half of all type 2 diabetic patients with microalbuminuria and macroalbuminuria returned to normoalbuminuria with any blood pressure lowering drugs in the advance study .
however , more patients assigned to perindopril indapamide treatment than those assigned to placebo treatment achieved remission to normoalbuminuria . to explore the clinical impact of a reduction of microalbuminuria
, we expanded the follow up by a 2 years beyond our previous study and examined whether remission and regression of microalbuminuria could translate into risk reduction of renal and cardiovascular events .
the primary evaluation consisted of combined incidence defined as cardiovascular death , and first hospitalization for renal and cardiovascular events .
a secondary evaluation was the kidney function as determined by the annual decline rates of estimated gfr ( egfr ) . during the 8year followup period ,
the number of first occurrences of outcomes in subgroups , who achieved remission of microalbuminuria , was 11 events and 36 events in the nonremission group .
the pooled logistic analysis adjusted by sex , age , the initial aer levels , a history of cardiovascular disease , current smoking , hba1c , total cholesterol , blood pressure , the use of ras inhibitors , the use of lipid lowering drugs and body mass index ( bmi ) showed that the risk for outcomes in patients , who achieved remission , was 0.25 ( 95% ci 0.070.87 ) as compared with those whose microalbuminuric stage did not change during the follow up , whereas that in patients who progressed to overt proteinuria was 2.55 ( 95% ci 1.046.30 ) ( figure 3 ) .
even though failing to achieve the remission , the number of the first occurrences of outcomes in subgroups stratified by a 50% reduction of urinary albumin excretion was 12 events in the regression group and 35 events in the nonregression group .
meier estimation showed that the cumulative incidence of evaluated events was significantly lower in the regression group than in the nonregression group .
the 8year cumulative incidence of these outcomes in the regression group showed a 59% decrease compared with the nonregression group .
the adjusted risk for outcomes in patients who achieved the regression was 0.41 ( 95% ci 0.150.96 ) as compared with those whose microalbuminuric stage did not achieve the regression during the follow up .
a prospective observational followup study including a total of 216 japanese type 2 diabetic patients with microalbuminuria was carried out to explore the clinical impact of remission and progression of microalbuminuria .
the primary evaluation consisted of combined incidence defined as cardiovascular death and first hospitalization for renal and cardiovascular events .
the pooled logistic analysis adjusted by sex , age , the initial albumin excretion rate levels , a history of cardiovascular disease , current smoking , hba1c , total cholesterol , triglyceride , highdensity lipoprotein cholesterol , systolic blood pressure , diastolic blood pressure , the use of renin angiotensin system inhibitors , the use of lipid lowering drugs and body mass index showed that the risk for outcomes in patients , who achieved remission , was 0.25 ( 95% ci 0.070.87 ) as compared with those whose microalbuminuric stage did not change during the follow up , whereas that in patients , who progressed to overt proteinuria , was 2.55 ( 95% ci 1.046.30 ) .
as suspected , the annual decline rate of egfr in the progression group ( median 4.2 ml / min / year ) was significantly faster than in the nonchange group ( 2.4 ml / min / year ) , whereas the annual decline rate of egfr in the remission group was significantly slower , 1.1 ml / min / year , which is almost identical with the decline rate by normal aging reported in healthy people . the effect of reducing microalbuminuria on kidney function was also reported in the steno2 study aforementioned .
the patients who reverted to normoalbuminuria had an egfr decline of 2.3 ml / min / year ; however , those who still had microalbuminuria lost 3.7 ml / min / year of egfr , and those who progressed to overt proteinuria showed the highest decline in egfr of 5.4 ml / min / year .
these results show that the remission of microalbuminuria is closely related to the improvement of renal function in the long term .
physicians have to take care of diabetic patients with an aggressive multifactorial management plan as early as possible after the development of microalbuminuria ( table 2 ) .
the clinical target , which is important and effective for diabetic kidney disease , is to achieve the remission and/or regression of microalbuminuria .
furthermore , reducing microalbuminuria results in a risk reduction of not only renal , but also cardiovascular events . | abstractduring the past 10 years , a global pandemic of endstage renal disease ( esrd ) attributed to diabetes mellitus has changed the therapeutic strategies based on landmark trials that have shown that diabetic micro and macrovascular complications might be preventable .
however , the remaining risk of the progression of diabetic kidney disease to esrd is still high , despite newly introduced antidiabetic , antihypertensive and dyslipidemic drugs in the 21st century . here
, we show the importance of targeting remission and regression of microalbuminuria in type 2 diabetic patients . to achieve the remission and regression of microalbuminuria
, physicians have revised the management strategy of diabetic patients and have to act immediately .
early detection of microalbuminuria with continuous screening , the use of renin angiotensin system blockades , and targets for hba1c of < 7.35% and systolic blood pressure of < 130 mmhg are closely associated with the remission and regression of microalbuminuria , resulting in protection against the progression of diabetic kidney disease , as well as cardiovascular events .
our concept of the natural history of diabetic kidney disease has to be modified by our results and others .
reducing microalbuminuria is therefore considered to be an important therapeutic target and could be a pivotal biomarker of therapeutic success in diabetic patients .
( j diabetes invest , doi:10.1111/j.20401124.2011.00112.x , 2011 ) | Introduction
Epidemiology
Screening methods for diabetic nephropathy
Therapeutic strategy of diabetic kidney disease
Targeting euglycemia
Blood pressure control with RAS inhibitors
Remission and regression of early stage of diabetic kidney disease and cardiorenal protection
Conclusion |
according to who , all people aged more than 65 years are defined as old ( 1 ) .
the average annual growth rate of aged population over 65 is annually 2.5% . in iran , the growth rate of 4.3% in 1995 has increased to 5.2% in 2005 , and it is estimated to reach more than 7.2% . according to the report of who , by 2050 , the number of elderly population in iran will reach 26,393,000 people and at that time , elderly population will form 26% of population . therefore , iran society will change to aged population and we will face common aging disorders ( 2 ) .
thus , memory impairment and amnesia is the most common disease in the old age . according to the statistics reported by the iranian alzheimer association ,
about 450,000 patients suffer from this disease and the costs of medical treatments and care for them is very high .
hence , this trend in the coming years will cause a high financial cost and emotional burden on the health care system in iran .
the amount of time spent providing care to these patients is significantly associated with the level of cognitive impairment and the patient s dysfunction .
psychological stress which caregivers incur , including the time spent away from community to care patient ( an average of 11 hours a day ) , illness stigma , behavioral and psychological symptoms of dementia ( bpsd ) , insomnia , memory impairment and cognitive dysfunction(4 ) .
early diagnosis and treatment of the disease at early stages of the disease before can stop the course of destruction and consequently improve the quality of these patients lives and reduce the burden of future maintenance costs .
dementia has not been considered as a major problem in iran health system so diagnosis of dementia and create tools which are free of educational level and culture is very crucial in improving the national health care system .
most of available neuropsychological tests to recognize dementia are highly dependent to culture and education ( years of schooling ) . due to high rates of dementia in developing countries , illiteracy and low literacy levels in the countries such as iran , there is an unmet need to develop appropriate scales , which are independent to education and culture ( 5 ) .
this research was done to provide the psychometric properties of the persian version of csadl questionnaire for the patients with dementia and ad in iran .
used method in the present research was cross - sectional , descriptive and correlation one .
the aim was to examine the convergent validity of the correlation between test performance evaluations with csadl as the evaluation of the correlation function , and cleveland were also calculated on the same number of sample .
the study population included all patients diagnosed with dementia and were referred to memory clinic at roozbeh hospital and iaa in 2011 2012 and were selected randomly from these centers and observed .
samples were recruited through purposive sampling . the sample size according to number of questions of questionnaire that was 46 was estimated 235 patients . among them
72 patients suffered ad , 137 people suffered other types of dementia and 26 people suffered mci . in total , main caregivers of 235 subjects completed the questionnaire , which 107 of the patients were male .
an average year of schooling in men was 9 years and in women was 5 years .
instrument used in this study was cleveland scale of activities daily living ( csadl ) ( 6 ) .
csadl has been designed to evaluate the dependence on others to perform activities of daily living ( adl ) .
the assessed people should have a normal developmental record and behavior of patients before suffering dementia should be like a normal adults .
the scale has 48 questions , and two questions ( number 32 and 48 ) are not used in scoring .
any questions should be rated with five following options : fully autonomous , rarely dependent , the time - dependent , dependent , not assessed .
an informed person who respond the questionnaire should be aware of patient dependency rate and should take care of patient in a way that have direct relation with patient at least two or three days a week .
implementation time is 15 to 20 minutes . according to research main objective , in the psychometric properties of the cleveland questionnaire , instruments standard making operations , including reliability assessment practicality , validity and software troubleshooting according to exploratory factor analysis with promax method and using spss version 18 software .
questions whole validity was 0.95 . the correlation of each score with whole score showed that all questions have proper and high relation with scale so it is better not to make changes in questions and delete them .
final observation showed coefficient after two weeks with retest method . to perform main factor analysis value and prove the point that correlation matrix of the data is not zero in society , bartlett s test of sphericity is used so gained results was meaningful statistically ( kmo=0.93 , p<0.001 ) .
therefore , based on the analysis of both criteria , correlation matrix of the observed sample group can be explained . to determine the observed assessment instrument ( whole question ) saturated by several factors ,
1 eigen value 2 - eigen value rotated diagram 3 - the amount of variance explained by each factor . to extract the relevant factors , factor analysis has done multiple times with a variety of solutions , including solutions , 8.7 , 6 , 5 , 4 factors .
eventually it became clear that the three factor solution is more adequate , and this solution was used .
scary chart has been shown in fig . 1 , so we can find out that first factor share in total variance of the variables is significant and is different from the other factors share .
the lowest communality for each question is 0.174 belongs to question number 34 ( effectively takes into things ) and 0.071 belong to question 46 ( write complex expressions ) .
the highest communality is 0.71 belongs to question 7 ( at the end of urination or defecation ) and 0.694 belong to question 3 ( ability to enter and exit the bath ) and 23 ( use the drug in specified time and amount ) . to simplify factors extraction and
factor analysis several results with different methods showed that the factors extracted by both methods are almost equal to each other .
however , the results obtained from using the promax rotation that is more suitable and less number of questions were deleted .
factor matrix which created by promax rotation is shown in table 2 . in this matrix ,
questions 47 , 35 , 12 and 34 deleted in factor rotation , as they had no relation with factors and at last question numbers reached 42 .
the factor scores for the three total , instrumental and basic respectively is 0.867 and 0.819 and 0.828 , which is a high correlation and significant at the 0.01 level . to evaluate the sensitivity and specificity of the questionnaire for the diagnosis of dementia syndrome of the roc curve was used .
scores of 20 for the total score was chosen as cut of point . in this cut - off point test , sensitivity is 90% and specificity rate is 93% .
if you select 26 for cut of point , sensitivity is 87% and specificity will be 100% . according to importance and sensitivity of test in related research , both of cut - off points can be chosen .
the cut - off score bas , 3 was the score at 88% sensitivity and 98% specificity .
the cut- off score ins , was 20 the test sensitivity is 91% and specificity is 100% . compared to the average of the three groups of patients with ad and others dementia and
x2 ( 2 , n=235 ) = 30.95 , p=0.001 , ( ad , n=72 : dementia , n=137 : mci , n=26 ) . experimental tests showed that the dementia group ( md = 93.5 ) and alzheimer groups ( md = 91 ) had higher median score than the ( md = 19.5 ) mci .
there was no significant difference in the scores of the two groups of others dementia and alzheimer s ( p=0.640 , r=0.045 , u=4738 , z=0.467 ) . to control type i error ,
the alpha level was used for correction bon ferroni and significant alpha level of 0.017 was used as the criterion . to determine the relationship between two genders variable and the risk of dementia , alzheimer and mci chi - square test was used .
two chi - square test for independence ( with yets correction ) showed that no significant relationship exists between gender and dementia syndrome .
this research was done with psychometric properties of the activities of csadl . whereas the number of published studies concerning csadl measure are rare , but there are some studies about adl in old population for providing methods relevant to assessment of dementia . in a study
the authors developed an 11 item scale to screen for dementia in illiterate population in india with good internal consistency ( cronbach s =0.82 ) .
another research was done in 1996 to develop the bristol adl scale specifically for use with people with dementia that assess 20 daily - living abilities ( 8) . in our study ,
three factors extraction were followed by an additional equity and scary chart confirms that these three factors are self - care ( 21 items ) , language skills ( 14 items ) , planning ( 7 items ) .
four questions from the original questionnaire was eliminated by removing any of these questions , the cronbach s alpha was increased only 0.002 and explained percentage of variance increased to 0.004 so due to the very small changes you can keep all the questions in the questionnaire . scale reliability was assessed using the test retest verification .
( 6 ) . in their study to determine the ability of the csadl to distinguish between ad patients and healthy elderly individuals and patients with physically impaired they compared this three groups and concluded that the csadl is a reliable measure of functional deficits in individuals with ad .
they developed csadl to evaluate a broad range of adl including basic and complex activities ( 6 ) . in our study correlation between scale scores and performance level ,
evaluation scale showed that in terms of theory , scales , and measures the desired characteristics .
these findings indicate persian version of csadl is a reliable scale of activities of daily living in iranian old population by using obtained roc curve and cut - off points .
the sensitivity and specificity of this questionnaire is able to separate the healthy subjects from the patients with mci and dementia .
it can be claimed that persian version of csadl questionnaire have appropriate indicators to serve as a useful tool for research in dementia and its early detection .
it can also enable the implementation of scientific research in academic and medical centers about dementia syndrome and ad in iran .
considering the fact that ad is the most common cause of dementia , it is recommended to do more research to differentiate ad and other types of dementia such as vascular dementia , lewy body dementia , fronto temporal dementia , etc .
the limitation of this study was the limited number of the caregivers who have enough time and energy to participate in our study , which shows the high burden of this devastating disease .
this research is specifically done on dementia as a whole . with a view to increasing age of our population and the burden of ad as the most common cause of dementia syndrome - including direct and indirect costs of the disease- the results of the psychometric tool for early detection and treatment of early stage disease
could be helpful significantly in reducing healthcare costs imposed by illness and caregivers suffer loss due to delay in the progress of the disease .
moreover , attention of health planning authorities and scientific and research centers into the disease is necessary and can reduce the burden of the disease in the coming years significantly . social intervention to improve attitudes , knowledge and performance of individuals is possible by public education through the mass media to enables the professionals make dementia diagnosis as early as possible .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors . | backgroundthe purpose of this study was to design a valid questionnaire to the iranian culture for dementia diagnosis and more specifically in its early stage.methods:a cross - sectional study was conducted in 2012 in memory clinic of roozbeh hospital and iranian alzheimer association in tehran in 2012 . among 235 subjects ,
there were 72 patients with alzheimer s disease ( ad ) , 137 patients with other types of dementia , and 26 subjects with mild cognitive impairment ( mci ) , which 107 of them were male .
moreover , 42 healthy subjects were selected as control group . we considered psychometric properties of the cleveland scale of activity daily living ( csadl ) questionnaire and used standard making operations according to exploratory factor analysis.results:three factors were extracted : self - care ( 21 items ) , language skills ( 14 items ) , and planning ( 7 items ) .
convergent validity was 0.86 and cut off point for total , basic and instrumental scores respectively was 20 , 3 and 20.conclusion:it can be claimed that persian version of csadl psychometric questionnaire has appropriate indicators and can serve as a useful tool for research in dementia and in its early stage .
it can also enable the implementation of scientific research in academic and medical centers on dementia in general and alzheimer s disease specifically in iran . | Introduction
Materials and Methods
Results
Discussion
Conclusion
Ethical considerations |
glial cells actively participate in brain development and function necessitating communication between neurons and glia ( allen and barres , 2009 ) .
their functions range from metabolic support to myelination , immune defense , and engagement in synapse formation and plasticity .
myelination requires intense communication between oligodendrocytes and neurons , which is also essential for the maintenance of axonal integrity over the lifetime ( nave , 2010a ) .
recent reports describe the horizontal transfer of biomolecules by secreted extracellular vesicles , which is increasingly becoming established as a general mode of intercellular communication ( simons and raposo , 2009 ; camussi et al . , 2010 ) .
neurons and the major types of glia release vesicles , raising the possibility that communication mediated via extracellular vesicles is a common mechanism in the cns .
small vesicles , here referred to as microvesicles , shed directly from the plasma membrane or originate from the endosomal system ( lakkaraju and rodriguez - boulan , 2008 ; cocucci et al . , 2009 ) .
a mixed population of such vesicles has been detected in body fluids including cerebrospinal fluid ( vella et al . , 2008 ) .
exosomes are released by fusion of multivesicular bodies ( mvbs ) with the plasma membrane and secretion of the intraluminal vesicles ( ilvs ) into the extracellular space .
proteins relating to their biogenesis ( alix and tsg101 ) , distinct cytosolic proteins such as heat - shock proteins , and certain membrane proteins ( tetraspanins , integrins ) are sorted into exosomes whereas others are excluded ( for review , see thery et al . ,
cells utilize exosomes to dispose of unwanted proteins or to exchange signals with neighboring cells . as an example
, erythrocytes remove the transferrin receptor via exosomes during maturation , instead of eliminating it via internal degradation .
proteins implicated in cell interaction are strikingly abundant in exosomes , which thus suggests a role in cell cell communication . in the immune system ,
antigen presenting cells ( apcs ) release exosomes containing mhc and costimulatory molecules to modulate t - cell activation ( thery et al . , 2009 ) .
furthermore , microvesicles ( including exosomes ) transport mirnas and mrnas from cell to cell .
translation of microvesicle - derived mrnas is initiated and new proteins are synthesized . in turn , transferred mirnas inhibit expression of resident proteins .
thus , shuttled rnas can alter the proteome of recipient cells ( valadi et al .
, 2007 ; skog et al . , 2008 ; pegtel et al . , 2010 ; zhang et al . ,
this review describes the characteristics and functions of microvesicles secreted by neurons and glia ( collectively referred to as neural cells ) , with particular focus on exosomes released by oligodendrocytes .
glia interaction and hypothesize that they shuttle functional molecules to neurons , thus influencing neuronal properties .
exosomes and other microvesicles can be isolated from culture supernatants or body fluids by differential centrifugation and filtration . with current technology ,
the isolation of extracellular vesicles directly from tissues is impossible because membrane debris and internal vesicles contaminate the preparation .
furthermore , discrimination between different types of microvesicles is difficult . to distinguish exosomes from other secreted vesicles , their characteristic size ( diameter below 100 nm ) , protein composition , density , and endosomal origin
exosomes are derived from mvbs and correspond to the ilvs , which bud from the limiting membrane into the lumen of late endosomes .
ilv - budding involves the action of the escrt ( endosomal sorting complex required for transport ) machinery , though its exact role in exosome biogenesis is not clear and appears cell - type dependent ( simons and raposo , 2009 ; bobrie et al . , 2011 ) .
anyhow , escrt and associated proteins such as tsg101 and alix are integrated in exosomes and serve as markers of their identity .
in addition , escrt independent mechanisms of ilv formation have been described involving sorting of exosome cargo to endosomal domains and ceramide - mediated budding from the limiting membrane ( trajkovic et al . , 2008 ; buschow et al . , 2009 ) .
possibly , distinct endosomal sorting mechanisms lead to the generation of subpopulations of exosomes . mvb trafficking and fusion is regulated by rab - family gtpases . in oligodendroglial cells , rab35 regulates docking of mvbs to the plasma membrane ( hsu et al . , 2010 ) .
moreover , rab27a and rab27b are involved in the docking step in hela cells ( ostrowski et al . ,
proteomic and microarray analysis on a range of exosome preparations yielded a reproducible compendium of exosome - associated proteins and rnas , summarized in the database exocarta ( mathivanan et al . , 2012 ) .
typical proteins are cytoskeletal proteins such as tubulin and actin , heat - shock proteins ( hsp70 , hsp90 ) , metabolic enzymes of the glucose metabolism , flotillin-1 , signal transduction proteins ( kinases , heterotrimeric g proteins ) , mhc molecules , clathrin , proteins involved in transport and fusion ( annexins , rab proteins ) , and translation elongation factors . strikingly abundant in exosomes are proteins of the tetraspanin family , e.g. , cd9 , cd63 , cd81 , and cd82 ( van niel et al . , 2006 ; simpson et al . , 2008 ; thery et al . , 2009 ) .
additionally , exosomes contain cell - type specific components reflecting the host cell identity and presumably also hinting at the biological function of the released exosomes .
in the cns , neurons , microglia , astrocytes , and oligodendrocytes have been reported to secrete microvesicles into the extracellular environment . in response to glutamatergic synaptic activity , cultured cortical and hippocampal neurons release microvesicles with the characteristics of exosomes .
neuronal exosomes carry the cell adhesion molecule l1 , the gpi - anchored prion protein , as well as the glur2/3 subunits of the ampa receptor ( faure et al . , 2006 ; lachenal et al . , 2011 ) .
the parkinson disease related protein -synuclein is secreted from a neuroblastoma cell line by exosomes and can influence the viability of neighboring cells ( emmanouilidou et al . , 2010 ) .
oligodendrocytes release exosomes that include the lipids galactocerebroside , sulfatide , and cholesterol ( krmer - albers et al . , 2007 ) , which are also prominent in oligodendroglial lipid rafts and represent characteristic myelin lipids ( krmer et al . , 1997 ) .
the proteomic profile of oligodendroglial exosomes mirrors the exosome - pattern of marker proteins ( alix , tsg101 , flotillin-1 ) , ubiquitous tetraspanins ( cd81 , cd63 ) , and chaperones ( figure 1 ) .
they are furthermore characterized by the presence of unique myelin proteins , such as plp , cnp , mag , and mog .
remarkably , oligodendroglial exosomes carry a range of enzymes such as the nad - dependent deacetylase sirtuin-2 , oxidative stress alleviating peroxiredoxins and dihydropyrimidinase - related proteins , and glycolytic enzymes ( gapdh , pyruvate kinase , -enolase ) . characteristics of oligodendroglial exosomes .
( a ) electron micrograph of exosomes in the extracellular space released by primary oligodendrocytes .
immuno - gold labeling was performed with antibodies recognizing myelin - associated glycoprotein ( mag ) .
the illustration is based on proteomic analyses of exosome preparations derived from oligodendroglial cells ( krmer - albers et al . , 2007 ) .
they become activated and execute immune functions such as antigen presentation ( kettenmann et al . , 2011 ) .
microglia secrete exosomes containing the expected exosomal proteins as well as a set of proteins previously reported for b cell- and dendritic cell - derived exosomes .
in addition , they carry the surface - bound aminopeptidase n ( cd13 ) and the monocarboxylate transporter 1 ( mct1 ) .
cd13 cleaves n - terminal amino acids from polypeptides and exosome - associated cd13 degrades enkephalins , influencing the activity of ligands of the opioid receptor and thus neuronal camp levels .
since these exosomes contain the lactate transporter mct1 together with glycolytic enzymes , they may serve to deliver energy substrates to neurons ( potolicchio et al . , 2005 ) .
moreover , microvesicles carrying the proinflammatory cytokine il-1 shed from the plasma membrane of microglial cells and astrocytes in response to atp stimulation and activation of acid sphingomyelinase ( bianco et al . , 2009 ) .
in response to oxidative and heat stress , cultured astrocytes release elevated amounts of the heat - shock protein 70 ( hsp / hsc70 ) as well as synapsin 1 in association with exosomes ( taylor et al . , 2007 ;
intriguingly , astrocyte - derived exosomes have been reported to contain mitochondrial dna ( guescini et al . , 2010 ) .
secretion of microvesicles comprising a mixture of exosomes , shedding vesicles , and possibly also apoptotic bodies is a prominent feature of brain tumor cells , which often originate from astrocytes ( van der vos et al . , 2011 ) .
microvesicles derived from highly aggressive glioblastoma multiforme tumors ( gbm ) , carry oncogenic efgrviii in addition to immunosuppressive and angiogenic factors ( al - nedawi et al . , 2008 ; graner et al . , 2009
they are moreover characterized by the presence of nucleic acids , including mrnas , mirnas , non - coding rnas , retrotransposon elements , genomic dna , and cdna derived from oncogenic sequences ( skog et al . , 2008 ;
two general functions have been ascribed to exosome secretion : disposal of unneeded cell components and signaling to neighboring cells involving the horizontal transfer of biomolecules ( lotvall and valadi , 2007 ; simons and raposo , 2009 ) .
both functional properties assigned to exosomes appear eligible to be utilized by neural cells , which operate as a long - term cellular network relying on finely tuned cell cell interactions , mutual support , and the clearance of remnants .
the physiological and pathological impact of exosomes in the nervous system has been a topic of discussion ( smalheiser , 2007 ; aguzzi and rajendran , 2009 ) , however , we are only beginning to capture a true picture ( figure 2 ) .
enhanced glutamatergic activity within cultures of mature cortical neurons stimulates the release of exosomes carrying the ampa receptor subunit glur2 from the somatodendritic postsynaptic compartment ( lachenal et al . , 2011 ) .
these findings suggest that activity - dependent exosome secretion may help to adapt the efficacy of synaptic transmission by depletion of neurotransmitter receptors from the postsynaptic compartment .
what happens to the exosomes after the release , whether they become internalized by the presynaptic neuron or surrounding glial cells remains to be determined .
a synaptic transfer of wnt - signaling molecules involving exosome - like vesicles has been shown to occur in drosophila larva at the neuromuscular junction ( koles et al . , 2012 )
neuronal signals trigger exosome release from oligodendrocytes by raising intracellular ca - levels . upon internalization by neurons
microglia take up and degrade oligodendroglial exosomes without changing their inflammatory properties . under specific pathological conditions
these exosomes may transfer antigens to microglial cells or other apcs and induce inflammatory responses . in the context of cns pathology
, it appears that pathogenic proteins such as -amyloid peptide , prion protein , -synuclein , tau , and superoxide dismutase are released from cells in association with exosomes ( fevrier et al .
, 2004 ; rajendran et al . , 2006 ; gomes et al . , 2007 ;
these proteins have in common the activity to form aggregates ( amyloids , prionoids ) that escape the normal cellular degradation machinery .
it is not clear yet whether exosome - associated secretion of amyloidogenic proteins helps to relieve cells of potentially detrimental components , or if the pathogen - filled exosomes engage in propagating neurodegenerative
microvesicles ( including exosomes ) are released by glioma cells , which carry the mrna and protein of oncogenic egfrviii as well as angiogenic factors .
they can be internalized by surrounding cells , promoting cell transformation or mediating tubular growth of endothelial cells ( al - nedawi et al . , 2008 ;
, 2008 ; graner et al . , 2009 ; svensson et al . , 2011 ; van der vos et al . , 2011 ) .
thus , glioma - derived microvesicles appear to modulate the environment to favor tumor growth .
intriguingly , tumor - derived microvesicles can also be detected in the circulation of glioma - bearing mice or human glioblastoma patients demonstrating that they are produced in vivo and are capable of crossing the blood brain barrier .
microvesicle release from primary cortical astrocytes and microglial cells appears to be triggered by atp - mediated activation of p2x7 receptors and downstream stimulation of acid sphingomyelinase ( bianco et al . , 2009 ) .
a recent study suggests that this special type of microvesicle signals to neurons resulting in modulation of synaptic activity ( antonucci et al . , 2012 ) .
application of microvesicles isolated from atp - stimulated microglial cells to neurons in vitro and in vivo gave rise to increased neurotransmission , that appeared to be due to an enhanced release probability at the presynaptic site .
scanning electron micrograph pictures of glioma cells and fluorescence microscopy analysis of atp - stimulated glial cells , as well as the heterogeneous size profile of the released microvesicles indicate that shedding from the cell surface is the dominant form of vesicle generation in these paradigms . nevertheless , it is possible that exosomes account for some of the described functions since they are also present in the vesicular fractions analyzed .
astrocytes release exosomes carrying hsp70 and synapsin 1 in response to heat or oxidative stress , which have been suggested to ship neuroprotective cargo to neurons facilitating their survival ( taylor et al . , 2007 ) .
intriguingly , synapsin 1 is first released from the exosomal cytosolic compartment under these conditions , before it acts on neurons in its soluble form ( wang et al . , 2011 ) .
oligodendrocytes secrete mvb - derived exosomes in a ca - dependent fashion , which also carry mrna and mirna in addition to myelin proteins and lipids ( krmer - albers et al . , 2007 ; krmer - albers et al .
these exosomes appear to convey autocrine signals that inhibit membrane expansion and myelin formation by oligodendrocytes in culture in response to neuron - derived trophic factors ( bakhti et al . , 2011 ) .
this autocrine signaling pathway does not involve exosome reinternalization but is mediated by activation of second messenger cascades involving rhoa , fyn , and fak .
furthermore , it has been shown that microglia take up oligodendroglial exosomes by macropinocytosis , which subsequently become degraded and apparently fail to provoke an immune response ( fitzner et al . , 2011 ) .
internalization is observed preferentially in mhc class ii negative microglia and does not promote microglial activation .
the authors suggest that microglia are engaged in the degradation of excess myelin components secreted by the exosome pathway
. it will be interesting to determine whether exosomes derived from oligodendrocytes exposed to pathogens or specific forms of stress will be able to induce an inflammatory response .
this is particularly relevant to the still unresolved etiology of multiple sclerosis and the question of how cns self - antigens are transferred to trigger a myelin - specific autoimmune response .
our recent work indicates that oligodendroglial exosomes play an important role in mutual communication between oligodendrocytes and neurons .
we found that neurotransmitter release stimulates oligodendroglial exosome secretion by activating ca - permeable ionotropic receptors on the surface of oligodendrocytes .
furthermore , neurons internalize oligodendroglial exosomes by endocytosis and utilize their cargo ( submitted manuscript ) .
these findings suggest that neuronal activity triggers the transfer of oligodendroglial exosomes and their cargo to neurons .
thus , neurons would regulate their supply of glia - derived exosomal proteins , mrnas , and mirnas .
myelinated axons exist as long protrusions at a distance from the neuronal cell body and are shielded from the cns environment by the myelin membrane ( nave , 2010b ) .
hence , external support by exosome - mediated transfer of glial substrates could be contributing to and be critical for long - term axonal maintenance .
a lack of glial support is modeled by plp and cnp knockout mice , which develop a progressive axonal degeneration ( edgar and nave , 2009 ) .
plp and cnp are both components of oligodendroglial exosomes and thus , it is tempting to speculate about the potential contribution of exosomes to glial support .
oligodendroglial exosomes additionally include substances that can contribute to neuroprotection such as hsp / hsc70 .
there is evidence that the squid giant axon locally picks up hsps from periaxonal glial cells ( tytell et al . ,
1986 ) and it was indeed suggested that the transfer is mediated by exosomes ( tytell , 2005 ) . moreover , newly synthesized glial rnas are delivered to the giant axon in response to axonal depolarization ( eyman et al . , 2007 ) .
in the pns , it has been described that axons receive ribosomal subunits in association with vesicles from myelinating schwann cells ( court et al . , 2008 ) . it will be interesting to determine , whether oligodendroglial exosomes exhibit neuroprotective or neurotrophic functions .
the pathology of multiple sclerosis involves an immune - mediated degeneration of the myelin sheath . which factors direct
the specificity of the immune response toward myelin and whether myelin antigens in multiple sclerosis are processed by apcs is unknown .
exosomes are known to deliver antigens to apcs ( bobrie et al . , 2011 ) .
in spite of reports that oligodendroglial exosomes appear not to activate microglia , it is feasible that other apcs such as dendritic cells , which invade the cns under certain conditions , process oligodendroglial exosomes and present the antigens on their surface to initiate an immune response .
future studies will determine whether oligodendroglial exosomes can mediate myelin antigen transfer to dendritic cells .
furthermore , exosome composition may be altered in certain pathological conditions , causing a switch of immunologically inert into immunologically active exosomes .
oligodendroglial exosome composition indeed may be altered in pelizaeus merzbacher disease ( pmd ) resulting from duplications in the plp1 gene .
overexpression of plp leads to its accumulation in late endosomes ( simons et al . ,
increased exosome release or an altered exosome protein / lipid stoichiometry may thus trigger inflammatory reactions in the cns contributing to pmd pathology .
common to most myelin diseases is the phenomenon of progressive axonal degeneration due to lack of glial support .
this secondary neuronal damage is the major cause of irreversible disability and death of the patients .
thus , it is of clinical importance to decipher the potential implications of oligodendroglial exosomes in neuroprotection and to identify the beneficial components , with the ultimate goal to develop therapeutic strategies mitigating axonal degeneration .
furthermore , there is accumulating evidence that exosomes qualify as promising vehicles for the delivery of therapeutic agents into the brain , as they can be delivered across biological barriers such as the blood brain barrier ( lakhal and wood , 2011 ) .
the hypothesized role of secreted microvesicles / exosomes in neural cell communication is materializing into a picture substantiated by experimental evidence ( figure 2 ) .
microvesicles may execute their functions by distinct modes of action : ( 1 ) internalization by target cells and cargo retrieval , ( 2 ) binding to the cell surface and triggering second messenger pathways , and ( 3 ) release of components into the extracellular matrix .
however , their interaction with target cells is not well understood at a mechanistic level . to date , most theories of exosome function have arisen from in vitro data .
the field awaits genetic mouse models that interfere with neural exosome secretion to demonstrate the in vivo relevance of exosome - mediated processes .
nonetheless , the versatile role of cns microvesicles opens up new perspectives for the understanding and treatment of neurodegenerative diseases including diseases of myelin .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | brain function depends on coordinated interactions between neurons and glial cells .
recent evidence indicates that these cells release endosome - derived microvesicles termed exosomes , which are 50100 nm in size and carry specific protein and rna cargo .
exosomes can interact with neighboring cells raising the concept that exosomes may mediate signaling between brain cells and facilitate the delivery of bioactive molecules .
oligodendrocytes myelinate axons and furthermore maintain axonal integrity by an yet uncharacterized pathway of trophic support .
here , we highlight the role of exosomes in nervous system cell communication with particular focus on exosomes released by oligodendrocytes and their potential implications in axon glia interaction and myelin disease , such as multiple sclerosis .
these secreted vesicles may contribute to eliminate overproduced myelin membrane or to transfer antigens facilitating immune surveillance of the brain .
furthermore , there is emerging evidence that exosomes participate in axon
glia communication . | Introduction
Classification and General Components of Exosomes
Characteristics of CNS Exosomes
Functions of Nervous System Exosomes
Role of Oligodendroglial Exosomes in Cell Communication
Relevance for Myelin Disease
Conclusion
Conflict of Interest Statement |
secreted phospholipase
a2 ( spla2 ) cleave
glycerophospholipids at the sn-2 ester bond .
they are excreted at the extracellular side of
the plasma membrane and are overexpressed in a variety of tumors ,
e.g. , up to 22-fold in prostate cancer .
these enzymes have been hypothesized to be targets to control drug
release from nanoparticles , such as liposomes .
spla2 are regulated by pla2 receptors
including
the m - type receptor , otherwise known as pla2r1 . while several studies have reported on the expression of
spla2 in cancer cells ,
few have examined the expression
of pla2r1 and fewer have determined its role in cell physiology or
cancer pathology .
most interestingly , we have not identified any studies
that examined the effect of pla2r1 on the disposition of lipid - based
nanomedicines , including those that are targeted or sensitive to expression
of spla2 .
pla2r1 is a membrane - bound glycoprotein
expressed on the extracellular
surface and can also exist as a soluble secreted protein .
the internalization of
spla2 by pla2r1 may , but does not always , inactivate spla2 by degradation , which is followed by the recycling of pla2r1
to the membrane .
pla2r1 was initially characterized in rabbit muscle
tissues , but it is also found in the lung , spleen , and kidney , and
in breast and colon cancers .
human pla2r1 does not preferentially
bind group iii spla2 ( bee venom ) or naja venom ( cobra venom ) and has weak - to - no binding affinity for group
ib , iia , and v spla2 .
spla2 binding
to pla2r1 is reported to alter cell invasion ,
proliferation , and mapk activation .
a recent
report in breast cancer cells suggested that pla2r1 could act as a
tumor suppressor .
we recently demonstrated
that engineering liposomes to interact
with spla2 increased payload release and enhanced intracellular
uptake compared to that for pegylated , long - circulating sterically
stabilized ( ssl ) dox liposomes , which are similar to the clinically
approved doxil .
these liposomes , termed
spla2 responsive liposomes ( sprl ) , were also more effective
at slowing tumor growth in a xenograft model of human prostate cancer .
interestingly , the effectiveness of sprl formulations was not altered
by inhibitors of spla2 activity .
this suggested that spla2-mediated lipid degradation of sprl and drug ( dox ) release
may not be the only mechanism for the enhanced antitumor activity .
thus , we hypothesized that pla2r1 may mediate the disposition of sprl
and other lipid - based nanomedicines .
the purpose of the work
herein was to determine the expression
of pla2r1 in non - cancerous and cancerous prostate cells and to determine
the role of pla2r1 in prostate cancer cell growth .
we also determined
the role of pla2r1 in chemotherapeutic - induced cytotoxicity using
free and liposome - encapsulated drug .
these findings are important
as they provide insights into the roles of pla2r1 , its potential as
a chemotherapeutic target for controlling tumorigenesis , and its impact
on intracellular delivery of lipid - based nanomedicines for the treatment
and identification of aggressive vs indolent disease .
distearoylphosphatidylcholine ( dspc ) , distearoylphosphatidylethanolamine
( dspe ) , and 1,2-distearoyl - sn - glycero-3-phosphoethanolamine - n-[poly(ethylene glycol ) 2000 ] ( dspe - peg ) were purchased
from avanti polar lipids inc .
cell lines derived
from primary cultures of human prostate cells ( pcs-440 - 010 ) and those
from prostate cancer tumors ( lncap , du-145 , and pc-3 cells ) were purchased
from atcc ( manassas , va ) .
doxorubicin ( dox ) was purchased from toronto
research chemicals ( north york , on , canada ) .
3,3-dioctadecyloxacarbocyanine
perchlorate ( dio ) , iscript cdna synthesis kit , and universal sybr
green master mix were purchased from biorad ( hercules , ca ) .
pcr primers
specific for pla2r1 , spla2 group ib , iia , v , x , and gapdh
were purchased from integrated dna technologies ( idt , coralville ,
ia ) .
pla2r1 shrna lentiviral particles , control shrna plasmids , polybrene ,
and puromycin dihydrochloride were purchased from santa cruz biotechnology
( santa cruz , ca ) .
an alternate set of pla2r1 and control shrna plasmids
was purchased from genecopoeia ( rockville , md ) .
all other reagents
were of analytical quality and purchased from sigma - aldrich ( st .
louis ,
mo ) . all cell media and supplements , including
antibiotics and serum , were purchased from atcc .
pcs-440 - 010 ( pcs )
cells were grown in supplemented prostate epithelial cell basal medium
according to the manufacture s recommendations .
lncap , du-145 ,
and pc-3 were cultured in 10% fbs and 1% penicillin / streptomycin supplemented
rpmi-1640 , emem , and f12k , respectively .
all cell cultures were incubated
in 95% humidity and 5% co2 at 37 c .
mrna was isolated from cells using ezna total
rna kit i ( promega , madison , wi ) according to the manufacturer s
specifications .
the quantity and integrity of the rna was checked
using a nanodrop ( life science technology , ny ) .
rna ( 1 g ) was
converted to cdna using the iscript cdna synthesis kit ( biorad , hercules ,
ca ) .
cdna ( 100 ng ) was used for qrt - pcr to analyze the expression
of pla2r1 ( f : 5-taaatcggttctgaccctgga-3
and r : 5- gccaccgtaaggaaacgag-3 ,
182 bp ) , group ib spla2 ( f : 5-tgccagacacatgacaactg-3
and r : 5-acgagtatgaataggtgtgggt-3 ,
97 bp ) , group iia spla2 ( f : 5-gaagttgagaccacccagca-3
and r : 5- gttgcatccttgggggatcctctg-3 ,
201 bp ) , group v spla2 ( f : 5- gacccgttactgaacctctttg-3
and r : 5-aattcctgctgtgtgaaatcct-3 ,
145 bp ) , group x spla2 ( f : 5-gaccggcagagaacaaatgc-3
and r : 5-ttgtactcagtttgggctaagc-3 ,
88 bp ) , and gapdh ( f : 5-aaggtcggagtcaacggat-3
and r : 5-tggaagatggtgatgggatt-3 ,
221 bp ) , as a house - keeping gene .
relative expression values were calculated by ct
using gapdh as an internal control and pcs-440 - 010 cells as a standard
of comparison .
proteins from
different cell
lines were collected in ripa buffer supplemented with 1% ( v / v ) protease
inhibitor cocktail ( sigma , st .
the protein concentrations
were determined using the bca assay , and protein samples ( 40 g )
were separated on 4%/12% stacked sds - page gels and transferred to
nitrocellulose membranes .
the membranes were blocked in 5% ( w / v ) milk
powder tbs - t for 2 h and then exposed to antibodies .
four different
antibodies targeting human pla2r1 were used : a rabbit polyclonal antibody
from abcam ( cambridge , ma ) , a rabbit polyclonal antibody from proteintech
( chicago , il ) , a rabbit polyclonal antibody from atlas antibodies ( stockholm , sweden ) , and a guinea pig polyclonal
antibody raised against rabbit pla2r1 at 1:500 , 1:500 , 1:1000 , and 1:1000 dilutions in 1% bsa tbs - t , respectively .
samples for immunoblot analysis using the guinea pig polyclonal antibody
were prepared under nonreducing conditions .
, santa cruz , ca ) and gfp ( genecopoeia ,
rockville , md ) were used at 1:200 and 1:500 dilutions in 1% bsa tbs - t ,
respectively , for 1 h at room temperature .
membranes were incubated
with a relevant peroxidase - conjugated secondary antibody ( 1:2500 dilution )
( promega , madison , wi ) or a guinea pig hrp - conjugated secondary antibody
( 1:5000 dilution ) ( sigma , st .
louis , mo ) for 2 h. bands were visualized
using supersignal chemiluminescent substrate ( thermo scientific , waltham ,
ma ) , and intensities were visualized and quantified using an alpha
innotech fluorchem hd2 system ( proteinsimple , santa clara , ca ) .
on the basis of our
previous studies , we prepared sprl containing
10% dspe .
these sprl were chosen because they exhibited sensitivity
to spla2 with improved tumor growth inhibition in a xenograft
model of prostate cancer .
dox - loaded
liposomes
were prepared by remote loading using a drug concentration and ph
gradient as described previously .
briefly ,
lipids and cholesterol in chloroform were mixed and dried under vacuum
using a rotary evaporator .
the resulting lipid film was hydrated in
250 mm ammonium sulfate , ph 5.5 .
thaw
cycles and was extruded through double - stacked polycarbonate , 80 nm ,
filters , n > 5 ( lipex , northern lipids , on ) .
following
extrusion , the liposomes were placed immediately on ice for 10 min
and then dialyzed overnight with isotonic 10% ( w / v ) sucrose solution
with three changes to remove unencapsulated ammonium sulfate .
drug
loading was performed by adding dox ( 10% sucrose , ph 8.5 ) to the dialyzed
liposomes at a 0.2:1.0 drug / lipid molar ratio .
the formulation was
mixed and incubated for 1 h at 65 c with periodic vortexing
and immediately put on ice for 15 min .
the loaded liposomes were then
dialyzed overnight using a 1214 kd mwco membrane ( spectrum
laboratories , rancho dominguez , ca ) in a 10% ( w / v ) sucrose solution
to remove unencapsulated drug .
dox loading was quantified spectroscopically
in acidified ( 0.2 n hcl ) ethanol ( 1:1 v / v ) , and lipid concentration
was determined using an assay for inorganic phosphate .
fluorescent dio - labeled liposomes were prepared according
to the method of kamps et al .
briefly , lipids and cholesterol in chloroform
were mixed , and 1 mol % dio was added before the solution was evaporated
to a lipid film .
the resulting film was then rehydrated in pbs or
ammonium sulfate depending on whether dox would subsequently be loaded .
pc-3 cells were transfected with
various titers of pla2r1 shrna lentiviral vectors in media containing
5 g / ml polybrene , whereas the control cells were transfected
with scrambled plasmid . after 24 h ,
the following day , clonal
selection was performed using 1020 g / ml puromycin .
selected cells were grown in media containing
puromycin ( 4 g / ml ) .
similar transfection processes were performed
with a second set of pla2r1 and gfp control shrna vectors ( genecopoeia ,
rockville , md ) .
gfp was included as a reporter with the alternative
shrna to assist the clonal selection process . scrambled and pla2r1 knockdown
pc-3 cells were seeded into 48-well plates , in 50,000 cells / ml and
allowed to adhere for 24 h. cells
were then treated with free dox ,
liposome - encapsulated dox , or chemotherapeutics .
after 24 , 48 , and
72 h , 0.25 mg / ml mtt was added .
the plates were then incubated for
2 h before media were aspirated and replaced with dmso .
plates were
shaken vigorously for 15 min to dissolve all precipitates , and absorbance
was determined at 590 nm with a fluostar optima plate reader ( bmg
lab technologies , inc . ,
pc-3 cells expressing
either scrambled or pla2r1 shrna were seeded in 6 cm dishes ( 4000
cells per dish ) or in 48-well plates ( 50,000 cells / ml ) . crystal violet
staining was analyzed at 0 , 24 , and 72 h for 48-well plates or at
0 , 7 , and 11 days for 6 cm dishes .
louis , mo ) for 10 min and stained with 1% ( w / v ) crystal
violet for 15 min followed by three washes with water .
the crystal
violet stain was dissolved in methanol ( fisher , waltham , ma ) , and
the absorbance was determined at 540 nm with a fluostar optima plate
reader .
the uptake of dox and liposomes into cells was determined using flow
cytometry as described in our recent studies . scrambled pc-3 and pla2r1 knockdown cells
were seeded in 12-well
plates at 7.08.0 10 cells / well and allowed
to attach for 24 h. cells were then treated with pbs , free dox , empty
liposomes , empty dio - labeled liposomes , dox - loaded liposomes , or dio - labeled
dox - loaded liposomes .
assays for inorganic phosphate were
performed to determine lipid concentrations , and empty and dio - labeled
liposomes were dosed at equal lipid concentrations compared to dox
loaded equivalents ( 10 nmol lipid / ml ) . at 24 , 48 , and 72 h
post dosing ,
cells were washed three times with ice - cold pbs , released
from the plate using trypsin / edta , and pelleted .
pellets were washed
again with pbs and suspended in pbs supplemented with 1 mg / ml glucose .
samples were analyzed immediately using a cyan flow cytometer ( beckman
coulter , brea , ca ) .
samples were excited with a 488 nm argon laser ,
and emission was determined at 575 and 613 nm .
only whole cells were
analyzed , as determined by forward and side scatter , and at least
5000 events were counted per run .
data was analyzed using flowjo software ,
v. 9.7.4 ( tree star , inc . ,
results were compared
using a student s t test or a one - way anova
followed by a tukey s test , considering p <
0.05 to be significant .
pla2r1 expression
was determined in cell cultures derived from normal prostate tissue
( pcs-440 - 010 ) and in pc-3 , lncap , and du-145 human prostate cancer
cell lines using immunoblot analysis ( figure 1 ) .
pla2r1 protein expression was lower in pcs-440 - 010 cells compared
to that in all prostate cancer cell lines studied .
these findings
were validated using three additional antibodies , including those
demonstrated to recognize pla2r1 in several different cell types ( supporting information
figure 1a ) .
transfection of pc-3 cells with shrna plasmids significantly decreased
pla2r1 mrna to levels approximately 25% of that seen in cells transfected
with scrambled shrna ( figure 2a ) . decreased
mrna expression correlated to decreased protein expression ( figure 2b ) .
cells with decreased expression of pla2r1 appeared
to grow more rapidly than those expressing scrambled shrna .
this hypothesis
was supported by increased mtt staining ( figure 2c ) and was verified by crystal violet staining ( figure 2d and supporting information figure 2 ) .
crystal violet staining also showed that the increase in cell
growth was not dependent on the initial cell number , as similar effects
were seen if cells were seeded at low density ( 4000 cells per plate
in 6 cm dishes , figure 2d ) or at high density
( 50,000 cell / ml in 48-well
plates , supporting information figure 2 ) .
similar results were also observed when pla2r1 expression was
inhibited using shrna purchased from genecopoeia ( supporting information figure 3 ) .
knockdown of pla2r1 was verified by qrt - pcr ( a ) and immunoblot analysis
( b ) .
assessment of cell growth
was performed using mtt assays ( c ) and crystal violet staining ( d ) .
data in panels a c are represented as the mean sem of
at least three separate experiments ( n = 3/study ) .
* indicates a significant difference ( p < 0.05 )
as compared to control cells .
data in panel d are indicative of at
least three separate experiments . prior to examining the role of pla2r1
on liposome - induced cell death
, we determined the role of pla2r1 on
cytotoxicity induced by a variety of chemotherapeutics , including
docetaxel , cisplatin , and dox . as expected , all three chemotherapeutics
induced concentration - dependent decreases in mtt staining after 72
h of exposure ( figure 3a c ) .
inhibition
of pla2r1 did not alter the sensitivity of pc-3 cells to any of these
chemotherapeutics .
similar results were seen at 24 and 48 h and in
cells containing the scrambled shrna ( supporting
information figure 4a c ) .
the absence of effect of pla2r1
inhibition on dox - induced cytotoxicity was confirmed using cell morphology
( figure 3d ) .
cells were treated with docetaxel ( a ) , cisplatin ( b ) ,
or dox ( c ) for 72 h. mtt assays were used to determine the effect
of knocking down pla2r1 on chemotherapeutic - induced cytotoxicity .
the effect of pla2r1 on doxorubicin - induced toxicity was further assessed
at 72 h using phase contrast microscopy at 10 magnification
( d ) .
data in panels a c are represented as the mean
sd of at least three separate experiments ( n = 3/study ) .
data in panel d are indicative of at least three separate experiments . our recent studies demonstrated that spla2-targeted liposomes ( sprl ) had
greater carrier uptake and drug delivery
in prostate cancer cells in vitro and increased efficacy against tumor
growth in vivo compared to that of ssl .
these studies also suggested
that the activity of some of these liposome formulations was not dependent
on spla2 activity .
we hypothesized
that mechanisms other than spla2-mediated lipid degradation
may be mediating sprl activity .
therefore , we determined the effect
of pla2r1 knockdown on the cytotoxicity and uptake of sprl . as shown
in figure 4 , pla2r1 inhibition did not alter
decreases in mtt staining caused by dox - loaded ssl , but did decrease
mtt staining in cells treated with dox - loaded sprl ( figure 4a ) .
the decrease in mtt staining correlated to a
reduction in cell number and alteration in cellular morphology ( figure 4b e ) .
interestingly , knockdown of pla2r1
appeared to have a greater effect on cell morphology than on mtt .
similar results were observed using a different set of shrna ( genecopoeia , supporting information figure 4d ) .
effect of pla2r1
knockdown on the toxicity of doxorubicin encapsulated
in ssl and sprl in pc-3 cells .
pla2r1 knockdown cells and those expressing
scrambled shrna were treated with 2.5 m concentrations of dox
encapsulated in ssl or sprl .
mtt assays ( a ) and phase contrast microscopy
at 40 magnification ( b ) were used to determine the effect of
pla2r1 knockdown on cytotoxicity .
data in panel a are represented
as the mean sem of at least three separate experiments ( n = 3/study ) .
* indicates a significant difference ( p < 0.05 ) as compared to cells transfected with scrambled
shrna .
data in panel e are indicative of at least three separate experiments . to examine the importance of pla2r1 in the uptake of
ssl and sprl formulations , pla2r1 knockdown cells were exposed to
dox - loaded ssl or sprl formulations labeled with dio , and the intracellular
uptake of both drug and nanoparticle
as previously
reported , ssl and sprl were taken up by pc-3 cells ( figure 5a , c ) , and dox uptake was greatest in cells incubated
with sprl vs ssl formulations ( figure 5b , d ) .
knockdown of pla2r1 did not affect the uptake of the ssl formulation
( i.e. , dio uptake ) , but it did slightly increase dox uptake at 48
and 72 h ( figure 5a , b ) . in comparison ,
knockdown
of pla2r1 significantly increased the intracellular uptake of sprl
( i.e. , dio ) at 48 and 72 h ( figure 5c ) and
increased the uptake of dox at all time points studied ( figure 5d ) .
effect of pla2r1 knockdown on dio and doxorubicin
uptake from ssl
and sprl in pc-3 cells .
pc-3 cells were treated with liposomes containing
dox and dio for 24 to 72 h. the efficiency of dio and drug uptake
via ssl ( a , b ) and sprl ( c , d ) was quantified using flow cytometry .
data are represented as the mean sem of at least three separate
experiments ( n = 3/study ) .
* indicates a significant
difference ( p < 0.05 ) as compared to cells expressing
scrambled shrna .
it has been shown previously
that pla2r1 functions as a
negative regulator of spla2 by binding to and removing spla2 from the extracellular
side of the cell membrane .
we showed that
addition of different spla2 isoforms , including group iia ,
increased payload release and liposome degradation in vitro .
we hypothesized that increased sprl activity
in cells in which pla2r1 was inhibited may result from the upregulation
of spla2 .
we tested this hypothesis by assessing changes
in the expression of various spla2 isoforms in pc-3 cells
after pla2r1 inhibition .
knockdown of pla2r1 increased the expression
of group iia spla2 , as compared to that in cells expressing
the scrambled control shrna ( figure 6a ) . a
slight increase in group
x spla2 protein expression was
also detected . to determine if these increases correlated to increased
mrna levels , we performed qrt - pcr analysis , which also allowed us
to further assess changes in expression of other spla2 isoforms
including groups ib and v ( figure 6b ) . in agreement
with the immunoblot analysis , inhibition of pla2r1 increased spla2 group iia mrna levels .
in contrast , no increases in spla2 group ib , v , or x mrna were detected . collectively , these
data suggest that inhibition of pla2r1 increases the expression of
select spla2 isoforms , which correlates to the increase
in cell growth as well increased drug ( dox ) and liposome ( dio ) uptake . effect
of pla2r1 knockdown on spla2 expression in pc-3
cells .
pla2r1 expression was inhibited in pc-3 cells using shrna ,
and changes in the expression of various spla2 isoforms
was determined by immunoblot analysis ( a ) and qrt - pcr ( b ) .
. data
in panel b are represented as the mean sem of at least three
separate experiments ( n = 3/study ) .
* indicates a
significant difference ( p < 0.05 ) as compared
to cells expressing scrambled shrna .
pla2r1 is expressed in several tissues , including skeletal muscle , kidney , spleen , breast , and pancreas .
the expression of pla2r1
is species - dependent , with significantly different tissue profiles
being reported for its mrna expression in mouse , rat , and human . to our knowledge , these studies are the first
to show protein expression of pla2r1 in prostate cancer cells .
pla2r1 protein expression was higher in pc-3 and du145 cells compared
to that in lncap cells .
one of the only other studies that examined
pla2r1 expression in cancer cells did so in breast cancer cells and showed that mrna expression was decreased
in cancer cells compared to that in non - cancerous cell lines .
however ,
this study did not compare the expression of pla2r1 protein between
the non - cancerous and cancerous cells .
pcs-440 - 010 cells are
derived from prostate tissue and represent
multiple prostate cell types , whereas the prostate cancer cell lines
used here are actually derived from prostate tumors that metastasized
to distal sites .
this may account for differential expression between
pcs-440 - 010 and the prostate cancer cells used in this study .
regardless
of the mechanisms involved , the data clearly suggest that the protein
expression of pla2r1 is higher in the prostate cancer cell lines than
in non - cancerous prostate cells .
our data
clearly demonstrated that inhibition of pla2r1 increased mtt and crystal
violet staining , supporting the hypothesis that pla2r1 plays a role
in the growth of the prostate cancer cells .
this hypothesis is further
supported by recent studies in human breast cancer and fibroblasts
cells that suggest pla2r1 mediates replicative senescence , increases
colony formation , and possibly acts as a tumor suppressor .
the aforementioned studies in breast cancer cells and
fibroblasts suggested that pla2r1 regulates senescence through the
p53 pathway .
another study , from the
same group , demonstrated that pla2r1 activated jak2 signaling , which
resulted in decreased cellular transformation .
pc-3 cells do not express p53 , suggesting that pla2r1 may
inhibit cell growth by p53-independent mechanisms , possibly involving
activation of kinase - mediated pathways .
another possible mechanism
by which pla2r1 inhibition may increase
cell growth is by altering cell death . in support of this hypothesis ,
increasing pla2r1 expression in breast cancer cells decreased cell
growth and colony formation .
cell death
was associated with an increase in mitochondrial - mediated reactive
oxygen formation .
in addition , some cancer cells may overexpress pla2r1
in order to inactivate spla2 activity , helping them to
survive under inflammatory conditions .
although the mechanism is not
clear , the expression and effect of pla2r1 in breast and prostate
cancer may differ and suggest further studies are needed .
these data suggest that pla2r1 does not mediate cell
death induced by several different types of chemotherapeutics when
administered as free drug .
the slight increase in cytotoxicity induced
by dox in pla2r1 knockdown cells is somewhat suggestive , but this
was lost when a plasmid control was included ( supporting information figure 4a c ) .
it should be noted
that pla2r1 expression was inhibited in pc-3 cells by approximately
50% compared to control cells .
additionally , the role of pla2r1 in
cell death may be more specific to those circumstances where spla2 is induced , such as inflammation .
finally , it is also possible
that the increase in cell growth induced by pla2r1 inhibition counteracts
any enhanced toxicity that might be seen under the conditions tested
in this study .
we recently showed that sprl are superior
to ssl at inhibiting tumor growth in vivo and in releasing drug payload
in vitro .
we also showed that sprl degradation
was increased in prostate cancer cells exposed to spla2 .
however , subsequent studies investigating
the mechanisms involved suggested that the uptake of liposomes and
drug was independent of enzymatic activity .
the binding of spla2 to pla2r1 is independent of spla2 activity , and this may explain
why ly311727 ( a commonly used spla2 inhibitor ) did not
alter sprl activity in our previous study .
it remains to be seen if spla2 , liposomes , and pla2r1
can indeed form a complex at the cell membrane that undergoes endocytosis .
the fact that pla2r1 inhibition had a minimal effect on the toxicity
of dox - loaded ssl , as compared to that with sprl , correlates to the
fact that pla2r1 inhibition did not alter ssl delivery .
this specificity
may be due to the increased preference of sprl for spla2 , which may increase its preference for pla2r1 .
regardless , these
data suggest that some specificity is inherent in the ability of pla2r1
to mediate liposome uptake , and they further support our previous
findings that sprl behave differently than ssl .
the increase in cytotoxicity
with dox - loaded liposomes required that dox be present in the liposome ,
as pla2r1 inhibition did not increase cytotoxicity when cells were
treated with free , unencapsulated dox .
our data show that inhibition
of pla2r1 increases the expression
of groups iia and x spla2 protein .
the increase in spla2 expression induced by pla2r1 inhibition may facilitate increased
interaction with liposomes and increased delivery .
it should be noted
that group iia spla2 is not believed to bind to human pla2r1
with high affinity .
thus , the increase in group iia
spla2 induced by pla2r1 inhibition is probably not a result
of decreased uptake of this protein .
rather , it is possible that pla2r1
is inducing a signaling pathway that leads to increased group iia
mrna transcription .
another possibility is that increased degradation
of liposomes by spla2 may enhance the release of individual
dio labeled lipids , which may be more rapidly incorporated into cellular
membranes than whole liposomes .
accumulation of spla2 may increase liposomal degradation ,
resulting in faster rates of drug release , greater effective concentrations
of drug outside of the cell , and greater uptake .
this may account
for the increased uptake of dox in pla2r1 knockdown cells seen with
both ssl and sprl formulations .
our previous studies showed that exogenous
spla2 degraded both ssl and sprl , but that sprl were more
sensitive to the effect of spla2 and released dox at a
higher level .
we have shown that the addition
of the 10% of dspe into liposomes enhances their interactions with
spla2 .
this finding is supported
by data in this study , which demonstrate greater increases in dox
release from sprl , as compared to that from ssl , and at earlier time
points .
the most obvious explanation
is that
the loss of pla2r1 decreases spla2 uptake and degradation .
the most obvious explanation is that the loss of pla2r1 decreases
spla2 uptake and degradation , but this is unlikely as neither
group iia or x are believed to be a substrate for human pla2r1 .
however ,
the fact that mrna levels were increased for spla2 group
iia suggests that a transcriptional component may also be involved ,
at least for some isoforms .
it is also possible that pla2r1 acts as
transcriptional suppressor for spla2 group iia .
it is not
known why group iia spla2 mrna levels would be increased
but not group x mrna levels .
the increase in groups iia and x spla2 does correlate to the increase in cell growth in pla2r1 knockdown
cells .
this result is similar to the clinical observation that group
iia spla2 expression is greater in more metastatic and
aggressive prostate tumors . in conclusion ,
this study determined the expression of pla2r1 in
non - cancerous and cancerous prostate cell lines and showed that inhibition
of pla2r1 increased cell growth and the expression of select spla2 isoforms .
these findings
suggest novel roles for pla2r1 in the regulation of spla2 and in the targeting of lipid - based nanoparticles for the treatment
of prostate cancer . | the m - type phospholipase a2 receptor ( pla2r1 ) is a member
of the c - type lectin superfamily and can internalize secreted phospholipase
a2 ( spla2 ) via endocytosis in non - cancer cells .
spla2 itself was recently shown to be overexpressed in
prostate tumors and to be a possible mediator of metastasis ; however ,
little is known about the expression of pla2r1 or its function in
prostate cancers .
thus , we examined pla2r1 expression in primary prostate
cells ( pcs-440 - 010 ) and human prostate cancer cells ( lncap , du-145 ,
and pc-3 ) , and we determined the effect of pla2r1 knockdown on cytotoxicity
induced by free or liposome - encapsulated chemotherapeutics .
immunoblot
analysis demonstrated that the expression of pla2r1 was higher in
prostate cancer cells compared to that in primary prostate cells .
knockdown of pla2r1 expression in pc-3 cells using shrna increased
cell proliferation and did not affect the toxicity of cisplatin , doxorubicin
( dox ) , and docetaxel .
in contrast , pla2r1 knockdown increased the
in vitro toxicity of dox encapsulated in spla2 responsive
liposomes ( sprl ) and correlated with increased dox and sprl uptake .
knockdown of pla2r1 also increased the expression of group iia and
x spla2 .
these data show the novel findings that pla2r1
is expressed in prostate cancer cells , that pla2r1 expression alters
cell proliferation , and that pla2r1 modulates the behavior of liposome - based
nanoparticles .
furthermore , these studies suggest that pla2r1 may
represent a novel molecular target for controlling tumor growth or
modulating delivery of lipid - based nanomedicines . | Introduction
Materials and
Methods
Results
Discussion |
malignant myelomatous pleural effusions ( mpes ) are very rare and occur in < 1% of cases of mm .
since this condition is associated with poor prognosis , an accurate diagnosis of this condition is necessary . in this article ,
we report a rare case of a patient who initially presented with pleural effusion , which was subsequently found to be secondary to mm .
a 63-year - old female presented to the outpatient department of our hospital in december 2014 , with a complaint of feeling increasingly breathless and fatigued over a period of 2 months .
she also complained of right sided chest pain and nonradiating pain in the lower back since a month . on evaluation ,
the chest x - ray revealed a homogenous opacity in the right mid and lower zones [ figure 1 ] .
biochemical analysis of the pleural fluid confirmed that it was exudative in nature ( protein 9.8 g / dl , glucose 4.9 mg / dl , lactate
dehydrogenase 1020 iu / l , adenosine deaminase 69.6 u / l [ ref : 33 u / l ] ) .
the pleural fluid sent for culture , and cytology showed no acid - fast bacilli .
a computed tomography ( ct ) scan thorax was done and showed an ill - defined nodular heterogeneously enhancing lesion in right posterior hemithorax with right sided gross pleural effusion , collapse of right lung , and involvement of the right 4 rib [ figure 2 ] .
fine - needle aspiration cytology ( fnac ) done from the right pleural lesion showed numerous plasma cells , binucleate forms , and few atypical plasma cells [ figure 3 ] .
a cell block was prepared after centrifuging the pleural fluid and immunohistochemistry done on the cell block showed tumor cells positive for cd20 , cd138 , and lambda and negative for leukocyte common antigen , cd3 , cytokeratin , and kappa [ figure 4 ] .
serum electrophoresis showed an m - spike in beta region with elevated serum igg levels ( 3586 mg / dl , ref range 7001600 mg / dl ) .
beta 2 microglobulin level was elevated ( 3.23 mg / l ref : 0.82.2 mg / l ) .
magnetic resonance imaging whole spine was done , and confirmed the presence of a lobulated enhancing soft tissue lesion in the right paravertebral region , measuring 6 cm 8.6 cm , with involvement of the adjacent rib and also intraspinal extension .
ct - guided fnac done from this paravertebral mass showed multiple plasma cells , contributing to the diagnosis of mm . bone marrow aspiration and biopsy showed scattered and < 2% infiltration with plasma cells .
she received palliative radiotherapy of 30 gray in 10 fractions to the t12l2 spine and paravertebral mass .
she was started on vtd regimen with bortezomib , thalidomide , and dexamethasone chemotherapy along with monthly bisphosphonates .
after 6 cycles of chemotherapy , she was symptomatically better , and her chest x - ray showed resolution of the pleural effusion .
computed tomography image plasma cells on cytology low- and high - power view cd20 ( top low- and high - power ) , cd138 ( middle- low- and high - power ) , lambda ( bottom low- and high - power )
in history , mm was first described in egyptian mummies . the word mm was first coined by rustizky in 1873 .
the median age of presentation is 69 years and is more common in men , and increases with advancing age .
patients with mm may be asymptomatic or can usually present with hematologic manifestations such as anemia , bleeding disorders , or bone related problems , infections and other end organ damage like renal failure . in mm , the development of pleural effusion
pleural effusion occurs in around 6% of patients with mm during the course of the disease , while mpe is even rarer presenting in < 1% of patients as reported by kintzer et al .
it is associated with poor prognosis , and there are previous studies with the survival of < 4 months .
mpes may arise from either extension of plasmacytomas of the chest wall , invasion from adjacent skeletal lesions , direct pleural involvement by myeloma ( pleural plasmacytoma ) or also following lymphatic obstruction secondary to lymph node infiltration .
pleural effusions are rarely a direct consequence of the myeloma itself and usually occur due to the concurrent disease process or coexisting illness such as cardiac failure , amyloidosis , pulmonary embolism , pneumonia , or a second malignancy .
reported that about 50% of mm patients accompanied with pleural effusion were due to congestive heart failure .
the other possible mechanisms are a pulmonary embolism , chronic renal failure accompanying mm , and second malignancy .
mpes are most commonly associated with the presence of an iga paraprotein ( in up to 80% of cases ) .
sasser et al . reported 56 cases of mm with the involvement of the serous cavities .
the sites of involvement were mostly the pleural cavity ( thirty cases ) and among them , 50% of the cases with cavitary involvement were of the iga type . in this case ,
this is an important contributory factor for the development of mpes and explains the apparent aggressive nature of myelomatous disease .
this case is distinctive in regards to the direct involvement of the pleural cavity by malignant plasma cells , which was confirmed with the fnac and ihc .
only 11 cases have been described previously , including the present case ( to the best of our knowledge ) .
chemotherapy with various newer drugs such as bortezomib , thalidomide , lenalidomide along with dexamethasone or 2 generation proteasome inhibitors like carfilzomib remains the first - line treatment for mm . in practice , pleural involvement with myeloma cells is associated with an aggressive course which is poorly responsive to first or second - line therapies used in conventional myeloma treatment . in this case , the patient was doing better with vtd chemotherapy and palliative radiotherapy .
this patient was started on treatment early and had igg paraprotein mpe probably indicating better response in these cases .
the occurrence of mpes in mm is rare . it indicates a poor prognosis because of an aggressive natural course .
early consideration of mpes helps in rapid diagnosis and early initiation of treatment which may help in improving prognosis as seen in the present case . | multiple myeloma ( mm ) is a plasma cell neoplasm and constitutes 10% of hematologic malignancies .
malignant myelomatous pleural effusions are very rare and occur in < 1% of cases of mm . in this article , we report a rare case of a patient who initially presented with pleural effusion and was subsequently found to be secondary to mm with an underlying raised igg paraprotein . the patient symptomatically improved and was in partial remission with palliative radiotherapy , vtd chemotherapy , and bisphosphonates . | INTRODUCTION
CASE REPORT
DISCUSSION
CONCLUSION
Financial support and sponsorship
Conflicts of interest |
extubation failure ( the need for re - intubation ) is associated with increased intensive care unit and hospital mortality , increased length of stay in the intensive care unit and hospital , greater need for tracheostomy and for long - term acute care , and increased costs . underlying severity of illness , premorbid health status , and complications directly associated with re - intubation fail to explain the adverse outcomes seen with extubation failure . clinical deterioration between the time of extubation and the re - establishment of ventilatory support
the study reported by lee and coworkers is one of a series of recent investigations examining whether corticosteroids can prevent postextubation upper airway obstruction ( uao ) , which is a common cause of extubation failure .
intubation and the endotracheal tube ( ett ) may cause laryngotracheal injury , resulting in inflammation , mucosal ulceration , edema , or granuloma formation .
this can lead to glottic or subglottic narrowing , which manifests as stridor , respiratory distress , or respiratory failure after removal of the ett .
factors associated with increased risk for postextubation uao include female sex ( probably resulting from small airway size ) , trauma patient , age above 80 years , excessively mobile or overly large ett size , ratio of ett size to laryngeal diameter above 45% , ratio of patient height to tube diameter , duration of intubation , tracheal infection , absence of cough , absence of sedation , low glasgow coma scale score , or excess cuff pressure [ 2 - 5 ] . research into detection of uao , with the ett in place , has recently focused on using the quantitative cuff leak test . during this maneuver
the patient breathes on assist control ventilation , the endotracheal cuff is deflated , and the difference between inspired and expired tidal volume is compared .
an obstructed upper airway results in similar inspiratory and expiratory volumes , whereas a patent airway results in a substantial difference as a large volume of gas escapes around the tube . this quantitative cuff leak can be reported as either a percentage of inspired tidal volume or as an absolute cuff leak volume ( clv ) .
previous investigators have found that the risk for postextubation stridor is increased when clv is less than approximately 12% to 25% of inspired volume or an absolute value of less than 110 to 130 ml [ 2,6 - 9 ] . although previous studies conducted in pediatric patients found that corticosteroids reduce the prevalence of postextubation uao by nearly 40% and may reduce the need for re - intubation , earlier controlled trials in mechanically ventilated adults did not corroborate those findings .
francois and colleagues recently compared 20 mg methylprednisolone ( given every 4 hours for 12 hours before extubation ) with placebo in nearly 700 adults patients who had been intubated for at least 36 hours .
corticosteroid pretreatment was associated with decreased risk for postextubation uao ( 3% versus 22% ) , need for re - intubation ( 4% versus 8% ) , and need for re - intubation secondary to uao ( 0.3% versus 4% ) . the number needed to treat ( nnt ) was eight to prevent one case of stridor and 26 to prevent one case of re - intubation .
cheng and colleagues used a reduced clv ( 24% of inspired tidal volume ) to define and study patients at high risk for postextubation uao .
patients randomly assigned to methylprednisolone ( 40 mg every 6 hours for four doses ) were less likely either to experience stridor ( 7% versus 30% ) or to require re - intubation ( 7% versus 19% ) than were those receiving placebo .
the study reported in this issue of critical care also targeted high - risk patients by examining those ventilated for at least 48 hours and with a clv below 110 ml .
patients were randomly assigned to receive placebo or dexamethasone 5 mg every 6 hours for 24 hours , and were then extubated 24 hours later .
the dexamethasone group was less likely to develop postextubation stridor ( 10% versus 27.5% ; nnt = 5.7 ) without a difference in need for re - intubation ( 2.5% versus 5% ; nnt = 40 ) .
an important observation is that dexamethasone led to a significant increase in clv that persisted for 24 hours after the last dose ( for example , at the time of extubation ) . given that no further improvement in clv occurred after the last dose of dexamethasone , one could argue for immediate extubation at that time rather than waiting an additional 24 hours .
the study by lee and coworkers also revealed that 14 out of 285 in the non - randomized cohort ( 4.9% ) , who had a clv above 110 ml , developed stridor . examining these patients and those randomly assigned to placebo , only 20% with postextubation uao required re - intubation , possibly a result of the effective use of inhaled racemic adrenaline ( epinephrine ) and noninvasive ventilation . among placebo patients , 73%
did not develop postextubation uao , despite a clv below 110 ml ; similar findings have been noted by other investigators .
a falsely low clv may result from secretions adherent to or pooled around the ett .
alternatively , with the cuff deflated , the patient may breathe additional tidal volume around the tube ( in addition to machine delivered volume ) , leading to a falsely low measurement of inspired tidal volume .
this phenomenon can be overcome by delivering the machine breath with the cuff inflated and then deflating the cuff just before expiration .
the evidence is now mounting that corticosteroids can prevent postextubation uao , and possibly the need for re - intubation , but should all patients be intubated for longer than 36 to 48 hours receive such therapy ? although a short course of corticosteroids may be relatively safe , further study is warranted .
this author believes the focus should continue to be on targeting patients at greatest risk .
although the study by francois and coworkers examined an ' unselected ' cohort , the 22% incidence of postextubation uao suggests a high risk group . using
the clv can help to identify a cohort at greater risk , but the sensitivity and specificity of the test is suboptimal . using this test alone to determine need for prophylactic corticosteroids will result in an unnecessary 12 to 24 hour prolongation of intubation for three out of every four such patients .
another approach is to identify first a high - risk cohort based on clinical factors ( for instance , age , sex , tube size , and so on ) and then to apply clv to determine which patients should receive corticosteroids before extubation .
clv = cuff leak volume ; ett = endotracheal tube ; nnt = number needed to treat ; uao = upper airway obstruction . | intubation of the airway can lead to laryngotracheal injury , resulting in extubation failure from upper airway obstruction ( uao ) .
a number of factors can help to identify patients who are at greatest risk for postextubation uao .
three randomized controlled trials demonstrate that prophylactic corticosteroids decrease the risk for postextubation uao and probably the need for re - intubation . | None
Abbreviations
Competing interests |
choriocarcinoma presenting as a pulmonary embolism is extremely rare . because of the rarity of tumors of the pulmonary arteries , these tumors
this paper reports a case of a patient with a choriocarcinoma presenting as a massive pulmonary embolism ( pe ) , who required venoarterial ( va ) extracorporeal membrane oxygenation ( ecmo ) support for bridging to a surgical embolectomy and chemotherapy .
a 22-year - old woman ( gravida 1 , para 0 ) presented at the local hospital complaining of dyspnea .
her menstrual history revealed that she had experienced menarche at age 14 , irregular cycles in the past , and occasional vaginal spotting in last two cycles .
she was treated for pulmonary tuberculosis and pneumothorax with tuberculosis medications and the insertion of a chest tube ; however , her symptoms worsened .
a pulmonary thromboembolism was suspected , and chest enhanced computed tomography ( ct ) showed a filling defect in the left inferior pulmonary artery ( fig .
two weeks after starting treatment with rivaroxaban , the patient presented with aggravated dyspnea and massive hemoptysis and was urgently referred to the emergency department ( ed ) . upon arrival at the ed ,
the patient was afebrile , with a heart rate of 138 beats per minute , blood pressure ( bp ) of 90/80 mm hg , respiratory rate of 18 breaths per minute , and oxygen saturation of 100% in room air .
the chest examination for the breath sounds and auscultation revealed coarse crackles from the right lung and no sounds from the left .
the arterial blood gas levels under oxygen mask inhalation ( 5 l / min ) were as follows : ph , 7.51 ; pao2 , 81 mm hg ; and paco2 , 25 mm hg .
her hemoglobin level was 13.1 g / dl , white blood cell count was 7,520/ml , and platelet count was 273,000/ml .
the d - dimer was 2.72 g / ml , and the troponin level was elevated slightly , at 0.01 ng / ml . her chest radiograph revealed a normal cardiac field , diffuse nodularity in both lung fields , and a pneumothorax with chest tubing in the left lung zone . while repositioning the chest tube into the pneumothorax , she became mentally confused , and the laboratory results showed a partial pressure of oxygen ( po2 ) of 38 mm hg .
she was intubated , started on mechanical ventilation , and admitted to the intensive care unit for further evaluation .
the patient remained hypotensive despite the intravenous fluid boluses that escalated the inotropic infusion with the maximum dose .
an echocardiogram revealed a severe left ventricular systolic dysfunction with an ejection fraction of 29% and a d - shaped left ventricle .
pulmonary angiography was performed and showed a large filling defect in the left pulmonary artery ( fig .
at the site of the main pulmonary artery near its opening to the left pulmonary artery , a whitish tumor embolus was found in the left pulmonary artery .
histologically , the pulmonary tumor embolism specimen revealed a malignancy consistent with choriocarcinoma ( fig .
2 ) . after a diagnosis of choriocarcinoma was made , the serum beta human chorionic gonadotropin ( hcg ) level was measured , and a gynecologic examination was performed .
a metastatic workup revealed no lesions in the liver , spleen , kidney , pelvic cavity , and brain ( international federation of gynecology and obstetrics [ figo ] stage iii , figo prognostic score 6 ) .
although she was under an ecmo insertion state and her platelet level was below 75,000/l , chemotherapy was started with the following conventional regimen after receiving fully informed consent : etoposide , 100 mg / m on days 1 and 2 ; methotrexate , 100 mg / m via intravenous bolus on day 1 and 200 mg / m via intravenous infusion over 12 hours on day 1 ; actinomycin d , 0.5 mg via intravenous bolus on day 1 and 2 ; cyclophosphamide , 600 mg via intravenous infusion on day 8 ; and vincristine , 1.0 mg / m on day 8 ( ema - co ) .
after the initial chemotherapy , her beta hcg level decreased to 2,296 miu / ml , and the ecmo was removed as her heart function was restored .
the second cycle of chemotherapy was postponed because of a poor general condition and grade 4 neutropenia . after a 2-month period of chemotherapy ,
choriocarcinoma is a malignant , gestational trophoblastic neoplasm that can occur after a molar hydatidiform mole , ectopic pregnancy , abortion , and even normal pregnancy .
choriocarcinomas spread hematogenously to the lungs , resulting in pe , pulmonary hypertension , or acute respiratory distress syndrome .
although the prognosis for metastatic gestational choriocarcinoma to the lungs ( stage iii ) is good , the rarity of a pe can result in a misdiagnosis , and the patient might be treated for more common diseases , such as pneumonia and tuberculosis . in the present case
, the patient also was diagnosed incorrectly with tuberculosis and a venous pulmonary thrombosis . in the case of fertile women presenting with dyspnea , cough , and hemoptysis , it is essential to have a suspicion of a tumor embolism .
watanabe et al . emphasized the importance of considering choriocarcinoma and measuring the serum beta hcg levels when evaluating fertile women presenting with pulmonary emboli or pulmonary artery hypertension .
therefore , it is recommended that the serum beta hcg level be performed as a diagnostic test in women of reproductive age to differentiate the causes of a pe .
patients presenting with massive pe complicated by right ventricular failure and cardiogenic shock have high short - term mortality ( > 25% ) .
the hemodynamic instability hinders a clinical evaluation including chest ct scan and pulmonary angiography . with regard to treatment , urgent
thrombolysis or surgical approach is mandatory ; however , these treatments might be limited because of refractory hypoxia and shock .
va ecmo could be an optional strategy in a patient with a massive pe as a bridge to further diagnostic work - up and therapeutic interventions .
chowdhury et al . reported the use of va ecmo as an adjunct to thrombolytic therapy for progressive circulatory collapse secondary to a massive acute pe .
as in other cases , the patient remained hypotensive despite intravenous fluid boluses , in which inotropic infusion was escalated escalating to the maximum dose . to perform diagnostic workup and therapeutic interventions , such as embolectomy and pulmonary angiogram ,
ecmo is essential to maintain hemodynamic stability . to the best of the authors knowledge ,
only a few cases of a pulmonary embolectomy to remove tumor emboli from choriocarcinoma have been reported . on the other hand , this is a rare case of a patient with a metastatic gestational choriocarcinoma who presented with a pulmonary artery tumor embolism by employing ecmo and pulmonary embolectomy followed by chemotherapy . according to worku et al . , a patient with lymphoma developed cardiogenic shock at the time of chemotherapy initiation .
ecmo was instituted to restore the hemodynamic stability , and to bridge the patient to chemotherapy until the tumor burden could be reduced effectively . in this study ,
generally , chemotherapy is not recommended routinely in a patient under ecmo because of its adverse effects , such as neutropenia or thrombocytopenia . despite this
, the choriocarcinoma responded very well to the chemotherapeutic agent initiated , and the patient under va ecmo responded positively , with serum beta hcg falling to within the normal levels .
therefore , although the prolonged use of ecmo would increase the risk of morbidity , including thrombotic and hemorrhagic complications , its adequate application allows the patient to achieve benefits as an effective bridging therapy , while minimizing complications .
these results suggest that although metastatic gestational choriocarcinoma is rare , it should be considered in a differential diagnosis of fertile women presenting with a massive pe . in addition , ecmo may be used as an adjunct to bridge to embolectomy and chemotherapy as soon as possible in a patient with hemodynamic instability , because of the potential for a good response of the choriocarcinoma to the chemotherapy . | a 22-year - old woman with a 1-month history of shortness of breath that was treated as a case of tuberculosis and pulmonary embolism was referred to the authors hospital .
because of the hemodynamic instability in this patient , venoarterial extracorporeal membrane oxygenation ( ecmo ) was administered in the intensive care unit .
she underwent a pulmonary embolectomy for the treatment of progressive circulatory collapse secondary to a pulmonary embolism .
the histopathologic result was consistent with a metastatic choriocarcinoma . despite the surgical management , persistent refractory cardiogenic shock occurred .
subsequently , the patient was treated with chemotherapy in the presence of ecmo and responded well to chemotherapy .
she was discharged after 3 months .
this case suggests that metastatic choriocarcinoma should be considered as a differential diagnosis in women of childbearing age presenting with a pulmonary embolism , and ecmo may be beneficial in patients with pulmonary embolism for bridging to surgical embolectomy and chemotherapy . | Introduction
Case Report
Discussion |
pms is defined as the periodical recurrence of a set of annoying physical , psychological , and social symptoms in the luteal phase of menstrual cycle .
millions of females worldwide experience this disorder in their reproductive ages ( 3 ) . the relative prevalence rate of pms and premenstrual dysphoric disorder is reported to be between 98.5% and 2.8% , respectively ( 4 ) .
the prevalence of this syndrome varies from 60% to 80% in the asian countries ; 66.6% in turkey ( 5 ) , 76% in china ( 6 ) , and 63.1% in malaysia ( 7 ) .
american college of obstetrics and gynecology ( acog ) reported the prevalence of this syndrome 65.5% , with 8.75% of the patients requiring specialized treatments ( 8) . in iran , it is estimated that 98.2% of university female students experience at least one of the pms symptoms at age of 18 - 27 years old ( 9 ) . sometimes the physical and mental symptoms of pms are so severe that need to be treated ( 10 , 11 ) .
the etiology of pms and dysphoric disorder are unknown , but they are considered multi - factorial resulting from internal and external factors ( 12 ) .
biological , physiological , environmental , and social factors are also reported to be involved in the disorder ( 13 ) .
although the causes of this disorder are still unknown , research demonstrated that supportive strategies , such as writing the symptoms down , might be beneficial in diagnosis and management of the disorder .
moreover , changing lifestyle ( healthy diet , vitamins , mineral supplements , primrose oil , restricting use of sodium and caffeine , reduction of stress , and doing sports ) ( 2 ) , hormone therapy ( estrogen , oral contraceptive pills , gnrh analogues , danazol and progesterone ) , diuretics , anti - depressants , bromocriptine , surgery , psychotherapy , and serotonin reuptake inhibitors ( sris ) are proposed as the first line treatments in this regard ( 14 ) . besides , fluoxetine , paroxetine , and sertralin
however , side effects of pharmacological treatments are mentioned in some studies ( 15 - 19 ) . in the past decades ,
complementary and alternative methods such as homeopathy and herbal medicine were frequently used in alleviation of the pms ( 11 , 20 - 23 ) symptoms .
a study performed in iran , investigated the effects of aquatic extract and essence of m. officinalis and reported that this plant has anti - depression and sedative effects ( 24 ) .
although more than 100 chemical compounds have been identified in m. officinalis , its main components include citral , linalool , geraniol , -caryophyllene oxide , phenolic acid , tannins , rosmarinic acid and caffeic acid .
melissa officinalis can be effective to improve cognitive function and its effect is similar to that of triazolam ( 25 , 26 ) .
several studies are conducted on pms in iran . however , most of them focused on the prevalence of premenstrual symptoms and dysphonic ( 27 ) , types of symptoms ( 28 ) , efficacy of stress management or counseling to reduce symptoms ( 29 ) .
however , less attention is paid to treatment and a few herbal surveys exist on the treatment of pms in iran .
nonetheless , due to the sedative effects of m. officinalis , this question comes to mind that can melissa officinalis be used to treat pms symptoms ?
the current study aimed to investigate the effect of m. officinalis capsule , as a substitute for chemical medicines , on the intensity of menstrual cycles in high - school girl students in shiraz , iran .
the current double - blind randomized clinical trial was conducted on 100 high school girls during 2013 - 2014 .
sample size was calculated based on the results of a study that used crocus sativus l. ( saffron ) to treat pms ( 20 ) .
considering the effect size of 2 ( reflecting the difference between the two groups ) , standard deviation ( sd ) of 1.3 , type i error probability of 5% , power of 0.9 , it was estimated that 42 subjects were needed in each group . yet , considering a possible attrition rate of 20% , 50 subjects were recruited in each group .
the study subjects were selected through random cluster sampling . at first , under the supervision of the department of education ,
four girl high schools ( including 800 students ) were selected from the four educational districts of shiraz , iran .
then , in each high school , the students with symptoms of pms were invited to take part in the study among which , considering the inclusion criteria , 100 subjects were selected and then randomly allocated into the intervention ( n = 50 ) and the placebo groups ( n = 50 ) .
the inclusion criteria were willing to participate in the study , being a high school student , obtaining a score < 23 from the general health questionnaire ( ghq ) , gaining a score > 20 from the premenstrual syndrome screening tool ( psst ) , not using vitamin supplements during the study , not having used hormonal drugs such as oral contraceptive pills at least two months prior to the study , length of menstrual cycle between 24 and 35 days , not suffering from other diseases such as thyroid , diabetes and mental disorders .
the exclusion criteria were a decision to withdraw from the study , parents request for exclusion of their child from the study , experiencing a stressful event such as death , marriage , or surgery during the study , experiencing a change in the intervals of menstrual cycles for less than 24 and more than 35 days , and experiencing changes in the length of menstrual cycles for less than three and more than seven days .
melissa officinalis capsules were made in the pharmacology department in the shiraz medical school under the supervision of a professional counselor .
moreover , the placebo was prepared from starch in capsules similar to m. officinalis . to keep the study blind ,
the drug and placebo were marked with codes 1 and 2 and only the specialized consultant knew about the drugs .
a self - report questionnaire was designed consisting of demographic characteristics , the ghq-28 questionnaire , and the premenstrual syndrome screening tool ( psst ) .
the ghq-28 consists of four subscales including somatic symptoms ( items 1 - 7 ) , anxiety / insomnia ( items 8 - 14 ) , social dysfunction ( items 15 - 21 ) and severe depression ( items 22 - 28 ) .
all items are responded on a 4-point likert scale of none , mild , moderate , and severe which are scored from zero to three .
the score 23 or above was the cut - off point for probability of having a mental health disorder ( 30 ) .
the farsi version of ghq-28 questionnaire was validated by yaghoubi , as cited in ozgoli et al . and its sensitivity and specificity
the first and second sections includes 14 items on physical , and psychological symptoms , and the third section contains five items that assesse the effects of symptoms on subject s life ( social symptoms ) ( 32 ) .
all items are responded on a four options likert scale namely none , mild , average , and severe , receiving a score from zero to three , respectively .
scores ranging from 0 - 19 , 20 - 38 , and 39 - 57 represented mild , average , and severe conditions , respectively .
the content validity ratio and content validity index of this scale were obtained as 0.7 , and 0.8 , respectively . moreover ,
the reliability of the scale was confirmed by a cronbach s alpha of 0.9 ( 8) .
subjects in the intervention group were required to consume 1200 mg m. officinalis essence daily ( two 600 mg capsules ) from the first to the last day of their menstrual cycle for three cycles . in the control group ,
the first researcher called the subjects in both groups at least 3 - 4 times to guide them and explain about consumption of the medication .
all subjects in the two groups were required to complete the psst questionnaire at the beginning of the study and then in three consecutive months ( three menstrual cycle ) .
the protocol of the study was approved by the ethics committee of shiraz university of medical sciences .
they were all assured of the confidentiality of their personal information . in order to prevent any probable error ,
moreover , subjects in the intervention group were allowed to withdraw from the study at any time .
paired t - test was used to compare the changes of pms scores in each group before and after the intervention .
moreover , the repeated measures anova was used to compare the severity of symptoms in the two groups during the four subsequent measurements .
subjects in the intervention group were required to consume 1200 mg m. officinalis essence daily ( two 600 mg capsules ) from the first to the last day of their menstrual cycle for three cycles . in the control group ,
the first researcher called the subjects in both groups at least 3 - 4 times to guide them and explain about consumption of the medication .
all subjects in the two groups were required to complete the psst questionnaire at the beginning of the study and then in three consecutive months ( three menstrual cycle ) .
the protocol of the study was approved by the ethics committee of shiraz university of medical sciences .
they were all assured of the confidentiality of their personal information . in order to prevent any probable error ,
moreover , subjects in the intervention group were allowed to withdraw from the study at any time .
paired t - test was used to compare the changes of pms scores in each group before and after the intervention .
moreover , the repeated measures anova was used to compare the severity of symptoms in the two groups during the four subsequent measurements .
the mean age of the participants was 16.2 1.06 years in the intervention group and 16.3 0.66 years in the placebo group .
the two groups were homogeneous with respect to age ( p = 0.32 ) , education level ( p = 0.83 ) , and body mass index ( bmi ) ( p = 0.42 ) . the results of repeater measures anova showed that the mean ( sd ) of symptoms in the intervention group was 42.56 15.73 before , 30.72 13.24 one month after , 30.2 12.08 two months after , and 13.90 10.22 three months after the intervention , and the differences were statistically significant ( table 1 ) .
data are presented as mean sd . the results of paired t - test showed that the intensity of physical symptoms significantly decreased in the subjects who consumed the capsules of m. officinalis ( p < 0.001 ) , but no significant difference was observed in the placebo group in this regard .
the results of the paired t - test also indicated a significant decrease in psychological and social symptoms of the subjects in the intervention group .
however , no significant difference was found in the control group in this respect ( p < 0.001 ) ( table 2 ) .
the study results revealed a significant difference between the two groups regarding the total intensity mean of physical , psychological and social symptoms of pms in the first , second and third months after the intervention .
of course , in the control group there was also a decrease in the severity of symptoms .
no previous studies were available on the effect of m. officinalis on the intensity of pms ; however , the effects of other herbal products were investigated on anxiety , depression , sleep disorder , stress and other symptoms of pms ( 21 , 22 , 31 , 33 ) .
moreover , taiwo et al . investigated the effect of m. officinalis on mice and showed the positive psychoactive potentials of this herb ( 34 ) .
another study indicated the effectiveness of m. officinalis in reduction of restlessness and insomnia in children ( 35 ) .
another study also reported m. officinalis as a mediator of mood and cognitive function with anxiolytic effects ( 36 ) .
melissa officinalis leaves have also been shown to have anxiolytic and spasmolytic properties ( 37 ) .
the results of the above studies are similar to those of the current study in reducing psychological symptoms and mood changes .
still no blood or biochemical test is available to diagnose this disorder ( 38 ) .
the main mechanism of pms is perhaps related to the level of serotonin ( 39 ) .
although there is no evidence in favor of hormonal disorders in this syndrome , since its symptoms can begin at the beginning , middle , or end of the luteal phase , it might be attributed to the progesterone produced by ovaries .
overall , gabaergic and serotonergic neurotransmitter systems and reduction of serotonin are involved in the occurrence of these symptoms ( 40 , 41 ) .
some studies investigated the effects of herbs such as crocus sativus ( 20 ) and hypericum perforatum ( 21 ) on the symptoms of pms and reported that these herbs probably affected the reduction of pms symptoms through increasing the level of circulating serotonin .
some studies also revealed that m. officinalis can reduce the symptoms of pms through gaba neurotransmitters ( gamma - aminobutyric acid , gabaergic system ) .
gaba neurotransmitters have great inhibitory effects on the central nervous system and are essential to create balance between nervous stimulation and suppression in brain s normal function .
it is reported that the brain s gaba levels are highly associated with anxiety ; in such a way that benzodiazepines used as sedatives in the past decades imitate gaba .
these medications result in sedative and anxiolytic effects through binding to gabaergic receptors and changing other neurotransmitters of brain , such as norepinephrine and serotonin ( 42 , 43 ) .
review of the studies performed on treatment of pms demonstrated that some of the herbs could , to some extent , decrease the symptoms of this disorder .
however , which herb is more effective , efficient , and cost - effective , and which mechanisms are involved in the effects yet remains to be determined .
thus , further studies are recommended to compare other plants to m. officinalis to confirm the results of the present study and find an answer to the above - mentioned questions .
one of the limitations of the current study was its small sample size and its implementation in high school girls . moreover , the placebo group also experienced some reductions in their symptoms that might be attributed to the psychological effects of placebo .
a self- report questionnaire was used to assess the symptoms and this may affect the students responses . furthermore , the subjects of the present study were at different stages of puberty and , consequently , did not experience the changes related to this period similarly . also , individual differences in learning ability and interest might have affected the participation in the adoption of plans . therefore further studies with larger sample size , among older females from different levels of the community , and also studies without a placebo are suggested . in conclusion
, the results of the current study showed that m. officinalis capsules were effective to reduce the intensity of pms symptoms . yet
, this plant is recommended to be compared to other herbal medicines and its degree of effectiveness should be assessed up to several months after the intervention . | background : several studies are conducted on premenstrual syndrome ( pms ) .
however , a few herbal surveys exist on the treatment of pms in iran . due to the sedative effects of melissa officinalis ( m. officinalis ) , this question comes to mind that can it be used in the treatment of pms symptoms?objectives : the current study aimed to assess the effect of m. officinalis capsule on the intensity of pms in high - school girls.materials and methods : a double - blind randomized , placebo - controlled trial was performed on 100 high school girls from 2013 to 2014 . the intervention group ( n = 50 ) received 1200 mg of m. officinalis essence daily from the first to the last day of their menstrual cycle for three consecutive cycles . the second group ( n = 50 ) received the placebo .
the premenstrual symptoms screening tool was used to assess the intensity of pms symptoms in the two groups before and one , two , and three months after the intervention .
the data were analyzed using paired t - test and repeated measures analysis of variance.results:the results of repeated measures test revealed a significant reduction ( p < 0.001 ) in pms symptoms .
overall , the mean score of pms intensity in the intervention group was 42.56 + 15.73 before the intervention and changed to 32.72 13.24 , 30.02 12.08 , and 13.90 10.22 at the three consecutive months after the intervention , respectively ( p = 0.001).conclusions : m .
officinalis capsules were effective in reduction of the pms symptoms . yet ,
application of this medication requires further investigations . | 1. Background
2. Objectives
3. Materials and Methods
3.1. The Procedure
3.2. Ethical Considerations
3.3. Data Analysis
4. Results
5. Discussion |
despite the diffusion of effective care bundles and the implementation of new technologies able to support organ function , severe sepsis and septic shock still represent a leading cause of intensive care unit ( icu ) admission with a case fatality rate of 3040% [ 1 , 2 ] .
systemic inflammation , surrounding multiorgan failure and septic shock , results from a maladaptive unbalance between early antimicrobial immune reactions and uncontrolled local infection and inflammation .
innate immune system is the primitive first - line organism 's response to invasive pathogens , and it interacts with other homeostatic patterns , including inflammation and coagulation .
early activation of immune response is mediated by soluble pattern recognition molecules that , in addition to complement proteins , cytokines , and coagulation factors , activate humoral and cellular effectors , identifying and neutralizing the invasive pathogen .
mannose - binding lectin ( mbl ) is a soluble pattern recognition molecule which activates the lectin pathway of the complement system and the subsequent inflammatory mechanisms [ 4 , 5 ] .
low mbl plasmatic levels , mainly due to genetic influences , have been largely described to be associated with susceptibility to invasive infections and poor outcome . on the other hand
, the excessive activation of this ancient protective system may be responsible for a detrimental unbalanced inflammatory and coagulation response , as observed in inflammatory diseases , transplant rejections , and diabetic nephropathy .
many authors have investigated whether mbl may influence the susceptibility to common pathogens and the development of severe infections , but , still , there is no consensus about the clinical relevance of its deficiency or the indications for replacement therapies .
the purpose of this review is to summarize the results of relevant recent studies where the role of mbl in severe sepsis and septic shock has been investigated .
mannose - binding lectin is a serum calcium - dependent protein , synthesized by the liver and is detectable in the sites of inflammation , particularly in epithelial - lining fluid .
small amounts of this protein are also produced in other organs ( kidney , thymus , tonsil , small intestine , and vagina ) .
mbl is a collectin ( collagen - like lectin ) and is characterized by a high - ordered oligomeric structure that is essential for its function and interaction with mbl - associated serine proteases ( masps ) [ 8 , 9 ] .
mbl harbors a carbohydrate recognition domain ( crd ) through which it binds to specific carbohydrates ( i.e. , mannose or n - acetylglucosamine ) exposed on pathogenic agents surface , and it is therefore called a pattern - recognition molecule . subsequently masps ( mainly masp-2 ) are able to trigger the lectin complement pathway cleaving c4 and c2 to form c3 convertase .
complement system may be activated by three pathways : the classic and the alternative ones are antibody dependent and belong to the adaptive immune response ; the lectin one is antibody independent and , as part of the innate immune system , comes into play within the first 12 hours from microorganisms ' contact ( figure 1 ) .
mbl plays a central role as a first - line defense against invading pathogens by triggering complement system , directly mediating opsonophagocytosis , and possibly functioning as a toll - like receptor coreceptor . in humans
there are two genes that might code for mbl , but only mbl2 gene is functional , located on the long arm of chromosome 10 .
mbl deficiency may be due to the presence of single nucleotide polymorphisms ( snp ) either in the gene - coding or in the promoter regions .
the wild - type gene is called a ( homozygous haplotype , a / a ) ; instead the variants alleles are widely classified as 0 ( 0/a and 0/0 ) .
three points mutations involve the exon 1 , identifying allele b ( codon 54 ) , c ( codon 57 ) , and d ( codon 52 ) .
additionally , many snps may affect the promoter region and determine low mbl protein serum levels and activity ( variants
h / l , y / x , and p / q ) . even though all these mutations could be combined with exon 1 alleles , seven haplotypes are typically found in humans genome [ 13 , 14 ] .
these polymorphisms determine the production of unstable proteins , with shorter half - life , mainly due to the absence of the high - ordered oligomeric structure .
healthy individuals ( genotype a / a ) generally present mbl levels above 1000 ng / ml . in the newborn this protein is detectable at concentrations of two - thirds of their mothers .
mbl levels are not influenced by age , circadian cycle , and physical exercise and , during inflammation , do not increase over 3 - 4 folds than baseline level .
mbl deficiency is generally defined by plasmatic protein levels below 500 ng / ml or by an mbl function lower than 0.2 u/l c4 deposition .
some authors have reported bronchoalveolar lavage ( bal ) levels ranging between 20 and 80 ng / ml , but these results were not corrected for dilution factors ( i.e. , urea or other lung proteins with known lung concentration ) that could explain the large distance from the minimum concentration needed to activate complement proteins ( 300 - 400 ng / ml ) .
plasmatic levels ranging between 500 and 1000 ng / ml are generally detected in heterozygous patients ( a / o genotype ) ; instead homozygous variant mbl2 alleles usually present very low concentrations ( < 50 ng / ml ) .
similarly the haplotypes that include mutations in promoter regions are associated with significant reduction of mbl protein production and activity . however , even though the degree of mbl deficiency is strictly dependent upon patients ' genotypes , in some cases low mbl plasmatic levels have been also associated with wild - type genes .
this gene was already present in early invertebrates more than fifty million years ago and has been highly conserved throughout animal and human evolution .
this would suggest that the correct function of mbl protein is crucial for the survival of living animal species .
it is of interest to note that there is geographic distribution of different alleles : the b variant is predominant in eurasian populations , the c variant mainly among asians and america indians , and the d haplotype seems to be frequently expressed in caucasian region .
this particular distribution might be linked to the initial human migrations out of africa and induced by some specific advantages due to mbl deficiency .
for example , high mbl production has been observed to be associated with higher incidence of preterm births ; instead moderately low levels could protect the organism from mycobacteria systemic infection and from the complement induced inflammatory - mediated damage of some diseases ( i.e. , meningococcemia and rheumatoid arthritis ) [ 20 , 21 ] . additionally sporadic reports have not found a clear association between mbl deficiency and increased rate of infectious episodes [ 2224 ] .
the wide range of clinical effects linked to mbl haplotypes has also been attributed to the role of associated mutations in other genes encoding proteins with similar functions ( i.e. , l - ficolin , masp2 , and surfactant proteins ) [ 25 , 26 ] .
however , to date , there are few data upon the clinical role of these combined deficiencies .
the prevalence of mutations in one or both mbl2 gene alleles is relevant , ranging between 30% and 40% in analyzed populations [ 13 , 27 ] . during the last twenty years
an increasing body of evidence has indicated that mbl deficit , due to specific haplotypes , generally increases frequency and severity of infectious episodes [ 28 , 29 ] ( table 1 ) .
however the structure of our immune system is redundant , and this may explain why in many cases polymorphisms of mbl2 gene were not observed to influence susceptibility to infections .
the role of this lectin is particularly relevant when adaptive immune system is immature or compromised . in a case - control study upon 47 infants ,
lower mbl cord blood concentrations were associated with a higher incidence of gram - negative sepsis ( p = 0.036 ) , and an observational cohort study upon 100 pediatric icu patients identified mbl2 gene exon 1 polymorphisms as a main determinant of progression from sepsis to septic shock . additionally , the incidence and outcome of severe infections appear to be influenced by the levels and activity of mannose - binding lectin . in a cohort of leukemic patients undergoing chemotherapy , severe infections ( bacteremia , pneumonia or both ) occurred more frequently in those individuals with lower mbl concentrations ( p < 0.001 ) . in an ethnically homogeneous english population ,
homozygotes for mbl codon variant alleles showed a significantly higher risk of invasive infections due to streptococcus pneumoniae , the captain of men of death .
similarly allelic variants of this gene seem to be associated with increased susceptibility to meningococcal disease . among respiratory tract infections , independently from the causal pathogen , mbl insufficiency has been observed to predispose to higher severity and poor outcome . even though legionella spp .
act as an intracellular pathogen , mbl function was lower in infected cases during an australian legionnaires ' disease outbreak . increased susceptibility and worse outcome in 212 caucasian patients with acute respiratory distress syndrome ( ards )
regarding viruses , in chinese population , the presence of mbl2 gene b variant was associated with increased risk of coronavirus infection [ 39 , 40 ] ; instead normal mbl function seems to worsen pandemic h1n1 and avian h9n2 infections by potentially upregulating inflammatory response .
furthermore , in a recent large retrospective study involving 102 donor - recipient orthotopic liver transplantation pairs , patients who received mbl - deficient livers showed a threefold increased risk of clinically significant infections including cytomegalovirus - related diseases .
polymorphisms of this gene were observed in seven of ten white patients with chronic necrotizing aspergillosis compared with 25% of controls . in addition variations of mbl
mbl genetic , plasmatic , and functional profiles were investigated in numerous clinical settings obtaining different results .
the critically ill patient , affected by severe infections with severe sepsis and septic shock , might be a field of particular interest for a better knowledge of their clinical relevance and the possible development of novel therapeutic strategies .
mannose - binding lectin is not only part of the innate recognition system of invasive pathogens but effectively modulates the cytokines ' production by macrophages during phagocytosis .
this effect , upon interleukin ( il)-6 , il-1 , and tumor necrosis factor- , was clearly shown in an
mbl deficiency may be associated with unbalanced proinflammatory responses to infective and noninfective triggers . in a cohort of critically ill pediatric patients ,
fidler and coworkers observed that mbl levels less than 1000 ng / ml , consistent with mbl-2 gene exon 1 polymorphisms , significantly increased the risk of developing systemic inflammatory response syndrome ( sirs ) and progression to severe sepsis / septic shock . additionally in patients with sirs , mbl insufficiency degree was observed to correlate with severity of systemic infection , according to the genetic profile .
the association between the deficiency of this protein and worse outcome during severe systemic infections ( i.e. evolution to refractory septic shock ) may be also related to the significant interaction between complement activation , inflammatory cytokines ' storm , and coagulation cascade .
many studies have shown how the classical and alternative pathways are activated during septic shock and are involved in mechanisms aimed to clear endotoxin .
this role has been more recently studied also for lectin complement activation due to mbl [ 47 , 48 ] .
disseminated intravascular coagulation ( dic ) may worsen the course of septic shock but the occurrence of this severe complication is unpredictable .
however recent data suggest that mbl deficit may be a significant risk factor for the early development of dic and organ failure during severe infections .
conversely , excessive mbl expression might be harmful , since this molecule may contribute to the pathogenesis of inflammatory induced vascular damage and organ failure , as observed in patients undergoing solid organ transplantation .
hence mbl , due to its pivotal role in the crosstalking among complement activation , coagulation , and systemic inflammation , may represent a key point for the understanding of the development of systemic severe infections , as interestingly investigated in animal models and clinical studies involving patients with severe sepsis / septic shock . even though many differences between animal models and humans limit the translationalability of preclinical data , several mouse experiments support the role of mbl deficiency in severe infections , especially after bacteria inoculation .
two functional mbl genes exist in the mouse , and the generation of double knockout gene - deficient mice has increased the investigations in this field .
after inoculation of 5 10 cfu staphylococcus aureus , mbl - null mice showed at 48 hours 100% mortality compared with wild - type ( wt ) mice which survived in a percentage of 55% .
additionally , pretreatment of mbl - null mice with rhmbl increased their survival rate of about 50% . in another model of mbl and/or masp 1/3 deficient mice takahashi and coworkers observed that this deficiency was associated with early occurrence of dic and liver injury after s. aureus inoculation , suggesting the role of this protein in the development of organ failure and systemic coagulation activation during severe infections .
another study demonstrated that mbl is able to strongly bind to o - antigen region of lps , contributing to mice platelets activation and rapid occurrence of septic shock .
all mbl - null mice , after burn and bacterial inoculation , early developed septic shock and died ; instead the majority of wt animals ( two - thirds ) survived .
these observations underline the relevance of innate immunity and mannose - binding lectin in the susceptibility and outcome of severe bacterial infections occurring in this population . regarding fungal diseases , the protective role of this lectin
was also observed in murine models of invasive pulmonary aspergillosis after ex vivo mbl administration .
some authors have observed how deficient mice models , without the capability to activate mbl - independent lectin cascade ( i.e. , ficolins and other collectins ) , are more susceptible to develop severe systemic pneumococcal infections .
although most of literature evidence obtained by animal studies supports the importance of mbl in the acquisition and outcome of severe infections , these observations , due to unresolved several limits of animal studies , may not be considered conclusive and strongly need clinical human studies to definitely identify its clinical relevance .
the mbl key role as part of innate immunity is the reason why haplotypes associated with its deficiency mainly influence infectious episodes involving neonates and children or immunosuppressed adults . in a population - based prospective study performed in greenland upon almost 300 eskimo children , both heterozygous and homozygous subjects , aged 6 to 17 months , for variant alleles
additionally , capoluongo and colleagues , analyzing 75 preterm newborns , identified two mbl2 gene variants as independent risk factors associated with unfavorable outcome , including higher bronchopulmonary dysplasia prevalence .
turkish authors have investigated the possible relationship between cord blood mbl levels and neonatal sepsis .
the results indicated that lower mbl levels during fetal inflammatory response syndrome ( firs ) were associated with higher risk of sepsis development independently from gestational age and birth weight . another prospective study conducted on 62 neonates ( 27 of them were preterm ) showed how lowest mbl levels were detected in infants with septic shock , especially in case of fatal outcome ( p < 0.05 ) .
relevant sensitivity , specificity , positive , and negative predictive values for detecting sepsis episodes were also documented .
in a recent swiss investigation , mbl levels were detected in cord blood of 141 newborns .
forty - seven developed sepsis ( 28% within the first 72 hours of life ) and 13% required catecholamines because of septic shock . after excluding those infants who underwent surgery ,
low mbl concentrations resulted independently being associated with increased risk of early - onset gram - negative sepsis . in pediatric oncological patients , mbl deficiency was associated with susceptibility , poor outcome , and duration of febrile neutropenic episodes . in a prospective study mbl deficit was observed to increase the severity of disease during pediatric icu admission after febrile neutropenia .
additionally also mbl - related proteins deficit was investigated in this setting . in a cohort of 94 children treated with chemotherapy for cancer , masp-2 deficit ( < 200 ng / ml ) significantly increased the risk of febrile neutropenia and bacteraemia development and prolonged cumulative duration of hospitalization and antimicrobial treatment .
the importance of mbl function during the first months of life , when the efficacy of innate immunity is crucial , has induced some authors to propose its dosing as part of a biomarkers panel for the early detection of severe neonatal infections in low - resource settings
. impaired innate immune mechanisms may also increase the risk of nosocomial infections in critically ill patients as observed by sutherland and colleagues . in a genetic association study , the authors identified the relationship between snp in cd 14 , mbl and toll - like receptor-2 with increased prevalence of positive cultures and sepsis . in a cohort of 195 adult septic patients ,
mbl deficiency resulted also independently being associated with higher sequential organ failure assessment ( sofa ) score at day 3 , suggesting its role as a risk factor for the development of severe sepsis and septic shock . additionally in a multicenter prospective study involving eight adults icus in u. k. , the association between mbl-2 exon and promoter polymorphisms with the outcome of 174 patients affected by severe
compared with healthy subjects , mbl deficient patients were at increased risk of sepsis , with a significant higher mortality rate in presence of levels below 1000 ng / ml ( 47.2% versus 22.2% , p = 0.05 ) . during severe sepsis and septic shock , the increase of mbl plasmatic levels , as acute phase response molecule , may be different . in a report of 128 adult critically ill patients , dean and
colleagues observed that regardless of mbl-2 genotype those patients who were mbl deficient at study entry were not able to reach normal plasmatic levels during severe sepsis and septic shock .
furthermore , a well - conducted prospective study , performed in denmark , investigated the mbl genetic and plasmatic profile in a population of 272 critically ill icu patients with documented sirs . among enrolled patients 172 met the criteria for severe sepsis and 70 for septic shock . compared with noninfectious sirs , these patients shared the carriage of mbl variants alleles and low serum levels according to the severity of disease ( p = 0.03 ) .
another recent korean study in icu patients investigated whether mbl2 gene polymorphisms and serum levels might influence severity and prognosis of sepsis .
the authors compared 26 septic patients with 398 healthy controls , analyzing three snp and dosing mbl serum levels on day one . among sepsis group ,
homozygosis for the polymorphism at codon 54 ( a / a ) resulted in a significant risk factor for severe sepsis development ( p = 0.001 ) .
mbl serum levels 1.3 mcg / ml were associated with a lower 28-day mortality rate in the septic shock group ( p = 0.02 ) .
the role of mbl deficiency in critically ill patients with severe pneumonia , a still leading cause of death due to an infectious disease , has been investigated by many authors . in a large case - control study , 848 patients affected by community - acquired pneumonia ( cap ) were compared with 1447 healthy control subjects and 519 patients without relevant infectious diseases .
mbl2 and masp2 haplotypes were equally distributed among those subjects . in the multivariate analysis , mbl deficiency was associated with poor outcome measures ( i.e. , severe sepsis , acute respiratory failure , multiorgan dysfunction syndrome , and death ) .
eisen and colleagues have reanalyzed data from six studies involving 675 patients affected by severe infections .
first , the authors defined a mbl cutoff value of 0.5 mcg / ml as a reliable predictor of low producing status ( negative predictive value 98% ) .
they confirmed that mbl deficiency significantly increased the risk of death due to severe infection , also in icu setting , especially when streptococcus pneumoniae was the invasive causative agent ( odds ratio 5.6 , 95% confidence interval , 1.2724.3 ) .
the association between mbl deficiency and s. pneumoniae invasive infection outcome has been recently investigated in a spanish prospective cohort study . during the study period
117 patients with invasive pneumococcal infection were enrolled : the rate of allelic variants was 32% .
snp mbl2 ( ao / oo ) and septic shock were the factors independently associated with in - hospital mortality .
otherwise early adequate antibiotic dose 4 hours resulted in a significant protective determinant .
mbl deficiency role was also studied in some other systemic infections due to specific organisms .
resman and colleagues recently described the case of a necrotizing myositis and septic shock due to haemophilus influenzae in a patient where igg3 and mbl deficiency were diagnosed . in a well - conducted prospective study ,
the correlation between mbl2 gene polymorphisms and the outcome of escherichia coli pyelonephritis was investigated .
although no association was found with the incidence of e. coli infections and the presence of bacteremia , those patients who shared low - expression mbl2 genotypes showed a significant higher risk of septic shock development ( odd ratio : 9.1 , 95% confidence interval : 1.2365.9 ; p = 0.03 ) . finally , in nonbacterial severe systemic infections , invasive candidiasis ( ic ) , especially candidemia , still remains a leading cause of death due to infections in critically ill patients .
serum mbl levels were measured in 68 patients with proven ic , 82 hospitalized not infected patients , and 70 healthy subjects .
even though mbl concentration was significantly higher in ic patients than controls , the authors identified a marked decrease in its plasmatic levels during the first days of infection in association with mannans increase .
these observations , although limited , suggest a crucial role of mbl also in the early phase of candidiasis .
apart from genetic analyses , antigenic measurement is widely diffused as diagnostic test . even though mbl serum levels <
500 ng / ml or mbl activity < 200 u / ml may be considered a significant deficiency , there are not standard guidelines aimed to define which patient categories need to be tested ( i.e. , in presence of severe recurrent respiratory infections or acquired immunesuppression ) .
recombinant human mbl use , to supplement mbl deficiency status , has been investigated in animal and phase i / ii human studies [ 68 , 69 ] .
although its clinical efficacy has not been clearly established , still now no adverse effects were observed .
sixty - five mbl infusions were given to 12 mbl deficient chemotherapy - induced neutropenic children .
the observed postadministration level was 1.06 mcg / ml ( range : 0.662.05 ) which may be considered protective .
a similar pharmacokinetic profile was observed in 20 healthy mbl - deficient volunteers and two patients with staphylococcus aureus septicemia .
however , beyond these preliminary observations , mbl replacement needs to be further investigated in deficient patients affected by acute severe infections , especially in presence of multiple - level immune system impairment .
an increasing body of data support the role of mbl as central player of innate immunity .
many authors have showed the association of this molecule deficit with recurrent severe infections , particularly involving the respiratory tract and encapsulated bacteria .
additionally growing evidence suggests its importance during systemic severe infections as severe sepsis and septic shock .
this correlation might derive from the cross - talking among complement system , coagulation patterns , and proinflammatory cytokines . even though many patients with systemic infections , who present mbl serum levels below the functional threshold , are at higher risk to develop severe complications and poor outcomes ( i.e. , septic shock , multiple organ failure ) , in some cases low levels have appeared to be protective , probably reducing the inflammatory cytokines ' storm .
moreover not all published studies have identified a clear association between deficiency and increased risk of infections .
replacement therapy with recombinant human protein during severe sepsis and septic shock affecting deficient patients has been proposed but it still remains an experimental treatment .
hence , until new promising and robust data will be available , the strict adherence to current standard recommendations still remains the mainstay of severe sepsis / septic shock management . | severe sepsis and septic shock are a primary cause of death in patients in intensive care unit ( icu ) .
investigations upon genetic susceptibility profile to systemic complications during severe infections are a field of increasing scientific interest .
particularly when adaptive immune system is compromised or immature , innate immunity plays a key role in the immediate defense against invasive pathogens .
mannose - binding lectin ( mbl ) is a serum protein that recognizes a wide range of pathogenic microorganisms and activates complement cascade via the antibody - independent pathway .
more than 30% of humans harbor mutations in mbl gene ( mbl2 ) resulting in reduced plasmatic levels and activity .
increased risk of infection acquisition has been largely documented in mbl - deficient patients , but the real impact of this form of innate immunosuppression upon clinical outcome is not clear . in critically ill patients higher incidence and worse prognosis of severe
sepsis / septic shock appear to be associated with low - producers haplotypes .
however an excess of mbl activation might be also harmful due to the possibility of an unbalanced proinflammatory response and an additional host injury .
strategies of replacement therapies in critically ill patients with severe infections are under investigation but still far to be applied in clinical practice . | 1. Introduction
2. The MBL Protein and Its Deficiency
3. MBL and Severe Infections
4. MBL and Severe Sepsis/Septic Shock
5. Conclusions |
osteoradionecrosis is a well - recognized complication of radiotherapy for head and neck or skull base tumors .
it may predispose the patient to an aggressive or chronic infectious process and meningitis , or cause destruction of tissue by direct necrosis .
the temporal bone is rare site of osteoradionecrosis ; it is common in the mandible ( 1 ) .
only two cases of osteoradionecrosis of the temporal bone complicating cerebrospinal fluid ( csf ) otorrhea have been reported in the literature , and were in the cases with nasopharyngeal carcinoma ( 2 , 3 ) .
this case is the first report of csf otorrhea from osteoradionecrosis of the temporal bone in a patient with recurrent meningioma .
the patient was successfully treated with tympanomastoid surgery and autologous fat obliteration in the mastoid .
a 58-yr - old woman was diagnosed with meningioma at the right cerebello - pontine angle and underwent total tumor removal by a neurosurgeon in august 2002 .
three years after the surgery , the tumor recurred and the patient received 5,400 cgy of radiation . immediately after the completion of radiation therapy , otorrhea developed suddenly and
had lasted for about 7 months when the patient was referred to the otolaryngology department in april 2006 .
otoscopic examination of the right ear revealed clear pulsating discharge and a central perforation of the tympanic membrane . computed tomography ( ct ) of temporal bone demonstrated hyperostosis with sclerotic and lytic changes consistent with osteoradionecrosis .
the inner margin of the cortical bone was destroyed and a moth - eaten appearance was identified at the superior margin of the petrous temporal bone ( fig .
the t2 weighted magnetic resonance ( mr ) imaging showed high signal intensity , whereas t1 weighted mr imaging showed low signal intensity , suggesting csf ( fig .
dry glucose test of the aural discharge was 52 mg / dl , implying again that it could be csf .
however , the radioisotope cisternography with tc-99 m did not reveal a specific leakage site . a canal wall up mastoidectomy and exploration of the mastoid antrum
was carried out in june 2006 . the cortical bone of the mastoid process and mastoid tegmen was very soft and fragile .
although no definite tegmen defect was noted in the ct scans , there was an approximately 10 mm - sized , irregular margined shallow bony defect on the mastoid tegmen , and the exposed dura appeared relatively intact .
the defect on the tegmen and mastoid antrum was obliterated using autologous abdominal fat graft .
postoperativley , there has been no evidence of csf leakage for 10 mon under otoscopic and nasopharyngeal examination .
the pathogenesis of osteoradionecrosis was first described by ewing in 1926 ( 4 ) . the first case of osteoradionecrosis of the temporal bone
an aseptic , avascular necrosis of the bony tissue with obliterative vasculitis and arteritis is the main pathogenesis , and this is more likely to occur in the presence of tumor involvement . as osteolysis proceeds , demineralization of the bone with a compensatory reparative fibrosis occurs in the absence of osteoblastic activity .
the tissue then becomes prone to injury and highly susceptible to infection . after infection sets in
, the necrotic process accelerates and osteoradionecrosis continues . the severity of necrosis is closely correlated to the total amount of radiation . in this case , the recurrent tumor was closely approximated with temporal bone , possibly increasing the exposure to a relatively high dose of radiation .
osteoradionecrosis of the temporal bone was classified as either a localized or diffuse type by ramsden et al .
, osteoradionecrosis is generally confined to the external auditory canal , and symptoms usually include dermatitis , otalgia , and otorrhea . in the diffuse type , the disease extends beyond the temporal bone to the skull base .
this type of disease can produce more severe symptoms including profuse and pulsatile otorrhea , and significant pain and can also be a more severe complication ( 2 ) .
osteoradionecrosis of the temporal bone can make complications like hearing loss , gross tissue extrusion , chronic otomastoiditis , as well as more severe complications including meningitis , facial palsy , intradural and/or extradural abscesses , pneumocephalus , lateral sinus thrombosis , fistula formation into the parotid gland or temporal mandibular joint , and other cranial neuropathies ( 6 ) . in this patient ,
the disease was relatively diffuse involving mostly the mastoid bone but not the deep skull base .
the patient presented with an exceptionally rare complication of osteoradionecrosis of the temporal bone , secondary to radiotherapy for meningioma : an otogenic csf leak . in this case , 2-transferrin was identified and a dry glucose test of the collected discharge suggested it could be csf , although an isotope cisternogram study could not find the leakage site .
this patient had a tympanic membrane perforation . however , considering the lack of otologic problems before radiotherapy , the perforation could have been caused by radionecrosis and/or subsequent infection .
the patient was first treated conservatively with antibiotics and aural cleansing , but long - lasting clear aural fluid despite conservative treatment implied that it was a csf leak . on the other hand ,
it is conceivable that recurrent meningioma may destroy the temporal bone resulting in csf leakage . in this case ,
preoperative ct imaging study did not show a destructive pattern of the temporal bone but rather typical hyperostosis with sclerotic and lytic changes and small mastoid tegmen defect which was detected in operation might be caused by lytic change .
the management of osteoradionecrosis in the temporal bone is controversial . in the localized type , conservative treatment with frequent aural cleansing and topical antibiotics
is often administered ( 7 ) . in the presence of csf leakage , conservative management such as bed rest , head elevation and , insertion of a subarachnoid drain can be useful .
surgical management of osteoradionecrosis of the temporal bone has met with limited success because of the difficulty of accurate assessment of the viability of non - necrotic bone .
failure to resect all non - viable bone results in recurrence of a necrotic focus ( 8) . in this case , we removed all inflamed , sponge - like non - viable bone that corresponded to the radionecrosis and closed the defect with autologous abdominal fat . | osteoradionecrosis of the temporal bone is a very rare but potentially lethal complication of radiotherapy for head and neck or skull base tumors .
only two cases of osteoradionecrosis of the temporal bone complicating cerebrospinal fluid ( csf ) otorrhea have been reported in the literature .
this report describes a case of csf otorrhea and osteoradionecrosis of the temporal bone in a patient with meningioma who was treated with tympanomastoid surgery and autologous fat obliteration in the mastoid . | INTRODUCTION
CASE REPORT
DISCUSSION |
it has been estimated that introduction will succeed only if fitness is greater than 80% .
one of the prime targets for such modification is anopheles gambiae , one of the primary vectors in sub - saharan africa , where more than 90% of the world 's malaria is transmitted . whilst size of males
females that mate with males that are two days old may be more likely to oviposit than if they mate with older males . hence
, younger males may be fitter and , for the introduction to succeed , released males will need to mate with wild females early in their life . in many areas of africa
funestus is likely to have little long - term effect on malaria in many areas .
given their sympatry and the likelihood of a similar mating period , some aspects of the mating behaviour of an .
gambiae , like many other anophelines , mating is associated with swarming [ 5 - 9 ] .
funestus , however , is that of harper who observed swarming males on the threshold of a thatched dwelling 1 km from nyanza , lake victoria . indeed
the doyens of african medical entomologists , gilles and de meillon , in their extensive review state , ' we have never found them ( swarms ) ourselves , even in areas of high density ' . an .
the greater the contrast the more likely will a swarm form and they can be induced to form over artificial markers .
although thought to be a eurygamic species ( which requires large volumes of space to successfully mate ) harper describes an .
no marker was described and no mating was recorded despite the fact that estimated numbers in the swarm , which stretched almost a metre across , exceeded 500 . in a recent study of swarming behaviour of an .
, , however , considered that swarm site and marker were unlikely to be specific to a particular species .
they also threw doubt on the idea of ' swarm arenas ' proposed by charlwood and jones .
funestus were commonly observed , in a village in southern mozambique , in areas similar to those used by an .
funestus in these areas and to determine if any aspects of the observed behaviour differed from that recorded for the m form of an .
the study took place on nineteen evenings between the 23march and 3may 2002 , in the village of furvela , 650 km north of maputo and 7 km south of the town of morrumbene , in the province of inhambane , on the main maputo - beira highway ( en1 ) .
the village lies circa 3 km from mangrove - bordered coast and is delineated by the furvela river a small stream within a 2 km wide valley .
most of the villagers live by subsistence farming , growing maize , manioc , peanuts and beans .
cashew nut trees and coconut palm are common . in the river valley sugar cane , dry rice and bananas are grown .
direct observation of swarms was undertaken in the manner described by charlwood & jones and charlwood et al . , .
swarming males and insects in copula were collected by sweep net , modified in the manner described by marchand .
artificial markers used were the same as those used in so tom . in order to determine whether size affected likelihood of a male swarming or mating the wing lengths of males collected resting , exiting houses , swarming and mating were measured .
collections of indoor resting insects were performed , with a torch and aspirator , for 10 minutes in buildings shown in figure 1 and exiting insects at dusk were monitored by placing a conical , double - size bednet over the gable - ends of houses within the study area .
map of four sites in which swarms of anopheles funestus were observed , furvela village , mozambique .
wing lengths , between the alula notch and the wing tip , excluding scales , of unselected samples of insects from all collections were measured using an ocular micrometer on a stereoscope to the nearest 0.03 mm .
wing lengths of the different groups were compared using anova . in order to determine if differences in flight sound between an .
gambiae , which might swarm together , differ ( and therefore may act as potential barrier to prevent hybridization ) the frequency distribution of individual insects , in free flight confined inside netting covered paper cups , was determined according to the method outlined in brogdon .
briefly , recordings of individual insects were made with a microphone ( a sony ecm - d870p ) either directly onto a portable computer or onto mini - disc and then transferred to computer and stored as wave files .
the files were digitally sampled at 20,000 hz and then re - sampled at 5,000 hz and sonograms , plots of sound frequency versus time , prepared using computer software ( spectrogram , public domain by richard horne ) .
temperature data was obtained for the two nearest weather stations ( inhambane and vilanculos ) available from the noaa website and the mean value used .
there was , however , no obvious pattern as to the location of the swarms which could be at the edge or in the middle of the clearing ( figure 1 , figure 2 ) .
swarms occurred 24 m off the ground , occupied a similar volume , and appeared to consist of a similar number of insects . at some sites two or more swarms occurred within a few metres of each other ( figure 1 ) .
it was not possible to determine with any certainty , what the characteristics were that enabled males to maintain their position .
at the site closest to the river valley ( the putative breeding site ) the swarm occurred in a gap in vegetation that was illuminated by the western sky ( figure 1a ) . when this gap was artificially closed ( by extending a sheet across it ) males flew higher ( so that they continued swarming in a gap ) .
two further swarms were discovered by looking for such gaps , and similar profiles occurred at other swarm sites , although in all other cases the ' silhouette ' was created at a much greater distance from the place where the swarm occurred .
it was rarely possible to see the first male at the swarm site ; rather , several insects started swarming at the same time .
numbers rapidly built up and within five minutes of the start had reached maximum size and density . on two occasions , dragonflies ( libellula sp . )
on one occasion all four males in a swarm were caught and eaten in a matter of seconds .
funestus were collected from a swarm of apparently larger insects that formed close to a higher and larger swarm from which 1 an .
funestus were collected swarming ( a total of 601 males from 13 swarms ) in sharp contrast to the an .
gambiae from so tom , swarming males avoided black or white horizontal markers and dispersed when these were introduced under the swarm . despite there being a considerable number of male an .
the number and time of pairs in copula was noted on 9 evenings of observation .
the time at which the first pair was observed , relative to the time of the start of swarming , was inversely proportional to the total number observed throughout the swarming period ( figure 3 ) limitation of resources meant that comparisons between sites on the same day were unavailable .
3.7 min after the start of swarming and had reached a maximum 4 min later . by the end of the observation period ( when it became impossible to see the insects with the naked eye ) numbers of mating pairs had almost declined to zero ( figure 4 ) .
relationship between the time of the first copula observed after the start of swarming and the total number of pairs subsequently counted .
number of pairs of anopheles funestus observed relative to the start of swarming , itself co - incident with sunset .
all were newly emerged with undeveloped ovaries . of the 71 unfed females dissected from resting collections 68 were virgins .
the number of unfed females and males resting inside houses were positively associated ( figure 5 ) but there was no association in the number of either of these categories with gravid and blood fed insects in resting collections .
relationship between the number of males and unfed ( virgin ) females collected resting inside houses , furvela village , mozambique .
overall both male and female wing size distributions were approximately normal and were not significantly different ( figure 6 ) .
the wing length of males from resting collection , leaving houses , collected from swarms and in copula was similar ( table 1 ) ( figure 7a ) .
the mean wing size of males differed according to collection site ( one - way anova for 2 d.f .
, p = 0.037 ) . among the females , those collected in light - traps ( i.e. host seeking ) were smaller than the other categories ( figure 7b ) .
the wing size of females collected in copula were similar to that of newly emerged insects collected resting or exiting from houses .
wing length distribution of male and female anopheles funestus from furvela village , march - may 2002 .
winglength of male anopheles funestus collected at different phases of the activity cycle , furvela village , mozambique . during the period of study temperatures dropped from an average of 29c to 26c .
female wing sizes increased over this period but male size did not ( figure 8) .
mean male and female wing length of anopheles funestus and ambient temperature from furvela village , mozambique , by date of collection .
funestus were so common in furvela that it is strange that they have not been observed elsewhere .
they differed from those recorded by harper in that they all occurred in very open spaces several metres off the ground rather than the threshold of houses a few centimetres off the floor .
anopheles funestus is now known to belong to a group of species , some of which are non - vectors and it is not certain which member of the group the author had observed .
gambiae seen in so tom . in both species they occurred at sunset 24 m above the ground in relatively open areas .
swarm size , dimensions and the estimated number of males per swarm appeared to be relatively constant between sites and species but the number of females entering swarms showed considerable variation .
swarm sites , each of which has a fixed capacity , may determine the dispersal of males .
one might expect relatively more mating to take place in the swarms closest to the female emergence site .
we were unable to determine the number of males in a swarm and hence unable to determine if male mating success rates were similar in the different swarms .
the fact that male and newly emerged female ratios resting in houses were relatively constant implies that location of swarm has little influence on mating success .
the lack of a relationship between either of these two groups and older females highlights the fact that entry routes , reasons for entry , sense used and time entered differs between the two categories .
males and virgin females use their eyes and enter houses at dawn usually via the darkest orifice ( which usually means windows and doors ) .
they are in search of a bloodmeal and use their sense of smell for direction . with a single exception
funestus does not seem to be required since they are only likely to encounter con - specific females . on the one evening
was obtained two distinct swarms , one of an apparently larger mosquito were seen prior to their being sampled .
the swarms occurred circa 50 cm apart , with the larger insects swarming closer to the ground .
it is not certain that the species were mixed . given that they were caught swarming at least once during the study begs the question of why swarms of an .
were not more commonly observed or induced over markers in furvela as they were in so tom .
one reason may be that the member of the complex observed in so tom was the m form of an .
it would appear to be a different species from the other members of the complex and thus may behave differently .
in particular all size groups were caught in copula , the caveat being that the numbers involved were small .
the sampled houses were situated at varying distances from the river valley , the putative breeding site .
. this may be due to the relatively large sample size or because size influenced male dispersal recently it has been shown that in small cages smaller female an .
one of the difficulties with this interpretation is that a male can inseminate four or more females whilst females are largely monogamous . given the equal sex ratio at emergence an average male will only meet a single female in his lifetime .
if so it would seem unlikely that males would be too selective since there is probably another set of genes around that is not and should a further female come along then she can still be fertilized . indeed
the size distribution of females caught in copula was not significantly different from those emerging .
as temperatures drop the duration of larval and pupal stages increase and the size of emerging insects increases . the duration of the larval stage in an .
the effect of the drop in temperature on mean female size but not male size may be because the adult males collected had not been exposed as larvae , or particularly as pupae to such low temperatures as the females .
funestus avoided such markers ( both light and dark ) and dispersed if they were placed underneath naturally occurring swarms .
the response to potential horizontal markers is likely to be sufficient to prevent mixed swarms from occurring and this is likely to be the factor responsible for isolation between an .
charlwood conducted the work in the field and helped prepare the manuscript thompson provided logistical support to the fieldwork madsen helped prepare the manuscript , was responsible for figures and provided statistical support
jdc would like to thank marcia , elsa and luis for their help in swarm watching .
this study was undertaken as part of the mozdan project and was supported by the danish bilharziasis laboratory . | backgroundcontrol of malaria by the release of genetically modified mosquitoes refractory to transmission is now becoming a possibility . in many areas of africa ,
anopheles gambiae is found together with an equally important vector , an .
funestus . given their sympatry and the likelihood of a similar mating period some aspects of the mating behaviour of an .
gambiae s.l . and an .
funestus are likely to differ .
we therefore attempted to characterise the swarming behaviour of an .
funestus and to determine if any aspects of the observed behaviour differed from that recorded for the m form of an .
gambiae from so tom.methodsin march may 2002 the swarming , mating , house exiting and resting behaviour of anopheles funestus was studied by direct observation in mozambique .
swarming males and insects in copula were collected by sweep net .
wing lengths of males collected resting , exiting houses , swarming and mating were measured and the wingbeat frequency distribution of individual insects , in free flight confined inside netting covered paper cups , was also determined.resultsmono-specific swarms occurred at sunset in relatively open areas close to houses used for resting .
mating pairs were seen 11 3.7 min after the start of swarming .
the number of total pairs observed being inversely proportional to the time difference between the start of swarming and the first pairing . the great majority of females mated before feeding .
male or female size did not appear to affect mating success or other behaviours . during the study ,
ambient temperatures decreased and female , but not male , wing size increased . at 516 hz , the flight tone of female an .
funestus was similar to the 497 hz of the local an .
gambiae .
males dispersed if light or dark artificial horizontal markers were placed underneath naturally occurring swarms.conclusiondifferential response to markers would be sufficient for swarming in an .
funestus and an .
gambiae s.l . to occur in distinct sites . | Background
Methods
Results
Discussion
Conclusions
Authors' contributions
Acknowledgements |
progressive hemifacial atrophy ( pha ) is a rare disorder characterized by unilateral facial atrophy affecting the skin , subcutaneous tissue , and fat , muscle , and osteocartilagenous structures creating a sunken hemiface appearance .
we report a 41-year - old woman with pha who showed an uncharacteristic relapsing remitting evolution of brain lesions and was seropositive for hepatitis b virus ( hbv ) .
magnetic resonance imaging ( mri ) showed progressive atrophy and multiple white matter lesions in the left side of the brain .
interestingly , the serial mri examination ( 4 mri scans over a period of 9 years ) showed a relapsing remitting pattern of brain lesions akin to that observed in a subtype of multiple sclerosis .
autoimmune - related investigations revealed increased serum levels of immunoglobulin ( ig ) g , anti - nuclear antibody ( ana ) , and -igg .
however , the association of peripheral infection such as hbv infection with pha has not been reported .
our experience with this case suggests that pha may have a relapsing remitting disease course . autoimmune inflammatory response to chronic hbv infection
progressive hemifacial atrophy ( pha ) ( also referred to as the parry romberg syndrome ) was first reported by parry in 1825 , and , later , described in more detail by moritz heinrich romberg ( 1846 ) . it is a rare disorder that usually presents in the first or second decade of life and is characterized by unilateral atrophy of the face and subcutaneous tissues . sometimes , the condition may affect the underlying bony structures . in the majority of patients ,
the disease stabilizes over a period of 2 to 10 years after its first presentation ; a small proportion of patients ( 26% ) , however , may experience sustained progression .
neurological complications such as epilepsy , migraine , hemiplegia , and trigeminal neuralgia may develop in 15% of all pha patients .
the etiology of pha remains poorly understood ; defects of vascular supply , trauma , sympathetic over - excitation , and infection have all been postulated as possible causes . in this report
, we describe a case of pha who manifested serial changes in brain lesions on magnetic resonance imaging ( mri ) .
the case suggests that pha may have a relapsing remitting disease course and that periphery hepatitis b virus ( hbv ) infection associated auto - immune inflammatory process may be one of the triggers for relapse of pha .
a 41-year - old woman was referred to our department because of recurrent tonic - clonic seizures .
her left side of the face was of smaller size ; the deformity was noticed since she was a teenager , and which progressed with increase in age . the first episode of seizures occurred when she was 32 years old .
the patient was diagnosed as a case of encephalitis and received acyclovir treatment . the second episode of tonic - clonic seizures occurred at the age of 40 years . a diagnosis of encephalitis - related seizure was made and antiepileptic therapy prescribed .
eight months after the second seizure attack she sustained a third attack and was therefore referred to our department .
besides , she also had a history of paroxysmal electric discharge like abnormal sensations on the left half of face and memory decline .
neurological examination showed facial asymmetry with marked hypoplasia of the left side of the face , left enophthalmos , left eyelid , tongue , gingival and periodontal tissue atrophy , and left teeth crowdedness ( fig .
her lower left lips were thinner than that at the right side and a big linear dark scar ( coup de sabre ) was observed .
the muscle strength of the right lower extremity was 4/5 on muscle strength grading scale .
on electroencephalography ( eeg ) , spike and slow waves were observed over the left temporal area .
she tested positive for antibodies against hepatitis b virus ( hbv ) surface antigen ( hbsag ) and envelope antigen ( hbeag ) .
immunoglobulin g ( igg ) levels were increased both in csf ( 51.7 mg / l , normal range : 034.0 mg / l ) and in the serum ( 16.4
laboratory tests related to autoimmune function showed higher values of -igg levels ( 23.1% , normal range : 9.018.0% ) and lower levels of complement c3 ( 0.86
( a g ) mri axial t2-flair performed in december 2014 showed enlarged left ventricle and multiple hyperintensities in the left frontal , temporal , occipital and parietal lobes and the periventricular area ( a and b ) ; some lesions presented heterogeneous enhancement on t1 postcontrast images ( c and d ) .
the left ventricle was bigger on mri axial t2-flair in january 2015 ; lesions in the left orbitofrontal cortex and the basal ganglia were more widespread , whereas the lesions in the periventricular area were smaller ( e and f ) . in august 2015 ,
the left ventricle enlarged more on mri , mri axial t2-flair also showed attenuation of lesions in the left orbitofrontal cortex ( h and i ) and new lesions in the left superior frontal gyrus ( i ) , some lesions are partially enhanced ( j and k ) . photograph of the patient ( g ) .
flair = fluid - attenuation inversion recovery , mri = magnetic resonance imaging . the first mri scan performed at the time of the first seizure episode showed multiple white matter lesions in the left frontal lobe and the parieto - occipital area ; some lesions were enhanced after the gadolinium contrast injection ( the mri was lost ) .
the second mri examination was performed in december 2014 , immediately after the second seizure episode .
it showed enlargement of the left lateral ventricle and multiple lesions in the left frontal and parietal lobes and the periventricular area ( fig .
1a and b ) ; heterogeneous gadolinium enhancement was observed in the left frontal and parietal lobes ( fig .
mri performed 1 month after the second seizure episode ( i.e. , in january , 2015 ) showed that the lesions in the left orbitofrontal cortex and basal ganglia were more widely diffused , whereas the lesions at the periventricular space and the posterior horn of the lateral ventricle had attenuated ( fig .
the most recent mri ( august , 2015 ) showed increase in the size of left ventricle , when compared with previous mri study performed 7 months ago . moreover , the lesions in the left orbitofrontal cortex had attenuated and new lesions appeared in the left superior frontal gyrus , some of which are partially enhanced ( fig .
no intracranial vascular abnormalities were identified on magnetic resonance angiography ( mra ) or digital subtraction angiography ( dsa ) ( data not shown ) .
pha is characterized by unilateral atrophy of the face , including that of skin and the subcutaneous tissue .
our patient experienced slow progressive atrophy of her left face since her teenage , as evidenced by changes on mri .
neurological complications such as seizures are known to occur in up to 15% of all pha patients .
the eeg showed spikes and slow waves predominantly in the left temporal lobe , which is indicative of seizure activity .
besides , the patient also had a history of migraine , which is a common accompaniment in pha patients .
serial changes in imaging findings with progression of the disease have rarely been reported . in the present patient , 4 mri examinations performed over a period of 9 years showed progressive left brain atrophy and multiple lesions affecting both white and gray matter in the left hemisphere .
interestingly , brain lesions in this patient appeared and resolved , a pattern similar to that associated with a subtype of multiple sclerosis ( ms ) , the relapsing remitting ms . to date , no disease - modifying drugs are available for pha .
the relapsing remitting lesions in this patient indicate that identification of triggers for relapse may help prevent the progression of the disease . in ms , relapses are believed to represent recurrent episodes of inflammation and demyelination that are often accompanied by axonal injury .
immune cell - infiltration in the central nervous system ( cns ) and microbial infections have been considered as immunological triggers for relapse in ms , all of which can elicit an inflammatory response .
typical histological findings in patients with pha include epidermal atrophy , inflammatory infiltrate , gliosis , and neuronal loss .
therefore , it is plausible that the relapsing remitting lesions in this patient may have similar inflammatory background . some brain lesions of this patient showed gadolinium enhancement , which indicates disruption of the bbb and inflammation . after excluding the possibility of brain tumor and vascular malformations by mr spectroscopy and dsa analysis , we think the enhancement of lesions might be related to vasculitis .
indeed , perivascular inflammation and microglial activation have been reported in a pha patient with epilepsy at brain biopsy , which suggests that inflammation can be one of the factors that drive the acceleration of pha .
various infections such as borrelia burgdorferi , poliomyelitis , and herpes zoster have been reported in patients with pha .
however , neurologic complications of hbv such as acute disseminated encephalomyelitis ( adem ) and guillain barr syndrome have also been noticed , which suggests that periphery disease can affect the brain .
in addition , hbsag has been identified in the csf of patients without active liver disease but with positive hbsag in serum . for a long period of time , the blood brain barrier ( bb ) was thought to protect brain from infections in the periphery .
it has been controversial whether hbsag crosses bbb from the periphery or if it is locally generated within the cns .
on the other hand , recent studies suggest that there are intensive communications between the periphery and cns
. the molecular mimicry between hbv dna and myelin proteins and the subsequent activation of autoimmune inflammatory cells could constitute the other possible underlying mechanisms of neurological injury in this patient .
concomitant occurrence of autoimmune diseases such as systematic lupus erythematosus ( sle ) and pha has been reported .
autoimmunity - related antibodies are often found positive in pha patients . in line with previous reports ,
increased serum levels of ana and igg were observed in this patient , which suggests a common autoimmune - related background .
therefore , it is highly likely that the inflammatory microenvironment induced by infection or dysregulated autoimmunity may render the patient more susceptible to pha .
surgical aesthetic treatments of hemifacial atrophy such as augmentation of the atrophic region and restoration of the symmetry of the face have been used in clinics . however , these treatments do not have a long - lasting effect .
beneficial effect of immunosuppressive drugs on a pha patient with cerebral involvement have been reported .
the present case showed inflammatory relapsing and remission lesions on mri . whether anti - inflammatory and immune suppressive drugs can halt or slow down disease progression is worth further investigation . in summary
the autoimmune inflammatory process due to chronic hbv infection may be one of the triggers for relapse . to date | abstractintroduction : progressive hemifacial atrophy ( pha ) is a rare disorder characterized by unilateral facial atrophy affecting the skin , subcutaneous tissue , and fat , muscle , and osteocartilagenous structures creating a sunken hemiface appearance.etiopathogenesis of pha is poorly understood ; no definitive treatment is currently available.clinical findings : we report a 41-year - old woman with pha who showed an uncharacteristic relapsing remitting evolution of brain lesions and was seropositive for hepatitis b virus ( hbv ) .
she presented with a history of recurrent tonic - clonic seizures . magnetic resonance imaging ( mri ) showed progressive atrophy and multiple white matter lesions in the left side of the brain .
interestingly , the serial mri examination ( 4 mri scans over a period of 9 years ) showed a relapsing remitting pattern of brain lesions akin to that observed in a subtype of multiple sclerosis .
autoimmune - related investigations revealed increased serum levels of immunoglobulin ( ig ) g , anti - nuclear antibody ( ana ) , and -igg .
infection is considered as one of the possible causes of pha .
however , the association of peripheral infection such as hbv infection with pha has not been reported.conclusion:our experience with this case suggests that pha may have a relapsing remitting disease course .
autoimmune inflammatory response to chronic hbv infection may have triggered the relapse in this case .
this case underlines a novel etiopathogenetic mechanism of pha . | Introduction:
Clinical Findings:
Conclusion:
Introduction
Case report
Discussion |
mycosis fungoides palmaris et plantaris ( mfpp ) is an uncommon variant of mycosis fungoides ( mf ) limited to the palms and soles , first described by resnik et al . in 1995 .
since only 10 english papers about mfpp have been previously published , little is known about its pathogenesis . in this report
, we describe a case of mfpp showing a dense deposition of periostin ( postn ) in the cancer stroma , which might modulate the tumor microenvi ronment through tumor - associated macrophages ( tams ) .
our present case might suggest one of the possible reasons for the good prognosis of mfpp .
an 85-year - old japanese man visited our outpatient clinic with a 2-year history of pruritic erythema on his scalp .
his condition had been treated in a private clinic as pustulosis palmaris et plantaris with topical steroid and maxacalcitol , but they were ineffective . on his initial visit ,
physical examination revealed erosive , atrophic , well - demarcated scaly erythema on his right palm and right sole ( fig .
a biopsy specimen showed atypical large lymphocytes densely infiltrated mainly in the upper dermis with involvement of the overlying epidermis ( fig .
immunohistochemical ( ihc ) staining revealed that these atypical lymphocytes , which were distributed from the upper layer of the stratum spinosum to the dermis , were positive for cd3 , cd4 and cd5 , and negative for cd7 and cd8 . a full blood count and biochemical profile revealed eosinophilia ( 19.7% ) , and a significantly high level of serum il-2 receptor ( 925 u / ml ) .
we screened for possible metastatic lesions with positron emission tomography and computed tomography but found no evidence of metastasis . from the above findings , we diagnosed this patient as having mfpp .
we administered radiation therapy 40 gy in 20 fractions to the right palm and sole , and the erosive , atrophic erythema then disappeared .
to further investigate the possible immunological background of the mfpp , we employed ihc staining for postn , cd163 and cd206 .
ihc staining revealed the dense deposition of postn within the superficial to deep dermis ( fig .
mfpp is a rare variant of mf limited to the palms and soles [ 2 , 4 , 5 ] . since only a small number of cases
have been reported in english , the pathogenesis and biological behaviors of mfpp are still incompletely understood . among the published reports , nakai et al .
reviewed 24 cases of mfpp , which suggested that patients with mfpp present a relatively good prognosis , and that radiotherapy is one of the best therapies for mpff .
excimer laser therapy ( 308 nm ) and bexarotene are also effective [ 4 , 5 ] and , to our knowledge , no patients have died from disease progression .
postn is an extracellular matrix protein that modulates the production of a series of chemokines from macrophages and fibroblasts [ 3 , 6 ] . as we previously reported , the deposition of postn is prominent in early stage ( patch to plaque stage ) of conventional mf .
in addition , previous reports also suggested that in vitro stimulation of monocyte - derived macrophages by postn induces the production of chemokines such as cxcl5 and cxcl10 , which correlates with the tumor - formation of mf in the early stage . in another report , zhou et al . reported that postn secreted from glioblastoma stem cells increases the m2 tams in the tumor site , resulting in the growth of glioblastoma multiformes .
these reports suggest that the postn / tam axis might contribute to the progression of the early stage of mf . in our present case , unlike conventional mf in the tumor stage , the dense infiltration of atypical lymphoid cells as well as dense deposition of postn were observed throughout the dermis . in addition , the main population of tams was cd163cd206 macrophages , which suggested that tams were not polarized to m2 macrophages in mfpp . as a previous reports suggested ,
m2 macrophages produce ccl17 and ccl22 [ 9 , 10 , 11 ] , which recruit regulatory t cells ( tregs ) in the tumor microenvironment .
since a large population of tregs is associated with a poor prognosis in various types of human cancer , and the depletion of m2-like tams delays the cutaneous t - cell lymphoma development in vivo , the inhibition of m2 polarization in tams might be connected with the progression of mf .
concerning our present case , the phenotypes of tams were not polarized to the m2 phenotype , which might be responsible for the good prognosis in mfpp . since this report presented a single case of mfpp , and since we did not directly prove the relationships between immunomodulatory effects of postn and prognosis of mfpp , further analysis of the mechanisms underlying this phenomenon may provide fundamental insights into the mechanisms of postn with mfpp . | mycosis fungoides palmaris et plantaris ( mfpp ) is a rare variant of mycosis fungoides limited to the palms and soles .
although little is known about the pathogenesis of mfpp , this variant of mycosis fungoides presents a relatively good prognosis . in this report
, we describe an 85-year - old japanese man with mfpp .
immunohistochemical staining revealed the dense deposition of periostin in the cancer stroma , as well as infiltration of cd163+cd206 tumor - associated macrophages ( tams ) , which suggested the phenotypes of tams were not polarized to the m2 phenotype in the lesional skin of mfpp .
our present case might suggest one of the possible reasons for the good prognosis of mfpp . | Introduction
Case Report
Discussion
Statement of Ethics
Disclosure Statement |
distal median nerve masses may be developed post - traumatic or non - traumatic . in this paper , we aim to present a 52 year old female case with a postraumatic neuroma of the median nerve in the left wrist .
a 52-year - old female patient had accidental incised wound over her left wrist which was primarily sutured .
intraoperatively the mass was seen to arise from medial nerve and careful excision was done protecting the nerve . at one year follow up the patient is relived of her symptoms with no sensorimotor deficit .
post traumatic neuroma present as unrelieved pain and progressive swelling . a high index of suspicion
should be kept in cases of wound that are primarily sutured over an area with superficial nerves .
soft tissue , skin or bone tumors should be considered in the differential diagnosis of the hand tumors .
neuromas are the most common solid peripheral nerve tumor frequently seen in 30 - 60 ages .
neuromas can originate after trauma to the nerves and such cases are rarely reported in literature [ 4 - 6 ] . in this paper , we aim to present a case with post - traumatic neuroma of the median nerve on the left wrist diagnosed by usg - clinical findings and confirmed with pathological reports .
a 52-year - old female had accidental incised wound over her left wrist which was primarily sutured elsewhere .
she was reffered to our centre 6 months after injury with unrelieved wrist pain and progressively growing mass on the wrist .
usg showed a solid tumor of size 2 x 3 cms and a decision for excision of the mass was taken .
local anaesthesia was given over the area and skin and subcutaneous tissues were dissected to isolate the tumor .
the tumor was carefully excised from the surrounding tissue trying to keep the nerve intact .
intraoperative examination was possible as patient was under local anesthesia and minimal motor disability and hypoesthesia were noted ( fig .
histopathological examinations revealed wallerian degeneration in evolutionary phase as revealed by disorganized growth in axonal and perineural structures ( fig 4 ) .
the patient had a normal outcome with no pathological findings after one year follow - up median nerve neurinomma pathological findings
hand injuries must be carefully examined because of anatomic and neurovascular complexity of hand and wrist .
sharp devices , gunshot injuries , occupational injuries and traffic accidents are the most common causes of hand injuries[7 - 9 ] in a study , seddon divided nerve fascicle injuries into three types ; noropraxia , aksonothemesis and norothemises .
it is stated in this study that noropraxia , does not need any surgical treatment , wallerian degeneration does not occur and the injury can recover completely . in axonothemesis , axonal integrity can be broken but endoneural tubes remain contact .
motor , sensorial and otonomic disfunctions can be present with complete wallerian degeneration . in norothemesis , when the nerve is completely disfonctioned , internal anatomy of the nerve can also be damaged and motor , sensorial and otonomic disfunctions at the distal region of the injury become significantly present .
clinical and electroneuromyographical ( enmg ) study results can be the same with axonothemesis . when the nerves are partially or completely damaged after injury , axonal regeneration initiated by proximal part of the nerve is mostly resulted as neuroma . in adults ,
mean regeneration rate is 1 - 2 mm / day . if fibrous barrier has been developed in injury site , than the axons can not be able to find enough room to grow up and form a mass with fibrous tissue which is called neuroma .
there are some articles about post - taumatic or non - traumatic median nerve masses in the literature . in 1969 ,
a two cm sized neuroma occured after distal radius fracture and trapped in fracture line was disgussed . after having median nerve excision for neuroma
, nerve ends were sutured and the patients showed remarkable improvement in the four - mounth follow - up .
in the recent studies ; chen et al . reported a 42-year - old female cut the wrist in a suicide attempt and had subsequent tendon and median nerve repairment followed by rehabilitation .
after neuroma on the median nerve region was confirmed by the excision of the lesion in the surgery , nerve repairment with a nerve graft was performed and the patient 's symptoms improved significantly .
reported that distal traumatic median nerve neuromas are mostly painful and related with recurrent carpal tunnel syndrome which is generally managed with hypothenar fat pad flap .
hubert et al . reported a schwannoma sized 4.0x0.5x1.2 cm and located in carpal tunnel .
bagatur and yalinkaya reported two giant lipomas in carpal tunnel . in a study of zdemir
et al . , 10 of 14 patients had tumours located in the median nerve distribution area , whereas 4 were found on the ulnar nerve distribution .
four tumours were at the wrist level , 3 at the palm level , and 7 at the digital level .
our case was a post - traumatic neuroma of the median nerve on the left wrist and the diagnose was confirmed by clinical , ultrasonographical and electrodiagnostic examinations .
after one - year follow - up , the patient had normal clinical findings without any pain or neuromotor loss .
in addition , opposition loss is frequently present in distal level median nerve injuries . however , in our case , the patient had complete nerve injury with no opposition loss or any motor deficits .
in conclusion , the masses on the wrists and hands are not rare and can be seen as posttraumatic or non - traumatic .
however , trauma related soft - tissue masses on the wrist have usually been reported as case reports in the literature . therefore , hand injuries , must be carefully inspected by experienced orthopedic surgeons because of anatomic and neurovascular complexity of hand and all possible outcomes should be considered in the management of these cases .
incised wounds over nerves should be carefully inspected for nerve injuries and primary suturing of such wounds can lead to post traumatic neuromas .
these neuromas are cause of pain and discomfort , however they can be easily treated by excision of the lesion | introduction : distal median nerve masses may be developed post - traumatic or non - traumatic . in this paper , we aim to present a 52 year old female case with a postraumatic neuroma of the median nerve in the left wrist.case series : a 52-year - old female patient had accidental incised wound over her left wrist which was primarily sutured .
she presented 6 months later with unrelieved pain and growing swelling at the wrist .
usg showed solid mass of size 2x3 cms .
intraoperatively the mass was seen to arise from medial nerve and careful excision was done protecting the nerve . at one year follow up the patient is relived of her symptoms with no sensorimotor deficit.conclusion:post traumatic neuroma present as unrelieved pain and progressive swelling .
a high index of suspicion should be kept in cases of wound that are primarily sutured over an area with superficial nerves .
careful excision of the lesion is very effective in relieving patients symptoms | Introduction:
Case Series:
Conclusion:
Introduction
Case Report
Discussion
Conclusion |
the oxidation of alcohols into corresponding aldehydes and ketones is a crucial transformation in organic chemistry , both with academic and industry relevance [ 14 ] .
traditionally , this reaction is realized by using inorganic oxidants ( e.g. cr(vi ) reagents ) .
these reagents are needed in stochiometric amounts and are usually toxic or hazardous and hard to be separated from products , which are not environmental friendly and economically
. moreover , most of them are not effective with a broad range of alcohols , especially those in the presence of other oxidizable functional groups such as olefinic group and heteroatoms .
recently , more and more efforts have been put in high valuable catalytic oxidizing process . among these , protocols based on o2 , air or h2o2 [ 69 ] are particularly attractive because of cheap and readily available oxidants and with h2o as the only byproduct .
successful examples include both homogeneous catalysts ( e.g. ru- , pd- , cu- complexes ; bi - metallic complexes systems ) and heterogeneous catalysts ( e.g. metal catalysts and supported catalysts , including mesoporous materials , zeolites , etc . ) .
room - temperature ionic liquids are finding growing applications as alternative reaction media for separations and organic transformations [ 1321 ] .
recent examples of such organic transformations include hydrogenations , friedel - crafts reactions , diels - alder reactions , heck reactions , bischler - napieralsky reactions , olefin dimerizations , cross - couplings , hydroformylations and alkylations .
the desirable advantages of ionic liquids such as low vapor pressure , wide liquid range and thermal stability have made them exceptional reaction media .
accordingly , they are emerging as novel replacements for volatile organic compounds , mainly used as solvents in organic transformations .
ionic liquids have already been used as solvents for oxidation of alcohols with hypervalent iodine reagents , cu(clo4)2/acetamido - tempo / dmap catalytic system , tetravalent cerium salts as oxidizing agents , and manganese dioxide , etc . .
in pursuing economical and environmentally friendly processes for the production of the selective oxidation of alcohols with molecular oxygen is particularly desirable . in this work ,
the chose of copper - bisisoquinoline - based catalysts is based on the fact that copper chloride can mediate oxidation of alcohols very efficiently , in the presence of a nitrogen - contained ligand .
however , the studies on copper - bisisoquinoline - based catalysts for selective oxidation of alcohols under air conditions using ionic liquid solvent system has not yet reported .
the effects of some important variables , like oxidants and some additives , such as base or solid support are investigated .
solvent effect has been as well studied in ionic liquids [ bmim]pf6 ( il1 ) , [ omim]bf4 ( il2 ) and [ hmim]bf4 ( il3 ) ( figure 1 ) , comparing to traditional volatile organic solvent .
the present work revealed that copper - bisisoquinoline - based catalysts has potential applications in the oxidation of alcohols into corresponding aldehydes and ketones with excellent conversion and good selectivity .
the use of ionic liquids was found to enhance the catalytic properties of the catalysts used .
8 substrates with a wide range of primary , secondary , allylic , and benzylic alcohols can be smoothly oxidized to the corresponding aldehydes or ketones with good conversions .
the selectivity of the catalytic products of the 8 studied substrates at different experimental conditions was conducted by gc - ms .
all the studied alcohols were able to be selected converted to corresponding aldehydes at selectivity higher than 80 % .
for the effects of the ligands , although the difference between l1 and l2 is only on the c - c ( in l1 ) and c = c ( in l2 ) bond in the nitrogen ring , the conversion of the alcohols are investigated higher in the catalytic system containing l2 than that of l1 .
this may be due to the results of l2 has a better conjugated structure , which may stabilize the cu - l complex system for better catalytic properties .
air can be conveniently used instead of oxygen without affecting the efficiency of the process .
the catalyst shows excellent tolerance for a broad range of alcohol substrates and is notably not deactivated by nitrogen- and sulfur - containing compounds .
besides its role as a solid support , the carbonate also acts as a base , initiating the addition of the alcohol , or dbadh2 ( ditert - butylazodicarboxylate ) , or both to the copper complex , and as a water scavenger .
k2co3 could be replaced by a nonoxidizable base such as koh or kobut , with slightly effects on the conversion and selectively .
the reaction solvent , toluene , can be replaced by ionic liquids [ bmim]pf6 ( il1 ) , [ omim]bf4 ( il2 ) and [ hmim]bf4 ( il3 ) used in this study
. 2 ml of ionic liquids are needed for the reactions , with at least 1 % improvement of the conversion of alcohols .
not much effect on the conversion of alcohols was observed with the variation of the anion of the ils , or the side chain length of the imidazole cation part of the ils .
the reaction can be carried out with high conversion and selectivity without base ( table 1 e - g ) , while base strictly necessary when toluene is used as solvent . in this work
, we have discovered an efficient catalytic system that oxidizes a wide range of alcohols into the corresponding aldehydes or ketones under mild conditions and that uses o2 as the oxidant .
the present work revealed that copper - bisisoquinoline - based catalysts has potential applications in the oxidation of alcohols into corresponding aldehydes and ketones with excellent conversion and good selectivity .
higher catalytic activity was investigated when l2 was applied ; which may be due to the aromatic ring can make the cu - l complex more stable . for different substrates , the present catalytic system was more effective to the aromatic alcohols than the aliphatic ones ;
the use of ionic liquids was found to enhance the catalytic properties of the catalysts used .
further studies are needed to delineate the intimate mechanistic steps and expand the scope of this oxidation process .
ionic liquids [ bmim]pf6 ( il1 ) , [ omim]bf4 ( il2 ) and [ hmim]bf4 ( il3 ) were purchased from solvent - innovation gmbh and purified by washing with ethyl acetate , and diethyl ether , and dried in vacuum .
all the studied alcohols , light petroleum , dichlormethene , and hexane were purchased from fluka with purity higher than 99% and used as received .
the structure of the bisisoquinoline ligands ( l1 and l2 ) were shown in figure 2 .
the experimental procedure of the studied 8 substrates with a wide range of primary , secondary , allylic , and benzylic alcohols were similar .
typical experimental procedure was carried out as follows : in a 100 ml two - necked flask , cucl ( 0.05 g , 0.5 mmol ) and l1 or l2 ( 0.19 g , 0.5 mmol ) were dissolved in toluene ( 20 ml ) .
then , k2co3 ( 2.75 g , 0.02 mol ) were added and the mixture was stirred for 30 min at room temperature .
dbadh2 ( ditert - butylazodicarboxylate ) ( 0.115 g , 0.5 mmol ) and cinnamyl alcohol ( 0.134 g , 0.01 mol ) were added successively , and the mixture was heated for 1.5 hours on an oil - bath at 80 c while o2 was gently bubbled through the reaction mixture .
after cooling down to room temperature , the mixture was diluted by addition of et2o and filtered through a pad of silica gel .
the solution was washed successively with water , 1 m hcl , and saturated aqueous nacl solution , dried over mgso4 , and distilled out all the organic portions . for the reactions carried out in ionic liquids , no k2co3 or other base
the rest procedures were similar to the ones carried out in toluene . in order to monitor the reaction ,
samples were taken at intervals , treated with passing through a silica gel pad and diluted with toluene before injecting in gc .
qualitative analyses were conducted with a hp 6890n/5973n gc - ms with chemstation containing a nist mass spectral database .
an hp-5 capillary column containing crossed linked 5%-phenyl 95%-dimethylsiloxane copolymer was used for gc seperation .
ionic liquids [ bmim]pf6 ( il1 ) , [ omim]bf4 ( il2 ) and [ hmim]bf4 ( il3 ) were purchased from solvent - innovation gmbh and purified by washing with ethyl acetate , and diethyl ether , and dried in vacuum .
all the studied alcohols , light petroleum , dichlormethene , and hexane were purchased from fluka with purity higher than 99% and used as received .
the structure of the bisisoquinoline ligands ( l1 and l2 ) were shown in figure 2 .
the experimental procedure of the studied 8 substrates with a wide range of primary , secondary , allylic , and benzylic alcohols were similar .
typical experimental procedure was carried out as follows : in a 100 ml two - necked flask , cucl ( 0.05 g , 0.5 mmol ) and l1 or l2 ( 0.19 g , 0.5 mmol ) were dissolved in toluene ( 20 ml ) .
then , k2co3 ( 2.75 g , 0.02 mol ) were added and the mixture was stirred for 30 min at room temperature .
dbadh2 ( ditert - butylazodicarboxylate ) ( 0.115 g , 0.5 mmol ) and cinnamyl alcohol ( 0.134 g , 0.01 mol ) were added successively , and the mixture was heated for 1.5 hours on an oil - bath at 80 c while o2 was gently bubbled through the reaction mixture .
after cooling down to room temperature , the mixture was diluted by addition of et2o and filtered through a pad of silica gel .
the solution was washed successively with water , 1 m hcl , and saturated aqueous nacl solution , dried over mgso4 , and distilled out all the organic portions . for the reactions carried out in ionic liquids , no k2co3 or other base
the rest procedures were similar to the ones carried out in toluene . in order to monitor the reaction ,
samples were taken at intervals , treated with passing through a silica gel pad and diluted with toluene before injecting in gc .
qualitative analyses were conducted with a hp 6890n/5973n gc - ms with chemstation containing a nist mass spectral database .
an hp-5 capillary column containing crossed linked 5%-phenyl 95%-dimethylsiloxane copolymer was used for gc seperation . | the selective oxidation of alcohols with molecular oxygen was efficiently completed in high conversion and selectivity using copper - bisisoquinoline - based catalysts under mild reaction condition .
the effects of various parameters such as reaction temperature , reaction time , oxidant , ligands , etc , were studied .
solvent effect has been as well studied in ionic liquids [ bmim]pf6 , [ omim]bf4 and [ hmim]bf4 , comparing to traditional volatile organic solvent .
the use of ionic liquids was found to enhance the catalytic properties of the catalysts used . | 1. Introduction
2. Results and Discussion
3. Experimental Section
3.1. Materials
3.2. Catalytic reaction |
in the field of medical imaging and noninvasive measurement , computed tomography ( ct ) plays an important role in diagnosis .
the tomography image is reconstructed from a series of projection data , which are transmitted signals throughout an object , such as x - rays , in multiple directions .
radon transform is usually used in mathematical formulations to describe the generating process of the observation data , and inverse of the radon transform is considered as one of the frameworks for the image reconstruction from observation data ; unfortunately , this reconstruction formulation does not care about noisy observations . in order to improve image quality occurred by noisy observation , several image restoration methods based on the bayesian inference
the purpose of image restoration lends itself naturally to the bayesian formulation , which infers a posterior probability for the original image using the prior probability of an assumed model for the original image and the corruption process .
one well - known strategy for bayesian image restoration is to adopt the image that maximizes the posterior probability ; this is called the maximum a posteriori ( posterior ) probability ( map ) inference . in map inference ,
the quality of a restoration image is controlled by the strengths ratio between fidelity of the observation process and the prior strength of the model .
hyperparameters are often introduced to describe these strengths of the ratio ; however , these hyperparameters inference is a hard problem in the map framework . in order to estimate hyperparameters in the map framework ,
the cross - validation method is considered as effective ; however , we consider that there exists several problems .
and the second point is to determine the cost function for the hyperparameters . in the field of image restoration ,
several types of methods are compared ; however , it is difficult to choose a cost function that is suitable for our problem .
in contrast , from the viewpoint of the bayesian inference , the hyperparameter inference problem can be expressed naturally .
for example , in the field of the image restoration , molina et al . demonstrated several hyperparameter inference methods in the bayesian manner in the manner of a hierarchical bayes inference .
pryce and bruce and mackay et al . proposed marginal likelihood maximization to infer those hyperparameters , which is called evidence framework or type 2 marginal likelihood maximization [ 6 , 913 ] .
in typical conventional methods , which use map inference for the computed tomography , a cost function that consists of data - fitting terms and several smoothness constraints has been introduced , and a minimization of the cost function is carried out in order to obtain the reconstructed image from the noisy observation data .
unfortunately , there have been few discussions related to the inference of a proper ratio between the data fitting and the constraints within the map framework . on the contrary , from the bayesian inference point of view , it is natural to discuss the hyperparameter inference for image restoration using an evidence framework [ 1416 ] . in our previous work
, we proposed a ct image reconstruction in the manner of bayes inference with a hyperparameter inference method from the noisy radon - transformed observation by the evidence framework [ 12 , 13 ] . in the previous work , however , we only showed that the bayesian inference framework works well in the specific environment , that is , we assumed the additive white gaussian noise for the 2-dimensional object observation .
gaussian noise is one of the tractable models for a mathematical formulation ; however , in the x - ray ct or positron emission tomography ( pet ) image observation , we should assume poissonian noise for the observation .
thus , in this study , we show that our reconstruction algorithm also works well under the poissonian noise as well as under the gauss noise case .
considering the poissonian noise case for the observation which is different from our assuming model , we show a kind of robustness of our reconstruction model .
shepp and logan phantom , which is usually used for evaluation of ct / pet image reconstruction , is a simple model of the axial cross - section human body .
the internal organ of human body is not so much simple , so we use a real ct image data for reconstruction .
in order to explain our bayesian inference method , we show the conventional ct reconstruction method using filtered backprojection ( fbp ) under the formulation of the radon transform .
after that , we introduce bayesian inference into the reconstruction process . briefly , the radon transform assumes that the observed signals are transmitted through the target object .
we describe the target object density as the function of the ( x , y ) coordinate and assume that the detectors are aligned along the s axis that is rotated in . we can thus denote the relationship between the ( x , y ) and ( s , t ) coordinates as a rotation
( 1)(st)=(cossinsincos)(xy ) .
we describe the density of the target as (x , y , z ) , that is , (x , y , z ) represents the absorption coefficients of the x - ray in the case of x - ray ct observation .
the detectors are aligned on the s axis , so we describe the observation (s , , z ) as the following formulation , called radon transform :
( 2)(s,,z)=dt(x , y , z)=dt(x(s , t),y(s , t),z ) .
before introducing the bayes inference , we formulate the conventional filtered backprojection ( fbp ) method .
this reconstruction method is mainly formulated on the frequency domain , so we introduce the 2-dimensional fourier transform of the reconstruction image (x , y ) and its inverse transform pair as
( 3)(x,y)=dx dy (x , y)e2j(xx+yy ) ,
( 4)(x , y)=dx dy (x,y)e2j(xx+yy ) ,
where the ( x,y ) represents the frequency space coordinate . meanwhile , we can apply a 1-dimensional fourier transform for the s of the observed data (s , ) as (s, ) . the (s, ) satisfies the following relationship , which is called a projection theorem :
( 5)(s,,z)=(scos,ssin,z ) .
the fbp method is derived as a coordinate transformation from cartesian coordinate ( x,y ) into the polar coordinate ( s, ) in the inverse fourier transform ( 4 )
( 6)(x , y , z)=0dds|s|(scos,ssin)e2jss
( 7)=0dg(s, ) ,
where
( 8)g(s,)=ds|s|(s, ) e2jss ,
since we can assume that the reconstruction image (x , y ) should be identical to the original image (x , y ) without the observation noise , and we can apply the projection theorem in ( 5 ) .
thus , the reconstructed image (x , y ) can be obtained by substituting the coordinate relationship s = xcos + ysin , that is derived from the rotation coordinate in ( 1 ) into ( 7 ) .
we call this reconstruction method the fbp method [ 1 , 2 ] . in this section ,
of course , it is natural to consider poissonian noise for observation in a realistic model ; however , introducing poissonian process makes it hard to solve the reconstruction in analytic form .
so in our theoretical framework , we introduced additive white gaussian noise for observation on the signal (x , y ) .
when we consider the gaussian noise np(x , y ) on the image (x , y ) , the observation through the radon transform (s , ) can be described as
( 9)(s,)=dt((x , y)+np(x , y))=dt(x , y)+np(s, ) ,
where np(s , ) = dt np(x , y ) , and we also treat it as gaussian noise . in the manner of the conventional image restoration method proposed by tanaka and inoue , we also introduce the energy function hn( | ) as follows [ 14 , 16 ] :
( 10)hn( )=420dds((s,)dt(x , y))2 .
the important point of ( 10 ) is that the energy function hn( | ) is defined as a kind of quadrature form of the difference between observation (s , ) and the radon transform of the reconstruction image dt(x , y ) .
we can thus denote the observation process as
( 11)p( )=1zn()exp(hn( ) ) ,
( 12)zn()=exp(hn( ) ) ,
where zn( ) is to normalize a factor called the partition function .
the hyperparameter represents a precision parameter that is proportionate to the inverse of the variance of the gaussian noise np(s , ) , that is , the large indicates a good s / n ratio in the observation .
moreover , introducing both a polar coordinate for the frequency domain and planchrel 's theorem , we can drive the following expression :
( 13)p( )=1zn()exp(42dds |s,s,|2 ) ,
where s,=(s, ) and s,=(scos,ssin ) . in the following formulation , we adopt these expressions for the polar coordinate in the frequency domain description for the sake of convenience . to reconstruct an image from noisy data , using bayes inference
, we also denote the prior distribution . at first , we introduce the following energy function hmrf( ) for smoothness of the image :
( 14)hmrf()=dx dy ||(x , y)||2 ,
where means gradient operator = ( /x , /y ) .
this energy plays a role in the markov random field ( mrf ) like a constraint since the gradient operation in the discretized space can be regarded as the difference between the neighboring pixels .
so , this constraint controls neighboring pixel values to become similar to the target pixel .
then , we also introduce the following energy constraint to avoid taking large absolute pixel values :
( 15)hl2()=dx dy||(x , y)||2 ,
which are sometimes called l2 constraint .
hence , we treat the prior as gibbs - boltzmann distribution of the linear combination of energies hmrf( ) and hl2( )
( 16)p()=1zpri(,h)exp(hmrf()42hhl2( ) ) ,
( 17)zpri(,h)=exp(hmrf()42hhl2( ) ) .
the prior probability can thus be described as follows when we adopt the polar coordinate in the frequency domain :
( 18)p()=1zpri(,h)exp(42dds(s2+h)|s||s,|2 ) .
from ( 13 ) and
( 18 ) , we can derive the posterior probability with bayes theorem p( | ) = p( | )p()/p( | )p( ) .
then , we can describe the posterior as
( 19)p( )exp(420dds fs|s,fss,|2 ) ,
where fs=(s2+h)|s|+. in order to calculate the denominator value called partition function , we discretize the integral description in the partition function over polar coordinate in frequency domain .
when we denote the sampling width for radial direction and polar angle as s and , respectively , the discretized sampling point ( sk,l ) can be described as sk=ks and l = l , respectively , where k and l represent the indexes of the radial direction and the polar angle .
therefore , we assume that the observation is carried out n times in the angle [ 0 , ] , that is , = /n. the coordinate value sk represents the position in the radial direction , which means the spatial frequency described in the fourier transform . from the nyquist frequency , we can denote s=1/nss , where s is an interspace of the detectors in the array .
we assume the length of detectors array as l , and ns detectors are assigned with the same interspace in the array , so s = l / ns . when we discretize the integral ds in the posterior as kns-1s , we can derive the marginalized posterior probability as a gaussian distribution
( 20)p(k,l )=(k,l fkk,l , ns82sfk ) ,
where the descriptions k,l , k,l , and fk represent k,l=(skcosl , sksinl ) , k,l=(sk,l ) , and fk=fsk=(sk2+h)|sk|+ , respectively .
thus , { s, } , which represents an average set of fourier expressions , is required to obtain the mean pixel value over the posterior (x , y). we can evaluate s, by discretizing the coordinate as in the previous section , thereby obtaining
( 22)k,l=fkk,l .
this solution , called the posterior mean ( pm ) solution , provides identical result as the map does , that is , energy function hn( ) minimization with the constraint of the smoothness of hmrf( ) and hl2( ) ,
( 23)map = argmaxlnp( )p()=argmin(42hn( ) + hmrf()+42hhl2( ) ) .
of course , pm solution is not identical to map solution in general ; however , in this case , the pm solution and the map solution are identical , because the posterior distribution is denoted as a gaussian distribution . to reconstruct an appropriate tomography image with our bayesian inference , we need to assign proper values to the hyperparameters , h , and . these hyperparameters and h control the strength of constraints , while controls the fidelity of the observation .
we infer these hyperparameters by using maximization of marginal log likelihood , which is sometimes called evidence framework [ 911 ] .
the marginal log - likelihood is denoted as the linear combination of log partition functions ,
( 24)lnp( ,h,)=lnzpost(,h,)lnzn()lnzpri(,h ) ,
where zn( ) is also denoted as ( 12 ) , zpri( , h ) is denoted as ( 17 ) , and , for the posterior , we introduce zpost( , h , ) ;
( 25)zpost(,h,)=exp(42hn( ) hmrf()42hhl2( ) ) .
we use discretization to evaluate each partition function and obtain
( 26)lnzpri(,h)=n2k=0ns1ln(sk2+h),lnzn()=nns2ln,lnzpost(,h,)=42snsk=0ns1(1fk ) |k,l|2n2k=0ns1lnfk.
to maximize the marginal log likelihood ( 24 ) , we adopt a naive gradient method corresponding to the hyperparameters , h , and , that is , we update hyperparameters using the following rule :
( 27)(lnt+1lnht+1lnt+1)=(lntlnhtlnt)+(lnp( t , ht,t)lntlnp( t , ht,t)lnhhtlnp( t , ht,t)lnht ) ,
where is a sufficiently small value . those update rules ( 27 )
are denoted for ln , lnh , and ln , since , h , and should be nonnegative values .
in the computer simulation , we created the shepp and logan phantom image in nxny ( pixels ) and mapped the image into an origin - centered square with an edge length set to l , that is , the area is set to [ l/2 , l/2 ] [ l/2 , l/2 ] . in the square ,
the area , which takes distance from the origin larger than l/2 , is sometimes unobservable by the detectors from several angles , and we therefore ignore this area during our evaluation . for each angle l , we assume the s axis as figure 1 , and the origin in the ( x , y ) coordinate projects to the point s = 0 in any angle .
we set the sampling parameters as nx = ny = n = ns = 256 , and the length of the detectors array as l = 1 . for hyperparameter inference
, we adopt a gradient method that requires initial state of these parameters . in the following simulations , the initial state of , h , and
the number of iterations is limited to the 10000 times . in order to evaluate the performance of the hyperparameter inference ,
we assumed that the gaussian noise np(x , y ) was added during the observation process ( see ( 9 ) ) and controlled the noise standard deviation ( sd ) in the range of 0 to 6 .
a small sd means the low noise level in the observation process , and the larger sd becomes , the higher additive gaussian noise level becomes . on the other hand ,
the mrf like prior ( 16 ) plays a roll of compensation for the information loss . in the simulation
, gaussian noise value sometimes makes fluctuation to the result , so we evaluated the average performance over 10 trials .
the computational cost is mainly consumed by hyperparameters inference . in this study , we adopted gradient method for the hyperparameter inference , so the computational cost depends on the initial state of these hyperparameters and learning coefficients . in typical cases , about 1000~2000 iterations are required to converge for the = 10 .
it takes 1~2 minutes for intel xeon e5530 2.40 ghz with 24 gib memory .
the most left image shows the true which means a reconstruction image without any observation noise ( sd = 0.0 ) . the top part shows the result using our bayesian inference with inferred hyperparameters , and the bottom one shows the result using the conventional fbp method .
each column corresponds to the sd of the additive gaussian noise np(x , y ) . in figure 2 , we show magnification of each reconstructed image around the edge whose location is located as the white rectangle in the true image . the degradation of the image in the conventional fbp result when the noise sd is large is clearly visible , whereas the contrast of the image has been maintained in the bayesian reconstruction result .
we used the peak signal - to - noise ratio ( psnr ) to evaluate the quality of the reconstructed image .
the horizontal axis indicates the sd of the np(x , y ) , and the vertical shows the psnr between the reconstructed image for both a noised and noiseless reconstruction images .
the solid line shows the median of the bayesian inference reconstruction results for 10 trials , and each box plot shows the quartiles deviations .
even when the sd of the noise was 4.0 , the psnr value remained 27.5 ( db ) . on the other hand ,
the psnr of the conventional fbp method was degraded and became 27.7 [ db ] when the sd is only 1.5 .
this demonstrated that the bayesian inference is more robust to the observation noise rather than the conventional fbp method .
figure 4 shows the reconstruction performance against the hyperparameter . the horizontal axis shows the value of the hyperparameter , and the vertical one shows the psnr .
the hyperparameter controls the smoothness of the image in the prior equation ( 16 ) , so too much large makes excessive blurring .
our hyperparameter inference algorithm , shown in the filled rectangle in the figure , looks to provide optimal value .
gauss noise observation is the assumed model in our formulation equation ( 9 ) ; however , the ct / pet observation process is usually described as the poissonian process .
thus , we should evaluate the reconstruction quality for the poissonian noise case for the more realistic environment .
of course , our model is designed for the gaussian noise case , so the performance of reconstruction for the poissonian process observation might become worse ; however , quantitative evaluation is important in the meaning of the approximation . in the computer simulation
the poissonian noise value is generated by acceptance - rejection method [ 18 , 19 ] .
hence , the number of the samplings determines the noise strength property corresponding to the sds in the gaussian case , that is , less number of the samplings make low signal - to - noise ratio .
the computational cost is also consumed by hyperparameter inference , and it takes about 1000 times iterations for the = 10 , that is , it requires ~1 minute for the convergence in our computational environment .
the top part shows the result of our bayesian reconstruction images , and the bottom one shows the conventional fbp result .
the most left image shows also the true image that means a reconstructed image without any poissonian noise .
in other columns , we show the image with poissonian noise whose strength is controlled by sampling levels , that is , the s / n ratio becomes worse when sampling level becomes low . in the figure , the noise strength becomes large for the right direction .
figure 6 shows the quantity evaluation result in the meaning of the psnr against the sampling level of the observation .
the horizontal axis shows the sampling level , and the vertical one shows the psnr .
the solid line shows the median of 10 trials for our bayesian reconstruction method , and the box plots are quartiles for each sampling levels .
roughly speaking , the bayes reconstruction shows better result in the meaning of the psnr . in order to evaluate the performance of our method for the ct / pet image
the acquisition parameters of those hrct images are as follows : toshiba aquilion 16 is used for imaging device , and each slice image consists of 512 512 pixels , and pixel size corresponds to 0.546~0.826 mm ; slice thickness is 1 mm .
thus , we set the sampling parameters as nx = ny = n = ns = 512 . in order to obtain noise - corrupted data
, we simulate gaussian and poissonian noised observation for these ct images in the same manner with phantom images .
figure 7 shows a reconstruction result for the real chest ct image with gaussian noise .
the top row shows our bayesian method , and the bottom one shows the conventional fbp results .
each column corresponds to the additive gaussian noise strength for pseudo - observation . in each image
, we show a magnification part around bronchus , whose location is described as a black rectangle in the true image . in the bayesian reconstruction ,
the hyperparameter inference mechanism would try to compensate for the information loss , which is caused by the observation noise , by use of the mrf prior . as a result ,
the large sd makes strong blurring effect to the image . in the magnification image of the bayesian inference ,
the bronchus parts are hard to identify around sd > 4.0 , however , vessels along the bronchus are able to identify for these sds . in contrast , in the conventional fbp results , both of those parts are just difficult to identify for these sds .
in contrast , low sampling level makes large blurring effect by the mrf prior . as a result ,
moreover , we evaluate the quantitative reconstruction performance by psnr for the real ct image .
figure 9 shows the result for the gaussian noise case , and figure 10 shows the one for the poissonian case .
each horizontal axis means the noise strength control variable , and the vertical shows the reconstruction performance by psnr . in both of these results ,
in contrast , in the weak noise area , the bayes reconstruction result is just worse than that of the conventional method .
we can see that the real ct image is more complex than the shepp and logan phantom image like figure 5 , and simple mrf like prior ( 16 ) prefers smooth image .
thus , in the weak noise area , complex shape in the real image makes overestimate for the prior strength , which controls blurring effect by the prior . as a result
, our bayesian reconstruction method prefers too much smooth image in the weak noise area ; however , the psnr value stays around 30 ( db ) for the sd = 2 in the gaussian case and around 28 ( db ) for the 2560 samplings in the poissonian case .
we proposed a hyperparameter inference based on the bayesian inference in order to reconstruct tomography image formulated by radon transform .
as a stochastic model , we introduced a simple mrf - like distribution p( ) for the prior and formulated the observation process p( | ) by assuming the gaussian noise channel .
we discretized the image signals in the frequency domain expressed by the polar coordinate in order to evaluate the posterior distribution analytically , resulting in the ability to conduct posterior mean for the reconstructed image . using the marginal - likelihood maximization method
, we show that the hyperparameters introduced as , h , and , which allows us to maintain a balance between observation fidelity and prior constraint , could be determined automatically . and using those hyperparameters , we could obtain a higher - quality reconstructed image than when using the conventional fbp method . in order to evaluate the performance of our method , we simulated two observation noise cases , that is , gaussian and poissonian noises
. we controlled noise strength by sd for gaussian noise and sampling levels for poissonian noise . in the phantom simulation for the gaussian noise
, we confirmed that our hyperparameter inference worked well against the psnr , and the performance for the reconstruction was better than that of the conventional fbp .
the computational cost for the hyperparameter inference depend on the initial state of them ; however , about 1200~2000 times iterations made convergence to them for typical cases . in the poissonian cases ,
our bayesian method made better performance than the conventional fbp in any noise strength area .
however , in the strong poissonian noise case , that is , the noise could not approximate well by gaussian noise , we confirmed that the performance of the reconstruction was not good enough for diagnosing .
thus , in the low - noise strength area for both noise cases , the prior components worked too much for the smoothness effect . as a result ,
the psnr was just worse than the conventional fbp in such area . however , detail structure of the organ was easy to identify in the obtained image of our model . in this study , we demonstrate applying our algorithm to the only 2-dimensional image reconstruction .
thus , we would reformulate our algorithm for applying to the 3-dimensional image reconstruction and confirm the performance in the future work . | we develop a
hyperparameter inference method for image
reconstruction from radon transform
which often appears in the computed tomography , in the manner of
bayesian inference .
hyperparameters are often introduced in
bayesian inference to control the strength ratio between prior
information and the fidelity to the observation .
since the quality
of the reconstructed image is controlled by the estimation
accuracy of these hyperparameters , we apply bayesian inference
into the filtered back - projection ( fbp ) reconstruction method with
hyperparameters inference and demonstrate that the estimated
hyperparameters can adapt to the noise level in the observation
automatically . in the computer simulation , at first , we show that our
algorithm works well in the model framework environment , that
is , observation noise is an additive white gaussian noise case .
then ,
we also show that our algorithm works well in the more realistic
environment , that is , observation noise is poissonian noise case .
after that , we demonstrate an application for the real chest ct
image reconstruction under the gaussian and poissonian observation
noises . | 1. Introduction
2. Formulation
3. Evaluation by a Computer Simulation
4. Conclusion |
does this situation reflect the overall difficulty of modern drug development wherein development and approval of a new drug may take two decades or longer ? or does it reflect the complexity of cftr function and subsequent disease manifestations ( cuthbert , 2011 ) ? likely both . primarily studied and defined as a chloride ion channel regulating mucosal fluid composition , cftr can also transport bicarbonate and can regulate the epithelial sodium channel enac , the outwardly rectifying chloride channel orcc , and two inwardly rectifying k channels ( romk1 and romk2 ) .
cftr also transports atp and glutathione , and may regulate the ph of intracellular organelles .
however , it seems that the bicarbonate transport function of cftr is central to one set of manifestations of cf : the thick mucus secretions in the gi tract and lung and the impacted ducts in the pancreas .
gi problems are still a fundamental aspect of cf , although medical management via pancreatic enzymes and nutritional supplements has dealt with this problem relatively effectively .
many , but not all , mouse models of cf mimic the gi pathology seen in untreated human cf disease ( guilbault et al .
, 2007 ) , and cf mice must often be maintained on laxatives and liquid diets .
cf pigs ( ostedgaard et al . , 2011 ) and ferrets ( sun et al . , 2010 ) also show gi disease , which manifests as meconium ileus at birth and requires proper management . cloning a wild - type cftr gene in front of
an intestinal - specific promoter led to proper synthesis of cftr in the ferret gi tract and alleviated the gi manifestations of the disease ; this strategy was also used to create transgenic cf mice with normal gi tract function ( zhou et al . , 1994 ) .
in 2008 , quinton proposed ( quinton , 2008 ) that the highly compacted mucins in intracellular granules are held together by ca and h cations , and that removal of these cations by bicarbonate is critical for mucin unfolding and expansion . accordingly a bicarbonate transport defect such as that in cf would result in a hco3 anion - poor extracellular milieu that could not remove the ca cations and would leave the mucins compacted , not readily soluble , and thus poorly transportable , as shown in the mouse intestine ( garcia et al . , 2009 ) .
in this issue of the journal of experimental medicine , gustafsson et al . confirm that bicarbonate plays a crucial role in increasing local ph and removing ca cations to facilitate unpacking of mucins secreted from goblet cells .
they demonstrate that adding bicarbonate to cf mouse intestinal mucus led to normal mucin unfolding and function .
can we exploit this knowledge of the importance of cftr - secreted bicarbonate to treat other disease manifestations of cf ?
this depends , in part , on the degree to which poor mucus transport plays a role in chronic infection and inflammation in the lungs of cf patients .
many investigators believe that defective mucus transport does contribute to cf lung disease ( clunes and boucher , 2007 ) , and numerous therapies directed at enhancing mucus transport have been developed or are under investigation .
but there remains a fundamental problem with this hypothesis ; it fails to explain the observation that infection with pseudomonas aeruginosa , more specifically the mucoid phenotype of p. aeruginosa that emerges in the cf lung , is the predominant cause of pulmonary decline in cf patients .
although a progression of pathogens , notably nontypable hemophilus influenzae and staphylococcus aureus , have been seen in early cf lung disease for years , the vast majority of papers examining correlates of lung function decline in cf find p. aeruginosa infection to be the primary factor ( mott et al . , 2012 ) .
some papers have associated lung function decline with infection by methicillin - resistant s. aureus and streptococcus milleri ( cohen and prince , 2012 ) ; and rapid declines in cf patients conditions have also been associated with burkholderia infections ( courtney et al . , 2007 ) .
however , most of these later infections occur in addition to preexisting p. aeruginosa infection .
more recent high - throughput sequencing techniques revealed microbial dna in lung secretions of cf patients ( zemanick et al . , 2011 ) ; however , the actual impact of these diverse microbial communities on airway disease is mostly speculative .
overall , it is still mucoid p. aeruginosa that drives lung function decline in cf , and how this specificity is accounted for by defects in lung mucociliary transport is unexplained .
would aerosolized bicarbonate have a therapeutic role in cf lung disease by allowing proper unfolding of airway mucins ? perhaps .
even if defective mucociliary clearance does not underlie many of the manifestations of mucoid p. aeruginosa infection in cf , enhancing microbial clearance by promoting mucociliary transport has potential .
the success of hypertonic saline aerosolization in improving the lung function in some but not all groups of cf patients supports the utility of developing strategies to enhance mucociliary transport ; however , recent investigations into how hypertonic saline inhalation therapy works suggests it also has antiinflammatory and antimicrobial effects that could contribute to the benefit of this therapy ( reeves et al . , 2012 ) .
overall , we do nt know how much defective mucociliary transport contributes to initiation or progression of chronic p. aeruginosa infection in cf , but as long as there is a safe means to aerosolize bicarbonate , there seems to be no reason not to try this strategy .
many studies implicate immune system dysfunction in driving the progression of lung disease in cf ( cohen and prince , 2012 ; ratner and mueller , 2012 ) .
few provide an explanation for the highly specific association between cf and p. aeruginosa infection .
my group over the past 15 yr has provided evidence that cftr itself is a receptor for p. aeruginosa and that binding of this organism to cftr activates host defenses needed to clear the organism from the lung ( campodnico et al . , 2008 ; fig .
1 ) . the key component here is the recruitment of polymorphonuclear neutrophils ( pmn ) to the lung , where they phagocytose and kill p. aeruginosa .
binding of the outer lps core of nonmucoid p. aeruginosa to the first extracellular loop of cftr initiates formation of lipid rafts incorporating molecules such as caveolin and major vault protein ; lung epithelial cells then internalize the bacteria and release il-1 .
this il-1 signals through the il-1 receptor and myd88 adaptor protein , ultimately leading to nf-b nuclear translocation and synthesis of cytokines ( e.g. , il-6 , il-8 , ccl1 ) that recruit pmns ( fig . 1 ; reiniger et al . , 2007 ) . in individuals with wt cftr this process effectively controls p. aeruginosa lung infection .
it is noteworthy that the mucoid , lps rough p. aeruginosa that emerge as the main pathogen in cf do not bind cftr because of alterations in the lps outer core structure and overproduction of alginate ( massengale et al . , 2000 ) .
however , even in the presence of wt cftr , in the absence of rapid and effective pmn lung recruitment ( e.g. , in neutropenic mice or myd88-deficient mice ; koh et al . , 2009 ) , the lethal infectious dose of p. aeruginosa applied to the nares plunges from 10 cfu to < 60 cfu , and for some strains as few as 10 cfu is a lethal dose .
neutropenic and myd88-deficient humans are at high risk for p. aeruginosa infections ( von bernuth et al . , 2008 ; kerr and snelling , 2009 ) . an early failure to clear p. aeruginosa may then allow bacterial attachment to and entry into stagnant cf mucus ; this may be the next key step in establishment of chronic p. aeruginosa lung infection in cf , and the place where mucolytic agents or inhaled bicarbonate might be effective .
protection versus susceptibility to p. aeruginosa infection in lungs expressing wild - type or mutant cftr .
( a ) proposed factors responding to p. aeruginosa in the airway of humans with intact , wild - type cftr . some of the bacteria in normal mucus with properly unfolded mucins bind to cftr in the plasma membrane , initiating rapid ( 215 min ) il-1 release ; the resulting il-1 triggers autocrine or paracrine signaling through the il-1 receptor .
bacteria binding to cftr also initiates formation of lipid rafts and recruitment of caveolin , major vault protein ( mvp ) , and other proteins to the rafts ; this is followed by bacterial internalization .
these processes leads to myd88-dependent activation and nuclear translocation of nf-b and regulated inflammatory responses involving production of il-6 and il-8 and increases in icam-1 and gro-1 ( cxcl1 ) , all of which participate in recruitment of polymorphonuclear neutrophils ( pmn ) to the airway mucosa .
the remaining , viable p. aeruginosa are phagocytosed and killed , and those entrapped within epithelial cells are carried out in the mucus .
( b ) on the cf airway surface , lack of functional cftr , such as the f508 variant that is unable to make it to the plasma membrane , leaves the p. aeruginosa bacteria trapped in the mucus , which is dehydrated and more viscous because of the compacted mucins released from the secretory granules of goblet cells .
pmn recruitment does occur , but in a dysregulated , uncoordinated , and slower fashion , and when the pmn do arrive their ability to phagocytose the p. aeruginosa cells trapped within the airway mucus is poor .
the pmn undergo necrosis instead of apoptosis , and this results in a failure to clear bacteria and resolve inflammation .
the chronic infection is perpetuated by an ineffective adaptive immune response , allowing the progression of chronic infection , inflammation , and destruction of lung tissue .
once infection is established and bacterial levels increase , p. aeruginosa must evade adaptive immunity . within the cf lung major changes in the phenotype of p. aeruginosa
these result in the overproduction of the cell surface polysaccharide alginate , loss of the lps o antigen ( campodnico et al . , 2008 ) , and accumulation of dna mutations caused by mutations affecting the dna repair enzyme muts ( oliver and mena , 2010 ) .
thus , the organism presents an ever - changing set of antigens for adaptive host immune responses . as cf patients do not have known defects in adaptive immunity , why ca nt they mount an effective immune response to clear p. aeruginosa ? some do , as it was shown almost 25 yr ago that a small subset of cf patients > 12 yr old remained uninfected and had serum antibodies that recognize alginate and facilitate opsonic killing ( pier et al . , 1987 ) .
this antibody is not found in other cf patients or even in healthy humans , most of whom produce natural nonopsonic / nonprotective antibodies to alginate .
engineering alginate to induce opsonic antibody production has been a major challenge and , to date , not highly successful , thus preventing pursuit of alginate vaccines in cf patients .
a fully human igg1 mab to alginate , which is opsonic and protective in animals , has been made ( pier et al . , 2004 ) but
other potential conserved antigens of p. aeruginosa that could be targeted for vaccination or passive mab therapy include oprs , the lps core , and two other surface polysaccharides known as pel and psl .
these latter two antigens , along with alginate and dna , participate in biofilm formation by p. aeruginosa .
psl is also involved in attachment of p. aeruginosa to host cells ( ghafoor et al . ,
1988 ) as a neutral polysaccharide present in the lps of different strains of p. aeruginosa .
no definitive chemical linkage of psl to the lps has been established , and its role in immunity has not been explored . in this issue of the journal of experimental medicine , in a robust display of modern technology , digiandomenico et al . screened single - chain variable fragment antibody - producing phage libraries expressing antibody v regions genes isolated from both healthy humans and those recovering from p. aeruginosa infection .
they identified several antibodies that bound to distinct epitopes on p. aeruginosa psl and , when one of these was engineered into a human igg1 expression vector , it bound to many strains of p. aeruginosa , mediated opsonic killing and showed protective efficacy in several animal models of infection .
the potential of the mab as an immunotherapeutic is thus strong , but important questions remain , particularly for testing in cf patients . as digiandomenico
et al . ( 2012 ) found that the psl polysaccharide was not essential for virulence in animal models , the microbe may escape immune defenses targeted to psl .
alginate , also produced by most strains of p. aeruginosa , is essential for chronic but not acute p. aeruginosa infection ( campodnico et al . , 2008 ) .
another question to be asked regarding the mab to psl is whether or not infected cf patients have opsonic antibody to psl , and whether disease progresses regardless of the presence of the antibody . also of importance is whether the effects of the mab to psl are manifest when p. aeruginosa is growing in a microcolony within the cf lung . if not , the mab to psl might be more useful for preventing infection or controlling it at an early stage of cf , as is now being done by early administration of antibiotics .
efficacy and cost considerations will drive the decision as to whether routine antibody administration to cf patients is warranted .
currently , significant issues related to compliance and safety impact the efficacy and use of at - home inhaled antibiotics in cf , although this might be improved by newer dry - powder formulations that can be administered in a short time period . however , if a mab is at least as efficacious and cost - competitive as inhaled antibiotics , clinician - observed administration of this mab every 36 mo could be an important advance in the immunotherapy of cf patients .
finally , an effective vaccine capable of inducing antibodies to psl , alginate and/or similar antigens would be the most desirous outcome of all for preventing p. aeruginosa infection . | therapeutic intervention in cystic fibrosis ( cf ) remains a challenge , partly because of the number of organs and tissues affected by the lack of a functional cystic fibrosis transmembrane conductance regulator ( cftr ) protein .
cf was originally regarded primarily as a gastrointestinal ( gi ) disease because of the failure to thrive and early death from malnutrition in infants with cf . however , successful interventions for the gi manifestations of cf have left chronic lung infections as the primary cause of morbidity and mortality . despite a complex microbiology within the cf lung , one pathogen , pseudomonas aeruginosa ,
remains the critical determinant of pulmonary pathology .
treatment and management of this infection and its associated symptoms are the major targets of extant and developing cf therapies .
understanding the multitude of effects of cftr on mucosal physiology and susceptibility and progression of chronic lung disease , and how host immune responses fail to adequately control lung infection , will be essential for the development of improved therapies for cf . | CFTR functions in disease: the role of bicarbonate
Mucociliary transport and chronic lung infection in CF
Establishment and progression of chronic lung infection |
following endodontic treatment , there is a decrease in the fracture resistance of the teeth .
this is also seen after the preparation of wide mesio - occluso - distal ( mod ) cavities .
an ideal restoration for a tooth is able to maintain the aesthetics and function , preserve the remaining tooth structure and prevent the microleakage .
indirect restorative procedures such as metallic post and core fabrication followed by full crown are customary
. however , there may be cases where the tooth is still erupting , or where the tooth or root canal therapy has a questionable prognosis , or where the clinician wants to wait and evaluate the healing of a periapical lesion before proceeding with full crown restorations . to prevent the failure of root canal treatment , a simple , quick , high strength
adhesive technology is advancing by leaps and bounds every day , making it possible to create conservative and highly aesthetic restorations with direct bonding to the teeth . a significant increase in the fracture resistance of root filled teeth
was observed when they were intracoronally restored with a resin composite material . reinforcing composites with polyethylene fibres and glass fibres
has successfully provided superior results.[57 ] however , there are no studies comparing the two in direct composite restorations .
the aim of this study was to evaluate the fracture resistance of endodontically treated maxillary premolars with wide mesio - occluso - distal ( mod ) cavities restored with either composite resin , composite resin reinforced with a polyethylene fibre , or composite resin reinforced with a composite impregnated glass fibre .
all the specimens were scaled to remove the adhering soft tissue and calculus , and were stored in physiologic saline .
five intact teeth were used as positive controls and endodontic access cavities were prepared in forty five teeth using a water cooled diamond bur ( endo access bur ; dentsply ) with an airotor hand piece , and the pulp tissue was removed with barbed broaches . a size 15 k - file ( mani prime dental pvt . ltd . )
the canals were prepared with protaper ( dentsply maillefer ) nickel titanium ( ni - ti ) instruments using a 1:64 reduction handpiece ( anthogyr niti control ; dentsply ) at a speed of 300 revolutions per minute .
canals were shaped till the working length using the s1 and s2 files , and the apical third of the canal was finished using finishing file f1 and later f2 .
copious irrigation using 5 ml of 5.25% sodium hypochlorite was carried out throughout the procedure .
obturation was donewith protaper gutta percha points and ah plus root canal sealer ( dentsply de trey , konstanz , germany ) using a cold lateral condensation technique .
mod cavities were prepared in the teeth using an airotor hand piece with a long straight fissure diamond point ( sf-12c ; mani dia burs ) .
the dimensions of the cavity were decided with the help of a periodontal probe to standardize the remaining tooth structure .
the remaining thickness of the buccal and lingual wall of the teeth was 2.5 mm from the height of contour of the buccal and lingual surface till the buccal and lingual cavity walls , and the gingival cavosurface margin was 1.5 mm above the cement - enamel junction ( cej ) [ figure 1a ] .
( a ) standardized dimensions of mesio - occluso - distal cavity ( b ) preparation of bucco - occluso - lingual groove subsequently , the teeth were randomly divided into three groups ( n = 15 ) :
group a - preparations restored with composite , without fibre ( n = 15)group b - preparations restored with composite impregnated with glass fibre ( n = 15)group c - preparations restored with composite impregnated with polyethylene fibre ( n = 15)positive control - intact teeth ( n = 5 )
group a - preparations restored with composite , without fibre ( n = 15 ) group b - preparations restored with composite impregnated with glass fibre ( n = 15 ) group c - preparations restored with composite impregnated with polyethylene fibre ( n = 15 ) positive control - intact teeth ( n = 5 ) cavities were cleaned , dried , and etched with 35% phosphoric acid ( scotch bond multi purpose etchant ; 3 m espe , st .
the tooth surfaces were then rinsed for 10 seconds and gently dried for 1 - 2 seconds .
subsequently , a single bottle total etch adhesive ( adper single bond 2 ; 3 m espe , st .
paul , mn , usa ) was applied and photocured using light - emitting diode ( led ) ( ledition ; ivoclar vivadent ) at 600 mw / cm for 10 seconds .
light intensity output was verified after every 10 samples using a digital read out light meter .
tofflemire retainer and matrix band were applied and the preparations were restored with a nanocomposite ( filtek z350 xt ; 3 m espe , st .
the layers were placed at a 1.5 mm thickness and cured for 40 seconds according to the manufacturer 's instruction .
after restoring the preparation as described for group a , a groove 2 mm wide and 1 mm deep was prepared buccolingually on the occlusal surface of the restoration and cusp tips .
the ends of the groove were on the occlusal third of the buccal and lingual surfaces of the tooth [ figure 1b ] .
after etching the grooves , single bottle total etch adhesive was applied and cured for 10 seconds .
flowable composite with 10 mm of composite impregnated glass fibre ( interlig ; angelus , londrina pr , brazil ) was placed on the floor of the groove and light cured for 20 seconds .
a layer of the nanocomposite was added to cover the exposed fibre surface and cured from the occlusal direction for 40 seconds according to manufacturer 's instructions .
buccolingual grooves were prepared , etched and bonded in a manner similar to group b. flowable composite resin with 10 mm of polyethylene fibre ( ribbond ; ribbond inc . ,
seattle , wa , usa ) which had been saturated with the unfilled resin ( scotch bond multi purpose plus ; 3 m espe , st .
paul , mn , usa ) was added to the groove and cured from occlusal direction for 20 seconds .
the exposed surface of the fibre was covered with a layer of the nanocomposite and cured for 40 seconds from the occlusal direction according to the manufacturer 's instructions .
the teeth were then mounted in a block of cold cure acrylic measuring 2 cm in diameter , at cej .
a layer of polyvinyl siloxane was adapted around the root surfaces to simulate the periodontal ligament .
thermocycling was carried out for 500 cycles at 5 to 55c , 30 second dwell time and 5 second transfer time .
all the specimens were stored in an incubator ( ibod ) at 37c and 100% humidity for 24 hours .
the fracture resistance of the teeth was measured using a universal testing machine ( lr 50k ; lloyd instruments ) , under a compressive force at a strain rate of 0.5 mm / min .
a 5 mm diameter round stainless steel ball was positioned parallel to the long axis of the teeth and centered over the teeth until the bar just contacted the occlusal surface of the restoration and the buccal and lingual cusps .
the force needed to fracture each tooth was recorded in newtons.[57 ] the study design was a three arm comparative study where the outcome variable was fracture resistance .
statistical analysis was performed using descriptive statistical methods , one way anova test and the post - hoc tukey test .
the statistical software namely sas 9.2 , spss 15.0 , stata 10.1 , medcalc 9.0.1 , systat 12.0 and r environment ver.2.11.1 were used for the analysis of the data and microsoft word and excel were used to generate graphs , tables etc .
cavities were cleaned , dried , and etched with 35% phosphoric acid ( scotch bond multi purpose etchant ; 3 m espe , st .
the tooth surfaces were then rinsed for 10 seconds and gently dried for 1 - 2 seconds .
subsequently , a single bottle total etch adhesive ( adper single bond 2 ; 3 m espe , st .
paul , mn , usa ) was applied and photocured using light - emitting diode ( led ) ( ledition ; ivoclar vivadent ) at 600 mw / cm for 10 seconds .
light intensity output was verified after every 10 samples using a digital read out light meter .
tofflemire retainer and matrix band were applied and the preparations were restored with a nanocomposite ( filtek z350 xt ; 3 m espe , st .
the layers were placed at a 1.5 mm thickness and cured for 40 seconds according to the manufacturer 's instruction . after restoring the preparation
as described for group a , a groove 2 mm wide and 1 mm deep was prepared buccolingually on the occlusal surface of the restoration and cusp tips .
the ends of the groove were on the occlusal third of the buccal and lingual surfaces of the tooth [ figure 1b ] .
after etching the grooves , single bottle total etch adhesive was applied and cured for 10 seconds .
flowable composite with 10 mm of composite impregnated glass fibre ( interlig ; angelus , londrina pr , brazil ) was placed on the floor of the groove and light cured for 20 seconds .
a layer of the nanocomposite was added to cover the exposed fibre surface and cured from the occlusal direction for 40 seconds according to manufacturer 's instructions .
buccolingual grooves were prepared , etched and bonded in a manner similar to group b. flowable composite resin with 10 mm of polyethylene fibre ( ribbond ; ribbond inc . , seattle , wa , usa ) which had been saturated with the unfilled resin ( scotch bond multi purpose plus ; 3 m espe , st .
paul , mn , usa ) was added to the groove and cured from occlusal direction for 20 seconds .
the exposed surface of the fibre was covered with a layer of the nanocomposite and cured for 40 seconds from the occlusal direction according to the manufacturer 's instructions .
the teeth were then mounted in a block of cold cure acrylic measuring 2 cm in diameter , at cej .
a layer of polyvinyl siloxane was adapted around the root surfaces to simulate the periodontal ligament .
thermocycling was carried out for 500 cycles at 5 to 55c , 30 second dwell time and 5 second transfer time .
all the specimens were stored in an incubator ( ibod ) at 37c and 100% humidity for 24 hours .
the fracture resistance of the teeth was measured using a universal testing machine ( lr 50k ; lloyd instruments ) , under a compressive force at a strain rate of 0.5 mm / min .
a 5 mm diameter round stainless steel ball was positioned parallel to the long axis of the teeth and centered over the teeth until the bar just contacted the occlusal surface of the restoration and the buccal and lingual cusps .
the force needed to fracture each tooth was recorded in newtons.[57 ] the study design was a three arm comparative study where the outcome variable was fracture resistance .
statistical analysis was performed using descriptive statistical methods , one way anova test and the post - hoc tukey test .
the statistical software namely sas 9.2 , spss 15.0 , stata 10.1 , medcalc 9.0.1 , systat 12.0 and r environment ver.2.11.1 were used for the analysis of the data and microsoft word and excel were used to generate graphs , tables etc .
cavities were cleaned , dried , and etched with 35% phosphoric acid ( scotch bond multi purpose etchant ; 3 m espe , st .
the tooth surfaces were then rinsed for 10 seconds and gently dried for 1 - 2 seconds .
subsequently , a single bottle total etch adhesive ( adper single bond 2 ; 3 m espe , st .
paul , mn , usa ) was applied and photocured using light - emitting diode ( led ) ( ledition ; ivoclar vivadent ) at 600 mw / cm for 10 seconds .
light intensity output was verified after every 10 samples using a digital read out light meter .
tofflemire retainer and matrix band were applied and the preparations were restored with a nanocomposite ( filtek z350 xt ; 3 m espe , st .
the layers were placed at a 1.5 mm thickness and cured for 40 seconds according to the manufacturer 's instruction .
after restoring the preparation as described for group a , a groove 2 mm wide and 1 mm deep was prepared buccolingually on the occlusal surface of the restoration and cusp tips .
the ends of the groove were on the occlusal third of the buccal and lingual surfaces of the tooth [ figure 1b ] .
after etching the grooves , single bottle total etch adhesive was applied and cured for 10 seconds .
flowable composite with 10 mm of composite impregnated glass fibre ( interlig ; angelus , londrina pr , brazil ) was placed on the floor of the groove and light cured for 20 seconds .
a layer of the nanocomposite was added to cover the exposed fibre surface and cured from the occlusal direction for 40 seconds according to manufacturer 's instructions .
buccolingual grooves were prepared , etched and bonded in a manner similar to group b. flowable composite resin with 10 mm of polyethylene fibre ( ribbond ; ribbond inc . ,
seattle , wa , usa ) which had been saturated with the unfilled resin ( scotch bond multi purpose plus ; 3 m espe , st .
paul , mn , usa ) was added to the groove and cured from occlusal direction for 20 seconds .
the exposed surface of the fibre was covered with a layer of the nanocomposite and cured for 40 seconds from the occlusal direction according to the manufacturer 's instructions .
the teeth were then mounted in a block of cold cure acrylic measuring 2 cm in diameter , at cej .
a layer of polyvinyl siloxane was adapted around the root surfaces to simulate the periodontal ligament .
thermocycling was carried out for 500 cycles at 5 to 55c , 30 second dwell time and 5 second transfer time .
all the specimens were stored in an incubator ( ibod ) at 37c and 100% humidity for 24 hours .
the fracture resistance of the teeth was measured using a universal testing machine ( lr 50k ; lloyd instruments ) , under a compressive force at a strain rate of 0.5 mm / min .
a 5 mm diameter round stainless steel ball was positioned parallel to the long axis of the teeth and centered over the teeth until the bar just contacted the occlusal surface of the restoration and the buccal and lingual cusps .
the force needed to fracture each tooth was recorded in newtons.[57 ] the study design was a three arm comparative study where the outcome variable was fracture resistance .
statistical analysis was performed using descriptive statistical methods , one way anova test and the post - hoc tukey test .
the statistical software namely sas 9.2 , spss 15.0 , stata 10.1 , medcalc 9.0.1 , systat 12.0 and r environment ver.2.11.1 were used for the analysis of the data and microsoft word and excel were used to generate graphs , tables etc .
highest mean fracture resistance was observed with positive control followed by group b and group a respectively .
one way anova test revealed a significant difference ( p = 0.001 ) between the groups [ table 1 ] [ figure 2 ] . on intergroup comparison , post - hoc tukey test revealed a moderately significant difference between control and group b ( p = 0.034 ) whereas a strongly significant difference was recorded between control and group a ( p = 0.002 ) and between control and group c ( p = 0.001 ) .
no significant difference was recorded between any of the experimental groups ( group a , b and c ) ( p > 0.1 ) [ table 2 ] .
mean fracture resistance in newton ( n ) in all four groups as seen in the study graph depicting mean fracture resistance values pair wise comparison : difference and p value in the study
restoration of root filled teeth , despite posing a major challenge to the clinician , is an essential final step of root canal treatment .
the purpose of the restoration is not only to repair , reinforce and strengthen the tooth , but also to provide an effective seal between the canal system and the mouth .
the gold standard of post endodontic restorations is the full crown ; however , there are situations where the clinician may choose to delay the delivery of the full crown . in such cases , an efficient , direct , high strength
adhesive restorations allow a more efficient transfer and distribution of functional stresses across the bonding interface to the tooth structure .
the smaller size of the fillers allows them to have excellent optical properties along with good mechanical properties . despite the advances in material sciences ,
original ribbond ( group c ) consists of cold plasma treated , leno weave ultra high modulus ( lwuhmw ) polyethylene fibres , which are arranged in a lock - stitch design .
interlig ( group b ) consists of glass fibres pre - impregnated with light curable composite resin arranged in a braided design .
fibres were placed occlusal to the restoration following a technique given by oskoee et al . , and belli et al .. placing fibres on the occlusal surface keeps buccal and lingual cusps together and protects the natural cusps resulting in higher fracture resistance .
in addition , fracture resistance increases when fibres are placed close to the point where the force is exerted because it leads to a shorter working arm according to levers principle .
the results of the present study revealed that the positive control group had highest mean fracture resistance ( 811.90 n ) .
this is in accordance with the study by beli et al . , and also denotes that endodontic and restorative treatment have a detrimental effect on fracture resistance of teeth . among the experimental groups , group b had the highest mean fracture resistance ( 600.49 n ) followed by group a ( 516.96 n ) , and group c ( 514.64 n ) [ table 1 ] [ figure 2 ] .
the one way anova test done in the present study revealed a statistically significant difference ( p = 0.001 ) between all the groups [ table 1 ] .
post - hoc tukey test revealed a moderately significant difference between control and group b ( p = 0.034 ) and a strongly significant difference between control and group a ( p = 0.002 ) , and between control and group c ( p = 0.001 ) .
no significant difference was found between any of the experimental groups ( group a , b and c ) ( p > 0.1 ) [ table 2 ] .
group a showed an acceptable fracture resistance due to the use of nanocomposites in the present study .
the high filler loading enables nanocomposites to demonstrate good physical and mechanical properties and reinforce the tooth structure well .
single bottle total etch system gave evidence of better bond strength than the newer self- etch systems .
the presence of the adhesive layer under the restoration acts as a stress buffer . a study by ausiello et al .
, has shown that an optimal adhesive layer thickness leads to maximum stress release while preserving interface integrity .
the fracture resistance of group a can be attributed to the increase in strain capacity of the adhesive resin and the improved physical and mechanical properties of nanocomposites .
this study recorded that group b had the highest fracture resistance amongst the experimental groups .
the superior performance of group b may be because of the pre - fabricated resin impregnation of these fibres by the manufacturers . also , glass fibres have very high tensile strength , density and percentage of elongation allowing them to withstand high stresses without fracturing .
results of this study were in agreement with the study by kolbeck et al . , who reported the glass fibres performed better than polyethylene fibres due to pre - impregnation with light cured composite which ensures a good bond with the composite resin .
polyethylene fibres have shown high fracture resistance in previous studies . according to the manufacturer original ribbond fibres
are woven using the lock - stitch leno weave which prevents slipping of fibres within resin matrix , prevents micro - cracks from propagating to form larger cracks and reinforces the restoration in multiple directions .
beli et al . , found that insertion of polyethylene fibre in the occlusal third of a composite restoration increased the fracture resistance of root filled teeth compared to teeth restored with composite resin alone .
however , the present study showed that insertion of polyethylene fibre did not significantly increase the fracture resistance of a root filled tooth as compared to teeth restored with composite resin alone ( group a ) ( p > 0.1 ) .
the causes for lower fracture resistance of group c may include the following :
non uniform wetting of fibre with unfilled resin - manual wetting of original ribbond ( group c ) with unfilled adhesive was done as suggested by the manufacturer .
this may lead to areas of non - uniform wetting in the fibre which will affect the adhesion of fibre to resin matrix .
the poorly impregnated regions may become areas of increased water sorption , hence causing deterioration of mechanical properties of the composite .
such voids may also act as oxygen reserves hence preventing complete polymerisation of composite resin.the lwuhmw polyethylene fibre is treated with cold gas plasma to convert the material from hydrophobic to hydrophilic .
this treatment is meant to make the fibre surface more receptive to bonding with the resin however ; it makes the fibre very technique sensitive .
the fibres frayed on cutting , and became very stiff after the wetting procedure.an additional reason for its poor performance may be lower tensile strength , density and elongation compared to glass fibres .
non uniform wetting of fibre with unfilled resin - manual wetting of original ribbond ( group c ) with unfilled adhesive was done as suggested by the manufacturer .
this may lead to areas of non - uniform wetting in the fibre which will affect the adhesion of fibre to resin matrix .
the poorly impregnated regions may become areas of increased water sorption , hence causing deterioration of mechanical properties of the composite .
such voids may also act as oxygen reserves hence preventing complete polymerisation of composite resin .
the lwuhmw polyethylene fibre is treated with cold gas plasma to convert the material from hydrophobic to hydrophilic .
this treatment is meant to make the fibre surface more receptive to bonding with the resin however ; it makes the fibre very technique sensitive .
an additional reason for its poor performance may be lower tensile strength , density and elongation compared to glass fibres . though it was not among the objectives of the study it was observed that the majority of failures in the fibre reinforced groups were favourable in nature .
this can prove immensely beneficial to clinicians as despite fracturing , the tooth remains repairable with techniques such as post and core followed by full crown .
additionally , the study done by reeh et al . , showed a relative loss of stiffness of 5% due to endodontic procedures and 63% in mod cavity preparation whereas the present study found a relatively smaller decrease of 25 - 35% in fracture resistance of root filled teeth with mod cavity preparation restored with nanocomposites or nanocomposites restored with different fibres . despite this decrease in fracture resistance
all the experimental groups demonstrated results much higher than the average normal biting force of human maxillary premolars ( 100 - 300n ) .
forces generated intraorally during function vary in magnitude , speed of application and direction , whereas the forces applied to the teeth in this study were at a constant direction and speed and they increased continuously until fracture occurred .
further in vivo studies should be done to test the reinforcement effect of fibres in clinical situations .
root canal treatment and mod cavity preparation significantly reduced fracture resistance of root filled maxillary premolars ( p = 0.001).even though there was no statistically significant difference between the test groups , the fracture resistance of the composite impregnated glass fibre reinforced group was much higher .
root canal treatment and mod cavity preparation significantly reduced fracture resistance of root filled maxillary premolars ( p = 0.001 ) . even though there was no statistically significant difference between the test groups , the fracture resistance of the composite impregnated glass fibre reinforced group was much higher . | aim : the aim of this study was to evaluate the fracture resistance of endodontically treated maxillary premolars with wide mesio - occluso - distal ( mod ) cavities restored with either composite resin , or composite resin reinforced with different types of fibres .
materials and methods : fifty human maxillary premolars were selected .
five intact teeth served as positive controls .
endodontic therapy was carried out in the remaining forty - five teeth .
standardized mod cavities were prepared in all the teeth .
the teeth were restored with a nanocomposite using an incremental technique .
these forty five teeth were randomly divided into three experimental groups ( group a , b and c ) ( n = 15 ) .
the teeth in group a did not undergo any further procedures .
the teeth in group b and c were reinforced with composite impregnated glass fibre and polyethylene fibre , respectively . fracture resistance was measured in newtons ( n).results : the positive controls showed the highest mean fracture resistance ( 811.90 n ) , followed by group b ( 600.49n ) , group a ( 516.96n ) and group c ( 514.64n ) , respectively
. one way analysis of variance ( anova ) test revealed a statistically significant difference between all the groups ( p = 0.001 ) .
post - hoc tukey test revealed a moderately significant difference ( p = 0.034 ) between control and group b , and a strongly significant difference between control and group a ( p = 0.002 ) , and control and group c ( p = 0.001).conclusions : endodontic therapy and mod cavity preparation significantly reduced the fracture resistance of endodontically treated maxillary premolars ( p = 0.001 ) .
no statistically significant difference was found between the experimental groups ( group a , b and c ) ( p > 0.1 ) . however , the fracture resistance of the composite impregnated glass fibre reinforced group was much higher than the others . | INTRODUCTION
MATERIALS AND METHODS
Preparation of specimens
Group A (No fibre group)
Group B (Composite impregnated glass fibre)
Group C (Polyethylene fibre)
RESULTS
DISCUSSION
CONCLUSIONS |
secondary leukemia or de novo leukemia should be considered when a new leukemia develops after successful treatment of various malignancies .
secondary leukemia refers to the appearance of a new , biologically - unrelated leukemia different from the primary malignancy , following the treatment of the primary malignancy ; de novo leukemia refers to leukemia in patients without exposure to potentially leukemogenic therapies or agents . in patients that undergo allogeneic hematopoietic stem cell transplantation ( hsct ) , the possibility of the appearance of leukemia from allogeneic hematopoiesis ( donor cell leukemia ) as well as de novo or secondary leukemia , which originates in the recipient ,
it is not surprising that a large percentage of patients who develop secondary acute myeloid leukemia ( aml ) were previously treated for hematological disorders but not solid tumors , considering the responsiveness of hematologic malignancies to chemotherapy .
however , in most cases , prior treatment was not for leukemia but for lymphoma and myeloma . indeed , although malignancies after hsct has been well documented , secondary leukemia occurring after hsct for aml is rare .
in addition , most reports of secondary aml follow autologous transplantation , and it is rare following allogeneic transplantation regardless of the primary disease , primarily because the anti - leukemic effects of the allogeneic graft reduce the risk of a secondary clone developing .
we present a case initially diagnosed as a de novo aml without a cytogenetic abnormality .
the patient was successfully treated with a hla - matched sibling allogeneic hsct . however , more than six years later , a second aml developed that was associated with new complex cytogenetic abnormalities .
a 36-year - old man was diagnosed with aml - m1 by the fab classification in april 1998 ( fig .
his chromosome analysis showed a 46 , xy karyotype without any cytogenetic abnormalities ( fig .
he was treated with induction chemotherapy ( idarubicin 12 mg / m / d on days 1 to 3 , enocitabine 300
mg / m / d on days 1 to 7 , 6-thioguanine 100 mg / m , bid on days 1 to 7 ) and augmentation chemotherapy ( enocitabine 400 mg / m / d for 2 days ) .
he achieved a complete remission , and underwent consolidation chemotherapy with amsacrine 100 mg / m / d on days 1 to 3 and etoposide 100 mg / m / d on days 1 to 5 .
the patient had two hla - identical sisters out of his three siblings , and received an allogeneic bone marrow ( bm ) hsct from one of his fully matched sisters on december 1998 ; conditioning included fractionated total body irradiation ( tbi ) 1200 cgy for three days , followed by cyclophosphamide 120 mg / m for two days . on day 21 ,
the first hsct resulted in a continuous , complete remission that lasted seventy three months . on december 2004
, he presented with a hemoglobin of 9.1 g / dl , white blood cells 2.0 10/l and platelets 52 10/l .
a bm aspirate showed that a majority of the nucleated elements were blasts without dysplastic changes ( fig .
cytogenetic analysis showed a complex karyotype : 46,x , der(y)t(y;15)(q11.2;q11.2 ) , del(1)(q32 ) , t(1;3)(p36.1;q21),inv(3)(p21q25),add(4)(p16 ) , del(7)(q22),+8,inv(9)(p13p24),-15,add(16)(p13.3)/46,idem , del(13)(q12q22)/46,xx(fig .
2b ) . molecular analysis with a y - chromosome probe revealed that the abnormal chromosomes originated from the recipient .
the patient achieved morphological and cytogenetic remission again with reinduction chemotherapy ; he underwent a second allogeneic peripheral blood hsct from another human leukocyte antigen - identical sister on may 2005 .
the patient has been followed for over 12 months after the second hsct without serious complications .
this case is characterized by a longer latency period than in previous reports of secondary aml following hematologic and/or non hematologic malignancies as well as rare cases of secondary aml following de novo aml , in the setting of an allograft . in our case
, the new complex cytogenetic aberrations , as well as the allograft setting , suggested that the origin of the second aml might be biologically unrelated to the first .
there are two possible origins for the second aml : a secondary aml , another de novo aml , or perhaps a donor cell leukemia .
secondary aml is primarily associated with therapy - related myelodysplasia and/or therapy - related aml ( t - aml ) as a late complication following cytotoxic therapy [ 1 - 3,5,6 ] .
t - aml consists of 2 different syndromes : one with a long latency ( 5 to 7 years or more ) observed following the administration of alkylating agents , which frequently show antecedent dysplastic changes and clonal abnormalities with loss of all or part of chromosome 5 or 7 , or both .
the other syndrome has a short latency period ( 1 to 3 years ) , with no antecedent dysplastic phase , abnormalities of chromosome 11 , specifically 11q23 , or abnormalities of chromosome 21q22 , and usually follows the use of topoisomerase ii inhibitors .
our patient received topoisomerase ii inhibitors for induction ( idarubicin ) and consolidation ( amsacrine and etoposide ) chemotherapy , and the alkylating agents , tbi / cyclophosphamide , for conditioning therapy . in our case
, the long latency period and cytogenetic abnormalities characterized by deletion of 7q would suggest that the newly developed aml might be a t - aml caused by cyclophosphamide and/or tbi , rather than by topoisomerase ii inhibitors .
however , the dose of cyclophosphamide was much lower than normally associated with t - aml , there were no antecedent dysplastic changes and relatively long latency period , and secondary aml is very rare in the allograft setting , making it difficult to verify this possibility . another possibility is the development of another primary aml , either de novo aml or donor cell leukemia .
however , donor cell leukemia was excluded by cytogenetic studies showing the aberrations associated with a y chromosome . then , is the second de novo aml of recipient origin ?
first , our case had a longer latent period and an allogeneic hsct . generally , in all grafted adult aml
, patients without a relapse or chronic graft - versus - host disease five years after allogeneic hsct are often considered " cured " .
second , deletion of 7q , which may be associated with alkylating agents , often occurs in de novo aml as well as secondary aml .
third , considering the possible graft - versus - leukemia effect of the allograft , our patient was probably cured and then developed a new aml later .
finally , the patient showed a good clinical course after the second allogeneic hsct ; secondary aml due to alkylating agents has a uniformly poor prognosis .
alternatively , the clones found in the second aml may have been undetected subclones at the time of the first aml that later gained proliferative potential after the hsct
. however , this is unlikely and would be difficult to prove even with molecular genetic analysis . in conclusion
, our patient may have had a second de novo aml following successful treatment of the first de novo aml , although we could not rule out other possibilities .
future studies of a patient 's intrinsic genetic makeup may help indicate a predisposition to the rare development of a secondary or de novo aml . | secondary leukemia occurring after hematopoietic stem cell transplantation ( hsct ) for acute myeloid leukemia ( aml ) is rare .
secondary aml usually follows autologous and not allogeneic transplants . when a new leukemia develops in a patient successfully treated with an allogeneic hsct , the possibility of a de novo or secondary leukemia from either the donor or recipient should be considered .
we present a case initially diagnosed as de novo aml without a cytogenetic abnormality .
the patient was successfully treated with an hla - matched sibling allogeneic hsct . however ,
more than six years later , aml developed again and was associated with new complex cytogenetic abnormalities . after a second hsct , the patient has been followed without serious complications .
considering the allogeneic setting , the newly developed cytogenetic abnormalities , a relatively long latent period , and the good clinical course after the second allogeneic hsct , this case might represent a second de novo aml following successful treatment of the first aml . | INTRODUCTION
CASE REPORT
DISCUSSION |
advances in the delivery of radiotherapy treatment , such as multileaf collimators and three - dimensional ( 3d ) treatment planning systems , allow us to plan and deliver increasingly more conformal treatments .
evidence exists for lung , head and neck and prostate cancer that dose escalation leads to improved clinical outcomes . the ability to deliver high dose radiotherapy to
an accurately defined and shaped target volume with minimum dose to surrounding tissues hence improves the therapeutic ratio and reduces normal tissue morbidity .
it is well recognised that there are set up variations on a daily basis during a fractionated course of radiotherapy which may be delivered over up to 3540 treatments .
these result from daily uncertainties in the immobilisation of the patient and their position , patient preparation , staff experience , and machine parameter variations .
these geometric errors are made up of both systematic and random errors and each radiotherapy department has a verification programme for each tumour site .
this ensures that these geometric uncertainties are measured and then used to define the margin around the clinical target volume ( ctv ) to make up the planning target volume ( ptv ) .
the planning target volume is a geometrical concept which ensures that the ctv receives a tumouricidal dose every day in its entirety , by adding a margin around it for set up errors .
commonly , electronic portal imaging ( epid ) is used on the treatment unit and compared with the digitally reconstructed radiograph ( drr ) or simulator film used at tv localisation .
with the publication of studies of organ motion there is now an increasing awareness that there is internal organ motion which is physiological and may affect the position of the target volume during treatment delivery
. this may be predictable ( respiration and cardiac pulsation ) or unpredictable ( bladder and rectal filling , swallowing , small bowel motion ) .
current epid based verification of 3d conformal treatment only visualises bony anatomy and therefore can not identify movement of internal organs .
these individuals are therefore at risk of geographical miss of the target if it has moved significantly from the initial localisation computed tomography ( ct ) scan position .
the clinical benefits of highly conformal treatments will clearly not be realised unless this internal target volume motion is quantified and compensated for where necessary . in order to meet this need ,
a form of 3d verification has been developed called image - guided radiotherapy ( igrt ) .
this encompasses technologies which quantify errors in target volume position during delivery of radiotherapy and either reduce or compensate for them .
methods of igrt include : implanted fiducial markers , ultrasound , in - room diagnostic ct or kilovoltage x - rays , kilovoltage cone beam ct , and megavoltage cone beam ct .
prostate motion can be indirectly quantified using implanted radio - opaque prostate markers such as gold seeds , which can be visualised using epid .
the use of ultrasound for localising the prostate on a daily basis prior to treatment is described by lattanzi et al .. the disadvantages are that it requires a bladder fuller then that used for radiotherapy , it can be observer dependent and it has to be compared with the original ct dataset , i.e. a different imaging modality . in - room diagnostic ct involves a treatment couch on rails moved into the diagnostic ct scanner , but the image acquisition is not in the actual treatment position . in - room kilovoltage x - ray imagers
kilovoltage cone beam ct uses a kv imaging device integrated into the gantry of a megavoltage linear accelerator .
ct imaging on a linac is limited by the speed at which the gantry can safely be rotated . an x - ray volumetric image ( xvi ) is reconstructed from a cone beam of x - rays acquired during a single gantry rotation .
megavoltage cone beam ct or tomotherapy uses a megavoltage beam mounted on the ring gantry of a ct scanner .
many studies in the literature have contributed to data on prostate motion showing that differential prostate motion occurs with the seminal vesicles and base of prostate moving more than the apex . recently a publication by crevoisier et al . showed in a retrospective analysis that rectal distension on the initial ct planning scan correlated with reduced cure rate for patients with prostate cancer .
a series of 127 patients at the md anderson hospital treated with 3d conformal radiotherapy to 78 gy in 19931998 formed the study group .
a retrospective analysis was made of their initial ct planning scans with measurement of the rectal volume .
rectal distension was measured using an average rectal cross sectional area ( csa ) = rectal volume /length .
results showed that for patients whose rectum was distended with a csa > 11.2 cm , the 5 year prostate specific antigen ( psa ) control rate was only 63% compared with 92% for those with csa < 11.2 cm ( p<0.001 ) .
this shows that a distended rectum on the initial ct scan leads to a systematic error in localisation of the prostate , which on a daily basis may drop posteriorly out of the target volume when the rectum is empty , resulting in a geographical miss .
the patient should be given dietary instructions to void the bowels prior to ct scan and treatment , or regular laxatives considered .
the lack of reduction of this prostate motion with attempted use of rectal balloons has recently been reported by van lin .
prostate displacement correlates less strongly with bladder volume but instructions are given to patients to maintain a constant bladder volume prior to planning ct scan and daily treatment . an alternative to tracking markers on the prostate , to ensure accurate target localisation on a daily basis , is the use of adaptive radiotherapy ( art ) .
martinez et al . discussed a series of 150 patients who were planned conventionally using a 1 cm margin around the ctv to create the ptv , in order to allow for geometric uncertainties including prostate motion .
daily ct scans were taken on the kv cone beam ct on the first 4 treatments days , as well as daily portal images .
a new ptv was delineated using the actual systematic and motion errors measured on each individual patient using the initial ct and 4 subsequent scans .
art allows the creation of a patient specific margin rather than using a generic 1 cm ctv ptv margin .
organ motion studies have also been carried out in the lung , where respiration causes motion of lung tumours during radiotherapy , particularly in the peripheral and lower lobes .
methods of suspending respiration include active breathing control , gated ct scanning and respiration correlated ct scans .
these techniques allow reduction in the ctv ptv margin which is otherwise required to ensure delivery of dose to the whole tumour if the patient is breathing normally .
however serial ct studies show that the bladder is subject to significant motion over the treatment course requiring margins of 1.52.5 cm for ctv to ptv , especially in the cranial direction .
adaptive radiotherapy and good patient instructions can reduce these margins considerably , as can the use of cone beam ct prior to radiotherapy delivery .
standard portal imaging based verification systems on most treatment units use 2d bony anatomy as the verification end point .
this can not visualise or quantify or compensate for internal organ motion on a daily basis .
the use of fiducial markers for lung and prostate cancer and kv and mv cone beam ct scanners integrated with linear accelerators provide high quality volumetric images which can now be used for 3d verification of the actual daily target position . this will provide individualised 3d target verification on a daily basis ensuring that highly conformed radiotherapy is delivered accurately . | the delineation of the target volume for irradiation is a critical step in the radiotherapy process .
delivery of radiotherapy occurs over a fractionated course of many treatments .
variations in the position of the target volume may occur on a daily basis during treatment and so the procedure for defining the target volume on a single initial
snapshot computed tomography scan has been re - evaluated .
newer technologies of image - guided radiotherapy allow the development of on - line daily definition of the target volume prior to radiotherapy delivery . | The need for target volume verification
Organ motion during radiotherapy
Prostate motion
Summary |
seto et al . ( 13 ) reported successful results in four patients that underwent an esophageal bypass using a gastric bypass and cardiostomy .
this treatment is palliative and involves the restoration of the ability to ingest food and to prevent aspiration by inserting an esophageal or airway stent in most cases .
radiation therapy and chemotherapy are generally contraindicated due to the concern regarding fistula enlargement caused by tumor necrosis . a feeding gastrostomy or jejunostomy
is only occasionally used for palliation since these procedures do not restore normal swallowing ( 11 ) .
covered expandable metallic stents were introduced in the mid-1990s and have shown a 67 - 100% stent closure rate ( 1 , 3 - 12 ) .
we previously reported the long - term outcomes in 61 patients with malignant erfs , each of whom had undergone the insertion of a covered expandable metallic stents .
stent placement was technically successful in all patients , and there were no immediate procedural complications ( 1 ) .
the stent completely sealed off the fistula in 80% ( 49 of 61 ) of the patients , and there were no further aspiration symptoms ( initial clinical success ) ( figs . 1 , 2 ) .
incomplete closure of the fistula caused by spillage of material through a gap between the proximal stent margin and the esophageal wall within seven days after stent placement ( initial clinical failure ) , was seen in 12 ( 20% ) of the 61 patients ( 1 ) , and was due to the ' funnel phenomenon ' which is difficult to manage despite the insertion of additional stents or glue injection to seal the gap ( 14 - 16 ) . for esophageal stenosis with erfs , 18-mm - diameter stents were used . whereas , for esophageal stenosis without erfs , 16-mm - diameter stents were generally used . in the study by balazs et al .
( 12 ) , which included 188 patients that underwent covered stent placement for malignant erfs , improvement of swallowing and fistula closure were achieved in 77% of the patients ( 144 of 188 ) .
a close follow - up of patients with erfs is important since non - sealing of a fistula after stent placement , and reopening of a fistula after initial sealing , might cause aspiration pneumonia which would certainly lead to the rapid demise of the patient . to prevent further aspiration pneumonia , an esophagogram obtained immediately after stent insertion is crucial in order to confirm the sealing of the fistula and subsequently allow a patient to eat a soft diet .
if there is persistent leakage through the fistula , resulting from an incomplete stent expansion , a follow - up esophagogram should be obtained 2 - 3 days after stent placement in order to confirm stent expansion before food intake is resumed ( 1 ) .
the protocol of a repeat esophagogram at one week and then every one to two months after the procedure is suggested to evaluate fistula closure and stent patency or migration .
this would also provide early detection of fistula reopening as well as long - term outcomes .
several kinds of covered esophageal stents are available in the united states ( i.e. , ultraflex stent , wallstent , and z stent ) . in korea , covered retrievable esophageal or airway stents made by s & g biotech and taewoong medical are available ; however , there are no randomized or controlled trials to compare the outcomes of any of these stents when used to treat malignant erfs .
an understanding of the esophageal and airway anatomy of patients with erfs is critical to determine stent placement into the esophagus , airway , or both .
airway stenting , with or without esophageal stenting , is useful in patients with ivor lewis esophagectomy , i.e. , partial esophagectomy with bowel interposition , substantial airway stricture , previously placed esophageal stent , and an erf secondary to pressure necrosis of the esophageal stent ( 1 , 10 , 11 , 17 ) ( fig .
the selection guide for determining the stenting area could be summarized as follows ( fig .
3 ) : 1 ) esophageal stent placement if a patient has a stricture in the esophagus , but with no or only mild airway stricture since an esophageal stent can successfully treat both esophageal stricture and a fistula ; 2 ) airway stent placement if a patient has no or only mild stricture in the esophagus , or has moderate to severe stricture in the airway , since an esophageal stent migrates well when esophageal stricture is absent or mild , and an airway stent can treat an airway stricture ; or 3 ) both the airway and esophageal stent placement when a patient has moderate to severe stricture involving both the esophagus and the airway , since both the airway and esophageal stents are necessary to treat a stricture involving both the esophagus and the airway . in the selected patients ,
as the insertion of a single stent may be insufficient for palliation , placement of parallel stents may be indicated for patients with symptoms caused by malignant erfs ( 11 , 17 ) ( fig .
4 ) . it is very important to carefully evaluate the airway stenosis with ct scans or bronchoscopes prior to esophageal stent placement , since it is possible to develop tracheal compression caused by expanding esophageal stents ( 17 ) .
therefore , for insertion of both esophageal and airway stents during the same procedure , airway insertion should precede the esophageal stent insertion , since dyspnea could be aggravated immediately following the esophageal insertion .
mechanical friction between the esophageal and airway stents may cause pressure necrosis of the interposed tissue between the two stents , thereby possibly resulting in a fatal hemorrhage ( 10 , 17 , 18 ) .
thus , parallel stenting should only be performed after thoroughly reviewing a patient 's clinical indications .
reopening of a closed erf is another life - threatening problem because reopening of the fistula indicates a return to the aspiration symptoms . in our large series report ( 1 ) , the fistula reopened in 17 ( 35% ) of 49 patients with initial clinical success at a mean follow - up time of 4.8 weeks .
the reopening was caused primarily by complications associated with the placed stent , i.e. , stent occlusion caused by tumor overgrowth or ingrowth , food impaction or granulation tissue formation , stent migration , and stent covering disruption ( 1 , 6 , 8 , 14 ) ( fig . 5 ) .
furthermore , stent upgrade will be necessary in order to minimize tumor ingrowth or overgrowth as well as granulation tissue formation . in a report by shin et al .
balloon irrigation was performed to displace the impacted food bolus into the stomach ( fig . 5 ) .
balloon dilation and stent placement were performed for reopening caused by new granulation tissue formation ; whereas , second stent placement was performed for incomplete covering of the fistula or stricture , or stent migration .
reopened fistulas can be treated successfully using interventional management if a patient 's general condition is not poor . in a comparative study ,
health - related quality of life was remarkably improved in the stenting group , compared with the control group and the gastrostomy group in 35 patients with malignant erfs ( 19 ) . in two ,
large series reports ( 1 , 12 ) , mean patient survival was reported to be 3.1 - 3.4 months . in one of these reports ( 12 ) ,
the survival benefit was significant in patients in the stenting group ( 3.4 months ) compared with the enterostomy group ( 1.1 months ) , and the supportive management group ( 1.3 months ) . in patients with stenting for malignant erfs , survival depends on the successful sealing of the fistula ( 15.1 versus 6.2 weeks , p < 0.05 ) ( 1 ) ; therefore , suggesting that control of pulmonary contamination can provide the opportunity for both improved survival and quality of life .
seto et al . ( 13 ) reported successful results in four patients that underwent an esophageal bypass using a gastric bypass and cardiostomy .
this treatment is palliative and involves the restoration of the ability to ingest food and to prevent aspiration by inserting an esophageal or airway stent in most cases .
radiation therapy and chemotherapy are generally contraindicated due to the concern regarding fistula enlargement caused by tumor necrosis . a feeding gastrostomy or jejunostomy
is only occasionally used for palliation since these procedures do not restore normal swallowing ( 11 ) .
covered expandable metallic stents were introduced in the mid-1990s and have shown a 67 - 100% stent closure rate ( 1 , 3 - 12 ) .
we previously reported the long - term outcomes in 61 patients with malignant erfs , each of whom had undergone the insertion of a covered expandable metallic stents .
stent placement was technically successful in all patients , and there were no immediate procedural complications ( 1 ) .
the stent completely sealed off the fistula in 80% ( 49 of 61 ) of the patients , and there were no further aspiration symptoms ( initial clinical success ) ( figs . 1 , 2 ) .
incomplete closure of the fistula caused by spillage of material through a gap between the proximal stent margin and the esophageal wall within seven days after stent placement ( initial clinical failure ) , was seen in 12 ( 20% ) of the 61 patients ( 1 ) , and was due to the ' funnel phenomenon ' which is difficult to manage despite the insertion of additional stents or glue injection to seal the gap ( 14 - 16 ) . for esophageal stenosis with erfs , 18-mm - diameter stents were used . whereas , for esophageal stenosis without erfs , 16-mm - diameter stents were generally used . in the study by balazs et al .
( 12 ) , which included 188 patients that underwent covered stent placement for malignant erfs , improvement of swallowing and fistula closure were achieved in 77% of the patients ( 144 of 188 ) .
a close follow - up of patients with erfs is important since non - sealing of a fistula after stent placement , and reopening of a fistula after initial sealing , might cause aspiration pneumonia which would certainly lead to the rapid demise of the patient . to prevent further aspiration pneumonia , an esophagogram obtained immediately after stent insertion is crucial in order to confirm the sealing of the fistula and subsequently allow a patient to eat a soft diet .
if there is persistent leakage through the fistula , resulting from an incomplete stent expansion , a follow - up esophagogram should be obtained 2 - 3 days after stent placement in order to confirm stent expansion before food intake is resumed ( 1 ) .
the protocol of a repeat esophagogram at one week and then every one to two months after the procedure is suggested to evaluate fistula closure and stent patency or migration .
this would also provide early detection of fistula reopening as well as long - term outcomes .
several kinds of covered esophageal stents are available in the united states ( i.e. , ultraflex stent , wallstent , and z stent ) . in korea , covered retrievable esophageal or airway stents made by s & g biotech and taewoong medical are available ; however , there are no randomized or controlled trials to compare the outcomes of any of these stents when used to treat malignant erfs .
an understanding of the esophageal and airway anatomy of patients with erfs is critical to determine stent placement into the esophagus , airway , or both .
airway stenting , with or without esophageal stenting , is useful in patients with ivor lewis esophagectomy , i.e. , partial esophagectomy with bowel interposition , substantial airway stricture , previously placed esophageal stent , and an erf secondary to pressure necrosis of the esophageal stent ( 1 , 10 , 11 , 17 ) ( fig .
the selection guide for determining the stenting area could be summarized as follows ( fig .
3 ) : 1 ) esophageal stent placement if a patient has a stricture in the esophagus , but with no or only mild airway stricture since an esophageal stent can successfully treat both esophageal stricture and a fistula ; 2 ) airway stent placement if a patient has no or only mild stricture in the esophagus , or has moderate to severe stricture in the airway , since an esophageal stent migrates well when esophageal stricture is absent or mild , and an airway stent can treat an airway stricture ; or 3 ) both the airway and esophageal stent placement when a patient has moderate to severe stricture involving both the esophagus and the airway , since both the airway and esophageal stents are necessary to treat a stricture involving both the esophagus and the airway . in the selected patients ,
as the insertion of a single stent may be insufficient for palliation , placement of parallel stents may be indicated for patients with symptoms caused by malignant erfs ( 11 , 17 ) ( fig .
it is very important to carefully evaluate the airway stenosis with ct scans or bronchoscopes prior to esophageal stent placement , since it is possible to develop tracheal compression caused by expanding esophageal stents ( 17 ) .
therefore , for insertion of both esophageal and airway stents during the same procedure , airway insertion should precede the esophageal stent insertion , since dyspnea could be aggravated immediately following the esophageal insertion .
mechanical friction between the esophageal and airway stents may cause pressure necrosis of the interposed tissue between the two stents , thereby possibly resulting in a fatal hemorrhage ( 10 , 17 , 18 ) .
thus , parallel stenting should only be performed after thoroughly reviewing a patient 's clinical indications .
reopening of a closed erf is another life - threatening problem because reopening of the fistula indicates a return to the aspiration symptoms . in our large series report ( 1 ) , the fistula reopened in 17 ( 35% ) of 49 patients with initial clinical success at a mean follow - up time of 4.8 weeks .
the reopening was caused primarily by complications associated with the placed stent , i.e. , stent occlusion caused by tumor overgrowth or ingrowth , food impaction or granulation tissue formation , stent migration , and stent covering disruption ( 1 , 6 , 8 , 14 ) ( fig . 5 ) .
furthermore , stent upgrade will be necessary in order to minimize tumor ingrowth or overgrowth as well as granulation tissue formation . in a report by shin et al .
balloon irrigation was performed to displace the impacted food bolus into the stomach ( fig .
balloon dilation and stent placement were performed for reopening caused by new granulation tissue formation ; whereas , second stent placement was performed for incomplete covering of the fistula or stricture , or stent migration .
reopened fistulas can be treated successfully using interventional management if a patient 's general condition is not poor .
in a comparative study , health - related quality of life was remarkably improved in the stenting group , compared with the control group and the gastrostomy group in 35 patients with malignant erfs ( 19 ) . in two ,
large series reports ( 1 , 12 ) , mean patient survival was reported to be 3.1 - 3.4 months . in one of these reports ( 12 ) ,
the survival benefit was significant in patients in the stenting group ( 3.4 months ) compared with the enterostomy group ( 1.1 months ) , and the supportive management group ( 1.3 months ) . in patients with stenting for malignant erfs , survival depends on the successful sealing of the fistula ( 15.1 versus 6.2 weeks , p < 0.05 ) ( 1 ) ; therefore , suggesting that control of pulmonary contamination can provide the opportunity for both improved survival and quality of life .
although the term ' esophagorespiratory fistula ' is used to describe all fistulas located between the esophagus and airway tree , the fistula site is esophagotracheal in 52 - 57% of patients and esophagobronchial in 37 - 40% ( 2 , 20 , 21 ) . in the remaining patients ( 3 - 11% ) , communication
is established peripherally through the lung parenchyma , thus forming an esophagopulmonary fistula ( 2 , 20 , 21 ) .
however , previous reports regarding stent placement in patients with esophagopulmonary fistulas are very few ( 22 ) . in our recent study ( 22 ) , we determined that 14 esophagopulmonary fistulas were caused by esophageal ( n = 9 ) or bronchogenic ( n = 5 ) carcinomas . chemotherapy and radiation therapy appeared to be highly associated with fistula development , which occurred in 12 of our 14 study patients . at the time of stent placement , all patients had aspiration pneumonia and 11 had lung abscesses ( 79% ) , thus indicating lung contamination in all cases .
stent placement was technically successful in all cases , and clinical success , i.e. , complete fistula sealing resulting in resolution of the aspiration symptoms , occurred in 12 patients ( 86% ) ( fig .
6 ) . during follow - up , the fistula reopened in two patients , who were subsequently treated with clinical success . in our recent report ,
the mean patient survival time was 101 days ( 22 ) , and the cause of death was usually aspiration pneumonia ( 13 of 14 patients ) .
the survival period seems to be similar to that of esophagotracheobronchial fistulas , which range between 3.1 - 3.4 months ( 1 , 12 ) .
lung abscesses decreased in size , but persisted even after stent placement , probably because the natural drainage of lung abscesses into the esophagus would be closed after stent placement ( 22 ) .
concomitant abscess drainage procedures should thus be considered . to increase the length of patient survival
, the diagnosis of esophagopulmonary fistulas must be established early , ideally before the onset of pneumonia or the development of lung abscesses .
high - risk patients with esophageal or bronchogenic carcinomas and who undergo chemotherapy or radiation therapy should be closely followed in order to detect symptoms associated with fistula formation .
placement of covered expandable metallic stents is a safe and effective palliative treatment for patients with erfs .
furthermore , although the initial clinical success rate was poor and the rate of reopening was high , interventional management may be effective for sealing off reopened erfs .
placement of covered expandable metallic esophageal stents can be a successful alternative for palliative treatment of malignant esophagopulmonary fistulas .
however , persistence of lung abscesses and the worsening of a patient 's clinical condition are frequently observed even following stent placement . | an esophagorespiratory fistula ( erf ) is an often fatal consequence of esophageal or bronchogenic carcinomas .
the preferred treatment is placement of esophageal and/or airway stents .
stent placement must be performed as quickly as possible since patients with erfs are at a high risk for aspiration pneumonia . in this review ,
choice of stents and stenting area , fistula reopening and its management , and the long - term outcome in the interventional management of malignant erfs are considered .
lastly , a review of esophagopulmonary fistulas will also be provided . | ESOPHAGOTRACHEOBRONCHIAL FISTULA
Interventional Management and Follow-Up
Selection of Stents and Stenting Area
Fistula Reopening and Management
Quality of Life and Long-Term Outcome
ESOPHAGOPULMONARY FISTULA
SUMMARY |
three portals are used in this technique : a standard anteromedial portal , a standard anterolateral portal , and an extreme far anteromedial portal ( fig .
this portal is located 1 cm above the lateral joint line and 1 cm lateral to the margin of the patellar tendon .
this portal provides easy access for a special instrument to the anterior horn of the lateral meniscus .
this portal is located approximately 1 cm above the medial joint line and just medial to the margin of the patellar tendon and provides viewing of the anterior horn of the lateral meniscus .
to avoid collision of arthroscopic instruments , this portal is more closer to the patella tendon than the normal standard anteromedial portal .
the extreme far anteromedial portal is created as another working portal 3 cm medial to the margin of the patella tendon .
this portal is located 1 cm above the medial joint line and nearly anterior to the medial edge of the medial femoral condyle .
this portal is used for the removal of the unstable inferior leaf in the anterior horn of the lateral meniscus .
after diagnostic arthroscopy , a careful estimation of the depth and extent of the cleft and stability of the superior and inferior leaves is made with the use of a probe under the position of figure " 4 " . through the low anterolateral portal
, a small skin hook retractor is inserted to reach the superior leaf of the anterior horn .
this portal allows optimal and stable handling of the dominant superior leaf and viewing of the unstable inferior leaf ( fig .
is then excised with a 90 rotary punch through the extreme far anteromedial portal ( fig .
a motorized shaver ( linvatec , largo , fl , usa ) is used to smooth the remnant rim of the meniscus ( fig .
a small skin hook retractor is used to provide firm and stable meniscal retraction during postural or instrumental changes .
the dominant superior leaf can be damaged and detached with excessive or sudden retraction force .
horizontal tears of the meniscus are associated with degenerative changes in the meniscal tissue1 ) . until recently , the preferred treatment for meniscal injury has been partial meniscectomy or subtotal meniscectomy . for degenerative tears
the goal of careful partial meniscectomy of the horizontal tear is to preserve meniscal functions3 ) .
it is difficult to reach the inferior leaf of the anterior half of the meniscus to perform proper resection of the meniscus in tears extending to the anterior portion of the meniscus . and
it is difficult to decide how much of the meniscus should be resected in the case of deep - seated horizontal tears because it often extends into the capsular junction in multiple directions .
various methods for the treatment of a horizontal tear in the anterior horn of the meniscus have been proposed and described .
kim et al.4 ) described the inframeniscal portal technique for horizontal tears of the meniscus .
it proved to be an effective method for treating horizontal tears of the meniscus ; however , the disadvantage of this technique is the complication of impending synovial fistula .
kim and park5 ) described an arthroscopic technique of partial meniscectomy for horizontal tears of the meniscus using 3 portals .
this technique is safe and simple , and does not cause injury to the soft tissues .
however , it does not allow optimal handling of the dominant superior leaf for excision of the unstable inferior leaf of the anterior horn in horizontal tears of the meniscus .
meniscal retraction using a probe does not provide enough stability because of probe slippage during the arthroscopic procedure .
we have described a technique of arthroscopic partial meniscectomy using 3 portals and a small skin hook retractor for horizontal meniscal tears that involve the anterior portion of the lateral meniscus .
our technique is a useful method because it allows optimal and stable handling of the dominant superior leaf and viewing of the unstable inferior leaf . and surgeons can attempt resection of the margins of the meniscus more easily because the stable retraction is helpful in identifying the shape and extent of deep - seated horizontal tears . | we introduce a new arthroscopic partial meniscectomy technique using a three portals and a small skin hook retractor to remove unstable inferior leaf in horizontal meniscal tear that involved the anterior portion of the lateral meniscus .
the patient is positioned for a standard knee arthroscopy .
after careful estimation of the depth and extent of the cleft and stability of the superior and inferior leaves is done through the standard anteromedial portal , a small skin hook retractor is inserted through the standard anterolateral portal to raise the dominant superior leaf of anterior horn , then the unstable inferior leaf is excised with a 90 rotary punch and a motorized shaver through the extreme far anteromedial portal .
this technique is useful method to remove unstable inferior leaf of anterior horn of lateral meniscus which is difficult to remove with a standard technique . | Surgical Technique
Discussion |
cardiopulmonary resuscitation ( cpr ) is a potentially life - saving intervention following cardiac arrest .
however , it may be associated with traumatic injury to the upper abdominal organs , namely the liver , stomach and spleen [ 24 ] .
we here describe a rare case of occult splenic rupture complicating resuscitation efforts in post - operative cardiac arrest occurring immediately after left pneumonectomy .
a 63-year - old male smoker was admitted for elective surgical resection of a left upper lobe squamous cell carcinoma , diagnosed 2 months previously . his medical history included psoriasis , lumbar disc prolapse and previous laparoscopic cholecystectomy without concomitant haematological or neoplastic disease .
mediastinoscopy demonstrated only reactive changes in the sampled lymph nodes ; therefore , informed consent was obtained for left upper lobectomy . at bronchoscopy , tumour was seen to involve the orifice of the left upper lobe bronchus .
a left upper lobe sleeve resection was initially performed via left posterolateral thoracotomy , with routine stapling and division of the left superior pulmonary vein and upper lobe pulmonary artery branches . following this however ,
lung reinflation was not possible and left pneumonectomy was completed uneventfully with surgical haemostasis and placement of a single basal chest drain .
with the patient in a right lateral position , external cpr alongside emergent re - thoracotomy were performed .
active bleeding from a disrupted left inferior pulmonary vein staple line was controlled with sutures .
once cardiac output was regained , the patient was stabilized with minimal inotropic support , and left ventricular pacing wires were sited .
unfortunately , haemodynamic instability recurred after chest closure , this time without large - volume chest drainage , and the patient could not be resuscitated after a second cardiac arrest .
examination demonstrated a distended peritoneal cavity containing at least 1 200 ml of blood .
in addition , a subcapsular haematoma measuring 9 5 cm was noted on the upper pole of the spleen in association with a 3 2 cm laceration ; a second 3.5 4 cm laceration was also present on the inferior pole .
the left 2nd7th ribs , right 2nd5th ribs and the right 8th rib were fractured in the mid - axillary line .
the coroner concluded that the intra - abdominal bleeding had originated from the spleen , although there was no pathological evidence attributing this to the recent surgical intervention .
the acute splenic rupture was considered to be consequent to the first episode of cpr .
external cardiac massage in combination with ventilatory support and timely defibrillation has been demonstrated to enhance outcomes following cardiac arrest .
nevertheless , recognized complications associated with the technique include rib and sternal fractures , and injuries to the pleura , pericardium , heart and great vessels .
gastric mucosal tears have been found in 912% of patients following cpr , while liver lacerations are reported in 2% .
splenic rupture is a rarer occurrence , present in 0.3% of 705 patients undergoing post - mortem examination after cpr .
we believe that the present case is the only report of splenic rupture subsequent to cpr , occurring immediately post - operatively .
the prompt and accurate identification of occult intra - abdominal bleeding after cpr , particularly so soon after major thoracic surgery , represents a diagnostic challenge .
we recognized the onset of hypovolaemic cardiac arrest following left pneumonectomy , instituted cpr accordingly and were able to control active bleeding from a disrupted staple line via emergency thoracotomy .
the patient s rapid deterioration following the initial successful resuscitation , however , was not accompanied by profuse chest drainage and was attributed to a primary myocardial event rather than intrathoracic haemorrhage . a second re - thoracotomy at this stage
would likely have yielded no additional diagnostic benefit , since the culprit splenic lesion would not have been visualized .
basic radiological studies , such as an erect chest radiograph to reveal free subdiaphragmatic air , or abdominal ultrasound , could have been performed had the patient not destabilized after the first cardiac arrest .
furthermore , exploratory laparotomy in this already precarious situation would be very hazardous and rapid arrest of bleeding might not have been achieved within the confines of a cardiac arrest scenario . in the present case ,
pre - existing infective or neoplastic diseases causing splenomegaly might have predisposed this enlarged organ to rupture during cpr , but none were present in our patient . while left - sided rib fractures were sustained during resuscitation ,
the spontaneous rupture of an apparently normal spleen following left - sided lung resection has been described , but splenic rupture in the context of cpr immediately subsequent to left pneumonectomy has not been reported before .
it is known that major left lung resections may be accompanied by varying degrees of left diaphragmatic elevation .
thus , we propose that elevation of the left hemidiaphragm to occupy part of the cavity resulting from left pneumonectomy may have caused the spleen to reside in a slightly higher anatomical position than normal , especially in a supine patient .
this , perhaps combined with chest compressions over the lower border of the sternum , may have led to significant compressive forces being transmitted over the spleen , precipitating laceration and rupture .
this mechanism of injury may also happen following left - sided lobectomy , especially if the lower lobe is resected .
an alternative explanation would be upper abdominal adhesions after previous cholecystectomy , which might have anchored the spleen to an abnormally high subcostal position . in conclusion ,
concealed intra - abdominal visceral injury may occur during cpr and complicate resuscitation efforts by contributing to persistent hypotension .
clinicians should be aware that intrathoracic volume changes following major procedures , such as pneumonectomy or lobectomy , may
lift the spleen into a higher anatomical location , rendering it at risk of injury during cpr .
finally , special attention should be paid to the desired position of chest compressions to prevent excessive force being directed over the upper abdominal viscera . | cardiopulmonary resuscitation ( cpr ) techniques are now well - established and play a crucial role in improving survival in cardiac arrest . recognized complications associated with cpr include injury to the upper abdominal viscera , including the liver , stomach and spleen .
we present a rare case of occult splenic rupture following cardiac arrest in a 63-year - old male immediately after left pneumonectomy .
we discuss potential mechanisms predisposing the spleen to injury in this case , and highlight the difficulty of promptly identifying such a traumatic injury within the confines of a cardiac arrest scenario .
clinicians should be aware that anatomical changes following thoracic surgery may render the intra - abdominal viscera at increased risk of injury following cpr . | Introduction
Case Report
Discussion
Conflict of interest statement |
palatal tremor is a rare movement disorder characterized by rhythmic contraction of the soft palate .
palatal tremor is most often symptomatic , secondary to brainstem or cerebellar disease and , in rarer cases , is categorized as essential in the absence of documented brain lesions.1 some authors have documented hypertrophic degeneration of the inferior olives in secondary palatal tremor , but its precise role in causing palatal tremor has not yet been clarified and this finding is currently controversial.2 essential palatal tremor generally affects children of both genders , whereas secondary palatal tremor is most commonly observed in adult males . essential palatal tremor is bilateral and usually disappears during sleep , whereas secondary palatal tremor is more frequently unilateral and persists even during sleep .
patients with essential palatal tremor usually have an ear click , which is absent in the symptomatic form .
although essential palatal tremor has a benign course and usually disappears spontaneously , it is very annoying for the patient , so several treatments have been administered , including anticonvulsants and anxiolytics , with varying therapeutic effects . at present
no specific treatment has been established , although successful treatment by botulinum has recently been reported.3 there have also been reports in the literature of cases of palatal tremor which have been described as psychogenic because they were associated with psychological or psychiatric disorders . in this form , known as psychogenic palatal tremor ,
the abnormal movement is intermittent , increases during attention , decreases during distraction , and is under voluntary control.4 we describe the case of a 12-year - old boy with palatal tremor presenting clinical features of symptomatic essential and psychogenic palatal tremor , thus suggesting a neuropsychopathological continuum between the different forms of palatal tremor .
the case was a 12-year - old boy , the only child of unrelated parents .
there was a positive family history of psychiatric disorders , in that the father has a personality with borderline and narcissistic traits , poor impulse control , and multiple motor tics , and the mother had a major , recurrent depressive disorder , and histrionic and paranoid personality traits .
moreover , the emotional climate in this family was characterized by a high level of expressed emotion with over involvement and criticism , and with a very conflictual relationship between the parents.5 the patient was born by elective cesarean delivery at the eighth month of gestation after a pregnancy characterized by gestational diabetes treated with insulin .
he showed mild motor developmental delay and inadequate performance at primary school , and difficulty in relating to peers .
he came to our attention about one year earlier due to the emergence of behavioral disturbances characterized by oppositional defiant behavior and aggression , episodes of psychomotor agitation with dysphoria , and aggression towards others .
about two years before these events , when the patient was 10 years old , his parents had started to hear a clicking sound coming from the boy , but no research was carried out until our observations .
we performed clinical and instrumental assessments , including physical , neurological , and otolaryngological examinations , laboratory tests , audiological and neuroimaging studies , and a psychodiagnostic assessment , including the iq rating scale ( wechsler intelligence scale for children iii ) and interviews administered to the patient and his parents using the child behavior checklist and schedule for affective disorders and schizophrenia for school - age children present and lifetime version .
the neurological examination showed only hypotonia of the facial muscles causing drooling , but no other clinical signs , except for the presence of rhythmical bilateral palatal movements , mainly on the right side , associated with a clicking sound that could easily be heard when listening close to the child s ear .
the patient seemed to be very annoyed and concerned about this ear click , which was present with the mouth both open and closed .
nevertheless , it was under voluntary control , and the patient was able to voluntarily induce it or stop it for a few minutes . moreover , the ear click was less audible or had a changed frequency during the performance of complex motor and cognitive tasks .
otolaryngological examination with fibroscopy detected a bilateral palatal tremor at a frequency of 80 cycles per minute .
laboratory tests , including a complete blood count , antinuclear antibody studies , thyroid tests , plasma copper , ceruloplasmin , plasma amino acids , serum lactate and pyruvate , ammonium , and transaminases , were normal .
audiometry and electroencephalography were also normal , as were brain magnetic resonance imaging , angiographic magnetic resonance imaging , and proton magnetic resonance spectroscopy , focusing particularly on study of the brainstem . during spontaneous observation ,
the patient showed a reduced adaptive and relational capacity , with his relationships being characterized by oppositional behavior that sometimes culminated in episodes of aggression and psychomotor agitation .
his moods and affectivity were extremely unstable , featuring sudden swings and a poor control of emotions and impulses , in particular at moments of frustration and deferral of pleasure .
psychosomatic and anxiety symptoms were also detected . at the wisc - iii test , he obtained an iq of 65 ( verbal iq = 81 , performance iq = 56 ) , expressing mild mental retardation . during the previous year , several therapies had been attempted , including anticonvulsants and antipsychotic drugs , with variable results .
topiramate and valproic acid treatment showed no effect on either the behavioral disturbances or the palatal tremor , and carbamazepine therapy showed a transient effect that disappeared for about two months but then recurred . due to an increased frequency of episodes of agitation ,
chlorpromazine therapy was started , then carbolithium was added , resulting in an improvement of the behavioral disturbances .
treatment with piracetam , the effectiveness of which in essential palatal tremor was recently reported by campistol - plana et al,3 was ineffective .
it was not possible to administer treatment with botulinum toxin due to the patient s limited cooperation .
after six months of treatment with carbolithium , chlorpromazine , and family psychotherapy , the behavioral disturbances were further improved and the ear click was audible only on the right side and had started to fluctuate , disappearing spontaneously for days , reappearing spontaneously in stressful situations . over time , the patient had developed a greater ability to inhibit the palatal tremor voluntarily and to induce it on request or by thinking about it , sometimes to attract attention , thus demonstrating voluntary control .
palatal tremor is an abnormal movement of the soft palate and was previously known as palatal myoclonus but more recently has been renamed palatal tremor because this corresponds better with the electrophysiological characteristics of the rhythmic pattern .
the heterogeneous nature of palatal tremor covers a wide spectrum of clinical pictures , including symptomatic essential and psychogenic forms .
secondary palatal tremor can be a consequence of vascular , infectious , degenerative , traumatic , or neoplastic lesions of the brainstem or cerebellum .
this form is often associated with neurological deficits and , once present , persists throughout life and does not disappear during sleep or even in coma .
most symptomatic cases occur in adulthood , while a few cases have been reported in childhood in the course of krabbe s disease,6 a cerebellar tumor,7 and encephalitis.8 in secondary palatal tremor , abnormal hypertrophy of the inferior olives has been detected , but its precise role in causing palatal tremor is controversial and not yet clearly demonstrated .
recently shaikh et al9,10 have shown , through a mathematical model , that oculopalatal tremor oscillations originate in the hypertrophic inferior olive and are amplified by learning in the cerebellum . in essential palatal tremor , neurological investigations and brain neuroimaging are normal , while an ear click is present , perceived as objective tinnitus , that does not occur in the symptomatic form .
deuschl et al11 demonstrated that , in secondary palatal tremor , the movement of the soft palate is caused by contraction of the levator veli palatini and in essential palatal tremor , by contraction of the tensor veli palatini which induces secondary closure of the eustachian tubes , causing a clicking sound that is audible by the examiner .
essential palatal tremor is more frequently bilateral , occurs mainly in children , and usually disappears when the patient s mouth is open and during sleep , although in some cases it persists even during sleep .
the pathophysiology of essential palatal tremor remains unclear ; it is generally benign , persists for months or years , and in children it tends to fluctuate and disappear spontaneously .
essential palatal tremor has been observed in monozygotic male twins , in one of whom symptoms developed at the age of 14 years and in the other at 37 years , suggesting a genetic etiology of the disorder.12 fernandez - alvarez13 included essential palatal tremor in the class of transient movement disorders , a heterogeneous group of primary pediatric movement disorders with a limited duration of expression over time , none or mild disability , and a spontaneously fading disorder .
in fact , the abnormal movement can be voluntarily induced or inhibited , and can also be discontinued when the patient is concentrating on motor and cognitive tasks , performing movements , reading , thinking , or doing calculations .
some authors have suggested that voluntary control of essential palatal tremor could be due to a certain degree of cortical control that is otherwise absent in the symptomatic forms , while other authors have suggested that it could be due to a psychogenic origin of the disorder .
this form is often associated with psychopathology , responds to placebo and improves with psychotherapy .
furthermore , the movements have a variable frequency , and unlike the other forms of palatal tremor , increase during attention and decrease when the patient is distracted .
nevertheless , psychiatric symptoms , in particular anxiety disorders , have also been reported in the literature for some cases of essential palatal tremor .
after a review of the literature in relation to different forms of voluntary control , samuel et al14 suggested that rather , than being a uniform pathogenic entity , essential palatal tremor may be a heterogeneous disorder including different forms ; in particular , a form of conversion disorder , a tic disorder , or a series of completely involuntary movements , as described in most patients with essential palatal tremor . moreover , the same authors suggested a correlation between secondary palatal tremor and essential palatal tremor , in view of the fact that functional magnetic resonance imaging studies have shown an activation of the inferior olives during palatal movements in the essential form.15 these studies suggest an involvement of the same structures in essential palatal tremor and secondary palatal tremor .
in addition , in some cases of essential palatal tremor , an association with minor ailments has been reported , including respiratory infections , otitis , tonsillitis , fever , minor head trauma , and headache .
the clinical characteristics of our patient seem to support this hypothesis of a continuum between the different forms of palatal tremor ( table 1 ) .
he has a palatal tremor with an ear click , audible in both ears , which is usually present in the essential form but is rare in the symptomatic form .
the palatal tremor persisted during sleep , which is common in the symptomatic form but rare in the essential form . furthermore , neuroimaging studies did not document lesions in the brainstem or cerebellum , which are typically present in the symptomatic form .
in addition , in our patient , pre - perinatal risk factors were present , namely a family history of psychiatric disorders , motor developmental delay , mental retardation , hypotonia of the facial muscles , and behavioral disturbances .
even if voluntary modulation of palatal tremor has been reported in literature in some cases of essential palatal tremor , our patient has developed possible voluntary control , suggesting the acquisition of special motor skills rather than an inhibition of involuntary movements , and this seems suggestive of a psychogenic etiology.16 limited data are available about psychogenic movement disorders in children , but clinical findings suggesting a psychogenic cause similar to that in adults , including inconsistent character of the movements , exacerbation with stress and while paying attention , and disappearance when distracted , as well as a response to placebo and improvement with psychotherapy .
the underlying psychiatric diagnosis was a conversion disorder in most of the cases described in literature.17 in our patient , the disorder also shared some features of psychogenic movement disorders , such as a discontinuous ear click , association with psychopathological disorders , an increase during periods of attention and disappearance at moments of distraction , as well as voluntary control of the movement . in conclusion ,
the clinical characteristics of our patient suggest that there may be a neuropsychopathological continuum between different forms of palatal tremor , but this hypothesis requires further investigation , especially functional neuroimaging and genetic studies . | palatal tremor is a rare movement disorder characterized by rhythmic contractions of the soft palate .
it is most often symptomatic , secondary to brainstem or cerebellar disease and , in rarer cases , is categorized as essential in the absence of documented brain lesions .
there have also been reports in the literature of cases of palatal tremor described as psychogenic because they were associated with psychological or psychiatric disorders .
we describe the case of a 12-year - old boy with palatal tremor presenting clinical features of symptomatic essential and psychogenic palatal tremor , thus suggesting a neuropsychopathological continuum between the different forms of disease . | Introduction
Case report
Discussion |
in turkey a kind of smokeless tobacco called
maras powder has a lot of addicts in the city of
kahramanmara and its surroundings
[ 13 ] .
the leaves
of nicotina rustica l. are powdered , mixed , crushed with the ash
obtained from the oak , walnut tree , or vine stick in the
proportion of 1/2 or 1/3 , and humidified a little before it is
used .
it is known that the ash blended during the preparation
stage of maras powder eases the absorption of nicotine
from the mouth mucous membrane by making the medium alkaline .
maras powder is a kind of smokeless tobacco that is used
by the addicts through buccal mucosa instead of cigarette or in
order to give up smoking . on the other hand
it is reported that
toombak use may play an important role in the etiology of
oral squamosus cell carcinoma of the oral cavity and also may be
associated with salivary gland cancers [ 4 ,
5 ] . due to the
fact that it is taken orally
, it is reported that the cronic
stimulation of the lenfoid tissues in oral mucous membrane may be
related to the increased gingivitis , leukoplacis , and oral cancer
incidence .
similarly , it is stated that it has a stronger
potential of leading to addiction compared to cigarette
smoking because of its higher nicotine concentration and prolonged
mean usage time .
most of the diseases related to smoking have been
known in detail so far .
more than 400 000 people die in the usa
because of smoking and the direct expenditures for medical
purposes regarding smoking - related morbidity exceed 50 million us
dollars .
the effect of smoking on the immune system and its
parameters is not understood fully and the data about this is
limited and somewhat contradictory .
the studies up till now put
forth that the immunotoxic and genotoxic impacts of cigarette
arise from the particle phase more than the smoke - phase . the
particle phase is composed of thousands of substances , but mainly
nicotine .
there are a lot of findings about the fact that nicotine
is the major immunosuppressive in cigarette and/or smokeless
tobacco .
nicotine causes the secretion of chatecolamines that have
suppressive effects on immune system by inducing acth secretion
.
it is crucial to clarify
the relation between tobacco smoking and immune system in order
to understand this biological process fully .
the aim of this study was to determine the effects of
maras powder use and cigarette smoking on the parameters
of humoral immune response .
the study was conducted between january 2004 and june 2004 in
kahramanmaras sutcu imam university , faculty of medicine .
all
subjects included in the study population were healthy volunteers
recruited from visitors .
the control group was
composed of 33 women ( 41.1% ) and 37 men ( 52.9% ) with no
history of smoking or maras powder usage ; the smokers
group was composed of 31 women ( 42.2% ) and 39 men ( 55.8% ) ;
and maras powder group was composed of 17 women
( 45.9% ) and 20 men ( 54.1% ) . the mean ages were
37.8 12.5 sd ( standard deviation ) ( min . 19max . 73 ) ,
37.6 12.0 sd ( min
71 ) , and 41.9 10.2 sd in the control , smoking , and maras powder
groups , respectively .
mean ages
and the sex distribution of the groups were similar ( p > .05 ) .
selection criteria of the individuals were as follows : cigarette
smokers have been smoking a pack of cigarettes ( twenty in number ) ,
maras powder addicts have been using at least 2 packs of
maras powder ( a pack is of 16 3 g sd ) for at least 5 years and nonpassive smoking for control and
maras powder users .
the blood samples are collected from each subject by
venipuncture of the cubital veins before labour and
frozen at 20c after aliquoting their sera
until they are studied .
blood samples were analyzed for concentrations
of the humoral immune system parameters ( ige , igm , igg , iga , c3 ,
and c4 ) using nephelometry ( dade behring , marburg gmbh , germany ) .
the normal values of humoral immune system parameters were
accepted as 0.704.00 g / l for iga , 7.016.0
g / l for igm , 0100 iu / ml for ige ,
0.901.80 g / l for c3 , and 0.100.40
value for ige since its range starts from 0uniu / ml ) , and
over these ranges as high .
data were expressed as mean values sd , median and range , or
as number of subjects and percentages .
either nonparametric or
parametric ( if data was normally distributed ) tests were used for
statistical analyses .
anova and kruskal - wallis variance analysis
( followed by post - hoc mann - whitney u test where needed ) were used
for comparison of numerical data .
analyses were performed by using spss
software , version 9.05 for windows ( spss inc . ,
comparison of humoral immune system parameters in study groups
were shown in table 1 .
no statistically significant
difference was detected among the parameters except for ige ( p > .05 ) .
ige values of maras powder and smoking groups were
significantly higher than that of the control group ( p < .05 ) . furthermore , the distribution of subjects according to ranges of
humoral immune system parameters was compared
( table 2 ) . for this purpose
, data was classified as
low , normal , and high for each parameter .
the distribution of
normal values was similar for each parameter except igm and ige .
in control group 1.4% of the subjects had igm values below
normal where it was 18.6% and 10.8% in smoking and
maras powder groups , respectively ( p < .05 ) .
after chi - square analysis , it was seen that ige values above the normal
had been similar in the smoking and maras powder groups
and significantly higher compared to the control group ( p < 0.01 ) .
it was stated that using tobacco affects both the cellular and
humoral immunity negatively in various ways . nevertheless
, the
level of the negative effects could not yet be explained clearly .
in a number of studies carried out for finding out the possible
effects of cigarette smoke on lymphocytes ,
the relation between cigarette smoking and effects of
cigarette smoke on in vitro lymphocyte functions is disputatious .
some authors reported that there had been significant reductions
in the proliferative response of lymphocytes to t cell mitogens .
on the other hand
, some others reported that there had been no
significant difference in terms of this response between smokers
and nonsmokers . besides
, it was stated that these differences
might have been influenced by age , sex , dosage , duration of
exposure , and ethnic origin [ 815 ] .
goud et al reported increases in lymphocyte proliferation
and polyclonal igm response caused by smokeless tobacco .
however ,
lindemann and park reported that water - soluble smokeless
tobacco extract had anticytolytic and antiproliferative effects on
peripheral lymphocytes .
, it was shown that
cigarette smoking was closely related to a series of immunological
deteriorations accompanied by decreases in immunoglobulin levels ,
the number and the functions of nk ( natural killer ) cells , and the
number of t cell subgroups [ 9 ,
11 , 12 ,
14 ] .
moszczynski et al
had observed a decrease of
cd4/cd8 ratio due to the decrease in the serum concentration of lysozyme and
immunoglobulins and a decrease in the number of ( cd 16 ) nk
cells particularly in the addicts who had smoked for more than 10
years and an increase in the number of ( cd 8) cytotoxic t
lymphocytes .
it was shown that smoking decreases serum levels of
almost all types of immunoglobulins except ige ( ige increases )
[ 1820 ] .
there are also some articles that defend the
idea that it has no particular effect on immunoglobulin levels . in our study ,
rates of subjects with a serum igm level below
normal were significantly higher in smoking and
maras powder groups than in control group ( p < .05 ) .
however , the
differences of serum igm levels between the 3 groups were not
statistically significant . this may be interpreted as
contradictory .
when the data was studied carefully , it
was seen that the igm values below normal were very close to the
lower limit . as for ige levels ,
rates of subjects with values
above normal were significantly higher in smoking and
maras powder groups than in control group ( p < 0.01 ) .
nearly all of the individuals ( 86.5%95.7% )
have levels of iga , igg , c3 , and c4 within the normal limits . in some studies
it was reported that alcaloid ,
nitrosamine , and nicotine contents distinguish between nicotiana
rustica l. and nicotina tobacum l. alcaloid content of
maras powder ( nicotiana rustica l. ) may be 610 times
more than that of nicotina tobacum l. .
it was reported that tobacco - specific nitrosamine content of toombak
was one hundred times more than that
of other types of smokeless tobacco used in sweden and usa , and
toombak use was described as the highest nonoccupational
carcinogen exposure documented [ 4 ,
5 ] .
three times more
urinary cotinine levels were found in maras powder
addicts than in smokers .
however , lindemann et al reported that plasma nicotine levels were found to be similar in
smokeless tobacco users and smokers .
nevertheless , in
our study , the effect of maras powder on humoral immune
response was found to be similar to that of smoking .
as noted earlier in our study , many of the researchers stated that
smoking affects the immune system and its parameters negatively at
various levels .
nonetheless , the level of this negative effect
could not be determined yet effectively and evidently .
we
believe that further studies investigating the effects of
different types of tobacco usage on humoral immune system
parameters are needed .
distribution of the humoral immune system parameters
with respect to low , normal , and high ranges in study groups . * statistical analysis could not be performed due to the limited number of cases . * | background .
the aim of this study is to assess the
impacts of maras powder and cigarette
smoking on the parameters of the humoral immune system .
material and
methods .
one hundred seventy seven subjects were included in the
study .
the iga , igg , igm , c3 and c4 levels were detected via
nephelometric method . results . in 1.4% of the control
group igm levels were below normal where it was 10.8% and 18.6%
in maras powder group and in cigarette smoking group respectively .
the igm levels of both groups were significantly lower compared to
the control group ( p < .05 ) .
nonetheless , the ige levels of
maras powder group and smoking group were found to be remarkably
higher compared to the control group ( p < .01 ) .
conclusion .
effects of maras powder on humoral
immune response were found to be similar to that of smoking . | BACKGROUND
MATERIALS AND METHODS
RESULTS
DISCUSSION
Figures and Tables |
microwave imaging has recently emerged as one of the most promising non - invasive imaging modalities of the last two decades .
its low cost , non - ionising characteristics justify the considerable interest of the scientific community .
although breast cancer imaging has been the most widely explored applications [ 1 , 2 ] , other biomedical diagnostic areas are also proposed [ 3 , 4 ] .
the operating principle is based on the dielectric contrast between the targeted and surrounding tissues .
the imaging formation procedure involves illuminating the tissue with an electromagnetic radiation and analysing the reflected / scattered ( and sometimes transmitted ) signals from dielectric boundaries within the tissue .
these algorithms can be divided into two broad categories : those that seek to identify the presence and location of significant dielectric scatterers in the tissue ( termed as radar approaches ) ; and those whose aim is to reconstruct the entire dielectric profile of the tissue under examination ( termed as tomographic approaches ) .
ultra - wideband ( uwb ) antennas have been proven suitable for microwave medical imaging under radar approaches due to their large operating bandwidth combined with stable radiation / coupling properties and compact designs [ 5 , 6 ] .
limited field penetration or non - uniform frequency - dependent near - field distribution can generate artefacts and degrade or destroy the imaging process . in order to fully assess the near - field microwave detection system performance ,
the antenna presence must be taken into account . in [ 4 , 7 ] microwave tomography
the technique was proposed as non - invasive screening modality of osteoporosis bone cortex degradation . in this letter
, we present a microwave radar technique to image bone profiles in a more complex multi - tissue phantom that mimics a large leg .
the system is capable of detecting the dielectric boundaries of two bones with different cross - sections that are embedded within a non - uniform multi - layer structure of skin , adipose and muscle tissues .
an uwb signal is transmitted and received in the frequency bandwidth 0.54 ghz by two vivaldi antennas in a radar monostatic fashion .
the signal travels across different impedance conditions due to the heterogeneous scenario due to non - uniform multi - layer structure of skin , adipose , muscle and bone tissues .
however , it also penetrates a highly attenuating muscle tissue that accounts for about 50% of the entire investigated volume .
this work shows the viability of microwave bone radar imaging technology which is low cost , portable , non - ionising and does not require specially trained personnel .
in fact , microwave technology allows using compact and moderately expensive devices compared to other conventional imaging technologies .
images are reconstructed by using non - coherent migration , which is a particular version of beamforming [ 8 , 9 ] .
in particular , using non - coherent migration to reconstruct bone profiles from measured reflection coefficients makes unnecessary any pre - scan antenna characterization .
this feature both speeds up the scanning time and ease usability . after a brief description of its functional parts
, results are shown in the following scenarios :
a metal scatterer in homogeneous background totally filled with adipose tissue for delocalisation assessment.bones inserted in a multi - layer structure including skin , fat and muscle . a metal scatterer in homogeneous background totally filled with adipose tissue for delocalisation assessment .
the 3d scanner proposed here extends the investigation carried out in for breast cancer detection in a more controlled environment and on a diverse target ( fig . 1 ) .
the prototype is made of the following parts :
two printed antipodal vivaldi antennas that can be manoeuvred to adjust their height and distance from the phantom.a turntable that rotates the phantom with 1 accuracy.a tank that contains the measuring setup immersed in a coupling medium with permittivity of 12.a vector network analyser to measure the s - parameters at the antennas ' terminals.an acquisition unit to synchronise the antenna / phantom positioning with the data acquisition.a data processing unit to generate reconstructed images from the measured datasets .
13d microwave scanner and phantoma schematics of the scanning procedure with two antennas positioned on opposite sides of the phantom to half the scanning timeb detail of the scanner two printed antipodal vivaldi antennas that can be manoeuvred to adjust their height and distance from the phantom . a turntable that rotates the phantom with 1 accuracy .
a tank that contains the measuring setup immersed in a coupling medium with permittivity of 12 .
a vector network analyser to measure the s - parameters at the antennas ' terminals .
an acquisition unit to synchronise the antenna / phantom positioning with the data acquisition . a data processing unit to generate reconstructed images from the measured datasets .
3d microwave scanner and phantom a schematics of the scanning procedure with two antennas positioned on opposite sides of the phantom to half the scanning time b detail of the scanner the geometry of the antenna is shown in fig . 2 and consists of a printed element on 1.6-mm thick fr4 substrate . the dimensions and the taper of the two metallised parts were optimised to combine compactness with satisfactory field penetration inside the phantom .
each prototyped antenna was sprayed with 3m novec coating to prevent electro - mechanical change of the dielectric when immersed in the coupling medium .
2geometry of the printed antipodal vivaldi antenna geometry of the printed antipodal vivaldi antenna the system records s11 and s22 sampled across 801 equally spaced points in the frequency range 0.54 ghz , where satisfactory impedance matching is achieved ( better than 8 db ) . in this configuration , instead of having one single antenna scanning the phantom across 360 as in , two antennas are positioned on opposite sides of the phantom to half the scanning time .
the coupling medium used a mixture of 50% kerosene50% safflower oil solution and de - ionised water in the proportion of 80 and 20% , respectively . a realistic phantom that mimics a cow 's leg was prepared by using a bovine tibia and fibula bone section with muscle tissue attached and embedded in pork fat and turkey skin for convenience ( fig .
3 ) . by assembling the phantom , more control on the ratio between adipose and non - adipose tissue volumes can be achieved .
this phantom was manufactured with the bone + muscle accounting for more than 80% of the entire volume in order to challenge the imaging procedure with high percentage of electromagnetically dense tissue in the scanned volume .
the dielectric properties of the corresponding human tissues in the phantom are listed in table 1 at the centre frequency of 2.75 ghz [ 1012 ] .
the phantom has an overall approximate diameter of 100 mm and a length of 250 mm with the bone - section of diameter 28 mm .
three slices in the central region spaced 10 mm apart were considered for screening with 36 scans per slice ( 18 per antenna ) .
3realistic phantom that mimics a cow 's leg was prepared by using a bovine tibia and fibula bone sectiona phantom 's cross - sectionb sagittal x - ray scan of the phantom
table 1dielectric properties of corresponding human tissues in phantom at 2.75 ghzconductivity , s / mrelative permittivitybone cortical0.4542911.207marrow0.108775.2644muscle1.951552.363fat0.118095.2492skin1.780242.442 realistic phantom that mimics a cow 's leg was prepared by using a bovine tibia and fibula bone section a phantom 's cross - section b sagittal x - ray scan of the phantom dielectric properties of corresponding human tissues in phantom at 2.75 ghz the dielectric contrast between the target ( i.e. bone ) and surrounding tissues is about 4.6 which is significantly greater than that observed in microwave breast cancer imaging .
however , this scenario presents different challenges as the target bone tissue is embedded in a thick and electromagnetically denser layer of muscle tissue , hence results in a weaker signal reaching the target tissue .
the observation domain is a set of circular lines each located at different heights , zh . for a fixed height
, the field scattered by the phantom is collected by a tx / rx antenna over n scanning positions ( r01 , r02 , ,
the data of a complete scan can be arranged accordingly in the n nf scattering matrix \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{upgreek }
\usepackage{mathrsfs }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
} { } $ \underline { \underline{{\bi s } } } = \left[{{\underline{{\bi s } } } _ { 1}\comma \ ; \ldots \comma \ ; \ ; { \underline{{\bi s } } } _ { n_{\rm f}}\comma \ ; \ldots \comma \ ; \ ; { \underline{{\bi s } } } _ { n_{\rm f } } } \right]$\end{document}s__=s_1, ,s_nf, ,s_nf where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{upgreek }
\usepackage{mathrsfs }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
} { } $ \underline{{\bi s } } _ { n_{\rm f}}$\end{document}s_nf is the column vector of data collected over the observation positions at nfth frequency .
these data include the information signal , but also strong clutter components generated from the antenna 's internal reflection , skin and other non - targeted tissues .
as the clutter tends to mask the bone - interface signal , it has to be reduced before the image construction procedure .
different clutter rejection methods exist in the literature such as the differential approach , the subspace projection method and the entropy - based time windowing algorithm .
however , considering the cylindrical layout of the adopted phantom for this proof - of - concept , the average trace subtraction strategy is implemented .
in particular , in frequency domain one obtains
( 1)\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{upgreek }
\usepackage{mathrsfs }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
} { } $ $ \underline { \underline { { \bi s } } } _ { { \rm av } } = \underline { \underline { { \bi s } } } - \underline { \underline { \check{{\bi s } } } } \ ;
\eqno\lpar 1\rpar $ $ \end{document}s__av = s__s__where the subscript av indicates that the average trace subtraction algorithm is used .
each column of the matrix \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{upgreek }
\usepackage{mathrsfs }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
} { } $ \underline { \underline { \check{{\bi s } } } } = \left[\underline { \check{{\bi s}}}_{1}\comma \ ; \ldots \comma \ ; \ ; \underline{\check{{\bi s}}}_{n_{\rm f}}\comma \ ; \ldots \comma \ ; \ ; \underline{\check{{\bi s } } } _ { n_{\rm f } } \right]$\end{document}s__=s_1, ,s_nf, ,s_nf has values all equal to the average over the sensors ' positions ( fixed the frequency ) . to test the detection system ,
the non - coherent migration is adopted according to the expression in the following equation
( 2)\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{upgreek }
\usepackage{mathrsfs }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
} { } $ $ \ ; \phi _ { n - m}\left({{\underline{r } } _ { k}\comma \ ; z_{\rm h } } \right)= \mathop \sum \limits_{i = 1}^{n_{\rm f } } \eqno\lpar 2\rpar $ $ \end{document}nmr_k , zh=i=1nfwhere a(fi ) is the steering vector calculated at the trial position rk within the spatial domain d. the positions of the target are identified where the pseudo - spectrum nm ( . ) peaks , with mi[. ] being migration operator .
note that by employing non - coherent migration no information about the antenna is needed .
in fact , as shown in this algorithm actually represents a no - windowing beamforming image method .
therefore , as the time window is not considered , the travel time within the antenna is not required .
the data collected for each measurement position on the observation circle is used to generate a reconstruction of the corresponding 2d slice ( i.e. , in the x y - plane ) .
more in detail , both the de - clutter procedure and the calculation of the pseudo - spectrum nm ( . )
hence , the final 3d reconstruction is obtained by performing a collection of 2d single pseudo - spectra at different heights .
once the 2d slice reconstructions are obtained , the 3d image of the target is obtained by superimposing the 2d reconstructions
( 3)\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{upgreek }
\usepackage{mathrsfs }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
} { } $ $ \ ; i\left({{\underline{r } } _ k } \right)= \left({\matrix { { \phi _ { n - m}\left({{\underline{r } } _ { k}\comma \ ; z_1 } \right ) } \cr \cdots \cr { \phi _ { n - m}\left({{\underline{r } } _ { k}\comma \ ; z_{\rm h } } \right ) } \cr } } \right)\eqno\lpar 3\rpar $ $ \end{document}ir_k=nmr_k , z1nmr_k , zhwhere zh
( z1 , , zh ) are the different heights at which the slices are taken .
finally , the actual 3d reconstruction is obtained by interpolating in the z - direction .
the scanner was assessed for a very simple homogeneous scenario with the investigation scene totally filled with the coupling medium and an 8 mm thick cylindrical metal bar used as target .
this test was performed in order to estimate the delocalisation error due to the mismatch of the equivalent permittivity used by the algorithm to generate the image from the actual permittivity of the coupling medium .
thirty - six equally spaced measurements were taken across three sections spaced 10 mm from each other . in the top panel of fig . 4 , the target located at ( x = 20 mm ; y = 5 mm ) is imaged .
although the object appears slightly oblique , the 3d reconstruction is successfully performed . in each of the three 2d reconstructions ( omitted here for brevity ) the target is detected with a consistent spatial displacement ( sd ) of 2.78 , 2.85 and 4.23 mm , respectively .
the sd measures the error in the target localisation and accounts for the difference between the target centre position as a peak value in the reconstruction and as actual centre position in the scanned phantom .
this is due to the mismatch between the adopted equivalent phantom permittivity in the reference green 's function and the actual unknown permittivity mapping of the detection scene .
4 highlights once again the effect of the mismatch described above .
fig .
4target located at ( x = 20 mm ; y = 5 mm ) is imageda 3d reconstruction of the investigation scene totally filled with adipose tissue and an 8-mm thick cylindrical metal bar used as targetb overhead view of 3d reconstruction target located at ( x = 20 mm ; y = 5 mm ) is imaged a 3d reconstruction of the investigation scene totally filled with adipose tissue and an 8-mm thick cylindrical metal bar used as target b overhead view of 3d reconstruction the phantom 3d image is shown in fig . 5 when scanned across three sections spaced 10 mm apart .
the presence of both tibia and fibula is correctly detected and their 3d profile is reconstructed .
although the different cross - sections of the bones are not distinguished by the imaging algorithm , the targets are localised in the scanned area with good accuracy .
5phantom 3d imagea preparation of the realistic phantom ( tibia and fibula are marked in yellow circle)b 3d image reconstruction of the tibia and fibula in the phantom a preparation of the realistic phantom ( tibia and fibula are marked in yellow circle ) b 3d image reconstruction of the tibia and fibula in the phantom
the microwave scanning system presented here shows promising results for bone imaging in a multi - layer complex limb - mimicking phantom . without a priori antenna characterisation ,
the image formation procedure based on non - coherent migration successfully reconstructs the 3d profile of both bones in the phantom .
although the scenario under investigation presents several degrees of difficulty such as its multi - layer structure and the presence of more than one target ( i.e. tibia and fibula ) with different cross - sections , the scanner is able to discriminate the bone - muscle interface and reconstruct its 3d profile .
future work will explore the integration of a multi - element antenna array to enable multi - view radar configurations . on a more engineering side , a more compact version of the prototyped scanner
will be designed to deliver a portable bone scanning device that can be used in site of accidents .
this work was supported by italian ministry of university and research through the firb initiative under the project micenea ( rbfr12a7cd ) and the cost actions td1301 mimed and bm1309 emf - med . | this letter introduces a feasibility study of a scanning system for applications in biomedical bone imaging operating in the microwave range 0.54 ghz .
mechanical uncertainties and data acquisition time are minimised by using a fully automated scanner that controls two antipodal vivaldi antennas .
accurate antenna positioning and synchronisation with data acquisition enables a rigorous proof - of - concept for the microwave imaging procedure of a multi - layer phantom including skin , fat , muscle and bone tissues .
the presence of a suitable coupling medium enables antenna miniaturisation and mitigates the impedance mismatch between antennas and phantom . the three - dimensional image of tibia and fibula is successfully reconstructed by scanning the multi - layer phantom due to the distinctive dielectric contrast between target and surrounding tissues .
these results show the viability of a microwave bone imaging technology which is low cost , portable , non - ionising , and does not require specially trained personnel .
in fact , as no a - priori characterisation of the antenna is required , the image formation procedure is very conveniently simplified . | Introduction
Three-dimensional (3D) microwave scanner and phantom
Imaging procedure
Results
Conclusions
Funding and declaration of interests |
moyamoya disease ( mmd ) is characterized by a chronic progressive steno - occlusive change of the distal internal carotid artery and abnormal development of a fine vascular network ( moyamoya vessels ) at the base of the brain .
takeuchi and shimizu11 ) had initially reported this disease in 1957 , followed by suzuki11 ) in 1969 who named the disease as moyamoya ( the japanese word for puff of smoke ) .
the disease was initially known to be endemic where it was limited to japan but is now found worldwide.4 - 9)12)15 ) several studies have indicated a high prevalence of mmd in asian countries , particularly in japan , korea , and china.2)8)9 ) japan has the highest outbreak of illness frequency , followed by korea and china .
the national prevalence of mmd in japan is well - documented.7)13 ) until this investigation , the epidemiology of mmd in korea has not been reported .
we reviewed the national health insurance corporation ( nhic ) data to study the epidemiological features of mmd in korea .
the authors requested data from the nhic of mmd patients who were treated from 2004 until 2008 in korea .
the data in this study were standardized based on data of the south korean population in 2004 - 2008 , which was provided by statistic korea . in the present investigation
, these data gathered from nhic may not adhere strictly to the criteria for mmd proposed by yonekawa et .
al.14 ) and we could not gather detailed data including symptoms , diagnostic and treatment methods of the mmd .
the nhic data revealed that in 2004 , 2,539 mmd patients were treated in korea , representing a prevalence rate of 5.2 per 100,000 people .
the respective numbers of patients and prevalence rate were 2,987 and 6.3 in 2005 , 3,429 and 7.0 in 2006 , 4,051 and 8.6 in 2007 , and 4,517 and 9.1 in 2008 , representing an annual increase of 15% . in 2008 , 466 people were newly diagnosed with mmd , representing an incidence rate of 1 per 100,000 persons .
the prevalence of mmd in korea increased from 5.2 per 100,000 in 2004 to 9.1 per 100,000 in 2008 ( fig . 1 , 2 ) .
the gender balance was 1,547 men ( 34% ) and 2,970 women ( 66% ) .
3 . there is a bimodal peak pattern , first on teenagers ( 10 - 19 years old ) and second among those in their forties ( 40 - 49 years old ) .
the nhic data revealed that in 2004 , 2,539 mmd patients were treated in korea , representing a prevalence rate of 5.2 per 100,000 people .
the respective numbers of patients and prevalence rate were 2,987 and 6.3 in 2005 , 3,429 and 7.0 in 2006 , 4,051 and 8.6 in 2007 , and 4,517 and 9.1 in 2008 , representing an annual increase of 15% . in 2008 , 466 people were newly diagnosed with mmd , representing an incidence rate of 1 per 100,000 persons .
the prevalence of mmd in korea increased from 5.2 per 100,000 in 2004 to 9.1 per 100,000 in 2008 ( fig . 1 , 2 ) .
the gender balance was 1,547 men ( 34% ) and 2,970 women ( 66% ) .
3 . there is a bimodal peak pattern , first on teenagers ( 10 - 19 years old ) and second among those in their forties ( 40 - 49 years old ) .
mmd was first described in japan , and originally considered a disease that predominantly affected asian populations .
its prevalence is highest in japan , followed by korea and china.8 ) in japan , four national surveys were conducted : 1986 , 1990 , 1995 , and 2003.7 ) in 2003 , the total number of patients treated in japan was estimated at 7,700 and the annual rate of newly diagnosed cases in 2003 was 0.54 per 100,000 population .
the estimated prevalence of mmd in japan has almost doubled during the most recent decade where data is available ( 3,900 in 1994 and 7,700 in 2003).7 ) in korea , mmd was first reported in 1969 , based on case reports of hemangiomatous malformation of the brain.2 ) in korea , two co - operative studies on mmd patients treated at several neurological institutes were reported . however , to date , the national epidemiological features of mmd in korea have not been reported.2)3)5 ) this is the first study to report the korean national epidemiology of mmd .
the authors obtained data from the nhic on mmd patients who were treated from 2004 to 2008 .
these data included both symptomatic and asymptomatic cases . in 2008 , 466 people were newly diagnosed with mmd , representing an incidence rate of 1 per 100,000 persons . the prevalence of mmd in korea has increased from 5.2 per 100,000 in 2004 to 9.1 per 100,000 in 2008 .
the annual increase may reflect both an actual increase in new cases and an increased detection of asymptomatic existing cases due to an improved diagnostic capability and developing brain check - up system .
increasing numbers of mmd cases have been reported worldwide.1)7)15 ) in japan , the prevalence and annual rate in 1994 were 3.16 and 0.35 per 100,000 people and in 2003 , it was reported as 6.03 and 0.54 respectively.7 ) the prevalence rate almost doubled in 10 years because of the increase in the occurrence rate .
the higher detection rate and prevalence of mmd in japan may have contributed to the increase in newly diagnosed cases . after an induction of recently developed noninvasive diagnostic tools ,
asymptomatic mmd is being diagnosed more frequently.7 ) in korea , the prevalence rate of the mmd was 6.03 per 100,000 in 2003 .
the well - known specific features of mmd are a bimodal pattern of age distribution and female prevalence .
this study revealed a bimodal age distribution where the highest was observed among teenagers , followed by those in their forties .
national figures for mmd in china have not been reported , but there is data on the epidemiological and clinical features in nanjing , a provincial capital city.9 ) the annual average detection rate was 0.43 per 100.000 and the prevalence rate was 3.92 per 100,000 .
this was lower than the prevalence of 6.3 found in japan and 5.2 found in korea , but similar to taiwan.4 ) mmd has been observed throughout the world and it affects individuals from different ethnic backgrounds.9 ) but it is rarely observed among americans and europeans .
a recent european study has reported an incidence of approximately 1/10 th of that in japan.15 ) studies in the united states suggest an incidence of 0.086/100,000 persons.12 ) compared to whites , ethnicity - specific incidence rate ratios were 4.6 for asian americans , 2.2 for african americans , and 0.5 for hispanics.12 ) based on the japanese national data , the prevalence rate of mmd between japan and korea are similar .
in conclusion , the prevalence rate of mmd was 5.2 per 100,000 in 2004 and it increased at a rate of 15% annually through 2008 . | objectivethe objectives of the present study were to investigate the annual detection rate of patients with moyamoya disease ( mmd ) and to describe the prevalence and epidemiological features of the moyamoya patients in korea.materials and methodsthe authors analyzed the epidemiological data of korean patients taken from the national health insurance corporation in korea among moyamoya patients who were treated from 2004 until 2008.resultsbased on 2004 data , 2,539 mmd patients were treated in korea and the prevalence rate was 5.2 per 100,000 people .
there were 2,987 in 2005 , 3,429 in 2006 , 4,051 in 2007 , and 4,517 cases in 2008 , and the prevalence rates per 100.000 people were 6.3 , 7.0 , 8.6 , and 9.1 , for those respective years .
this represents an annual increase of 15% of new cases during this period . in 2008 , 466 people were newly diagnosed with mmd , representing an incidence rate of 1 per 100,000 persons .
the gender ratio was 1,547 men ( 34% ) and 2,970 women ( 66% ) .
women had a higher incidence rate than men ( 1.94 times ) .
there were two age peaks : teenagers and those in their forties.conclusionthe present study shows that the number of moyamoya patients in korea is increasing .
this increase could partly be explained by a recent increase in newly diagnosed cases , suggesting that a more careful consideration of the disease and better diagnostic techniques should be promoted among clinicians . | INTRODUCTION
MATERIALS AND METHODS
RESULTS
Incidence and Prevalence
Gender differences
Age distribution
DISCUSSION
CONCLUSION |
advances in biomedical research have given way to new enthusiasm surrounding the expectation that medical treatment will be informed by an individual 's genetic information .
as knowledge of the genetic factors underlying complex diseases such as cancer advances , new tools for disease risk assessment , screening , prognosis , and therapeutics incorporating this knowledge are continuing to emerge at an increasingly rapid pace . tailoring medical treatment decisions to an individual 's genetic profile
using their own genetic information to guide medical decisions will optimize patient care by allowing for the personalized assessment of disease risk , and prescription of treatments with higher likelihoods of success .
for society , integrating the use of personal genetic information into health - care delivery is hoped to result in significant cost savings by administering treatments only to those most likely to benefit .
should the use of individual genetic information in the delivery of health care be a cause for concern ?
fears regarding the potential for misuse of genetic information have given rise to the concept of genetic discrimination ' , directed against an individual based solely on an apparent or perceived genetic variation from the normal human genotype ' .
dialog surrounding genetic discrimination has predominately occurred in relation to use of genetic information contained in a patient 's medical file by third parties with access to the information : namely employers and private insurance companies providing disability or life insurance ( see eg ) .
so prevalent is public concern over the possibility of genetic discrimination , legislation exists prohibiting it in many jurisdictions ( reviewed in ) .
but the rise of personalized medicine raises questions as to whether the use of an individual 's genetic information to inform medical decision making by health - care professionals collecting the information could be inequitable , perhaps amounting to discrimination . by discrimination , we mean the possibility of indirect discrimination , whereby policies or practices surrounding the use of genetic information in medical decision making could have the unintended effect of denying individuals access to health care on non - medical grounds .
we ask whether exclusion based on genetic information could result in inequitable access to health care , where equal medical need does not result in equal access . here
, we examine this question from legal and socioethical perspectives . indeed , these questions are timely as stakeholders worldwide have acknowledged that establishing fair access to genomic medicine is a priority as they contemplate translation strategies .
the practice of oncology has been revolutionized by the use of individual genetic information to identify those most at risk or likely to benefit from increased surveillance , therapeutic , and risk reduction measures for cancer . among the many new developments ,
genetic risk assessment models that calculate cancer risk represent an excellent case study from which to ask whether inequitable access to health care can result from the use of individual genetic information .
indeed , risk assessment that includes individual genetic information is one of the fastest growing areas of personalized medicine and promises to be a prominent component of health - care delivery going forward .
presently , clinical risk assessment for complex disease is predominantly based on family history , lifestyle , and shared environmental factors and the predictive value of non - genomic - based risk assessment is considered variable or low .
further , while genetic models have been in existence for nearly 20 years for breast cancer , the advent of genome - wide association scans and whole genome sequencing has led to the forecast that new risk prediction tools will emerge capable of using genomics to calculate an individual 's risk of developing not only cancer , but numerous other complex diseases . proposed risk assessment tools that include individual genomic information ,
however , promise to raise distinct concerns , as the analytic validity of such risk assessment is , arguably , higher than family history , justifying a greater number of medical decisions to be based on it . with
a greater number of risk assessment tools with increased predictive value expected to emerge , genomic - based risk assessment promises to have a profound impact on the delivery of health care by using genetic information to identify and intervene for those at risk , prior to development of disease .
breast cancer genetic risk assessment models are clinical tools that calculate a patients ' individual risk for developing cancer or harboring a cancer predisposing genetic mutation .
these tools seek to identify patients likely to benefit from increased cancer surveillance , prophylactic treatments , and other cancer risk reducing interventions . in existence for nearly 20 years , the models are based on cancer prevalence in particular populations . by mapping individual factors from the patient such as family history of cancer , age , etc .
, into the models , a patients ' individual cancer risk can be expressed numerically .
countries worldwide have established particular risk thresholds required before a patient is eligible for additional screening , or cancer risk reduction measures . as a result , patient stratification regarding access to health care occurs through the use of their genetic information . on the surface ,
use of breast cancer genetic risk prediction models to select patients for additional health care should not raise concerns for equitable access .
indeed , they are tools that have the purpose of improving the delivery health care .
strong medical , legal , ethical , and economic arguments exist favoring their use to maintain or improve equitable access to health care . from a medical perspective ,
decisions based on the best available scientific evidence is part of evidence - based medicine , a widely adopted practice in health - care systems worldwide .
hence , the use of risk assessment scores to select patients for additional care is consistent with evidence - based medicine .
use of risk assessment scores to prioritize patients can be justified from a legal perspective in the context of a publically funded health - care system .
for example , in canada , the canada health act , specifies the conditions for public funding of health care stipulating that universal public funding is provided for services that are deemed medically necessary for the purpose of maintaining health , preventing disease or diagnosing or treating an injury , illness or disability ' .
thus use of cancer risk assessment scores as a medical tool to identify those patients in need of further medical intervention is consistent with the legislated purpose of the public health insurance program to provide funding for medically necessary care .
use of risk assessment scores can also be justified from ethical perspectives . indeed , selecting only patients likely to benefit from additional interventions
spares those unlikely to benefit from the burden of additional medical treatment , consistent with the principle of non - malfeasance . in
publically funded health - care systems , limiting access to additional screening and testing by establishing thresholds through the use of risk assessment represents a fair distribution of limited resources , by prescribing additional treatment only to those in need .
while use of breast cancer genetic risk prediction models has advantages , the technology has limitations .
increasingly , researchers and decision makers have come to realize that successful implementation of genomic - based technologies requires consideration of not only benefits , but also drawbacks , medical , and otherwise .
thus , the clinical application of breast cancer genetic risk prediction models provides an opportunity to identify limitations and examine the consequences for equitable access to health care .
two categories of limitations can potentially give rise to the unintended effect of perpetuating inequities in access to health care : ( i ) limitations inherent to the models themselves and ( ii ) the means by which the models are implemented and used .
first , underlying limitations of the models themselves raise the question as to whether their use could be inequitable when applied across a general population .
indeed , variability exists within individual models in their ability to assess risk among different age and ethnic groups .
age under 40 has been shown to be a factor resulting in reduced accuracy of the models .
moreover , ethnicity has been shown to affect validity of the resulting risk assessment . in effect , some models have a high level of accuracy among some groups , such as italian or french canadian populations , while at the same time underestimating risk among other groups such as african - american , turkish , iranian , or hispanic populations .
concerns over accuracy among african americans , hispanics , and asians have led to questions from the medical community as to whether individuals in these groups receive optimal care when medical decisions are based on risk assessment scores .
more than a dozen models assessing breast cancer risk exist , and inconsistencies have been reported with respect to which model provides the most accurate degree of risk assessment .
as new data about the risk factors for cancer are continually incorporated into the models , understanding of the models becomes a moving target . finally , despite the clinical use of breast cancer risk prediction models for over 20 years
, systematic reviews of their performance have raised questions regarding their ability to consistently and accurately predict breast cancer risk across different populations , while the need for ongoing validation of the models as they are modified has been recognized .
. clinical collection of patient information upon which risk assessment is based is one example that illustrates the potential for inequities to occur during implementation
. family history , which provides insight into the shared genetic information of individuals , is considered the largest risk factor after age and gender for a number of cancers and other chronic conditions . as
breast cancer risk prediction models rely heavily on family history , it follows that accuracy of family history can significantly affect the validity of the resulting risk assessment .
despite the potential value of family history in cancer treatment and prevention , barriers have been reported in its clinical collection .
indeed , it is widely accepted that accuracy of family history is considered inadequate to fully assess familial cancer risk .
underlying inequities are known to exist emanating from both patients and health - care professionals . from patients , knowledge , socioeconomic , and cultural barriers
are each factors that have been shown to influence patient 's accuracy of their family history .
older age , lower education , and membership in a minority group have also been shown to be associated with lower accuracy of personal and family history of cancer .
health - care providers also contribute to the inaccuracy of family history . as no standard medical definition of family
member exists , health - care providers have reported being unclear themselves regarding information that should be collected .
further , health - care provider knowledge of cancer incidence among minority populations is purported to be a barrier to accurate collection of family history .
this has led to the recognition of the need to routinize and educate health - care professionals in clinical family history collection , and develop distinct family history tools targeting underserved groups . however , at present , such tools are only in the preliminary stages of development and still require validation .
limitations with respect to age , race , and underlying variability across breast cancer genetic risk prediction models , as well as limitations arising during their implementation , raise the possibility that some populations are excluded , or are sent for superfluous testing , not as a result of actual medical risk , but as a result of inequities arising from the limitations inherent to the models themselves or through the inadequate collection of family history .
such use of risk assessment scores to determine access to health care would not be discriminatory on the surface , but could represent a more insidious means through which use of genetic information could create or perpetuate inequities in accessing health care .
further , as the patient inputs and the means of collecting information for breast cancer risk prediction models are similar for risk prediction models for other diseases , similar questions can be asked of other genetic - based risk prediction tools .
the possibility for inequitable access resulting from the use of genetic information thus raises the following questions : what are the challenges for implementing genomic technology as a result of these limitations ?
limitations of breast cancer genetic risk prediction models highlight the challenges that exist for health - care professionals and governments seeking to maintain equitable access to health care when implementing technologies that use genetic information to inform medical decision making . for health - care professionals ,
how are they educated about underlying limitations in the tools , and how are these limitations taken into account when selecting or administering a model to a given patient ? for governments and hospitals administering a publically funded health - care system ,
how are these limitations taken into account when selecting which models will be relied upon , and what risk thresholds will be required to establish eligibility for subsequent health care ? in countries with diverse immigrant populations , how is the variable performance across ethnic groups taken into account when setting population - based thresholds ? at what point is the evidence gathered on risk prediction models considered sufficient for governments and health - care professionals to rely on their use in the clinic ?
simply put , how can evidence demonstrating their medical value be reconciled with the possibility of inequities arising during implementation ?
failure to consider these issues during implementation would increase the likelihood that inequities could be created or perpetuated by the use of risk prediction models in medical decision making .
consequently , it becomes important to consider the consequences , legal and ethical , of possible inequities .
could inequities arising through the use of risk prediction models result in legal consequences ? from an international law perspective ,
article 12 of the united nations international covenant on economic , social and cultural rights , for which 160 nations are party , states that everyone has the right to the enjoyment of the highest attainable standard of physical and mental health ' .
this has been interpreted by the un committee on economic , social and cultural rights to mean that the covenant proscribes any discrimination in access to health care and underlying determinants of health , as well as to means and entitlements for their procurement ' .
similarly , article 3 of the council of europe convention on human rights and biomedicine , provides that parties , taking into account health needs and available resources , shall take appropriate measures with a view to providing , within their jurisdiction , equitable access to health care of appropriate quality ' .
while neither provision creates enforceable rights for individuals alleging inequitable access to health care , nevertheless such provisions have persuasive value by imposing obligations on governments to consider equitable access in their political and legislative agendas surrounding health care .
moreover , in jurisdictions with publically funded health - care systems , legal mechanisms can exist that allow individuals to pursue the government on questions of equitable access to health care .
for example in canada , two normative regimes exist which together have the purpose of ensuring that all canadians have equitable access to publically funded health care .
citizens have the right under the canadian charter to challenge government decisions and have done so with respect to choice and availability of health - care services under the public system on the grounds that such decisions are indirectly discriminatory . given the national and international norms that exist surrounding equitable access to health care , it becomes prudent for nations having public and/or private health - care delivery models , to consider whether the use of genetic risk assessment scores could have for effect to deny individuals access to health care on non - medical grounds , and how to mitigate such effects during their implementation .
beyond legal questions , the effect of excluding or testing individuals on non - medical grounds raises ethical questions of the harm that would be caused to individuals as a result .
further , inequities arising from their use raises the question as to whether such use could be inconsistent with the principle of fair distribution of resources .
indeed , scientific advances underlying personalized medicine genetic - based technologies are the result of enormous public investment in basic genomic sciences .
the public is justified to expect that these discoveries will translate into products and services accessible to all , a sentiment echoed by the us national advisory council for human genome research stating that genetic - based personalized medicine will only achieve its full potential to improve health when the advances it engenders become accessible to all ' .
others have expressed that genomic - based advances represent tools to be used to address underlying health disparities , by identifying those at risk , while those most in need should not be the last to benefit .
thus , if new personalized medicine genetic technologies have the effect of inequitably excluding individuals , thereby becoming vehicles through which disparities are perpetuated , we can ask whether the decision to rely on information from them is ethical , in light of the significant public investment underlying their development .
health technology assessments and other implementation strategies are recognizing the need to improve implementation of genomic - based technologies and as a result , are integrating perspectives beyond scientific including ethical , legal , and social perspectives .
indeed , part of the center for disease control acce framework for evaluating genetic tests involves considering the potential for discrimination and stigmatization as impediments to their implementation .
however , as discussion surrounding genetic discrimination has been predominantly focused around employment or private insurance , we suggest that there is a need to consider a broader view of genetic discrimination , one which departs from the categorical conception of genetic discrimination , where it is either present or absent .
our case study of breast cancer genetic risk prediction models illustrates how using individual genetic information in medical decision making could give rise to inequities capable of creating or perpetuating disparities in accessing health care .
further it raises legal , ethical , and implementation challenges distinct from those raised in relation to employment or private insurance . as an increasing number of medical decisions
are based on individual genetic information , the potential for inequities arising from the medical use of this information also increases and it becomes important to consider this possibility .
thus , we suggest acknowledging the potential for inequitable access as occurring along a continuum ranging from inequities that could be tolerated in varying degrees , to intolerable , possibly amounting to discrimination .
challenges have been recognized related to evaluating the ethical , legal , and social concerns raised by genetic technologies and the need to improve upon methods to identify these concerns .
we advocate investment in research to assess the potential for inequitable access to occur from the use of emerging genetic technologies that are used in part to determine access to health care .
such research would be conducted early on to mitigate identified concerns and would address the following questions : we suggest examining new genetic technologies to assess whether limitations exist such that their use as medical decision making tools could have the effect of creating or perpetuating inequitable access to health care . for this
, evidence is needed to better understand these technologies from the perspective of the potential for inequities to occur .
for example , early assessment of the accuracy of breast cancer genetic risk prediction models compared among multiple age , socioeconomic , and ethnic backgrounds would provide an opportunity to ask whether a one size fits all ' approach is appropriate or to consider the extent to which subsequent medical decisions will be based on a risk assessment .
further , we ask whether the use of genetic information in a given genetic technology for medical decision making is compatible with existing legislative regimes surrounding equitable access to health .
a key remaining question is whether legislative regimes are appropriate tools to safeguard against possible inequities .
moreover , beyond legal questions raised , successful implementation requires that evidence of potential inequities arising through the use of individual genetic information be brought to the attention of and taken into consideration by health - care professionals using the technology , and by decision makers conducting health technology assessments .
the continuum approach to characterizing inequities as advocated above would recognize the need to adjust implementation efforts so as to address the potential for inequities according to the tolerance level and the likelihood that it will occur .
the use of genomic information to inform medical decision making raises significant social , ethical , and legal questions .
however , delaying implementation of tools that use genomic information until they are sufficiently perfected does not represent a realistic solution . as discussed , strong medical ,
rather , our example points to the need to continue to invest in parallel at improving upon the limitations of these tools , as well as identifying when to supplement information from genetic - based tools with other sources of information for clinical decision making .
early identification of the potential for inequities lends an opportunity to take proportionate proactive steps to minimize the risks of inequities during implementation . by anticipating and addressing the potential for inequitable access to health care to occur from the use of genetic information , we will move closer to realizing the goal of personalized medicine : to improve health care for individuals . | personalized medicine promises that an individual 's genetic information will be increasingly used to prioritize access to health care .
use of genetic information to inform medical decision making , however , raises questions as to whether such use could be inequitable . using breast cancer genetic risk prediction models as an example , on the surface clinical use of genetic information
is consistent with the tools provided by evidence - based medicine , representing a means to equitably distribute limited health - care resources .
however , at present , given limitations inherent to the tools themselves , and the mechanisms surrounding their implementation , it becomes clear that reliance on an individual 's genetic information as part of medical decision making could serve as a vehicle through which disparities are perpetuated under public and private health - care delivery models .
the potential for inequities arising from using genetic information to determine access to health care has been rarely discussed .
yet , it raises legal and ethical questions distinct from those raised surrounding genetic discrimination in employment or access to private insurance .
given the increasing role personalized medicine is forecast to play in the provision of health care , addressing a broader view of what constitutes genetic discrimination , one that occurs along a continuum and includes inequitable access , will be needed during the implementation of new applications based on individual genetic profiles . only by anticipating and addressing the potential for inequitable access to health care occurring from using genetic information will we move closer to realizing the goal of personalized medicine : to improve the health of individuals . | Using genetic information in medical decision making
Case study: breast cancer risk prediction models
Limitations of risk prediction models
Consequences for equitable access to health care
Challenges for implementation
Legal consequences
Ethical consequences
Conclusion |
paradoxical embolism causing acute myocardial infarction ( ami ) in the setting of patent foramen ovale ( pfo ) or atrial septal defect ( asd ) has been rarely reported.[14 ] the present report describes a case of ami due to paradoxical embolism in a patient with asd .
this may be related to the presence of intracardiac right to left shunt in the context of hypercoagulable state .
the presentation also emphasizes the importance of adequate anticoagulation therapy during perioperative period in patients with pfo / asd and hypercoagulable state .
a 16-year - old male known to have congenital heart disease was admitted with dyspnea on exertion ( new york heart association class ii ) . at 5 months of age
, he was diagnosed to have pulmonary stenosis , hypoplastic right ventricle , and asd .
the peak gradient across pulmonary valve dropped from 100 to 20 mmhg . on examination ,
electrocardiogram ( ecg ) showed a sinus rhythm and right bundle branch block [ figure 1a ] .
echocardiography showed mild pulmonary stenosis , severe right ventricular hypertrophy , and asd with right to left atrial shunt [ figure 2 ] .
( a ) a baseline electrocardiogram that showed sinus rhythm and right bundle branch block , ( b ) electrocardiogram immediately after cardiac arrest showed st segment elevation in the inferior leads and multiple premature atrial beats an echocardiography that demonstrated atrial septal defect ( upper ) , right to left shunt ( arrow ) and small severely hypertrophied right ventricle ( lower ) because of persistent symptoms , cyanosis , and right to left atrial shunt , the patient underwent glenn operation and partial closure of the asd .
two weeks after surgery , while using the incentive spirometry , the patient suddenly collapsed , developed ventricular fibrillation , and required two direct current ( dc ) shocks .
the patient was taken to catheterization laboratory where a total occlusion of the left circumflex coronary artery was treated with thrombus aspiration using export catheter ( medtronic , minneapolis , mn , usa ) .
the coronary flow was restored at timi flow 3 [ figure 3 ] with no further stenting .
the patient was then maintained on glycoprotein iib / iiia inhibitor ( abciximab ) and heparin infusions for 12 hours .
few months later , he underwent elective device closure of the asd / pfo [ figure 4 ] that resulted in substantial improvement in his symptoms .
( a ) invasive coronary angiography that demonstrated total occlusion of the left circumflex coronary artery with filling defect suggestive of thrombus , ( b ) the timi 3 flow was restored after repeated aspirations of the thrombus ( a ) , an echocardiography that demonstrated atrial septal defect with right to left shunt , ( b ) three dimensional echocardiography during device deployment ( c and d ) echocardiography few days after device deployment where atrial septal device was in place with no residual shunt
paradoxical embolism due to a pfo or an asd resulting in ami has been reported in the literature[16 ] but is rarely considered in clinical practice . coronary embolism
should always be suspected in the context of sudden chest pain in patients with valvular prosthesis , chronic atrial fibrillation , dilated cardiomyopathy , infective endocarditis , intracardiac shunts , cardiac myxoma , mural thrombi , and hypercoagulable states.[710 ] the standard treatment for coronary embolism with st elevation ami remains uncertain .
however , thrombolysis , percutaneous transluminal coronary angioplasty , and thrombus aspiration have been frequently used.[1113 ] thrombolysis has been associated with distal embolization causing complete obstruction in smaller branches.[1214 ] furthermore , if the source of the embolus is infected vegetation , thrombolysis might be contraindicated .
percutaneous transluminal coronary angioplasty and stenting have been used in some cases with coronary embolism and consequent ami .
successful catheter aspiration embolectomy has been described by some authors . in our patient with recent surgery
catheter aspiration embolectomy for the intracoronary thrombus was found very effective precluding the need for stenting .
anticoagulation with heparin and intravenous glycoprotein iib / iiia inhibitors was also used to reduce the risk of further embolism . | we present a case of a young male with severe pulmonary stenosis , hypoplastic right ventricle , and atrial septal defect .
acute embolic myocardial infarction , followed by cardiac arrest , occurred during hospitalization after glenn operation .
the therapeutic challenges are discussed .
insufficient anticoagulation therapy during the postoperative period was a possible contributing factor leading to embolic myocardial infarction . | INTRODUCTION
CASE REPORT
DISCUSSION |
vegf
and bfgf contents in various subtypes of grade i meningiomas vegf
( upper panel ) and bfgf ( lower panel ) contents were determined by
elisa .
n denotes the number of patients . for transitional
meningiomas : vegf range [ 0.259.85 ] and bfgf range
[ 67.4576.9 ] ; for microcystic meningiomas : vegf range
[ 0.715.29 ] and bfgf range [ 164.3520.0 ] ; for
meningothelial meningiomas : vegf range [ 0.874.98 ] and bfgf
range [ 183.6573.7 ] ; for fibroblastic meningiomas : vegf range
[ 0.101.69 ] and bfgf range [ 142.1377.3 ] .
*
no statistical differences were observed between groups ( mann - whitney
u test ) . | the quantitative analysis of vegf using elisa in various subtypes of grade i meningiomas reported higher vegf contents in meningothelial ( 2.38 0.62 pg/g protein , n = 7 ) , transitional ( 1.08 0.21 pg/g protein , n = 13 ) , and microcystic meningiomas ( 1.98 0.87 pg/g protein , n = 5 ) as compared with fibrous ones ( 0.36 0.09 pg/g protein , n = 5 ) .
in contrast to vegf , no difference in the concentrations of bfgf was detected .
vegf levels did not correlate with meningioma grade ( 1.47 0.23 pg/g versus 2.29 0.58 pg/g for 32 and 16 grade i and ii , resp ) , vascularisation ( 1.53 0.41 pg/g versus 1.96 0.28 pg/g for 24 low and 24 high vascularisated tumours , resp ) , and brain invasion ( 2.32 0.59 pg/g versus 1.46 0.27 pg/g for 7 and 41 patients with and without invasion , resp ) .
the elisa procedure is , thus , an interesting tool to ensure vegf and bfgf levels in meningiomas and to test putative correlations with clinical parameters .
it is , thus , tempting to speculate that elisa would also be valuable for the quantitative analysis of other angiogenic growth factors and cytokines in intracranial tumours . | Figures and Tables |
the composite international diagnostic interview ( cidi ) is a comprehensive and fully standardized diagnostic interview , primarily for use in epidemiological surveys and mental health research .
this instrument has not only been used worldwide in numerous epidemiological studies , but it was also psychometrically explored and reviewed in a considerable number of studies . although standardized diagnostic interviews such as cidi have been shown to be quite reliable in various cultural settings and populations , very few studies have examined the clinical validity of these diagnostic interviews in chinese population . therefore , there are still considerable concerns about the cross - cultural validity of diagnoses generated from these instruments when compared with careful and well - documented diagnoses assigned by clinical psychiatrists .
acceptable , but less promising estimates have also been obtained for some diagnoses in a few validity studies with quite variable designs in clinical samples and considerably less frequently in general population samples .
consistently poor validity estimates were obtained for several types of mental disorders , whereas anxiety and depressive disorders were demonstrated across studies to have good validity estimates , with kappa values of 0.5 or above . given the widespread use of the cidi in chinese epidemiological studies , there is an urgent need to determine the degree of concordance and the types of discrepancies between cidi and clinical diagnoses made by mental health professionals .
this paper presents the data from a systematic comparison of the translated cidi version , known as the cidi-3.0 , in an unselected clinical sample of patients with mental disorders , by comparing cidi / diagnostic and statistical manual of mental disorders , fourth edition ( dsm - iv ) diagnoses with those assigned by the treating clinical psychiatrists .
the aim of this study was to investigate the validity of the cidi in relation to the structured clinical interview for dsm - iv axis i disorders ( scid - i ) , a gold standard
the protocol was approved by the institutional reviewed board of institution of mental health , peking university .
translation of the composite international diagnostic interview there are several version of cidi in china .
the standard procedure of back - translation was followed for the cross - cultural adaptation of an original english psychometric instrument .
a team of experts completed the initial translation and a separate team then carried out an independent back - translation to confirm preservation of the meaning of the original english version .
an expert panel of four academic psychiatrists evaluated its content validity , tested it with chinese patients , and revised it to ensure its questions easily understandable and practically answerable by lay people . in the pilot study of the validity of cidi ,
the sensitivity ranged from 65.6% ( mood disorders ) to 87.0% ( substance use disorder ) and the specificity ranged from 83.3% ( anxiety disorders ) to 98.3% ( substance use disorders ) .
( = 0.05 , = 0.15 ) . to achieve adequate representation of the major mental disorders and sufficient nonpatient controls , the study was designed to include at least 71 cases with major depressive disorder , 30 with mania , 40 with anxiety disorder , 20 with an alcohol dependence disorder , 20 with eating disorder , and 60 healthy community - residing adults .
all patients were consecutively recruited from two participating psychiatric institutions between september 2006 and february 2008 .
exclusion criteria were age under 16 and having difficulties in completing cidi interview because of functional and cognitive disabilities including hearing and reading impairments , dementia , mental retardation , serious medical illnesses , marked and persisting hallucinations , thought disorders and disorganized speech .
a total of 194 patients , 46 were excluded , either because they satisfied the exclusion criteria or because they did not complete the interview , leaving 148 patients completed the study .
the healthy controls were selected from communities nearby the two participating psychiatric institutions , and they voluntarily participated in the study .
the two psychiatrists were fully licensed psychiatrists with at least 3 years of clinical experiences in psychiatry and had received an intensive training in the use of scid - i .
the six lay interviewers received 2-week training in the use of cidi that was provide by the beijing cidi training and resource center and completed at least 20 interviews under the supervision of experienced cidi trainers .
design and the clinical assessment procedure clinicians diagnoses the two psychiatrists interviewed all subjects with scid - i according to the definitions and criteria of dsm - iv , blinded to the results of cidi interviews .
both were informed about aim and procedures of the study and the necessity of a complete and detailed documentation of the psychopathology , course of illness and final diagnostic decision for each participating patient ; they were also encouraged to consult the dsm - iv manual and use all information available ( e.g. , history of psychiatric illnesses and treatment ) whenever necessary .
all probable and definite lifetime diagnoses recorded in scid - i interview charts were used as the gold standard in the final analyses .
discrepancy and case - by - case review after analyzing the diagnostic concordance , one psychiatrist reviewed interview records of all discrepant cases , in an attempt to identify why either the cidi did not pick up significant psychopathology or why the psychiatrist did not confirm the cidi diagnoses .
the validity of cidi against scid - i was assessed using the sensitivity ( sn ) , specificity ( sp ) , positive predictive value ( ppv ) , and negative predictive value ( npv ) .
the raw data were also cross tabulated . individual - level cidi - scid diagnostic concordance was evaluated using two different descriptive measures : the area under the receiver operator characteristic curve ( auc ) and cohen 's k. although k is the most widely used measure of concordance in validity studies of mental disorders , it has been criticized for its dependency on prevalence .
various populations are different in prevalence when the populations do not differ in sn or sp . as sn and sp
are considered to be fundamental parameters , this means that the comparisons across different populations can not be used to evaluate the cross - population performance of a test .
the odds ratio ( or ) meets this requirement , as or = ( sn sp)/([1 sn ] [ 1 sp ] ) .
however , the upper end of the or is unbounded , making it difficult to evaluate the extent to which cidi diagnoses are consistent with clinical diagnoses .
yules q has been proposed as an alternative measure to resolve this problem , as q is a bounded transformation of or ( q = [ or 1]/[or + 1 ] ) that ranges between 1 and + 1 .
q can be interpreted as the difference in the probabilities of a clinical case and a clinical noncase that differ in their classification on the cidi .
( clinical cases and noncases that have the same cidi classification ) are excluded , which means that q does not tell about actual prediction accuracy .
the auc is a measure that resolves this problem , as auc can be interpreted as the probability that a randomly selected clinical case will score higher on the cidi than a randomly selected noncase .
the protocol was approved by the institutional reviewed board of institution of mental health , peking university .
translation of the composite international diagnostic interview there are several version of cidi in china .
the standard procedure of back - translation was followed for the cross - cultural adaptation of an original english psychometric instrument .
a team of experts completed the initial translation and a separate team then carried out an independent back - translation to confirm preservation of the meaning of the original english version .
an expert panel of four academic psychiatrists evaluated its content validity , tested it with chinese patients , and revised it to ensure its questions easily understandable and practically answerable by lay people . in the pilot study of the validity of cidi ,
the sensitivity ranged from 65.6% ( mood disorders ) to 87.0% ( substance use disorder ) and the specificity ranged from 83.3% ( anxiety disorders ) to 98.3% ( substance use disorders ) .
( = 0.05 , = 0.15 ) . to achieve adequate representation of the major mental disorders and sufficient nonpatient controls , the study was designed to include at least 71 cases with major depressive disorder , 30 with mania , 40 with anxiety disorder , 20 with an alcohol dependence disorder , 20 with eating disorder , and 60 healthy community - residing adults .
all patients were consecutively recruited from two participating psychiatric institutions between september 2006 and february 2008 .
exclusion criteria were age under 16 and having difficulties in completing cidi interview because of functional and cognitive disabilities including hearing and reading impairments , dementia , mental retardation , serious medical illnesses , marked and persisting hallucinations , thought disorders and disorganized speech .
a total of 194 patients , 46 were excluded , either because they satisfied the exclusion criteria or because they did not complete the interview , leaving 148 patients completed the study .
the healthy controls were selected from communities nearby the two participating psychiatric institutions , and they voluntarily participated in the study .
the two psychiatrists were fully licensed psychiatrists with at least 3 years of clinical experiences in psychiatry and had received an intensive training in the use of scid - i .
the six lay interviewers received 2-week training in the use of cidi that was provide by the beijing cidi training and resource center and completed at least 20 interviews under the supervision of experienced cidi trainers
. design and the clinical assessment procedure clinicians diagnoses the two psychiatrists interviewed all subjects with scid - i according to the definitions and criteria of dsm - iv , blinded to the results of cidi interviews .
both were informed about aim and procedures of the study and the necessity of a complete and detailed documentation of the psychopathology , course of illness and final diagnostic decision for each participating patient ; they were also encouraged to consult the dsm - iv manual and use all information available ( e.g. , history of psychiatric illnesses and treatment ) whenever necessary .
all probable and definite lifetime diagnoses recorded in scid - i interview charts were used as the gold standard in the final analyses .
discrepancy and case - by - case review after analyzing the diagnostic concordance , one psychiatrist reviewed interview records of all discrepant cases , in an attempt to identify why either the cidi did not pick up significant psychopathology or why the psychiatrist did not confirm the cidi diagnoses .
the validity of cidi against scid - i was assessed using the sensitivity ( sn ) , specificity ( sp ) , positive predictive value ( ppv ) , and negative predictive value ( npv ) .
individual - level cidi - scid diagnostic concordance was evaluated using two different descriptive measures : the area under the receiver operator characteristic curve ( auc ) and cohen 's k. although k is the most widely used measure of concordance in validity studies of mental disorders , it has been criticized for its dependency on prevalence .
various populations are different in prevalence when the populations do not differ in sn or sp . as sn and sp
are considered to be fundamental parameters , this means that the comparisons across different populations can not be used to evaluate the cross - population performance of a test .
the odds ratio ( or ) meets this requirement , as or = ( sn sp)/([1 sn ] [ 1 sp ] ) .
however , the upper end of the or is unbounded , making it difficult to evaluate the extent to which cidi diagnoses are consistent with clinical diagnoses .
yules q has been proposed as an alternative measure to resolve this problem , as q is a bounded transformation of or ( q = [ or 1]/[or + 1 ] ) that ranges between 1 and + 1 .
q can be interpreted as the difference in the probabilities of a clinical case and a clinical noncase that differ in their classification on the cidi .
( clinical cases and noncases that have the same cidi classification ) are excluded , which means that q does not tell about actual prediction accuracy .
the auc is a measure that resolves this problem , as auc can be interpreted as the probability that a randomly selected clinical case will score higher on the cidi than a randomly selected noncase .
the mean age of all patient participants was 33.5 14.2 years , 61.5% were females , and the mean educational year of the respondents was 10.1 years .
the healthy controls and patients differed not significantly in terms of education , age group , and gender . within the subjects with mental disorders ,
women were somewhat overrepresented in the anxiety depression and eating groups and underrepresented in the substance use disorder group .
table 2 shows the frequency of dsm - iv lifetime diagnoses identified in the scid - i and cidi interviews . in total ,
scid - i interviews recognized 46 cases with major depressive disorder , 20 with bipolar disorders , 59 with anxiety disorders , 20 with eating disorders , 33 with psychotic disorders , 20 with alcohol or drug disorders .
demographic characteristics of patients with mental disorders and healthy people , n ( % ) frequency of dsm - iv lifetime diagnoses assigned by the clinician using scid - p and by the cidi 3.0 dsm - iv algorithms * 33 subjects was diagnosis as psychosis by clinicians ; other anxiety disorders : specific phobia disorder , social phobia , agoraphobia , panic disorder , ptsd .
dsm - iv : diagnostic and statistical manual of mental disorders , fourth edition ; scid : structured clinical interview for dsm - iv axis i disorders ; cidi-3.0 : composite international diagnostic interview-3.0 ; ocd : obsessive and compulsive disorder .
table 3 provides crosstab number of cidi - scid diagnose , auc , or , q , sns , sps , ppvs , and npvs for each diagnosis generated by the cidi .
the separate disorder - specific cidi - scid comparisons of lifetime prevalence were made for major depression , bipolar disorder , general anxiety disorder , obsessive and compulsive disorder ( ocd ) , other anxiety disorders ( including panic disorder , phobias , posttraumatic stress disorder [ ptsd ] ) , alcohol abuse with or without dependence , anorexia nervosa , bulimia nervosa , binge eating disorder , and psychosis .
the individual - level cidi - scid lifetime concordance for dsm - iv diagnosis was substantial to excellent for three disorders : substance use disorders ( auc = 0.926 ) , anxiety disorders ( auc = 0.807 ) , and mood disorders ( auc = 0.806 ) . in detail , the concordance was moderate ( auc : 0.70.8 ) for general anxiety disorder , ocd , other anxiety disorder , and psychosis .
the concordance was almost perfect ( auc 0.9 ) for alcohol and substance use disorders and major depression , but fairly inadequate ( auc in the range : 0.60.7 ) for the remaining disorders ( bulimia nervosa ) .
the concordance between the cidi and the scid for two individual disorders , bipolar disorders ( auc = 0.55 ) and anorexia nervosa ( auc = 0.50 ) was poor with very high sps and very poor sns .
the majority of scid cases were detected by the cidi ( sn ) for major depression ( 69.6% ) , general anxiety disorders ( 58.6% ) , ocd ( 82.8% ) , substance dependence ( 87.0% ) , and psychosis screen ( 63.6% ) .
the vast majority of cidi cases , in comparison , were confirmed by the scid ( ppv ) , including 83.3% ( 85.0100.0% ) with anxiety disorder , 96.7100% with mood disorder , and 98.3% with substance disorder .
the sn values were particularly low for the diagnoses of bipolar disorder and eating disorder ( 0.040.0% ) .
consistency of lifetime dsm - iv cidi and scid diagnoses with cross tabulation of findings ( n = 148 ) * other anxiety disorders : specific phobia disorder , social phobia , agoraphobia , panic disorder , ptsd .
tn : true negatives ; fn : false - negatives ; fp : false - positives ; tp : true - positives ; or : odds ratio ; auc : area under the roc curve ; roc : receiver operating characteristic ; sn : sensitivity ; sp : specificity ; ppv : positive predictive value ; npv : negative predictive value .
q : yules q ; se : standard error ; ptsd : posttraumatic stress disorder ; ocd : obsessive and compulsive disorder ; dsm - iv : diagnostic and statistical manual of mental disorders ; fourth edition ; scid : structured clinical interview for dsm - iv axis i disorders ; cidi : composite international diagnostic interview .
the mean age of all patient participants was 33.5 14.2 years , 61.5% were females , and the mean educational year of the respondents was 10.1 years .
the healthy controls and patients differed not significantly in terms of education , age group , and gender . within the subjects with mental disorders ,
women were somewhat overrepresented in the anxiety depression and eating groups and underrepresented in the substance use disorder group .
table 2 shows the frequency of dsm - iv lifetime diagnoses identified in the scid - i and cidi interviews . in total ,
scid - i interviews recognized 46 cases with major depressive disorder , 20 with bipolar disorders , 59 with anxiety disorders , 20 with eating disorders , 33 with psychotic disorders , 20 with alcohol or drug disorders .
demographic characteristics of patients with mental disorders and healthy people , n ( % ) frequency of dsm - iv lifetime diagnoses assigned by the clinician using scid - p and by the cidi 3.0 dsm - iv algorithms * 33 subjects was diagnosis as psychosis by clinicians ; other anxiety disorders : specific phobia disorder , social phobia , agoraphobia , panic disorder , ptsd .
dsm - iv : diagnostic and statistical manual of mental disorders , fourth edition ; scid : structured clinical interview for dsm - iv axis i disorders ; cidi-3.0 : composite international diagnostic interview-3.0 ; ocd : obsessive and compulsive disorder .
table 3 provides crosstab number of cidi - scid diagnose , auc , or , q , sns , sps , ppvs , and npvs for each diagnosis generated by the cidi .
the separate disorder - specific cidi - scid comparisons of lifetime prevalence were made for major depression , bipolar disorder , general anxiety disorder , obsessive and compulsive disorder ( ocd ) , other anxiety disorders ( including panic disorder , phobias , posttraumatic stress disorder [ ptsd ] ) , alcohol abuse with or without dependence , anorexia nervosa , bulimia nervosa , binge eating disorder , and psychosis .
the individual - level cidi - scid lifetime concordance for dsm - iv diagnosis was substantial to excellent for three disorders : substance use disorders ( auc = 0.926 ) , anxiety disorders ( auc = 0.807 ) , and mood disorders ( auc = 0.806 ) .
in detail , the concordance was moderate ( auc : 0.70.8 ) for general anxiety disorder , ocd , other anxiety disorder , and psychosis .
the concordance was almost perfect ( auc 0.9 ) for alcohol and substance use disorders and major depression , but fairly inadequate ( auc in the range : 0.60.7 ) for the remaining disorders ( bulimia nervosa ) .
the concordance between the cidi and the scid for two individual disorders , bipolar disorders ( auc = 0.55 ) and anorexia nervosa ( auc = 0.50 ) was poor with very high sps and very poor sns . the majority of scid cases were detected by the cidi ( sn ) for major depression ( 69.6% ) , general anxiety disorders ( 58.6% ) , ocd ( 82.8% ) , substance dependence ( 87.0% ) , and psychosis screen ( 63.6% ) .
the vast majority of cidi cases , in comparison , were confirmed by the scid ( ppv ) , including 83.3% ( 85.0100.0% ) with anxiety disorder , 96.7100% with mood disorder , and 98.3% with substance disorder .
the sn values were particularly low for the diagnoses of bipolar disorder and eating disorder ( 0.040.0% ) .
consistency of lifetime dsm - iv cidi and scid diagnoses with cross tabulation of findings ( n = 148 ) * other anxiety disorders : specific phobia disorder , social phobia , agoraphobia , panic disorder , ptsd .
tn : true negatives ; fn : false - negatives ; fp : false - positives ; tp : true - positives ; or : odds ratio ; auc : area under the roc curve ; roc : receiver operating characteristic ; sn : sensitivity ; sp : specificity ; ppv : positive predictive value ; npv : negative predictive value .
q : yules q ; se : standard error ; ptsd : posttraumatic stress disorder ; ocd : obsessive and compulsive disorder ; dsm - iv : diagnostic and statistical manual of mental disorders ; fourth edition ; scid : structured clinical interview for dsm - iv axis i disorders ; cidi : composite international diagnostic interview .
the present study estimated the concordance of diagnoses based on the cidi-3.0 with diagnoses based on scid - i interviews .
overall , our data suggested that the cidi-3.0 succeeds in validly eliciting diagnoses used in making dsm - iv diagnoses .
there are several possible factors that may have contributed to the low concordance figures for the two disorders in this study .
one major reason is the difference between the information - collecting methods of the cidi and scid .
the patients with a diagnosis of bipolar disorder might refuse to confirm about some of their symptom .
have you ever had a period lasting 4 days or longer when you became so happy or excited that you either got into trouble , people worried about you , or a doctor said you were manic ? ) .
patients with anorexia nervosa were not more likely to endorse to some questions ( ea1 . this part of the interview is about problems you might have had either with eating or with your weight . was a time in your life when you had a great deal of concern about or strongly feared being too fat or overweight ? ) . because of the cultural differences in presentation of symptoms
, some chinese patients do not admit the symptom of strongly feared being too fat or overweight ,
the study was used a clinical sample with the advantage of complete and comprehensive longitudinal symptom and diagnostic documentation .
however , it is necessary to be cautious about generalizing the findings to nonclinical general population samples , for which one might expect more close - to - threshold conditions .
another possibility is that in the current study , the clinical samples are known to have a considerable degree of comorbidity .
this has the advantage of allowing for more disorder - specific comparisons with small samples .
however , this approach might also inflate the concordance estimations , due to the inclusions of the same subject in testing several diagnoses .
similar risk existed in our choice of not using the optional dsm - iv / cidi-3.0 diagnostic hierarchy rules because it would considerably reduce the number of cidi-3.0 diagnoses assigned .
second , both ppv and npv depend on prevalence . although sn and sp do not depend on prevalence , they still depend on the case mix .
finally , the small sample size did not allow for more extensive subgroup comparisons by characteristics of interviewers and subjects , but we could expect , based on similar previous studies , that the cidi-3.0 is quite robust in empirical validity .
further , we focused on lifetime mental disorders , therefore , the validity of cidi in diagnosing 12-month or 1-month mental disorders needed to be examined in future studies . in conclusion , the validity study has shown that cidi - scid concordance in dsm - iv diagnoses is generally good , however , for specific mental disorders , such as bipolar and eating disorders , we should be cautious in using cidi .
this work was supported by grants from special research project of ministry of health ( no .
201202022 ) , the national 11 5-year plan of ministry of science and technology of china ( no .
2007bai17b01 ) , and national key technology research and development program of the ministry of science and technology of china ( no .
this work was supported by grants from special research project of ministry of health ( no .
201202022 ) , the national 11 5-year plan of ministry of science and technology of china ( no .
2007bai17b01 ) , and national key technology research and development program of the ministry of science and technology of china ( no . | background : the composite international diagnostic interview-3.0 ( cidi-3.0 ) is a fully structured lay - administered diagnostic interview for the assessment of mental disorders according to icd-10 and diagnostic and statistical manual of mental disorders , fourth edition ( dsm - iv ) criteria . the aim of the study was to investigate the concurrent validity of the chinese cidi in diagnosing mental disorders in psychiatric settings.methods:we recruited 208 participants , of whom 148 were patients from two psychiatric hospitals and 60 healthy people from communities .
these participants were administered with cidi by six trained lay interviewers and the structured clinical interview for dsm - iv axis i disorders ( scid - i , gold standard ) by two psychiatrists .
agreement between cidi and scid - i was assessed with sensitivity , specificity , positive predictive value and negative predictive value .
individual - level cidi - scid diagnostic concordance was evaluated using the area under the receiver operator characteristic curve and cohen 's k.results:substantial to excellent cidi to scid concordance was found for any substance use disorder ( area under the receiver operator characteristic curve [ auc ] = 0.926 ) , any anxiety disorder ( auc = 0.807 ) and any mood disorder ( auc = 0.806 ) .
the concordance between the cidi and the scid for psychotic and eating disorders is moderate .
however , for individual mental disorders , the cidi - scid concordance for bipolar disorders ( auc = 0.55 ) and anorexia nervosa ( auc = 0.50 ) was insufficient.conclusions:overall , the chinese version of cidi-3.0 has acceptable validity in diagnosing the substance use disorder , anxiety disorder and mood disorder among chinese adult population .
however , we should be cautious when using it for bipolar disorders and anorexia nervosa . | I
M
Ethnics
Study design
Statistics
R
Clinical and demographic characteristics of study sample
Lifetime individual-level concordance between the Composite International Diagnostic Interview-3.0 and the Structured Clinical Interview for DSM-IV Axis I Disorder
D
Financial support and sponsorship
Conflicts of interest |
tobacco use is a major modifiable risk factor for health , which is one of the leading causes of a range of cardiovascular and respiratory disorders in addition to various cancers in the body .
india has a huge burden of tobacco - related morbidity , disability , and mortality .
the global adult tobacco survey ( gats ) in 2010 revealed that 47.9% of males and 20.3% of females , constituting 34.6% of the adult population , used tobacco in one or the other form in india .
social and cultural acceptance among youth is one of the reason for higher prevalence of tobacco consumption in india . among the 70% of nicotine dependent participants reporting that they want to quit , annually only 46% succeed .
unassisted tobacco cessation is very low unlike in the west . to assist the tobacco cessation efforts of tobacco users , tobacco cessation clinics ( tccs ) were started across india by the ministry of health and family welfare , government of india , with the support of the world health organization in 2002 .
a tcc provides interventions such as behavioral counseling with or without medication ( nicotine / non - nicotine replacement therapy ) . however , long - term outcome of these interventions conducted at tccs remained poor , but successful than unassisted tobacco cessation .
a recently published study showed that only 26% participants improved at 3 months , 21% at 6 months , and 18% at 9 months .
major barriers for long - term tobacco cessation include peer pressure , lack of psychosocial support , attitude towards tobacco cessation , younger age , lack of community awareness , lack of trained professionals , and poor follow - up in subsequent visits . to improve tobacco cessation outcome
, it needs to go beyond the health sector to multiple settings such as workplace , educational , and tobacco control policies .
workplace and educational setting has shown two to three times increase in tobacco cessation rate .
these results are promising , but limited by uncontrolled study design , non - homogenous study population , and minimal interventions . to overcome the limitations of previously conducted studies , the present study aimed to compare the effectiveness of tobacco cessation services in clinical and workplace settings .
the study was conducted with due permission and support from the management , union , and employees of the selected industry as well as hospital .
fifty employees working in the selected chemical industrial unit and willing to participate were enrolled in the workplace group .
an equal number of age and sex - matched participants visiting tcc of jagruti de - addiction centre were recruited in the tcc group .
the participants with a previous history of psychiatric illness or neurological illness were excluded from study .
the aim and purpose of the study were explained to each participant , and those who are willing to participate were enrolled after signing the written informed consent form which was made available in the local language ( marathi ) .
the first session included an introductory lecture and interviews of the participants to collect preintervention data about various sociodemographic and risk factor variables .
the follow - up sessions were offered at 2 weeks and 4 weeks , and then at 3 months and 6 months for both the clinical and tcc groups . during these sessions , professional help in the form of health awareness sessions , focus group discussion , one - on - one counseling , and pharmacotherapy including nicotine ( gum , lozenges ) and non - nicotine ( bupropion and varenicline ) replacement was provided to the employees by a team of doctors and counselors . during follow - up , abstinence was evaluated by self - report and biochemically confirmed by negative result of a cotinine test performed on saliva ( a cotinine level of < 15 ng per milliliter ) or urine sample ( with a level of < 2 ng per milliliter ) .
sample size was based on change in the primary outcome variable ( qualitative outcome i.e. complete tobacco cessation , more than 50% reduction , no change , and drop out ) .
the ps , power and sample size calculation version 3.1.2 was used for sample size calculation .
prior studies indicate that the probability of complete tobacco cessation after 6 months of treatment in clinical setting is 0.20 and odds ratio for tobacco cessation in workplace settings is 3.65 .
the sample size was calculated with a power of 80% , precision rate of 5% , correlation coefficient ( ) of 0.5 , and matched in 1:1 ratio . the minimum sample size for this study
was calculated to be 47 , and therefore , 50 participants were included in each group .
the statistical analysis was carried out by using the statistical package for the social sciences ( spss ) version 21.0 .
the categorical variables were expressed in percentage and analyzed by independent chi - square test and fisher exact test .
the quantitative data were expressed in mean sd ( standard deviation ) , and compared using independent t - test .
multinominal logistic regression was used to predict the outcome of tobacco cessation in both the settings . for each test , the significance level was set at p < 0.05 .
fifty employees working in the selected chemical industrial unit and willing to participate were enrolled in the workplace group .
an equal number of age and sex - matched participants visiting tcc of jagruti de - addiction centre were recruited in the tcc group .
the participants with a previous history of psychiatric illness or neurological illness were excluded from study .
all the participants were enrolled in the month of august 2015 . the aim and purpose of the study were explained to each participant , and those who are willing to participate were enrolled after signing the written informed consent form which was made available in the local language ( marathi ) .
the first session included an introductory lecture and interviews of the participants to collect preintervention data about various sociodemographic and risk factor variables .
the follow - up sessions were offered at 2 weeks and 4 weeks , and then at 3 months and 6 months for both the clinical and tcc groups . during these sessions , professional help in the form of health awareness sessions , focus group discussion , one - on - one counseling , and pharmacotherapy including nicotine ( gum , lozenges ) and non - nicotine ( bupropion and varenicline ) replacement was provided to the employees by a team of doctors and counselors . during follow - up , abstinence was evaluated by self - report and biochemically confirmed by negative result of a cotinine test performed on saliva ( a cotinine level of < 15 ng per milliliter ) or urine sample ( with a level of < 2 ng per milliliter ) .
sample size was based on change in the primary outcome variable ( qualitative outcome i.e. complete tobacco cessation , more than 50% reduction , no change , and drop out ) .
the ps , power and sample size calculation version 3.1.2 was used for sample size calculation .
prior studies indicate that the probability of complete tobacco cessation after 6 months of treatment in clinical setting is 0.20 and odds ratio for tobacco cessation in workplace settings is 3.65 .
the sample size was calculated with a power of 80% , precision rate of 5% , correlation coefficient ( ) of 0.5 , and matched in 1:1 ratio .
the minimum sample size for this study was calculated to be 47 , and therefore , 50 participants were included in each group .
the statistical analysis was carried out by using the statistical package for the social sciences ( spss ) version 21.0 .
the categorical variables were expressed in percentage and analyzed by independent chi - square test and fisher exact test .
the quantitative data were expressed in mean sd ( standard deviation ) , and compared using independent t - test .
multinominal logistic regression was used to predict the outcome of tobacco cessation in both the settings . for each test
the clinical and sociodemographic characteristics of the workplace and tcc groups are depicted in table 1 .
there was no statistically significant difference between the two groups in terms of age , socioeconomic status , residence , type of tobacco use , and intervention for tobacco cessation .
the age of initiation of tobacco use was significantly lower in case of participants attending tobacco cessation services than the workplace group ( p < 0.001 ) .
however , the fagerstrom score was higher and significant among the participants with tobacco cessation group than the workplace group ( t = 2.03 df = 98 , p = 0.045 ) .
sociodemographic and clinical characteristics of workplace and tcc groups table 2 and figure 1 show the outcome of tobacco cessation at the end of 2 weeks , 4 weeks , 3 months , and 6 months after intervention , at the end of 2 weeks , ( n = 9 , 18% ) participants in the tcc group and ( n = 22 , 44% ) participants in the workplace group stopped tobacco consumption completely , whereas ( n = 14 , 28% ) participants in the tcc group and ( n = 22 , 44% ) participants in the workplace group reduced tobacco consumption .
tobacco cessation rate was increased in the subsequent visit in both the groups . however , proportion of tobacco cessation in the workplace group was higher in comparison to the tcc group .
outcome of tobacco cessation in two groups outcome of tobacco cessation in two groups at the end of 6 months , ( n = 12 , 24% ) participants in the tcc group and ( n = 30 , 60% ) participants in the workplace group stopped tobacco consumption completely , whereas ( n = 4 , 8% ) participants in the tcc group and ( n = 10 , 20% ) participants in the workplace group reduced tobacco consumption .
only ( n = 1 , 2% ) participant at the end of 2 weeks and ( n = 14,28% ) participants at the end of 6 months were lost to follow up in the workplace group , while ( n = 13,26% ) participants at the end of 2 weeks and ( n = 27 , 54% ) participants at the end of 6 months were lost to follow up in the tcc group . on multinominal logistic regression ,
odds ratio ( or ) for complete tobacco cessation was ( or = 0.20 , 95% ci = 0.0820.526 , p < 0.001 ) , more than 50% reduction was ( or = 1.29 , 95% ci = 0.344.88 , p = 0.70 ) , and no change was ( or = 0.25 , 95% ci = 0.023.11 , p = 0.28 ) in clinical group [ table 3 ] .
the present study aimed to compare the effectiveness of tobacco cessation services in clinical and workplace settings .
we observed that the outcome of tobacco cessation improved in the workplace group than the clinical group .
after 6 months of intervention , complete tobacco cessation rate was 2.5 times higher among the workplace group than the clinical group .
in addition , the tobacco cessation rate was consistently maintained over period of 6 months , with a lower dropout rate in the workplace group than the clinical group .
the literature on tobacco cessation suggests that most relapses occur within the first month of cessation , and that approximately 90% of the relapses occur within the first 6 months .
the reasons for this may be that the workplace group was more homogenous and cohesive and peer support in workplace group may be more effective than family support in the tcc group .
peer pressure has a vital role as a predisposing , reinforcing , and enabling factor for tobacco use .
further studies are warranted to explore the role of peer pressure in tobacco cessation as most of the previous reviews and studies are inconclusive .
the primary finding , i.e. , improved outcome in workplace setting than that in the clinical group , is in support with almost three - quarters of the previously conducted studies and meta - analysis .
there are few studies that showed contradictory findings , suggesting the non - effectiveness of workplace interventions .
however , these studies were uncontrolled , having poor inclusion and exclusion criteria , and other methodological issues .
in addition , the recently published cochrane review showed that there is strong evidence for some interventions ( individual / group counseling , pharmacological treatment ) which increases the tobacco cessation rate in the workplace .
self - help group and social support are less effective in tobacco cessation . out of the 57 reviewed trials , only 5 trials examined outcome with pharmacotherpy , despite having high quality of evidence ; most of the trials included one or more intervention at the workplace .
in the present study , intensive , comprehensive , and multiple interventions were carried out at both the places , depending on indications in individual case , which may be the reason for higher success rate among the workplace group than the clinical group and previously conducted studies .
another important finding in the present study was that the tcc group participants were highly tobacco dependent than workplace group participants and the age of initiation of tobacco use was also lower among the tcc group participants than the workplace group participants .
the early age of initiation of tobacco consumption and higher tobacco dependence may also be responsible for high failure rate and dropout in the tcc group than the workplace group in addition to various individual predictors such as sociodemographic variables ( socioeconomic status and residence ) , number of quit attempts , motivational variables , and nicotine - related variables .
tobacco cessation barriers include poor knowledge , lack of advice and support , lack of motivation , as well as intrapersonal , social , cultural , and financial factors . most of these barriers may be reduced or eliminated by multiple interventions carried out in our study such as pre - awareness session , focus group discussion , one - on - one counseling , and pharmacotherapy resulting in low dropout rate and adherence to the tobacco cessation program .
only few studies have been attempted in the indian context , the second largest tobacco consumer in the world , with variable success .
the present study not only represents the success of workplace setting , but also of multiple interventions , as well as an intensive and integrated approach .
in addition , workplace - based tobacco cessation interventions are cost effective . in the present study
, there was no difference among the two groups for confounding factors such as sociodemographic variables and pharmacological intervention reflecting well - controlled and planned study design than previous studies .
the present study population represents a small sample size , open - label design , and only male employees from low socioeconomic status .
further large scale , multicentric , controlled studies are required to better understand the role of gender , peer pressure , and sociocultural factors in tobacco cessation outcome in the workplace settings among the indian population .
in the present study , there was no difference among the two groups for confounding factors such as sociodemographic variables and pharmacological intervention reflecting well - controlled and planned study design than previous studies .
the present study population represents a small sample size , open - label design , and only male employees from low socioeconomic status .
further large scale , multicentric , controlled studies are required to better understand the role of gender , peer pressure , and sociocultural factors in tobacco cessation outcome in the workplace settings among the indian population .
our study shows that multiple , intensive tobacco cessation interventions are more effective in workplace setting than the clinical setting ( tcc ) .
peer support and regular follow - up in the workplace setting may be responsible to increase the success rate .
our study findings suggest that there is a need of expansion of existing clinic - based tobacco cessation services to workplace tobacco cessation services . | aims and objectives : several biological , social , and cultural factors contribute to the poor outcome of tobacco cessation interventions .
inability to engage large number of participants is one of the major identifiable factors .
the objective of this study was to compare the outcome of tobacco cessation interventions in the clinical and workplace settings.materials and methods : in the present study , we recruited 100 participants in tobacco cessation clinic ( tcc ) group and workplace group ( 50 participants in each ) .
both the groups were regularly intervened and were followed up regularly at 2 weeks , 4 weeks , 3 months , and 6 months .
active interventions in the form of awareness lectures , focused group discussions , and if needed , pharmacotherapy ( nicotine / non - nicotine replacement therapy ) was carried out for all participants .
the outcome was assessed as no change , harm reduction ( > 50% reduction ) , complete cessation , and drop out .
statistical analysis of the data was done using the statistical package for the social sciences version 21.0.results:at the end of 1 month , there was higher tobacco cessation rate in the workplace group versus tcc group (
n = 22 , 44% vs n = 9 , 18% ; p < 0.0001 ) .
the tobacco cessation rate was maintained even after 6 months of intervention ( n = 30 , 60% vs n = 12 , 24% ; p = 0.002 ) and dropout rate was also lower among the workplace group than the tcc group ( n = 14 , 28% vs n = 27 , 54% ; p < 0.0001).conclusions : our study findings suggest that the workplace setting has superior outcome in tobacco cessation and harm reduction than clinical setting . in addition , it is associated with low dropout rate and the cessation effect is maintained over a period of 6 months . | INTRODUCTION
MATERIALS AND METHODS
Participants
Intervention
Sample size calculation and statistical analysis
RESULTS
DISCUSSION
Strengths and limitations
CONCLUSION
Financial support and sponsorship
Conflicts of interest |
it has been reported that the limited oral opening may result from the surgical treatment of orofacial cancers , cleft lips , trauma , burns , plummer - vinson syndrome or scleroderma .
the maximum oral opening that is smaller than the size of complete denture can make the prosthetic treatment challenging .
several techniques have been described for use when either standard impression trays or the denture itself becomes too difficult to place and remove from the mouth .
describe a maxillary complete denture consisting of 2 pieces joined by a stainless steel rod with a diameter of 1 mm fitted behind the central incisors .
describe a sectional impression procedure for dentulous patient by using 2 plastic sectional impression trays assembled with lego building blocks and autopolymerizing resin . in this article ,
a different design for the fabrication of maxillary and mandibular sectional trays and a foldable maxillary and mandibular complete denture is described .
there was no suggestive history of smoking , alcoholism or any other systemic disease . on clinical examination ,
preliminary impressions for both dental arches were obtained with a putty silicon impression material ( imprint , 3 m espe , germany ) with the help of finger pressure . the impressions were poured in dental stone ( kalstone , kalabhai karson , mumbai ) to obtained primary cast .
an autopolymerizing acrylic resin ( dpi rr cold cure , dpi , india ) tray was prepared on each stone cast . for each tray ,
4 metal pins were attached , each 2.5 mm in diameter ; two of these pins were 25 mm long and the other two were 15 mm long . in mandibular tray ,
the long pins were placed close to the distal end and the short pins close to the midline and in the maxillary tray , the short pins were placed over the residual ridges and the long pins close to the midline [ figure 2 ] .
sectional special tray the acrylic resin trays were lubricated with petroleum jelly , and an acrylic resin block that slid tightly on the pins was prepared .
the trays were cut into two pieces with a steel disc and then joined with the acrylic resin block , which slid onto the parallel pins .
the mandibular impression tray could be inserted into the patient 's mouth in one piece because the acrylic resin block was elevated on the long pins and the tray could be folded in the horizontal plane .
border moulding was alternately done for the first and second halves of the sectional trays .
impression trays were inserted into the patient 's mouth in two separate pieces : left and right and stabilized by means of the acrylic resin block .
final impressions were made by using zinc - oxide eugenol impression paste ( dpi impression paste , dpi , india ) in sectional trays , which were stabilized intraorally with acrylic resin block .
after the impression paste set , the acrylic resin blocks were detached in the mouth , and the right and left pieces were removed separately by fracturing the impression material .
the acrylic resin blocks were carefully joined out of the mouth and after it was determined that the fracture line joined smoothly , dental stone was poured [ figure 3 ] .
final impression in sectional tray the maxillary and mandibular denture bases were prepared in two pieces : right and left .
these pieces were joined by overlapping one on the other by 2 mm in the midline .
a stainless steel hinge was fitted with autopolymerizing acrylic resin in the centre of the axis connecting the denture bases [ figure 4 ] .
temporary denture base with hinge jaw relation record was obtained with the use of occlusion rims oriented to the established vertical dimension of occlusion , the anatomic occlusal plane , and the patient 's centric relation .
the try - in sectional denture was evaluated to verify jaw relations and tooth arrangement .
heat cure acrylization was carried out alternately for right and left halves of the denture bases and to prevent flow of resin into the connecting area , silicone impression material was placed into the gap in the hinge design .
foldable complete denture home care instruction ( oral hygiene instruction , insertion and removal of prosthesis ) were imparted to the patient and routine follow - up appointments were scheduled .
many authors have advised sectional custom trays and collapsible denture systems with complicated attachment devices , e.g. locking levers ( various pins , bolts , and lego pieces ) , hinges , orthodontic expansion screws , magnet systems , etc . for the patient described here , 4 parallel pins and an acrylic resin block fitted on these pins
the use of different size pins in the mandibular impression tray made it possible for the tray to be folded in the horizontal plane and inserted in one piece , facilitating impression procedure .
it was believed that the cross section of the mandibular impression paste was not wide enough in the midline and that this would negatively affect the stability of the right and the left tray pieces .
thus the pins on the mandibular tray were arranged in 2 different planes and the resin block fitted on these pins ensured the proper approximation of two halves of the tray .
when the oral opening is limited , joining the pieces of a sectional denture base intraorally may be problematic .
for this reason , we preferred to fabricate the collapsible ( foldable ) design of maxillary and mandibular complete denture .
severe reduction of oral opening renders access to the oral cavity difficult for dental procedures .
this report describes the impression procedure for a patient with restricted mouth opening using a sectional impression tray and fabrication of sectional maxillary and mandibular denture .
figure 6 presents a patient who has been wearing such appliances successfully for the past 2 years . | microstomia may result from surgical treatment of orofacial neoplasms , cleft lips , maxillofacial trauma , burns , radiotherapy or scleroderma .
a maximal oral opening that is smaller than the size of a complete denture can make prosthetic treatment challenging .
this clinical report presents the prosthodontic management of a total edentulous patient with microstomia .
sectional mandibular and maxillary trays and foldable mandibular and maxillary denture were fabricated for the total edentulous patient . | Introduction
Case Report
Procedure
Discussion
Summary and Conclusion |
from october 1996 to november 2002 , 30 consecutive patients with hepatocellular carcinomas underwent transarterial chemoembolization followed by hepatic resection at our institution .
of these patients , we included the patients who met the two following criteria : ( a ) two or more four - phase ( i.e. , hepatic arterial , portal venous , and delayed phase , and unenhanced image ) helical cts were taken after the first transarterial chemoembolization , and ( b ) hepatic resection was done within one month of the last follow - up ct .
eighteen patients had one tumor , four patients had two tumors , one patient had three tumors and one patient had six tumors .
they underwent lobectomy ( n = 22 ) , segmentectomy ( n = 1 ) or liver transplantation ( n = 1 ) after transarterial chemoembolization . of these , 20 patients could undergo hepatic resection because they had recovered enough hepatic function to endure hepatic surgery , as compared to the time when they had undergone the initial transarterial chemoembolization . there were 21 men and three women , and their ages ranged from 38 to 73 years ( mean age ; 54 years ) .
all the patents in the study had liver cirrhosis as a result of either hepatitis b ( n = 23 ) , or hepatitis c ( n = 1 ) .
twenty - six hepatocellular carcinomas were diagnosed by the pathologic results for those patients that demonstrated viable tumor in the resected specimens .
of the nine totally necrotic tumors , the diagnosis of three hepatocellular carcinomas was established based on the results of percutaneous needle biopsy .
the remaining six hepatocellular carcinomas showed the characteristic laboratory findings ( e.g. , elevated -fetoprotein levels and viral markers ) in combination with the characteristic radiological findings on the follow - up ct images .
the mean diameter of the hepatocellular carcinomas was 3.7 cm ( range ; 0.5 - 12 cm ) .
seventeen patients underwent multiple treatments of transarterial chemoembolization ( range ; 2 - 5 treatments , mean ; 2.9 treatments ) .
the remaining seven patients underwent it once . the mean interval between the transarterial chemoembolization and
the follow - up ct was 20 days ( range ; 3 - 23 days ) , and the mean interval between the last ct and surgery was 14 days ( range ; 1 - 30 days ) .
the ct scans were performed with a helical scanner ( hispeed advantage ; ge medical systems , milwaukee , wi , usa ) .
the scanning parameters were 120 kvp , 180 mas , 7 mm section collimation and a 7 mm / sec table speed during a single breath - hold helical acquisition of 25 - 30 seconds , depending upon the liver size .
the images were obtained in a craniocaudal direction and they were reconstructed every 7 mm to provide contiguous or overlapping sections for the unenhanced and enhanced images . after the acquisition of the unenhanced images , the hepatic arterial phase , the portal venous phase and the delayed phase images were obtained with delays of 30 , 60 and 180 seconds , respectively , after the start of injecting 120 ml of nonionic iodinated contrast material ( iopamiro 300 , bracco , milano , italy and ultravist 300 , schering , berlin , germany ) through the antecubital vein at a rate of 3 ml / sec .
transarterial chemoembolization was performed with a mixture of iodized oil ( lipiodol ; guerbet , aulnay - sous - bois , france ) and doxorubicin hydrochloride ( adriamycin ; kyowa hakko kogyo , tokyo , japan ) in all the patients .
we used 3 mg of doxorubicin hydrochloride and 1 cc of iodized oil per 1-cm diameter of the tumor . for particle embolization
, we also used gelfoam powder ( upjohn , kalamazoo , mi , usa ) if a patient had neither child class c cirrhosis nor thrombosis in the major portal vein .
the pathologic specimens were sectioned at 5-mm intervals and the tumor necrosis was estimated as a percentage .
the pathologic findings that were used as the standards of reference revealed that nine of the 35 hepatocellular carcinomas were totally necrotic .
one observer had 24 years experience at abdominal imaging and other two observers had five years experience each .
the observers were informed of the patients ' histories in as much as they knew that all the patients had undergone transarterial chemoembolization for hepatocellular carcinoma , but the observers were blinded to the pathologic findings concerning the presence of viable tumor in each patient .
first , the observers reviewed the last four - phase ct taken before liver resection .
second , the observers repeated the review two weeks after the first interpretation with using the last ct combined with the previous serial ct images .
the observers were obliged to review the second - to - the - last ct .
further review of the other previous ct examinations was determined by the respective decision of the observers for each case .
all images were evaluated using a 2,000 2,000 picture archiving and communication systems ( pacs ; ge medical systems integrated imaging solutions , mt prospect , il , usa ) monitor .
the images were initially evaluated using two window settings ( window level ; 60 hu , window width ; 350 hu , and window level ; 110 hu , window width ; 200 hu ) , and then the window settings were adjusted as needed .
images were interpreted for the presence , number , size and site of the viable tumors .
each observer also recorded his or her degree of confidence as to whether a lesion seen on an image represented a viable tumor .
the attenuation of each lesion in relation to that of the liver ( i.e. , hypoattenuation , hyperattenuation , isoattenuation or mixed attenuation ) was subjectively assessed .
the diagnostic confidence for each lesion was scored using a five - point scale ( 1 , not viable tumor ; 2 , probably not viable tumor ; 3 , possibly viable tumor ; 4 , probably viable tumor ; 5 , definitely viable tumor ) at each interpretation session . for the objectivity and reproducibility of the image analysis performed in this study ,
we regarded the following lesions as viable areas of tumors on the last ct images : ( a ) a hyperattenuating or isoattenuating lesion seen during the hepatic arterial phase and as a hypoattenuating lesion seen during the portal venous phase or the delayed phase , ( b ) an area of mixed attenuation seen on the hepatic arterial phase images that showed a hypoattenuating portion either on the portal venous phase or the delayed phase , and ( c ) a nodule that was seen as being isoattenuation on the hepatic arterial phase , the portal venous phase or the delayed phase images , but it was seen as hypoattenuation on the unenhanced images ( 4 ) .
a lesion that showed wedge - shaped hyperattenuation during the hepatic arterial phase and that appeared as isoattenuation on the portal venous phase , on the delayed phase images and on the unenhanced images was considered to be a noncancerous lesion .
when the last ct along with the previous serial ct images was reviewed , a lesion that showed a newly presenting defect within an iodized oil - containing nodule was regarded as a viable portion of tumor . a small peritumoral area with suspicious enhancement on the hepatic arterial phase of the last ct , which showed an iodized oil - containing liver parenchyma on the previous serial ct images , was considered as an arterioportal shunt and not as a viable tumor .
also , a long - standing hypoattenuating area ( longer than one year ) that did not change after contrast enhancement within a nodule of hepatocellular carcinoma was not considered viable tumor . a radiologist ( the study coordinator ) and
they evaluated the location ( upper or lower , right or left , and anterior or posterior ) and the size of the viable portions within the tumors on both the ct and the pathologic examinations . a binominal receiver operating characteristic ( roc ) curve
was calculated for each observer 's confidence rating data with using maximum - likelihood estimation .
we evaluated the diagnostic accuracy of the last ct alone and the last ct combined with the previous serial ct images by calculating the area under each observer - specific binomial roc curve ( denoted as the az index ) ( 5 ) .
the lesions that were assigned a score of three to five were considered as diagnosed viable tumors .
the sensitivity and specificity were calculated for each observer and for each different review of the cts , and the statistical analysis of their differences was assessed using the mcnemar test ( spss , version 10.0 ; spss , chicago , il , usa ) .
the false negative rates for the detection of viable tumors were also calculated for the review of the last ct alone and for the review of the last ct along with the previous serial ct images .
statistics were used to assess the interobserver agreement for the presence of a viable portion of tumor with the review of the last ct alone and with the review of the last ct combined with the previous serial ct images .
the degree of agreement was categorized as follows : values of 0.00 - 0.20 were considered to indicate poor agreement , values of 0.21 - 0.40 were considered to indicate fair agreement , values of 0.41 - 0.60 were considered to indicate moderate agreement , values of 0.61 - 0.80 were considered to indicate good agreement and values of 0.81 - 1.00 were considered to indicate excellent agreement ( 5 ) .
from october 1996 to november 2002 , 30 consecutive patients with hepatocellular carcinomas underwent transarterial chemoembolization followed by hepatic resection at our institution .
of these patients , we included the patients who met the two following criteria : ( a ) two or more four - phase ( i.e. , hepatic arterial , portal venous , and delayed phase , and unenhanced image ) helical cts were taken after the first transarterial chemoembolization , and ( b ) hepatic resection was done within one month of the last follow - up ct .
eighteen patients had one tumor , four patients had two tumors , one patient had three tumors and one patient had six tumors .
they underwent lobectomy ( n = 22 ) , segmentectomy ( n = 1 ) or liver transplantation ( n = 1 ) after transarterial chemoembolization . of these , 20 patients could undergo hepatic resection because they had recovered enough hepatic function to endure hepatic surgery , as compared to the time when they had undergone the initial transarterial chemoembolization . there were 21 men and three women , and their ages ranged from 38 to 73 years ( mean age ; 54 years ) .
all the patents in the study had liver cirrhosis as a result of either hepatitis b ( n = 23 ) , or hepatitis c ( n = 1 ) .
twenty - six hepatocellular carcinomas were diagnosed by the pathologic results for those patients that demonstrated viable tumor in the resected specimens .
of the nine totally necrotic tumors , the diagnosis of three hepatocellular carcinomas was established based on the results of percutaneous needle biopsy .
the remaining six hepatocellular carcinomas showed the characteristic laboratory findings ( e.g. , elevated -fetoprotein levels and viral markers ) in combination with the characteristic radiological findings on the follow - up ct images .
the mean diameter of the hepatocellular carcinomas was 3.7 cm ( range ; 0.5 - 12 cm ) .
seventeen patients underwent multiple treatments of transarterial chemoembolization ( range ; 2 - 5 treatments , mean ; 2.9 treatments ) .
the remaining seven patients underwent it once . the mean interval between the transarterial chemoembolization and
the follow - up ct was 20 days ( range ; 3 - 23 days ) , and the mean interval between the last ct and surgery was 14 days ( range ; 1 - 30 days ) .
the ct scans were performed with a helical scanner ( hispeed advantage ; ge medical systems , milwaukee , wi , usa ) .
the scanning parameters were 120 kvp , 180 mas , 7 mm section collimation and a 7 mm / sec table speed during a single breath - hold helical acquisition of 25 - 30 seconds , depending upon the liver size .
the images were obtained in a craniocaudal direction and they were reconstructed every 7 mm to provide contiguous or overlapping sections for the unenhanced and enhanced images . after the acquisition of the unenhanced images , the hepatic arterial phase , the portal venous phase and the delayed phase images were obtained with delays of 30 , 60 and 180 seconds , respectively , after the start of injecting 120 ml of nonionic iodinated contrast material ( iopamiro 300 , bracco , milano , italy and ultravist 300 , schering , berlin , germany ) through the antecubital vein at a rate of 3 ml / sec .
transarterial chemoembolization was performed with a mixture of iodized oil ( lipiodol ; guerbet , aulnay - sous - bois , france ) and doxorubicin hydrochloride ( adriamycin ; kyowa hakko kogyo , tokyo , japan ) in all the patients .
we used 3 mg of doxorubicin hydrochloride and 1 cc of iodized oil per 1-cm diameter of the tumor . for particle embolization
, we also used gelfoam powder ( upjohn , kalamazoo , mi , usa ) if a patient had neither child class c cirrhosis nor thrombosis in the major portal vein .
the pathologic specimens were sectioned at 5-mm intervals and the tumor necrosis was estimated as a percentage .
the pathologic findings that were used as the standards of reference revealed that nine of the 35 hepatocellular carcinomas were totally necrotic .
one observer had 24 years experience at abdominal imaging and other two observers had five years experience each .
the observers were informed of the patients ' histories in as much as they knew that all the patients had undergone transarterial chemoembolization for hepatocellular carcinoma , but the observers were blinded to the pathologic findings concerning the presence of viable tumor in each patient .
first , the observers reviewed the last four - phase ct taken before liver resection .
second , the observers repeated the review two weeks after the first interpretation with using the last ct combined with the previous serial ct images .
the observers were obliged to review the second - to - the - last ct .
further review of the other previous ct examinations was determined by the respective decision of the observers for each case .
all images were evaluated using a 2,000 2,000 picture archiving and communication systems ( pacs ; ge medical systems integrated imaging solutions , mt prospect , il , usa ) monitor .
the images were initially evaluated using two window settings ( window level ; 60 hu , window width ; 350 hu , and window level ; 110 hu , window width ; 200 hu ) , and then the window settings were adjusted as needed .
images were interpreted for the presence , number , size and site of the viable tumors .
each observer also recorded his or her degree of confidence as to whether a lesion seen on an image represented a viable tumor .
the attenuation of each lesion in relation to that of the liver ( i.e. , hypoattenuation , hyperattenuation , isoattenuation or mixed attenuation ) was subjectively assessed .
the diagnostic confidence for each lesion was scored using a five - point scale ( 1 , not viable tumor ; 2 , probably not viable tumor ; 3 , possibly viable tumor ; 4 , probably viable tumor ; 5 , definitely viable tumor ) at each interpretation session . for the objectivity and reproducibility of the image analysis performed in this study , the important criteria for a viable tumor and for the noncancerous lesions
we regarded the following lesions as viable areas of tumors on the last ct images : ( a ) a hyperattenuating or isoattenuating lesion seen during the hepatic arterial phase and as a hypoattenuating lesion seen during the portal venous phase or the delayed phase , ( b ) an area of mixed attenuation seen on the hepatic arterial phase images that showed a hypoattenuating portion either on the portal venous phase or the delayed phase , and ( c ) a nodule that was seen as being isoattenuation on the hepatic arterial phase , the portal venous phase or the delayed phase images , but it was seen as hypoattenuation on the unenhanced images ( 4 ) .
a lesion that showed wedge - shaped hyperattenuation during the hepatic arterial phase and that appeared as isoattenuation on the portal venous phase , on the delayed phase images and on the unenhanced images was considered to be a noncancerous lesion .
when the last ct along with the previous serial ct images was reviewed , a lesion that showed a newly presenting defect within an iodized oil - containing nodule was regarded as a viable portion of tumor . a small peritumoral area with suspicious enhancement on the hepatic arterial phase of the last ct , which showed an iodized oil - containing liver parenchyma on the previous serial ct images , was considered as an arterioportal shunt and not as a viable tumor .
also , a long - standing hypoattenuating area ( longer than one year ) that did not change after contrast enhancement within a nodule of hepatocellular carcinoma was not considered viable tumor . a radiologist ( the study coordinator ) and
they evaluated the location ( upper or lower , right or left , and anterior or posterior ) and the size of the viable portions within the tumors on both the ct and the pathologic examinations .
a binominal receiver operating characteristic ( roc ) curve was calculated for each observer 's confidence rating data with using maximum - likelihood estimation .
we evaluated the diagnostic accuracy of the last ct alone and the last ct combined with the previous serial ct images by calculating the area under each observer - specific binomial roc curve ( denoted as the az index ) ( 5 ) .
the lesions that were assigned a score of three to five were considered as diagnosed viable tumors .
the sensitivity and specificity were calculated for each observer and for each different review of the cts , and the statistical analysis of their differences was assessed using the mcnemar test ( spss , version 10.0 ; spss , chicago , il , usa ) .
the false negative rates for the detection of viable tumors were also calculated for the review of the last ct alone and for the review of the last ct along with the previous serial ct images .
statistics were used to assess the interobserver agreement for the presence of a viable portion of tumor with the review of the last ct alone and with the review of the last ct combined with the previous serial ct images .
the degree of agreement was categorized as follows : values of 0.00 - 0.20 were considered to indicate poor agreement , values of 0.21 - 0.40 were considered to indicate fair agreement , values of 0.41 - 0.60 were considered to indicate moderate agreement , values of 0.61 - 0.80 were considered to indicate good agreement and values of 0.81 - 1.00 were considered to indicate excellent agreement ( 5 ) .
during the two analyses of the ct images , each observer detected all 35 hepatocellular carcinomas that were pathologically demonstrated in the resection specimens .
the mean diagnostic accuracies ( az values ) for the depiction of viable tumor with the last ct alone and with the review of previous serial ct images for all the observers were 0.885 and 0.901 , respectively ( p > 0.05 ) ( table 1 ) .
the sensitivity , specificity and diagnostic accuracy of the last ct alone were 72% , 91% and 78% , respectively , and the corresponding values for the review of the last ct combined with the previous serial ct images were 78% , 97% and 84% , respectively ( table 2 ) , and the differences were not statistically significant .
although these differences in the diagnostic accuracies were not statistically significant , the review of the previous images enabled the observers to render a correct diagnosis for three ( 9% ) tumors .
two of these three tumors showed as being slightly hyperattenuating focal areas adjacent to the iodized oil - containing tumors on the hepatic arterial phase images of the last ct , and these two tumors appeared as isoattenuating areas on the unenhanced images .
the second to the last ct showed that these areas appeared as parenchymal uptake around the iodized oil - containing tumors ( fig .
1 ) , and the two observers changed their confidence levels to probably not viable tumor .
the one remaining tumor showed as an interval developed defect within the iodized oil - containing nodule that was not significantly enhanced on the last ct . on the basis of this feature , the two observers changed their confidence level to probably viable tumor .
the pathology revealed a 70% necrotic hepatocellular carcinoma . after reviewing of the last ct and the previous serial ct images , all three observers assessed the 10 compact iodized oil - containing tumors as being non - viable . of these
thus , the compact iodized oil - containing tumors showed a mean necrosis rate of 98.5% .
all of the 16 false - negative lesions that were diagnosed by each observer after reviewing the last ct combined with the previous serial ct images showed 90% or greater necrosis on the pathologic examination ( table 3 ) . particularly , four tumors of these lesions were diagnosed as negative lesions simultaneously by all the observers with both the review of the last ct alone and the review of the last ct with the previous serial ct images .
2 ) . the remaining two showed no definite enhancement in the iodized oil defect portion on the hepatic arterial phase ct . the interobserver agreement ( statistic ) for
the presence of a viable tumor was 0.828 to 0.943 for the review of the last ct alone and 0.826 to 0.885 for the additional review of the previous serial ct images ( table 4 ) .
the interobserver agreement for the review of the last ct with or without the previous serial ct images was considered excellent .
the criteria suggested by the world health organization and that is used for evaluating the effect of chemotherapy on cancer can not be applied to the evaluation of transarterial chemoembolization therapy because any tumor reduction can seldom be recognized before one month after the treatment ( 6 ) .
thus , other criteria have been evaluated to determine the efficacy of transarterial chemoembolization treatment for hepatocellular carcinoma by using iodized oil retention in a tumor and the enhancement on ct ( 7 , 8) .
( 9 ) suggested that the overall cumulative recurrence rate of hepatocellular carcinoma was 23% after one year , 55% after two years and 67% after three years , and 45% of the recurrences occurred adjacent to a primary site that was considered controlled by the transarterial chemoembolization . hence , periodic ct follow - up or angiography might be recommended even though there may be the appearance of complete remission for hepatocellular carcinoma . with the advent of helical ct and with the other rapid technical advances , multiphasic helical ct
has recently become a more useful imaging modality for the detection and characterization of liver lesions , for the follow - up after local treatment or surgical excision , and for the assessment of the hemodynamic changes in the liver .
however , to the best of our knowledge , there has been no previous study that has compared the preoperative ct and the review of the previous serial ct images with the resected specimens for the evaluation of the viable portion of hepatocellular carcinoma treated with transarterial chemoembolization . in the past
, some investigators have reported on the diagnostic efficacy of the hepatic arterial phase ct and the portal venous phase ct for the detection of hypervascular tumors , and especially hepatocellular carcinoma ( 10 , 11 ) .
( 1 ) have suggested that the delayed phase is important for the detection of small hepatocellular carcinomas that are less than 2 cm , for confirming or increasing the confidence level for the detection of equivocal nodules on the arterial or portal venous phase images ( because those nodules are usually more conspicuous on the delayed phase than on the portal venous phase imaging ) , and for the differentiation of arterioportal shunting from the true hepatocellular carcinoma . in our study , this concept was used to depict a viable tumor among the arterioportal shunt areas . for the hepatocellular carcinoma treated with transarterial chemoembolization , takayasu et al .
( 8) have suggested that the iodized oil deposition in a tumor could be considered as necrosis .
choi et al . ( 7 ) have also proposed that the complete retention of iodized oil in a tumor and the surrounding liver demonstrated the best therapeutic effects .
kim et al . ( 4 ) have recently pointed out that unenhanced images could be of additional diagnostic value to supplement the enhanced biphasic helical ct images for the patients treated with transarterial chemoembolization for hepatocellular carcinoma by facilitating the differentiation of the true lesions from the hyperattenuating pseudolesions that simulate viable tumor .
further , they stated that these unenhanced images can also aid in the detection of any isoattenuation lesion on the hepatic arterial phase and the portal venous phase because of the hypoattenuation on the unenhanced images .
we also evaluated the unenhanced images , and we used the criteria suggested by kim et al .
in addition to the criteria in the previous studies ( 1 , 4 , 7 , 10 , 11 ) , we considered the long - standing hypoattenuating areas within an iodized nodule on the enhanced images of the serial ct images as necrotic lesion despites a lack of iodized oil . on the other hand , a lesion that showed an interval developed defect within an iodized nodule
was considered as a viable portion of tumor . in our study , although no significant statistical difference was found between the review of the last ct alone and the review of the last ct along with the previous serial ct images , the additional review of the previous serial ct images allowed the observers to render a correct diagnosis for three ( 9% ) lesions .
we believe that many abdominal radiologists actually do review some of the previous ct images when they find an equivocal viable lesion on the liver ct following transarterial chemoembolization . according to our results , after the review of the last ct combined with the previous serial ct images , all the false - negative lesions showed 90% or greater necrosis on the pathologic examination .
thus , if a substantial ( larger than 10% ) viable tumor is present in an iodized nodule , we can depict it on ct with a thorough review of the previous serial ct images .
first , as this is a retrospective study , all the patients of the study group did not undergo regular follow - up ct and transarterial chemoembolization because of suspected complications or because of personal preference .
second , we included a relatively small number of hepatocellular carcinomas , and so this might show no significant statistical difference between the review of the last ct alone and the review of the last ct along with the previous serial ct images .
finally , although we thoroughly reviewed the pathologic specimens alongside the ct images , any perfect area - by - area histopathologic correlation was actually impossible . by referring to the location and size of viable tumors within the tumors , however , we tried to match the ct and histopathologic findings as closely as possible . in our results , two of the three tumors that had a correct diagnosis rendered after the review of previous images appeared as parenchymal uptake around the iodized oil - containing tumors on the second to the last ct
the pathology demonstrated totally necrotic tumors , and this revealed that the suspicious hyperattenuating focal areas adjacent to the iodized oil - containing tumors on the hepatic arterial phase images of the last ct were pseudolesion .
for the third hepatocellular carcinoma with 70% necrosis , we could not perfectly match the interval developed defect within the iodized oil - containing nodule and the 30% viable tumor portion on the pathologic specimen .
also , we do not know the reason why the two compact iodized oil - containing tumors seen on ct had viable tumor portions on the pathology examination . in conclusion
, for depicting the viable tumor in hepatocellular carcinoma patients treated with transarterial chemoembolization , although the difference in the diagnostic accuracies was not found to be statistically significant in our study , a review of the multiphasic helical ct combined with the previous serial ct images can help render a correct diagnosis for those lesions incorrectly diagnosed with the review of only the last ct . | objectivethe purpose of our study was to assess whether a review of multiphasic helical ct combined with the previous serial ct images could be helpful to depict a viable tumor in hepatocellular carcinoma treated with transarterial chemoembolization.materials and methodstwenty - four consecutive patients with 35 hepatocellular carcinomas underwent transarterial chemoembolization followed by hepatic resection .
first , three radiologists independently analyzed the last ct images taken before resection for the presence of viable tumor .
a second analysis was then performed using the last ct combined with the previous serial ct images .
the ct analyses were then compared with the pathologic results .
the added value of the review of the previous serial ct images was evaluated by performing a receiver operating characteristic analysis .
the sensitivity , specificity and diagnostic accuracy for the depiction of viable tumor were also assessed , and the characteristics of the false - negative lesions were pathologically evaluated.resultsthe mean diagnostic accuracies ( az values ) for the depiction of viable tumor with using the last ct alone and with the review of the previous serial ct images for all observers were 0.885 and 0.901 , respectively , which were not significantly difference ( p > 0.05 ) . however , the additional review of the previous serial ct images allowed the observers to render a correct diagnosis for three lesions that had been incorrectly diagnosed with the review of last ct alone .
the sensitivity , specificity and diagnostic accuracy of the last ct along with the review of the previous serial ct images were 78% , 97% and 84% , respectively .
all of the 16 false - negative lesions diagnosed by each observer showed 90% or greater necrosis on the pathologic examination.conclusionfor the depiction of viable tumor in hepatocellular carcinoma treated with transarterial chemoembolization , although the difference in the diagnostic accuracies was not statistically significant , a review of the multiphasic helical ct combined with the previous serial ct images could help reach a correct diagnosis for those lesions incorrectly diagnosed with the review of the last ct alone . | MATERIALS AND METHODS
Patient Selection
Multiphasic Helical CT
Transarterial Chemoembolization Techniques
Pathologic Analysis
Image Analysis
Statistical Analysis
RESULTS
DISCUSSION |
substantial progress has been made using genetic markers to elucidate the evolutionary histories of populations , yet this work has primarily been accomplished using large numbers of individuals and small numbers of genetic markers .
more recently , studies screening large numbers of markers have demonstrated their effectiveness at clarifying more subtle patterns of population stratification .
such studies can facilitate the exploration of the genetic structure that may exist among and within populations and also provide a valuable source of ancestry informative markers ( aims ) to quantify and adjust for this structure in gene - identification studies .
here , we analysed 11,555 single nucleotide polymorphism ( snp ) markers in 12 population samples using a new microarray - genotyping platform called whole genome sampling amplification ( wgsa ; affymetrix , santa clara , ca ) .
populations were selected to represent a broad spectrum of world variation ( table 1 ) .
four populations stand out as having similarly elevated heterozygosity ( burunge , spanish , indian and altaian ) .
four groups ( nahua , quechua , nasioi and mbuti ) have lower levels of variability , while the two east asian populations and the mende are intermediate . these results are largely consistent with expectations for populations known to have experienced restrictions in population size ( eg mbuti , nasioi , nahua and quechua ) , reducing levels of genetic variability relative to other populations ; however , ascertainment bias in terms of the population ( s ) in which markers were first discovered precludes making strong statements about differences in variability using snp data .
in addition , ascertainment bias -- such as that resulting from both a limited representation of populations and small numbers of individuals in discovey panels-- can lead to deviations in linkage disequilibrium estimates , artefactually elevated fst levels ( see ronald and akey in this issue of human genomics ) and higher derived allele frequencies in non - african than in african populations . despite the general importance of considering ascertainment bias on a number of population genetic parameter estimates , there is no evidence or theory that predicts problems from ascertainment bias on estimates of measures of individual relatedness or deviations from hardy - weinberg equilibrium ( hwe ) .
randomly mating populations are expected to show genotype frequencies that are consistent with hwe expectations .
the results of tests for hwe are presented as the proportion of loci that have deviations from equilibrium expectations ( table 1 ) .
the most notable deviation is seen when all the populations are combined , at which point over half ( 56 per cent ) of the snps show significant hwe deviations .
these deviations highlight the importance of taking population structure into account in gene - association studies .
extensive admixture structure is created by combining these samples , leading to hwe deviations and , presumably , allelic associations among unlinked markers at loci showing large frequency differences across populations . populations and summary statistics for autosomal single nucleotide polymorphism ( snp ) loci average unbiased heterozygosity .
proportion of deviations from hardy - weinberg equilibrium ( hwe ) using = 0.05 with standard test .
the proportion of the total genetic variation due to differences among populations was estimated using fst .
figure 1 shows a histogram of the fst distribution , with the autosomal snps plotted separately from the x - linked snps .
the average level of fst for autosomal snps ( 0.148 ) is within the range of previously published fst estimates ( 5 - 15 per cent ) , confirming the well - known fact that most variability in human populations is observed within populations [ 4 - 6,14,15 ] .
the average fst observed for the x - chromosomal snps ( 0.224 ) is substantially higher than that for the autosomal snps ( p < 0:0001 ) , which is consistent with both the smaller effective population size and the higher levels of natural selection for x - chromosome genes [ 16 - 18 ] .
it is also notable that these distributions are not described well by averages , since they are highly skewed and have long tails , highlighting the fact that unlinked loci can have different evolutionary histories .
distribution of locus - specific fst for autosomal ( n = 11,078 , grey bars ) and x - linked ( n = 313 , black bars ) single nucleotide polymorphism loci . for calculating heterozygosity and fst ,
population divisions were assumed to be known and individuals were grouped using ethnic and geographical information . given the large number of markers in our dataset , population genetic analyses can be performed at the level of the individual , making no presumption of group membership .
two methods were used to investigate clustering among individuals : neighbour - joining trees and principal coordinates ( pcs ) analysis , using the allele - sharing distance ( asd ) for all pairwise combinations of individuals .
figure 2 shows a neighbour - joining tree of individuals , constructed with the asd measure matrix , using 11,078 autosomal snps .
the root of the tree , based on the combined ape out - group , is located between the mende and mbuti .
most populations have population - specific branches of substantial length , the largest being the melanesians and the indigenous americans .
in addition to the burunge , the south asian indians and the altaians have relatively short population - specific branches , consistent with gene flow between these groups and other populations . the largest internal branch separates the three african from the non - african populations , and the next group to diverge is the spanish , followed by the south asian indians .
no clear separation of the upper and lower caste populations is seen here ( but see figure 3 ) .
neighbour - joining tree of the 203 individuals included in this study , using an allele - sharing distance matrix .
the genotype of the ancestral state ( root ) is taken from those markers showing one common homozygous genotype for two chimpanzees and two gorillas .
individual population affiliations are indicated by the following abbreviations : mbti ( mbuti ) , brng ( burunge ) , sp ( spanish ) , indl ( indian lower caste ) , indu ( indian upper caste ) , bgvl ( nasioi ) , qech ( quechua ) , nah ( nahua ) , alt ( altaian ) , ch ( chinese ) , jp ( japanese ) .
principal components ( pcs ) plot of the 203 individuals based on the allele - sharing distance matrix .
individuals are the basis of analysis and have been labelled with symbols as indicated in the figure legend .
the first three of four significant pcs ( using the broken - stick method ) axis are shown on this plot .
( b ) enlarging the segment of the plot with the european and asian populations . although trees provide a useful means of illustrating relationships among populations or individuals , they are limited by the assumption of bifurcating topologies .
figure 3a shows the first three pc axes for all populations . as with the tree , individuals from one population cluster tightly , to the exclusion of individuals from other populations .
the first pc axis shows a separation of the african and non - african populations , with the burunge being closer to the non - africans than either of the other two african populations .
the second pc axis shows the indigenous americans and melanesians to be on opposite sides of the axis . on the tree
, the two indigenous american populations are separated into monophyletic clusters , while the pc analysis shows overlapping clusters .
when focusing on the eurasian populations ( figure 3b ) , there is a clinal relationship across all three pc axes for these populations , which is consistent with their geographic positions from spanish in the lower left to japanese in the upper right .
notable are the near separation of the indian sample into lower and upper caste , with the upper caste individuals positioned closer to the spanish .
additionally , the altaians are intermediate between the east asians and the europeans , a finding that is consistent with y - chromosomal studies showing central asian origins for components of the european gene pool .
another way of exploring the pc analysis results is to examine the pairwise plots of the pc components .
as the first four components were significant using the broken stick test , not all can be plotted in three - dimensional space .
symbols used to indicate populations are consistent across figures ( a ) to ( f ) ( see individual keys ) and the components presented are indicated on the x and y axes : ( a ) 1st and 2nd , ( b ) 1st and 3rd , ( c ) 1st and 4th , ( d ) 2nd and 3rd , ( e ) 2nd and 4th and ( f ) 3rd and 4th .
in addition to these 12 geographically well - defined population samples , we have analysed three cosmopolitan samples collected in the usa ( african - americans , european - americans and puerto ricans ) .
these populations are known to have been subject to both within - continent and among - continent admixture in the recent past .
these maximum likelihood estimates of proportional ancestry ( figure 5 ) show a greater tendency for the european - american subjects to cluster together , by comparison with the other two population samples .
the african - americans and puerto ricans both show relatively high levels of variability in individual ancestry levels , with most of the non - african ancestry in the african - americans being from europe .
the puerto ricans show some individuals with more indigenous american ancestry , as well as substantial west african ancestry .
puerto ricans ( n = 20 ) are shown as filled circles , african - americans ( n = 42 ) as grey triangles and european - americans ( n = 41 ) as open circles .
parental populations in this analysis are the average of the nahua and quechua as the indigenous american ; mende as the west african ; and spanish as the european .
another test for the presence of admixture structure is based on correlations in individual ancestry indices calculated from independent ( unlinked ) panels of markers .
we tested for significant correlations using two types of individual indices , pcs ( table 2 ) and biogeographical ancestry ( table 3 ) , calculated separately from the even and odd chromosomal snps .
to do this , we divided the snps into two groups ; all of the snps on even chromosomes in one group and all of the snps on odd chromosomes in the other group . unless there is structure which is related to the axes of ancestry measured by these indices within a population , no significant relationship between the two estimates is expected .
the correlation results on the pc components show that only three ( upper caste indian , altaian and nasioi ) of the 12 world populations show evidence of population structure .
the combined indian sample ( upper caste and lower caste together ) also shows significant correlations , while the combined east asian ( japanese and chinese ) population does not .
alternatively , all three cosmopolitan samples tested ( african - american , european - american and puerto rican ) show significant correlations between the even and odd chromosome pc analyses .
significant correlations are also seen for the estimates of biogeographical ancestry in these three populations ( table 3 ) .
it is notable that , not only are there high correlations in the african - american and puerto rican samples , but also in the european - american sample , indicating the presence of admixture structure in a population generally assumed to be homogeneous .
correlation coefficients for comparisons between principal components ( pc ) estimates from the even and odd chromosome marker sets shown is spearman 's correlation coefficient and p value in parentheses .
correlation coefficients for comparisons between biogeographical ancestry estimates from the even and odd chromosome marker sets shown is spearman 's correlation coefficient and p value in parentheses .
the large number of markers used in these analyses has provided an opportunity to assess genetic variation at the level of the individual in a number of populations from around the world .
these multilocus genotype data on a large panel of snps provide a new level of resolution in the distribution of variation within and among populations .
individuals cluster into groups comprising other individuals from their own or closely - related populations when diverse groups from around the world are analysed . by contrast , when samples from the more cosmopolitan us resident populations are analysed , clustering patterns are less discrete .
substantial levels of variation in ancestry are observed within the african - american and puerto rican samples , while smaller , but significant , admixture structure is evident in the european - american sample . whether the admixture structure in the european - american sample is the result of intraor intercontinental gene flow is an important outstanding question .
thus , although discrete clustering of individuals may be useful in describing some of the variation in diverse , well - defined population samples , continuous measures -- such as biogeographical ancestry or pc indices -- are required to describe the same axes of population structure in populations that have experienced recent admixture .
wgsa technology was used to genotype individuals in this study using the genemapping 10 k array xba 131 ( affymetrix inc .
, santa clara , ca ) . details of this method have been published elsewhere ; in brief , fractions of the genome are obtained by restriction enzyme ( xba i ) digestion of genomic dna , ligated with adaptors and subsequently amplified with a universal primer that is directed to the linker . the amplified target ( a smear of polymerase chain reaction products of 400 to 800 base pairs [ bps ] in length ) is fragmented , labelled with terminal transferase and biotin - ddatp and hybridised overnight to synthetic microarrays .
genotypes are called by interpreting signals from allele - specific probes using a model - based algorithm .
snps were chosen from the snp consortium ( tsc ) database on the basis of their predicted location on 400 -800 bp fragments generated by in silico digestion of human genome sequences with various restriction enzymes .
predicted snps were then assayed against a panel of 108 individuals from diverse populations . if two individuals were observed with each of the three genotypes , and the clustering patterns were acceptable , the snp was considered to be confirmed and retained as part of the panel .
the population samples used in this study were collected under internal review board approvals from the various institutions involved .
the mbuti population samples were collected in the ituri forest , the mende samples from sierra leone .
the cushitic - speaking burunge samples were collected in tanzania but are thought to be of ethiopian descent .
the upper and lower caste groups were both sampled from vishakapatnam , andhra pradesh , india .
the chinese ( na17011-na17020 ) and japanese ( na17051-na17060 ) samples are from us residents , curated at the coriell institute .
quechua were sampled in lima ( n = 9 ) or cerro de pasco , peru , at 4,338 meters ( n = 11 ) . in the former case , the subjects were highland natives , as both parents and grandparents were born on the altiplano .
quechua subjects were selected to represent a subgroup of subjects with the lowest possible european admixture from a larger total sample of n = 71 .
similarly , the nahua , who were sampled in the city of tlapa , guerrero , mexico , were also selected as a subset of individuals showing low european ancestry , as measured with an independent set of markers .
african - americans ( subset of 42 from na17100 - 17199 ) and european - americans ( subset of 42 from na17200-na17285 ) are represented by samples curated at the coriell institute . for these analyses ,
na17205 ) was excluded from the european - american sample , as he / she clusters with south asians , which , in combination with the lack of monophyletic clustering of south asians and spanish in this study , highlights the inappropriateness of the category ' caucasian ' in biomedical research .
the puerto ricans are women born in puerto rico and living in new york city at the time of data collection .
wgsa technology was used to genotype individuals in this study using the genemapping 10 k array xba 131 ( affymetrix inc .
, santa clara , ca ) . details of this method have been published elsewhere ; in brief , fractions of the genome are obtained by restriction enzyme ( xba i ) digestion of genomic dna , ligated with adaptors and subsequently amplified with a universal primer that is directed to the linker . the amplified target ( a smear of polymerase chain reaction products of 400 to 800 base pairs [ bps ] in length ) is fragmented , labelled with terminal transferase and biotin - ddatp and hybridised overnight to synthetic microarrays .
genotypes are called by interpreting signals from allele - specific probes using a model - based algorithm .
snps were chosen from the snp consortium ( tsc ) database on the basis of their predicted location on 400 -800 bp fragments generated by in silico digestion of human genome sequences with various restriction enzymes .
predicted snps were then assayed against a panel of 108 individuals from diverse populations . if two individuals were observed with each of the three genotypes , and the clustering patterns were acceptable , the snp was considered to be confirmed and retained as part of the panel .
the population samples used in this study were collected under internal review board approvals from the various institutions involved .
the mbuti population samples were collected in the ituri forest , the mende samples from sierra leone .
the cushitic - speaking burunge samples were collected in tanzania but are thought to be of ethiopian descent .
the upper and lower caste groups were both sampled from vishakapatnam , andhra pradesh , india .
the chinese ( na17011-na17020 ) and japanese ( na17051-na17060 ) samples are from us residents , curated at the coriell institute .
quechua were sampled in lima ( n = 9 ) or cerro de pasco , peru , at 4,338 meters ( n = 11 ) . in the former case , the subjects were highland natives , as both parents and grandparents were born on the altiplano .
quechua subjects were selected to represent a subgroup of subjects with the lowest possible european admixture from a larger total sample of n = 71 .
similarly , the nahua , who were sampled in the city of tlapa , guerrero , mexico , were also selected as a subset of individuals showing low european ancestry , as measured with an independent set of markers .
african - americans ( subset of 42 from na17100 - 17199 ) and european - americans ( subset of 42 from na17200-na17285 ) are represented by samples curated at the coriell institute . for these analyses ,
na17205 ) was excluded from the european - american sample , as he / she clusters with south asians , which , in combination with the lack of monophyletic clustering of south asians and spanish in this study , highlights the inappropriateness of the category ' caucasian ' in biomedical research .
the puerto ricans are women born in puerto rico and living in new york city at the time of data collection .
the tree of individuals , based on the asd distance , was constructed using the neighbour - joining method , using the molecular evolutionary genetics analysis software package ( mega version 2.1 ) .
the pc analysis was carried out using ntsys software ( rohlf , f. j. , ntsys - pc version 1.70 ) .
the statistical significance of pc axes was determined using the broken stick model , resulting in four significant axes .
these axes together explain 23.6 per cent of the total variation ( 12.6 per cent by the first axis , 5.5 per cent by the second , 3.5 per cent by the third and 1.9 per cent by the fourth ) . all pairwise pc axis plots for these four axes are presented in the online supplementary information .
the structure 2.0 computer program was used to infer the presence of genetic structure in the sample .
the analysis was performed both with and without the admixture model for k = 2 to k = 6 , the model previously having been determined to show the highest posterior probabilities for these data .
a total of 25,000 simulation iterations were run for the burn - in period ; 75,000 additional iterations were run to get parameter estimates .
biogeographical ancestry estimates were calculated for the 42 african - american subjects , the 41 european - american subjects and the 20 puerto rican women , using the maximum likelihood algorithm previously described , whereby the allele frequencies for the three parental populations were taken to be indigenous american ( nahua and quechua averaged together ) , west african ( mende ) and european ( spanish ) . for testing the correlation between subsets of markers , autosomal snps were divided by chromosome into those on odd and even chromosomes , respectively .
spearman 's correlation coefficient was then calculated for four significant pcs and the three ancestral components between using the odd and even estimates of these statistics . as has been demonstrated , estimates -- even for highly admixed populations -- will be uncorrelated unless there is substantial non - random mating in the population that is related to ancestry .
we would like to thank kateryna makova , ken weiss , anne buchanan and s. malia fullerton for helpful comments and discussions on this paper .
we would also like to acknowledge the trust and generosity of the people and populations who contributed the dna samples on which this study is based .
additionally , for the collection of the spanish population sample , we acknowledge jose americo montoro from the blood transfusion centre in valencia ( servei valencia de salut ) .
this work was supported in part by grants : nih / nhgri ( hg02154 ) to mds ; njh / nia ( p30ag / nr15294 - 01 ) to jrf ; nsf ( sbr-9514733 and sbr-9818215 ) to lbj ; | understanding the distribution of human genetic variation is an important foundation for research into the genetics of common diseases .
some of the alleles that modify common disease risk are themselves likely to be common and , thus , amenable to identification using gene - association methods .
a problem with this approach is that the large sample sizes required for sufficient statistical power to detect alleles with moderate effect make gene - association studies susceptible to false - positive findings as the result of population stratification [ 1,2 ] .
such type i errors can be eliminated by using either family - based association tests or methods that sufficiently adjust for population stratification [ 3 - 5 ] .
these methods require the availability of genetic markers that can detect and , thus , control for sources of genetic stratification among populations . in an effort to investigate population stratification and identify appropriate marker panels , we have analysed 11,555 single nucleotide polymorphisms in 203 individuals from 12 diverse human populations .
individuals in each population cluster to the exclusion of individuals from other populations using two clustering methods .
higher - order branching and clustering of the populations are consistent with the geographic origins of populations and with previously published genetic analyses .
these data provide a valuable resource for the definition of marker panels to detect and control for population stratification in population - based gene identification studies . using three us resident populations ( european - american , african - american and puerto rican ) ,
we demonstrate how such studies can proceed , quantifying proportional ancestry levels and detecting significant admixture structure in each of these populations . | Introduction
Results
Discussion
Methods
SNP genotyping
Samples
Statistical analyses
Acknowledgements |
a recent estimate suggests that approximately one billion adults have hypertension ( 333 million in the developed and 639 million in developing countries ) with the highest prevalence in eastern europe and the latin america and the caribbean.1 national surveys also indicate that both the average level of blood pressure and prevalence of hypertension in children and adolescents increased between 1988 - 2000.2 the disease , and its complications , is causing considerable morbidity and mortality . furthermore , there are numerous management problems regarding early diagnosis , clinical assessment , and proper management . in sub - saharan africa , hypertension is a common problem , especially in urban areas.36 very few studies have been done in sudan on this common problem .
the people of sudan are composed of a mix of african and arabic ethnic groups .
the africans have their own languages , traditions , and belong to various religions , such as islam , christianity and others .
on the other hand , those of arabic ethnic background are arabic speaking , and muslim .
this differentiation may be a source of variation of the problem of hypertension as well as other chronic diseases .
the ethnic groups in sudan are distributed geographically , but the population of most towns in the country is made up of people from all over the country .
the aim of this study is to describe some clinico - epidemiological aspects of the disease , in relation to ethnicity , in the form of geographical distribution of population using a series of outpatient clinic - based hypertensive patients , in kassala town , in eastern sudan .
the study was carried out in kassala teaching hospital , kassala town , eastern sudan between 2003and 2004 .
the study 's parameters were classified as blood pressure ( bp ) levels , risk factors for hypertension , and complications of hypertension .
the variables related to those parameters were the geographical origin of subjects ( classified as central , eastern , western , northern and southern ) , and as indicated by their tribal label , gender , age ; and level of education ( classified as low which included illiterate persons , as well as those who had no more than the intermediate level of education ; average where subjects had high secondary school education , and high for those who had university degrees or more ) ; family history of hypertension , body mass index ( bmi ) , waste - hip ratio ( w / h ratio ) and presence of diabetes mellitus in the form of a diagnosis label with on - going treatment .
the complications of hypertension were defined as the presence of coronary artery disease confirmed by electrocardiographic findings , left ventricular failure , congestive cardiac failure , stroke ( which are all confirmed clinically , retinopathy ( confirmed by ophthalmoscopic examination and defined as the presence of signs of hypertensive retinopathy,7 and nephropathy as confirmed by abnormal urea and creatinine levels and presence of albuminuria .
each patient was weighed and had his/ her height recorded to the nearest half kilogram and centimeter ; respectively .
the bmi was calculated as the weight in kilograms divided by the square of the height in meters .
the w / h ratio was calculated as the waist circumference divided by the hip circumference .
a w / h ratio of more than one was considered as abnormal while a bmi of more than 25 kg / ht and a w / h ratio was considered as high .
the bp was measured using a standard mercury sphygmomanometer with the patient in a sitting position , using a cuff of suitable size . the systolic blood pressure ( sbp ) and diastolic blood pressure ( dbp )
were determined by first hearing of the korsakoff 's sound and their muffling ; respectively .
blood pressure readings were classified as controlled or not controlled if the systolic and diastolic blood pressure were equal to or more than 140 and 80 mm hg , respectively.8 data were entered and analyzed using an ibm compatible computer incorporating the statistical package for social sciences ( spss version 11 ) .
a p - value of 0.05 or less was considered as indicative of statistical significance .
most patients ( 73.6% ) were aged between 35 and 64 years , and almost three quarters of them had a low level of education .
subjects from the northern and western parts of the sudan constituted about two - thirds of the sample ( table 1 ) . demographic variables
the distribution of risk factors for hypertension revealed a significantly higher proportion of subjects , with a positive family history of hypertension , and origins from the northern region of sudan ( p<0.001 ) . of the remaining risk factors
risk factors of hypertension according to geographical origin distribution less than one - fifth of the sample had controlled blood pressure .
there was significant variation between patients from different geographical areas of the country , the highest proportion of patients with controlled blood pressure were from central sudan ( p<0.000 ) ( table 3 ) .
blood pressure control according to geographical origin distribution as regards complications of hypertension , significantly more subjects from the eastern and western regions had coronary artery disease ( p<0.001 ) .
also , significantly more subjects from the western region had left ventricular failure ( p < 0.02 ) and congestive cardiac failure ( p < 0.0001 ) than subjects from the other regions .
nephropathy was significantly more among subjects from the southern region ( p<0.007 ) ( table 4 ) .
since there are no symptoms in this condition , known as the silent killer , awareness of hypertension comes with an appropriate application of diagnostic criteria and a clear communication of the findings and relevant instructions by a member of the health care delivery team .
the best means of increasing awareness of hypertension is an improvement in detection , and communication during routine clinical encounters .
effective mass screening programmes must be linked effectively to the settings of the health care provider where the diagnosis can be rapidly confirmed or refuted and treatment promptly initiated .
factors that influenced rates of awareness , treatment and control of hypertension include the extent to which individuals came in contact with the health care providers , the presence or absence of co - morbidities , the individual socioeconomic status , the integrity of social support network ; and the extent to which the treatment and control of hypertension is a priority for the community ; and the accessibility and affordability of health care .
hypertension is a major health problem worldwide and the sudan is not an exception . in this study ,
hypertension was found with increasing age , female gender , and family history of hypertension , high body mass index and diabetes , a situation which is akin to findings from other communities.911 moreover , the study revealed a less than 20% rate of controlled patients , which is low .
this may be due to the lack of compliance with follow - up and medications as a result of a variety of well - known factors that are beyond the scope of this study.1214 urgent preventive measures need to be taken at the community level .
these measures must focus on primary prevention , early tracking information , health education and suitable treatment , as well as management of any causes of non - compliance as was indicated in a previous study in the same area.15 the study has also revealed some characteristics of variations in blood pressure dependent on ethnic origins .
the sudan is a country of multi - ethnic origins comprising more than 500 tribes , forming a mix of afro - arabian population .
variation in the clinical characteristics of hypertension , and in blood pressure control status , have been well documented,1617 and this study highlights that in - depth studies of this should be carried out in the country .
it also revealed a low rate of blood pressure control as well as suggestions of ethnic variations of those characteristics . | objectives : to study the clinico- epidemiological profile of hypertension in a series of hypertensive patients in a town in eastern sudan.methods:a sample of 242 hypertensive patients was studied using a structured questionnaire including the clinico - epidemiological features associated with hypertension.results:two thirds of the sample were females , 73.6% of whom were in the 35 - 64 year age - range ; three - quarters of them had a low level of education .
significant risk factors for hypertension included positive family history of hypertension , and being from the northern sudan .
significantly more patients from the eastern and western regions had coronary heart disease ( p<0.001 ) .
also , significantly more patients from western sudan had left ventricular failure ( p<0.02 ) and congestive heart failure ( p<0.0001 ) , while significantly more patients from southern sudan had nephropathy ( p<0.007).conclusions : the study reveals some clinico - epidemiological characteristics in a series of hypertensive patients in eastern sudan .
it suggests a low rate of blood pressure control as well as ethnic variation of blood pressure control and complications . | INTRODUCTION
METHODOLOGY
RESULTS
DISCUSSION
CONCLUSION |
preclinical studies have shown that cancer is a large group of diseases characterized by the uncontrolled cell growth and spread of abnormal cells . over the past quarter of a century , an outstanding progress in understanding of the proteins involved in cancer progression has grown , providing chances for identifying new targets for anti - cancer therapy [ 2 , 3 ] .
present modes of treatment based on synthetic drugs have limited potential , because they are toxic and expensive and also alter cell signaling pathways .
natural drugs that are safe , affordable , and effective are needed to control cancer development and progression .
natural products have been used for thousands of years in the management of several diseases including various types of cancer .
neem ( azadirachta indica ) , is a traditional medicinal plant of the meliaceae family widely distributed in asia , africa and other tropical parts of the world .
all parts of the neem tree offer amazing potential for medicinal , agricultural and industrial exploitation and have been evaluated for antiinflammatory , antipyretic , antihistamine , antifungal , antitubercular , antiprotozoal , vasodilatory , antimalarial , diuretic , spermicidal , antiarthritic , insect repellent , antifeedant , and antihormonal activities .
studies of extracts from all major parts of neem plant including the leaves , flowers , fruits , and seeds , have shown promising chemopreventive and therapeutic effects in pre - clinical research .
extracts of neem leaf have been reported to be non - toxic and non - mutagenic and are found to possess immunomodulatory as well as anti - inflammatory and anticarcinogenic properties .
there are many studies showing the ethanolic extract of neem leaves to possess anticancer activity .
ethanolic neem leaf extract ( enle ) exhibited anticancer activity against n - methyl - n'-nitro - n - nitrosoguanidine - induced oxidative stress and gastric carcinogenesis .
enle induces apoptosis in a prostate cancer cell line ( pc-3 ) by up - regulating the pro - apoptotic protein bax and decreasing the level of bcl-2 protein resulting in dna fragmentation in prostate cancer cells [ 9 , 10 ] .
many bioactive compounds are isolated from this plant among which , nimbolide belongs to the limonoid group .
nimbolide ( 5,7,4'-trihydroxy-3',5'-diprenylflavanone ) , is a tetranortriterpenoid with a , -unsaturated system and -lactonic ring ( fig .
it has been shown to exhibit numerous types of biological activities , including , anti - malarial , anti - bacterial activity , anti - feedent , and anticancer activities [ 15 , 16 , 17 , 18 , 19 ] .
literature evidence reveals that , -unsaturated ketone structural element is responsible for the anticancer activity of nimbolide [ 20 , 21 ] .
so , any agent that has anti - cancer activity either protects genetic material from alterations or kills the genetically altered cancer cells .
the active component nimbolide from neem acts on cancer cells and kill them by altering the several molecular pathways .
the cytotoxicity of nimbolide has been widely studied over the last several years in a large variety of cancer cell lines .
it was reported recently that nimbolide inhibited cancer progression by influencing multiple mechanisms , including prevention of procarcinogen activation and oxidative dna damage , upregulation of antioxidant and induction of apoptosis , inhibition of tumor cell proliferation , invasion , angiogenesis , and metastasis [ 19 , 23 , 24 , 25 , 26 ] .
the potential mechanisms of cancer prevention by nimbolide are described below and summarized in fig .
tumorigenesis and cancer progression are thought to be the result of some changes in different types of genetic pathways [ 27 , 28 ] .
nimbolide , a chief constituent of neem , shows a vital role in cancer prevention and treatment through the modulation of various biological activities , including molecular cascades .
however , understanding the mechanism of action of nimbolide in the activation or inactivation of genetic pathways will provide significant information to develop therapeutic approaches to manage various types of cancers .
nimbolide decreased cell viability , with an ic50 ranging from 4 to 10 m and averaging 6 m for the neuroblastoma ( ne-115 ) and osteosarcoma ( 143b ) cell lines .
have tested the in vitro cytotoxicity of nimbolide against a panel of human cancer cell lines .
treatment of cells with 0.5 - 5.0 m nimbolide resulted in growth inhibition of the u937 , hl-60 , thp1 , and b16 cell lines .
it has been shown to interfere with the expression of cell survival proteins ( bcl-2 , bcl - xl , iap-1 , and iap-2 ) , proliferation ( cyclin d1 ) , invasion ( matrix metalloproteinase [ mmp]-9 ) , and angiogenesis ( vascular endothelial growth factor [ vegf ] ) by inhibiting inhibitor of b ( ib ) kinase ( ikk)/nuclear factor kappa b ( nf-b ) .
nimbolide treatment to human colon carcinoma ( ht-29 ) cells at 2.5 - 10 m resulted in moderate to very strong growth inhibition .
nimbolide significantly inhibited cell viability , with ic50 values of 4.0 m and 2.7 m for 24 and 48 h , respectively , in mcf-7 cells and 6.0 m and 3.2 m for 24 and 48 h , respectively , in mda - mb-231 cells .
the insulin - like growth factor ( igf ) system is involved in the proliferation , survival , and migration of tumor cells .
igf - i receptor ( igf - ir ) is a receptor tyrosine kinase that is overexpressed in about 70% of breast cancers [ 31 , 32 ] .
it is established that the consequences of igf - ir activation by its ligands result in the recruitment of major adapter signaling proteins , such as src / collagen homology proteins , which lead to interaction with grb2/sos .
one pathway activates ras , raf , and mitogen - activated protein kinase ( mapk ) , resulting in the transcription of genes that drive proliferation , and the other pathway involves phosphoinositide 3-kinase ( pi3k)/akt , which are responsible for cell survival and anti - apoptotic signal transduction .
downregulation of these molecules will give rise to inhibition of cell survival , invasion , and induction of apoptosis .
aberrant activation of pi3k / akt signaling has been associated with the development and progression of many cancers , making this pathway an attractive target for therapeutic strategies .
the increase in p - akt level in breast tumor samples correlates with a poor prognosis [ 36 , 37 ] and predicts a worse outcome among endocrine - treated patients .
the major inhibitor of akt is the dual - specificity protein and lipid phosphatase , phosphatase tensin homolog deleted on chromosome 10 ( pten ) that counteracts the pi3k - dependent akt activation by dephosphorylating the d3 position of pip3 .
pten activity is frequently lost by mutations , deletions or promoter methylation silencing in many primary and metastatic human cancers [ 40 , 41 ] .
the inhibition of pi3k / akt and activation of the pten pathway constitute a good strategy in the prevention of cancer .
the recent findings of karkare et al . proved that nimbolide suppresses glioblastoma viability and detains tumor growth by inhibiting cdk4/6 activity , leading to retinoblastoma hypophosphorylation and cell cycle arrest and by inhibiting growth factor pathways that are hyperactivated in glioblastoma , including the pi3k - akt , mapk , and jak - stat pathways .
it has been reported that decreased igf - ir expression and increased igfbp-3 expression are observed in nimbolide - treated breast cancer cells .
the protein expression of the igf signaling molecules irs-2 , pi3k , pakt , ras , raf , mek , and mapk was significantly decreased in nimbolide - treated cells .
this is further supported by a significant increase in the protein expression of pten upon nimbolide treatment in breast cancer cell lines ( fig .
thereby , nimbolide inhibits the cell survival and proliferation of breast cancer and prostate cancer cells [ 19 , 43 ] .
nf-b comprises a family of transcription factors involved in the regulation of a wide variety of biological responses .
nf-b has a well - known function in the regulation of immune responses and inflammation , but growing evidence supports a major role in oncogenesis .
nf-b regulates the expression of genes involved in many processes that play a key role in the development and progression of cancer , such as proliferation , migration , and apoptosis [ 44 , 45 ] .
activation of nf-b may result from different signaling pathways triggered by a variety of cytokines , growth factors , and tyrosine kinases .
recently , it was studied that nimbolide exerts potent anticancer effects in hepg2 cells by inhibiting nf-b activation and its downstream events , such as activation of the wnt/-catenin pathway and apoptosis evasion .
inhibitors of nf-b which can block several signalling pathway , have developed as a successful candidates for novel anti - cancer regimens .
thus , nimbolide , by targeting multiple components of the nf-b signaling pathway to inhibit tumor progression , is a promising agent for cancer prevention and therapy .
gupta et al . found that suppression of nf-b activation by nimbolide was caused by inhibition of ikk , which led to suppression of ib phosphorylation and degradation , nuclear translocation , dna binding , and gene transcription in myeloid and leukemic cells .
nimbolide significantly decreased the protein expression of ikk , ikk , and nf-b in breast cancer cell lines .
metastasis is the process by which a cancer cell leaves the primary tumor , travels to a distant site via the circulatory system , and begins a secondary tumor . in order to metastasize
, cancer cells must invade through the basement membrane and the extracellular matrix ( ecm ) .
proteolysis of the ecm is an important step in metastasis , and the process is associated with the upregulated production and activity of several ecm - degrading proteases .
the matrix metalloproteinases ( mmps ) constitute a family of structurally related , zinc - dependent endopeptidases that are capable of degrading the protein components of the ecm and basement membrane and release growth factors from ecm stores [ 47 , 48 ] .
mmp activity is regulated by specific inhibitors , the tissue inhibitors of mmp ( timps ) .
activation of chemokines and the urokinase plasminogen activator ( upa)/upa receptor ( upar ) system is also a central mediator of tumor - cell migration and invasion , and igf - i signaling can influence the upar pathway .
chemokines are chemotactic cytokines that cause the directed migration of leukocytes and are induced by inflammatory cytokines , growth factors , and pathogenic stimuli .
chemokine signaling results in the transcription of target genes that are involved in cell invasion , motility , and survival .
the upregulation of chemokine molecules in tumor biology as compared with " normal " cells confers chemokines as " a magic bullet , " as targeting them can potentially hit cancer cells and their metastasis , leaving non - affected cells unharmed .
the expression of the chemokines ccl2 , cxcl12 , and cxcl8 and their receptors ccr2 , cxcr1 , cxcr2 , and cxcr4 is significantly decreased in nimbolide - treated breast cancer cell lines .
upa is a serine protease that is involved in cancer progression , mainly invasion and metastasis .
upa can be observed as a multifunctional protein that is involved in both proteolysis and signal transduction .
recently , nimbolide has been shown to interfere with the expression of nf-b - regulated proteins , like bcl-2 , cyclooxygenase 2 , mmp-9 , and vegf , by inhibiting ikk .
therefore , it is likely that nimbolide will interfere with cell migration invasion and angiogenesis .
the neem limonoids azadirachtin and nimbolide inhibit hamster cheek pouch carcinogenesis by prevention of procarcinogen activation and oxidative dna damage , upregulation of antioxidants and carcinogen detoxification enzymes , and inhibition of tumor invasion and angiogenesis .
the protein expression of mmp-2 and -9 is significantly decreased , and timp-2 expression is increased in nimbolide - treated breast cancer cells .
other studies also reported that the protein expression and activity of mmp-2 and -9 were significantly decreased in myeloid leukemia cell lines and colon cancer cells .
limonoid - treated xenografts exhibited significant down - regulation in the expression of proteins involved in tumor cell survival ( bcl-2 , bcl - xl , c - iap-1 , survivin , and mcl-1 ) , proliferation ( c - myc and cyclin d1 ) , invasion ( mmp-9 , intercellular adhesion molecule 1 ) , metastasis ( cxcr4 ) , and angiogenesis ( vegf ) .
the migration and invasive potential of the mcf-7 and mda - mb-231 cell lines were considerably suppressed upon nimbolide treatment .
the results showed that nimbolide downregulated the expression of upa , upar , chemokines , phopho - epidermal growth factor receptor , vascular endothelial growth factor , nf-b , ikk , ikk , mmp-2 , and mmp-9 and upregulated the expression of timp-2 , suggesting that nimbolide inhibits angiogenesis and metastasis of breast cancer .
the loss of the ability to regulate the cell - cycle is characteristic of cancer cells and results in uncontrollable proliferation .
processing cells through the first gap ( g ) phase of the cell cycle is a step that is frequently disordered in cancer .
nimbolide has been investigated in different studies for its ability to mediate cell cycle arrest . in many in vitro and in vivo studies ,
nimbolide has shown cell cycle - regulatory effects [ 18 , 25 , 53 , 54 ] .
it has been reported that nimbolide inhibits cell proliferation by interfering with cell cycle kinetics by inducing g0/g1 and s phase arrest , primarily caused through the repression of cyclin a / cyclin d1 [ 16 , 54 , 55 ] . in another interesting molecular study
, a japanese group has proved that nimbolide , a triterpenoid present in certain edible parts of a. indica , arrested ht-29 cells in the g2/m and g0/g1 stages apparently through upregulation of p21 , which is a well - known downstream effector of the p53 .
p53 is a very important anticancer protein that regulates a large number of genes that are involved in cancer progression .
nimbolide has also been shown to upregulate cyclin d2 and cdk2 and to suppress the expression of cyclin a , cyclin e , cdk2 , and rad17 at the same time .
flow cytometric analysis of u937 cells showed that nimbolide treatment ( 1 - 2.5 m ) resulted in cell cycle disruption by decreasing the number of cells in g0/g1 phase , with initial increases in s and g2/m phases . it is shown that nimbolide can affect cell cycle progression and induce apoptosis in colon cancer , oral carcinoma , and cervical cancer [ 18 , 25 , 55 ] .
nimbolide significantly suppressed the viability of hela cells in a dose - dependent manner by inducing cell cycle arrest at g0/g1 phase , accompanied by p21 accumulation and down - regulation of the cell cycle regulatory proteins cyclin b , cyclin d1 , and proliferating cell nuclear antigen ( pcna ) .
nimbolide treatment results in the accumulation of cells in g0/g1 phase and decreased in s - phase by up regulating p21 and downregulating the cell cycle - regulatory proteins cyclins and pcna .
cyclin d1 is known as a proto - oncogene whose gene amplification and protein overexpression of which are frequently observed in tumor cells .
the activated cyclin d1/cdk4 and cyclin d1/cdk6 complex phosphorylates the retinoblastoma protein to induce the expression of target genes essential for s phase entry , facilitating the progression from g1 to s phase .
cyclin b1 is a g2/mitotic - specific protein that plays a role in the initiation of mitosis and tumorigenesis .
it was reported that cyclin b1 depletion inhibits proliferation and induces apoptosis in human tumor cells .
nimbolide treatment decreases cyclin ( a1 , b1 , c , d1 , and e1 ) expression in breast cancer cells .
p21 , originally identified as an inhibitor of the cyclin / cdk complexes , has also been shown to have a role as an adaptor protein that assembles and promotes the kinase activity of cyclin d / cdk4 complexes .
the level of p21 was significantly increased in nimbolide - treated breast cancer cell lines .
pcna , a cofactor for dna polymerase , plays a central role in cell cycle progression .
pcna is involved in a wide range of cellular functions , including dna replication , repair , and epigenetic maintenance , and is often used as a diagnostic and prognostic marker
. the protein expression of pcna is decreased in nimbolide - treated breast cancer cells .
nimbolide directly inhibited cdk4/cdk6 kinase activity , leading to hypophosphorylation of the retinoblastoma protein , cell cycle arrest at g1-s , and cell death . in animal tumor models ,
nimbolide ( 100 g / kg ) has been shown to exhibit chemopreventive activity against 7,12-dimethylbenzanthracene ( dmba ) 3-induced hamster buccal pouch carcinogenesis by downregulating proteins involved in cell cycle progression and transduce apoptosis by both the intrinsic and extrinsic pathways .
apoptosis , or programmed cell death , is essential for the maintenance of development and homeostasis of multi - cellular organisms by eliminating superfluous or unwanted cells .
any alteration or change in the normal process of apoptosis may increase cell survival and support tumor development and progression .
the extrinsic pathway is initiated by cell surface - expressed death receptors of the tumor necrosis factor superfamily .
one of the central pathways of apoptosis is initiated by cytokines , such as tumor necrosis factor- , fas ligand ( fasl ) , and tumor necrosis factor--related apoptosis - inducing ligand ( trail ) .
the intrinsic pathway is initiated by anticancer drugs , growth factor withdrawal , or hypoxia or via induction of oncogenes .
caspases are a family of evolutionarily conserved cysteine proteases that play a essential role in the majority of apoptotic pathways .
death signals activate the proteolytic cascade of caspases through two main pathways : an extrinsic and intrinsic pathway .
both pathways converge to the activation of caspase-3 , the closer homolog of caenorhabditis elegans ced-3 .
caspase-3 activates downstream enzymes of the caspase family and contributes with them to generate the typical apoptotic cell death phenotype .
harish kumar et al . reported that nimbolide transduces apoptosis by both the intrinsic and extrinsic pathways in dmba - induced hamster buccal pouch carcinogenesis . working on the choriocarcinoma ( bewo ) cells , have shown that nimbolide , induces apoptosis through engagement of the mitochondrial pathway .
the involvement of this pathway is based on the observation that nimbolide mediates the upregulation of apaf1 and a caspase-3 and decrease in the bcl2/bax ratio .
nimbolide sensitizes human colon cancer cell lines ( hct-116 and ht-29 ) to trail through reactive oxygen species- and erk - dependent up - regulation of death receptors , p53 , and bax .
a normal breast cell line ( mcf-10a ) and breast cancer cell lines ( mcf-7 ) were treated with nimbolide ( 1 - 5 m ) for 6 h , followed by trail for 24 h. the results indicated that whereas nimbolide and trail alone were minimally effective in inducing apoptosis in mcf-7 cells , the combination of both enhanced the number of apoptotic cells to 42% .
conversely , the combination of nimbolide and trail was unable to evoke apoptosis in the normal breast cell line .
the results showed a lack of dr5 and dr4 induction in mcf-10a cells by nimbolide , whereas a dose - dependent induction of these receptors was observed in mcf-7 cells .
the decreased expression of bcl-2 and increased expression of bax , cytochrome c , smac , and caspases , together with changes in nuclear morphology and mitochondrial transmembrane potential , seen in nimbolide treatment and inhibition of nf-b activation by nimbolide , stimulate the intrinsic apoptotic pathway in hepg2 cells . in another study ,
nimbolide repressed cell proliferation by inhibiting the igf1/igf - ir - pi3k / akt pathway and induced apoptosis through the activation of both the extrinsic and intrinsic apoptotic pathways in prostate cancer cells .
nimbolide also induced apoptosis in breast cancer cells by upregulating pro - apoptotic protein ( bad , bax , fasl , fadd , trail , and cytochrome c ) expression and down - regulating anti - apoptotic proteins ( bcl-2 , bcl - xl , mcl-1 , and xiap-1 ) .
nimbolide activates caspase-3 , -8 , and -9 , which favors the cleavage of poly(adp ) ribose polymerase into 115- and 85-kda peptides , thus inducing apoptosis in breast cancer cell lines .
further , the nimbolide - induced apoptotic cells were detected using dapi and ao / etbr dual staining .
after treatment with nimbolide , the cells exhibited the typical morphological changes associated with apoptosis : cell shrinkage , nuclear condensation , and membrane blebbing .
activation of caspase-3 , -8 , and -9 , suggests that nimbolide potentiated both the extrinsic and intrinsic pathways of apoptosis in human breast and colon cancer cells [ 68 , 30 ] .
the overview of all of the signaling molecules modulated by nimbolide is shown in fig .
the present mode of treatment based on chemotherapy and radiotherapy is very expensive and also exhibits serious side effects in human beings .
keeping in view the significance of herbs , this review is written to show the role of nimbolide in the prevention of various types of cancer through the activation or inactivation of various signaling pathways .
these reported features , combined with the absence of side effects and being inexpensive and easy to access , neem and its constituent nimbolide may be proved very effective therapeutics in the management of cancers .
nimbolide is a potential chemopreventive agent that is able to suppress multiple signaling pathways involved in carcinogenesis and hence is an attractive candidate for further research .
currently , nimbolide is undergoing extensive research to determine the dose efficacy and administration form that could enhance its bioavailability and chemopreventive properties .
however , most of the anticancer activities assigned to nimbolide have been based on in vitro studies . while in vitro studies predominantly established the anti - cancer effects of nimbolide on cancer cells , its efficiency in vivo has still to be proven . | cancer is the most dreaded disease in human and also major health problem worldwide . despite its high occurrence ,
the exact molecular mechanisms of the development and progression are not fully understood .
the existing cancer therapy based on allopathic medicine is expensive , exhibits side effects ; and may also alter the normal functioning of genes .
thus , a non - toxic and effective mode of treatment is needed to control cancer development and progression .
some medicinal plants offer a safe , effective and affordable remedy to control the cancer progression .
nimbolide , a limnoid derived from the neem ( azadirachta indica ) leaves and flowers of neem , is widely used in traditional medical practices for treating various human diseases .
nimbolide exhibits several pharmacological effects among which its anticancer activity is the most promising .
the previous studies carried out over the decades have shown that nimbolide inhibits cell proliferation and metastasis of cancer cells .
this review highlights the current knowledge on the molecular targets that contribute to the observed anticancer activity of nimbolide related to induction of apoptosis and cell cycle arrest ; and inhibition of signaling pathways related to cancer progression . | Introduction
Mechanism of Action of Nimbolide in Cancer Prevention
Inhibition of Cancer Cell Proliferation and Growth
The Effects of Nimbolide on NF-B Signaling
Nimbolide Inhibits Cancer Cell Metastasis
Inhibition of Cell Cycle and Induction of Apoptosis by Nimbolide
Conclusion and Future Perspectives |
marine sponges ( porifera ) are well - known as prolific producers of bioactive metabolites . a sesquiterpene quinone , ilimaquinone , was reported in 1979 , and since then , related compounds have been obtained from several genera of marine sponge [ 39 ] .
we have isolated 11 sesquiterpene quinones : ilimaquinone ( 1 ) and its 5-epimer ( 2 ) , smenospongidine ( 3 ) and its 5-epimer ( 4 ) , smenospongiarine ( 5 ) and its 5-epimer ( 6 ) , smenospongine ( 7 ) and its 5-epimer ( 8) , dactyloquinone b , 18-hydroxy-5-epihyrtiophenol , and pelorol , from hippospongia sp . collected in palau , and reported the effects of these compounds on the production of an inflammatory cytokine , interleukin-8 ( il-8 ) , in tetradecanoyl phorbol acetate ( pma)-stimulated human promyelocytic leukemia hl-60 cells .
il-8 is a member of the superfamily of c - x - c chemokines and a chemotactic factor for t - cells , neutrophils , and basophils .
expression of il-8 has been detected in a variety of human cancers and is suggested to be a factor involved in tumor progression and metastasis [ 1215 ] .
compounds 38 increased the production of il-8 ; therefore , we examined the effects of compounds 18 on the production of one of the most well - known and important inflammatory cytokines , tnf- , in lipopolysaccharide ( lps)-stimulated murine monocytic leukemia raw 264.7 cells .
the raw 264.7 cell line was obtained from the japanese cancer research resources bank ( jcrb , kamiyoga , tokyo , japan ) .
this cell line was maintained in tissue culture dishes in rpmi 1640 medium ( nissui seiyaku , tokyo , japan ) , supplemented with 10% heat - inactivated fcs , 2 mm glutamine , 100 u / ml of penicillin g and 100 g / ml of streptomycin .
tnf- concentrations of the culture supernatants under control and various test conditions were measured by elisa using a combination of monoclonal and polyclonal antibodies .
cell proliferation was evaluated by enumerating the viable cells using the mtt formazan production method .
raw264.7 cells ( 1 10 cells / ml ) were treated with lps ( with or without test compounds ) and then transferred to 96-well microtiter plates .
after incubation for 24 h , 20 l of mtt reagent ( 5 mg / ml in pbs ) was added to each well and further incubated for 3 h. the production of formazan was assessed by measuring optical density ( od570 nm ) .
data are shown as the values relative ( % ) to each pma - stimulated optical density .
the raw 264.7 cell line was obtained from the japanese cancer research resources bank ( jcrb , kamiyoga , tokyo , japan ) .
this cell line was maintained in tissue culture dishes in rpmi 1640 medium ( nissui seiyaku , tokyo , japan ) , supplemented with 10% heat - inactivated fcs , 2 mm glutamine , 100 u / ml of penicillin g and 100 g / ml of streptomycin .
tnf- concentrations of the culture supernatants under control and various test conditions were measured by elisa using a combination of monoclonal and polyclonal antibodies .
cell proliferation was evaluated by enumerating the viable cells using the mtt formazan production method .
raw264.7 cells ( 1 10 cells / ml ) were treated with lps ( with or without test compounds ) and then transferred to 96-well microtiter plates .
after incubation for 24 h , 20 l of mtt reagent ( 5 mg / ml in pbs ) was added to each well and further incubated for 3 h. the production of formazan was assessed by measuring optical density ( od570 nm ) .
data are shown as the values relative ( % ) to each pma - stimulated optical density .
raw 264.7 cells are known to produce tnf- in response to the addition of lps , and this system is used to detect the modulating activities of compounds on tnf- production .
5-epi - smenospongine ( 8) stimulated the production of tnf- to a level three times greater than the control , but compounds 17 did not show any apparent activity ( fig .
compounds 3 , 5 , and 7 exhibited stronger activity on the promotion of il-8 production than the corresponding 5-epimers 4 , 6 , and 8 in pma - stimulated hl-60 cells , which showed the contribution of the trans - decaline ring in enhancing activity .
the basic functional group at c-18 increased il-8 production , since 38 exhibited stronger activities than 1 and 2 .
it was therefore revealed that the production of tnf- induced by 8 involves a different mechanism from that involved in il-8 production .
ilimaquinone ( 1 ) showed antibacterial , cytotoxic , anti - hiv , hemolytic , and antimitotic activities , disruption of the golgi apparatus , inhibition of the cytotoxicity of ricin and diphtheria toxin , and differentiation - inducing activity [ 5 , 1722 ] .
compounds 25 and 7 were reported to have cytotoxic , antibacterial , and hemolytic activities [ 4 , 5 , 17 ] .
compounds 24 , 7 , and 8 induced the differentiation of k562 cells into erythroblasts , as did 1 . in this study
, we revealed the production of tnf- production in lps - stimulated raw 264.7 cells by one of the eight sesquiterpene quinones , 5-epi - smenospongine ( 8) . this is the first report on the modulation of tnf- production by sesquiterpene quinones . from the comparison of structures 18 ,
it is suggested that the cis - decaline ring and a primary amine in the benzoquinone ring are necessary for the activity of 8 .
as we previously reported , compounds 3 to 8 induced the production of il-8 by pma - stimulated hl-60 cells . in this study
, we investigated their actions on tnf- produced by lps - stimulated mouse macrophage cell lines .
compound 8 induced tnf- production . however , there was no influence of the other compounds .
this may have been associated with the different actions of these compounds related to variations in receptors , signal molecules , and transcription factors in the production process of il-8 and tnf- as inflammatory cytokines .
therefore , the results of our experiment suggest that individual inflammatory cytokines can be controlled ; these compounds should be further developed in the future . | eight sesquiterpene quinones : ilimaquinone ( 1 ) , smenospongidine ( 3 ) , smenospongiarine ( 5 ) , smenospongine ( 7 ) , and their corresponding 5-epimers 2 , 4 , 6 , and 8 , isolated from the palauan marine sponge hippospongia sp . , were examined regarding their effects on tnf- production in lps - stimulated raw 264.7 cells .
5-epi - smenospongine ( 8) promoted the production of tnf- to a level three times greater than the control at 10 m , but compounds 17 did not show apparent activity .
the results suggest that the cis - decaline ring and a primary amine in the benzoquinone ring are necessary for activity .
this is the first study to report the modulation of tnf- production by a sesquiterpene quinone . | 1. Introduction
2. Materials and Methods
2.1. Test Compounds
2.2. Cell lines and culture conditions
2.3. Detection of murine TNF- by ELISA
2.4. Determination of cell proliferation
3. Results and Discussion |
in this issue of critical care , graf and colleagues describe a long - term cohort study of the costs and consequences of intensive care after resuscitation from cardiac arrest .
we took particular interest in this study because health care costs in the us exceed those of any other nation .
this study was a programmatic evaluation rather than an assessment of a specific intervention such as therapeutic hypothermia .
thirty - one percent of the cohort that survived to be cared for in the intensive care setting were still alive 5 years after hospital discharge .
the health - related quality of life of this group of 5-year survivors was similar to that of matched healthy controls .
the cost per quality - adjusted life year ( qaly ) gained was 14,487 euros ( approximately us $ 22,900 at current rates ) .
the cost per life year gained increased by 18% when it included the 6.4% of 5-year survivors who had severe neurological disability ( that is , glasgow coma scale score of less than 6 ) .
how much to pay for a health intervention is a poignant question most societies have yet to answer formally .
such decisions are complex and are predicated not only on the absolute and incremental cost of the intervention but also on the quantity and quality of effectiveness data related to the intervention .
countries with a centralized planning process for health care may imply their answer when they approve or disapprove for national formulary a drug designed to extend life in a terminal disease .
the uk 's national health service recently declined approval of bevacizumab ( avastin , with a cost of therapy per year of approximately $ 100,000 ) as first - line therapy for lung and breast cancer . in the us
, there appears to be a general consensus that $ 50,000 to $ 100,000 per year of life gained is acceptable .
an analysis based on economic principles suggested that we should be willing to spend up to twice the average annual income on health care . in this light , less than 15,000 euros per qaly for intensive care after resuscitation from cardiac arrest is similar to or less than the cost of other commonly used medical interventions .
this study has some limitations relative to current standards for economic evaluation of health interventions .
the application of post hoc subgroup analysis based on neurologic status tended to underestimate the costs and overestimate the cost - effectiveness of the program . restricting the analysis to consider a health care rather than a societal perspective underestimated costs and made it difficult to compare the results of this analysis with comprehensive economic evaluations of health care and other interventions .
these are that quality of life after resuscitation from cardiac arrest is good and that the costs of care after resuscitation are acceptable .
survival after out - of - hospital cardiac arrest ( ohca ) has been static over time , but a recent analysis suggests that outcomes are improving .
therapeutic hypothermia is likely to be the first of several effective hospital - based interventions for cardiac arrest [ 10 - 12 ] .
the perceived poor prognosis and expense of care of patients resuscitated from cardiac arrest are key barriers to the implementation of effective therapies such as cooling .
we need to change the culture of resuscitation and recognize that cardiac arrest is a treatable condition that is associated with good quality of life after resuscitation as well as acceptable costs of care . in many countries ,
imminent death is not always predictable , and a persistent vegetative state is associated with poor quality of life .
therefore , we require better methods of predicting who will recover and who will have disability after resuscitation from cardiac arrest , especially in the era of hypothermia . two hundred seventy thousand people experience ohca each year in the us ( g. nichol , unpublished data ) .
about 450,000 do so in europe based on extrapolation from population - based incidence estimates .
if we double survival after ohca , then 18,900 premature deaths in the us and 31,500 in europe would be averted each year .
there are many ways to improve the chain of survival , including improved communications from citizens to emergency medical services , delivery of care to the patient , delivery of the patient to the hospital , and delivery of cardiac and critical care once there .
ohca = out - of - hospital cardiac arrest ; qaly = quality - adjusted life year .
saw is a member of the american heart association ( aha ) ( dallas , tx , usa ) national registry for cardiopulmonary resuscitation adult research task force .
gn is a member of the aha advanced cardiac life support subcommittee , the scientific advisory board of the aha national registry for cardiopulmonary resuscitation , and the board of directors of the medic one foundation ( seattle , wa , usa ) .
he has received grants from the national institutes of health ( bethesda , md , usa ) for the resuscitation outcomes consortium ( 20042009 ) , the laerdal foundation for acute medicine ( stavanger , norway ) for a randomized trial of a cpr training aid ( 2007 ) , and the canadian institutes of health research ( ottawa , on , canada ) and medtronic inc . (
minneapolis , mn , usa ) for a randomized trial of a resynchronization therapy ( 20052009 ) .
he has received equipment , including mannequins ( laerdal medical , stavanger , norway ) and monitor / defibrillators ( physio - control inc .
, a division of medtronic , redmond , wa , usa ) , donated to support overseas medical missions . | two hundred seventy thousand people in the us and 450,000 people in europe experience out - of - hospital cardiac arrest each year . perceived poor prognosis and expense of care of patients resuscitated from cardiac arrest remain barriers to implementation of effective therapies . in this issue of critical care , graf and
colleagues have provided a programmatic evaluation of the costs and consequences of intensive care after resuscitation from cardiac arrest .
thirty - one percent of the cohort that survived to be cared for in the intensive care setting were still alive 5 years after hospital discharge .
the health - related quality of life of this group of 5-year survivors was similar to that of matched healthy controls , and the cost per quality - adjusted life year gained was similar to or less than the cost of other commonly used medical interventions .
we need to change the culture of resuscitation and recognize that cardiac arrest is a treatable condition that is associated with acceptable quality of life and costs of care after resuscitation . | None
Abbreviations
Competing interests |
nhanes is an ongoing cross - sectional , multistage , stratified , clustered probability sample of the u.s .
civilian noninstitutionalized population conducted by the national center for health statistics ( nchs ) , a branch of the centers for disease control and prevention ( 12 ) .
detailed in - person interviews , physical examinations , and blood samples were obtained from 18,986 participants aged 20 years in the 19992006 surveys who participated in the mobile examination visit . for the present study , we excluded those individuals who reported that a doctor or health care profession had ever told them they had diabetes ( n = 1,900 ) , who were missing information on diabetes status ( n = 288 ) , or who were missing a1c data ( n = 986 ) .
the protocols of conduct for nhanes were approved by the nchs institutional review board , and informed consent was obtained from all participants . approximately one - half of nhanes participants were sampled to attend the morning session .
fasting plasma glucose ( fpg ) values are available for those adults aged 20 years who attended the morning examination and were fasting for 8 h ( n = 9,232 ) .
our analyses of fasting glucose were limited to the fasting subpopulation of adults without diabetes who were not missing a1c data ( n = 7,772 ) . in the plasma glucose fasting subsample
, we conducted analyses comparing a1c levels among individuals with normal fasting glucose ( < 100 mg / dl ) , impaired fasting glucose ( ifg ) ( 100<126 mg / dl ) , and undiagnosed diabetes ( fasting glucose 126 mg / dl ) ( 13 ) . in the 20052006 survey ,
thus , ogtt data were available for participants in the morning fasting subsample in the 20052006 survey only .
a1c measurements for nhanes 19992004 were performed by the diabetes diagnostic laboratory at the university of missouri - columbia using primus clc330 and primus clc 385 instruments ( primus , kansas city , mo ) .
a1c measurements in nhanes 20052006 were performed by the diabetes laboratory at the university of minnesota using a tosoh a1c 2.2 plus glycohemoglobin analyzer ( tosoh medics , san francisco , ca ) .
all a1c measurements were standardized to the reference method used for the diabetes control and complications trial .
hypertension was defined as a mean systolic blood pressure of 140 mmhg , a mean diastolic blood pressure of 90 mmhg , or hypertension medication use .
hypercholesterolemia was defined as a total cholesterol level of 240 mg / dl or lipid medication use .
c - reactive protein was measured by latex - enhanced nephelometry , a high - sensitivity assay .
information on age , sex , race / ethnicity , education level , and smoking was based on self - report during the questionnaire portion of the survey .
a history of cardiovascular disease was defined on the basis of a self - reported history of coronary heart disease , angina , previous heart attack , or stroke .
smoking status was determined using answers to the questions , have you smoked at least 100 cigarettes in your life ? and do you now smoke cigarettes ?
alcohol consumption was determined during the computer - assisted personal interview using answers to the questions , in any one year , have you had at least 12 drinks of any type of alcoholic beverage ? and in your entire life , have you had at least 12 drinks of any type of alcoholic beverage ? detailed information regarding the collection of data in nhanes is available elsewhere ( 12 ) .
analyses were performed incorporating the sampling weights ( 8-year combined weights ) to obtain unbiased estimates from the complex nhanes sampling design using statase ( version 10.0 ; statacorporation , college station , tx ) and r ( version 2 ; free software foundation , boston , ma ) .
ses for all estimates were obtained using the taylor series ( linearization ) method following nchs - recommended procedures ( 16 ) .
analyses of fpg categories were limited to the morning plasma glucose sample and corresponding 8-year fasting subsample weights were used for these analyses .
we generated weighted and smoothed histograms ( kernel density estimator ) to compare the distribution of a1c in individuals with normal fasting glucose , ifg , and undiagnosed diabetes .
elevated a1c as a1c > 6% in this population without a history of diabetes .
however , we also assessed the prevalence of elevated a1c at cut points of 6.0 , 6.1 , 6.2 , 6.3 , 6.4 , 6.5 , 6.6 , 6.7 , 6.8 , 6.9 , and 7.0% .
adjusted odds ratios ( ors ) and their corresponding 95% cis were estimated from logistic regression models to assess the association between potential risk factors and elevated a1c levels .
we conducted multivariable logistic analyses modeling a1c > 6% as the outcome in the overall population . in the population of adults with normal a1c
( < 6% ) and normal fasting glucose ( < 100 mg / dl ) levels , we modeled the association between risk factors of interest and a1c level above the weighted median a1c level in this population ( > 5.2% ) .
model 2 included all variables in model 1 plus hypertension , hypercholesterolemia , bmi , education , history of cardiovascular disease , alcohol consumption , and c - reactive protein categories .
sensitivity analyses were conducting using the ogtt data only available in nhanes 20052006 and the appropriate 2-year fasting weights for this survey .
estimates from this study are nationally representative of the noninstitutionalized population of adults 20 years in the u.s .
census to obtain estimates of the number of nondiabetic individuals with elevated a1c in the u.s . in the year 2000 .
fasting plasma glucose ( fpg ) values are available for those adults aged 20 years who attended the morning examination and were fasting for 8 h ( n = 9,232 ) .
our analyses of fasting glucose were limited to the fasting subpopulation of adults without diabetes who were not missing a1c data ( n = 7,772 ) . in the plasma glucose fasting subsample
, we conducted analyses comparing a1c levels among individuals with normal fasting glucose ( < 100 mg / dl ) , impaired fasting glucose ( ifg ) ( 100<126 mg / dl ) , and undiagnosed diabetes ( fasting glucose 126 mg / dl ) ( 13 ) . in the 20052006 survey , an oral glucose tolerance test ( ogtt )
thus , ogtt data were available for participants in the morning fasting subsample in the 20052006 survey only .
a1c measurements for nhanes 19992004 were performed by the diabetes diagnostic laboratory at the university of missouri - columbia using primus clc330 and primus clc 385 instruments ( primus , kansas city , mo ) .
a1c measurements in nhanes 20052006 were performed by the diabetes laboratory at the university of minnesota using a tosoh a1c 2.2 plus glycohemoglobin analyzer ( tosoh medics , san francisco , ca ) .
all a1c measurements were standardized to the reference method used for the diabetes control and complications trial .
hypertension was defined as a mean systolic blood pressure of 140 mmhg , a mean diastolic blood pressure of 90 mmhg , or hypertension medication use .
hypercholesterolemia was defined as a total cholesterol level of 240 mg / dl or lipid medication use .
c - reactive protein was measured by latex - enhanced nephelometry , a high - sensitivity assay .
information on age , sex , race / ethnicity , education level , and smoking was based on self - report during the questionnaire portion of the survey .
a history of cardiovascular disease was defined on the basis of a self - reported history of coronary heart disease , angina , previous heart attack , or stroke .
smoking status was determined using answers to the questions , have you smoked at least 100 cigarettes in your life ? and do you now smoke cigarettes ?
alcohol consumption was determined during the computer - assisted personal interview using answers to the questions , in any one year , have you had at least 12 drinks of any type of alcoholic beverage ? and in your entire life , have you had at least 12 drinks of any type of alcoholic beverage ? detailed information regarding
analyses were performed incorporating the sampling weights ( 8-year combined weights ) to obtain unbiased estimates from the complex nhanes sampling design using statase ( version 10.0 ; statacorporation , college station , tx ) and r ( version 2 ; free software foundation , boston , ma ) .
ses for all estimates were obtained using the taylor series ( linearization ) method following nchs - recommended procedures ( 16 ) .
analyses of fpg categories were limited to the morning plasma glucose sample and corresponding 8-year fasting subsample weights were used for these analyses .
we generated weighted and smoothed histograms ( kernel density estimator ) to compare the distribution of a1c in individuals with normal fasting glucose , ifg , and undiagnosed diabetes .
elevated a1c as a1c > 6% in this population without a history of diabetes .
however , we also assessed the prevalence of elevated a1c at cut points of 6.0 , 6.1 , 6.2 , 6.3 , 6.4 , 6.5 , 6.6 , 6.7 , 6.8 , 6.9 , and 7.0% .
adjusted odds ratios ( ors ) and their corresponding 95% cis were estimated from logistic regression models to assess the association between potential risk factors and elevated a1c levels .
we conducted multivariable logistic analyses modeling a1c > 6% as the outcome in the overall population . in the population of adults with normal a1c
( < 6% ) and normal fasting glucose ( < 100 mg / dl ) levels , we modeled the association between risk factors of interest and a1c level above the weighted median a1c level in this population ( > 5.2% ) .
model 2 included all variables in model 1 plus hypertension , hypercholesterolemia , bmi , education , history of cardiovascular disease , alcohol consumption , and c - reactive protein categories .
sensitivity analyses were conducting using the ogtt data only available in nhanes 20052006 and the appropriate 2-year fasting weights for this survey .
estimates from this study are nationally representative of the noninstitutionalized population of adults 20 years in the u.s .
census to obtain estimates of the number of nondiabetic individuals with elevated a1c in the u.s . in the year 2000 .
mean a1c level and proportion of individuals with elevated a1c ( a1c > 6% ) by population characteristics are displayed in table 1 .
the mean se a1c in adults aged 20 years without diagnosed diabetes was 5.3 0.01% .
mean a1c level and the proportion of individuals with a1c > 6% increased considerably with age .
non - hispanic blacks also had higher a1c levels than non - hispanic whites . in this crude comparison ,
differences in a1c were also observed for hypertension and hypercholesterolemia status , bmi categories , education level , and c - reactive protein quartiles . a1c and proportions of elevated levels ( a1c > 6% ) by population characteristics in adults aged 20 years without diagnosed diabetes , u.s .
19992006 figure 1 displays the count of individuals ( in millions ) with elevated a1c at cut points between 6.0 and 7.0% .
the prevalence of a1c > 6.0% in individuals without a history of diabetes was 3.8% ( 95% ci 3.54.2 ) ( table 1 ) , corresponding to 7.1 million adults ( 6.57.8 ) in the u.s ( fig .
1 ) . the prevalence estimates for a1c cut points of > 6.1 , 6.5 , and 7.0% were 2.9 ( 2.63.2 ) , 1.6 ( 1.41.8 ) , and 0.8 ( 0.60.9 ) .
these correspond to 5.4 million ( 4.86.0 ) , 3.0 million ( 2.63.3 ) , and 1.5 million ( 1.11.7 ) individuals in the u.s .
these prevalence estimates suggest the yield of individuals in the u.s . with elevated a1c at different cut points if a1c alone was used to screen for diabetes .
count in millions ( 95% ci ) of persons at different a1c cut points in the u.s .
figure 2 displays the distributions of a1c in individuals with normal fasting glucose ( fasting glucose < 100 mg / dl ) , ifg ( fasting glucose 100<126 mg / dl ) , and undiagnosed diabetes ( fasting glucose 126 mg / dl ) , revealing substantially overlapping distributions in individuals with normal glucose and ifg but a right - skewed distribution in individuals with undiagnosed diabetes .
the mean a1c levels in individuals with normal fasting glucose , ifg , and undiagnosed diabetes were 5.2 0.01 , 5.5 0.01 , and 6.9 0.16% , respectively ( not shown ) .
similarly , the distribution of individuals in the fasting glucose categories ( < 100 , 100125 , and 126 mg / dl ) varied substantially , depending on the a1c cut point .
for instance , among individuals with a1c > 6.0% , 45.6% had undiagnosed diabetes , 45.3% had ifg , and 9.1% had normal fasting glucose .
in contrast , among individuals with an a1c 7.0% , 91.7% had undiagnosed diabetes , 6.6% had ifg , and only 1.7% had normal glucose levels .
a comparison of the distribution of fasting glucose categories among individuals with a1c > 6.1% and a1c 6.5% yielded intermediate results . among individuals with a1c > 6% , 53.3% had undiagnosed diabetes , 38.6% had ifg , and 8.1% had normal fasting glucose . among individuals with a1c 6.5% , 76.7% had undiagnosed diabetes , 19.6% had ifg , and 1.7% had normal fasting glucose ( supplementary figure a , available in an online appendix at http://care.diabetesjournals.org/cgi/content/full/dc08-1699/dc1 ) .
weighted smoothed histogram comparing distributions of a1c by fasting glucose category , adults aged 20 years without diagnosed diabetes , u.s .
multivariable logistic regression analysis demonstrated that older age , male sex , non - hispanic black and mexican american race / ethnicity , hypertension , higher bmi , less than a high school education , and higher c - reactive protein levels were all associated with the prevalence of elevated a1c ( a1c > 6% ) even after multivariable adjustment in this population of adults without diagnosed diabetes ( supplementary table a ) .
we next examined the same variables but limited the population to individuals with normal a1c ( a1c < 6% ) and with a fasting glucose < 100 mg / dl and assessed the association with having an a1c level above the median in this population ( a1c > 5.2% ) ( table 2 ) .
similar associations as in the model of a1c > 6% were observed in the full population . in table 2 , older age , male sex , non - hispanic black and mexican - american race / ethnicity , hypercholesterolemia , higher bmi , and lower attained education
current smoking was associated with higher a1c and current alcohol consumption with lower a1c in this population with normal glucose levels .
additional adjustment for fasting glucose did not alter these results ( data not shown ) .
our results were also unchanged in sensitivity analyses of nhanes 20052006 , the only years for which ogtt data were available , in which we further excluded individuals with impaired glucose tolerance ( 2-h glucose 140 mg / dl ) from our multivariable models ( data not shown ) . adjusted ors ( 95% cis ) of a1c above the median ( a1c > 5.2% ) in adults aged 20 years without diagnosed diabetes and with normal fasting glucose and normal a1c levels , u.s .
model 2 : all variables in model 1 plus hypertension , hypercholesterolemia , bmi , education , history of cardiovascular disease , alcohol consumption , and c - reactive protein categories .
absence of diabetes with normal fasting glucose indicates no history of diabetes and fpg < 100 mg / dl ; normal a1c level indicates a1c < 6% .
this analysis suggests that elevated a1c ( > 6% ) is common in the general population of nondiabetic adults .
the overall prevalence of a1c > 6% was 3.8% , corresponding to 7.1 million individuals in the u.s .
approximately 45% of these individuals have ifg and 45% have fasting glucose 126 mg / dl . elevated
a1c levels were particularly common among older adults , non - hispanic blacks , and obese individuals .
we found that demographic characteristics and risk factors for type 2 diabetes and its complications including older age , male sex , nonwhite race / ethnicity , lower attained education level , adiposity , and hypercholesterolemia were associated with elevated a1c even in the presence of normal fasting glucose .
significant advantages of adopting a1c for the screening and diagnosis of diabetes are the high repeatability of the measurement ( 17,18 ) and the high specificity of elevated values for detecting undiagnosed diabetes ( 1921 ) .
recent recommendations have stated that diagnosis based on a1c should be confirmed using a glucose - dependent test ( fpg or ogtt ) or by a second a1c ( 11 )
. however , glucose - dependent tests are less reliable ( repeatable ) than a1c ( 17 ) . requiring confirmation of a highly reliable test by one that is less reliable poses problems for the interpretation of any discrepancy between the two values . in a previous study , we analyzed repeated measurements taken 2 weeks apart on an unselected sample of individuals without diabetes and found that 100% of individuals with a1c 7% had a second a1c measurement of 7% 2 weeks later and 80% of individuals with a1c 6.5 had an a1c level 6.5% 2 weeks later ( pearson 's r = 0.95 ) ( 17 ) . there is little marginal gain to repeating the a1c test within a short ( several week ) time period . furthermore , we show in the present study that 92% of individuals with a1c 7.0% also had fpg 126 mg / dl and 77% of individuals with a1c 6.5% had fpg 126 mg / dl . at the population level ,
additional advantages to using a1c for screening and/or diagnosis of diabetes include national standardization of the assay ( 22,23 ) , the low analytic variability ( high methodological quality of the assay , even when compared with glucose ) ( 24 ) , the widespread availability of the a1c test and its current use in the management and treatment of diabetes , and the fact that the patient does not need to fast .
it is unclear why nondiabetic non - hispanic blacks have consistently higher a1c values even in the setting of normal fasting glucose levels and after adjustment for demographic and clinical characteristics .
further research should be conducted to determine whether this disparity stems from racial differences in postprandial glycemia or from racial differences in the tendency of hemoglobin to undergo glycosylation .
this study has several strengths including the large , nationally representative sample of healthy , nondiabetic individuals .
we benefited from the rigorous measurement of risk factors using standardized protocols and strict quality control data collection and laboratory procedures in nhanes .
important limitations include the cross - sectional design , which limits our conclusions regarding the temporality of the observed associations . in addition , we had only a single measurement of fasting glucose .
the american diabetes association recommends repeating an elevated fasting glucose measurement to confirm the diagnosis of diabetes ( 13 ) .
the use of a single measurement of fasting glucose rather than two will overestimate the prevalence of undiagnosed diabetes ( 17 ) .
nonetheless , interpretation of single measurements of fasting glucose and a1c as analyzed in this study reflects a common clinical decision - making setting .
although we can not rule out the possibility of laboratory differences over time , calibration of a1c to account for the change in laboratories in 20052006 using a published equation ( 14 ) did not appreciably alter our results .
the lack of ogtt data in the fasting glucose subsample for all survey years is an important limitation of this study .
nonetheless , similar results were obtained in multivariable models using the ogtt measurements in the subgroup from the 20052006 nhanes .
to date , the diagnostic utility of a1c has largely been assessed by its accuracy ( as measured by its sensitivity and specificity ) to detect glucose - defined cases of diabetes ( 25 ) .
the concordance of a1c with fasting glucose is important and , as confirmed by our data , an a1c 6.5% is specific for the detection of undiagnosed diabetes defined by a single fasting glucose level .
thus , it seems reasonable to adopt a single elevated a1c value as being diagnostic for diabetes .
however , the real test of utility for a1c as a screening or diagnostic test of diabetes is its association with long - term clinical outcomes in an initially nondiabetic population specifically in comparison with fasting glucose levels . to address this question we need large , observational studies of a1c in populations of individuals without diabetes | objectivethe purpose of this study was to examine the prevalence and correlates of elevated a1c in a large , nationally representative sample of adults without diabetes in the u.s.research design and methodswe analyzed data from 15,934 participants aged 20 years without diagnosed diabetes who had a1c measurements in the 19992006 national health and nutrition examination survey , a cross - sectional and nationally representative sample of the u.s . population.resultsthe overall prevalence of a1c > 6% was 3.8% , corresponding to 7.1 million adults without diabetes in the u.s .
population .
approximately 90% of these individuals had fasting glucose 100 mg / dl .
older age , male sex , non - hispanic black race / ethnicity , hypercholesterolemia , higher bmi , and lower attained education were significantly associated with having a higher a1c level even among individuals with normal fasting glucose ( < 100 mg / dl ) and after multivariable adjustment.conclusionsa single elevated a1c level ( a1c > 6% ) is common in the general population of adults without a history of diabetes and is highly reliable for the detection of elevated fasting glucose .
nondiabetic adults with elevated a1c are likely to have impaired fasting glucose and an array of other risk factors for type 2 diabetes and cardiovascular disease . | RESEARCH DESIGN AND METHODS
Fasting plasma glucose subsample
Laboratory measurement of A1C and plasma glucose
Other variables of interest
Statistical analysis
RESULTS
CONCLUSIONS
Supplementary Material |
the instrument measures corneal hysteresis ( ch ) and corneal resistance factor ( crf ) as the markers of corneal viscoelastic properties .
technically , ch is the difference between inward and outward applanation pressures created by an air puff and is an indicator of viscous properties of the cornea .
however , crf is a measurement of corneal resistance to deformation and indicates elastic properties of the cornea .
corneal properties other than central corneal thickness ( cct ) have several implications especially in glaucoma and corneal refractive surgery .
corneal viscoelastic properties depend on the structure and organization of collagen fibrils and extracellular matrix ( ecm ) .
collagen fibers are responsible for strength and elasticity of the cornea while the ecm is responsible for the viscous properties .
structural changes with age include an increase in collagen fiber diameter as a result of an increase in number of collagen molecules and expansion of intermolecular space .
ex vivo measurements of corneal biomechanical properties have shown progressive stiffening of the cornea with age.6 , 7 , 8 , 9 however , the results of in vivo measurements of corneal biomechanics are inconclusive .
some studies have shown no change by age,11 , 12 , 13 , 14 while some report a decrease in ch and crf.15 , 16 , 17 , 18 , 19 this study was conducted to evaluate the corneal viscoelastic properties in different age groups .
this cross - sectional study was performed at the department of ophthalmology , ahvaz jundishapur university of medical sciences , ahvaz , iran .
the study protocol was approved by the local ethics committee and adhered to the tenets of declaration of helsinki .
informed consent was obtained from all patients . in this observational cross - sectional study ,
exclusion criteria included any history of ocular or systemic diseases including diabetes , hypertension , hyperlipidemia , glaucoma , ocular surgery , keratoconus , ocular or systemic medications including corticosteroids , corneal astigmatism > 2 d , severe dry eye , pregnancy , and contact lens use within 1 month of the study .
after a complete ocular examination , corneal viscoelastic properties were measured using ora and cct measured using an ultrasonic pachymeter ( pachymeter sp 3000 , tomey , nagoya , japan ) . in case of ocular disease , the sound eye and otherwise the right eye was chosen for the study .
individuals were put into 6 groups : group 1 ( 1019 years ) , group 2 ( 2029 years ) , group 3 ( 3039 years ) , group 4 ( 4049 years ) , group 5 ( 5059 years ) , and group 6 ( 6069 years ) .
ora is an air puff tonometer that measures the corneal response to a steady air pulse .
it makes two applanation measurements : a force - in applanation which has been attributed to the dampening effects of the cornea and a force - out applanation that occurs at a lower pressure than the first .
the difference between the two pressures is ch and indicates viscous properties of the cornea , while crf shows the elastic properties of the cornea .
therefore , these parameters may affect intraocular pressure ( iop ) measurements more than cct alone .
the instrument also reports goldman - correlated iop ( iopg ) and its corneal - compensated counterpart ( iopcc ) .
ora parameters including ch , crf , iopg , and iopcc , as well as cct , and spherical equivalent refractive error were considered for analysis .
refractive errors of 1 to 1 d were considered as emmetropia . to obtain a power of 0.8 and = 0.05 , sample size of 36 cases
in addition , to compare data , we used one way analysis of variance ( anova ) .
to obtain a power of 0.8 and = 0.05 , sample size of 36 cases was calculated for each age decade .
pearson correlation coefficient and partial correlation were used in analyses . in addition , to compare data , we used one way analysis of variance ( anova ) .
overall , 302 healthy individuals were enrolled in the study . table 1 shows demographic data and participants ' characteristics .
ch and crf were significantly different among the age groups ( p < 0.001 , anova ) .
group 1 ( 1019 years old ) showed significantly higher ch and crf compared to all other age groups ( p < 0.001 ) while other groups were not significantly different from each other ( all p values > 0.05 , tukey test ) ( table 1 , fig . 1 ) .
ch and crf were highly correlated ( p < 0.001 , r = 0.821 ) .
age showed a significant negative correlation with ch ( p < 0.001 , r = 0.353 ) and crf
female gender had significantly higher ch ( 11.35 vs 10.85 , p = 0.017 ) and crf ( 10.9 vs 10.4 , p = 0.019 , independent t - test ) .
after adjustment for gender , cct , iop , and refractive error , age remained significantly correlated with ch and crf ( p < 0.001 for both , r = 0.398 and r = 0.372 , respectively ) .
cct showed a biphasic pattern in which groups 1 , 5 , and 6 had significantly higher ccts compared to other groups ( table 1 , fig . 2 ) .
ch and crf showed significant positive correlation with cct ( p < 0.001 for both , r = 0.21 and r = 0.26 , respectively ) .
iopcc was significantly higher in group 4 compared to group 1 ( p = 0.045 ) .
iopg was significantly higher in group 1 ( compared to groups 2 and 3 , p = 0.007 ) and group 4 ( compared to group 3 , p = 0.007 ) .
iopg and iopcc were significantly correlated ( p < 0.001 , r = 0.845 ) and were not significantly different ( p = 0.148 ) .
iopg ( but not iopcc ) was significantly correlated with cct ( p = 0.001 , r = 0.193 ) and crf ( p < 0.001 , r = 0.598 ) , while iopcc was negatively correlated with ch ( p < 0.001 , r = 0.474 ) .
( p = 0.055 , anova ) ch and crf showed a significant positive correlation with refractive error ( p = 0.001 , r = 0.187 and p = 0.007 , r = 0.157 , respectively , fig . 3 ) .
ch and crf were significantly higher in hyperopes compared to emmetropes and myopes ( table 2 ) .
this study showed a significant decrease in corneal response parameters ch and crf measured with the ora with age .
corneal properties including thickness , hydration , elasticity , viscosity , and possibly other unrevealed factors can affect corneal behavior during iop measurements and after refractive surgery .
corneal viscoelastic properties are provided by collagen fibers , and glycosaminoglycans and proteoglycans forming the ground substance .
abnormal corneal viscoelastic properties are seen in keratoconus and post laser keratectasia.2 , 15 aging induces structural changes in the cornea including an increase in collagen fiber diameter as a result of an increase in the number of collagen molecules in collagen fibrils and expansion of intermolecular space due to glycation - induced cross - linking .
ex vivo studies have shown significant stiffening of the human cornea with age.6 , 7 , 8 , 9 this has been attributed to non - enzymatic cross - linking of the stromal collagen fibrils . however , the relationship between corneal stiffening and age is not linear,6 , 7 and the stiffness increases by a factor of approximately two between the ages of 20 and 100 years .
for example , keratoconus is a disease of youth , the incidence of which decreases with age .
additionally , youth is a risk factor for both post laser keratectasia and keratoconus progression.22 , 23 based on the above - mentioned evidence , an increase in corneal stiffening with in vivo measurements is expected as well . in vivo measurement of corneal biomechanics has been possible since 2005 with ora , and for years it was the only commercially available instrument .
ora has shown lower ch and crf in keratoconus and fuchs endothelial dystrophy as expected.2 , 15 however , the results of studies on age - related changes in corneal biomechanics are not consistent .
some studies on children have shown no correlation between age and ch11 , 12 or crf with similar or slightly higher ch and crf values in children compared to adult studies .
on the other hand , several studies have reported a decrease in ch and crf with age.15 , 16 , 17 , 18 , 19 , 24 ortiz et al in a study on 165 normal eyes showed significantly lower ch in the age group 6080 years compared to age group 914 years .
kotecha et al reported an iop - independent biomechanical property of the cornea ( corneal constant factor ; ccf ) that increased with thicker cct and decreased with greater age .
their study group consisted of 105 ocular hypertensives and normal individuals with a mean age of 60 years .
some of these studies suffer from a small sample size , limited age range , and mixed study population . in another study on 204 normal eyes with a mean age of 46.7 years ( range : 1989 years ) , a significant decrease in ch and crf
we observed significantly higher ch and crf in the younger age group and a significant negative correlation with age .
the measured values were similar to those reported elsewhere.10 , 11 , 12 most studies evaluating the effect of cct on corneal viscoelastic properties have reported a positive correlation between cct and ch,10 , 11 , 13 , 14 , 16 , 19 , 24 or crf.10 , 11 , 14 , 19 , 24 in the present study , cct showed a biphasic pattern with higher values in the young and elderly and had significant correlation with ch and crf . in group 1 , higher ch and crf are in agreement with higher cct . however , considering structural changes in the elderly , lower ch and higher cct can be explained by changes in ecm and corneal hydration by aging as the elderly have poorer corneal hydration control compared to the young .
thus , while the increase in collagen cross - linking causes corneal stiffening , increased water content of the cornea causes a reduction in ch and crf .
clinically , it is possible to postulate that low ch accompanied by low cct is attributed to collagen weakness like keratoconus , while low ch with high cct is more likely the result of ground substance changes such as hydration
measuring corneal biomechanics by a new ultra - high - speed scheimpflug camera ( oculus corvis st , scheimpflug technology ; wetzlar , germany ) has shown significant corneal stiffening by age manifested in an increase in highest concavity time ( i.e. time from starting until highest concavity is reached ) .
several studies have shown that a negative correlation exists between ch and iop.10 , 11 , 13 , 19 in our study , we observed a significant negative correlation between iopcc and ch , and a significant positive correlation between iopg and crf .
although we observed a significantly higher iopcc in age group 4 compared to group 1 , the difference does not seem to be clinically important .
it has been reported that ch is significantly lower in high myopes14 , 24 , 27 and higher in hyperopes compared to normal individuals .
we observed significantly higher ch and crf in hyperopes compared to myopes and emmetropes as well .
however , by excluding high astigmatism we tried to overcome this limitation . additionally , axial length is correlated with refractive error which was included in the study .
some strengths of our study are the large sample size and that we enrolled individuals with a wide range of age , without previous surgery , ocular pathology or systemic disease , and evaluated corneal viscoelastic changes in 6 decades . in conclusion ,
age - related decrease in ch and crf may be due to increased corneal hydration with age .
iopcc is not correlated to cct and may be a better indicator of real iop . | purposeto determine age - related changes in corneal viscoelastic properties in healthy individuals.methodsthis observational cross - sectional study was performed at the department of ophthalmology , imam khomeini hospital , ahvaz , iran and included 302 healthy individuals in 6 age decades ( range : 1069 years ) . after complete ocular examination ,
corneal viscoelastic properties were measured by ocular response analyzer and central corneal thickness ( cct ) by an ultrasonic pachymeter .
our main outcome measures were corneal viscoelastic properties in different age groups.resultscorneal hysteresis ( ch ) and corneal resistance factor ( crf ) showed a significant negative correlation with age ( p < 0.001 for both , r = 0.353 and r = 0.246 , respectively ) .
female gender had significantly higher ch ( p = 0.017 ) and crf ( p = 0.019 ) .
ch and crf were significantly correlated ( p < 0.001 , r = 0.821 ) .
cct showed a biphasic pattern with significantly higher thicknesses before 20 and after 50 years of age .
ch and crf were significantly correlated with cct ( p < 0.001 for both , r = 0.21 and r = 0.26 , respectively ) and intraocular pressure ( iop ) ( p < 0.001 for both , r = 0.474 and r = 0.598 , respectively ) .
corneal - compensated iop ( iopcc ) was significantly higher after age 40 compared to age group < 20 ( p < 0.045 ) .
goldmann - correlated iop ( iopg ) was significantly correlated with cct ( p = 0.001 , r = 0.193 ) , while iopcc showed no correlation with cct ( p = 0.265 , r = 0.062 ) .
ch was significantly higher in hyperopic eyes compared to emmetropic eyes ( p = 0.009 ) and myopic eye ( p < 0.001).conclusionsin this study , there was a decrease in ch and crf with an increase in age .
hyperopia and female gender are associated with higher ch and crf .
cct is higher toward the extremes of life and is significantly correlated with ch and crf . | Introduction
Methods
Statistical analysis
Results
Discussion |
we report a case where incidental 18-fluorodeoxyglucose ( 18-fdg ) uptake in pituitary fossa was noted in positron emission tomography - computed tomography ( pet - ct ) , which on further investigations was found to be clinically occult follicle stimulating hormone ( fsh ) secreting pituitary macroadenoma .
a 73-year - old man , known case of hodgkin 's lymphoma , underwent 18-fdg pet - ct for post - chemotherapy evaluation of the disease status .
the scan revealed focal increased fdg uptake in pituitary fossa [ figure 1a and b ] .
the sagittal reformatted ct image [ figure 2a ] showed homogenously enhancing pituitary lesion causing expansion of the sella , and axial contrast ct image [ figure 2b ] showed mildly enhancing rounded lesion in the sella abutting the tuberculum and dorsum sella anteriorly and posteriorly .
( a and b ) fdg pet images showing focal increased fdg uptake in the pituitary fossa ( a and b ) ct images demonstrating mildly enhancing rounded lesion in the sella nuclear magnetic resonance ( nmr ) imaging of brain confirmed the presence of pituitary macroadenoma .
high - resolution , t1-weighted , contrast - enhanced , fat - suppressed sagittal image [ figure 3a ] showed the pituitary lesion , with expanded sella pushing the optic chiasma superiorly , and high - resolution , t1-weighted , contrast - enhanced , fat - suppressed axial image [ figure 3b ] showed homogenously enhancing sellar lesion abutting the cavernous segment of bilateral internal carotid arteries . hormonal assay of the patient showed raised fsh level of 18 iu / ml ( normal range for males up to 5 iu / ml ) .
fat - suppressed sagittal nmr image ( a ) showing pituitary lesion with expanded sella pushing the optic chiasma superiorly and high - resolution , t1-weighted , contrast - enhanced , fat - suppressed axial image ( b ) showing enhancing sellar lesion
a study revealed that the incidence of focally increased fdg uptake in pituitary is only 0.073% .
the mean suvmax calculated without correction for partial volume effect for macroadenomas is reported to be significantly higher than the suvmax for microadenomas .
pituitary adenomas are the most common cause of pituitary hormone hypersecretion and hyposecretion syndromes in adults .
isolated gonadotropin secreting pituitary adenoma with increased levels of circulating fsh , as in our case , is a very rare occurrence .
our case demonstrates the importance of further evaluations , including hormone assays and nmr imaging of the pituitary , to diagnose clinically occult pituitary adenoma when incidental increased pituitary fdg uptake is noted . | a 73-year - old man , known case of hodgkin 's lymphoma , underwent 18-fluorodeoxyglucose positron emission tomography - computed tomography ( 18-fdg pet - ct ) for post - chemotherapy evaluation of the disease status .
the scan revealed focal increased fdg uptake in pituitary fossa .
the ct images showed homogenously enhancing pituitary lesion causing expansion of the sella . a possibility for the presence of pituitary adenoma
was raised in the report .
hormonal assay of the patient showed raised follicle stimulating hormone ( fsh ) level of 18 iu / ml ( normal range for males up to 5 iu / ml ) .
all the other pituitary hormones were within the normal range .
nuclear magnetic resonance ( nmr ) imaging of brain showed a pituitary lesion with expanded sella pushing the optic chiasma superiorly .
nmr findings confirmed the presence of pituitary macroadenoma . a final diagnosis of fsh secreting pituitary macroadenoma was made . | INTRODUCTION
CASE REPORT
DISCUSSION |
despite decades of intensive research , cancer remains one of the most dangerous diseases in the developed world . in the united states alone ,
the incidence of various tumors and cancers is increasing at an alarming rate despite great achievements and decades of intensive , labor - consuming and expensive research . according to the national cancer institute estimates , slightly less than one - in - two men and a little more than one - in - three women in the u.s .
although some success in surgical removal of primary tumors has been achieved , it is difficult to terminate the spread of metastatic cancer or to predict which early stage cancers are potentially metastatic .
therefore , there has been an intense interest in methods for identifying patients with higher recurrence risk . among the many ,
procathepsin d ( pcd ) is one of the independent prognostic factors that has gained considerable attention in recent years[18 ] .
the first study showing increased levels of cathepsin d ( cd ; processed form of pcd ) in several human neoplastic tissues was reported in the mid - eighties .
subsequent clinical studies demonstrated a correlation between pcd / cd levels and tumor size , tumor grade , tumor aggressiveness , incidence of metastasis , prognosis and a degree of chemoresistance in a variety of solid tumors[1214 ] .
various studies employing several different approaches such as immunohistochemistry , in situ hybridization , cytosolic assay , northern and western blot analyses indicated that in most breast cancer tumors , pcd was overexpressed at least 2-to-50 fold .
the mitogenic effect of secreted pcd on breast cancer cells was first demonstrated by vignon et al .. subsequent additional studies showed that secreted pcd functioned as an autocrine growth factor in breast , prostrate , ovarian and lung cancer cells .
in contrast , decreased expression of pcd by antisense gene transfer , rna interference or ribozymesresulted in decreased growth of breast cancer cells in vitro and in vivo .
consistent with this , tumor growth was also inhibited by utilization of anti - pcd antibodies in vivo and in vitro .
in addition to this autocrine mitogenic effect , pcd is also implicated in paracrine communication with surrounding cells .
berchem 's group demonstrated that pcd not only stimulated parent cancer cell proliferation but also tumor angiogenesis by a paracrine mechanism .
. showed that pcd secreted from cancer cells possibly stimulated proliferation , survival , motility and invasive potential of surrounding fibroblasts by activation of the ras - mapk pathway indicating pcd 's role in paracrine communication . supporting these data
, we demonstrated substantial secretion of cytokines especially il-4 , il-8 , il-10 , il-13 and mip-1b from both cancer cell lines and fibroblasts after addition of pcd which promoted the growth of both cell types .
direct association of secreted pcd with cancer invasion and metastasis has also been demonstrated by independent studies .
the first direct role of pcd in cancer metastasis was demonstrated in rat tumor cells where over - expressed pcd increased the metastatic potential of these cells .
alternatively , downregulation of pcd expression by antisense gene inhibited lung metastasis of breast cancer cells but had no effect on invasion in vitro .
however , tedone et al . showed that downregulation of pcd expression resulted in decreased invasion of mcf-7 cells in vitro .
in addition , sivaparvathi et al . observed that anti - cd antibodies inhibited glioblastoma cell invasion through matrigel .
consistent with this data , our studies with decreased pcd secretion from breast and lung cancer cells directly influenced their ability to cross the matrigel membrane in vitro and in vivo .
berchem et al demonstrated that secreted pcd stimulated tumor angiogenesis in tumor xenograft in athymice nude mice . supporting this , we recently observed several regulators of angiogenesis being differentially expressed in breast cancer cells treated with the activation peptide of pcd .
these studies strongly suggest that pcd may also be involved in angiogenesis during cancer progression . since the control of angiogenesis is a balance between positive and negative angiogenic factors , additional experiments are required to define the exact role of pcd in angiogenesis . supporting the diverse functions of pcd in cancer progression , microarray analysis of activation peptide ( ap ) treated breast cancer cells showed differential expression of genes involved in cell cycle progression , cell survival , cell adhesion , angiogenesis , invasion and metastasis .
in contrast , decreased expression of these genes in response to ablated pcd using rna interference further confirmed the role of pcd in cancer progression . despite extensive documentation regarding pcd 's role in cancer progression ,
independent studies have shown that the secreted pcd binds to the surface of the breast cancer cells through a receptor with possible downstream signalling . based on these observations , we proposed a model for the mechanism of pcd action in which overexpressed pcd escapes its normal targeting pathway and is secreted from the cancer cells .
the secreted pcd interacts via its activation peptide to an unidentified cell surface receptor present on its surrounding cells .
this interaction releases a signal resulting in differential expression of cancer promoting genes that includes various cytokines that stimulate tumor growth .
collectively , these studies not only define pcd as a tumor marker of cancer progression but also underlie pcd as a potential target for cancer therapy if selective inhibition of pcd interaction with a cellular receptor could be achieved .
current diagnostic assays for cancers are antigen - based and rely on the detection of circulating proteins that are associated within a particular cancer . these assays are based on the expression , synthesis and release of specific proteins by tumor cells either by active secretion or shedding or as a consequence of cell death ( either by necrosis , apoptosis , or autophagy ) .
regardless , these antigenic proteins must escape the primary site of disease , saturate the antigen - processing capacity of the individual 's immune components , gain access to the circulation , and reach a sufficient steady - state concentration to be detected by enzyme- or radiolabel - based immunoassays .
thus , despite the fact that certain specific antigenic epitopes exhibit common recognition sites among patients with the same tumor types , the use of these antigen - based cancer assays has not been widely accepted into clinical practice and many individual countries differ in the use of these potential diagnostic factors .
research performed in both our laboratory and others has demonstrated the presence of anti - pcd autoantibodies .
as these antibodies are specific to pcd only and do not recognize mature cd , they represent an ideal target for comparison of the pcd presence and cancer progression .
as pcd / cd is supposed to be contained inside the cells , it is possible that the body will react to their presence by formation of specific autoantibodies .
subsequently , their level might correlate with the stage of breast , lung and prostate cancer , corresponding with the increased number of pcd - releasing cancer cells and thus offer a cost - effective , non - invasive screening test . as the release of pcd was observed in numerous cancer types[1521 ] , one can assume that the specific autoantibodies will also be formed in additional types of cancer . in our preliminary experiments
, we found the elevated levels of anti - pcd autoantibodies in lung , prostate and stomach cancer .
we assume that the amount of the appcd / pcd in the patient 's serum will change with the progress of the cancer disease , in correlation with the increased number of pcd - releasing cancer cells .
since the levels of autoantibodies corresponded with stages of breast cancer , it is clear that there is a high clinical potential in evaluation of specific anti - pcd autoantibodies as biological marker .
in past decades , more and more interest was focused on the possible additional roles of pcd 's .
independent studies showed the potential role of pcd in wound healing , tissue remodeling and programmed cell death - apoptosis .
epidermis is the barrier between the body and external environment which is constantly exposed to various forms of environmental and physical stresses .
keratinocytes are the basic elemental cells that form the epidermis and play a critical role in normal regeneration and healing processes .
skin healing is dependent upon several processes that involve inflammation , protein synthesis , matrix deposition , migration and subsequent proliferation of keratinocytes .
numerous proteins that include proteolytic enzymes such as matrix metalloproteinases , interstitial collagenase and cathepsin b are secreted from keratinocytes . during the wound healing process
, these proteolytic enzymes may play a role in motility of keratinocytes by remodeling of extracellular matrix for migration of keratinocytes to peripheral layers of epidermis .
indeed , the study conducted by katz and taichmann , focusing on the proteins secreted by cultured human epidermal keratinocytes , showed cd being one of the secreted proteins . in skin , increased levels of the mature form of cd was shown in basal keratinocytes during hyperproliferative skin disorders such as psoriasis .
in addition , the involvement of different isoforms of cd in the epidermal cell differentiation was suggested .
the presence of pcd was shown in the spinous layer and the active forms were present in stratum corneum , where they played a role in epidermal desquamation .
although the role of cd in epidermal differentiation has been defined , the presence of pcd at different stages of differentiation is still unclear .
moreover , most of these studies were performed using cell lysates where all the isoforms are present , thus making clear distinction of the roles played by individual isoforms virtually impossible . to better define the role of pcd in differentiation , our recent study demonstrated active secretion of pcd by human keratinocytes cell line hacat .
subsequent experiments showed that exogenous addition of purified pcd enhanced the proliferation of hacat cells .
this proliferative effect of pcd was inhibited by monoclonal antibody against the activation peptide of pcd . supporting this , treatment of hacat cells with pcd or
its activation peptide resulted in the secretion of a set of cytokines that promoted the growth of cells in a paracrine manner .
the role of secreted pcd and its mechanism of action were further studied in a scratch wound model . while the presence of pcd and its activation peptide enhanced the regeneration of monolayer , this effect was reversed by the addition of anti - ap antibody .
finally , expression and secretion of pcd was upregulated in hacat cells exposed to various stress conditions .
taken together , our results strongly suggest that the secretion of pcd is not only linked to cancer cells but also plays an essential role in the normal physiological conditions such as wound healing and tissue remodeling .
while many functions of pcd in the physiological and pathological processes could be attributed to its enzymatic activity , this review clearly establishes that some of the functions of pcd are independent of its protease activity and rely on the ability of pcd to interact with other important molecules .
therefore , it seems inevitable that searching for pcd - interacting partners should be conducted to explore the mechanism of pcd actions . | procathepsin d is a major glycoprotein that is secreted from numerous types of cancer cells including breast , lung and prostrate carcinomas .
it affects multiple stages of tumorigenesis that include proliferation , invasion , metastasis and apoptosis .
previous studies showed that the mitogenic effect of procathepsin d on cancer cells was mediated through its propeptide or activation peptide .
recent studies have also implicated the possible use of procathepsin d / activation peptide as a marker of cancer progression .
considering the broad range of functions of procathepsin d , the present review summarizes the three major potentials of procathepsin d - cancer progression , tumor marker and wound healing . | Procathepsin D in Cancer Progression
Procathepsin D as a Tumor Marker
Procathepsin D in Wound Healing
Conclusion |
this study was approved by the sheba medical center and maccabi healthcare services ( mhs ) institutional review board committees .
this study consists of elderly ( 65 years of age ) type 2 diabetic subjects who are engaged in the idcd , a longitudinal investigation assessing the relationship of long - term type 2 diabetes characteristics and cognitive decline .
longitudinal follow - up began recently , so the present results are based on baseline data only .
subjects were randomly selected from the 11,000 type 2 diabetic individuals that are in the diabetes registry of mhs .
the mhs diabetes registry is an integral part of the mhs electronic patient record system and was established in 1999 to facilitate disease management and to improve treatment .
entry criteria to the registry are any of the following : 1 ) hba1c > 7.25% , 2 ) glucose > 200 mg / dl on two exams > 3 months apart , 3 ) purchase of diabetic medication twice within 3 months supported by an hba1c > 6.5% or glucose > 125 mg / dl within half a year , or 4 ) diagnosis of type 2 diabetes ( icd-9 code ) by a general practitioner , internist , endocrinologist , ophthalmologist , or type 2 diabetes advisor , supported by a hba1c > 6.5% or glucose > 125 mg / dl within half a year .
these criteria have been validated by 20 physicians in mhs against their own practice records ( 20 ) .
additionally , age - specific prevalence rates were similar to those of a diabetes registry of another large hmo in israel ( 21 ) .
the diabetes registry has collected detailed laboratory , medication , and diagnosis information since 1998 ( 20 ) .
subjects are eligible for the study if they are listed in the mhs diabetes registry , live in the central area of israel , are diagnosed as suffering from type 2 diabetes , are 65 years of age or above , are diagnosed as cognitively normal at baseline ( based on a multidisciplinary weekly consensus conference ) , do not suffer from major medical , psychiatric , or neurological conditions that affect cognitive performance , have three or more hba1c measurements in the diabetes registry , and speak hebrew fluently and have contact with an informant for at least 10 h per week .
the latter criterion was implemented to ensure obtaining of data regarding the existence of functional impairments secondary to cognitive changes as well as information on changes in behavior , both of which are important for diagnosis of cognitive status , especially in cases that are on the border between normal cognition and mci or early dementia .
the mhs team performs a thorough screening of the diabetes registry and the mhs electronic patient record in order to identify potential subjects , excluding anyone with an icd code for dementia or its subtypes , treated with prescribed cholinesterase inhibitors , or with a major psychiatric or neurological condition ( such as schizophrenia or parkinson disease ) that could affect cognitive performance ( fig .
letters are sent by mhs to the primary care physicians , asking for permission to contact each patient regarding the study .
if the doctors agree , letters are sent to the subjects briefly describing the study and saying that they will be contacted by phone in the following 2-week period .
then the mhs team calls the subjects and asks for their participation after determining that they are fluent in hebrew and have a family member or caregiver whom they see at least 10 h per week who is willing to be an informant for the study .
subjects who are willing to participate in the study are assessed at their residence ( or they come to the sheba medical center memory clinic , according to their preference ) in two phases .
first , the subject is visited by a study physician who , after the subject signs the informed consent form , performs medical , neurological , geriatric , and nutritional assessments ( food frequency questionnaire ) and draws blood for inflammatory markers ( il-6 and crp ) and hp and apolipoprotein e ( apoe ) genotypes . in the second phase ( optimally 2 weeks after the physician visit ) , the subject is visited by a neuropsychologist who administers a cognitive battery ( described below ) and questionnaires to the subject and informant for cognitive and functional impairment and for depression and behavioral disturbances characteristic of dementia .
all subject cognitive data are discussed by a multidisciplinary consensus conference team in order to define the subject s cognitive status ( as cognitively normal , mci , or dementia and their subtypes ) .
if the subject is cognitively normal at baseline , the idcd has follow - up interviews at 18-month intervals .
subjects who are diagnosed as mci at baseline are not included in the study ; however , subjects who convert from cognitive normal status to mci during follow - up continue their participation in the study until conversion to dementia .
the clinical dementia rating scale assesses , through an interview with the subject and an informant , the severity of cognitive and functional impairment in six domains : memory , orientation , judgment and problem solving , community affairs , home and hobbies , and personal care ( 22 ) .
the mini - mental state exam ( mmse ) is a 30-item questionnaire assessing orientation , concentration , memory , and language ( 23 ) .
factor analysis revealed four cognitive domains , which were then scored as totals of z scores : episodic memory factor ( included word list immediate and delayed recall and recognition from the consortium to establish a registry for alzheimer 's disease [ cerad ] neuropsychological battery ) ( 24 ) , semantic categorization factor ( 25 ) ( included the letter and category fluency and similarities ) , attention / working memory factor ( included the diamond cancellation and digit span forward and backward tests ) ( 28 ) , and an executive factor ( included the trail making test , parts a and b and the digit symbol test ) .
finally , we computed an overall measure summing the scores of all four domains ( overall cognitive score ) .
immediately after the bloods were drawn into an edta - containing vacutainer tube , the tubes were placed in an ice box until handling at sheba medical center . within up to 6 h from phlebotomy ( as recommended ) , the bloods were centrifuged and serum was stored at 70c until determination .
hp typing was performed on stored plasma samples by polyacrylamide gel electrophoresis as previously described ( 30 ) . in brief , 10 l of hb - enriched plasma was subjected to electrophoresis in a nondenaturing gel , and the gel was subsequently immersed in solution containing a congener of benzidine with a precipitate forming in the gel corresponding to the location of hb - hp complexes .
the hp type of the sample was determined by the banding pattern of the hp - hb complexes with each of the three hp types having a characteristic banding fingerprint .
previous work established a 1:1 correspondence between this method and a pcr - based method for hp genotyping ( 30 ) .
the sociodemographic covariates were age at the time of cognitive assessment , years of education , sex , and number of follow - up years in the registry .
the cardiovascular covariates were bmi , creatinine , total cholesterol , triglycerides , diastolic and systolic blood pressure , and hba1c .
for the cardiovascular covariates , we used the average of all the subject s measurements available in the mhs diabetes registry .
microalbumin levels in the urine were used to reflect microvascular disease , whereas diagnosis of mi was used to reflect macrovascular disease .
our a priori hypothesis was that hp 1 - 1 would have lower cognitive performance ; we therefore compared this group to each of the other two genotypes ( hp 1 - 2 and hp 2 - 2 ) .
for each of the five cognitive measures separately , ancova compared hp 1 - 1 to hp 1 - 2 and hp 1 - 1 to hp 2 - 2 , controlling for demographic factors ( age , years of education , sex , and number of follow - up years in the registry ) and cardiovascular factors ( bmi , creatinine , total cholesterol , triglycerides , diastolic and systolic blood pressure , and hba1c ) .
this study consists of elderly ( 65 years of age ) type 2 diabetic subjects who are engaged in the idcd , a longitudinal investigation assessing the relationship of long - term type 2 diabetes characteristics and cognitive decline .
longitudinal follow - up began recently , so the present results are based on baseline data only .
subjects were randomly selected from the 11,000 type 2 diabetic individuals that are in the diabetes registry of mhs .
the mhs diabetes registry is an integral part of the mhs electronic patient record system and was established in 1999 to facilitate disease management and to improve treatment .
entry criteria to the registry are any of the following : 1 ) hba1c > 7.25% , 2 ) glucose > 200 mg / dl on two exams > 3 months apart , 3 ) purchase of diabetic medication twice within 3 months supported by an hba1c > 6.5% or glucose > 125 mg / dl within half a year , or 4 ) diagnosis of type 2 diabetes ( icd-9 code ) by a general practitioner , internist , endocrinologist , ophthalmologist , or type 2 diabetes advisor , supported by a hba1c > 6.5% or glucose > 125 mg / dl within half a year .
these criteria have been validated by 20 physicians in mhs against their own practice records ( 20 ) .
additionally , age - specific prevalence rates were similar to those of a diabetes registry of another large hmo in israel ( 21 ) .
the diabetes registry has collected detailed laboratory , medication , and diagnosis information since 1998 ( 20 ) .
subjects are eligible for the study if they are listed in the mhs diabetes registry , live in the central area of israel , are diagnosed as suffering from type 2 diabetes , are 65 years of age or above , are diagnosed as cognitively normal at baseline ( based on a multidisciplinary weekly consensus conference ) , do not suffer from major medical , psychiatric , or neurological conditions that affect cognitive performance , have three or more hba1c measurements in the diabetes registry , and speak hebrew fluently and have contact with an informant for at least 10 h per week .
the latter criterion was implemented to ensure obtaining of data regarding the existence of functional impairments secondary to cognitive changes as well as information on changes in behavior , both of which are important for diagnosis of cognitive status , especially in cases that are on the border between normal cognition and mci or early dementia .
the mhs team performs a thorough screening of the diabetes registry and the mhs electronic patient record in order to identify potential subjects , excluding anyone with an icd code for dementia or its subtypes , treated with prescribed cholinesterase inhibitors , or with a major psychiatric or neurological condition ( such as schizophrenia or parkinson disease ) that could affect cognitive performance ( fig .
letters are sent by mhs to the primary care physicians , asking for permission to contact each patient regarding the study .
if the doctors agree , letters are sent to the subjects briefly describing the study and saying that they will be contacted by phone in the following 2-week period .
then the mhs team calls the subjects and asks for their participation after determining that they are fluent in hebrew and have a family member or caregiver whom they see at least 10 h per week who is willing to be an informant for the study .
subjects who are willing to participate in the study are assessed at their residence ( or they come to the sheba medical center memory clinic , according to their preference ) in two phases .
first , the subject is visited by a study physician who , after the subject signs the informed consent form , performs medical , neurological , geriatric , and nutritional assessments ( food frequency questionnaire ) and draws blood for inflammatory markers ( il-6 and crp ) and hp and apolipoprotein e ( apoe ) genotypes . in the second phase ( optimally 2 weeks after the physician visit ) , the subject is visited by a neuropsychologist who administers a cognitive battery ( described below ) and questionnaires to the subject and informant for cognitive and functional impairment and for depression and behavioral disturbances characteristic of dementia .
all subject cognitive data are discussed by a multidisciplinary consensus conference team in order to define the subject s cognitive status ( as cognitively normal , mci , or dementia and their subtypes ) .
if the subject is cognitively normal at baseline , the idcd has follow - up interviews at 18-month intervals .
subjects who are diagnosed as mci at baseline are not included in the study ; however , subjects who convert from cognitive normal status to mci during follow - up continue their participation in the study until conversion to dementia .
the clinical dementia rating scale assesses , through an interview with the subject and an informant , the severity of cognitive and functional impairment in six domains : memory , orientation , judgment and problem solving , community affairs , home and hobbies , and personal care ( 22 ) .
the mini - mental state exam ( mmse ) is a 30-item questionnaire assessing orientation , concentration , memory , and language ( 23 ) .
factor analysis revealed four cognitive domains , which were then scored as totals of z scores : episodic memory factor ( included word list immediate and delayed recall and recognition from the consortium to establish a registry for alzheimer 's disease [ cerad ] neuropsychological battery ) ( 24 ) , semantic categorization factor ( 25 ) ( included the letter and category fluency and similarities ) , attention / working memory factor ( included the diamond cancellation and digit span forward and backward tests ) ( 28 ) , and an executive factor ( included the trail making test , parts a and b and the digit symbol test ) .
finally , we computed an overall measure summing the scores of all four domains ( overall cognitive score ) .
the clinical dementia rating scale assesses , through an interview with the subject and an informant , the severity of cognitive and functional impairment in six domains : memory , orientation , judgment and problem solving , community affairs , home and hobbies , and personal care ( 22 ) .
the mini - mental state exam ( mmse ) is a 30-item questionnaire assessing orientation , concentration , memory , and language ( 23 ) .
factor analysis revealed four cognitive domains , which were then scored as totals of z scores : episodic memory factor ( included word list immediate and delayed recall and recognition from the consortium to establish a registry for alzheimer 's disease [ cerad ] neuropsychological battery ) ( 24 ) , semantic categorization factor ( 25 ) ( included the letter and category fluency and similarities ) , attention / working memory factor ( included the diamond cancellation and digit span forward and backward tests ) ( 28 ) , and an executive factor ( included the trail making test , parts a and b and the digit symbol test ) .
finally , we computed an overall measure summing the scores of all four domains ( overall cognitive score ) .
blood samples for hp typing were taken during the physician assessment . immediately after the bloods were drawn into an edta - containing vacutainer tube , the tubes were placed in an ice box until handling at sheba medical center . within up to 6 h from phlebotomy ( as recommended ) , the bloods were centrifuged and serum was stored at 70c until determination .
hp typing was performed on stored plasma samples by polyacrylamide gel electrophoresis as previously described ( 30 ) . in brief , 10 l of hb - enriched plasma was subjected to electrophoresis in a nondenaturing gel , and the gel was subsequently immersed in solution containing a congener of benzidine with a precipitate forming in the gel corresponding to the location of hb - hp complexes .
the hp type of the sample was determined by the banding pattern of the hp - hb complexes with each of the three hp types having a characteristic banding fingerprint .
previous work established a 1:1 correspondence between this method and a pcr - based method for hp genotyping ( 30 ) .
the sociodemographic covariates were age at the time of cognitive assessment , years of education , sex , and number of follow - up years in the registry .
the cardiovascular covariates were bmi , creatinine , total cholesterol , triglycerides , diastolic and systolic blood pressure , and hba1c . for the cardiovascular covariates
, we used the average of all the subject s measurements available in the mhs diabetes registry .
microalbumin levels in the urine were used to reflect microvascular disease , whereas diagnosis of mi was used to reflect macrovascular disease .
our a priori hypothesis was that hp 1 - 1 would have lower cognitive performance ; we therefore compared this group to each of the other two genotypes ( hp 1 - 2 and hp 2 - 2 ) .
for each of the five cognitive measures separately , ancova compared hp 1 - 1 to hp 1 - 2 and hp 1 - 1 to hp 2 - 2 , controlling for demographic factors ( age , years of education , sex , and number of follow - up years in the registry ) and cardiovascular factors ( bmi , creatinine , total cholesterol , triglycerides , diastolic and systolic blood pressure , and hba1c ) .
one thousand two hundred and eighty - eight subjects passed the preliminary screening , expressed consent to participate , were approached by a study physician , and signed informed consent .
of these 1,288 subjects , 282 ( 21.1% ) were excluded from the study due to incompatibility with eligibility criteria ( based on physician assessment ) , 109 ( 8.5% ) refused to continue their participation in the study , and 897 remained active participants .
the present analysis consists of 850 subjects who had an hp genotype available , 87 with hp 1 - 1 , 350 with hp 1 - 2 , and 413 with hp 2 - 2 . of these , 84 , 335 , and 393 , respectively , had full data on demographic , cardiovascular , and cognitive data to allow comparisons .
the entire sample 's average was 72.9 years of age ( sd 4.7 ) and 39% were women .
subjects were in the diabetes registry for 10.5 years ( sd 1.4 ) on average , and their mmse score was 28.0 ( sd 1.8 ) , consistent with a cognitively normal status in a sample with a broad education range .
the mean hba1c was 6.8% ( sd 0.8 ) , consistent with good diabetes control .
the three groups of hp genotypes did not differ significantly in any characteristic except for the mmse , for which the hp 1 - 1 had poorer performance ( p = 0.02 ) .
sample characteristics as depicted in table 2 , compared with hp 1 - 2 and hp 2 - 2 , cognitive function ( presented as z scores ) of hp 1 - 1 genotype was lower in all categories . compared with subjects with the hp 1 - 2 genotype , hp 1 - 1 subjects performed significantly worse in semantic categorization ( f = 7.03 ; p = 0.008 ) and overall cognition ( f = 5.57 ; p = 0.02 ) ( table 3 ) .
similarly , compared with subjects with hp 2 - 2 genotype , hp 1 - 1 subjects performed significantly worse in semantic categorization ( f = 4.18 ; p = 0.04 ) and overall cognition ( f = 4.70 ; p = 0.03 ) ( table 3 ) . means and sds of z scores of cognitive performance by cognitive domain and by hp genotype comparison of cognitive function in hp genotypes
since the results of the comparisons of hp 1 - 1 with each of the hp 2 carriers on cognitive functions were substantially similar ( tables 2 and 3 ) , and in order to minimize multiple comparisons , in a secondary analysis , examining the relationship of cardiovascular risk factors and cognition by hp genotype , we compared hp 1 - 1 to hp 2 carriers ( hp 1 - 2 and hp 2 - 2 ) .
for each of the cognitive domains and overall cognition , for hp 1 - 1 and hp 2 carrier groups separately , stepwise multiple regressions evaluated the collective association with the seven cardiovascular risk factors , controlling for the demographic predictors . since the sample sizes of hp 1 - 2 and hp 2 - 2 were at least eight times as large as the sample size for the hp 1 - 1 group , the difference in power makes p values inappropriate when comparing the usefulness of cardiovascular predictors to cognition in the two hp groups .
a conditional r showed the proportion of variation not explained by the demographic predictors that was explained by the cardiovascular predictors .
the distribution of each conditional r was approximately normal ( 31 ) , so a student t test ( for normal distributions with different sds ) was used to compare them . for descriptive purposes , anova and were used to compare the three hp groups to describe demographic and cardiovascular characteristics .
table 4 shows the conditional r ( the proportion of variation not explained by the demographic predictors that was explained by the cardiovascular predictors ) in the two groups . in the hp 1 - 1 group ,
the association of cardiovascular risk factors with cognition was significant for semantic categorization ( p = 0.008 ) , attention / working memory ( p = 0.002 ) , executive function ( p = 0.05 ) , and overall cognitive score ( p = 0.05 ) . in the hp 2 carrier group ,
the association of cardiovascular risk factors with cognition was significant for semantic categorization ( p = 0.03 ) , executive function ( p < 0.0005 ) , and the overall cognitive score ( p = 0.001 ) . compared with hp 2 carriers ,
the conditional r was significantly higher in subjects with hp 1 - 1 genotype for the semantic categorization ( p = 0.009 ) , attention / working memory ( p = 0.002 ) , and overall cognitive score ( 0.05 ) .
as depicted in table 2 , compared with hp 1 - 2 and hp 2 - 2 , cognitive function ( presented as z scores ) of hp 1 - 1 genotype was lower in all categories . compared with subjects with the hp 1 - 2 genotype , hp 1 - 1 subjects performed significantly worse in semantic categorization ( f = 7.03 ; p = 0.008 ) and overall cognition ( f = 5.57 ; p = 0.02 ) ( table 3 ) .
similarly , compared with subjects with hp 2 - 2 genotype , hp 1 - 1 subjects performed significantly worse in semantic categorization ( f = 4.18 ; p = 0.04 ) and overall cognition ( f = 4.70 ; p = 0.03 ) ( table 3 ) .
means and sds of z scores of cognitive performance by cognitive domain and by hp genotype comparison of cognitive function in hp genotypes since the results of the comparisons of hp 1 - 1 with each of the hp 2 carriers on cognitive functions were substantially similar ( tables 2 and 3 ) , and in order to minimize multiple comparisons , in a secondary analysis , examining the relationship of cardiovascular risk factors and cognition by hp genotype , we compared hp 1 - 1 to hp 2 carriers ( hp 1 - 2 and hp 2 - 2 ) . for each of the cognitive domains and overall cognition , for hp 1 - 1 and hp 2 carrier groups separately , stepwise multiple regressions evaluated the collective association with the seven cardiovascular risk factors , controlling for the demographic predictors . since the sample sizes of hp 1 - 2 and hp 2 - 2 were at least eight times as large as the sample size for the hp 1 - 1 group , the difference in power makes p values inappropriate when comparing the usefulness of cardiovascular predictors to cognition in the two hp groups .
a conditional r showed the proportion of variation not explained by the demographic predictors that was explained by the cardiovascular predictors .
the distribution of each conditional r was approximately normal ( 31 ) , so a student t test ( for normal distributions with different sds ) was used to compare them . for descriptive purposes , anova and were used to compare the three hp groups to describe demographic and cardiovascular characteristics .
table 4 shows the conditional r ( the proportion of variation not explained by the demographic predictors that was explained by the cardiovascular predictors ) in the two groups . in the hp 1 - 1 group ,
the association of cardiovascular risk factors with cognition was significant for semantic categorization ( p = 0.008 ) , attention / working memory ( p = 0.002 ) , executive function ( p = 0.05 ) , and overall cognitive score ( p = 0.05 ) . in the hp 2 carrier group ,
the association of cardiovascular risk factors with cognition was significant for semantic categorization ( p = 0.03 ) , executive function ( p < 0.0005 ) , and the overall cognitive score ( p = 0.001 ) . compared with hp 2 carriers ,
the conditional r was significantly higher in subjects with hp 1 - 1 genotype for the semantic categorization ( p = 0.009 ) , attention / working memory ( p = 0.002 ) , and overall cognitive score ( 0.05 ) .
first , compared with hp 2 carriers ( both hp 1 - 2 and hp 2 - 2 ) , subjects with hp 1 - 1 genotype performed significantly worse in the semantic categorization domain and the overall cognitive score ( reflecting lower performance in the summary of all cognitive domains ) .
second , in both hp 1 - 1 and the hp 2 carriers , cardiovascular risk factors were associated with cognition with significantly stronger associations in the hp 1 - 1 group for semantic categorization , attention / working memory , and overall cognition .
cardiovascular risk factors were not associated with the episodic memory domain in either group . to the best of our knowledge ,
this is the first study to report an association between hp type and cognition in type 2 diabetic subjects . in subjects with post - traumatic brain injury ,
a similar association was demonstrated , such that subjects with hp 1 - 1 genotype had lower scores on verbal iq and motor tests at 1 and 12 months after injury ( 32 ) .
previous studies have shown that hp 2 - 2 genotype is associated with a less favorable cardiovascular profile .
since the latter is associated with cognitive function ( 33 ) , hp 2 allele could be expected to be associated with lower cognitive performance .
however , the role of hp in vascular pathology may differ according to the vascular bed ( brain vs. periphery ) ; the frequency of hp 1 - 1 genotype was significantly higher and frequency of hp 2 allele was significantly lower in a cohort of subjects with first symptomatic lacunar stroke due to small vessel disease compared with their frequency in healthy controls ( 18 ) .
consistent with this finding , in hypertensive subjects with asymptomatic small vessel disease , hp 1 - 1 was associated with larger volumes of deep wmls when adjusting for age , sex , brain volume , 24-h mean arterial pressure , duration of hypertension , and previous antihypertensive treatment ( 19 ) .
lacunar strokes and wml have been consistently associated with compromised cognitive functioning ( 34 ) .
these studies are consistent with the present neuropsychological findings and may explain the different role of hp genotype in the brain compared with its role in the periphery .
several mechanisms have been suggested to underlie the pathogenesis of small vessel disease ( which includes wml and lacunar infarcts ) ( 35 ) in the brain of hp 1 - 1 carriers . among these
are endothelial damage , compromised ability to form new blood vessels , and ineffective functioning of the blood - brain barrier ( 18 ) .
these hypotheses are based on findings pointing to the association of hp 1 - 1 with decreased activity of epithelial progenitor cells , which are involved in endothelial repair ( 35 ) , a process that may attenuate the trajectories of damaged epithelium ( 35 ) .
in contrast , hp 2 - 2 has been demonstrated in vitro to be superior in the promotion of new blood vessel formation compared with other hp phenotypes ( 36 ) .
an alternative explanation for our findings is a possible interaction of hp genotype with hypertension , a risk factor for dementia by itself ( 37 ) .
though groups stratified by hp genotype did not differ in mean systolic or diastolic blood pressure values , the negative association between cardiovascular risk factors ( including blood pressure ) and cognition was consistently stronger in hp 1 - 1 compared with hp 2 carriers .
in line with our findings , higher levels of hp in hypertensive men were associated in a previous study with higher risk for stroke ( 38 ) and other sequelae of cardiovascular risk factors ( 39 ) .
these levels vary by genotype , with hp 1 - 1 values being highest ( 39 ) .
the interaction of hp genotype and cardiovascular risk factors was associated with lower cognitive performance in semantic categorization , attention / working memory , and overall cognitive score , with a similar trend for the executive function but not episodic memory domains .
these findings may suggest that in type 2 diabetic subjects , a vascular mechanism ( 34 ) is involved in cognition rather than a hippocampal - related mechanism , which manifests typically in episodic memory impairment ( 40 ) .
accordingly , the association of diabetes with performance for executive functions and overall cognition , but not episodic memory , has been demonstrated by some ( 41,42 ) , but not all ( 43 ) , previous studies .
this report is based on cross - sectional data ; thus , we can not rule out that the present results reflect an artifact of the selection of subjects .
hp 2 carriers , who tend to have more cvd ( 8,44 ) , might have had higher mortality , morbidity , or cognitive impairment that precluded their participation in the study .
some previous cross - sectional studies have also demonstrated higher prevalence of cvd in hp 1 - 1 carriers , but in longitudinal follow - up , hp 2 - 2 was consistently associated with more incident events ( 44 ) .
the longitudinal follow - up of this sample is essential to shed light on this potential limitation and the interpretation of the current results .
strengths of this study include the large sample , validated diabetes diagnosis for each subject , strong validity for risk factor levels and medical diagnosis , and thorough cognitive evaluation .
the main limitation of this study is lack of brain imaging , thus limiting our ability to distinguish the vascular contribution to the association of hp with cognition .
the hp phenotype is not available for subjects from the mhs diabetes registry who were excluded from the study , and the results reported here are cross - sectional ( 44 ) . an additional limitation is lack of measurement of crystallized intelligence , preventing the evaluation of the contribution of this factor to our results .
nevertheless , we did control for education , which is a major contributor to crystallized intelligence .
israel has a strong family - oriented culture , so a major role in grandparenting has been the primary reason of refusal of women to participate in the study .
subjects who do not have contact with a caregiver for 10 weekly hours were excluded to optimize diagnosis of cognitive status .
in summary , in our sample of subjects with type 2 diabetes , cognitive function is associated with hp genotype , being worse for hp 1 - 1 compared with hp 2 - 2 and hp 1 - 2 genotypes .
furthermore , cardiovascular risk factors are associated with cognitive function in different domains ( but not episodic memory ) in all genotypes , but more strongly in the hp 1 - 1 . | objectivehaptoglobin ( hp ) genotype ( hp 1 - 1 , 1 - 2 , or 2 - 2 ) is associated with risk for type 2 diabetes complications , but its relationship with cognitive compromise , a growing concern in type 2 diabetes , has rarely been studied .
this study investigated whether hp genotype is associated with cognitive function in cognitively normal elderly diabetic subjects.research design and methodsrelationships of hp genotype with episodic memory , semantic categorization , attention / working memory and executive function , and an overall cognitive score were examined in subjects from the israel diabetes and cognitive decline ( idcd ) study.resultsin the present analysis , 812 subjects participated ( 84 with hp 1 - 1 , 335 with hp 1 - 2 , and 393 with hp 2 - 2 genotypes ) .
average was 72.9 years of age ( sd 4.7 ) , and mini - mental state exam ( mmse ) was 28.0 ( sd 1.8 ) . compared with subjects with hp 1 - 2 genotype , hp 1 - 1 subjects performed significantly worse in semantic categorization ( f = 7.03 ; p = 0.008 ) and the overall cognitive score ( f = 5.57 ; p = 0.02 ) .
a separate stepwise multiple regression analysis demonstrated that compared with subjects with hp 2 - 2 genotype , hp 1 - 1 subjects performed significantly worse in semantic categorization ( f = 4.18 ; p = 0.04 ) and the overall cognitive score ( f = 4.70 ; p = 0.03 ) .
the contribution of cardiovascular risk factors to cognition was significantly higher in subjects with hp 1 - 1 genotype compared with hp 2 carriers ( hp 1 - 2 and hp 2 - 2 ) in the semantic categorization ( p = 0.009 ) and attention / working memory ( p = 0.002 ) cognitive domains.conclusionscompared with hp 2 carriers , those with hp 1 - 1 genotype present lower cognitive performance .
stronger relationships between cardiovascular risk factors and cognition in the latter group may suggest an underlying vascular mechanism . | RESEARCH DESIGN AND METHODS
Sample
Eligibility criteria for the study
Subject recruitment process
Cognitive assessment
The Clinical Dementia Rating scale.
Mini-Mental State Exam.
Outcome measures.
Diagnosis of MCI and dementia
Hp typing
Covariates
Additional data from the MHS diabetes registry
Statistical analyses
RESULTS
Cognitive function by Hp genotype
CONCLUSIONS |
mycotic keratitis is a severe problem in most of the developing countries whereas specific antifungal agents are expensive and commercially unavailable as ready compounds for topical ocular use .
it is endemic and this is favored by certain ecological factors that already exist in those communities .
other problems like difficulties in its clinical diagnosis , laboratory results , and treatment are also incriminated .
mycotic keratitis is an important cause of corneal morbidity , scarring , and blindness caused by fungal invasion through corneal epithelium .
the disease was found to be more common among agricultural communities than others . according to predisposing factors , clinical features , and response to treatment
, fungal corneal pathogens were divided into filamentous fungi , yeast , and yeast like and dimorphic fungi .
the most common filamentous fungi causing keratomycosis are aspergillus , fusarium , curvularia , alternaria , and cladosporium , while candida albicans is the most common form of yeasts [ 2 , 3 ] .
mycotic keratitis probably arises as a result of an interaction between different agent factors as invasive ability and toxicity of fungal strains and host factors due to local or systemic causes .
the invasiveness of fungal strains is aided by certain properties such as the capacity of fungus to adhere to the cells and to produce enzymes and toxins that destroy anatomical defenses [ 4 , 5 ] .
fungi especially filamentous species rarely infect healthy cornea spontaneously and are usually predisposed by trauma with vegetable or organic matter . on the other hand candida albicans is a common infection in compromised or immune - suppressed cornea [ 6 , 7 ] .
identification of pathogenic corneal fungi is performed either by microscopic stained corneal scrapes or by their cultural features .
other methods for fungus identification depend on the types of enzymes produced , immune diffusion , electrophoresis , and elisa .
the three major groups of antifungal agents are as follows : polyenes , as amphotericin b and nystatin , azoles , as itraconazole and fluconazole , pyrimidines , as flucytosine [ 11 , 12 ] .
polyenes , as amphotericin b and nystatin , azoles , as itraconazole and fluconazole , pyrimidines , as flucytosine [ 11 , 12 ] .
the study was conducted from the first of january 2011 to the end of december 2013 at the outpatient clinic of ophthalmology department in tanta university hospital .
a total number of 66303 patients with different ophthalmological complaints were examined during that period .
our target included those cases diagnosed clinically as fungal keratitis ; they were 361 cases during that period .
clinical diagnosis of mycotic keratitis was dependent on some clinical criteria including the following : thick area of keratitis , thick hypopyon coagulum with or without level , immune rings , satellite lesions , stromal infiltrate with feathery edge , healing usually with dense leucoma with large solitary blood vessel , area of epithelial defect usually smaller than stromal infiltration .
thick area of keratitis , thick hypopyon coagulum with or without level , stromal infiltrate with feathery edge , healing usually with dense leucoma with large solitary blood vessel , area of epithelial defect usually smaller than stromal infiltration .
the other group included all cases of nonmycotic keratitis who attended the clinic during the same period .
all cases of mycotic and nonmycotic keratitis were submitted to a complete ophthalmological examination by the slit lamp using direct oblique , scleral scatter , and retroillumination techniques .
a questionnaire sheet was designed and filled by the researchers for cases and control including the following .
( 1 ) biological and sociodemographic data : age , sex , occupation , family size , crowding index ( family members / number of rooms ) , residence , source of water whether indoor or outdoor , and sewage disposal whether pipes system or conservancy system . ( 2 )
history taking for the following : some risk factors such as recent drug intake ( prolonged antibiotics and local or systemic corticosteroids ) , corneal trauma whether organic or nonorganic , systemic diseases ( diabetes mellitus , tuberculosis , and cancer ) , ocular surgery , local eye diseases such as glaucoma , and the time of onset of complaints till examination .
( 3 ) laboratory investigations : all cases diagnosed clinically as fungal keratitis were subjected to the following : sampling : under surface anesthesia , the active edge and the bed of ulcer were scraped using platinum spatula or sterile surgical blade ( number 15 ) with the aid of slit lamp biomicroscopy or surgical microscope to ensure that adequate corneal material was obtained and to avoid corneal perforation .
so disposable calcium alginate cotton tipped sterile applicators were used for those cases.isolation media : sabouraud dextrose agar was prepared with 0.05% chloramphenicol , autoclaved , and spread on sterile petri plates .
plates were incubated at room temperature ; fungal growth was identified and then sensitivity tests were carried out in vitro by using different antifungal agents . according to the results of sensitivity tests , the appropriate antifungal agent was used as topical drops , subconjunctival injection , and intracameral wash and even systemically if needed depending on the severity of the case .
sampling : under surface anesthesia , the active edge and the bed of ulcer were scraped using platinum spatula or sterile surgical blade ( number 15 ) with the aid of slit lamp biomicroscopy or surgical microscope to ensure that adequate corneal material was obtained and to avoid corneal perforation .
isolation media : sabouraud dextrose agar was prepared with 0.05% chloramphenicol , autoclaved , and spread on sterile petri plates .
plates were incubated at room temperature ; fungal growth was identified and then sensitivity tests were carried out in vitro by using different antifungal agents . according to the results of sensitivity tests , the appropriate antifungal agent was used as topical drops , subconjunctival injection , and intracameral wash and even systemically if needed depending on the severity of the case .
the treatment regimen used for all cases was as follows : amphotericin b ( 2 mg / ml ) ( fungizone ; bristol - myers squibb ) was used topically till the results of culture appeared;when the culture results appeared , the appropriate antifungal agent was used;the antifungal drugs prescribed included amphotericin b 0.15% ( fungizone ; bristol - myers squibb ) prepared as fortified drops , fluconazole 0.2% ( diflucan ; pfizer ) taken directly in eye dropper from the vial , natamycin 5% ( natamet ; sun pharmaceutical industries ) , and itraconazole 1% ( itral ; jawa pharmaceuticals ) .
amphotericin b ( 2 mg / ml ) ( fungizone ; bristol - myers squibb ) was used topically till the results of culture appeared ; when the culture results appeared , the appropriate antifungal agent was used ; the antifungal drugs prescribed included amphotericin b 0.15% ( fungizone ; bristol - myers squibb ) prepared as fortified drops , fluconazole 0.2% ( diflucan ; pfizer ) taken directly in eye dropper from the vial , natamycin 5% ( natamet ; sun pharmaceutical industries ) , and itraconazole 1% ( itral ; jawa pharmaceuticals ) .
adjunctive therapy
atropine sulphate ( isopto atropine ; alcon ) eye drops , 3 times / day.gatifloxacin ( zimmer ; allergan ) eye drops , 5 times / day ,
weak corticosteroid drops of fluorometholone ( fml ; allergan ) twice daily added if there is immune ring or associated uveitis .
atropine sulphate ( isopto atropine ; alcon ) eye drops , 3 times / day .
gatifloxacin ( zimmer ; allergan ) eye drops , 5 times / day ,
weak corticosteroid drops of fluorometholone ( fml ; allergan ) twice daily added if there is immune ring or associated uveitis
.
weak corticosteroid drops of fluorometholone ( fml ; allergan ) twice daily added if there is immune ring or associated uveitis . for cases not responding to treatment within the first week
, a debridement of superficial corneal layers was done to enhance good penetration of antifungal therapy .
statistical presentation and analysis of the present study were conducted , using the mean , standard deviation , chi square , and t - test by spss v.20 .
a total number of 66303 patients attended the outpatient clinic of ophthalmology department in tanta university during the period in which the study was conducted .
our target was 361 patients with mycotic keratitis representing 0.54% of the total attendants , while those with nonmycotic keratitis accounted for 473 cases representing 0.71% of the total attendants of the clinic during that period .
the mean age for cases of mycotic keratitis was 49.18 2.28 years , while mean age for the nonmycotic group was 50.88 2.60 years .
table 1 shows that males in patients of mycotic keratitis were affected about twice more than females .
the same was found with the nonmycotic keratitis group ; they were 66.6% males and 33.4% females .
however the difference was statistically insignificant between mycotic and nonmycotic groups as regards the sex ( = 6.4 , p = 0.739).52.4% of cases of mycotic keratitis were at the age group of 4060 years while it was recorded that 51.4% of cases of nonmycotic keratitis were at the same age group .
the difference between mycotic and nonmycotic keratitis was statistically not significant regarding the different age groups ( = 6.21 , p = 0.258 ) .
the mean age for cases of mycotic keratitis was 49.18 2.28 years , while mean age for the nonmycotic group was 50.88 2.60 years .
table 1 shows that males in patients of mycotic keratitis were affected about twice more than females .
the same was found with the nonmycotic keratitis group ; they were 66.6% males and 33.4% females .
however the difference was statistically insignificant between mycotic and nonmycotic groups as regards the sex ( = 6.4 , p = 0.739 ) .
52.4% of cases of mycotic keratitis were at the age group of 4060 years while it was recorded that 51.4% of cases of nonmycotic keratitis were at the same age group .
the difference between mycotic and nonmycotic keratitis was statistically not significant regarding the different age groups ( = 6.21 , p = 0.258 ) .
as shown in table 2 farmers ( unskilled workers ) represented the majority of cases ( 68.4% ) in mycotic keratitis group while they represented only 50.3% in the nonmycotic keratitis group .
professionals and semiprofessionals represented only 2.2% of the mycotic group compared to 19.9% among the nonmycotic group .
housewives were more among the mycotic cases than the nonmycotic cases ; they were 20% and 13.3% , respectively .
the difference was statistically significant between cases of mycotic and nonmycotic keratitis as regards their occupations ( = 21.41 , p = 0.001 ) .
as shown in table 3 , more than one - third of cases of mycotic keratitis were of large family size ( > 6 persons ) compared to the nonmycotic group ( 38.2% and 20.3% ) , respectively , while the percentage of cases with small family size ( < 4 persons ) was less than the nonmycotic group ; they were 20% and 36.6% , respectively .
the difference was statistically significant ( = 10.67 , p = 0.004 ) .
table 3 showed that 67.3% of cases with mycotic keratitis lived in overcrowded houses with crowding index > 2 .
there was no significant statistical difference between mycotic and nonmycotic keratitis regarding the crowding index ( = 3.03 , p = 0.081 ) .
table 4 showed that in cases of mycotic keratitis , 64.3% were rural residents compared to 56.2% among the nonmycotic group .
the difference was statistically not significant between mycotic and nonmycotic groups ( = 1.55 , p = 0.212 ) .
as shown in table 4 , outdoor water supply represented about three - quarters ( 72.9% ) of the houses of mycotic cases and more than half of those of cases with nonmycotic keratitis ( 58.1% ) .
the difference was statistically significant ( = 4.95 , p = 0.025 ) .
table 4 showed that in cases of mycotic keratitis only 22.7% of patients had pipes system of sewage disposal in their houses compared to 45% in the houses of nonmycotic group with a significant statistical difference ( = 10.78 , p = 0.001 ) . from table 5 , it was found that among the mycotic group 61.5% of cases came within the first week from the onset of complaints while about a quarter ( 22.4% ) of cases came for ocular examination from 14 days up to 30 days .
in nonmycotic corneal ulcers the majority ( 85% ) came within the first week of complaints and no one came after 14 days .
the difference between the two groups was statistically significant as regards the different periods of time ( = 25.63 , p = 0.3 ) .
table 6 and figure 1 revealed that aspergillus species constituted the majority of cases with positive cultures : aspergillus flavus in 29.1% of cases and aspergillus niger in 16.1% , and the least frequent species was candida albicans ( 3% ) .
negative cultures occurred in 15.5% of cases in spite of their improvement with antifungal therapy and their typical clinical findings for diagnosis .
table 7 showed that trauma either organic or nonorganic was the most frequent risk factor for both of mycotic ( 58.4% ) and nonmycotic ( 75% ) groups .
organic ocular trauma was the most frequent risk factor in mycotic keratitis ( 38.2% ) while nonorganic trauma was the most risky for the nonmycotic group ( 45% ) .
other risk factors included ocular surgery which represented 32.7% of mycotic cases compared to 0% among nonmycotic group .
prolonged local antibiotics therapy was risky for 6.1% of mycotic keratitis compared to 0% among nonmycotic group .
systemic diseases represented the least frequent risk for mycotic keratitis ( 2.2% of the cases ) while it was 10.4% in nonmycotic keratitis .
all cases of mycotic keratitis that had a history of ocular surgery had a mild course of corticosteroid therapy except in 22 cases that had a prolonged heavy course .
among the mycotic keratitis cases , 127 cases ( 35.2% ) showed healing with faint nebulae , 193 cases ( 53.4% ) with dense vascularized leucoma , 23 cases with descemetocele ( 6.4% ) , and 10 cases ( 2.8% ) with perforation , and 8 cases ( 2.2% ) ended by endophthalmitis as shown in figure 2 .
corneal infections including fungal types are responsible for about 50% of corneal scarring in the developing world which is a significant cause of blindness .
mycotic keratitis is a growing health problem in the developing countries representing from one - third up to 56% of total ocular infections .
world health organization reported that about 10 million all over the world were blind due to corneal infections in its program for prevention of blindness ( global initiative vision by the year 2020 ) [ 13 , 14 ] . in the present study , about half the cases of mycotic keratitis were at the age group from 40 to 60 years , and males were about two times more affected than females .
these findings were close to that of baradkar and others in 2008 in their study in india whereas they concluded that fungal keratitis affected males three times more than females and were more frequent in the age group from 20 to 50 years .
males are more affected because of their outdoor activity and movement in the surrounding environment which expose them to different risks such as corneal trauma . there were no significant statistical differences between cases of mycotic keratitis and those of nonmycotic keratitis as regards the age groups ( = 6.21 , p = 0.258 ) and sex ( = 6.4 , p = 0.739 ) .
( i ) in this study , mycotic keratitis affected farmers ( unskilled workers ) more than other occupations in 68.4% of the cases followed by housewives in 20% .
these findings were consistent with moharram and his colleagues in 1999 in their study in assiut where 47% of cases of fungal keratitis were farmers and 20% were housewives .
farming was the main job for most of cases of fungal keratitis in other studies [ 11 , 1517 ] .
most of fungal species such as aspergillus , penicillium , mucorrhacimosis species , and cladosporium are soil fungi , so they contaminate vegetables and fruits .
farmers are usually exposed to trauma by organic matter ( such as dried rice stems or maize ) which facilitates invasion of the cornea by the fungi .
there was a significant statistical difference between cases of mycotic keratitis and the nonmycotic keratitis regarding their occupations ( = 21.41 , p = 0.001 ) .
farmers were more recorded among cases while professionals and semiprofessionals were more recorded among the control .
professionals might be exposed to some risk factors such as the nonorganic trauma but rarely exposed to organic trauma which is associated mostly with fungal contamination . in this study organic trauma
was the most risky factor for fungal keratitis while nonorganic trauma was the most risky for the control group and this might explain the former finding .
( ii ) this study reported that cases of mycotic keratitis belonged to large families ( 46 persons in 41.8% and more than 6 persons in 38.2% ) , with a high crowding index ( 67.3% of cases with crowding index > 2 ) , and about two - thirds ( in 64.3% ) of them were rural .
there was a statistically significant difference between mycotic and nonmycotic cases as regards their family size ( larger families among mycotic keratitis cases ) ( = 10.67 , p = 0.004 ) .
there were insignificant statistical differences between both groups regarding crowding index ( = 3.03 , p = 0.081 ) and rural residence ( = 1.55 , p = 0.212 ) .
however in both of mycotic and nonmycotic keratitis the percentage of the disease was higher in large families , with a high crowding index and rural residence .
these were explained by the unsound health behavior and lack of health awareness especially in those living in overcrowded houses with bad sanitation .
these findings were in agreement with other studies [ 5 , 18 , 19 ] which reported that fungal and microbial keratitis associated with low socioeconomic status and rural residence .
( iii ) as regards water sources , the outdoor water supply accounted for 72.9% of houses of mycotic cases compared to 58.1% among the nonmycotic cases with significant statistical difference ( = 4.95 , p = 0.025 ) . concerning sewage disposal ,
more than three - quarters of houses of mycotic keratitis ( 77.3% ) were by conservancy system compared to 55% of the houses in the nonmycotic cases with a significant statistical difference ( = 10.78 , p = 0.001 ) .
( iv ) in conclusion , it was revealed that cases of mycotic keratitis lived in more deteriorated environment than the nonmycotic group .
this was consistent with gopinathan and his colleagues who reported in 2009 that cases of mycotic keratitis lived in poor insanitary environment .
rautaraya in 2011 reported that eye washing with contaminated water could cause mycotic and nonmycotic keratitis .
outdoor water and insanitary sewage disposal systems could affect personal hygiene and self - care with poor sanitation of houses together with spread of flies and insects that transmit organisms easily to healthy or unhealthy corneas . in this study ,
61.5% of cases of mycotic keratitis came within the first week of their onset of complaints to seek medical care compared to the majority ( 85% ) in the nonmycotic group .
about a quarter of cases of mycotic keratitis ( 22.4% ) came to seek medical care after two weeks from onset of complaints compared to no one in the nonmycotic group .
the difference in mean time between both groups was statistically significant ( = 25.63 , p = 0.3 ) .
first , some patients developed mycotic keratitis after ocular surgery and thought that their complaints were a normal sequence of the surgery , so they delayed seeking medical care . second , some other patients were posttraumatic and thought that the symptoms were a normal sequence of trauma .
lastly , some patients were treated by mistake at first as nonmycotic keratitis till they were managed as fungal keratitis .
( i ) it was found that 84.5% of patients were positive , while 15.5% were negative in spite of their typical clinical findings and their improvement with antifungal therapy .
these may be explained by some fungi present in deep stroma and so could not be obtained if superficial scraping was done or if scraping was obtained only from one area .
these findings were in consistence with rautaraya who reported that 25.4% of their patients showed negative fungal growth in spite of their typical clinical findings for microbial keratitis .
( ii ) for the type of fungusisolated , it was found that aspergillus species were the most common ( 45.2% ) , either flavus ( 29.1% ) or niger ( 16.1% ) .
these results were in agreement with rautaraya and his colleagues in india who demonstrated that aspergillus species constituted the majority ( 27.9% ) of fungal growth in their study .
these findings may be explained by the more spread of aspergillus species in the environment specially spores which can survive hot and dry weather for long time .
aspergillus species existed in the soil and animal skin , so they were more frequent among the farmers in this study .
( iii ) among aspergillus species it was found that aspergillus flavus constituted 29.1% and aspergillus niger 16.1% .
this was consistent with the findings of rautaraya study that demonstrated 15.8% for aspergillus flavus and 12.3% for other aspergillus species .
( iv ) candida species were the least frequent type ( only in 3% ) ; that is in agreement with what was reported by rautaraya and others that candida species were the least common in their study ( 0.9% ) .
our results revealed that , among a total number of 66303 cases examined during the time of the study , mycotic keratitis occurred among 0.54% of cases and the nonmycotic keratitis in 0.71% .
a study that was done from february 1991 to june 2001 by gopinathan and others in india demonstrated 5897 cases of suspected infectious keratitis ; 3563 ( 60.4% ) were culture proven ( bacterial : 1849 , 51.9% ; fungal : 1360 , 38.2% ; acanthamoeba : 86 , 2.4% ; mixed : 268 , 7.5% ) . among fungal cases aspergillus species were responsible for 28.9% of cases , fusarium in 35.6% , dematiaceous fungi in 19.3% , other hyaline fungi in 15.4% , and candida only in 0.8% . between september 1985 and august 1987 ,
405 patients with corneal ulceration were examined at tribhuvan university teaching hospital in kathmandu , nepal . males and females
the most common predisposing cause of ulceration was corneal trauma , usually with organic agricultural materials .
pure bacterial cultures were obtained from 256 ( 63.2% ) of the patients , whereas pure fungal cultures were obtained from 27 ( 6.7% ) of the patients . in 41 patients ( 10.1% ) ,
of 68 positive fungal isolates obtained , 32 ( 47.0% ) were identified as aspergillus species .
a 13-year study that was done in paraguay from 1988 to 2001 and included 660 patients with infectious keratitis revealed that 79% of cases were culture positive of which 49% was fungal growth .
in a study done in ghana in 1995 , one or more organisms were cultured from 114 of 199 patients ( 57.3% ) , with the most common being fusarium species , pseudomonas aeruginosa , and staphylococcus epidermidis .
fungi , alone or in combination , were isolated from 56% of the patients who had fungal growth , in total 122 patients ( 61.3% ) .
this work reported that , among cases of mycotic keratitis , organic trauma was the most prevalent risk factor ( 38.2% ) , followed by ocular surgery in 32.7% of cases then the nonorganic trauma in 20.2% followed by the use of topical antibiotics in 6.1% , and systemic disease ( such as diabetes ) was the least frequent in only 2.2% . on the other hand , the nonorganic trauma was the most frequent risk factor for nonmycotic keratitis ( 45% ) followed by the organic trauma ( 35% ) .
farmers were more exposed to organic trauma ( with rice or maize stems or others ) during farming so they were more exposed to mycotic keratitis .
as regards the risk of ocular surgery among the cases , fungal contamination might occur preoperatively in those cases with negative cultures or postoperatively due to lowered body immunity ( by the stressful surgery ) and/or the use of a course of local and systemic corticosteroids with the surgery .
in consistence with our findings , ocular trauma was the most frequent risk for either mycotic or nonmycotic keratitis in other studies [ 5 , 1522 ] .
community awareness of the risk factors.restriction of the abuse of topical corticosteroids or antibiotics.mycotic keratitis should be suspected in every patient with a corneal lesion , specially the resistant one , and should be ruled out before commencing steroids and antibiotics.for a successful treatment , we need the following :
proper early clinical diagnosis , proper laboratory diagnosis , initiating a broad spectrum antifungal drug till laboratory findings prove the specific drug , proper frequency of antifungal drugs , proper timing for termination of therapy .
community awareness of the risk factors .
mycotic keratitis should be suspected in every patient with a corneal lesion , specially the resistant one , and should be ruled out before commencing steroids and antibiotics . for a successful treatment ,
we need the following :
proper early clinical diagnosis , proper laboratory diagnosis , initiating a broad spectrum antifungal drug till laboratory findings prove the specific drug , proper frequency of antifungal drugs , proper timing for termination of therapy .
proper early clinical diagnosis , proper laboratory diagnosis , initiating a broad spectrum antifungal drug till laboratory findings prove the specific drug , proper frequency of antifungal drugs , proper timing for termination of therapy . |
purpose . this work aims to study the problems encountered with and the different epidemiological features of patients with fungal keratitis .
patients and methods . all cases with keratitis attending the outpatient clinic of ophthalmology department at tanta university hospital during three years from the first of january 2011 to the end of december 2013 were selected and carefully examined and cases with mycotic keratitis were further examined and investigated . results . from 66303 attendants during this period with different complaints , there were 361 cases ( 0.54% ) with mycotic keratitis and 473 cases ( 0.71% ) of nonmycotic origin .
mycotic keratitis is common between 40 and 60 years , more in farmers ( 64% ) , families with large number and large crowding index , rural than urban residence , and patients with outdoor water sources and insanitary sewage disposal .
positive fungal cultures were obtained in 84.5% and were negative in 15.5% of cases in spite of their typical clinical findings for diagnosis and their improvement with antifungal therapy . conclusion .
mycotic keratitis is more frequent in farmers , rural areas , outdoor water supply , insanitary sewage disposal , and patients preceded with organic trauma .
atypical clinical findings were found in some cases and not all cases improved with specific antifungal therapy . | 1. Introduction
2. Patients and Methods
3. Results
4. Discussion
5. Recommendation |
various reports have shown that the number of children with type 2 diabetes has increased
worldwide in recent years and continues to increase ( 1,2,3 ) .
it is noteworthy that several racial and ethnic groups are at a particularly
high risk for developing type 2 diabetes , including african - americans and asians ( 2 , 3 ) . in japan
, we
demonstrated an increased frequency of type 2 diabetes among school children residing in
tokyo as detected by urine glucose screening and confirmed by the oral glucose tolerance
test ( 4 , 5 ) .
a
similar trend was noted in yokohama and osaka ( 6 ) .
according to the data from these studies , the annual incidence of type 2 diabetes
concurrently , the
increased prevalence of obesity among japanese school children is notable ( 5 , 7 ) .
lifestyle
changes , including westernization of eating habits , increased consumption of animal protein
and fat ( 5 ) and a decrease of physical activity , have
been implicated in the increasing prevalence of childhood obesity .
there seems to be a strong relationship between
childhood obesity and the development of type 2 diabetes .
thus , the increase of type 2
diabetes in childhood is an evolving problem and it is critical to develop a strategy to
treat type 2 diabetes in childhood .
however , treatment for type 2 diabetes varies and it has
not been established for children and adolescents .
this paper presents some possible
therapeutic approaches to improve glycemic control for type 2 diabetes in childhood .
we have detected numerous children with type 2 diabetes by urine glucose screening at
school in tokyo ( 4 , 5 ) .
if the first and second tests are positive for urine glucose , the oral glucose
tolerance test is performed for diagnosis of diabetes .
the incidence of type 2 diabetes
during the last two decades was estimated at 2.8/100,000 school children / year in tokyo
( fig .
1 serial changes in the incidence of childhood type 2 diabetes detected by urine
glucose screening at school in tokyo . ) . according to our accumulated data , approximately 80% of children with type 2
diabetes have an obesity rate of more than 20% at diagnosis . the tendency to excessive
the incidence of type 2 diabetes is significantly higher
in junior high school children than in primary school children ( 6.4 vs. 0.78/100,000 school
children / year , p<0.01 ) .
a family history of type 2 diabetes is strongly associated with
the development of childhood type 2 diabetes .
the frequency of a history of type 2 diabetes
in first- or second - degree relatives is above 50% .
most children with type 2 diabetes have
no or minimum symptoms of hyperglycemia at diagnosis , however , some patients initially show
metabolic decompensation such as diabetic ketoacidosis requiring insulin therapy . serial changes in the incidence of childhood type 2 diabetes detected by urine
glucose screening at school in tokyo .
the ideal goal of treatment is physical and emotional well - being and near normalization of
blood glucose values .
successful treatment is defined as cessation of excessive weight gain
with normal linear growth , controlling of an emotional condition and improvement of
glycemia : i.e. fasting blood glucose of 90 to 130 mg / dl , postprandial blood glucose of less
than 180 mg / dl and hba1c<7.0% ( 8) .
dietary and
exercise regimens are often recommended as the initial therapeutic approach , with
progression to oral hypoglycemic agents and finally insulin if hyperglycemia remains
uncontrolled ( 9 ) .
therapeutic approaches for childhood
type 2 diabetes in our clinic are shown in table
1table 1 therapeutic approaches for childhood type 2 diabetes .
most
patients improve hyperglycemia within one to three months after introduction of lifestyle
changes .
some patients , however , continue hyperglycemia and require pharmacological therapy
( 7 ) .
we prescribe oral hypoglycemic agents or
insulin to patients who continue high levels of hba1c over 8.0% .
some practitioners recommend beginning insulin therapy immediately in patients who have
ketoacidosis or severe symptoms of hyperglycemia ( 10 ) .
it has been suggested that initial therapy with insulin can be helpful in
overcoming the toxic effects of hyperglycemia , interrupting the vicious cycle whereby
hyperglycemia increases peripheral insulin resistance and decreases endogenous insulin
secretion leading to worsening of hyperglycemia ( 11 ,
12 ) .
weight loss induced by low - calorie diets and exercise programs is a principal therapeutic
means for obese patients with type 2 diabetes .
later , peripheral sensitivity to
insulin is increased through reductions in lean and adipose mass ( 13 , 14 ) .
the majority of patients
can improve hyperglycemia through diet and exercise during a relatively short period .
near
normalization of blood glucose with reduced weight gain is achieved in most patients by a
relatively modest diet regimen : i.e. caloric reduction of 5 to 10% of the energy requirement
for age - matched healthy children with an adequate composition of energy source .
strict
restriction of food intake impairs childhood physical development and is likely to lead with
time to a drop out of patients ( 14 ) .
for patients who are unable to change their lifestyle through weight loss and increased
physical activity and for those who make these changes but continue to have poor glycemic
contorol , a variety of oral hypoglycemic agents are now available ( table 2table 2 available oral hypoglycemic agents ) .
because the pathophysiology of type 2 diabetes in children appears to be
similar to that of type 2 diabetes in adults , it is reasonable to assume that such agents
will be effective in children ( 2 ) .
the available oral hypoglycemic agents and their mechanisms of action are as follows : -glucosidase inhibitors ( acarbose and boglibose ) work by inhibiting the
absorption of carbohydrates in the small intestine .
they lower postprandial hyperglycemia
and are helpful for improving glycemic control especially for patients at an early stage of
diabetes .
-glucosidase inhibitors can be widely used in combination with other oral agents
or insulin ( 15 , 16 ) .
the most common side effects are gastrointestinal symptoms , which can be
tolerated by most patients .
no major systemic adverse effects exist . sulfonylureas ( tolbutamide , gliclazide , glibenclamide , glimepiride ) promote
endogenous insulin secretion and are useful for reducing hyperglycemia in non - obese or
mildly obese patients with type 2 diabetes , who maintain residual -cell
function , because the primary action of sulfonylureas is to enhance endogenous insulin
secretion ( 17 ) .
obesity is likely to be aggravated
when sulfonylureas are inappropriately used in patients under insufficient dietary
management with increasing huperinsulinism and insulin resistance ( 17 ) .
first - generation ( tolbutamide ) and second - generation ( gliclazide ,
glibenclamide ) sulfonylureas differ in potency but are thought to be equally effective
( 17,18,19 ) .
newer sulfonylureas ( glimepiride ) are thought to
exert their hypoglycemic effect by increasing peripheral sensitivity to insulin in addition
to stimulating insulin secretion . in general , sulfonylureas are well tolerated with gastrointestinal complaints , being the
most frequent adverse effects .
skin reactions , abnormal liver function and hematologic
complications have been reported but are uncommon .
the hypoglycemic
potential of sulfonylureas can be potentiated by certain drugs that displace them from
plasma protein binding sites , such as salicylates and sulfonamides .
conversely , phenytoin
and barbiturates can decrease the action of the sulfonylureas ( 17 , 21 ) . in adults ,
secondary
failure of sulfonylureas is common , and the frequency increases with duration of the
disease . worsening insulin resistance or increased impairment of -cell
function has been implicated in over half of the cases , but in the remainder the cause is
unknown ( 12 , 17 ) .
when sulfonylurea failure occurs , various therapeutic options exist ,
including another oral agent with a different mechanism of action such as metformin ,
changing to insulin therapy , or using a combination of sulfonylureas plus insulin .
glitinides ( nateglinide ) are nonsulfonylureas that promote insulin secretion
in a manner similar to that of sulfonylureas , but their onset of action is briefer and the
duration of action is shorter ( 9 ) .
nateglinide , one of
glinitides , alone and in combination with metoformin is reported to be useful for improving
glycemic control by reducing mealtime glucose levels in adults with type 2 diabetes ( 22 ) . on the other hand ,
glitinides are new oral agents
and most pediatricians are not familiar with their use , so that their hypoglycemic efficacy
has not been ascertained .
it is used as the initial
oral agent and has the advantage of inducing a significant decrease in hba1c by 1.2% and
fasting blood glucose by 3.6
mmol / l ( 64.8 mg / dl ) in the absence of severe hypoglycemia in
pediatric patients with type 2 diabetes ( 23 ) . in
addition
, it has been demonstrated that weight is either decreased or remains stable , and
plasma lipid profiles improve ( 23,24,25,26 ) .
metformin does not promote insulin secretion , but decreases
hepatic glucose output and peripheral insulin resistance ( 24,25,26 ) .
metformin is thought to be essentially effective for patients with insulin
resistance associated with overweight . for japanese young persons with type 2 diabetes ,
metformin
is considered to be most effective as monotherapy , because most of them are obese .
we introduced metformin therapy for pediatric use 5 years ago , now 15 patients have received
metformin at doses of 500 to 1,000 mg daily . if monotherapy with metformin is not successful
over a reasonable period ( i.e. , 36 mo ) , several alternatives can be considered .
combination
therapy with metformin plus sulfonylureas or insulin is more effective than either agent
used alone in some cases . the glycemic control in patients with metformin alone or a
combination with sulfonylureas or using insulin in our clinic is shown in table 3table 3 glycemic control in treatment with metformin alone or in combination with
sulfonylureas or insulin at our clinic .
the most common side effects of metformin are gastrointestinal symptoms , which are
significantly reduced with the passage of time and appropriate time schedule ( 23 , 25 , 26 ) .
lactic acidosis is uncommon and usually is
restricted to patients with underlying renal or hepatic dysfunction or cardiac disease
( 24,25,26,27 ) .
metformin
should not be used in patients with known hepatic disease , renal dysfunction , hypoxemic
conditions , or severe infections .
metformin should be temporarily discontinued with any
acute illness associated with dehydration or hypoxemia .
insulin should be used if glycemic
control deteriorates acutely ( 2 , 27 ) .
thiazolidenediones ( troglitazone ) is not used in japan , because it has been
associated with fatal hepatic failure ( 28 ) .
pioglitazone is reported safer for practical use , however , its routine use in children is
not recommended until safety information is available .
unfortunately , we do not have any
data for clinical efficacy and safety for pediatric use .
oral agents were practically not
used and insulin was the only hypoglycemic agent approved for pediatric use in japan .
nowadays , despite the clinical use of oral hypoglycemic drugs in pediatric patients , quite a
few patients with type 2 diabetes receive insulin therapy ( 9 , 29 ) .
the various insulin regimens used
in patients with type 2 diabetes are shown in fig
2fig .
2 insulin regimens for the treatment of type 2 diabetes .. there are insufficient data to help determine the best one , because residual
cell function is heterogenous in type 2 diabetes .
once - daily injection
of intermediate insulin at bedtime or before breakfast ( 10 ) seems uncommon for pediatric use .
twice - daily injections in combination with
intermediate- and rapid acting insulin ( 10 , 13 ) or pre - mixed regimens have been used to good effect .
however , a minority of patients with deranged metabolic control and deficient
cell capacity need intensive insulin therapy similar to type 1
diabetes . insulin regimens for the treatment of type 2 diabetes .
the approach to insulin therapy in patients with type 2 diabetes often differs from that
most frequently used in patients with type 1 diabetes .
adjustment of the dose of insulin at
each injection using sliding scales or algorithms is not required in most cases , because
their residual cell function is not exhausted .
insulin resistance is a
central feature of most forms of type 2 diabetes , and accordingly insulin requirement to
control hyperglycemia is often very high ( 10 , 13 ) .
high doses of insulin , however , lead to
hyperinsulinemia resulting in weight gain while hyperglycemia is not reduced .
appropriate
use with an adequate dose of insulin under sufficient dietary management is essential to
achieve glycemic goals in type 2 diabetes .
combination therapy with insulin and various oral hypoglycemic agents has also been
advocated . in some studies ,
the addition of oral agents to insulin regimens was shown to
achieve better glycemic control compared with insulin alone or to reduce the required dose
of insulin ( 9 , 10 , 13 , 30 , 31 ) .
modified insulin therapy ,
including a combination with oral hypoglycemic agents , and its metabolic effect in our
clinic are shown in table 4table 4 recent preparations of insulin for children with type 2 diabetes at our
clinic .
the use of pre - mixed insulin once or twice daily or a combination with
insulin and metformin seems to be useful for glycemic control in most of children with type
2 diabetes . however , some patients , who have lost endogenous insulin secretary capacities ,
need intensive insulin treatment similarly to the management of type 1 diabetes .
children with type 2 diabetes show clinical heterogeneity and therapeutic approaches to
them patients are considered to be heterogeneous .
on the other hand , some need either oral
hypoglycemic agents or insulin therapy for their glycemic control .
therapeutic means for
childhood type 2 diabetes should be variable depending on each patient s
characteristics
. considerable number of children who were treated with diet and exercise dropped out because
many children while not feeling ill , did not realize immediate benefits from lifestyle
changes through diet and exercise , and recognized no gain from the treatment .
adherence is
the most important factor for the management of childhood type 2 diabetes , and a good
patient - family - pediatrician relationship should be maintained to encourage good glycemic
control ( 7 ) . | urine glucose screening at school implemented in japan is useful for detecting
childhood type 2 diabetes at the early stage of the disease .
most patients detected by the
screening can improve hyperglycemia and reduce overweight within one to three months by
changing lifestyle with diet and exercise . for patients who are unable to alter their
lifestyle and for those who have hyperglycemia despite maintaining these changes ,
a
variety of oral hypoglycemic agents , including -glucosidase inhibitors , sulfonylureas ,
glitinides , metformin , thiazolidenediones , and insulin are available .
metformin is
considered to be the most effective oral agent as monotherapy for japanese young persons
with type 2 diabetes , because most of them are obese with insulin resistance .
the approach
to insulin therapy in patients with type 2 diabetes often differs from that most
frequently used in patients with type 1 diabetes .
adjustment of the dose of insulin at
each injection using sliding scales or algorithms is not required in most cases . in some
cases , combination therapy with metformin and sulfonylureas or use of insulin
is more
effective for stabilization of blood glucose values .
therapeutic means for childhood type
2 diabetes should be variable depending on each patient s characteristics . | Introduction
Clinical Features of Children with Type 2 Diabetes at Diagnosis
Treatment for Children with Type 2 Diabetes
Lifestyle Changes with Diet and Exercise
Oral Hypoglycemic Agents
Insulin
Conclusion |
according to the merriam - webster dictionary , an excipient is a usually inert substance ( as gum arabic , syrup , lanolin , or starch ) that forms a vehicle ( as for a drug or antigen ) ; especially : one that in the presence of sufficient liquid gives a medicated mixture the adhesive quality needed for the preparation of pills or tablets . in reality ,
a number of classical excipients show notable side effects , and these are clearly mentioned on the accompanying package leaflet of drugs .
for example , in individuals suffering from phenylketonuria , aspartame or polyethylene glycol can provoke digestive disturbances .
this is a serious but long - lasting and rather well - controlled aspect of drug usage that is carefully taken into consideration by pharmaceutical companies and supervised by competent international authorities .
this is the case , for example , of trehalose , a non - hygroscopic alpha - linked disaccharide formed by two molecules of glucose , used as an excipient in formulated drugs .
trehalose is approved by the us food and drug administration and received the gras ( generally recognized as safe ) rating in 2000 .
it is also approved in europe , japan , taiwan and korea , and is kosher certified .
this disaccharide is present as protector of protein integrity in several commercially available therapeutic products , notably monoclonal antibodies , including herceptin , avastin , lucentis , and recombinant proteins such as advate in hemophilia .
this non - reducing sugar exists under free form in plants , algae , insects , fungi and micro - organisms , sometimes in abundant amounts , but not in mammals .
it is ingested daily in the normal human diet and is metabolized by the trehalase enzyme residing in the intestinal villi .
the ability of trehalose to stabilize aggregation - prone proteins is currently exploited to design novel strategies in the treatment of polyglutamine diseases , such as huntington s chorea and alzheimer s disease .
there is , therefore , no apparent intrinsic risk in the use of trehalose , and potential applications are widely investigated .
autophagy is an essential mechanism by which a cell degrades its own cytoplasmic components through the lysosomal machinery .
this tightly regulated homeostatic process is central in the cell response to stress , and also in controlling diverse aspects of immunity and inflammation .
enhancing autophagy can be beneficial ( in cancer or certain neuronal diseases , for example ) but also detrimental ; in any case , it is not neutral .
it is worth mentioning that in this regard trehalose has been used experimentally as autophagy enhancer , as 3-methyladenine is classically used to inhibit autophagic activity in in vitro experiments .
it has also been applied as facilitator for intramuscular administration of naked plasmid to improve transgene expression .
a phase iib study in the treatment of systemic lupus was undertaken based on a trehalose formulation of p140 phosphopeptide ( forigerimod ; cep-33457 ) issued from the spliceosomal protein u1 - 70 k. the clinical outcome was disappointing , unfortunately exactly as predicted when we considered the recently discovered mechanism of action of the peptide ( see below ) .
p140 peptide formulated with trehalose was ineffective , with a trend even to be less effective than placebo ( -6% ) , while previous phase iia and iib clinical trials showed that a mannitol formulation of p140 peptide ( lupuzor ) was highly effective and very safe ( table 1 ) . in the phase iib study in mannitol , the increase in responder rates as evaluated by the sle responder index ( sri ) was + 25% when compared with the placebo ( 62% vs. 37% responders at 12 weeks ; p < 0.025 ) , a result that is superior to published data generated with the sole recently approved biotherapy for lupus , belimumab .
table 1drop - out rates and responder rates in phase iib clinical trials of lupuzor and forigerimodlupuzor p140 mannitolforigerimod p140 trehaloseduration of treatment3 months6 monthsnumber of patients arms50 3 ( 1)92 2 ( 2)sae active / placebo6%/6%12%/25%drop - out rate active5%22%drop - out rate placebo16%23%responder rate active62%34%responder rate placebo37%40%two multicenter , randomized , placebo - controlled phase iib studies were run separately with similar
standard protocols : 200 g p140/individual / month in addition to standard of care , inclusion of patients with clinical sledai-2 k scores > 6 and no bilag a score .
the demographic characteristics of the study populations were similar in both studies as well as in each treatment group .
drop - out rates were recorded irrespective of their reason and considered as treatment failure .
efficacy was evaluated using the sle responder index ( sri ) score.(1 ) 2 active arms ( 200 g p140/individual / month or 200 g p140/individual / twice a month ) and placebo .
drop - out rates and responder rates in phase iib clinical trials of lupuzor and forigerimod two multicenter , randomized , placebo - controlled phase iib studies were run separately with similar
standard protocols : 200 g p140/individual / month in addition to standard of care , inclusion of patients with clinical sledai-2 k scores > 6 and no bilag a score . the demographic characteristics of the study populations were similar in both studies as well as in each treatment group .
drop - out rates were recorded irrespective of their reason and considered as treatment failure .
( 1 ) 2 active arms ( 200 g p140/individual / month or 200 g p140/individual / twice a month ) and placebo
our increasing knowledge of the mechanism of action of p140 peptide in mice and human cells allows us to propose a reasoned explanation for the grounds on which trehalose , and not mannitol , counteracts the p140 effect in a lupus setting .
our recent data raised in mrl / lpr - prone mice showed that p140 peptide targets autophagy , and more particularly chaperone - mediated autophagy ( cma ) ( unpublished observation ) .
notably , we have demonstrated that the p140 inhibitory effect on cma results from its ability to alter the integrity of the hsc70/hspa8-hsp90 heterocomplex of lysosomal chaperones ( unpublished observation ) .
expression of hsc70 and lamp-2 a , the two main cma components , which is increased in mrl / lpr b cells , is down - regulated after p140 treatment .
taking all these findings together , we proposed that the effect of p140 on the hspa8-hsp90 heterocomplex leads to endogenous ( auto)antigen processing interference followed by a much weaker loading to mhcii molecules , leading in turn to a lower activation of autoreactive t cells and b - cell help ( figure 1 ) .
p140 peptide behaves as a modulator ( not as an immunosuppressor ) of the autoimmune response , whose main effect is thus to weaken mhcii autoantigen presentation through a cellular mechanism depending on the autophagy process .
this set of findings is central , since we showed recently that macroautophagy ( the best characterized type of autophagy ) is abnormally enhanced in t lymphocytes from lupus mice and patients , and that cross - talk exists between macroautophay and cma .
figure 1therapeutic targets in systemic lupus erythematosus .
belimumab ( benlysta ) is the first fda - approved treatment for lupus in over 50 years .
in contrast to the other agents , including belimumab , p140/lupuzor targets the up - stream autoreactive response by acting as a modulator of antigen presentation by major histocompatibility complex ( mhc ) class ii molecules.apcs : antigen - presenting cells ; april : a proliferating - induced ligand ; blys : b - lymphocyte stimulator ; cd : cluster of differentiation ; dcs : dendritic cells .
belimumab ( benlysta ) is the first fda - approved treatment for lupus in over 50 years .
in contrast to the other agents , including belimumab , p140/lupuzor targets the up - stream autoreactive response by acting as a modulator of antigen presentation by major histocompatibility complex ( mhc ) class ii molecules .
apcs : antigen - presenting cells ; april : a proliferating - induced ligand ; blys : b - lymphocyte stimulator ; cd : cluster of differentiation ; dcs : dendritic cells . in this context of pathologically elevated macroautophagy activity ,
any component that reduces this enhanced activity might be potentially favorable , while any activator would be rather harmful . it is the case that trehalose , which is a known mtor - independent activator of the macroautophagy pathway , further activates a mechanism that is already deregulated towards an excess of activity .
the results with forigerimod were disappointing because both the brake ( p140 peptide ) and the accelerator ( trehalose ) pedals were pressed down . if the levels of circulating cytokines , as measured using non - quantitative kit raybio cytokine antibody arrays , were not significantly different in the peripheral blood of mrl / lpr mice that received the peptide in mannitol and trehalose ( four consecutive administrations by the intraperitoneal route ; two mice per group ; measurements at day 5 ) , the adverse impact of trehalose was clearly notable when other parameters were followed .
thus , the capacity of p140 peptide to reduce the greatly increased peripheral cellularity in lpr - bearing mrl mice was significantly reduced when the peptide was injected intravenously in the trehalose formulation compared with a mannitol formulation ( figure 2(a ) ) .
the level of circulating cd45r / b220cd138-expressing plasmocytes as measured by flow cytometry analysis remained low in all groups of mice with , however , unequal results in mice that received p140 in trehalose ( figure 3 ) .
this high variability of responses was also observed when the level of peripheral white cells was measured after administration of p140 peptide in trehalose as compared with mannitol ( figure 2(a ) ) .
figure 2 in vivo effect of trehalose administrated alone or associated to p140 peptide , on mrl / lpr lupus mice.(a ) in vivo effect of p140 peptide in different excipients on the peripheral hypercellularity ; 1113-week - old female mrl / lpr and cba / j mice received a single administration of 100 g peptide p140 intravenously in either saline , or 5.4% mannitol or 10% trehalose .
each bar represents the percentage of cell decrease revealed after peptide treatment ( n = 55 and 44 without and with p140 in nacl , n = 11 and 12 without and with p140 in mannitol and n = 12 and 22 without and with p140 in trehalose ) .
the coefficient of variation on cell counts were 20.6 , 12.8 and 24.3% in the groups of mice that received saline , mannitol and trehalose , respectively , and 23.2 , 20.6 and 29.7% in the groups of mice that received p140 in saline , mannitol and trehalose , respectively .
( b , c ) effect on the course of the lupus disease of trehalose administration to mrl / lpr lupus mice ; 10 5-week - old female mrl / lpr mice were administered intravenously with either saline or trehalose alone ( arrow ) .
mice were then subjected to three further administrations ( weeks 7 , 9 , 12 ) in the same conditions . their viability ( b ) and the mean proteinuria score ( c ) are shown .
survival of mrl / lpr mice was analyzed by the kaplan meier method , and the significance of differences was determined by the log - rank test . the two - way anova test
ns = non - significant . at the end of the experiment ( week 35 ) : median survival = 18.5 weeks ( nacl ) and 21.0 weeks ( trehalose ) , p = 0.8375 ( ns ) ; proteinuria p = 0.3315 ( ns ) . at week 15 : survival p = 0.0671 ( ns ) ;
all animal experiments were performed with the approval of the local institutional animal care and use committee ( cremeas ) .
figure 3effect on the viability of cd45r / b220cd138 plasmocytes of p140 peptide administrated in different media to mrl / lpr lupus mice.two 12-week - old female mice received the peptide intraperitoneally once per day during four consecutive days ( 100 g / mouse ) . at day 5 ,
the blood was collected , peripheral white cells were purified on a ficoll gradient , and purified cells were labeled with anti - mouse cd45r / b220-fluorescein isothiocyanate ( fitc ) and cd138-allophycocyanin ( apc ) , both from bd biosciences .
cells were analyzed using a facscalibur apparatus and the cellquest software ( bd biosciences ) . in vivo effect of trehalose
( a ) in vivo effect of p140 peptide in different excipients on the peripheral hypercellularity ; 1113-week - old female mrl / lpr and cba / j mice received a single administration of 100 g peptide p140 intravenously in either saline , or 5.4% mannitol or 10% trehalose .
each bar represents the percentage of cell decrease revealed after peptide treatment ( n = 55 and 44 without and with p140 in nacl , n = 11 and 12 without and with p140 in mannitol and n = 12 and 22 without and with p140 in trehalose ) . the coefficient of variation on cell counts were 20.6 , 12.8 and 24.3% in the groups of mice that received saline , mannitol and trehalose , respectively , and 23.2 , 20.6 and 29.7% in the groups of mice that received p140 in saline , mannitol and trehalose , respectively .
( b , c ) effect on the course of the lupus disease of trehalose administration to mrl / lpr lupus mice ; 10 5-week - old female mrl / lpr mice were administered intravenously with either saline or trehalose alone ( arrow ) .
mice were then subjected to three further administrations ( weeks 7 , 9 , 12 ) in the same conditions . their viability ( b ) and the mean proteinuria score ( c ) are shown .
survival of mrl / lpr mice was analyzed by the kaplan meier method , and the significance of differences was determined by the log - rank test .
the two - way anova test was used to analyze statistical significance of proteinuria differences between study groups .
ns = non - significant . at the end of the experiment ( week 35 ) : median survival = 18.5 weeks ( nacl ) and 21.0 weeks ( trehalose ) , p = 0.8375 ( ns ) ; proteinuria p = 0.3315 ( ns ) . at week 15 : survival p = 0.0671 ( ns ) ;
all animal experiments were performed with the approval of the local institutional animal care and use committee ( cremeas ) .
effect on the viability of cd45r / b220cd138 plasmocytes of p140 peptide administrated in different media to mrl / lpr lupus mice .
two 12-week - old female mice received the peptide intraperitoneally once per day during four consecutive days ( 100 g / mouse ) . at day 5 , the blood was collected , peripheral white cells were purified on a ficoll gradient , and purified cells were labeled with anti - mouse cd45r / b220-fluorescein isothiocyanate ( fitc ) and cd138-allophycocyanin ( apc ) , both from bd biosciences .
cells were analyzed using a facscalibur apparatus and the cellquest software ( bd biosciences ) .
we also discovered that trehalose administrated alone tends to accelerate lupus disease in lupus - prone mice ( proteinuria and survival ) when compared with saline only ( figure 2(b ) and ( c ) ) .
in the open - label follow - up of 11 patients given forigerimod ( cep-3075 ) following the cep-33457 phase iib clinical trial , our group ( djw ) observed that , unlike lupuzor , there was no evident response for several months .
approximately 6 months later clear - cut improvements in response measures were observed , suggesting that at this stage the negative influence of trehalose was overcome .
these observations , as well as the clinical data of the cep-33457 phase iib clinical trial indicating that the peptide in trehalose tended even to be less effective than placebo ( table 1 ) , were closely corroborated by data generated ex vivo using human peripheral cells ( buffy coats ) . while , in a dose - dependent manner , p140 peptide in saline provoked a down - expression of hla molecules at the surface of b cells ( as also found in mrl / lpr b cells ) , p140 in trehalose , on the contrary , had no effect on hla cell expression even when the p140:trehalose ratio was increased ( figure 4 ) .
taken together , these converging findings are indicative of a negative effect of trehalose when associated with p140 peptide ( forigerimod ) , a result that was predicted when considering the metabolic pathway that is modulated by the bioactive peptide p140 . furthermore , beside this effect as an autophagy activator that is undesirable in lupus conditions , trehalose might also exert its adverse effect through another of its physicochemical properties ; that is , its capability to substitute water molecules around proteins / membranes .
this property , which is put forward to explain how trehalose displays its bioprotective action , might transiently alter the folding and mobility of the p140 peptide and also of partner macromolecules , the interaction of which is critical in its mode of action .
figure 4effect of trehalose on the capacity of p140 peptide to decrease hla expression at the surface of human b cells.b cells were isolated from the peripheral blood from three independent healthy donors ( buffy coats ) by negative selection ( b - cell isolation kit ii human , miltenyi biotec ) .
purified b cells ( 10 cells ; 9599% purity as evaluated using anti - cd19 antibodies from bd pharmingen ) were incubated ex vivo for 18 h with either nacl or 10% trehalose alone or with increasing concentrations ( 10 , 20 or 30 m ) of p140 peptide in these two media .
expression of dr / dq / dp hla molecules was measured by flow cytometry using anti - pan - hla antibodies and mouse igg2a , isotype control antibodies ( both from bd pharmingen ; dilution 1/100 ) .
variations of hla cell surface expression ( expressed as % variation of geomean values ) were determined using the paired t - test . * ,
statistical analysis demonstrated ( i ) a statistically significant decrease of hla expression in the presence of increasing concentrations of p140 peptide in nacl ; ( ii ) the absence of statistically significant effect of p140 peptide when administrated in trehalose .
effect of trehalose on the capacity of p140 peptide to decrease hla expression at the surface of human b cells .
b cells were isolated from the peripheral blood from three independent healthy donors ( buffy coats ) by negative selection ( b - cell isolation kit ii human , miltenyi biotec ) .
purified b cells ( 10 cells ; 9599% purity as evaluated using anti - cd19 antibodies from bd pharmingen ) were incubated ex vivo for 18 h with either nacl or 10% trehalose alone or with increasing concentrations ( 10 , 20 or 30 m ) of p140 peptide in these two media . expression of dr / dq / dp hla molecules was measured by flow cytometry using anti - pan - hla antibodies and mouse igg2a , isotype control antibodies ( both from bd pharmingen ; dilution 1/100 ) .
variations of hla cell surface expression ( expressed as % variation of geomean values ) were determined using the paired t - test . * ,
statistical analysis demonstrated ( i ) a statistically significant decrease of hla expression in the presence of increasing concentrations of p140 peptide in nacl ; ( ii ) the absence of statistically significant effect of p140 peptide when administrated in trehalose .
it displays some active properties which can directly or indirectly alter the behavior of potential therapeutics evaluated in clinical trials .
although it is exploited with success in a number of pharmaceuticals , special attention should be paid to the risk of trehalose impacting negatively on the success rate of a drug candidate evaluated in trehalose .
this research received no specific grant from any funding agency in the public , commercial , or not - for - profit sectors . | peptide therapeutics hold attractive potential .
however , the proper stabilization of such therapeutics remains a major challenge .
some peptides are marginally stable and are prone to degradation .
therefore , in addition to chemical modifications that can be introduced in their sequence , a wide variety of excipients are added in the formulation to stabilize them , as is also done routinely for protein therapeutics .
these substances are supposed to suppress peptide / protein aggregation and surface adsorption , facilitate their dispersion and additionally to provide physiological osmolality .
particular attention has to be paid to the choice of such excipients .
here we highlight the observation that in certain clinical situations , an excipient that is not totally inert can play a highly damaging role and mask ( or even reverse ) the beneficial effect of a molecule in clinical evaluation .
this is the case , for instance , of trehalose , a normally safe excipient , which notably has proven to act as an activator of autophagy .
this excipient , although used efficiently in several therapeutics , adversely impacted a phase iib clinical trial for human and murine lupus , a systemic autoimmune disease in which it has been recently discovered that at the base line , autophagy is already abnormally enhanced in lymphocytes .
thus , in this particular pathology , while the peptide that was tested was active in lupus patients when formulated in mannitol , it was not efficient when formulated in trehalose .
this observation is important , since autophagy is enhanced in a variety of pathological situations , such as obesity , diabetes , certain neurological diseases , and cancer . | Introduction
When the excipient plays the role of an active substance and can interfere with a potential drug
Trehalose virtually shuts down the immunomodulatory properties of the P140 peptide in MRL/lpr mice
A similar effect of trehalose on P140 peptide in a human setting?
Concluding remarks
Funding
Conflict of interest statement |
a 40yearold male presented with suddenonset severe anterior chest pain , profuse sweating , and vomiting . on admission , his blood pressure was 140/46 mmhg and his heart rate was 77 bpm .
marfan syndrome was diagnosed by ghent criteria.2 electrocardiography revealed nonspecific findings for myocardial injury , except for nonspecific t wave changes ( fig .
transthoracic echocardiography showed severe aortic valve regurgitation , aortic root dilatation , and a dissection flap in the ascending aorta .
his creatinine kinasemb isoenzyme level was mildly elevated ( 5.58 ng / ml ) , but his troponini level was in the normal range ( 0.1 ng / ml ) .
computed tomographic ( ct ) angiography showed that the aortic dissection flaps extended to the aortic sinuses proximally ( fig .
preoperative electrocardiography ( ekg ) and computed tomographic angiography . ( a ) preoprative ekg revealed a nonspecific t wave abnormality without st elevation or pathologic q wave .
( b ) preoperative computed tomographic angiography showed only a deep dissection flap ( black arrow ) in the left aortic sinus at the level of the left coronary artery ( black arrowhead ) .
cardiopulmonary bypass was instituted with a right axillary artery cannula via a side graft and two separate venous cannulas . using moderate hypothermia ,
the aorta was clamped and opened transversely and myocardial protection was maintained with intermittent retrograde blood cardioplegia .
the intima of the right coronary artery was intact , but the intima of the lmca was detached from the ostium .
the proximal dissected portion of the lmca was excised about 6.0 mm and the intact distal portion was anastomosed to a reverse saphenous vein graft of 1.5 cm with 10 simple interrupted 70 polypropylene sutures .
the aortic root , which had thick and shortened aortic leaflets , was replaced with a modified buttonbentall technique3 using a 23mm onx mechanical valve ( onx life technologies , austin , tx , usa ) and a 30mm valsalva graft ( sulzer vascutek , renfrewshire , uk ) .
the proximal end of the vein graft of the lmca was beveled and anastomosed to a low opening in the aortic graft with a continuous 50 polypropylene suture ( fig .
the dissected layers of the right coronary artery button were reapproximated with bioglue ( cryolife , inc . ,
the ascending aorta and the lower portion of the aortic arch were replaced with a beveled 28mm vascutek graft with a side branch during a 32minute period of circulatory arrest with bilateral selective antegrade cerebral perfusion .
after the distal anastomosis was completed , a cerebral perfusion cannula was removed from the left carotid artery and antegrade cardiopulmonary bypass was resumed through the right axillary artery sidegraft cannula and a side branch of the aortic graft .
bypass surgery was performed using a saphenous vein graft to the left anterior descending artery due to concern that there was insufficient flow due to intimal swelling of the reconstructed lmca .
aortic crossclamp time and cardiopulmonary bypass time were 251 minutes and 301 minutes , respectively .
the additional bypass graft to the left anterior descending artery had narrowed , probably due to competition flow .
( a ) reconstruction of the dissected left main coronary artery with severed intima . ( 1 ) the left main coronary artery was trimmed at the healthy intimal portion .
( 2 ) a short reversed saphenous vein graft was anastomosed to the healthy distal portion of the left main coronary artery with 10 simple interrupted 70 polypropylene sutures .
( 3 ) the vein graft was beveled and anastomosed to an opening in the aortic graft .
( b ) six months following surgery , computed tomographic angiography showed the intact lumen of the reconstructed left main coronary artery ( black arrow ) and near closure of the additional saphenous vein graft ( white arrow head ) .
in patients with acute type a aortic dissection , the extension of the dissection into the coronary artery causes coronary malperfusion.4 in patients with acute type a aortic dissection , 6.115% present with coronary malperfusion , which more frequently involves the right coronary artery.1 , 4 , 5 coronary artery dissection with an intact intima can easily be repaired by reapproximating the dissected sinus with bioglue or with teflon felt.6 in cases of coronary intimal detachment , however , bypass surgery is necessary.4 , 5 in patients with acute aortic dissection , left sinus dissection is absent or mild and intimal detachment of the lmca is very rare.7 there are two surgical options for restoring perfusion to the left coronary territory .
the first option is proximal suture closure of the lmca and bypass surgery using two or more grafts to the left coronary artery system.4 , 5 , 6 , 7 this is a simple , commonly used procedure , but it requires two or more grafts . when the distal lmca is nearly intact after the proximal dissected portion is excised , it can be extended with a short reversed saphenous vein graft .
although endtoend anastomosis of the vein graft and the distal lmca can be performed using a continuous suture technique,7 it may be better to use simple interrupted sutures for anastomosing the two obtusely beveled ends to prevent pursestring narrowing of the friable , swollen arterial lumen .
to ensure sufficient perfusion to the left coronary system immediately after surgery , we performed another vein bypass graft from the ascending aortic graft to the left anterior descending artery .
using a short vein graft may also be useful for repairing intimal detachment of the right coronary artery . in this case , | abstractin patients with acute type a aortic dissection , intimal detachment associated with circumferential dissection of the left main coronary artery ( lmca ) is a rare but lethal complication .
we report a marfan patient with dissection and intimal detachment of the lmca that was caused by acute aortic dissection involving the left aortic sinus and that was reconstructed using a short reversed saphenous vein graft .
doi : 10.1111/jocs.12746 ( j card surg 2016;31:348350 )
| PATIENT PROFILE
SURGICAL TECHNIQUE
DISCUSSION |
cancer is defined as an abnormal growth of cells caused by multiple changes in gene expression leading to deregulated balance of cell proliferation and cell death .
cancer is those tumors that have developed the ability to invade the surrounding normal tissues .
cancers are caused by exogenous chemical , physical , or biological carcinogens in humans and the mechanisms of carcinogenesis are often multifactorial and complex .
a cancerous cell is traveling throughout the body using the blood or lymph systems , destroying healthy tissue in a process called invasion , and that cell manages to make new blood vessels to feed itself in a process called angiogenesis .
tumors may activate angiogenic inhibitors ( angiostatin and endostatin ) that can modulate angiogenesis at both the primary site and downstream sites of metastasis [ 3 , 4 ] , when a tumor successfully spreads to other parts of the body using the blood or lymph systems known as metastasis .
cancer is a leading cause of death in the western world . in the united states and a number of european countries , cancer is the second leading destroyer after cardiovascular diseases .
cancer can occur at any age and the average age at the time of diagnosis for cancer is 67 years , and about 76% of all cancers are diagnosed at the age of 55 or older .
although cancer is relatively rare in children , it is the second leading cause of death in children ages of 114 . in this age
the overall death rates due to cancer have almost tripled since 1930 for men and gone up over 50% for women . world health organization ( who ) estimates that some 84 million people will die of cancer between 2005 and 2015 around the world . in 2007 , there were 7.9 million deaths from cancer , around 13 percent of all deaths .
the national institute of cancer research and hospital ( nicrh ) started a cancer registry in 2005 for the first time in bangladesh along with the world health organization ( who ) .
data were collected from 24,847 cancer patients who appeared in the nicrh for the first time . among them , 10,847 ( 57.6% ) were males .
lung cancer was the leading cancer ( 17.3% ) , followed by cancers of breast ( 12.3% ) , lymph nodes and lymphatics ( 8.4% ) , and cervix ( 8.4% ) for sexes combined in all ages . in males ' lung ( 25.5% ) and in females
in children aged 14 years or younger , lymphoma , retinoblastoma , osteosarcoma , leukemia , and kidney cancers were most prevalent .
lung cancer in males and cervical and breast cancer in females constitute 38% of all cancers in bangladesh . according to the who data published in april 2011 , oral cancer deaths in bangladesh reached 11,562 or 1.21% of total deaths .
the age adjusted death rate is 12.52 per 100,000 of population ranking bangladesh 4 in the world .
there are more than one million ( 10 lakh ) cancer patients in bangladesh while approximately 200,000 new patients , mostly women , are added every year creating a social burden on the country [ 8 , 9 ] .
various plants have been used against cancer and tumor in traditional medicine system of bangladesh since many years .
traditional medicine is practiced in bangladesh by folk medicine practitioners , also known as kabirajes who utilize various formulations of medicinal plants in most of their preparations .
we have observed that the kabirajes of various districts and areas use diverse varieties of plants for the treatment of schizophrenia and psychotic problems , cardiovascular problems , eye infections , snakebite , diabetes , gastrointestinal disorders [ 16 , 17 ] , hiv / aids related infections , rheumatoid arthritis , cattle diseases , and so on .
it was objective of the present study to conduct a randomized ethnopharmacological survey to learn more about the medicinal plants used by folk medicine practitioners of bangladesh for the treatment of cancer and also to do comprehensive study on several published articles attributed to the in vivo or in vitro anticancer properties of these species .
the anticipation was that the medicinal plants used by the kabirajes can prove to be a useful source for further scientific studies leading to discovering more efficacious antineoplastic drugs .
the present randomized surveys were carried out between october 2013 and march 2014 , among the kabirajes of three districts of bangladesh , namely , jessore , khulna , and narail .
it is located at 23100 north , 89130 east , bordered by khulna and satkhira district to the south , india to the west , magura and narail district to the east , and jhenaidah district to the north .
khulna and narail district geographically coordinate at 22480 north , 89330 and 23100 north , 89300 east , respectively .
the surveys were conducted with the help of a semistructured questionnaire and the guided field - walk method [ 21 , 22 ] .
kabirajes were asked whether they know about cancer and whether they treat the cancer on a regular basis .
the kabirajes mentioned the plants with which they treated cancer and took the interviewers to spots from where they collected the plants .
plant specimens were collected and dried in the field and later brought back to dhaka for complete identification at the bangladesh national herbarium .
nomenclature of the identified species was documented from the plant list database [ http://www.theplantlist.org/ ] .
a total of 20 plant species were obtained from the kabirajes of the three districts surveyed .
the acanthaceae , cucurbitaceae , and fabaceae family contributed two plants each ; the rest of the families contributed one plant each .
whole plant as well as plant parts like leaves , barks , roots , fruits , and seeds was used for preparing medicine .
roots , fruits , and seeds each constituted accordingly 15.6% , 12.5% , and 9.4% of total uses .
the other plant parts ( whole plant , stem , bark , flower , and tuber ) mentioned constituted , respectively , 9.4 and 3.1% of total uses ( figure 2 ) .
among developed countries , the incidence and mortality rates for various cancers are almost the same .
lung cancer is the most common cancer among men in both developing and developed countries of the world and breast cancer is the most common cancer in women .
annually , the global death rate for cancer is estimated to be more than 6 million people and over 22 million individuals have been diagnosed with cancer worldwide .
many developing countries have intensified their efforts in documenting the ethnomedical data and scientific literature on medicinal plants . in 2000 , natural product derivatives were involved in 14 of the top 35 drugs based on worldwide sales .
medicinal plants have been used for cancer treatment in many countries of the world from a prolonged period of time [ 26 , 27 ] and the treatment or prevention is attributed to their safety , low cost , and oral bioavailability as well ; natural plant derivatives claimed extensive scientific screening and clinical experiments for the development of anticancer drugs . over 3000 plants species
have been reported to have anticancer properties and about 35000 plant samples from 20 countries have been collected and around 114,000 extracts were screened against tumor systems used as a primary screen .
clinically active antineoplastic agents should be able to prolong the survival and decrease the leukocyte count of blood of tumor - bearing animals .
examples of some well - known plant - derived antineoplastic lead compounds along with their specific mechanism of actions are summarized in table 3 .
secondary metabolites are compounds belonging to varied chemical groups that exert biological activities both on human and animal cells
. products of secondary metabolites are the main phytochemical constituents with various pharmaceutical properties serving either as protective agents against various pathogens or growth regulatory molecules .
plant - derived commercial anticancer drugs ( vinblastine and vincristine from catharanthus roseus ) are still produced by isolation from growing plants . in table 4 , we have listed some reported plant - derived chemical compounds from the antineoplastic plants used by the bangladeshi folk health practitioners in the treatment of cancer .
hydroalcoholic seed and leaf extracts of abelmoschus moschatus exhibited antiproliferative activity against colorectal adenocarcinoma and retinoblastoma human cancer cell lines .
the ethanol leaves ' extract of the plant was found to be cytotoxic towards lung fibroblast cells in mtt assay .
another study reported that the plant extract has been shown to prevent dna alterations in a transplantable ehrlich ascites carcinoma - bearing murine model and in enlargement of the survival of the animals against the proliferation of ascites tumor .
ethyl acetate extract of the whole plant of a. ilicifolius has a potential cytotoxic activity on hela cell and kb cell lines by comet assay .
active compounds of a. ilicifolius flower play a role in killing artemia salina nauplii and can be considered as potential cytotoxic agents as well as future candidate for cancer therapy .
the cytotoxicity and antitumor activity of the chloroform extracts of aristolochia indica were assessed in human breast cancer cell line by mtt assay using taxol as standard and showed pronounced anticancer activity against ehrlich ascites carcinoma cell line [ 38 , 39 ] .
aristolochic acid was reported to possess various biological activities including antiadenocarcinoma , antineoplastic , and antitumor activities .
dammarane triterpenoid 1 , isolated from borassus flabellifer seed coat , inhibits tumor necrosis factor- and showed good antiproliferative activity against pancreatic cancer cell line .
apoptosis inducing activity was confirmed based on increased sub - g0 phase cell population in cell cycle analysis , loss of mitochondrial membrane potential , elevated levels of cytochrome c , nuclear morphological changes , and dna fragmentation in mia paca-2 pancreatic cancer cells .
b. flabellifer seed coat extracts were screened in another study for their possible anticancer activity on growth of the hela cells and these preliminary studies indicated that even the lower concentrations of plant extract showed significant antiproliferative activity .
there is an in vitro study that showed that blumea lacera exhibited broad spectrum antileukemic activity against k562 , l1210 , p3hr1 , and u937 leukemia cells .
methanolic extract of b. lacera leaves has also showed cytotoxic activity against human gastric adenocarcinoma cell line , human colorectal adenocarcinoma cell line , and human breast ductal carcinoma cell line .
the interest in anticarcinogenic properties of cannabinoids was renewed after the discovery of the endocannabinoid system .
the administration of 9-thc , 8-thc , and cannabinol inhibited the growth of lewis lung adenocarcinoma cells in vitro as well as in vivo after oral administration in mice .
antitumorigenic mechanisms of cannabinoids are showing their ability to interfere with tumor neovascularization , cancer cell migration , adhesion , invasion , and metastasis .
the mechanism of cannabinoids ' anticancer action depends on the ability of their agents to stimulate autophagy - mediated apoptotic cancer cell death ; thus , cannabinoid action helps in cancer cell death , impairs tumor angiogenesis , and blocks invasion and metastasis and cannabinoids are currently also being tested as anticancer agents in phase i / ii clinical studies .
methanol extract of cucurbita maxima aerial parts has been performed against ehrlich ascites carcinoma model in mice by saha et al . for the antitumor activity and
the results revealed that c. maxima possesses significant anticancer activity which may be due to its cytotoxicity and antioxidant properties .
l - asparaginase is an antineoplastic agent , identified from fruit of c. maxima , used for treatment of a type of cancer that is acute lymphoblastic leukemia and non - hodgkin 's lymphoma as well as being experimentally used as an anticancer agent in human patients [ 54 , 55 ] .
the methanolic extract of d. indica has been found to have significant antileukemic activity in human leukemic cell lines u937 , hl60 , and k562 .
methanolic extracts of betulinic acid were prepared from the d. indica fruits inducing apoptosis in ht-29 cells via mitochondrial dependent pathway and proving to be a potential therapeutic agent for colon cancer .
petroleum ether fraction of the plant showed potential effects against hepa with microstructure abnormality of hepa cells surface .
immune system modulation might be related to antitumor effects of d. bulbifera rhizome , as reported in s180 and h22 tumor cells bearing mice .
the aqueous and methanolic extracts of the leaves of emilia sonchifolia gradually exhibit antitumor activities .
the n - hexane extract of e. sonchifolia has anticancer effect and is rich in terpenoids and terpenoids were evaluated for their potential antineoplastic activity in various human cancer cell lines such as gastric , pancreatic , and colon carcinomas .
steroid derived from the stem bark and the leaves of erythrina variegata showed anticancer activity against in vitro breast cancer cell t47d . alkaloids ( 10,11-dioxoerythratidine and crystagallin a ) extracted from the leaves and stem bark of e. variegata plant strongly stated in vitro anticancer activity against breast cancer t47d cell lines in vitro using the sulforhodamine b ( srb ) assay . the effect of h. auriculata on carbohydrate metabolizing enzymes in n - nitrosodiethylamine induced hepatocellular carcinoma in rats .
the aqueous seed extract from h. auriculata displayed selective cancer cell cytotoxicity with an ic50 value of 0.22 mg ml against colon cancer cells . in vitro study of h. auriculata extracts
ahmad et al . reported antitumor activity from plant extract against chemically induced hepatocarcinogenesis in wister rats .
different leaf extracts of m. oleifera produced significant cytotoxic effects on human multiple myeloma cultured cell lines .
a study showed that leaves extract of m. oleifera can significantly obstruct the growth of cultured human pancreatic carcinoma cells by inhibiting the nf-b signaling pathway .
most of the anticancer studies of m. oleifera have not focused on the molecular basis of the tumor - suppressive activity but strongly suggested that it could potentially be a supreme anticancer candidate specific to cancer cells [ 73 , 74 ] .
the methanolic extract of nymphaea nouchali roots has showed inhibitory activity towards tumor promoter in the raji cells .
in vitro antiproliferative activity of polygonum hydropiper ( synonymy )
extracts was evaluated against cervix epithelial adenocarcinoma , skin epidermoid carcinoma , and breast epithelial adenocarcinoma cells and the results confirmed substantial cell growth inhibitory activity against one or more cell lines .
a triterpenoid compound named cucurbitacin b isolated from trichosanthes kirilowii showed the potent inhibitory activity against hif-1 activation induced by hypoxia in various human cancer cell lines . in vivo studies confirmed the inhibitory effect of cucurbitacin b on the expression of hif-1 proteins , leading to a decrease growth of hela cells in a xenograft tumor model .
cucurbitacin d isolated from the plant has also been shown to suppress proliferation of ht-29 human colon cancer cells and the compound could be potent therapeutic agent for breast cancer by blocking tumor cell proliferation and inducing apoptosis through suppression of stat3 activity and it could also induce apoptosis in human hepatocellular carcinoma cells .
among twenty plant species , four of the species used by folk medicine practitioners have no strong published data regarding anticancer or cytotoxic activities .
these 4 species are c. inerme , m. paniculata , s. sesban , and v. officinalis . from just a brief survey of the literature
, it appears that the rest of the sixteen plants used by the kabirajes in three districts of bangladesh present considerable potential in the treatment of cancer .
further scientific studies need to be conducted on these plants towards discovery of lead compounds , which can lead to formulation of new drugs for the prevention and management of malignant neoplastic diseases with giving less or no side effects . | cancer is a group of diseases which is categorized to differentiate into diverse cell types and move around in the body to sites of organogenesis that is key to the process of tumor genesis .
all types of cancer fall into the group of malignant neoplastic diseases . in bangladesh , cancer is now one of the foremost killer diseases and its personal , social , and economic bearing are huge .
plant - derived natural compounds ( vincristine , vinblastine , etoposide , paclitaxel , camptothecin , topotecan , and irinotecan ) are useful for the treatment of cancer . since there is no extensive ethnobotanical research study in bangladesh regarding the traditional uses of medicinal plants against neoplasms , therefore , a randomized ethnopharmacological surveys were carried out in 3 districts of bangladesh to learn more about the usage of anticancer medicinal plants and their chemical constituents having antineoplastic activity .
comprehensive interviews were conducted to the folk medicine practitioners and medicinal plants as pointed out by them were photographed , collected , deposited , and identified at the bangladesh national herbarium .
the various plant parts have been used by the healers which included whole plant , leaves , fruits , barks , roots , and seeds .
this study evaluated considerable potential for discovery of novel compounds with less side effects in the management and prevention of malignancy in cancer . | 1. Introduction
2. Methodology
3. Results
4. Discussion
5. Conclusions |
circadian rhythms are fluctuations in physiological and behavioral activities that occur over a period of about 24 hours . although these rhythms parallel environmental cycles of light and dark , they are not simply a reaction to environmental fluctuations , but are generated by an endogenous timekeeping mechanism called the circadian clock .
the ability of the clock to persist in the absence of environmental cues provides internal temporal organization so that rhythmic activities can occur at characteristic times during the circadian cycle . in addition , two other clock properties , entrainment ( that is , setting the clock to local time with respect to environmental cycles ) and temperature compensation ( that is , the ability of the clock to run at the same rate at different temperatures ) ensure synchrony with the environment .
the importance of the circadian clock is underscored by its ubiquity ; clocks are present in organisms ranging from prokaryotic and eukaryotic microbes to plants , insects and mammals .
the circadian clock has been conceptualized as a series of three components : an ' entrainment pathway ' that transmits environmental ( usually light ) signals to the timekeeping apparatus ; a timekeeping apparatus , or ' oscillator ' , which operates in the absence of environmental cues and is the core component of the circadian clock ; and ' output pathways ' that are activated at specific times of the circadian cycle by the circadian oscillator .
this framework has enabled us to concentrate on the mechanisms that interconnect these components to form an effective timekeeping system .
naturally , a great deal of effort has been focused on identifying genes that encode pieces of the oscillator - also known as ' clock genes ' .
the increasing volume of genomic and expressed sequence tag ( est ) sequences has rapidly increased the pace of clock gene discovery , particularly in mammals ; and the abundance of newly identified clock genes has given rise to detailed models of the oscillator mechanism .
in contrast , relatively little effort has been put into identifying genes within output pathways , even though these pathways provide the critical links to rhythmic physiology and behavior .
new tools that are now available for expression screening should enable rapid advances in the identification of output genes .
on the basis of studies in cyanobacteria , neurospora , drosophila and mice , the core circadian oscillator mechanism is thought to consist of one or more transcriptional feedback loops . despite this conservation of oscillator mechanisms , oscillator components in cyanobacteria and neurospora
in contrast , oscillator components from drosophila and mice show a high degree of sequence similarity , a property that has fueled recent advances in our understanding of the oscillator . essentially all components of the drosophila and mammalian circadian oscillators have been discovered ( directly or indirectly ) as a result of genetic screens for rhythm mutants . in this review
, i will describe the various clock genes , how they were isolated and how they function within the oscillator ( table 1 , figure 1 ) .
the first clock mutants to be discovered identified the period ( per ) gene from drosophila .
this gene encodes a protein , per , that contains a pas domain ( a protein interaction interface ) .
it feeds back as part of a heterodimer with the timeless ( tim ) protein ( tim ) to inhibit per and tim transcription and activate a gene required for per and tim activation , called drosophila clock ( dclk ) .
this differential effect of per - tim heterodimers on transcription gives rise to high levels of per and tim mrna at dusk and high levels of dclk mrna at dawn .
after many years of searching , pcr - based molecular screens and est searches uncovered three mouse per orthologs ( mper1 , mper2 and mper3 ) .
although all three mper proteins are capable of inhibiting mper1 transcription in cell culture , genetic analysis suggests that mper2 also leads to the activation of bmal1 , a gene required for mper1 activation .
these divergent regulatory functions lead to peaks in mper1 transcription during the day and peaks in bmal1 transcription at night . the protein encoded by tim ,
the second clock gene identified in drosophila , dimerizes with , and stabilizes , phosphorylated per , promotes per localization to the nucleus and is degraded in response to light .
these functions of tim allow for an approximately 6 - 8 hour delay in the accumulation of per protein ( with respect to per mrna ) and entrainment of the oscillator to light .
mammalian tim isologs ( related by sequence ) of human ( htim ) and mouse ( mtim ) have been isolated through est database searches .
although the role of mtim in the mouse oscillator is uncertain , it does not promote nuclear localization of the mpers or mediate entrainment to light as tim does in drosophila .
searching the drosophila genome database has , however , led to the discovery of another tim gene , thus opening up the possibility that mtim is not the true homolog of the drosophila tim clock gene .
the first mammalian clock gene identified as a result of genetic screening for rhythm mutants was mouse clock .
this gene , which was isolated by positional cloning and transgenic bacterial artificial chromosome ( bac ) mutant rescue , encodes a basic - helix - loop - helix - pas ( bhlh - pas ) protein ( clock ) which is required for activating the transcription of other clock genes ( mper1 - 3 , and the genes for mouse cryptochromes 1 and 2 ) and of an output gene ( for vasopressin ) .
clock mediates transcriptional activation as part of a heterodimeric complex with bmal1 - a bhlh - pas protein discovered in a yeast two - hybrid screen for proteins that interact with clock .
although bmal1 mrna levels cycle with a peak early at night and clock mrna levels are constant , the levels of bmal1 and clock proteins have not been characterized .
genetic , dna cross - hybridization and est database screens revealed drosophila homologs of clock and bmal1 , termed dclk and cycle ( cyc ) , respectively . as in mammals ,
this heterodimeric complex also activates tim transcription and inhibits dclk transcription , however , thereby accounting for the antiphase cycling of these transcripts .
in contrast to the situation in mammals , dclk mrna cycles with a peak at dawn and cyc mrna levels are constant . the dclk and cyc protein levels parallel
dclk and cyc mrna levels : dclk peaks during early day and cyc does not vary .
perhaps the only mammalian clock genes that were not discovered ( directly or indirectly ) by genetic screening are the mouse cryptochrome genes , mcry1 and mcry2 .
although these genes were initially thought to encode circadian photoreceptors , on the basis of their similarity to plant blue - light receptor cryptochromes , their protein products ( mcry1 and mcry2 ) in fact function within the oscillator to strongly inhibit transcriptional activation by clock - bmal1 and to mediate mper nuclear localization . as mcry1 and mcry2
are activated by clock - bmal1 heterodimers , high levels of the mcry1 and mcry2 inhibitors at dusk feed back to mediate rhythms in the abundance of mcry1 and mcry2 transcripts which , like mper transcripts , peak during the day . in drosophila , a single cryptochrome ( cry ) gene was identified through pcr - based screening for cry homologs and genetic screening for mutants that alter per - promoter - driven luciferase reporter - gene cycling . unlike its mammalian counterparts ,
drosophila cry is involved in receiving light signals and transmitting these signals to the clock by forming a complex with tim .
in addition to the intricate network of factors involved in transcriptional control , factors that mediate post - transcriptional regulatory events are also required for circadian oscillator function ( figure 1 ) .
one component of the post - transcriptional regulatory mechanism in drosophila is doubletime ( dbt ) , a casein kinase i ( cki ) ortholog that was identified by genetic screening .
dbt phosphorylates , and consequently destabilizes , per , which in turn prevents per from accumulating until it forms a heterodimer with tim .
this post - transcriptional regulation leads to a substantial ( approximately 6 hour ) lag between per mrna and per protein accumulation .
the gene corresponding to the first identified mammalian rhythm mutant , called tau , was recently isolated from hamsters via a groundbreaking positional syntenic cloning approach , and found to be a dbt homolog . like dbt , hamster tau - encoded cki acts to phosphorylate per proteins ( at least mper1 and mper2 in vitro ) .
the defective tau - mutant cki leads to a premature rise in hamster per1 levels , which not only explains the short - period phenotype of tau mutants but also suggests that cki destabilizes hamster per1 .
this explosion of clock gene discovery has also enhanced oscillator analysis in non - mammalian vertebrates such as zebrafish and xenopus
. in zebrafish , homologs to bmal1 ( bmal1 and bmal2 ) , clock and mper3 have been isolated using low - stringency hybridization and degenerate pcr .
homologs of other clock genes ( per and cry ) present in zebrafish est databases and new clock mutants ( g. cahill , personal communication ) should provide a detailed picture of the oscillator in this species .
likewise , the xenopus clock gene was recently described and should fuel the analysis of the frog oscillator mechanism .
the corresponding genes have been isolated , but they are not similar to any known clock genes and do not appear to be part of the core oscillator mechanism .
analysis of additional plant clock mutants should reveal whether oscillator components in plants bear any resemblance to those in other model systems .
the circadian oscillator mechanisms from flies and mice : models depicting the regulatory interactions within the drosophila and mouse feedback loops .
the ' p ' on per and mper represents phosphorylation due to dbt / ck1. the lightning bolt represents light acting on drosophila cry .
circadian clock genes and their functions in drosophila and mice gene symbols are as described in the text .
the ' ? ' for mper1 - 3 and mtim protein function indicates that the indicated activity is presumed on the basis of the clock function of these proteins .
cyc is the drosophila homolog of mouse bmal1 and dbt is the homolog of mouse ck1 and hamster tau .
significant progress has been made in determining how the circadian oscillator keeps time and maintains synchrony with the environment .
relatively little is known , however , about how the oscillator controls rhythmic events so that they occur at particular times of day .
a key to understanding how the oscillator carries out this temporal program is the identification and analysis of output pathways . as rhythmic transcription
is a prominent feature of the oscillator , mechanisms that regulate rhythmic transcription within the oscillator could also be used to control rhythmic expression within output pathways .
rhythmically expressed output genes have been identified in many organisms . in some organisms , such as cyanobacteria ,
rhythmic expression is the rule rather than the exception . in most organisms , however ,
several output genes , including the transcription factors dbp , tef and icer from mice , have been found fortuitously during careful analysis of gene expression .
other clock - regulated genes ( such as that for vasopressin ) were identified because their protein products were expressed in central clock tissues such as the mammalian suprachiasmatic nucleus , and were needed to produce compounds that affect the clock ( for example the enzyme serotonin n - acetyltransferase , which is required for the production of melatonin ) , or were involved in diurnally regulated processes such as photosynthesis ( for example cab and catalase in plants ) .
this identified two clock - controlled genes ( ccgs ) : ccg-1 and ccg-2 ; ccg-2 was later found to be involved in the development of conidia , which are reproductive structures produced in a circadian fashion .
different subtractive hybridization techniques have also been used to isolate ccgs from drosophila , including 20 drosophila rhythmically expressed genes ( dregs ) , crg-1 , and takeout , and ccgs from plants , including sagrp1 and sagrp2 .
another technique that has been used to identify ccgs is differential display reverse - transcription pcr ( dd rt - pcr ) .
this technique was used to identify several ccgs in xenopus , the vrille gene in drosophila and a set of 17 ccgs from arabidopsis .
the advent of dna microarray technology should enable researchers to identify a vast number of ccgs via differential screening of cdnas or predicted genes from whole genome sequences .
this volume of ccgs should reveal a multitude of clock output pathways and should provide clues to the identity of the physiological and behavioral phenomena they control .
searches for ccgs have so far focused mainly on rhythmically expressed mrnas . in a few cases ,
however , rhythms in protein abundance are seen in the absence of underlying mrna rhythms , indicating that potent clock - dependent post - transcriptional mechanisms are operating .
examples include luciferase - binding protein ( lbp ) , which contributes to bioluminescence rhythms in dinoflagellates , and white collar 1 ( wc1 ) , which is an integral component of the oscillator in neurospora . as rhythms in protein abundance
are generally not investigated unless the corresponding mrna cycles in abundance or the protein contributes to a rhythmic phenomenon , it is possible that other cycling proteins emanate from non - cycling mrnas . by coupling proteomics
technology and mass spectrometry - based protein sequence analysis , particularly in organisms whose genomes have been sequenced , it will be possible to detect and identify proteins that cycle in abundance .
once a comprehensive collection of clock outputs is available , we will be better able to understand how the biological clock orchestrates the temporal program that governs the coordinate expression of biological rhythms . | the genetic and molecular analysis of circadian timekeeping mechanisms has accelerated as a result of the increasing volume of genomic markers and nucleotide sequence information . completion of whole genome sequences and the use of differential gene expression technology will hasten the discovery of the clock output pathways that control diverse rhythmic phenomena . | None
Circadian oscillator mechanisms
Clock output pathways |
prenatal alcohol exposure may lead to a range of physical and cognitive abnormalities in children that persist into adulthood ( mattson et al . , 2011 ; riley et al . ,
the range of deficiencies observed in affected individuals is collectively described as fetal alcohol spectrum disorders ( fasd ) ( sampson et al . , 1997 ) , with fetal alcohol syndrome ( fas ) representing the most severe form .
the diagnosis for fasd is based on three major domains of deficiencies : brain growth , cognitive dysmorphology , and facial dysmorphology ( jones and smith , 1973 ; hoyme et al . , 2005 ) .
smaller parietal and frontal white matter volumes and smaller corpus callosum size and/or area have been specifically reported in this population ( archibald et al . , 2001 ; wozniak and muetzel , 2011 ) and may occur in tandem with abnormal gray matter thickness observed in the parietal and frontal cortices ( sowell et al .
change in white matter development over time , however , remains under - investigated in the fasd literature . in typically developing children , post - natal development of white matter
is more protracted than gray matter , and continues during childhood and adolescence and into midlife ( riddle et al . , 2010 ; welker and patton , 2012 ) .
specifically , during childhood and adolescence , there are significant age - related increases in white matter volume , with peak volumes occurring between 12 and 14 years in the frontal and temporal lobes to around 2024 years for the parietal lobes ( giedd et al . , 1999 ;
ge et al . , 2002 ; gogtay et al . , 2004 ; tamnes et al . , 2010 ;
increases in white matter volume are attributed to increases in myelination and potentially to changes in the size , density , and number of white matter fibers over time ( paus et al . , 1999 ; welker and patton , 2012 ) .
past studies have shown that those with fasd demonstrate very little improvement of cognitive function over time , and differences in cognitive ability between exposed and typically developing subjects are even more apparent during adolescence and adulthood ( streissguth et al . , 1991 ) .
cross - sectional relationships between gray and white matter and cognitive function have been assessed previously in this population . for instance , earlier studies from our group have shown significant positive correlations between verbal recall and frontal gray matter thickness only in those with fasd ( sowell et al . , 2008a ) .
similarly , white matter integrity estimated with diffusion tensor imaging ( dti ) and measures of fractional anisotropy ( fa ) in the external capsule ( significant differences near the fronto - temporal region ) have been found to be correlated with performance of visuomotor tasks in individuals with fasd but not in controls ( sowell et al .
others have also found lower fa ( li et al . , 2009 ) and moderate correlations between fa and math performance in individuals with fasd ( lebel et al . , 2010
however , relationships between longitudinal change in white matter and other executive functions over time in those with fasd have not been previously assessed .
while changes in white matter volume and executive function in typically developing children remain under investigated , cross - sectional studies of typically developing cohorts using dti show that higher fa near frontal and parietal areas is positively associated with better reading ability , lexical decision making ( nagy et al .
, 2004 ; gold et al . , 2007 ) and iq ( schmithorst et al . , 2005 ) .
positive relationships have also been reported between lower reaction times and greater white matter volumes in a lifespan sample of healthy volunteers ( walhovd and fjell , 2007 ) .
however , in typically developing children , such relationships are not consistently found , and null results have also been reported when compared with those with fasd ( lebel et al . , 2010 ; treit et al . , 2013 ) .
in the current study , we investigated age - related changes in white matter volume over time within individuals with fasd , and how these changes relate to executive function change over time .
behavior relationships with an executive function battery because of the following : i ) these functions are known to be subserved by these cortical association regions ( smith and jonides , 1997 ; smith and jonides , 1999 ; cabeza , 2008 ) ; ii ) due to the prominent attention and working memory deficits reported in fasd , these structures were hypothesized to be the most likely to be related to the deficits in function .
the corpus callosum was additionally chosen as a roi as numerous studies have previously documented abnormalities in its structure in fasd ( riley et al . , 1995 ; sowell et al . , 2001 ; astley et al . ,
2009 ) , and we hypothesized that this structure would show differential volume changes in children with fasd compared to controls .
hence , we first investigated whether the rate of change in white matter volume in frontal and parietal regions differed between children and adolescents who were typically developing from those with fasd .
secondly , we investigated whether regional white matter volume changes predict the rate of change in executive functions over time and differ in children with fasd and typically developing children .
we expected children with fasd to show smaller white matter volumes even after adjusting for overall brain size .
specifically , we hypothesized that volumes of frontal , parietal and total white matter would be smaller in participants with fasd than in controls independent of brain size and age .
given that previous studies have consistently found positive relationships between measures of white matter macro- and microstructure and cognitive function in fasd , we expected positive brain behavior relationships in children with fasd , but not in controls .
all participant data were obtained as part of the longitudinal collaborative initiative on fetal alcohol spectrum disorders ( cifasd ) and included subjects from los angeles , california .
participants were recruited via advertisements and word - of - mouth , and alcohol exposed participants were also recruited through the fetal alcohol and related disorders clinic at the university of california , los angeles .
prenatally exposed participants were identified as those who were exposed to more than 4 drinks per occasion at least once per week or more than 13 drinks per week during pregnancy .
control subjects had none or less than 2 drinks ( per week or on any one occasion ) throughout pregnancy .
participants with incomplete exposure documentation were classified as alcohol exposed if they displayed the physical characteristics of fetal alcohol syndrome ( fas ) as documented by an expert dysmorphologist . in the case of adoptive children , information about maternal alcohol use during pregnancy was gathered through sources other than the biological parent during the developmental history interview ( stratton , 1996 ; hoyme et al . , 2005 ) .
out of the 49 fasd children in the study , only 7 children were living with their biological parents , and the rest were adopted .
detailed explanations of fasd diagnosis for cifasd have been published previously ( jones et al . , 2006 ; mattson et al . , 2010
a total of 103 participants were included in the study , out of which 49 were classified as having fasd and 54 as controls . of these , data were available for 41 participants ( 25 with fasd , 16 controls ) for two time points . for the remaining 38 controls and 24 participants with fasd , data were available for one time point .
mean ages , scan intervals , and other demographic variables are presented in table 1 .
there were no significant differences in age , sex , or severity of diagnosis between participants who did and did not return for a follow - up visit .
scans were acquired on 1.5 t siemens sonata , tr = 1900 ms , te = 4.38 ms , flip angle = 15 , matrix size = 256 256 160 ; fov , 256 256 mm ; total acquisition time = 8 min 8 s , voxel size = 1 1 1 mm .
freesurfer allows for semi - automatic reconstruction of the cortical surface using t1-weighted mri images .
major steps during image analyses include motion correction , removal of non - brain tissue , automated talairach transformation , subcortical and cortical matter segmentation , intensity correction and delineation of gray / white / pial boundaries ( dale et al . , 1999 ;
after the formation of cortical models , deformable procedures are applied including cortical inflation , registration to a spherical atlas and parcellation of the cerebral cortex into gyral and sulcal units ( desikan et al . , 2006 ) .
for the participants with data at two time points , the structural scans were additionally processed through the longitudinal stream ( reuter et al . , 2010 ) .
after initial processing by freesurfer , all mri scans were visually checked slice - by - slice to ensure there was no misclassification of gray and white matter voxels ; scans were reprocessed if errors were detected and rechecked visually a second time . using the inbuilt atlas ( fischl et al . , 2004 ) , the volumes of the superior frontal , middle frontal , superior frontal , supramarginal , superior parietal , inferior parietal , and corpus callosum white matter , as well as total white matter volume was obtained from freesurfer and imported to spss 19.0 for preliminary analyses .
left and right hemisphere volumes for each region in the frontal and parietal cortices were added to give bilateral estimates to reduce numbers of hypothesis tested .
. performance on verbal working memory was measured through digit - backward span ( db ) , while attention was measured through digit - forward span ( df ) , both subtests of the wechsler intelligence scale for children , fourth edition ( wisc - iv ) ( wechsler , 2003 ) . attention and processing speed
were measured through the trail making test a ( tmt - a ) and mental flexibility was measured with the trail making test b ( tmt - b ) ( reitan and wolfson , 1985 ) .
finally , free recall was measured through california verbal learning test c ( cvlt - c ) for delayed total free - recall ( delis et al . , 1987 ) . for db ,
total completion times in seconds were utilized for tmt - a and -b , hence higher scores represent poorer performance .
the cognitive tests utilized in the study are widely used in neuropsychological examinations and their test retest reliabilities have been previously reported by other studies ( for cvlt - c see paolo et al . , 1997 ; for db see iverson , 2001 ; and for tmt - a and -b see cangoz et al . , 2009 ) .
descriptive statistics were analyzed using spss ( v 19.0 . ) and are presented in table 1 .
this allowed us to confidently assess white matter volumes in the age ranges between 6 and 17 . to minimize the effects of attrition
, we adopted the linear mixed modeling ( lesaffre and verbeke , 1998 ; rabe - hesketh et al . , 2001 ) and maximum likelihood approaches , which are able to estimate the most likely parameters based on available time points and are robust to missing data .
changes in white matter volume , as well as change in cognitive function over time were modeled taking sex , age , and icv into account .
first , the effects of age and status ( prenatal alcohol exposure status : controls , fasd group ) on white matter volumes were investigated for total white matter and each region of interest ( roi ) separately . in the model , volumes were dependent variables while age , status , sex , icv , and the interaction term of age - by - status were fixed variables .
a significant effect for group status indicated significantly different volumes between the groups , while a significant effect for age indicated a significantly different volume with age .
a significant age - by - status interaction would indicate a significant volume difference between groups in relation to age .
for the second set of analyses , the effects of change in cognitive variables were modeled for each white matter roi , and additionally included two - way interactions for roi - by - age , roi - by - status , age - by - status , and finally the three - way interaction of roi - by - age - by - status .
age , sex , icv , and status were again included as fixed variables , and subject intercept was included as a random variable . for significant three - way interactions , roi - by - age interactions were also separately investigated for each group ( controls / fasd group ) to determine which group was driving the relationship among the variables .
similar to the first set of analyses , these analyses allowed us to determine if status ( i.e. , being alcohol exposed or not ) , age , and age - related change in white matter volume were differentially related to change in cognitive function .
mean age for controls was 11.83 ( 2.93 ) years and for the fasd group was 11.15 ( 2.81 ) years .
there was no statistically significant difference in age between groups ( p= 0.54 ) .
mean interval between scans was 2.36 ( 3.05 ) years for controls and 2.46 ( 2.98 ) years for the fasd group .
independent sample t - tests revealed that cognitive function was significantly poorer in fasd participants compared to typically developing controls in tmt - b , df , db , and cvlt - c .
mean times for tmt - a were higher in those with fasd but were not significantly different from controls ( fig . 2 , table 1 ) .
as predicted , for both groups , age was significantly related to white matter volume change over time in each of the frontal and parietal regions , including total white matter and corpus callosum , except in the supramarginal region ( table 2 ) . also as predicted , participants with fasd had significantly smaller regional volumes than controls , and this difference remained significant even after adjusting for intracranial volumes , for the corpus callosum ( t = 2.18 , p= 0.031 ) , middle frontal ( t= 2.24 , p= 0.027 ) , supramarginal ( t= 2.58 , p= 0.037 ) , and inferior parietal regions ( t= 2.11 , p = 0.011 ) .
both groups showed similar rates of increase in regional white matter volumes and there were no significant age - by - status interactions for any of the regions investigated .
both groups improved with age significantly on all cognitive tests ( table 3 ) . after controlling for age , controls were also significantly better than those with fasd over time on all cognitive tests except tmt - a ( table 4 ) .
differential relationships between increased white matter volume and improved cognitive function were observed between the two groups ( table 4 ) .
such roi - by - status interactions were significant for i ) df for increases in volumes of corpus callosum ( t = 3.08 , p= 0.002 ) , inferior parietal ( t= 2.27 , p = 0.03 ) , middle frontal ( t= 2.28 , p = 0.03 ) , superior parietal ( t = 2.23 , p= 0.02 ) , inferior frontal ( t= 2.34 , p= 0.02 ) , and total white matter ( t= 2.35 , p = 0.02 ) ; ii ) tmt - b times for increases in volumes of corpus callosum ( t = 2.20 , p= 0.02 ) , inferior parietal ( t= 2.37 , p = 0.02 ) , supra marginal ( t= 2.30 , p = 0.03 ) , middle frontal ( t= 2.26 , p = 0.03 ) , and superior frontal ( t= 2.03 , p= 0.04 ) regions ; and iii ) db for corpus callosum volume increase ( t = 2.04 , p = 0.04 ) .
these findings showed that there were significant differences in change in cognitive function and change in volumes between those with fasd and controls .
follow - up analyses confirmed the direction of the findings , where larger white matter volumes were related to better performance in those with fasd , but not in controls .
in addition , only fasd participants showed significant relationships between white matter volume increase and better cognitive function with increasing age ( table 4 ) .
such three - way interactions ( roi - by - status - by - age ) were significant for i ) df for increases in volumes of corpus callosum ( t = 3.65 , p < 0.001 ) , inferior parietal ( t= 2.08 , p= 0.04 ) , middle frontal ( t = 2.08 , p= 0.04 ) , superior frontal ( t= 2.26 , p= 0.03 ) , inferior frontal ( t= 2.26 , p= 0.03 ) , and total white matter ( t= 2.63 , p < 0.01 ) ; ii ) cvlt - c long delay free recall for corpus callosum ( t = 2.11 , p = 0.04 ) .
such significant interactions show that the relationship between regional white matter volume , age , and cognition is mediated differently in the fasd and control groups
. analyses of t - values from tables 3 and 4 reveal that individuals with fasd have consistently lower cognition and volumes compared to controls .
finally , follow - up analyses conducted for each group separately revealed significant roi - by - age interactions for all of the regions with significant three - way interactions in the fasd group , but not in the control group . in contrast , while controls showed a significant positive effect of age on cognitive function , none of the interactions with age were significant for any of the cognitive variables .
a representative plot for significant three way interactions for each group has been presented in fig .
as highlighted in the plot , the relationship between white matter volume and cognitive function increases with age in the fasd group ( i.e. , increases in volume with age are related to better improvements in cognitive scores ) , but such relationships with age are not significant in controls .
we show for the first time that age - related regional increase in white matter volume is differentially related to cognitive change between children with fasd and typically developing children . specifically , age - related increases in callosal , frontal , and parietal white matter volume showed significant associations with cognitive improvements in children with fasd , but this relationship was not observed in those that were typically developing . since both groups showed improvement of cognitive performance and increases in white matter volume during the periods examined , results support the fact that age - related plasticity in white matter structure impacts the development of cognitive function in fasd children and adolescents .
these findings suggest that fasd - related disturbances or disorganization of white matter structure contribute to cognitive impairments over time in individuals with fasd and/or that variations in other structural characteristics not measured here ( such as gray matter volume or thickness ) play a more central role in cognitive development in typically developing controls .
abnormalities in white matter macro- and micro - structure are widely documented in fasd ( riley et al . , 1995 ; sowell et al .
, we have extended these findings to show that while developmental trajectories for white matter volume continues at the same rate as typical children , these trajectories have a strong positive effect on cognitive function in those with fasd .
these findings may have implications for continuing effective social and behavioral support for better health , and socioeconomic status shown to relate to better brain outcomes in those with fasd that may in turn have long - lasting positive effects on executive function .
results revealed that both typically developing children and those with fasd showed significant improvement of cognitive function over time , and age and time were significantly related to cognitive function for both groups .
significant group differences still remained for all the cognitive variables after taking age into account , and fasd children performed more poorly than typically developing children for all tasks examined with the exception of the tmt - a , which showed a trend for faster completion times in controls .
these results suggest that while those with fasd do not catch up to typically developing children in standardized tests , they nonetheless make significant improvements in cognitive function over time .
since results show that those with fasd can potentially improve in executive functioning with age , it appears to be of particular importance to enhance opportunities to support the social and behavioral development of those with fasd .
environmental support is especially relevant , as previous studies have shown that the biological parents of those with fasd have poorer health behaviors and education and are of lower socioeconomic status ( ses ) ( streissguth et al . , 2004 ;
furthermore , other studies of early life adversity have been related to smaller white matter volume ( teicher et al . , 2004 ) while adequate care early in life in typically developing children is associated with greater white matter volume later on ( als et al . ,
these results suggest that providing an environment with health and educational opportunities at home and in the community for those with fasd might continue to enhance overall cognitive development .
given that most of the children with fasd in the current study were not living with biological parents , but instead with adopted families , it is possible that participants in this study were exposed to improved home and school environments , which might have led to better brain and cognitive outcomes .
similarly , although individuals with fasd had significantly smaller white matter volumes at both time points , results revealed that the rate of increase in white matter volume with age is similar in the two groups : there were no significant exposure status - by - age interactions for change in white matter volume .
these findings suggest that even though those with fasd begin with smaller white matter volumes , this does not affect the subsequent increase / development of white matter over time in this population .
furthermore , results also showed that despite having smaller volumes , these differences only remained significant for the middle and superior frontal and the supramarginal regions for individuals with fasd after taking brain sizes into account .
our results of similar rate of white matter volume increase in those with fasd are in contrast with studies of gray matter development , where rates of change of gray matter have been found to be different between fasd and control children .
( 2012 ) found that while control children showed an inverted - u shaped development of the gray matter , those with fasd only showed linear decreases implying different timing of gray matter maturation between these two populations . hence , while gray matter development seems to show ongoing difference in developmental trajectory between groups , our results suggest that differences in white matter are static with pronounced but stable group differences .
these results could possibly be explained through the different developmental timelines for gray and white matter .
though some fiber connections develop early , the majority of white matter development ( myelination and changes in the size , density and organization of axons ) continues to develop after birth ( welker and patton , 2012 ) and increases in volume are reported at least until the first four decades of life ( thompson et al .
, 2005 ; riddle et al . , 2010 ) . hence , postnatal development of white matter occurs after the direct teratogenic effect of alcohol in utero .
, 2012 ; rubia , 2013 ) , hence the initial brain neurons may be directly affected by alcohol for a longer period .
gray matter volume also has a narrower developmental trajectory , as volumes peak in early adolescence ( giedd et al .
while no longitudinal studies addressing white matter volume development over time in fasd children exist , follow - up on preterm children have shown that after controlling for brain size , gray matter volumes are more affected than white matter at adolescence ( cheong et al . , 2013 ) .
hence , it is possible that , due to its relatively prolonged maturation period , white matter development could be more resistant to the long - lasting effects of prenatal alcohol exposure and/or be more amenable to plasticity relating to environmental factors .
future investigations should test our findings across a wider age range to verify the long - term effects of prenatal alcohol exposure beyond adolescence .
further , as mentioned above , increase in white matter volume showed different relationships with cognitive function depending on exposure status .
specifically , performance in df improved with age and larger white matter regional volumes in those with fasd . however , for typically developing children who also improved over time in cognitive function , this relationship was not shown as mediated by white matter volume increases .
significant interactions were also observed for db and cvlt - c where increased callosal volume with age was related to better cognitive function in the exposed group .
these results were less robust than those observed for tests of attention capacity and correlations were significant predominantly for the corpus callosum .
overall , our findings suggest that in typically developing children , cognitive function may rely more heavily on other neurodevelopmental changes in brain macro- or microstructure .
for instance , previous research has also shown that relationships between brain measures and cognitive function are stronger in study populations with neurological disorders , whereas such brain structure relationships during normal development are less consistently found ( van petten , 2004 ; treit et al . , 2013 ) .
thus , in a typically developing population , it is possible that the contribution of other neurodevelopmental processes might mask white matter contributions , making these relationships harder to detect .
in contrast , children with fasd have documented abnormalities of gray matter structure as well as function .
for instance , abnormal activation of the parietal and frontal cortices ( ohare et al . , 2009 ; meintjes et al . ,
2010 ) as well as atypical morphology of cortical regions ( riley et al . , 1995 ; mattson et al . ,
1996 ) have been previously reported . for children with fasd , typical relationships between gray and white matter structure and their connectivity across the brain
since children with fasd have smaller overall white matter volumes compared to age - matched typically developing peers , increase of white matter might significantly contribute to better communication among brain regions and consequently lead to improved cognitive abilities .
since increases in white matter volume are at least partly attributable to age - related increases in myelination ( welker and patton , 2012 ) , improvements in conduction velocity of axonal fibers may facilitate communication among brain regions .
not surprisingly , the time course of increased myelination is related to language function in typically developing young children ( pujol et al . , 2006 ) and may provide a possible explanation for the improvement of executive function with age in the current sample .
several factors may contribute to our observations for more pronounced group differences in attention than in other functional domains such as mental flexibility as measured by tmt - b .
first , since tasks like working memory and recall require more complex functional networks for successful task completion , it is possible that gross measures of white matter volume were not sensitive to variations associated with these specific cognitive functions .
second , only a small proportion of the participants in the fasd group had the full fas diagnosis ( n= 5 ) .
less severe neuropsychological deficits have been previously documented for children in the spectrum compared to those with full fas , and children with fetal alcohol effects but without the facial dysmorphology or growth abnormalities to warrant an fas diagnosis can show normal iq and display only subtle behavioral or cognitive deficits .
hence , the results could be more representative of those with less severe deficits who show fewer differences from control children in executive tasks . although we did not find differences in the developmental trajectory of white matter volume between diagnostic groups , it is possible that there might be changes occurring at the microstructural level .
for instance , a recent study has found different rates of white matter maturation using dti measures between controls and children with fasd ( treit et al . , 2013 ) .
although this study did not examine executive functioning , they reported positive correlations between change in mean diffusivity ( the overall magnitude of water diffusion in a voxel ) and reading scores in the fasd group .
future longitudinal research will need to clarify relationships between diffusion imaging indices of white matter integrity and structural connectivity and executive functions .
in addition , while we included participants with data on both first and follow - up visits in order to increase power in detecting significant relationships , this is a limitation of our study and our findings need to be understood in this context .
although there were no significant age , sex , or diagnosis severity differences in participants who did and did not complete the follow - up study , there might be other unknown factors that determined attrition .
finally , additional time points of 3 or more , would also have allowed us to assess more detailed changes in developmental trajectories . since development is a time of rapid change , it is possible that increasing the sample size and sampling at more time points would have allowed us to detect other subtler group differences .
this study showed that while the rate of development of white matter volume is similar with age in both typically developing and exposed children , there are differential relationships between cognitive function and white matter change over time .
specifically , for those with fasd , age - related increases in volumes were related to better cognitive function , while for controls , this positive relationship was not detected .
findings suggest that increasing white matter volume with age allows those with fasd to improve in their cognitive abilities over time , possibly by facilitating information processing among connected brain areas .
findings also suggest that better cognitive outcomes could be possible for fasd subjects through interventions targeting better cognitive and behavioral outcomes through education and/or other environmental factors . | prenatal alcohol exposure can cause a wide range of deficits in executive function that persist throughout life , but little is known about how changes in brain structure relate to cognition in affected individuals . in the current study , we predicted that the rate of white matter volumetric development would be atypical in children with fetal alcohol spectrum disorders ( fasd ) when compared to typically developing children , and that the rate of change in cognitive function would relate to differential white matter development between groups .
data were available for 103 subjects [ 49 with fasd , 54 controls , age range 617 , mean age = 11.83 ] with 153 total observations .
groups were age - matched .
participants underwent structural magnetic resonance imaging ( mri ) and an executive function ( ef ) battery .
using white matter volumes measured bilaterally for frontal and parietal regions and the corpus callosum , change was predicted by modeling the effects of age , intracranial volume , sex , and interactions with exposure status and ef measures . while both groups showed regional increases in white matter volumes and improvement in cognitive performance over time
, there were significant effects of exposure status on age - related relationships between white matter increases and ef measures .
specifically , individuals with fasd consistently showed a positive relationship between improved cognitive function and increased white matter volume over time , while no such relationships were seen in controls .
these novel results relating improved cognitive function with increased white matter volume in fasd suggest that better cognitive outcomes could be possible for fasd subjects through interventions that enhance white matter plasticity . | Introduction
Materials and methods
Results
Discussion
Conclusions |
toxic epidermal necrolysis ( ten ) is typically a drug - related fatal disease characterized by necrosis and destruction of the entire epidermal skin layer .
nephrotic syndrome ( ns ) is treated with steroids such as prednisolone ( pd ) . however , because of the adverse effects , such as osteoporosis , growth retardation , and weight gain , associated with pd treatment , other drugs with fewer side effects , such as deflazacort ( dfz ; an oxazoline derivative ) , have been recommended . among the 94 patients with ns who received steroid therapy in sanggye paik hospital , seoul , korea between 2001 and 2012 , three patients who received dfz developed ten .
we have reported one of these cases previously ; herein , we describe the two other cases of ten related to dfz in two boys aged 4 years and 14 years .
a 14-year - old boy , who was diagnosed with ns at 8 years of age , received pd as the initial treatment .
after 4 months of pd treatment , remission was achieved . however , because of ns relapse , the treatment was switched to dfz for 14 days ; dfz treatment was then tapered .
he was also receiving risperidone ( 0.5 mg , bid ) and atomoxetine ( 25 mg qd ) since 8 years of age for the treatment of mental retardation .
after 6 years , he again received dfz ( 24 mg tid ) daily owing to proteinuria .
after a 17-day treatment period , pruritic papules and patches appeared on the lower extremities .
he was admitted 19 days after medication was initiated , after the skin lesions indicated an extensive spread within 3 days .
laboratory tests revealed a white blood cell count of 7,040 cells / mm , c - reactive protein level of 0.3 mg / dl , and negative results for human immunodeficiency virus and mycoplasma pneumonia antigen . on hospital day 2 , the skin could be easily peeled off , similar to that noted in burn injuries ( fig .
hence , he was transferred to the intensive care unit for infection prevention and conservative care .
intravenous immunoglobulin - g ( iv - ig ; total , 4.51 g / kg ) was administered according to the severity of the skin lesions .
after discharge , the ns has been controlled by switching the treatment to pd , and the patient has consistently taken risperidone . thus far , he has not experienced any skin complications .
a 4-year - old boy who was diagnosed with ns was receiving dfz ( 24 mg tid ) and enalapril ( 5 mg qd ) .
after 41 days , he presented with papules and blisters around the mouth and on the palms and soles ( fig .
the initial white blood cell count was 14,720 cells / mm and the c - reactive protein level was 1.4 mg / dl .
erythematous papules and blisters rapidly spread on his body ( 50% ) within 3 days .
ceftriaxone was injected , and iv - ig ( total , 4 g / kg ) was administered for 13 days according to the extent of skin complications . from day 20 after hospital admission ,
thereafter , the medication was switched to pd , and he has not experienced a relapse thus far .
a 14-year - old boy , who was diagnosed with ns at 8 years of age , received pd as the initial treatment .
after 4 months of pd treatment , remission was achieved . however , because of ns relapse , the treatment was switched to dfz for 14 days ; dfz treatment was then tapered .
he was also receiving risperidone ( 0.5 mg , bid ) and atomoxetine ( 25 mg qd ) since 8 years of age for the treatment of mental retardation .
after 6 years , he again received dfz ( 24 mg tid ) daily owing to proteinuria .
after a 17-day treatment period , pruritic papules and patches appeared on the lower extremities .
he was admitted 19 days after medication was initiated , after the skin lesions indicated an extensive spread within 3 days .
laboratory tests revealed a white blood cell count of 7,040 cells / mm , c - reactive protein level of 0.3 mg / dl , and negative results for human immunodeficiency virus and mycoplasma pneumonia antigen . on hospital day 2 , the skin could be easily peeled off , similar to that noted in burn injuries ( fig .
hence , he was transferred to the intensive care unit for infection prevention and conservative care .
intravenous immunoglobulin - g ( iv - ig ; total , 4.51 g / kg ) was administered according to the severity of the skin lesions .
after discharge , the ns has been controlled by switching the treatment to pd , and the patient has consistently taken risperidone . thus far , he has not experienced any skin complications .
a 4-year - old boy who was diagnosed with ns was receiving dfz ( 24 mg tid ) and enalapril ( 5 mg qd ) .
after 41 days , he presented with papules and blisters around the mouth and on the palms and soles ( fig .
the initial white blood cell count was 14,720 cells / mm and the c - reactive protein level was 1.4 mg / dl .
erythematous papules and blisters rapidly spread on his body ( 50% ) within 3 days .
ceftriaxone was injected , and iv - ig ( total , 4 g / kg ) was administered for 13 days according to the extent of skin complications . from day 20 after hospital admission , the patient showed improvement in the symptoms , and was subsequently discharged . thereafter , the medication was switched to pd , and he has not experienced a relapse thus far .
ten is a rare but life - threatening disease that involves the skin and mucosa , and is usually caused by certain drugs .
a few recently published cases indicate that ten might be induced by steroid use , , . in particular , at our center , 40 patients treated with pd did not develop ten , but three of 54 patients treated with dfz developed ten . in case 1 , despite the initial treatment with pd and dfz , no skin complications developed at that time .
however , after readministration of high - dose dfz for more than 2 weeks , ten developed .
after remission was achieved , rashes did not reappear even after switching the treatment to oral pd .
the reaction severity decreases following the discontinuation of drug administration and develops more rapidly on drug readministration . in case 1 ,
however , these drugs were administered 6 years previously and the patient did not present side effects at that time .
consistent with the findings in case 2 , kim et al reported that ten developed in a patient with ns treated with dfz and enalapril .
after approximately 4 weeks of treatment , the condition progressed from erythematous papules to ten .
captopril was reported to possibly cause ten , whereas enalapril may be a causative agent for ten when combined with dfz .
enalapril and captopril have been suggested to be powerful acantholytic drugs in vitro , and the active amide group of both drugs could induce acantholysis .
however , papay et al , in their extensive review of sjs / ten , have classified both drugs as
kim and kim et al also reported cases of sjs and ten caused by the use of dfz ( table 1 ) .
their patients did not receive any other medication , except for dfz , over 8 weeks .
ten is considered to be associated with exposure to an agent during an 8-week period prior to disease onset . to confirm the relationship between ten and dfz
kim has suggested that dfz may be a possible cause of sjs , based on the results of skin tests and provocation tests using dfz . in the present cases , a rechallenge with dfz
the relationship between corticosteroids , especially dfz , and ten remains controversial , and its exact mechanism is not known .
roujeau et al suggested that the risks were particularly increased for patients who had recently started receiving therapy ( within 2 months ) with most of the commonly questionable agents , including corticosteroids .
an immunosuppressive mechanism involving corticosteroids might play a role in the pathophysiology of sjs / ten . in numerous cases of sjs / ten
, the use of multiple medications or co - use of drugs may cause the development of sjs / ten .
however , most importantly , the only medication that was common between the cases and was taken within 8 weeks prior to disease onset was dfz .
therefore , we hypothesized that dfz was more likely to be the potential cause of ten , compared with other medications , although we could not exclude the possible additional role of enalapril in case 2 . in most cases ,
ten is almost exclusively attributed to drugs ; however , infections by viruses , bacteria , and mycobacteria could trigger the development of ten in association with drugs . because infection tests , such as herpes simplex virus tests , other than those for m. pneumonia and human immunodeficiency virus , were not performed in the present cases
nevertheless , from the viewpoint of immune suppression , it should be noted that ten did not develop in patients treated with pd .
several cases have demonstrated an association between secondary glomerular nephritis such as that in systemic lupus erythematosus and ten . in the present cases ,
renal biopsies were not performed owing to the parents refusal to undergo this examination ; however , no serological abnormalities were noted with regard to the rheumatoid factor , antinuclear antibody , and complement levels .
iv - ig likely affects a combination of many pathways that results in blocking of the interaction of fas with fasl . in patients with ten , an iv - ig dose of 24 g / kg
the patients were administered a total dose of 4.51 g / kg over 18 days and 4 g / kg over 13 days .
g / kg during the first 5 days of the onset of skin eruption , which was reduced depending on the severity of the skin lesions .
no adverse effects related to iv - ig therapy , including cephalgia , low - grade fever , flushing , chills , and myalgia , were noted .
the patients needed to be isolated and to be administered supportive care such as wound management , fluid replacement , respiratory and nutritional support , careful monitoring , and pain management .
the reason for the development of ten in dfz patients and not in pd patients is not yet clear .
moreover , the effect of the combination of medications or infection on the development of ten is unclear . nevertheless ,
because of the rapid , progressive , and fatal course of ten associated with dfz , we believe that it is essential to perform additional multilateral research and safety evaluations of dfz , and that clinicians should be aware of the serious side effects of this drug when treating cases of ns . | toxic epidermal necrolysis ( ten ) is a drug - related fatal disease .
extensive necrosis of the epidermis can lead to serious complications .
this report describes two cases of ten , associated with deflazacort ( dfz ) , in two boys , aged 4 years and 14 years , with nephrotic syndrome ( ns ) .
the 14-year - old male teenager received dfz following ns relapse .
after 17 days , pruritic papules appeared on the lower extremities .
another case involved a 4-year - old boy receiving dfz and enalapril . after a 41-day dfz treatment period
, erythematous papules appeared on the palms and soles . within 3 days
, both boys developed widespread skin lesions ( > 50% ) and were admitted to the intensive care unit for resuscitative and supportive treatment .
the patients showed improvement after intravenous immunoglobulin - g therapy .
owing to the rapid , fatal course of ten , clinicians need to be aware of the adverse effects of this drug when treating cases of ns . | Introduction
Case report
Case 1
Case 2
Discussion
Conflict of interest |
adjacent segment disease ( asd ) following uninstrumented anterior cervical discectomy and fusion ( acdf ) has been reported to have an incidence of 2.9% per year and occur in approximately 25% of cases within 10 years.1 while it is not entirely clear how much this represents an increase over the natural history of disc degeneration , one of the most compelling arguments for total disc arthroplasty has been the potential for decreasing adjacent segment degeneration .
the rationale is that arthroplasty helps to preserve the biomechanics of the normal spine at the operated level and hence helps to maintain the normal biomechanical environment at the adjacent level .
this article critically examines the evidence that cervical artificial disc replacement has lived up to the promise of minimizing adjacent level disease .
from comparative studies of cervical total disc arthroplasty ( c - adr ) with acdf in patients with at least 24 months follow - up : what is the rate of asd following c - adr compared with the rate following fusion ?
is there a difference in the timing of asd development between c - adr and acdf ?
inclusion criteria : studies comparing c - adr with acdf using concurrent control group with a focus on studies with longer follow - up ( 4860 months ) of primary us food and drug administration ( fda ) trials of prestige st , prodisc - c , and bryan devices as available .
trials of other discs with a minimum of 24 months follow - up were considered for inclusion .
exclusion criteria : non - fda trials on discs for which long - term data were available .
four additional studies were excluded : three substantially overlapped with other studies ; and one only reported results from a single site of a large multicenter clinical trial , and data on the full study were available .
pooling of data was not done because of concerns regarding heterogeneity of treatments and populations as well as study quality .
study design : systematic review . search : medline / pubmed and bibliographies of key articles .
inclusion criteria : studies comparing c - adr with acdf using concurrent control group with a focus on studies with longer follow - up ( 4860 months ) of primary us food and drug administration ( fda ) trials of prestige st , prodisc - c , and bryan devices as available . trials of other discs with a minimum of 24 months follow - up were considered for inclusion .
exclusion criteria : non - fda trials on discs for which long - term data were available .
four additional studies were excluded : three substantially overlapped with other studies ; and one only reported results from a single site of a large multicenter clinical trial , and data on the full study were available .
pooling of data was not done because of concerns regarding heterogeneity of treatments and populations as well as study quality .
1 ) . four reported results from two large , multicenter randomized controlled trials ( rct ) , coe ii , comparing cervical total disc arthroplasty ( prestige and bryan discs ) to anterior cervical discectomy and fusion ( acdf).2,3,4,5 two reports overlapped but use different definitions of asd;2,5 thus , only the most complete report was included for analysis.5 one additional study6 reported results from a smaller multicenter rct ( coe ii ) , comparing c - adr ( kineflex|c ) with acdf , and one study,7 which reported only the results from a single clinical site of a large multicenter rct was excluded .
two nonrandomized prospective studies ( coe iii ) compared c - adr with acdf.8,9 in addition , three cohort studies ( coe iii ) reported combined results of several multicenter rcts of different c - adr disc devices being performed at a single site,10,11 or multiple clinical sites;12 however , there was overlap between two studies11,12 and only the most complete was included for analysis.12 thus , eight reports of comparative studies are critically summarized,3,4,5,6,8,9,10,12 four of which were from three rcts3,4,5,6 three reports of two trials describing adjacent segment range of motion ( rom ) were identified,13,14,15 two of which were in the same patient population .
the more complete published analysis was included.14 populations were predominantly female and younger ( table 1 ) .
different c - adr disc devices were used including : prestige , bryan discocerv / discover , mobi - c , kineflex / c , and advent .
six studies report results comparing a single disc device with acdf , and two report results from multiple disc devices . definitions of symptomatic asd were all based on rate of reoperation at the adjacent level ; however , definitions of radiographic asd differed substantially between studies ( table 1 ) .
longer - term data ( 4860 months ) for the prestige5 and bryan3 discs were available .
data at 24 months from the fda investigational device exemption ( ide ) trial of kineflex / c discs were available.6 further details on the class of evidence ( table 2 ) ratings and study characteristics for these studies can be found in the web appendix at www.aospine.org/ebsj .
the difference in risks of symptomatic asd were similar across studies ( range of risk difference between treatment arms : 1.5%2.3% ) , and was only marginally significant for one study at 24 months.4 at 24 months , one rct reported a marginally significant decreased risk of symptomatic asd in the prestige disc treatment group;4 however ; two additional fda rcts using other devices reported no differences in the rates of symptomatic asd between treatment arms at 24 months.5,6 in studies with longer follow - up , rates of symptomatic asd increased in both treatment groups over time ; however , there were no statistically significant differences in rates of symptomatic asd between treatment groups at either 48 or 60 months.3,5 low follow - up rates in these reports should be considered when interpreting these results . in a secondary analysis of rct data from two sites ( disc types not reported ) ,
asd was defined as clinico - radiographic evidence of asd and use of active intervention for management ( surgery or conservative treatment ) . at
last follow - up ( median , 38 months ) , 16.8% of c - adr and 14% of patients with acdf were considered to have asd.12 radiographic asd ( fig .
3 ) the primary evidence for this outcome is from cohort studies ( coe iii )
. rates of radiographic asd differed dramatically across studies ( 8%27% for c - adr and 10%44% for acdf ) , likely due to differences in definitions of radiographic asd .
one rct reported a significant decreased risk of radiographic asd in the kineflex / c treatment group.6 this same study reported , however , similar rates of symptomatic asd between groups . in cohort studies with longer follow - up,8,9
there were no differences in rates of radiographic asd between treatment arms at 28 or 36 months ( range of risk differences between treatment arms : 1.7%17.7% ) .
rom at adjacent segments in one rct,15 there were no statistical differences in angular rom at the cranial and caudal segments between patients receiving the bryan disc and those who had acdf either preoperatively or at 24 months .
the authors report no consistent correlation between angular rom at adjacent segments with ndi , neck or arm pain in either treatment group .
loss to follow - up ( > 15% ) with respect to cephalad motion evaluation was noted and may lead to potential selection bias . in a post - hoc analysis of the prodisc ide trial,14
there were no statistical differences in adjacent segment motion between treatment groups . within groups , time from surgery was a significant predictor of change in adjacent segment motion .
timing of asd development data from cohort analyses ( coe iii ) were available .
with regard to the timing of asd development , one cohort study8 and one secondary analysis of rct data12 report no statistical differences between c - adr and acdf . in a secondary analysis of rct data from two sites ( disc types not reported ) , there was no significant difference in mean time free from clinico - radiographic asd between treatment arms ( c - adr : 48.7 1.04 months ; acdf : 46.04 0.6 months ; p > .05).12 in another cohort , time to radiographic asd was not different between c - adr and acdf ( data not reported ; p = .072).8 results of literature search .
acdf indicates anterior cervical discectomy and fusion ; asd , adjacent segment disease ; rct , randomized controlled trials ; rom , range of motion ; nr , not reported or with respect to follow - up loss to follow - up not reported or could not be determined from data presented by authors .
parent study is anderson et al;2 this study was excluded because the definition of symptomatic asd differed from sasso et al , and sasso et al5 reported 24-month data . does not include secondary procedures which involved both index and adjacent levels .
mummaneni et al 4 is the original report of the fda ide study , burkus et al 3 report the long - term follow - up .
summary of results from fda ide randomized controlled trials ( coe ii ) reporting rates of symptomatic asd .
nr indicates not reported ; acdf , anterior cervical discectomy and fusion ; and c - adr , cervical total disc arthroplasty .
* percentages reported at 24 and 48 or 60 months were calculated using the full cohort ( n ) ; therefore , the denominator included participants who had either dropped out or had not yet completed follow - up .
the article by mummaneni et al 4 is the original report of the fda ide study ; burkus et al 3 report the long - term follow - up .
summary of results from studies reporting rates of radiographic asd*. * definitions of radiographic asd differ between studies .
general clinical guidelines related to cervical c - adr are summarized elsewhere in this issue .
conclusions from this review are limited by the following methodological concerns : mummaneni et al 4 , burkus et al 3 ( 60-month follow - up ) , and sasso et al ( 48-month follow - up ) 5 : the denominator used to calculate the proportions of participants with asd in each treatment arm in these studies is based on the full - sample size , not on the number of patients available at the time of follow - up ; therefore , the denominator included participants who had either dropped out or had not yet completed follow - up .
this may bias results if participants with symptoms were more likely to return for radiographic work - up than participants without symptoms , and would artificially increase asd rates .
in addition , loss to follow - up differed by treatment arm in at least one study 5 , which may make rates of asd artificially elevated in the treatment arm with more follow - up ( especially if the denominator used to calculate asd rates does not account for loss to follow - up ) .
furthermore , in the study by burkus et al 3 , the 60-month evaluations were ongoing ( at the time of publication ) and thus , loss to follow - up was primarily related to participants not having reached their 60-month time point in the study .
it is difficult to compare rates of radiographic asd across studies because authors use substantially different definitions for radiographic asd .
the study 9 reporting the highest rates used a definition with the lowest threshold for change in the height of adjacent discs ( 10% ) .
an association between adjacent segment motion and function or clinically relevant outcomes is not evident .
conclusions regarding rates of symptomatic asd are challenging given the variations in reporting of symptomatic asd based on surgical intervention at adjacent levels following the index procedure .
in one study 5 , participants who had undergone reoperation at the index and adjacent site were not included as symptomatic asd cases ; however , in other studies 3,4 , participants who had undergone reoperation at the index and adjacent sites were included as symptomatic asd .
other studies do not report cases of surgical intervention at both the index and adjacent site 6,10 .
it should be noted that reoperation was at the discretion of the surgeon and the patient but the surgeon can heavily influence the patient s decision .
therefore , it is possible that the surgeon may have had subconscious or conscious bias against reoperating on a disc patient .
if true , the reoperation rates for the arthroplasty patients may have been artificially low . based on the above
, there is inconclusive evidence to support the role of arthroplasty as a means of decreasing adjacent level disease .
part of the problem is that there is no uniform definition of adjacent level disease .
but even if we limit our definition to those cases that required operation at the adjacent level , the evidence for arthroplasty being superior to acdf is lacking .
some of the lack of evidence is due to inadequate follow - up and there are unpublished but nationally presented reports that with the prodisc - c , there is a statistically significant difference in reoperation rates at 5 years .
until the peer - review process is completed and the article published , however , we can not comment on the validity of their conclusions .
our review suggests that , to date , the promise of arthroplasty decreasing the risk of asd compared with acdf remains unfulfilled .
perhaps some of the longer - term follow - up data , which is currently in the peer - review process , or data from other arthroplasty trials will reveal differences . until such time
, arthroplasty s main advantage appears to be motion preservation and not adjacent level preservation .
no statistical differences between treatment groups noted across three coe ii rcts and one cohort ( coe iii ) study .
given the low rates of asd across studies , one might question whether studies were sufficiently powered to assess this outcome no statistical differences between treatment groups noted across one coe ii rct and four coe iii cohort studies .
radiographic asd may be an intermediate outcome , and no directional relationship between radiographic and symptomatic asd was evaluated . | study design : systematic review.clinical question : do the rates and timing of adjacent segment disease ( asd ) differ between cervical total disc arthroplasty ( c - adr ) and anterior cervical discectomy and fusion ( acdf ) in patients treated for cervical degenerative disc disease?methods : a systematic search of medline / pubmed and bibliographies of key articles was done to identify studies with long - term follow - up for symptomatic and/or radiographic asd comparing c - adr with fusion for degenerative disc disease of the cervical spine .
the focus was on studies with longer follow - up ( 4860 months ) of primary us food and drug administration trials of prestige st , prodisc - c , and bryan devices as available .
trials of other discs with a minimum of 24 months follow - up were considered for inclusion .
studies evaluating lordosis / angle changes at adjacent segments and case series were excluded.results : from 14 citations identified , four reports from three randomized controlled trials and four nonrandomized studies are summarized .
risk differences between c - adr and acf for symptomatic asd were 1.5%2.3% and were not significant across rct reports .
time to development of asd did not significantly differ between treatments .
rates of radiographic asd were variable .
no meaningful comparison of asd rates based on disc design was possible .
no statistical differences in adjacent segment range of motion were noted between treatment groups.conclusion : our analysis reveals that , to date , there is no evidence that arthroplasty decreases asd compared with acdf ; the promise of arthroplasty decreasing asd has not been fulfilled . | Study Rationale and Context
Clinical Questions
Methods
Results
Clinical Guidelines
Discussion
Conclusions
Evidence Summary |
the metabolic syndrome ( ms ) consists of multiple and interrelated risk factors of metabolic origin that appear to directly promote the development of atherosclerotic cardiovascular disease
. the ms strongly associates with type 2 diabetes mellitus , or the risk for this condition .
although the exact etiology of the ms still remains unclear , it is known to involve complex interactions between genetic , metabolic , and environmental factors , where diet is of central importance [ 13 ] .
there has been a substantial increase in fructose consumption , in the last decades , which has been associated with some adverse metabolic changes similar to those observed in the ms [ 47 ] . on the other hand ,
minerals like potassium , calcium , and magnesium , proposed as protective against the ms , are generally deficient in ms - inducing diets [ 3 , 810 ] .
natural mineral waters are waters of underground origin , protected from contamination and microbiologically wholesome .
they are characterized by their purity at source , content in minerals , trace elements , and other constituents as well as by favorable effects on human health . additionally , bioavailability of minerals from natural mineral waters is high [ 1214 ] .
the fructose - fed rat is an interesting and well - validated animal model of diet - induced ms ( predominantly acquired ms model ) that is commonly used in ms research .
different rat strains with distinct fructose ingestion protocols are reported in the literature and , in all cases , fructose has been observed to induce ms features such as moderate hypertension , glucose intolerance , hyperinsulinemia , insulin resistance , dyslipidemia ( hypertriglyceridemia , hypercholesterolemia ) , altered cytokine and adipokine status ( altered tumor necrosis factor - alpha ( tnf- ) and leptin levels , e.g. ) , decreased melatonin production , and/or increased body fat and/or body weight [ 1520 ] .
both in humans and rats , a strong association has been found between ms and oxidative stress and fructose - feeding associates with modification of the hepatic redox status [ 16 , 2224 ] .
beneficial effects of acute or chronic natural mineral - rich waters ingestion on blood pressure ( bp ) [ 2527 ] , metabolic profile ( plasma insulin sensitivity , fasting serum glucose concentration , and fasting serum lipid profile [ 25 , 29 ] ) , and plasma oxidative stress markers ( reactive oxygen species , lipid and protein oxidation product levels , total antioxidant capacity , and total thiol levels ) have been published , but , to our knowledge , not in ms individuals or animal models .
the natural mineral waters tested are rich , albeit in different proportions , in bicarbonate , calcium , magnesium , potassium , and/or sodium .
we aimed to investigate the possible beneficial effect of natural mineral - rich water on ms induction by fructose - feeding . in the present work , sprague - dawley rats ( sdr )
were fed with 10% fructose in natural mineral - rich water ( pedras salgadas ) for 8 weeks and compared to animals fed 10% fructose in tap water .
the natural mineral - rich water tested has high total mineralization content ( 2855 mg / l ) , being mainly rich in sodium and bicarbonate and with higher potassium , calcium , and magnesium content than tap water .
the study was carried out in 21 adult male cd sdr ( 388483 g ) , from charles river laboratories ( chatillon / chalaronne , france ) .
telemetry transmitters ( ta11pa - c40 , data sciences international ( dsi ) , st .
paul , mn , usa ) were implanted in the abdominal cavity , with the catheter in the abdominal aorta , by charles river .
rats were individually housed , in an enriched environment , and maintained on a daily photoperiod of 12 h lighting schedule ( 2022c ) with free access to standard laboratory pellet food ( 2014 teklad global 14% protein rodent maintenance diet from harlan interfauna iberica sa , barcelona , spain ) and tap water .
acclimatization took place for 10 days before starting the experimental protocol , which was authorized by the veterinary national department of the ministry of agriculture , rural development and fisheries . during acclimatization ,
the handling and care of the animals were conducted in conformity with the european community council guidelines for the use of experimental animals ( 86/609/eec ) and act 129/92 .
animals were randomly divided into 3 groups ( 7 animals each ) with free access to different drinking solutions : ( a ) tap water ( cont ) , ( b ) 10% fructose in tap water ( fruct ) , or ( c ) 10% fructose in natural mineral - rich water ( fructmin ) .
all experimental groups were fed ad libitum with the standard laboratory chow diet mentioned above ( 20% of energy derived from protein , 13% from fat , and 67% from carbohydrate ) .
a 3-week pretreatment period with the natural mineral - rich water was performed to the fructmin group ( while the other rats were drinking tap water ) to allow adjustment to water flavor and sparkles .
this period of time induced no change in the pattern of food intake or increase of animals body weight ( data not shown ; all animals weighed 475597 g at the beginning of the dietary manipulation with fructose ) .
body weight and food and fluid ingestion values were registered weekly , from week 0 to week 7 or 8 ( as shown in figures 1(a)1(c ) , resp . ) . on week 0
these parameters were evaluated on the same day , which occurred 24 to 48 h after starting the dietary manipulation , and then on every one week after the first measurement .
each week , from week 0 to 7 , all animals spent 24 h inside metabolic cages for evaluation of food and fluid consumption as well as for urine collection ( the latter at 0 , 2 , 4 , and 6 weeks ) . at each occasion , the three groups of rats were represented , with an equal number of animals per group .
total energy ingestion was calculated by multiplying food and fluid ingestion values by the corresponding reference energy values and then adding these two results .
the chemical characteristics of tap and natural mineral - rich waters are given in table 1 .
the latter is classified as a hypersaline sodium - rich naturally sparkling mineral water , in conformity with the european community council guidelines for natural mineral waters ( 2009/54/eec ) , and was kindly provided by unicer bebidas , sa ( lea do balio , matosinhos , portugal ) .
dataquest art 4.1 silver telemetry system ( dsi ) with rcp-1 receivers ( and apr-1 for ambient pressure reference ) was used for telemetric measurement of bp ( mm hg ) and heart rate ( hr ; beats / min ) in the animal cage .
dataquest art acquisition software ( dsi ) was used to monitor all rats , for 8 weeks .
sampling was performed every min and setting segment duration at 20 s ; 3 different animals ( one from each experimental group ) were evaluated per day from 4:00 p.m. to 8:00 a.m. , seven days per week .
bp values were not included / considered if pulse pressure ( the difference between systolic and diastolic bp ) was below 20 mm hg and hr values were not used if pulse pressure values were lower than 10 mm hg .
data were exported from dataquest art 4.0 analysis program ( dsi ) to microsoft excel 2010 ( redmond , wa , usa ) and then subjected to statistical analysis .
all chemical substances used in all the experiments were of analytical grade . at the end of the dietary intervention
kg of body weight ) and blood was collected from the left ventricle into heparinized syringes .
after perfusion , liver , heart , kidneys , and epididymal adipose tissue were rapidly removed from the thoracic and abdominal cavities , washed in cold saline solution , placed in qualitative filter paper for excess liquid removal , and weighed .
the liver was cut into several fragments that were immersed in liquid nitrogen and stored at 80c , until further processing .
plasma concentrations of glucose , triacylglycerols , total cholesterol , hdl - cholesterol , ldl - cholesterol , c - reactive protein ( crp ) , glutamic - oxaloacetic transaminase ( got ) , glutamic - pyruvic transaminase ( gpt ) , total bilirubin , uric acid , urea , creatinine , total proteins , albumin , ferritin , sodium , potassium , chloride , magnesium , calcium , and phosphorus were determined .
all these quantifications were made at the clinical pathology unit of so joo hospital centre , epe , porto , portugal , using standardized methods for human sample routine hospital measurements .
plasma levels of insulin ( mercodia ab , 10 - 1137 - 01 ( uppsala , sweden ) ) , adiponectin ( invitrogen corporation , krp0041 ( camarillo , ca , usa ) ) , aldosterone ( uscn life science inc . , e0911ra ( wuhan , china ) ) , substance p ( r&d systems inc . , kge007/skge007/pkge007 ( minneapolis , mn , usa ) ) , interleukin-6 ( il-6 ; cusabio biotech co. ltd .
, csb - e04640r ( wuhan , china ) ) , and tnf- ( cusabio , csb - e11987r ) were evaluated according to the manufacturers ' instructions from the specific elisa kits .
( rsh69 k ) , nuclear factor kappa - b ligand ( rankl ; rbn-31 k-1rankl ) , leptin , and osteoprotegerin ( opg ; rbn1 - 31 k ) were measured with a luminex 200 analyzer ( luminex corporation , austin , tx , usa ) according to protocols ( milliplex map kits ) of millipore corporation ( billerica , ma , usa ) .
raw data ( mean fluorescence intensity ) were analyzed using istm 2.3 software ( luminex corporation ) .
oxidative damage to lipids , proteins , and dna was evaluated by measuring thiobarbituric acid - reactive substances ( viz . , malondialdehyde ( mda ) ) , carbonyls , and 8-hydroxy-2-deoxyguanosine ( 8-ohdg ) levels , respectively .
catalase , total superoxide dismutase ( sod ) , glutathione - s - transferase ( gst ) , glutathione - peroxidase ( gpx ) , and glutathione - reductase ( gr ) activities were quantified .
, except for the use of bradford method for protein quantification and the use of a kit for 8-ohdg quantification ( the dna extraction kit ( v - gene ) was purchased from bioron international ( ludwigshafen , germany ) and the 8-ohdg kit from japan institute for the control of aging ( haruoka , fukuroi , shizuoka , japan ) ) .
liver tissue samples ( 300450 mg ) were homogenized with a teflon - glass homogenizer in an equal volume of protein extraction buffer ( 50 mm tris - base , 150 mm nacl , ph 7.4 , 1% triton x-100 , 0.5% sodium deoxycholate , 0.1% sodium dodecyl sulfate ( sds ) , 1 mm edta , tablets of protease inhibitors , and phosphatase inhibitors ( 100 mm sodium fluoride and 10 mm sodium orthovanadate ) ) , with subsequent agitation for 30 min at 4c .
then , each sample was centrifuged , at 13 000 g for 20 min at 4c , and the protein solution under the lipid layer was collected and kept at 80c , until further analysis .
proteins were quantified by using the bicinchoninic acid protein assay kit ( pierce , rockford , il , usa ) .
proteins were dissolved ( 1 : 1 ) in loading buffer ( 50 mm tris - hcl , ph 6.8 , 100 mm dithiothreitol , 2% sds , 0.01% bromophenol blue and 10% glycerol ) and denatured , for 5 min at 95c .
then , 40 g of each sample was loaded per well , separated by electrophoresis in a 12% sds polyacrylamide gel , and transferred to a nitrocellulose membrane ( hybond c - extra , amersham , ge healthcare , buckinghamshire , uk ) .
the membrane was blocked in tris - base - buffered saline with 0.1% tween 20 ( v / v ) ( tbst ) containing 5% bovine serum albumin ( w / v ) and incubated overnight with the primary antibody against sirtuin 3 ( sirt3 ; cell signaling technology inc . , danvers , ma , usa ) diluted 1 : 1500 in tbst , with gentle agitation , at 4c
. then , the membrane was washed in tbst and incubated with donkey anti - rabbit polyclonal antibody conjugated to horseradish peroxidase ( santa cruz biotechnology inc . ,
heidelberg , germany ) , diluted 1 : 5000 in tbst , for 1 h at room temperature .
detection was performed with an enhanced chemiluminescence reagent ( amersham , ge healthcare , buckinghamshire , uk ) .
band intensity was determined using image lab software ( version 4.0.1 ; bio - rad laboratories , hercules , ca , usa ) and normalized for -actin expression ( 1 : 1000 and 1 : 2000 for primary and secondary antibodies ( santa cruz biotechnology inc .
, heidelberg , germany ) , respectively , diluted in 5% ( w / v ) of nonfat
dry powdered milk sveltesse ( nestl portugal sa , linda - a - velha , portugal ) in tbst ) .
liver magnesium and calcium content were measured by inductively coupled plasma optical emission spectrometry ( icp - oes ; activam , jobinyvon , horiba scientific , edison , nj , usa ) , at 285.213 nm and 422.673 nm , respectively , according to iso 11885 ( water quality determination of selected elements by icp - oes ( https://www.astandis.at/shopv5/preview.action;jsessionid=cf7234fbac2bcfdd35a4593a11bd4700?preview=&dokkey=347061&selectedlocale=en ) ) , after microwave oven ( mars 5 , cem corporation , matthews , nc , usa ) assisted acid digestion of liver fragments according to epa 3052 ( microwave assisted acid digestion of siliceous and organically based matrices ( http://www.epa.gov/osw/hazard/testmethods/sw846/pdfs/3052.pdf ) ) .
the significance of differences of each week , cross - sectional statistical analysis , among groups regarding systolic and diastolic bp , hr , body weight , food and fluid ingestions , urine volume , urinary sodium and creatinine excretions , total energy ingestion , and percentage energy supplied by fluid / total energy ingestion was evaluated using anova followed by bonferroni 's multiple comparison test or by kruskal - wallis followed by dunn 's multiple comparison test , according to their distribution .
these statistical methods were also used for evaluation of significance of differences among groups regarding organ weight / body weight , hepatic oxidative stress markers , and mineral content as well as plasma biochemical , metabolic , hormonal , and inflammatory data , at the end of the dietary intervention .
the association between the outcomes ( systolic and diastolic bp , hr , body weight , food and fluid ingestions , urine volume , urinary sodium and creatinine excretions , total energy ingestion , and percentage energy supplied by fluid / total energy ingestion ) and the interaction of dietary intervention with time evolution ( evaluated in weeks ) , longitudinal statistical analysis , was measured with the interaction terms ( ) , which were estimated by mixed effects model with random effect in the intercept .
the area under the curve ( auc ) was calculated through linear interpolation using the composite trapezoid rule .
statistical analysis was performed using r : a language and environment for statistical computing , graphpad prism software ( version 6.00 ; la jolla , ca , usa ) , or ibm spss statistics software ( version 20.0 ; armonk , ny , usa ) .
values were presented as mean standard error of the mean and differences considered significant for p < 0.05 .
in general , on each separate week ( week by week ) , body weight ( figure 1(a ) ) and food ingestion ( figure 1(b ) ) revealed similar values for the 3 animal groups . with time ( over the dietary intervention period ) , a significantly higher and similar increase of body weight for both fructose groups versus cont group was observed ( see supplementary table 1 available online at http://dx.doi.org/10.1155/2014/384583 and inset in figure 1(a ) ) . with time
fructmin rats decreased food ingestion significantly more than cont rats and showed a trend towards a higher decrease with time than fruct rats ( supplementary table 1 ) .
week by week , fluid ingestion showed significantly higher values for both fructose - fed groups versus cont group , without any significant difference between fruct and fructmin ( figure 1(c ) ) , which was in accordance with auc values ( supplementary table 2 ) .
fluid ingestion increased significantly for fructmin versus cont and fruct with time ( supplementary table 1 ) .
week by week , no differences were observed for fructose ingestion ( either from fluid ingestion or from both food and fluid ingestions ( data not shown ) ) neither for percentage energy supplied by fluid / total energy ingestion between the two intervention groups ( the latter being in accordance with auc values ; figure 2(a ) and supplementary table 2 ) , in which there was a substantial proportion of energy ingested from fluid ( 4872% of total energy ingestion ; figure 2(a ) ) .
total energy ingestion was significantly higher every week of the protocol for both fructose - fed groups versus cont group , without any significant difference between fruct and fructmin ( figure 2(b ) ) , which was in accordance with auc ( supplementary table 2 ) and body weight ( figure 1(a ) ) results .
total energy ingestion decreased similarly with time for all groups ( supplementary table 3 ; data not shown for controls ) . with time , urine volume was significantly higher in fructmin versus cont and fruct ( supplementary table 4 ) .
week by week , urinary sodium excretion values were expected when taking into consideration the sodium content of tap and natural mineral - rich waters : fructmin group had significantly higher values than the other two animal groups , without any significant difference between fruct and cont ( figure 3(b ) ) , which also agreed with auc values ( supplementary table 2 ) . between weeks 1 and 5 , fruct rats had a significantly higher hr than cont rats ( figure 4(b ) ) .
interestingly , both systolic and diastolic bp and hr evolution over time seemed to be protected from fructose effects by the natural mineral - rich water until approximately half of the dietary intervention period ( figures 4(a)-4(b ) , resp . ) .
a significant increase of systolic bp with time for both fructose groups versus cont group was observed ( supplementary table 5 ) .
diastolic bp in fructmin group showed a tendency to increase with time versus cont group ( supplementary table 5 ) .
a significant increase of hr with time for fructmin versus cont was observed ( supplementary table 5 ) .
liver and both kidneys weight to body weight ratios were significantly higher in fruct versus cont ( figures 5(a ) , 5(c ) , and 5(d ) , resp . ) .
additionally , the liver showed a strong trend to an increase in fructmin versus cont ( p = 0.053 ) and a significant increase in fruct versus fructmin ( figure 5(a ) ) .
natural mineral - rich water ingestion prevented fructose effects on liver and both kidneys weight to body weight ratios .
epididymal adipose tissue to body weight ratio was slightly and similarly higher in both fructose - fed animal groups versus cont group ( figure 5(b ) ) .
no differences were found among groups regarding heart weight / body weight ( data not shown ) .
triacylglycerol levels significantly increased in fruct versus cont and a tendency to an increase in fructmin versus cont ( p = 0.080 ) was observed ( figure 6(b ) ) .
insulin significantly increased ( figure 6(c ) ) and leptin variation followed the same pattern in fruct versus cont ( p = 0.057 ) ( figure 6(d ) ) .
insulin sensitivity index was also calculated and a strong tendency to a decrease was observed in fruct versus cont ( p and global p = 0.055 ; 0.247 10 0.032 10 , 0.137 10 0.009 10 , and 0.211 10 0.030 10 for cont , fruct , and fructmin , resp . ) .
glucose ( figure 6(a ) ) and aldosterone ( figure 6(e ) ) seemed to increase and melatonin ( figure 6(f ) ) seemed to decrease in fruct versus cont .
natural mineral - rich water ingestion appeared to counteract these fructose - induced metabolic and hormonal effects .
urea ( table 2 ) and magnesium ( table 3 ) levels significantly decreased in the two fructose - fed groups versus the cont group .
total proteins and albumin levels significantly increased in both groups of fructose - fed animals versus cont group ( except for total proteins in fructmin versus cont where a strong tendency was observed ) ( table 2 ) .
tnf- and il-6 levels seemed to increase and opg to rankl ratio seemed to decrease in fruct versus cont ( table 2 ) , with the natural mineral - rich water improving these parameters .
crp and substance p levels slightly increased in fructmin versus the other two animal groups ( table 2 ) .
the replacement of food by fructose solution as an energy source could explain the similar decreases in plasma urea , magnesium , got , gpt , ferritin , and uric acid levels in both fructose - fed sdr groups versus cont group ( although significantly only for some parameters ) .
catalase and sod activities and gsh to gssg ratio increased ( figures 7(a ) , 7(b ) , and 7(e ) , resp . ) and gpx activity , gssg level and sirt3 protein expression decreased ( figures 7(c ) , 7(d ) , and 7(f ) , resp . ) in fruct versus cont ( significantly for catalase , gpx , and gssg and a strong tendency for gsh / gssg ( p = 0.062 , global p = 0.045 ) ) .
regarding catalase and gssg , there was a strong trend to , respectively , a decrease and an increase in fructmin versus fruct ( p = 0.065 and p = 0.055 , resp . ) .
no significant modifications were observed for 8-ohdg levels ( data not shown ) neither for other redox parameters ( table 4 ) .
a slight decrease was observed in fruct versus cont for both liver magnesium and calcium content that was prevented by natural mineral - rich water ingestion ( figures 8(a ) and 8(b ) , resp . ) , most particularly for magnesium .
the fructose - fed sdr model mimics a predominantly environmentally acquired ms model that is commonly used in ms research .
similarly , in the present study , many of the alterations observed in different protocols of fructose - induced ms were recapitulated .
increased systolic bp , adiposity index and liver and kidney weight to body weight ratios as well as modulation of the hepatic redox status and similar changes in the plasma levels of hormones , except for aldosterone , and/or energy substrates evaluated in this work have been reported in different protocols of fructose - induced ms in sdr [ 1518 , 20 , 2224 , 3638 ] . as previously reported , fructose intervention increases sdr body weight , but
besides fructose metabolic effects , two details of our experimental protocol could have contributed to body weight increase : rats were housed individually , which may have reduced their physical activity , and were already adult rats at the beginning of the dietary manipulation ( their age was reflected in the high body weight values 475597 g ) , which may have amplified fructose metabolic effects . additionally to the variations observed in food and fluid ingestions seen in the cont group with aging ( over the 8 weeks of dietary intervention ) , fructose - fed rats adjusted fluid and food ingestions , aiming to maintain the level of energy consumption , as previously described .
fructose - fed animals increased their body weight similarly between them and more than control rats ( associated with a small increase of epididymal body - fat ) , reflecting the absence of any major natural mineral - rich water consumption effect on both food and fructose ingestions .
accordingly , effects shown below against ms induction in fructmin rats related exclusively to natural mineral - rich water ingestion and , interestingly , natural mineral - rich water ingestion reduced / prevented the majority of the fructose effects and , consequently , protected against ms induction , which , to our knowledge , is described here for the first time .
ms represents a risk for cardiovascular disease ( whose prevalence is increasing worldwide ) , which , together with the recent report of luo et al . on the consumption of low - mineral bottled water that increases
the significant increase in plasma insulin levels in the fruct versus cont group could have contributed to the significant effects in systolic bp and hr described before ( the effect of natural mineral - rich water with time on hr and diastolic bp decreased after body weight adjustment ) .
hyperinsulinemia may increase bp and hr by increasing the sympathetic nervous system activity , through alteration in the neuronal vascular control and/or by enhancement of kidney sodium reabsorption [ 6 , 41 , 42 ] .
increased sympathetic modulation of vessels and heart precedes metabolic dysfunction in mice drinking 10% fructose in tap water for up to 2 months .
hr , a marker of autonomic dysfunction , associates with ms , particularly with insulin resistance , and interestingly , in japan , the prevalence of ms increases linearly with the increase in hr [ 1 , 44 ] .
bp correlates with plasma aldosterone levels and an association between plasma aldosterone levels and hyperinsulinemia has been described in obesity .
although both fructose - fed groups in the present study had significantly increased body weight versus controls , the insulin value in the fructmin group ( that after body weight adjustment presented a strong tendency to decrease versus fruct ( data not shown ) ) , along with the later bp increase , was in accordance with the unaltered aldosterone levels in the fructmin group .
in fructose - fed sdr , the absence of a significant increase in body weight associates with no increase of aldosterone levels , in spite of hyperinsulinemia . leptin resistance may be an early feature of metabolic dysfunction induced by fructose - feeding , since it may precede increased adiposity , elevated circulating leptin levels , and changes in glucose metabolism in rats . despite higher leptin levels ( with the comparison versus cont significant after adjustment for body weight ( data not shown ) ) , which would anticipate a reduction in food intake and body fat in healthy conditions , fruct rats had a lower decrease of food ingestion with time than fructmin rats ( significant after adjustment for body weight ( data not shown ) ) as well as a similar weight gain and amount of epididymal fat .
these results could reflect a phenomenon of selective leptin resistance that , together with the activation of the sympathetic nerves by hyperleptinemia , could have contributed to the earlier development of hypertension in fruct rats [ 5 , 4749 ] .
melatonin has anti - inflammatory , antihyperlipidemic , and antihypertensive properties and it is known to influence insulin secretion and to enhance its action ( it increases insulin sensitivity and enhances insulin effects on leptin expression ) [ 19 , 5052 ] .
the apparent deregulation of leptin , melatonin , insulin , and aldosterone observed in the fruct group , owing to modifications in the hormone levels , was less evident in the fructmin group .
fructose is highly lipogenic as its hepatic metabolism provides great amounts of triose phosphate precursors for fatty acid synthesis [ 5 , 6 ] .
the difference in triacylglycerol levels in the two fructose - fed groups could be explained by the improvement of leptin , insulin , and aldosterone levels in fructmin induced by the natural mineral - rich water ingestion ( the magnitude of triacylglycerols increase versus cont was reduced after body weight adjustment ( data not shown ) ) .
the increase in plasma albumin and total protein levels has been described in fructose - fed rats , which could reflect a combination of undernutrition ( also because of the decrease in food ingestion ) , some degree of liver disorder ( resulting from ms induction ) , and/or dehydration ( owing to loose stools resulting from incomplete fructose absorption ) [ 56 , 57 ] .
nevertheless , the pattern of urine volume mirrored the pattern of fluid ingestion and we did not observe loose stools , which makes dehydration unlikely in the fructose - fed rats .
although we found a significant increase in both kidneys weight to body weight ratios in the fruct group , we believe that there was no renal functional alteration in this sdr group taking into consideration the plasma and/or urinary profiles of creatinine , urea , albumin , total proteins , magnesium , sodium , potassium , calcium , chloride , and phosphorous . despite an increase in the kidney weight to body weight ratio , rizkalla et al . reported no glomerular basement membrane thickening in sdr after 10 weeks of 57% fructose - feeding .
fructose - feeding accelerates osteoporosis and , accordingly , the opg to rankl ratio ( reflecting the ratio of osteoblast versus osteoclast activities [ 58 , 59 ] ) seemed to decrease in the fruct group .
interestingly , and in accordance with fruct group results , tnf- and il-6 are important mediators in the process of osteoclast differentiation and activation and , thus , the changes observed in their levels might have contributed to the lower opg to rankl ratio .
high levels of leptin and aldosterone have been linked to proinflammatory and prooxidant actions [ 45 , 47 ] . in the fructmin group , the improvement of the leptin , aldosterone , tnf- , and il-6 values could have contributed to the improvement of the opg to rankl ratio .
taking into consideration all the results obtained for both fructose - fed sdr groups , the slightly increased levels of substance p and crp in fructmin rats were unexpected .
plasma substance p levels increase under magnesium deficiency and contribute to increase inflammation and protein and lipid oxidation .
in fact , plasma magnesium levels of both fructose groups were significantly decreased , but the fructmin group displayed better plasma tnf- and il-6 levels as well as lower hepatic protein oxidation content ( after adjustment for body weight this latter parameter showed a tendency to a decrease in fructmin versus the other two groups , most particularly versus fruct ( data not shown ) ) .
the absence of oxidative lesions in lipids , proteins , and dna ( the same as for proteins happened for dna oxidative lesions ( data not shown ) ) could be explained by the significantly increased catalase activity and apparently increased sod activity .
describe similar results for lipid oxidative lesions and catalase and sod activities by 10% fructose ingestion in tap water .
the significant decrease in gpx activity in fruct rats could be partially compensated by the significant increase in catalase activity , since both enzymes can eliminate hydrogen peroxide ( converting it to water ) .
catalase is responsible for the elimination of high concentrations of hydrogen peroxide , while gpx does it when concentrations of hydrogen peroxide are low . the higher levels of hydrogen peroxide could have resulted from the fructose - feeding [ 7 , 63 ] and the small decrease of sirt3 protein expression could have intensified reactive oxygen species production in fruct rats .
the significant decrease in hepatic gpx activity could have contributed to the strong tendency for an increase in the gsh / gssg ratio in fruct versus cont , by oxidizing less gsh to gssg .
increased gssg efflux from hepatocytes and/or increased hepatic gsh synthesis induced by fructose could also apply .
however , we did not observe an increase in gsh level as it might have been expected from a lower gsh oxidation and/or increased gsh synthesis .
although cellular atp depletion induced by fructose prevents atp - dependent gssg efflux in freshly isolated rat hepatocytes , this phenomenon should not have a strong impact here since an increase in uric acid formation was not observed .
the variations observed for gpx , sod , and catalase activities in the two fructose - fed groups are in accordance with the antioxidant actions of melatonin ( probably its primary function ) and sirt3 .
melatonin possesses free radical - scavenging activity , stimulates antioxidant enzymes ( e.g. , gpx ) , and inhibits reactive oxygen / nitrogen species producing enzymes [ 66 , 67 ] .
sirt3 has beneficial effects on mitochondrial electron transport chain ( contributing to a reduction in the production of reactive oxygen species ) and mitochondrial antioxidant enzymes ( probably also on gpx , like melatonin ) .
reduction of sirt3 associates with an accelerated development of metabolic abnormalities similar to the ms , which is in agreement with our overall results .
our results also showed that the natural mineral - rich water could contribute to the preservation of the hepatic intracellular ions , namely the magnesium content .
it is well documented that plasma ion levels might not reflect their tissue levels , and here this was evident regarding plasma and hepatic concentrations of magnesium and calcium .
for quite some time , it was thought that it could be the cause of insulin resistance , but very recently it was described that type 2 diabetes mellitus and a lower degree of metabolic control are essential in accounting for the lower levels of serum magnesium that occur in obese individuals .
figure 9 summarizes the significant effects of fructose - feeding obtained in this research that were reduced / prevented by the natural mineral - rich water ( taking into consideration that when fructose was coingested with the natural mineral - rich water no significant effects were observed versus the control ) . still , although for some of the parameters evaluated in our study the extension of differences among groups did not achieve statistical significance , the variations observed were consistent with the pattern expected , which reinforces their biological relevance and justifies their presentation and discussion .
the results here described suggest that this natural mineral - rich water seems to have potential to prevent ms induction .
we hypothesize that its regular intake in the context of modern diets , which have a general acidic character interfering with mineral homeostasis and are poor in micronutrients , namely potassium , calcium , and magnesium , could add surplus value and attenuate imbalances , thus contributing to metabolic and redox health and , consequently , decreasing the risk for atherosclerotic cardiovascular disease . | the metabolic syndrome increases the risk for atherosclerotic cardiovascular disease and type 2 diabetes mellitus .
increased fructose consumption and/or mineral deficiency have been associated with metabolic syndrome development .
this study aimed to investigate the effects of 8 weeks consumption of a hypersaline sodium - rich naturally sparkling mineral water on 10% fructose - fed sprague - dawley rats ( metabolic syndrome animal model ) .
the ingestion of the mineral water ( rich in sodium bicarbonate and with higher potassium , calcium , and magnesium content than the tap water used as control ) reduced / prevented not only the fructose - induced increase of heart rate , plasma triacylglycerols , insulin and leptin levels , hepatic catalase activity , and organ weight to body weight ratios ( for liver and both kidneys ) but also the decrease of hepatic glutathione peroxidase activity and oxidized glutathione content .
this mineral - rich water seems to have potential to prevent metabolic syndrome induction by fructose .
we hypothesize that its regular intake in the context of modern diets , which have a general acidic character interfering with mineral homeostasis and are poor in micronutrients , namely potassium , calcium , and magnesium , could add surplus value and attenuate imbalances , thus contributing to metabolic and redox health and , consequently , decreasing the risk for atherosclerotic cardiovascular disease . | 1. Introduction
2. Material and Methods
3. Results
4. Discussion
5. Conclusion |
the cadherin superfamily consists of classic cadherins and nonclassic cadherins , including desmosomal cadherins and the recently discovered protocadherins .
major cadherins in the skin include the adherens junction cadherin e - cadherin and the desmosomal cadherin desmoglein 1 ; these are expressed by virtually all epidermal keratinocytes and melanocytes and play important roles in maintaining proper cohesive arrangement of the epidermal cells .
a cadherin less well studied in the context of the skin is t - cadherin .
t - cadherin is a unique cadherin superfamily member : it possesses the five extracellular cadherin domain repeat structures typical of the classical cadherins but lacks transmembrane and cytoplasmic domains and is instead anchored to the cell membrane via a glycosylphosphatidylinositol moiety .
t - cadherin is strongly expressed on epidermal basal layer keratinocytes of human and murine skin .
very little information exists regarding expression of t - cadherin in other structures of the skin .
its presence on the hair follicle , sebaceous glands , and eccrine glands has been reported ; however , details on cellular distribution and pattern of expression are imprecise . in order to gain insight into the potential functions of t - cadherin in the skin
, we performed an extensive examination of t - cadherin expression and its distribution in the epidermis and adnexal structures of normal skin .
ten normal skin specimens obtained from the samples of wide surgical resection of cutaneous tumors were used .
immunohistochemical studies were performed on 4-m - thick sections cut from formalin - fixed paraffin - embedded tissue using a universal immunoperoxidase polymer detection system ( n - histofine simple stain max po ; nichirei biosciencies , tokyo , japan ) .
sections were deparaffinized in xylol and hydrated through grades of ethanol , and then heated in a citric acid buffer ( ph 6.0 ) at 95c for 60 min for antigen retrieval .
the primary antibodies used were goat anti - t - cadherin ( 1:300 ; cat .
af3264 , r&d systems europe ltd . , abingdon , uk ) , monoclonal mouse anti - cd34 ( undiluted [ rtu - end ] , novocastra ) , and rabbit anti - cytokeratin 15 ( ck15 ) mab epr1614y ( 1:300 ; cat .
immunoreactivity was visualized by using the histofine simple stain max po reagent and diaminobenzidine tetrahydrochloride as the substrate .
sections were counterstained with mayer 's hematoxylin , dehydrated with grades of ethanol , cleared with xylene , and mounted with tissue tec coverslipping film . for negative controls ,
immunohistochemical reactions on any given tissue sample and using any given antibody were run in duplicate .
stained sections were viewed using a nikon eclipse 50i microscope and images captured using a colorview iiiu camera ( olympus ) .
t - cadherin was strongly expressed in the basal keratinocyte layer , with a typically global distribution over the cell membrane and pronounced expression at intercellular junctions and on the basal and apical sides of the epidermal basal cells ( fig .
there was a weak cell body and/or nuclear expression of t - cadherin on occasional suprabasal keratinocytes ( fig .
, there was no t - cadherin expression in the upper spinous layer of the epidermis .
t - cadherin was present on endothelial cells in all types of dermal blood vessels .
subendothelial smooth muscle cells and pericytes also showed immunoreactivity for t - cadherin ( fig .
moderately to strongly positive staining for t - cadherin was observed in the basal cell layer surrounding maturing sebaceous cells .
2 ) . in the eccrine glands , moderately to strongly positive cytoplasmic and membranous staining for t - cadherin was found in the majority of the single layer of cells within the secretory portion .
t - cadherin was also strongly expressed on the outer myoepithelial cells surrounding the coiled gland ( fig .
the eccrine ducts consisting of a double layer of cells exhibited a strong membranous staining on the inner layer of cuticular cells , although infrequently , a few cells with cytoplasmic staining were seen ( fig .
in contrast to the pattern of staining in eccrine glands , both the coiled secretory gland and excretory ducts of apocrine glands were consistently negative for t - cadherin , whereas the myoepithelial cell layer around the periphery of the glands demonstrated moderately strong staining for t - cadherin ( fig .
4 ) . in order to define the distribution for t - cadherin in terminal hair follicles
, we used vertical consecutive sections of the hair follicles and compared the localization of t - cadherin with that of two usually used stem cell markers , cd34 and ck15 . in terminal hair follicles , the basal cell layer of the epidermis and follicular infundibulum was strongly positive for t - cadherin and ck15 but negative for cd34 .
cd34 was strongly expressed in the endothelial cell and perifollicular spindle - shaped cells ( fig .
a strong staining for t - cadherin was observed in the outer root sheath ( ors ) layers within the isthmus of the follicle : the distribution was typically global with staining intensity being more prominent on the apical surface and at intercellular contacts of cells ( fig .
the area of the ors around the site where the arrector pili muscle attaches to the hair follicle ( otherwise known as the bulge ) demonstrated intense staining for t - cadherin ( fig .
strong ck15 immunoreactivity was found in the ors of the isthmus and with increasing staining intensity at the site of attachment of the arrector pili muscle at the bulge level ( fig .
cd34 staining was not observed in the ors within the level of the isthmus ( fig .
cd34 was expressed in the most external layer of the ors below the level of the isthmus , but was not found in the lower part of the suprabulbar ors region ( fig .
6 ) . within the thin ors layers surrounding the bulb of the follicle , positive t - cadherin was expressed in most cells , whereas ck15 expression was more focal ( fig .
7 ) . in the surrounding fibrous root sheath of the hair bulb and in the dermal papilla , isolated cells with immunoreactivity for t - cadherin were observed .
t - cadherin was strongly expressed in the basal keratinocyte layer , with a typically global distribution over the cell membrane and pronounced expression at intercellular junctions and on the basal and apical sides of the epidermal basal cells ( fig .
there was a weak cell body and/or nuclear expression of t - cadherin on occasional suprabasal keratinocytes ( fig .
, there was no t - cadherin expression in the upper spinous layer of the epidermis .
t - cadherin was present on endothelial cells in all types of dermal blood vessels .
subendothelial smooth muscle cells and pericytes also showed immunoreactivity for t - cadherin ( fig .
within sebaceous glands , moderately to strongly positive staining for t - cadherin was observed in the basal cell layer surrounding maturing sebaceous cells .
2 ) . in the eccrine glands , moderately to strongly positive cytoplasmic and membranous staining for t - cadherin was found in the majority of the single layer of cells within the secretory portion .
t - cadherin was also strongly expressed on the outer myoepithelial cells surrounding the coiled gland ( fig .
the eccrine ducts consisting of a double layer of cells exhibited a strong membranous staining on the inner layer of cuticular cells , although infrequently , a few cells with cytoplasmic staining were seen ( fig .
in contrast to the pattern of staining in eccrine glands , both the coiled secretory gland and excretory ducts of apocrine glands were consistently negative for t - cadherin , whereas the myoepithelial cell layer around the periphery of the glands demonstrated moderately strong staining for t - cadherin ( fig .
in order to define the distribution for t - cadherin in terminal hair follicles , we used vertical consecutive sections of the hair follicles and compared the localization of t - cadherin with that of two usually used stem cell markers , cd34 and ck15 . in terminal hair follicles , the basal cell layer of the epidermis and follicular infundibulum was strongly positive for t - cadherin and ck15 but negative for cd34 .
cd34 was strongly expressed in the endothelial cell and perifollicular spindle - shaped cells ( fig .
a strong staining for t - cadherin was observed in the outer root sheath ( ors ) layers within the isthmus of the follicle : the distribution was typically global with staining intensity being more prominent on the apical surface and at intercellular contacts of cells ( fig .
the area of the ors around the site where the arrector pili muscle attaches to the hair follicle ( otherwise known as the bulge ) demonstrated intense staining for t - cadherin ( fig .
5b ) . in contrast , the inner root sheath of the hair follicles was t - cadherin negative .
strong ck15 immunoreactivity was found in the ors of the isthmus and with increasing staining intensity at the site of attachment of the arrector pili muscle at the bulge level ( fig .
cd34 staining was not observed in the ors within the level of the isthmus ( fig .
cd34 was expressed in the most external layer of the ors below the level of the isthmus , but was not found in the lower part of the suprabulbar ors region ( fig .
6 ) . within the thin ors layers surrounding the bulb of the follicle , positive t - cadherin was expressed in most cells , whereas ck15 expression was more focal ( fig .
7 ) . in the surrounding fibrous root sheath of the hair bulb and in the dermal papilla , isolated cells with immunoreactivity for t - cadherin were observed .
expression of t - cadherin on keratinocytes and specific localization on the basal cell layer of the epidermis in normal skin was first reported by zhou and colleagues more than a decade ago .
this finding was confirmed in a number of subsequent studies addressing expression of t - cadherin in a variety of keratinocytic disorders including psoriasis , basal cell carcinoma ( bcc ) , actinic keratosis , and squamous cell carcinoma ( scc ) . in this study , we demonstrate that t - cadherin exhibits a precisely confined pattern of expression not only in the normal epidermis but also in adnexal structures of the skin , including the sebaceous , eccrine and apocrine glands and the hair follicle .
the function of t - cadherin in skin ( patho)biology remains unclear . in vitro investigations exploiting ectopic modification of t - cadherin expression levels in human keratinocyte ( hacat ) and scc ( a431 , hsc-1 ) cell lines have demonstrated functions for t - cadherin as a negative regulator of proliferation , migration , and invasion and a positive regulator of cell - matrix adhesion . in keeping with these putative functions , immunohistochemical studies of human cutaneous specimens
have reported inverse relationships between t - cadherin expression levels and progression of several hyperproliferative keratinocytic disorders including psoriasis vulgaris , bowen 's disease , and scc . on the other hand , and as recapitulated in this study , in the healthy epidermis ,
notably , cells that move away from the basal layer compartment toward the skin surface , withdraw from cell cycle , and commit to terminal differentiation no longer express t - cadherin .
t - cadherin is also expressed in actinic keratosis , an in situ scc characterized by exaggerated keratinocyte proliferation .
furthermore , t - cadherin is prominently upregulated in bcc regardless of grade of proliferation and invasiveness ( superficial , nodular , and infiltrative ) , with expression being particularly strong in the palisading peripheral cells of invading tumor nests .
noteworthy too is that in well - differentiated scc , t - cadherin remains strongly expressed on cells at the periphery of tumor nests invading the dermis , whereas in moderately - to - poorly differentiated scc ( i.e. , transformed cells acquire dedifferentiated status ) , t - cadherin expression is reduced or lost .
studies using a431 scc keratinocyte cell line and a three - dimensional spheroid cell culture model to mimic multicellular tumor organization demonstrated that spheroid structure was remarkably more compact following ectopic upregulation of t - cadherin but loose following silencing of t - cadherin .
these in vitro findings , together with the collective immunohistochemical observations of the specific expression of t - cadherin in the basal keratinocyte layer of the epidermis and its maintained expression in the periphery of bcc and well - differentiated scc , might be interpreted to indicate an important role for t - cadherin in maintenance of organized structure .
support for such an interpretation is provided by our findings on the pattern of t - cadherin expression in skin adnexal structures , which , to date , has received rare attention . in sebaceous glands ,
the basal cell layer exhibited strong expression of t - cadherin , whereas sebocytes in the inner compartment of the gland showed no expression .
the expression of t - cadherin in the basal layer of the sebaceous gland is not surprising since the physiological processes of the glands are in many ways similar to those of the continual renewal of the interfollicular epidermis .
although epidermal terminal differentiation differs from sebocyte maturation , in both the epidermis and sebaceous glands undifferentiated cells of the proliferative basal cell layer are required to maintain the continual renewal of the epidermis as well as the continuous sebum production and regeneration of sebaceous glands . as for the interfollicular epidermis ,
basal cells of the sebaceous gland typically lack expression of t - cadherin once they have left the basal compartment , withdrawn from the cell cycle , and commit to terminal sebocyte differentiation . in normal eccrine glands , we observed positive cytoplasmic staining for t - cadherin in the majority of the inner layer of cells within the secretory coils , confirming the finding of takeuchi et al . .
however , we additionally found that outer layer of myoepithelial cells in the secretory portion and epithelial cells lining the excretory ducts strongly expressed t - cadherin .
pulse and pulse - chase studies using the sensitive nucleotide analog ethynyldeoxyuridine demonstrated proliferation of both luminal and myoepithelial cells within mature coiled secretory sweat glands , supporting that both cell populations are capable of regenerative self - renewal .
in contrast to eccrine glands , the inner layer of secretory cells in apocrine sweat glands was consistently negative for t - cadherin , whereas myoepithelial cells within the periphery of the secretory components exhibited positive staining .
as for eccrine glands , apocrine gland myoepithelial cells are likely also capable of self - renewal .
expression of t - cadherin in the hair follicle , especially in the ors , has been reported by takeuchi et al . .
our study clearly demonstrates that expression of t - cadherin in terminal hair follicles is strictly confined to the most external layer of the ors .
it is perhaps not surprising that t - cadherin is expressed throughout the ors , as the ors is contiguous with , and biochemically similar to , the basal layer of the epidermis .
epithelial hair follicle stem cells localize to the outermost ors layer of the distal hair follicle epithelium at the proximal end of the isthmus in the region known as the bulge , and in a cluster of cells below the bulge known as the hair germ . using consecutive sections of terminal hair follicles and k15 and cd34 antibodies as stem cell markers
, we found that both ck15-positive cells in the bulge region and cd34-positive cells in the suprabulbar ors localize with t - cadherin positivity .
like the basal keratinocyte layer , the bulge and suprabulbular regions of the hair follicle are regarded as important stem cell reservoirs for hair follicle renewal and also for regeneration of sebaceous glands and of the epidermis in case of injury .
the presence of t - cadherin throughout the bulge and suprabulbular regions might not endow t - cadherin with usefulness in specific hair follicle stem cell identification , but nevertheless invokes potential participation in regenerative processes .
accumulating evidence from different fields suggests that t - cadherin acts as a signaling receptor participating in the control of tissue architecture , recognition of the environment , regulation of cell motility , guidance of moving structures , and guarding integrity of functionally connected tissue layers . herein , we have shown that t - cadherin is expressed in cell layers considered to house regenerative stem cell populations , namely the basal keratinocyte layer of the epidermis , the basal layer of the sebaceous gland , the myoepithelial layer of the eccrine gland , the myoepithelial layer of the apocrine glands , and the hair follicle ors . a function for t - cadherin as a guardian of the structural integrity of the epidermis and
skin samples , previously collected for medical diagnostic , were obtained from the archival histopathology collection of the laboratory for histologic diagnostic , basel . | backgroundt - cadherin is an atypical glycosylphosphatidylinositol - anchored member of the cadherin superfamily of adhesion molecules .
the role of t - cadherin in biology of the skin is poorly understood .
expression of t - cadherin in basal keratinocytes and dermal blood vessels of the healthy epidermis has been demonstrated , but studies on expression in skin appendages are rare.methodswe conducted an immunohistochemical analysis of t - cadherin expression in the epidermis and adnexal structures of normal skin.resultst-cadherin expression is restricted to basal keratinocytes of the epidermis . the basal cell layer of sebaceous glands was t - cadherin positive , whereas sebocytes were negative . within apocrine glands , only myoepithelial cells were t - cadherin positive .
in contrast , both the secretory coils and excretory ducts of eccrine glands were t - cadherin positive . in terminal
hair follicles , the outer root sheath layers strongly expressed t - cadherin throughout different regions of the follicle , with the strongest immunoreactivity at the bulge and suprabulbar regions .
t - cadherin and ck15 stem cell marker similarly localized within the bulge and suprabulbar region .
t - cadherin and cd34 stem cell marker similarly localized at the suprabulbar level.conclusionthe specific patterns of t - cadherin expression in the epidermis and adnexal structures suggest an important guardian role in skin homeostasis . | Introduction
Materials and Methods
Results
T-Cadherin Expression in Normal Epidermis
T-Cadherin Expression in the Dermal Blood Vessels
T-Cadherin Expression in the Sebaceous, Eccrine, and Apocrine Glands
T-Cadherin Expression in the Hair Follicles
Discussion
Conclusion
Statement of Ethics
Disclosure Statement |
in our clinical experience some parents with epilepsy express concern how the condition will affect their child .
this is especially the case when the parent has therapy - resistant epilepsy and often suffers from seizures . on the other hand ,
there are also parents who are not at all concerned about the consequences of epilepsy for their children .
the children of people with epilepsy ( pwe ) comprise a group that possibly can be affected by their parent s condition for different reasons .
there is a potential risk that the child can be hurt in association with a seizure affecting their parent , but there are also possible psychosocial consequences associated with growing up with a parent with a chronic disease .
epilepsy is associated with an increased prevalence of mental - health disorder compared with the general population1 and it is also associated with a higher risk of suicide .
one may speculate that growing up with a parent under these conditions could be difficult for a child .
our interest in this matter is explained by information from focus - group interviews that we undertook with young to middle - aged persons with epilepsy and memory problems . here , many informants were worried about how growing up with a parent with epilepsy affected the situation of their children,2 and gave a more detailed description of the psychosocial stress that pwe may suffer , in relation to a reduced capability to look after their children , that some of them report .
there is not much knowledge about the situation of or risk for children of persons with a chronic disease such as epilepsy.3 one may suspect that such children could be at risk of developing psychosocial / psychological problems or even physical symptoms , but we have found no research on this subject .
there are some reports on these issues from people with other conditions such as multiple sclerosis47 and cancer.8 a literature search revealed just a few reports on the situation for children of persons with epilepsy9,10 and none that focused on the risks for the children .
studies indicate that epilepsy may cause psychosocial difficulties for family members , but have concentrated on the effect of children with epilepsy on adult family members.3 epilepsy also affects family members quality of life , but this has also been studied in adults exclusively.11 family members of adult pwe , especially of mothers , have increased levels of anxiety , depression , and somatic complaints.12 the literature search revealed no reports on the deeper meaning of being a parent with epilepsy and , to our knowledge , this area has not been investigated before .
the aim of this paper is to describe aspects of what it means to be a parent with epilepsy , focusing the parent s perspective and their thoughts on having children .
a qualitative method was used to obtain knowledge and understanding on this issue ; this method is often used to start research on a new area .
this method does not produce any numbers , but can help to understand more complex human behavior . in the study reported here , we reused preexisting data and performed a secondary analysis.2 heaton describes secondary analyses as a way of reworking and analyzes preexisting qualitative data by asking new and expanded questions of the text.13 focus - group interviews of young adults , aged 1835 years old , with epilepsy , treated in our clinics , that aimed to investigate the impact of memory problems in epilepsy , actually turned out to reveal much information about epilepsy and parenthood .
altogether , 18 young adults were invited to take part in the study , but four of them did not show up at the appointed time .
most of the participants were interested in meeting other young people with the same condition as themselves , and therefore wanted to join the study .
the interviews were conducted by two of the authors ( hg and aml ) and took place in four groups .
each group contained three or four individuals , two groups with women and two groups with men .
the participants have been described in a previous article2 and many of the participants had therapy - resistant epilepsy , but some of the participants were seizure free .
the participants ( male [ m ] 52 years old and m 55 ) who were interviewed for the book leva med epilepsi [ to live with epilepsy]14 were interviewed in face - to - face interviews by one of the authors ( aml ) . for demographic information
the participants in focus - group interviews were asked open questions on living with epilepsy and subjective memory problems .
if there were feelings the participants did not want to share in the group , they were informed they could meet the doctor confidentially after the interviews .
there were no questions about being a parent with epilepsy , but since the participants were free to discuss subjects of importance to them , this subject was raised spontaneously in the groups . such naturalistic data that have been collected with minimal interference by researchers , heaton13 describes as being very suitable for secondary analysis .
interviews by the same method , but without concentrating on cognitive problems , were also performed with people of different ages with epilepsy when preparing the book leva med epilepsi.14 the focus - group interviews were recorded and verbatim transcribed , which means that every word , sound , and silent period during the interviews was written down as a long text .
relevant areas and aspects covering the participants narratives and issues of being a parent with epilepsy were extracted from the original interview text .
in addition , relevant aspects from interviews undertaken by aml , using open - ended questions , for the book leva med epilepsi were extracted .
the two men taking part in these interviews with open - ended questions discussed issues of being a parent having epilepsy .
these men were older than the other participants and they were included in the study to achieve a wider age range ( m 52 and m 55 ) .
the text in the domain was analyzed in steps described by graneheim and lundman.15 first , all the authors read the transcripts several times , in order to get a sense of the whole and a good grasp of the content . in the next step ,
this analysis did not follow common grammatical or linguistic rules , but the text was divided when a shift in the sense of meaning could be found . in the next step ,
these meaning units were then concentrated without changing the inherent meaning and the implicit meaning in the text was interpreted . following this
the interpretations were grouped together and abstracted to themes and are presented in the results .
the regional ethical committee of linkping , linkping , sweden , approved this study ( dnr 2010/246 - 31 ) .
the aim of this paper is to describe aspects of what it means to be a parent with epilepsy , focusing the parent s perspective and their thoughts on having children .
a qualitative method was used to obtain knowledge and understanding on this issue ; this method is often used to start research on a new area .
this method does not produce any numbers , but can help to understand more complex human behavior . in the study reported here , we reused preexisting data and performed a secondary analysis.2 heaton describes secondary analyses as a way of reworking and analyzes preexisting qualitative data by asking new and expanded questions of the text.13
focus - group interviews of young adults , aged 1835 years old , with epilepsy , treated in our clinics , that aimed to investigate the impact of memory problems in epilepsy , actually turned out to reveal much information about epilepsy and parenthood . altogether
, 18 young adults were invited to take part in the study , but four of them did not show up at the appointed time .
most of the participants were interested in meeting other young people with the same condition as themselves , and therefore wanted to join the study .
the interviews were conducted by two of the authors ( hg and aml ) and took place in four groups .
each group contained three or four individuals , two groups with women and two groups with men .
the participants have been described in a previous article2 and many of the participants had therapy - resistant epilepsy , but some of the participants were seizure free .
the participants ( male [ m ] 52 years old and m 55 ) who were interviewed for the book leva med epilepsi [ to live with epilepsy]14 were interviewed in face - to - face interviews by one of the authors ( aml ) . for demographic information see table 1 .
the participants in focus - group interviews were asked open questions on living with epilepsy and subjective memory problems .
if there were feelings the participants did not want to share in the group , they were informed they could meet the doctor confidentially after the interviews .
there were no questions about being a parent with epilepsy , but since the participants were free to discuss subjects of importance to them , this subject was raised spontaneously in the groups . such naturalistic data that have been collected with minimal interference by researchers , heaton13 describes as being very suitable for secondary analysis .
interviews by the same method , but without concentrating on cognitive problems , were also performed with people of different ages with epilepsy when preparing the book leva med epilepsi.14
the focus - group interviews were recorded and verbatim transcribed , which means that every word , sound , and silent period during the interviews was written down as a long text .
relevant areas and aspects covering the participants narratives and issues of being a parent with epilepsy were extracted from the original interview text .
in addition , relevant aspects from interviews undertaken by aml , using open - ended questions , for the book leva med epilepsi were extracted .
the two men taking part in these interviews with open - ended questions discussed issues of being a parent having epilepsy .
these men were older than the other participants and they were included in the study to achieve a wider age range ( m 52 and m 55 ) .
the text in the domain was analyzed in steps described by graneheim and lundman.15 first , all the authors read the transcripts several times , in order to get a sense of the whole and a good grasp of the content . in the next step ,
this analysis did not follow common grammatical or linguistic rules , but the text was divided when a shift in the sense of meaning could be found . in the next step ,
these meaning units were then concentrated without changing the inherent meaning and the implicit meaning in the text was interpreted . following this
the interpretations were grouped together and abstracted to themes and are presented in the results .
the regional ethical committee of linkping , linkping , sweden , approved this study ( dnr 2010/246 - 31 ) .
the discussions in the focus groups revealed the following key issues of being a parent with epilepsy : ( 1 ) a persistent feeling of insecurity , since a seizure may occur at any time and the child could be hurt ; ( 2 ) a feeling of inadequacy of not being able to take full responsibility for one s child ; ( 3 ) acknowledgment that one s children are forced to take more responsibility than other children do ; and ( 4 ) a feeling of guilt of not being able to fulfill one s expectations of being the parent one would like to be .
the participants in the focus - group interviews talked about the difficulties for and dangers to the child of a parent with epilepsy .
they described that they were always aware of the possibility of a seizure and tried to foresee what the consequences would be in each and every situation , so that the child would be safe if a seizure did occur .
the participants took great care to prevent the child from being harmed and some of them explained that they were never left alone with their child .
they tried to care for their child on the floor or on a couch , preventing the child from falling if a seizure did happen , and also avoided carrying their child .
one woman described that she concentrated hard on the safety of her child in every situation .
if i will carry her or if i am walking with the stroller , it is really frightening .
if i am carrying her or do something with her i really shape up , i try to concentrate so that nothing will happen .
i always take care of my baby on the floor or on the couch so she can not fall .
( female [ f ] 26)i was really scared when i took care of the child .
if i would fall the child would fall too , so i was never alone with the boy until he was like 5 years old .
( m 32 ) i bite my tongue all the time i am with my baby .
if i will carry her or if i am walking with the stroller , it is really frightening .
if i am carrying her or do something with her i really shape up , i try to concentrate so that nothing will happen .
i always take care of my baby on the floor or on the couch so she can not fall .
( female [ f ] 26 ) i was really scared when i took care of the child .
if i would fall the child would fall too , so i was never alone with the boy until he was like 5 years old .
( m 32 ) one of the men ( m 24 ) , who was expecting his first child , was at first not concerned about the possible dangers for the child ( illustrated in the dialogue following ) .
however after discussing with one of the other participants , he seemed to realize that this is a problem he must consider in the future :
m 33 : how will it be when it is just you and your baby ?
i think that is really difficult?m 24 : just me and the baby ; but that is not difficult?m 33 : yes , i mean when you have to bathe the baby or walk with the stroller.m 24 : i think i can take care of that ; i am good with kids.m 33 : yes , but i mean if you have a seizure.m 24 : but i do not have many seizures now ; i think it will be okay.m 33 : i think it is so hard ; i have just a few seizures , but am so afraid
. a lot can happen if you have a seizure , even if you do not have them often [ ] .m 24 : i can understand that ; i feel the same now .
m 33 : how will it be when it is just you and your baby ?
m 33 : yes , i mean when you have to bathe the baby or walk with the stroller .
m 24 : i think i can take care of that ; i am good with kids .
m 24 : but i do not have many seizures now ; i think it will be okay .
m 33 : i think it is so hard ; i have just a few seizures , but am so afraid .
a lot can happen if you have a seizure , even if you do not have them often [ ] .
one father was not worried for his daughter when she was a small child , but in retrospect , he understood that the situation must have been difficult for her :
we were divorced but there was something i really wanted : my daughter .
i had a few seizures ; but it is hard to know if my daughter was afraid .
when she was older she got the telephone number for a nurse and could call if something happened .
she was a clever girl and could make a phone call . at this time i used to have a couple of seizures every month .
( m 55 ) we were divorced but there was something i really wanted : my daughter .
i had a few seizures ; but it is hard to know if my daughter was afraid .
when she was older she got the telephone number for a nurse and could call if something happened .
she was a clever girl and could make a phone call . at this time i used to have a couple of seizures every month .
( m 55 ) the participants described a feeling of inadequacy when discussing parenthood in the group .
they wished to take the same responsibility as other parents , but understood it was important to accept help from other people .
they expressed that it was difficult to accept that they could not be part of all aspects of parenthood .
for some participants this meant that they felt they did not have the same value or importance as other parents :
i feel like i am not really grown up , i can not even walk with the stroller .
but it hurts , that i can not and should not , take the full responsibility .
i did not have the energy to do all the things that i wanted to and my opinion was not always asked for .
( m 52 ) i feel like i am not really grown up , i can not even walk with the stroller .
but it hurts , that i can not and should not , take the full responsibility .
i did not have the energy to do all the things that i wanted to and my opinion was not always asked for .
( m 52 ) the parents were also worried that the children had to take on a big responsibility and grow up too fast because of epilepsy , giving the parents the feeling that their children were not allowed to be children .
they often trusted in their children and got help from them , but the fact that they had to lean on their children made them sad .
the children were always alert to recognizing if their parent might have a seizure and some children even observed their parent and did not let them out of sight .
the children learned to take own initiative ; for example , by getting help from other people by calling them . in this way they had to take on a big responsibility even if they were very young :
my daughters help me , with the seizures .
they are children , but they are not allowed to be children , they are like adults actually .
but i must try to let them be children now , as they are 8 and 9 years old .
and i wake up after a seizure and i call on her to ask her to turn off the tv .
she calls dad , but he does not answer and then she calls grandma instead .
they are children , but they are not allowed to be children , they are like adults actually .
but i must try to let them be children now , as they are 8 and 9 years old .
and i wake up after a seizure and i call on her to ask her to turn off the tv .
shall i call dad ? she calls dad , but he does not answer and then she calls grandma instead .
( f 29 ) the parents in the focus - group interviews often felt guilty because they could not be the parents they wanted to be .
they also felt guilty because of all the difficulties their children had to experience when witnessing a seizure .
they thought about what the seizure would look like and wondered if the child would be afraid when observing it .
the parents were also worried about how these experiences in childhood would affect their children in the long run .
they discussed whether the seizures would scare the children and how the children would react to them .
the participants also experienced subjective memory decline and they believed that this affected the situation of their children .
they explained that they often forgot to keep their promises and forgot to give information and they regarded this as being difficult for their children .
they felt that they often let their children down and the children were often disappointed :
i have been worried and i am so anxious .
how will it be when she gets older and how will she cope with it when i have a seizure ?
what will happen if i have a seizure , if it is just me and my children ?
i am feeling bad when i have a seizure and since i have this seizure my children must take care of themselves , just because i am feeling bad .
how will it be when she gets older and how will she cope with it when i have a seizure ?
what will happen if i have a seizure , if it is just me and my children ?
i am feeling bad when i have a seizure and since i have this seizure my children must take care of themselves , just because i am feeling bad .
( f 29 ) a friend of my daughter calls when my daughter is outside playing .
the participants in the focus - group interviews talked about the difficulties for and dangers to the child of a parent with epilepsy .
they described that they were always aware of the possibility of a seizure and tried to foresee what the consequences would be in each and every situation , so that the child would be safe if a seizure did occur .
the participants took great care to prevent the child from being harmed and some of them explained that they were never left alone with their child .
they tried to care for their child on the floor or on a couch , preventing the child from falling if a seizure did happen , and also avoided carrying their child .
one woman described that she concentrated hard on the safety of her child in every situation .
if i will carry her or if i am walking with the stroller , it is really frightening .
if i am carrying her or do something with her i really shape up , i try to concentrate so that nothing will happen .
i always take care of my baby on the floor or on the couch so she can not fall .
( female [ f ] 26)i was really scared when i took care of the child .
if i would fall the child would fall too , so i was never alone with the boy until he was like 5 years old .
( m 32 ) i bite my tongue all the time i am with my baby . if i will carry her or if i am walking with the stroller , it is really frightening .
if i am carrying her or do something with her i really shape up , i try to concentrate so that nothing will happen .
i always take care of my baby on the floor or on the couch so she can not fall .
( female [ f ] 26 ) i was really scared when i took care of the child .
if i would fall the child would fall too , so i was never alone with the boy until he was like 5 years old .
( m 32 ) one of the men ( m 24 ) , who was expecting his first child , was at first not concerned about the possible dangers for the child ( illustrated in the dialogue following ) .
however after discussing with one of the other participants , he seemed to realize that this is a problem he must consider in the future :
m 33 : how will it be when it is just you and your baby ?
i think that is really difficult?m 24 : just me and the baby ; but that is not difficult?m 33 : yes , i mean when you have to bathe the baby or walk with the stroller.m 24 : i think i can take care of that ; i am good with kids.m 33 : yes , but i mean if you have a seizure.m 24 : but i do not have many seizures now ; i think it will be okay.m 33 : i think it is so hard ; i have just a few seizures , but am so afraid
. a lot can happen if you have a seizure , even if you do not have them often [ ] .m 24 : i can understand that ; i feel the same now .
m 33 : how will it be when it is just you and your baby ?
m 33 : yes , i mean when you have to bathe the baby or walk with the stroller .
m 24 : i think i can take care of that ; i am good with kids .
m 24 : but i do not have many seizures now ; i think it will be okay .
i think it is so hard ; i have just a few seizures , but am so afraid
. a lot can happen if you have a seizure , even if you do not have them often [ ] .
m 24 : i can understand that ; i feel the same now . being a single parent with epilepsy
one father was not worried for his daughter when she was a small child , but in retrospect , he understood that the situation must have been difficult for her :
we were divorced but there was something i really wanted : my daughter .
i had a few seizures ; but it is hard to know if my daughter was afraid .
when she was older she got the telephone number for a nurse and could call if something happened .
she was a clever girl and could make a phone call . at this time i used to have a couple of seizures every month .
( m 55 ) we were divorced but there was something i really wanted : my daughter .
i had a few seizures ; but it is hard to know if my daughter was afraid .
when she was older she got the telephone number for a nurse and could call if something happened .
she was a clever girl and could make a phone call . at this time i used to have a couple of seizures every month .
they wished to take the same responsibility as other parents , but understood it was important to accept help from other people .
they expressed that it was difficult to accept that they could not be part of all aspects of parenthood .
for some participants this meant that they felt they did not have the same value or importance as other parents :
i feel like i am not really grown up , i can not even walk with the stroller .
but it hurts , that i can not and should not , take the full responsibility .
i did not have the energy to do all the things that i wanted to and my opinion was not always asked for .
( m 52 ) i feel like i am not really grown up , i can not even walk with the stroller .
but it hurts , that i can not and should not , take the full responsibility .
i did not have the energy to do all the things that i wanted to and my opinion was not always asked for .
the parents were also worried that the children had to take on a big responsibility and grow up too fast because of epilepsy , giving the parents the feeling that their children were not allowed to be children .
they often trusted in their children and got help from them , but the fact that they had to lean on their children made them sad .
the children were always alert to recognizing if their parent might have a seizure and some children even observed their parent and did not let them out of sight .
the children learned to take own initiative ; for example , by getting help from other people by calling them . in this way they had to take on a big responsibility even if they were very young :
my daughters help me , with the seizures .
they are children , but they are not allowed to be children , they are like adults actually .
but i must try to let them be children now , as they are 8 and 9 years old .
and i wake up after a seizure and i call on her to ask her to turn off the tv .
shall i call dad ? she calls dad , but he does not answer and then she calls grandma instead .
they are children , but they are not allowed to be children , they are like adults actually .
but i must try to let them be children now , as they are 8 and 9 years old .
and i wake up after a seizure and i call on her to ask her to turn off the tv .
she calls dad , but he does not answer and then she calls grandma instead .
the parents in the focus - group interviews often felt guilty because they could not be the parents they wanted to be .
they also felt guilty because of all the difficulties their children had to experience when witnessing a seizure .
they thought about what the seizure would look like and wondered if the child would be afraid when observing it .
the parents were also worried about how these experiences in childhood would affect their children in the long run .
they discussed whether the seizures would scare the children and how the children would react to them .
the participants also experienced subjective memory decline and they believed that this affected the situation of their children .
they explained that they often forgot to keep their promises and forgot to give information and they regarded this as being difficult for their children .
they felt that they often let their children down and the children were often disappointed :
i have been worried and i am so anxious .
how will it be when she gets older and how will she cope with it when i have a seizure ?
what will happen if i have a seizure , if it is just me and my children ?
i am feeling bad when i have a seizure and since i have this seizure my children must take care of themselves , just because i am feeling bad .
how will it be when she gets older and how will she cope with it when i have a seizure ?
what will happen if i have a seizure , if it is just me and my children ?
i am feeling bad when i have a seizure and since i have this seizure my children must take care of themselves , just because i am feeling bad .
( f 29 ) a friend of my daughter calls when my daughter is outside playing .
parents in the focus - group interviews expressed , without any direct questioning on this subject , that they were very worried about the consequences of epilepsy affecting their children .
these parents took great care to prevent any accidents that could harm their children because of epilepsy .
it was always in their minds to figure out the safest way to take care of the child in case they had a seizure .
we have not found any study examining the risk of accidents for children of parents with epilepsy . in a study examining children drowning or near drowning in baths in england , four out of 44 cases were related to epilepsy but every case affected children with epilepsy and none was caused by a parent with epilepsy.16 the parents themselves often suffered from a feeling of being an inadequate parent , forgetting about schedules , and being forced to rest instead of taking care of their children .
one may interpret this situation as putting more demand on the spouse , and also on the children themselves .
these results can be involved in a future discussion on different forms of support for pwe with children , especially if they are single parents or the spouse can not support the identified needs . on the other hand , it is also important to strengthen the self - esteem in pwe , which obviously also is determined by their ability to care for their children . consequently , this is a matter of balance between the quality of life and self - esteem of pwe and the safety of their children .
persons with epilepsy who have children seem to have a double trauma : first , the risk of getting seizures and the constant fear that this can create and , second , worries about generating psychological and physical problems for their children.2 the authors also suspect that there may be such risks for some children of pwe , that the pwe do not recognize themselves .
however , parents who are concerned about the security of the child will , just like the parents in our study , try to foresee every possible risk associated with epilepsy .
it is more dangerous if the parent does not acknowledge the possible risks associated with the seizure and ignores them .
it is therefore important to scrutinize the attitude and knowledge of each parent with epilepsy .
parents can also fear that the child will be taken into custody if they expose the possible risks to the social authorities .
it is essential that parents with epilepsy can get support in their homes if necessary , so that they do not have to conceal their worries for the child s safety .
interventions offered to pwe for supporting their children should be designed in a way that the person feels safe and the action taken should be beneficial to the whole family .
parents with epilepsy are aware of the difficulties of being a parent who can be affected by seizures , but it is important to identify those parents that ignore the risks .
cognitive profile is one factor that should be investigated in this situation ; low performance may be a risk factor , but further research is needed to know this for certain .
support programs must be done in a way that respects the condition of the patient , knowing that the self - esteem of the patient is vulnerable in this disease .
a previous study has shown that self - esteem among young adults with epilepsy decreases when they have passed adolescence and meet the different obstacles of adult life,17 such as getting a job and raising a child .
interventions should address both pwe but also their family members and the safety of the child must be discussed with the whole family .
it is essential that information about the difficulties for parents with epilepsy also reaches the pediatrician , general practitioner , and social authorities .
one possible method is to let professional patients persons with epilepsy who have been educated about the condition spread information about the difficulties of being a parent with epilepsy .
the young man in our study who at first could not see any risks for his future child because of epilepsy got new perspectives about this when discussing the subject with another parent with epilepsy . to talk with someone that has experience can be important for understanding the issue . even though this qualitative study is limited by the relatively small number of participants it shows that this is a field of importance to many pwe and further research could give more information .
since a qualitative study generates no numbers we do not know how frequent these problems are .
most participants in the interviews had therapy - resistant epilepsy and one could assume that patients who are seizure - free do not experience the same kinds of problems or find this issue as important .
another option would be to analyze groups of parents with epilepsy before and after extra support interventions and providing them with information .
material from the focus - group interviews suggests that parents with epilepsy are very concerned about the consequences of epilepsy affecting their children .
the feeling of insecurity is persistent , as a seizure can happen at any time .
the risk of seizures leads to a feeling of inadequacy and not being able to take full responsibility for the child .
the parents take care to prevent accidents , but need support and guidance , especially when expecting their first child .
fear of not being approved as a custodian can prevent parents from discussing the possible risks for their child .
parents with epilepsy also feel the children must take on too much responsibility for their age and they feel guilty they can not be the ideal parent .
we believe it is essential that supportive programs are made available to parents with epilepsy , since fear for the safety of the child increases the psychosocial burden of the condition , and that interventions should address both pwe and family members .
to arrange study circles , in which pwe get the opportunity to meet each other , is one possible strategy for sharing information about the difficulties of being a parent with epilepsy .
professional patients , who are persons with epilepsy who have been given education about the condition .
other family members , such as spouses and siblings , could also be offered to attend a group of their own .
associations for pwe could also recognize and work with this important aspect of living with epilepsy .
this qualitative study on parents with epilepsy indicates that further research is of importance in this field . | objectiveparents with epilepsy can be concerned about the consequences of epilepsy affecting their children .
the aim of this paper is to describe aspects of what it means being a parent having epilepsy , focusing the parents perspectives and their thoughts on having children.methodsfourteen adults aged 1835 years with epilepsy and subjective memory decline took part in focus - group interviews .
the interviews were conducted according to a semi - structured guideline .
material containing aspects of parenthood was extracted from the original interviews and a secondary analysis was done according to a content - analysis guideline .
interviews with two parents for the swedish book leva med epilepsi [ to live with epilepsy ] by am landtblom ( stockholm : bilda ide ; 2009 ) were analyzed according to the same method.resultsfour themes emerged : ( 1 ) a persistent feeling of insecurity , since a seizure can occur at any time and the child could be hurt ; ( 2 ) a feeling of inadequacy of not being able to take full responsibility for one s child ; ( 3 ) acknowledgment that one s children are forced to take more responsibility than other children do ; and ( 4 ) a feeling of guilt of not being able to fulfill one s expectations of being the parent one would like to be.conclusionthe parents with epilepsy are deeply concerned about how epilepsy affects the lives of their children .
these parents are always aware that a seizure may occur and reflect on how this can affect their child .
they try to foresee possible dangerous situations and prevent them .
these parents were sad that they could not always take full responsibility for their child and could not live up to their own expectations of parenthood .
supportive programs may be of importance since fear for the safety of the child increases the psychosocial burden of epilepsy .
there were also a few parents who did not acknowledge the safety issue of their child
the authors believe that it is important to identify these parents and provide extra information and support to them . | Introduction
Aim and methods
Aim
Participants and procedures
Analysis
Ethics
Results
A persistent feeling of insecurity, since a seizure can occur at any time and the child could be hurt
A feeling of inadequacy of not being able to take full responsibility for ones child
Acknowledgment that ones children are forced to take more responsibility than other children do
A feeling of guilt of not being able to fulfill ones expectations of being the parent one would like to be
Discussion
Conclusion |
data on the pharmacology of darunavir / ritonavir during pregnancy are limited to case reports 18 , few of which examined pharmacokinetics 13,57,9 .
the effects of pregnancy on the pharmacokinetics of darunavir remain unclear ; therefore , further pharmacokinetic studies are needed .
maternal physiological changes during pregnancy ( e.g. blood volume expansion , increased glomerular filtration rate and alterations in hepatic metabolism ) may result in altered pharmacokinetics 10 .
data support the conclusion that the pharmacokinetic parameters of hiv protease inhibitors ( pis ) are changed during pregnancy , leading to lower exposure in pregnant women 3,5,6,11,12 .
studying darunavir / ritonavir in hiv - infected pregnant women may provide insights into population - specific pharmacokinetics that could inform treatment strategies and dosing recommendations .
this nonrandomized study was designed to investigate the pharmacokinetic profile , antiviral activity and safety of darunavir / ritonavir [ 600/100 mg twice daily ( bid ) or 800/100 mg once daily ( qd ) ] , etravirine ( 200 mg bid ) and rilpivirine ( 25 mg qd ) in hiv - infected pregnant women . here
we report only on the group that received darunavir / ritonavir 600/100 mg bid .
hiv-1-infected pregnant women , aged 18 years or older , with pregnancies between 18 and 26 weeks of gestation were included in this multicentre , single - arm , open - label trial .
subjects had to be on the study drug before screening and enrolment , and had to undergo an obstetric examination and have a normal level ii ultrasound .
the study was approved by a centralized ethics committee [ western institutional review board ( irb ) ] or a site - specific irb .
subjects with any obstetric complications , any neurological conditions requiring medication or any active disease that may have compromised patient safety or study outcomes were excluded from the study .
the primary objective was to assess the effect of pregnancy on the pharmacokinetics of darunavir / ritonavir administered bid during the second and third trimesters of gestation and postpartum .
the secondary objectives were to document antiviral activity , safety and tolerability of darunavir / ritonavir - based regimens during pregnancy and postpartum , to compare darunavir / ritonavir concentrations between maternal serum and cord blood at delivery and to assess the outcomes for infants of women treated with darunavir / ritonavir bid during pregnancy .
intensive pharmacokinetic samplings over 12 h were performed at three study visits : during the second trimester ( 2428 weeks ) , during the third trimester ( 3438 weeks ) and 612 weeks postpartum .
eight blood draws were performed during each visit : predose and 1 , 2 , 3 , 4 , 6 , 9 and 12 h postdose .
darunavir ( total and unbound ) and ritonavir ( total ) plasma concentrations were measured .
cord blood and maternal plasma concentrations of total darunavir and ritonavir were also measured on the day of delivery .
total darunavir and ritonavir plasma concentrations were determined using a previously validated high - performance liquid chromatography tandem mass spectrometry assay with a lower limit of quantification of 5.00 ng / ml for both compounds 13 .
the unbound fraction of darunavir was calculated as the ratio of the unbound concentration in the filtrate to the total concentration in the plasma before centrifugation .
human serum albumin and 1-acid glycoprotein ( aag ) were measured because darunavir is highly protein bound and the concentration of these proteins usually decreases during pregnancy as a result of haemodilution 14 .
infants ' hiv-1 statuses were determined by polymerase chain reaction testing , reported within 16 weeks postpartum .
total and unbound pharmacokinetic parameters were derived from the plasma concentration actual time data using noncompartmental analysis ( winnonlin professional 4.1 ; pharsight , mountain view , ca ) . the minimum and maximum plasma concentrations ( cmin and cmax ,
respectively ) along with time to reach cmax ( tmax ) were obtained by inspection of the plasma concentration time profiles .
the area under the plasma concentration time curve from 0 to 12 h ( auc12h ) was determined using the linear trapezoidal rule .
the primary pharmacokinetic parameters used in the statistical analysis were auc12h , cmin and cmax on the logarithmic scale .
the least squares means ( lsms ) of the primary parameters for each treatment were estimated with a linear mixed - effects model , controlling for period as a fixed effect and subject as a random effect . a 90% confidence interval ( ci )
both the difference between the lsms and the 90% ci were retransformed to the original scale .
safety and antiviral activity were summarized using descriptive statistics ( sas / stat version 9.2 ; sas institute inc . , cary , nc ) .
hiv-1-infected pregnant women , aged 18 years or older , with pregnancies between 18 and 26 weeks of gestation were included in this multicentre , single - arm , open - label trial .
subjects had to be on the study drug before screening and enrolment , and had to undergo an obstetric examination and have a normal level ii ultrasound .
the study was approved by a centralized ethics committee [ western institutional review board ( irb ) ] or a site - specific irb .
subjects with any obstetric complications , any neurological conditions requiring medication or any active disease that may have compromised patient safety or study outcomes were excluded from the study .
the primary objective was to assess the effect of pregnancy on the pharmacokinetics of darunavir / ritonavir administered bid during the second and third trimesters of gestation and postpartum .
the secondary objectives were to document antiviral activity , safety and tolerability of darunavir / ritonavir - based regimens during pregnancy and postpartum , to compare darunavir / ritonavir concentrations between maternal serum and cord blood at delivery and to assess the outcomes for infants of women treated with darunavir / ritonavir bid during pregnancy .
intensive pharmacokinetic samplings over 12 h were performed at three study visits : during the second trimester ( 2428 weeks ) , during the third trimester ( 3438 weeks ) and 612 weeks postpartum .
eight blood draws were performed during each visit : predose and 1 , 2 , 3 , 4 , 6 , 9 and 12 h postdose .
darunavir ( total and unbound ) and ritonavir ( total ) plasma concentrations were measured .
cord blood and maternal plasma concentrations of total darunavir and ritonavir were also measured on the day of delivery .
total darunavir and ritonavir plasma concentrations were determined using a previously validated high - performance liquid chromatography tandem mass spectrometry assay with a lower limit of quantification of 5.00 ng / ml for both compounds 13 .
the unbound fraction of darunavir was calculated as the ratio of the unbound concentration in the filtrate to the total concentration in the plasma before centrifugation .
human serum albumin and 1-acid glycoprotein ( aag ) were measured because darunavir is highly protein bound and the concentration of these proteins usually decreases during pregnancy as a result of haemodilution 14 .
infants ' hiv-1 statuses were determined by polymerase chain reaction testing , reported within 16 weeks postpartum .
total and unbound pharmacokinetic parameters were derived from the plasma concentration actual time data using noncompartmental analysis ( winnonlin professional 4.1 ; pharsight , mountain view , ca ) . the minimum and maximum plasma concentrations ( cmin and cmax , respectively ) along with time to reach cmax ( tmax ) were obtained by inspection of the plasma concentration time profiles .
the area under the plasma concentration time curve from 0 to 12 h ( auc12h ) was determined using the linear trapezoidal rule .
the primary pharmacokinetic parameters used in the statistical analysis were auc12h , cmin and cmax on the logarithmic scale .
the least squares means ( lsms ) of the primary parameters for each treatment were estimated with a linear mixed - effects model , controlling for period as a fixed effect and subject as a random effect . a 90% confidence interval ( ci )
both the difference between the lsms and the 90% ci were retransformed to the original scale .
safety and antiviral activity were summarized using descriptive statistics ( sas / stat version 9.2 ; sas institute inc . , cary , nc ) .
sixteen women were enrolled in this part of the trial and received darunavir / ritonavir 600/100 mg bid ( supplementary table s1 ) .
the median age was 24 years ( range 1835 years ) , and 63% were black or african american .
most ( 80% ) subjects had a cd4 count 350 cells/l , 33% had a viral load < 50 hiv-1 rna copies / ml , 53% had a viral load between 50 and 400 copies / ml and 14% had a viral load 400 copies / ml .
sixty - three per cent were previously treated with one protease inhibitor ( pi)-based regimen .
of 16 subjects , 14 had at least one intensive pharmacokinetic visit and were included in the pharmacokinetic analysis , and 12 completed the treatment phase of the study .
a total of five subjects discontinued ( four during treatment before delivery ; one during follow - up ) ( table s1 ) .
two subjects discontinued because of adverse events ( aes ) : one for increased transaminases related to study drugs and one for unrelated premature delivery ( premature delivery led to an inability to fulfill protocol requirements as the patient missed the postpartum visit ) .
two subjects discontinued because of virological failure related to suboptimal adherence as documented by the principal investigator [ one patient reported 87.5% adherence ( auc12h 69 970 ng / h / ml ; cmin 4140 ng / ml ) in the 4 days prior to the second trimester visit and 75% adherence in the 4 days prior to the third trimester visit ( no pharmacokinetic data were available ) , and the other patient reported 62.5% adherence in the 4 days prior to the second trimester visit ; third trimester adherence rate and pharmacokinetic data were not available ] .
one subject was ineligible to continue the trial because of a failed drug screening . mean total and unbound darunavir plasma concentrations were higher during the postpartum period compared with the second and third trimesters of pregnancy ( fig .
mean ( standard deviation ) plasma concentration time curves for total darunavir ( a ) , unbound darunavir ( b ) and total ritonavir ( c ) after administration of darunavir / ritonavir 600/100 mg twice daily ( bid ) , during the second and third trimesters and postpartum .
data for unbound darunavir were not available for all patients as not all plasma samples were available for plasma protein binding analysis .
the maximum plasma concentration of total darunavir during the second and third trimesters was 28 and 19% lower , respectively , vs. postpartum based on the lsm ratios .
total darunavir cmin was on average 43 and 86% higher during the second and third trimesters , respectively , vs. postpartum .
total darunavir auc12h during pregnancy was 24 and 17% lower in the second and third trimesters , respectively , vs. postpartum .
unbound darunavir cmax was 22 and 18% lower during the second and third trimesters , respectively , vs. postpartum .
the median tmax of unbound darunavir was approximately 3 h during pregnancy and 2 h postpartum .
unbound darunavir cmin was 10 and 14% higher during the second and third trimesters , respectively , vs. postpartum .
unbound darunavir auc12h was 8 and 7% lower during the second and third trimesters , respectively , vs. postpartum .
the free fraction of darunavir ( ratio of unbound plasma concentration vs. total plasma concentration ) was slightly higher during pregnancy vs. postpartum ( data not shown ) .
mean ( standard deviation ) * pharmacokinetic parameters and statistical results for total and unbound darunavir and total ritonavir , after administration of darunavir / ritonavir 600/100 mg twice daily ( bid ) , during the second and third trimesters and postpartum lsm , least squares mean ; ci , confidence interval ; c0h , predose plasma concentration ; nd , not determined ; cmin , minimum plasma concentration ; cmax , maximum plasma concentration ; c12h , plasma concentration at 12 hours ; tmax , time to reach the maximum plasma concentration ; auc12h , area under the plasma concentration time curve over 12 h ; cl / f , apparent clearance .
data for unbound darunavir were not available for all patients because of poor sample quality ( protein in the filtrate ) or low sample volume .
n = 10 for c0h , n = 9 for cmin , and n = 7 for cmax and tmax .
n = 11 for c0h , and n = 8 for cmin , cmax and tmax .
n = 9 for cmin , and n = 7 for cmax .
n = 12 for cmin and cmax . matched maternal and cord plasma concentrations were available for 10 subjects . excluding one outlier resulting from a possible switch of the samples , the mean [ standard deviation ( sd ) ] total darunavir concentrations were higher in maternal plasma vs. cord plasma [ 2324 ( 1056 ) ng / ml vs. 383 ( 322 ) ng / ml , respectively ] when assessed in nine women and their infants .
the median cord : maternal plasma ratio was 0.1455 ( range 0.014070.3621 ) . mean total ritonavir plasma concentrations were higher during the postpartum period compared with the second and third trimesters of pregnancy ( fig .
median total ritonavir plasma concentrations peaked 4 h after drug administration during pregnancy and at 6 h in the postpartum period ( table 1 ) .
total ritonavir cmax during the second and third trimesters of pregnancy was 34 and 37% lower , respectively , vs. postpartum based on the lsm ratios .
total ritonavir cmin was on average 8 and 22% higher during the second and third trimesters , respectively , vs. postpartum .
total ritonavir auc12h during pregnancy was 28 and 33% lower in the second and third trimesters , respectively , vs. postpartum .
excluding one outlier resulting from a possible switch of the samples , the mean ( sd ) total ritonavir concentrations were higher in maternal plasma vs. cord plasma [ 429 ng / ml vs. 17 ng / ml , respectively ) when assessed in seven women and their infants .
the median cord : maternal plasma ratio was 0.1076 ( range 0.044320.114 ) . mean baseline albumin and aag concentrations were 31 and 617 g / l and postpartum concentrations were 38 and 790
g / l , respectively , resulting in a 22 to 28% decrease during pregnancy vs. postpartum ( fig .
the response rate ( < 50 copies / ml ) increased significantly from 33% ( five of 15 ) at baseline ( table s1 ) to 73% ( eight of 11 ) and 90%
( nine of 10 ) during the second and third trimesters , respectively , and was 80% ( eight of 10 ) at 12 weeks postpartum ( fig .
three patients had detectable viral loads during pregnancy ; two patients had detectable viral load during the second but not the third trimester [ 72 copies / ml in one patient ( 100% reported adherence in both trimesters ) and 123 copies / ml in the other ( 87.5% reported adherence in the second trimester , and 100% reported adherence in the third ) ] .
the third patient had detectable viral load during both trimesters ( 813 copies / ml in the second trimester and 59 copies / ml in the third trimester ) , with 100% reported adherence for both trimesters .
of these three patients with detectable viral load during pregnancy , two had undetectable viral load in the postpartum and follow - up periods .
cd4 count is significantly lower in hiv-1-negative women during pregnancy compared with the 12-week postdelivery period 15 ; therefore , the percentage of cd4 cells was plotted instead of absolute cd4 count .
the percentage of cd4 cells increased from 30% at baseline to 35% at 25 weeks postpartum ( fig .
all 12 infants born to women who stayed on treatment until delivery were hiv negative .
one of these infants was born to a patient who discontinued the study but remained on study treatment during follow - up .
the most common aes , occurring with an incidence of 25% , were infections and infestations ( 44% ) , gastrointestinal disorders ( 25% ) and premature labour ( 25% ) .
of 12 infants , four were born prematurely ( at weeks 30 , 36 , 36 and 37 ) and no congenital abnormalities occurred .
sixteen women were enrolled in this part of the trial and received darunavir / ritonavir 600/100 mg bid ( supplementary table s1 ) .
the median age was 24 years ( range 1835 years ) , and 63% were black or african american .
most ( 80% ) subjects had a cd4 count 350 cells/l , 33% had a viral load < 50 hiv-1 rna copies / ml , 53% had a viral load between 50 and 400 copies / ml and 14% had a viral load 400 copies / ml .
sixty - three per cent were previously treated with one protease inhibitor ( pi)-based regimen .
of 16 subjects , 14 had at least one intensive pharmacokinetic visit and were included in the pharmacokinetic analysis , and 12 completed the treatment phase of the study .
a total of five subjects discontinued ( four during treatment before delivery ; one during follow - up ) ( table s1 ) .
two subjects discontinued because of adverse events ( aes ) : one for increased transaminases related to study drugs and one for unrelated premature delivery ( premature delivery led to an inability to fulfill protocol requirements as the patient missed the postpartum visit ) . two subjects discontinued because of virological failure related to suboptimal adherence as documented by the principal investigator [ one patient reported 87.5% adherence ( auc12h 69 970 ng / h / ml ; cmin 4140 ng / ml ) in the 4 days prior to the second trimester visit and 75% adherence in the 4 days prior to the third trimester visit ( no pharmacokinetic data were available ) , and the other patient reported 62.5% adherence in the 4 days prior to the second trimester visit
mean total and unbound darunavir plasma concentrations were higher during the postpartum period compared with the second and third trimesters of pregnancy ( fig .
mean ( standard deviation ) plasma concentration time curves for total darunavir ( a ) , unbound darunavir ( b ) and total ritonavir ( c ) after administration of darunavir / ritonavir 600/100 mg twice daily ( bid ) , during the second and third trimesters and postpartum .
data for unbound darunavir were not available for all patients as not all plasma samples were available for plasma protein binding analysis .
the maximum plasma concentration of total darunavir during the second and third trimesters was 28 and 19% lower , respectively , vs. postpartum based on the lsm ratios .
total darunavir cmin was on average 43 and 86% higher during the second and third trimesters , respectively , vs. postpartum .
total darunavir auc12h during pregnancy was 24 and 17% lower in the second and third trimesters , respectively , vs. postpartum .
unbound darunavir cmax was 22 and 18% lower during the second and third trimesters , respectively , vs. postpartum .
the median tmax of unbound darunavir was approximately 3 h during pregnancy and 2 h postpartum .
unbound darunavir cmin was 10 and 14% higher during the second and third trimesters , respectively , vs. postpartum .
unbound darunavir auc12h was 8 and 7% lower during the second and third trimesters , respectively , vs. postpartum .
the free fraction of darunavir ( ratio of unbound plasma concentration vs. total plasma concentration ) was slightly higher during pregnancy vs. postpartum ( data not shown ) .
mean ( standard deviation ) * pharmacokinetic parameters and statistical results for total and unbound darunavir and total ritonavir , after administration of darunavir / ritonavir 600/100 mg twice daily ( bid ) , during the second and third trimesters and postpartum lsm , least squares mean ; ci , confidence interval ; c0h , predose plasma concentration ; nd , not determined ; cmin , minimum plasma concentration ; cmax , maximum plasma concentration ; c12h , plasma concentration at 12 hours ; tmax , time to reach the maximum plasma concentration ; auc12h , area under the plasma concentration time curve over 12 h ; cl / f , apparent clearance .
data for unbound darunavir were not available for all patients because of poor sample quality ( protein in the filtrate ) or low sample volume .
n = 10 for c0h , n = 9 for cmin , and n = 7 for cmax and tmax .
n = 11 for c0h , and n = 8 for cmin , cmax and tmax .
n = 9 for cmin , and n = 7 for cmax .
n = 12 for cmin and cmax . matched maternal and cord plasma concentrations were available for 10 subjects .
excluding one outlier resulting from a possible switch of the samples , the mean [ standard deviation ( sd ) ] total darunavir concentrations were higher in maternal plasma vs. cord plasma [ 2324 ( 1056 ) ng / ml vs. 383 ( 322 ) ng / ml , respectively ] when assessed in nine women and their infants .
the median cord : maternal plasma ratio was 0.1455 ( range 0.014070.3621 ) .
mean total ritonavir plasma concentrations were higher during the postpartum period compared with the second and third trimesters of pregnancy ( fig .
median total ritonavir plasma concentrations peaked 4 h after drug administration during pregnancy and at 6 h in the postpartum period ( table 1 ) .
total ritonavir cmax during the second and third trimesters of pregnancy was 34 and 37% lower , respectively , vs. postpartum based on the lsm ratios .
total ritonavir cmin was on average 8 and 22% higher during the second and third trimesters , respectively , vs. postpartum .
total ritonavir auc12h during pregnancy was 28 and 33% lower in the second and third trimesters , respectively , vs. postpartum .
excluding one outlier resulting from a possible switch of the samples , the mean ( sd ) total ritonavir concentrations were higher in maternal plasma vs. cord plasma [ 429 ng / ml vs. 17 ng / ml , respectively ) when assessed in seven women and their infants . the median cord : maternal plasma ratio was 0.1076 ( range 0.044320.114 ) .
mean baseline albumin and aag concentrations were 31 and 617 g / l and postpartum concentrations were 38 and 790
g / l , respectively , resulting in a 22 to 28% decrease during pregnancy vs. postpartum ( fig .
the response rate ( < 50 copies / ml ) increased significantly from 33% ( five of 15 ) at baseline ( table s1 ) to 73% ( eight of 11 ) and 90% ( nine of 10 ) during the second and third trimesters , respectively , and was 80% ( eight of 10 ) at 12 weeks postpartum ( fig
three patients had detectable viral loads during pregnancy ; two patients had detectable viral load during the second but not the third trimester [ 72 copies / ml in one patient ( 100% reported adherence in both trimesters ) and 123 copies / ml in the other ( 87.5% reported adherence in the second trimester , and 100% reported adherence in the third ) ] .
the third patient had detectable viral load during both trimesters ( 813 copies / ml in the second trimester and 59 copies / ml in the third trimester ) , with 100% reported adherence for both trimesters .
of these three patients with detectable viral load during pregnancy , two had undetectable viral load in the postpartum and follow - up periods .
cd4 count is significantly lower in hiv-1-negative women during pregnancy compared with the 12-week postdelivery period 15 ; therefore , the percentage of cd4 cells was plotted instead of absolute cd4 count .
the percentage of cd4 cells increased from 30% at baseline to 35% at 25 weeks postpartum ( fig .
all 12 infants born to women who stayed on treatment until delivery were hiv negative .
one of these infants was born to a patient who discontinued the study but remained on study treatment during follow - up .
the most common aes , occurring with an incidence of 25% , were infections and infestations ( 44% ) , gastrointestinal disorders ( 25% ) and premature labour ( 25% ) .
of 12 infants , four were born prematurely ( at weeks 30 , 36 , 36 and 37 ) and no congenital abnormalities occurred .
lower exposures of total darunavir / ritonavir 600/100 mg bid were observed during pregnancy compared with postpartum .
total darunavir cmax was 28 and 19% lower , and auc12h was 24 and 17% lower during the second and third trimesters , respectively , vs. postpartum .
these data are consistent with published reports demonstrating a decrease in total drug exposure ( auc ) of darunavir / ritonavir 600/100 mg bid during pregnancy ranging from 29 1 to 36% 9 .
lower levels of drug exposure during pregnancy vs. postpartum have been observed with other hiv pis 11,12,1619 .
however , unlike previous reports , the current study also assessed free plasma darunavir levels , which were higher during pregnancy vs. postpartum . as a result ,
the difference in unbound cmax and auc12h at postpartum compared with values found during pregnancy was minimal .
the small number of patients with pharmacokinetic data for unbound darunavir , six in the second trimester and seven in the third trimester , limited the ability to draw definitive conclusions ; however , we hypothesize that the lower total drug exposure of darunavir during pregnancy might be partially compensated for by higher free drug , resulting from lower protein binding to darunavir .
the antiviral activity of darunavir / ritonavir in hiv - infected pregnant women was effective in preventing mother - to - child transmission and in suppressing hiv in pregnant women , consistent with findings in pregnant 1,3,5,9 and nonpregnant hiv - infected individuals 20 . despite lower total pi levels in studies in pregnant women , subjects achieved desired immunovirological responses and protection from transmission of hiv to their infants 3,5,6,9,11,12 . taken together
, the findings that unbound concentrations of darunavir remained nearly unchanged during pregnancy relative to postpartum and that clinical responses were maintained suggest that no a priori dose adjustment is needed in darunavir / ritonavir when dosed bid in pregnant women .
total ritonavir cmax was 34 and 37% lower , and auc12h was 28 and 33% lower during the second and third trimesters , respectively , vs. postpartum , similar to findings in previously published reports 11 .
the levels of darunavir / ritonavir transferred from maternal to cord plasma were low , with median cord : maternal ratios of 0.1455 and 0.1076 , respectively , consistent with other reports demonstrating low transplacental passage of pis 3,7,9 .
it is interesting to note that cmin values were on average higher during the second and third trimesters , respectively , vs. postpartum for both darunavir ( 43 and 86% higher , respectively ) and ritonavir ( 8 and 22% higher , respectively ) .
plasma concentration values at 12 hours have also been presented in table 1 in order to provide additional context to these data . in this study ,
darunavir / ritonavir bid treatment was generally well tolerated in hiv - infected pregnant women , with few discontinuations because of aes ( 12% ) .
the observed ae profile partially overlaps with that found previously in nonpregnant adults 20 , and it is unclear how many aes may actually have been associated with pregnancy independent of darunavir / ritonavir bid treatment .
a limitation of this study may be the use of the 6- to 12-week postpartum levels as the reference .
darunavir / ritonavir pharmacokinetic parameters after administration of darunavir / ritonavir 600/100 mg bid as part of an antiretroviral regimen during pregnancy and postpartum were not clinically different compared with historical controls .
darunavir / ritonavir 600/100 mg bid administered with other antiretrovirals during pregnancy resulted in consistent unbound ( active ) drug exposure during pregnancy and postpartum , was effective in preventing mother - to - child transmission and in suppressing hiv and was generally well tolerated , with few discontinuations because of aes .
data from this small pharmacokinetic study , while not definitive , suggest that darunavir / ritonavir 600/100 mg bid may be a treatment option for pregnant women in need of highly active antiretroviral therapy .
additional supporting information may be found in the online version of this article at the publisher 's web - site : fig . s1 individual minimum plasma concentrations of total darunavir ( a ) , unbound darunavir ( b ) and total ritonavir ( c ) after administration of darunavir / ritonavir 600/100 mg twice daily ( bid ) , during the second and third trimesters and postpartum .
s2 mean ( standard error ) plasma concentration time curves for albumin ( a ) and 1-acid glycoprotein ( aag ) ( b ) assessed at various time - points throughout the study . fig .
s3 antiviral activity expressed as percentage response rate ( a ) ( only patients who completed the study in its entirety are included ) and status of the immune system expressed as median percentage cd4 count ( b ) assessed at various time - points throughout the study . | objectivesantiretroviral therapy during pregnancy is recommended to reduce the risk of mother - to - child transmission of hiv and for maternal care management .
physiological changes during pregnancy can affect pharmacokinetics , potentially altering pharmacological activity .
we therefore evaluated the pharmacokinetics of twice - daily ( bid ) darunavir in hiv-1-infected pregnant women.methodshiv-1-infected pregnant women receiving an antiretroviral regimen containing darunavir / ritonavir 600/100 mg bid were enrolled in this study .
total and unbound darunavir and total ritonavir plasma concentrations were obtained over 12 h during the second and third trimesters and postpartum .
total darunavir and ritonavir plasma concentrations were determined using a validated high - performance liquid chromatography tandem mass spectrometry assay and unbound darunavir was determined using 14c - darunavir - fortified plasma .
pharmacokinetic parameters were derived using noncompartmental analysis.resultsdata were available for 14 women .
the area under the plasma concentration time curve from 0 to 12 h ( auc12h ) for total darunavir was 1724% lower during pregnancy than postpartum .
the auc12h for unbound darunavir was minimally reduced during pregnancy vs. postpartum .
the minimum plasma concentration ( cmin ) of total and unbound darunavir was on average 4386% and 1014% higher , respectively , during pregnancy vs. postpartum .
the antiviral response ( < 50 hiv-1 rna copies / ml ) was 33% at baseline and increased to 7390% during treatment ; the percentage cd4 count increased over time .
one serious adverse event was reported ( increased transaminase ) .
all 12 infants born to women remaining in the study at delivery were hiv-1-negative ; four of these infants were premature.conclusionstotal darunavir exposure decreased during pregnancy .
no clinically relevant change in unbound ( active ) darunavir occurred during pregnancy , suggesting that no dose adjustment is required for darunavir / ritonavir 600/100 mg bid in pregnant women . | Introduction
Methods
Study design and treatment
Objectives
Evaluations
Statistical analysis
Results
Population and baseline characteristics
Disposition
Pharmacokinetics of total and unbound darunavir
Pharmacokinetics of ritonavir
Albumin and
Antiviral activity
Safety
Discussion
Supporting Information |
fractures have a high incidence rate in traffic accidents and are one of the three most important complications during accidents ( 1 ) .
each year millions of people all over the world suffer from bone fractures , the complications of which threaten the patients health for several years ( 2 , 3 ) .
one of the most important measures in the management of such patients in the emergency unit is fixation and pain control .
opioids are one of the main and most effective medications to relieve pain ( 4 , 5 ) by suppression of pain center in the cns through stimulation of and receptors .
however , complications such as dependence , tolerance , suppression of respiratory center and activation of vomiting center are some of their problems ( 6 ) .
nonetheless , this group of medications has gastrointestinal complications and even some of them exhibit renal and hepatic toxicity ( 7 ) .
paracetamol , aminophylline , tramadol , nefopam etc are some other drugs that have been evaluated in different studies for pain relief .
it is one of the medications , which is used for general anesthesia and sedation .
ketamine is an antagonist of n - methyl - d - aspartate ( nmda ) ( 8 , 9 ) and is used in iv , intramuscular , enteric , subcutaneous , intra - nasal , rectal and epidural forms .
however , at higher doses it can have complications such as hallucination , dysphoria , nightmares , an increase in intracranial pressure , hypertension , tachycardia , tremors and clonic - tonic seizures ( 10 , 11 ) .
several studies have shown that ketamine is effective in pain relief ; however , in the majority of studies available , ketamine has been used in conjunction with other analgesics and no study is available in which use of this medication alone has been comprehensively evaluated for pain relief . on the other hand , studies available have not evaluated the use of this medication in trauma patients in emergency units .
therefore , the present study was designed to evaluate the effect of ketamine alone on pain relief in trauma patients referring to an emergency unit of a third - level hospital .
study design and setting
the present double - blind clinical trial was carried out in 2012 - 2013 in al - zahra and ayatollah kashani educa - tional centers in isfahan , iran .
the subjects consisted of patients with fractures of long bones , referring to the emergency unit .
the protocol of the study was ap - proved by the ethics committee of isfahan university of medical sciences .
the study was registered in iranian registry of clinical trial ( irct number : irct2015042812072n3 ) .
the inclusion criteria consisted of an age range of 18 - 55 years , fractures of long bones and consent to participate in the study .
exclusion criteria consisted of drug abuse , trauma to the head , symptoms and signs of increased intracranial pressure , a decrease in consciousness level , respiratory problems , a history of asthma , contraindications for ketamine ( i.e. a history of cardiac problems , especially congestive heart failure , ischemic cardiac conditions , hypertension and patients with cerebrovascular attack ) and morphine ( i.e. asthma , respiratory problems , hemodynamic instability ) .
in addition , in case of any allergic reaction to any of the medications used , the patient was excluded from the study .
the sample size was estimated at 63 subjects in each group based on numeric rating scale ( nrs ) at 95% confidence interval , a study power of 80% , a standard deviation of 1.6 for pain severity and a minimum difference significance of 2 between the two groups ( 12 ) .
first the patients demographic and clinical data were recorded , which consisted of background diseases , drugs taken , drug abuse , drug allergies , the last meal eaten , location of fracture and severity of pain .
then the eligible patients were randomly divided into two groups : the group receiving iv morphine at a dose of 0.1 mg / kg and the group receiving iv ketamine at a dose of 0.5 mg / kg . to make sure of the double - blind protocol of the study ,
preparation of the solutions , injections and registration of the results were carried out by three different physicians who had no contact or relationship with each other .
the data on the injection of medications were available only to the chief researcher and the medical care personnel were granted access to such data only when drug complications arose . in such a case ,
the severity of pain was registered before injection and 10 minutes after injection based on nrs ( 13 ) . in cases
in which pain did not subside after 10 minutes ( a decrease in pain severity equal to or less than 3 ) , the patient received half the initial dose again .
demographic variables ( % ) of patients
statistical analysis
data were entered into spss 11.5 and were analyzed after being transferred to stata 11.0 software .
the severity of pain before administration of medications and 10 minutes after initiation of treatment , was reported as means standard deviations and analyzed using independent t - test .
then kaplan - meier curves and log rank analysis were used to evaluate the success of treatment , which was defined as a decrease of 3 scores in pain severity .
126 patients were included in the study and randomly divided into two equal groups of morphine and ketamine .
the mean ages of the patients in the morphine and ketamine groups were 53.614.3 and 35.113.5 years , respectively ( p=0.54 ) .
forty - five ( 71.4% ) and 51 ( 80.95% ) patients were male in the ketamine and morphine groups , respectively ( p=0.21 ) .
the mean pain severity scores at admission in the ketamine and morphine groups were 8.80.8 and 8.950.8 , respectively ( p=0.32 ) . after therapeutic intervention , the severity of pain decreed significantly in the ketamine ( 2.71.8 ; p<0.001 ) and morphine groups ( 2.41.5 ; p<0.001 ) , with no significant differences between the two groups ( p=0.28 ) , indicating that both medications are equally effective in alleviating pain ( figure 1 ) .
kaplan - meier curve showed that five minutes after initiation of injection , ketamine and morphine resulted in a successful decrease in pain severity in 33 ( 52.4% ) and 38 ( 60.3% ) patients , respectively .
this rate increased to 59 ( 93.65% ) and 61 ( 96.8% ) patients , respectively , after 10 minutes .
log rank test did not show any significant difference in success rates between the two groups ( p=0.62 ) ( figure 2 ) .
none of the patients receiving morphine exhibited any complications ; however , during the intervention , six patients ( 9.5% ) receiving ketamine developed emergence phenomenon ( p=0.28 ) . and
four patients ( 6.3% ) in this group required a rescue dose due to the short period of the drug effect ( p=0.12 ) .
the results of the present study showed that administration of a low dose of ketamine ( 0.5 mg / kg ) results in a significant decrease in pain severity of long bone fractures .
the incidence of drug complications was higher in the ketamine group compared to the morphine group ( p=0.028 ) , with emergence phenomenon in four subjects .
although the incidence of this complication was higher in the ketamine group , other studies have emphasized that since ketamine is one of the safest and most appropriate medications for sedation in emergency wards , such a complication should not preclude its use because this complication is resolved spontaneously without any therapeutic intervention ( 14 ) .
the majority of studies available have evaluated the efficacy of combination treatment with morphine/ ketamine in decreasing pain due to fractures .
galinski et al showed that use of low doses of ketamine decreases the need for morphine up to 26% and its efficacy when administered alone is similar to that of morphine in alleviating pain ( 5 ) .
weinbroum et al evaluated the simultaneous administration of morphine / ketamine compared with morphine alone in decreasing pain severity after surgery and showed that simultaneous administration of morphine and ketamine results in a significant decrease in pain severity perception by patients ( 15 ) .
a systematic review , too , showed that use of ketamine as a supplementary medication results in a decrease in the need for morphine , preventing unfavorable complications ( 16 ) .
means ( sd ) of pain severity in patients receiving ketamine and morphine before and after intervention . *
nrs : numeric rating scale . the treatment success rate in the morphine and ketamine groups at different time intervals .
mccarty et al , too , reported that ketamine is an appropriate , rapid and safe sedative agent , which facilitates reduction of fractures in children in the emergency unit .
however , they claim that ketamine should only be administered in locations , such as emergency units , where precise monitoring of patients is possible and an experienced physician is available in the center for the management of airways ( 17 ) .
snijdelaar et al reported that the combination of ketamine / morphine significantly decreases the need for morphine and has better analgesic effects ( 18 ) .
jennings et al reported similar findings but emphasized that more minor complications are seen with a combination of morphine / ketamine ( 12 ) .
one of the most important limitations of the present study was a short follow - up period of patients . in the present study ,
all the patients were evaluated for only 10 minutes , which precluded evaluation of the effect of ketamine at longer periods .
therefore , it is suggested that in future studies the efficacy of the medication be evaluated at longer follow - up periods .
due to ethical considerations , it was not possible to follow the patients without any medicinal intervention and use only placebo .
it was shown in the present study that iv administration of ketamine results in pain relief in bone fracture patients . however , the effect of this medication on the recurrence of pain is still unknown .
therefore , it is possible that further administration of the medication will prevent recurrence of pain .
in addition , the efficacy of other routes for administration of the medication , such as intramuscular , intra - nasal and local use , should be evaluated in future studies .
in addition , use of different administration regimens , such the continuous use or infusion , should be evaluated in future studies .
the results of the present study showed that administration of a low dose of ketamine ( 0.5 mg / kg ) results in a significant decrease in the severity of acute pain in patients with fractures of long bones .
all authors passed four criteria for authorship contribution based on recommendations of the international committee of medical journal editors . | introduction : the selective medication for pain control in many clinical situations is morphine but its complications prevent its widespread use .
ketamine has been introduced as an alternative for morphine in some studies .
however , the efficacy of its solitary use has not yet been evaluated .
therefore , the present study was undertaken to evaluate the effect of ketamine alone in relieving pain in trauma patients referring to an emergency unit .
methods : in this double - blind clinical trial , patients with long bone fractures were randomly divided into two groups of treatment with intravenous ( iv ) morphine at a dose of 0.1 mg / kg and treatment with iv ketamine at a dose of 0.5 mg / kg . pain severity of the patients was recorded before and 10 minutes after injection based on numeric rating scale .
the means in the two groups were compared using independent t - test . then the kaplan - meier curve and log rank analysis were used to evaluate the success of treatment .
results : 126 patients were included in this study .
the mean ages of the patients in the morphine and ketamine groups were 33.614.3 and 35.113.5 years , respectively ( p=0.54 ) .
after therapeutic intervention , the pain severity significantly decreased in ketamine ( 2.71.8 ; p<0.0001 ) and morphine ( 2.41.5 ; p<0.0001 ) groups , with a similar effect of both medications on alleviating pain ( p=0.28 ) .
the success rate of the treatment at 10-minute interval in groups receiving ketamine and morphine were 59 ( 93.65% ) and 61 ( 96.8% ) patients , respectively ( p=0.62 ) .
conclusion : the results of the present study showed that administration of ketamine at a low dose ( 0.5 mg / kg ) results in a significant decrease in the severity of acute pain in patients with fractures of long bones .
this palliative effect is very similar to that of morphine . | Introduction:
Methods
Results:
Discussion:
Conclusion:
Conflict of interest:
Funding support:
Authors contributions: |
the mortality and morbidity from cvst in various prospective studies range between 8.8% and 44.4% .
conditions predisposing to dural sinus thrombosis include puerperium , trauma , malignancy , disseminated intravascular coagulation , hypercoagulable states , infections , medications ( e.g. , synthetic steroids and contraceptive hormones ) , connective tissue disorders , and dehydration .
headache is the most common symptom ( 8090% ) , other common presentations are focal or generalized seizures , focal neurological deficits , and alteration in sensorium .
occlusions in the superficial venous system are better tolerated and has a better prognosis than thrombosis in the deep venous system because of the extensive collateral supply .
the treatment is aimed at opening up of the occluded sinuses by systemic anticoagulation and giving antiedema measures in the acute phase .
surgical decompression may be the option in cases with a large infarct volume and midline shift . in cases where there is no significant improvement following systemic anticoagulation , direct thrombolysis and mechanical thrombectomy can be considered . here
, we review the techniques and indications for endovascular treatment of cvst and long - term results in 8 cases of dural venous sinus thrombosis ( dvst ) that underwent mechanical thrombectomy with penumbra device with or without concurrent balloon angioplasty and chemical thrombolysis .
out of the 243 cases of acute cvt treated in a quaternary level teaching hospital over a period of 4 years , 8 underwent mechanical thrombectomy using the penumbra system , with or without concurrent balloon angioplasty and chemical thrombolysis .
the ages ranged from 2040 years , with all the patients being females . in all 8 patients , the common presenting feature was headache [ table 1 ] . in 5/8 patients
, there was involvement of the superficial venous system , and in the rest there was involvement of the superficial and deep system .
seven out of 8 cases had venous infarct on the magnetic resonance imaging ( mri ) before endovascular thrombectomy was performed [ figure 1 ] .
clinical and radiological profile mri brain showing areas of restricted diffusion in deep white matter of bilateral frontal lobes ( arrow ) in both diffusion ( a ) and adc maps ( b ) suggestive of infarcts .
there is extensive subacute thrombosis of the entire superior sagittal sinus ( straight arrow ) , both transverse sinuses ( curved arrow ) , straight sinus ( thin arrow ) , and multiple cortical veins in the mrv images ( c - e ) all patients were initially managed medically , systemic anticoagulation ( intravenous unfractionated heparin ) was started to keep the target ptt > 1.5 times the control .
anticonvulsants were started in patients who presented with seizures and also were given prophylatically to others with large venous infarcts involving the cerebral cortex .
all patients were treated for raised intracranial pressure with acetazolamide ( dose ranging from 250 mg thrice a day to 500 mg thrice day ) , intravenous dexamethasone , and hypertonic ( 3% ) saline .
these patients were taken up for endovascular thrombectomy after clinical and radiological worsening . in 5 out of 8 cases ,
balloon angioplasty was concurrently used along with the penumbra system ( penumbra , alameda , usa ) . in the remaining 3 cases , however ,
transarterial cerebral angiography was not routinely performed to survey the dvst detail , except when required .
penumbra mechanical clot retrieval was done with additional balloon angioplasty and chemical thrombolysis were carried out on as required basis . a 6f envoy guide catheter (
codman & shurtleff , inc , raynham , ma , usa ) was first advanced through the femoral vein and placed at the base of the skull .
the blocked dural sinuses were approached using an anteroposterior , lateral , or a combination of both projections . using a 300 cm 0.014 in microwire , a 032
penumbra reperfusion microcatheter was advanced retrogradely into the anterior two - thirds of the superior sagittal sinus . to disrupt the thrombus , 5 mg tpa , or 2l urokinase
was administered or a 35 mm balloon angioplasty was performed up to 23 times from the distal to the proximal end of the occlusion to sufficiently extract the thrombus . then using a penumbra reperfusion catheter separator combination ,
thrombus extraction was performed [ figures 25 ] . in cases where there was no significant angiographic recanalization of the sinus after 2 or 3 passes of the penumbra device along with thrombolysis / angioplasty , the procedure was discontinued .
thrombolysis was done by angioplasty ( a ) with a 3 mm 10 cm balloon ( arrow ) followed by mechanical thrombectomy ( b ) with a penumbra catheter system ( arrow ) .
no significant recanalization of superior sagittal sinus ( arrow ) , transverse , and sigmoid sinuses in the post - thrombolysis venogram ( c ) mrv done 5 days after thrombolysis ( a - c ) shows partial resolution of thrombus in the superior sagittal sinus ( straight arrow ) , transverse sinus ( curved arrow ) , and straight sinus with residual filling defects .
mrv done two and a half years later ( d ) shows near complete recanalization of the superior sagittal sinus ( straight arrow ) , transverse ( curved arrow ) and sigmoid sinuses , and straight sinus non - contrast ct brain axial images shows hyperdense area ( arrow ) in the parasagittal aspect of right high parietal region suggestive of a haemorrhagic infarct ( a ) mri brain done the next day shows heterogeneous lesion ( arrows ) in flair and t2 ( b - d ) with blooming on swi ( e ) in right parasagittal parietal region keeping with a infarct with haemorrhagic transformation .
mrv shows filling defects in the superior sagittal sinus ( straight arrow ) , right transverse ( curved arrow ) and sigmoid sinuses ( f and g ) .
ct brain done 6 days later shows ( h ) increase in haemorrhagic component in the right high fronto - parietal region ( straight arrow ) and new hypodense lesion in left high fronto - parietal region ( curved arrow ) with small foci of haemorrhage thrombolysis was done by balloon angioplasty ( a ) using a 3 mm 4 cm balloon ( arrow ) followed by mechanical thrombectomy ( b ) using a penumbra thrombectomy device ( arrow ) .
post - thrombolysis venogram ( c ) shows minimal recanalization of the anterior superior sagittal sinus ( arrow ) and angiogram ( d ) showed no flow in the anterior superior sagittal sinus but a patent posterior segment of superior sagittal sinus medical management was continued in all patients .
a repeat magnetic resonance venography ( mrv ) was performed if the patient showed no significant clinical improvement after 23 days .
after discharge , the patient was followed up with , mrs score assessment and fundal examination .
there were no hemorrhagic events during or after the procedure in any of the patients , nor any immediate or late endovascular - related complications was detected .
good improvement was noted at 6 months with mrs 02 in 5/8 ( 62% ) cases [ table 2 ] .
patients were followed for a mean of 14.5 months ( range : 3 months to 26 months ) ; there were no new neurological events during the follow - up period .
venous sinus thrombosis is a rare and potentially life - threatening condition , with a 30-day fatality rate of 3.4% in a multicentre international prospective study .
intravenous anticoagulation with heparin , followed by oral anticoagulation is the front - line treatment .
when the clinical condition fails to respond despite standard medical management , endovascular therapy can be undertaken .
all 8 patients described here were young , otherwise healthy individuals with severe and progressive neurological symptoms in spite of standard medical therapy . before the era of mechanical thrombectomy devices ,
found that local thrombolysis was associated with a non - negligible incidence of major bleeding complications , including intracranial bleeding , potentially affecting patient outcome . in this study ,
urokinase was used because it was readily available and less expensive than rtpa . in only one case
the use of mechanical thrombectomy with or without concurrent chemical thrombolysis has been reported using other devices , such as balloon angioplasty , the angiojet rheolytic catheter ( possis medical , minneapolis , minnesota , usa ) , the merci retriever device ( concentric medical , mountain view , california , usa ) , and the solitaire fr retrieval device ( covidien , irvine , ca , usa ) , with each having their own inherent limitations . in 3 out of 8 cases ,
thrombolysis was combined with balloon angioplasty and mechanical thrombectomy to aid in clot retrieval . here ,
we report possibly the largest series using the penumbra system for mechanical thrombectomy in dvst .
the penumbra system is a modification of the manual proximal aspiration technique and consists of a dedicated reperfusion catheter connected to a pump , which applies continuous aspiration . a microwire with an olive - shaped tip called the separator
is used to clear the tip of the reperfusion catheter from clot fragments to avoid obstruction .
the ps has shown safety and efficacy in the mechanical treatment of acute ischemic stroke due to thromboembolism . in this report
, the procedures utilized a 0.41 or 0.32 inch penumbra system reperfusion catheter based on the ease of the wire to traverse the thrombus .
balloon angioplasty augmentation was performed in cases where the penumbra system separator did not macerate the clot independently to allow optimum aspiration using the reperfusion catheter .
while most cases did not demonstrate significant recanalization in the immediate post - thrombolysis imaging , they showed improvement in their clinical course after the procedure as well as significant resolution in the follow - up imaging [ figures 3d and 6 ] . there were no intraprocedural complications and no procedure - related complications postoperatively .
the mean follow - up period in this study was 14.5 months , which is unique compared to other similar studies .
none of the patients had recurrent dural sinus thrombosis during the follow - up period .
a multicentre randomized controlled trial may be required to measure the clinical efficacy on a large sample size .
mrv done 4 months later ( a and b ) showed near complete recanalization of the superior sagittal sinus ( straight arrow ) , right transverse ( curved arrow ) , and sigmoid sinuses
cerebral venous sinus thrombosis is a rare but life - threatening condition that demands timely diagnosis and therapy . in cases of rapidly declining neurological status despite standard therapy of systemic anticoagulation
, mechanical thrombectomy appears to be a safe and effective method when used alone or in combination with catheter - directed chemical thrombolysis . | background : in dural venous sinus thrombosis ( dvst ) , the mortality ranges 530% . deep venous system involvement and septic dural sinus thrombosis
have a higher mortality rate . in acute occlusion , collateral flow may not be established , which may result in significant edema and mass effect .
endovascular interventions may be considered as a treatment option in appropriate high - risk patients with dvst.materials and methods : eight patients with magnetic resonance imaging ( mri)-confirmed dural sinus thrombosis , who did not respond to the conventional standard medical treatment , were subsequently treated with mechanical thrombectomy using the penumbra system. in all cases , medical treatment including anticoagulants were continued following the procedure for a minimum period of 1 year.results:recanalization of the dural sinus thrombosis was achieved in all 8 cases .
there were no immediate or late endovascular - related complications .
one death occurred due to an unrelated medical event . at 6 months
, there was notable improvement in the modified rankin score ( mrs ) , with 5/8 ( 62% ) patients achieving mrs of 2 or less .
the follow - up ranged between 3 months and 26 months ( mean : 14.5 months ) , and there were no new neurological events during the follow - up period.conclusion:cerebral venous sinus thrombosis is a rare but life - threatening condition that demands timely diagnosis and therapy . in cases of rapidly declining neurological status despite standard therapy with systemic anticoagulation and anti - edema measures ,
mechanical thrombectomy could be a lifesaving and effective option . in this study
, good outcomes were observed in the majority of patients at long - term follow up . | Introduction
Materials and Methods
Discussion
Conclusion
Financial support and sponsorship
Conflicts of interest |
femtosecond laser - assisted cataract surgery ( flacs ) is superior to conventional phacoemulsification in terms of precise wound construction , capsulotomy , intraocular lens ( iol ) centration , and decreased effective phacoemulsification time.14 flacs is comparable to traditional cataract surgery in terms of intraoperative complications , although further research is needed to evaluate its long - term safety aspects.57 it may be especially advantageous in white cataracts , where achieving an adequately sized continuous curvilinear capsulorhexis is the major surgical challenge . the increased incidence of capsulorhexis - related complications in white cataracts is often associated with posterior capsular rent , vitreous loss , and nucleus drop.8 various maneuvers have been used to facilitate capsulorhexis , such as use of high - molecular - weight viscoelastic,9 trypan blue dye to stain the anterior capsule,10 two - stage capsulorhexis,11 frequent aspiration of liquefied cortical matter,12 use of vannas scissors,12 and endoilluminator.9 however , limited literature exists on the application of femtosecond lasers in white cataracts.13 comparative evaluation of flacs and conventional phacoemulsification has been done for varying grades of nuclear sclerosis ; however , there are no studies that have compared the outcomes of flacs with conventional phacoemulsification in cases with white cataract.5,7 we herein report our results of comparison of femtosecond laser capsulotomies with conventional capsulorhexis in cases of white cataract .
in this prospective comparative study , 80 eyes of 80 patients with white cataract were enrolled at dr rp centre for ophthalmic sciences , all india institute of medical sciences , new delhi , india .
ethical clearance was obtained from the all india institute of medical sciences institutional review board .
the white cataracts were classified into type i , ii , and iii according to the classification provided by brazitikos et al.8 type i intumescent , white cataracts are characterized by the presence of liquefied cortex , type ii white cataracts have a voluminous nucleus with little amount of solid white cortex , and type iii white cataracts have anterior capsule fibrosis .
type iii white cataracts with calcific and fibrotic capsules were excluded from the study.8 eyes with preexisting glaucoma , retinal pathology , pseudoexfoliation syndrome , or pupillary dilatation < 6 mm were also excluded .
the patients were divided into two groups , each consisting of 40 eyes ( 40 patients ) .
group i ( n=40 ) underwent flacs and group ii ( n=40 ) underwent conventional phacoemulsification performed by an experienced phacoemulsification surgeon ( jst ) .
the patients with white cataract scheduled to undergo flacs or conventional phacoemulsification ( based on patient s choice and affordability of the procedure ) were compared .
the preoperative detailed examination included uncorrected distance visual acuity ( udva ) , anterior segment evaluation , slit - lamp biomicroscopy , applanation tonometry , biometry ( tonoref iii , nidek co. , ltd . and ocuscan rxp , alcon laboratories , inc . ) , and ultrasonography b - scan ( master - vu ophthalmic ultrasound , sonomed escalon ) .
the secondary outcome measures were intraoperative phacoemulsification parameters , intraoperative complications , and postoperative visual acuity .
in group i , the preoperative planning of the corneal incisions , capsulotomy , and nucleotomy was done on lensx version 2.23 femtosecond laser system ( alcon lensx , inc . ,
a 4.9 mm capsulotomy was planned , with a 2.2 mm temporal clear corneal incision and two 1.1 mm side ports at 90 and 240. the chop pattern of nucleotomy was selected , with three chops of length 6 mm each .
the anterior segment structures were imaged with intraoperative optical coherence tomography and the planned treatment was verified .
the femtosecond laser parameters were the same as those used in our routine cases ( nonwhite cataract cases ) of flacs .
the energy was kept at 6 j for corneal incisions , 8 j for capsulotomy , and 12 j for nucleotomy .
the spot and layer separation was 5 m for the side port incisions , 6 m for 2.2 mm corneal incision , and 14 m for the nucleotomy .
for capsulotomy , the spot separation was 5 m , the layer separation was 4 m , and the anterior and posterior delta value was 350 m each .
after femtosecond laser application , the corneal incisions were opened with the help of flap lifter .
sodium hyaluronate 1% was injected to maintain the anterior chamber and trypan blue 0.06% ( visionblue , dorc international , the netherlands ) was injected to stain the anterior capsule .
the capsulotomies were lifted and removed with the microcapsulorhexis forceps , and microadhesions , if any , were released ( figure 1 , video s1 ) .
gentle hydrodissection was performed , followed by phacoemulsification , irrigation aspiration ( ia ) , and implantation of single - piece hydrophobic acrylic iol .
a hybrid technique of ia using a combination of coaxial and bimanual ia hand pieces was frequently employed to aspirate the subincisional cortical matter in cases with difficulty during removal of cortical matter.14 the corneal wounds were hydrated at the end of the procedure . in group ii , a 2.2 keratome was used to construct a temporal corneal incision and two side ports were constructed using a 20 g microvitreoretinal blade .
capsulorhexis was performed with a 26-gauge needle cystotome ; microcapsulorhexis forceps was used if required . in cases with intumescence ,
an initial smaller capsulorhexis was followed by the aspiration of liquefied cortex , thus decreasing the raised intralenticular pressure .
the aim was to provide ~0.5 mm iol coverage all around as the optic of the iol was 6 mm .
after iol implantation , the capsulorhexis was further enlarged if required to achieve an adequate size .
intraoperatively , the total surgical time , cumulative dissipated energy , total ultrasound time , and total aspiration time were noted .
intraoperative complications such as anterior capsular tears / extension , posterior capsular tears , vitreous loss , need for anterior vitrectomy , and inability to implant iol were noted .
postoperatively , clinical photographs were captured with the help of slit - lamp - mounted camera on postoperative day 30 and after 6 months , and the capsulorhexis size , shape , continuity , and iol optic coverage were evaluated .
image - processing software ( imagej 1.46r , national institutes of health , md , usa ) was used to measure the diameter of the capsulorhexis and calculate the circularity index .
the diameter of the implanted iol was used as a scale to calibrate the image .
the circularity index was given by the formula 4 ( area / perimeter2 ) and a circularity index of 1 implied a perfect circle.3 the iol centration and coverage was assessed on the basis of coverage of iol optic in all four quadrants by the capsulotomy / capsulorhexis margin .
continuity of the capsulorhexis refers to the absence of radial extension / tear of the capsulorhexis edge .
udva and corrected distance visual acuity ( cdva ) were assessed on postoperative day 30 and at 6 months .
statistical analysis was done using statistical package for the social sciences ( spss 11.0 ; spss inc . , chicago , il , usa ) .
normally distributed continuous variables were expressed as mean standard deviation and were compared using independent samples t - test .
nominal data were compared using chi - square test or fisher s exact test as appropriate . a p - value less than 0.05 was considered significant .
in group i , the preoperative planning of the corneal incisions , capsulotomy , and nucleotomy was done on lensx version 2.23 femtosecond laser system ( alcon lensx , inc . ,
a 4.9 mm capsulotomy was planned , with a 2.2 mm temporal clear corneal incision and two 1.1 mm side ports at 90 and 240. the chop pattern of nucleotomy was selected , with three chops of length 6 mm each .
the anterior segment structures were imaged with intraoperative optical coherence tomography and the planned treatment was verified .
the femtosecond laser parameters were the same as those used in our routine cases ( nonwhite cataract cases ) of flacs .
the energy was kept at 6 j for corneal incisions , 8 j for capsulotomy , and 12 j for nucleotomy .
the spot and layer separation was 5 m for the side port incisions , 6 m for 2.2 mm corneal incision , and 14 m for the nucleotomy .
for capsulotomy , the spot separation was 5 m , the layer separation was 4 m , and the anterior and posterior delta value was 350 m each .
after femtosecond laser application , the corneal incisions were opened with the help of flap lifter .
sodium hyaluronate 1% was injected to maintain the anterior chamber and trypan blue 0.06% ( visionblue , dorc international , the netherlands ) was injected to stain the anterior capsule .
the capsulotomies were lifted and removed with the microcapsulorhexis forceps , and microadhesions , if any , were released ( figure 1 , video s1 ) .
gentle hydrodissection was performed , followed by phacoemulsification , irrigation aspiration ( ia ) , and implantation of single - piece hydrophobic acrylic iol .
a hybrid technique of ia using a combination of coaxial and bimanual ia hand pieces was frequently employed to aspirate the subincisional cortical matter in cases with difficulty during removal of cortical matter.14 the corneal wounds were hydrated at the end of the procedure . in group ii , a 2.2 keratome was used to construct a temporal corneal incision and two side ports were constructed using a 20 g microvitreoretinal blade .
capsulorhexis was performed with a 26-gauge needle cystotome ; microcapsulorhexis forceps was used if required . in cases with intumescence , an initial smaller
capsulorhexis was followed by the aspiration of liquefied cortex , thus decreasing the raised intralenticular pressure .
the aim was to provide ~0.5 mm iol coverage all around as the optic of the iol was 6 mm .
after iol implantation , the capsulorhexis was further enlarged if required to achieve an adequate size .
intraoperatively , the total surgical time , cumulative dissipated energy , total ultrasound time , and total aspiration time were noted .
intraoperative complications such as anterior capsular tears / extension , posterior capsular tears , vitreous loss , need for anterior vitrectomy , and inability to implant iol were noted .
postoperatively , clinical photographs were captured with the help of slit - lamp - mounted camera on postoperative day 30 and after 6 months , and the capsulorhexis size , shape , continuity , and iol optic coverage were evaluated .
image - processing software ( imagej 1.46r , national institutes of health , md , usa ) was used to measure the diameter of the capsulorhexis and calculate the circularity index .
the diameter of the implanted iol was used as a scale to calibrate the image .
the circularity index was given by the formula 4 ( area / perimeter2 ) and a circularity index of 1 implied a perfect circle.3 the iol centration and coverage was assessed on the basis of coverage of iol optic in all four quadrants by the capsulotomy / capsulorhexis margin .
continuity of the capsulorhexis refers to the absence of radial extension / tear of the capsulorhexis edge .
udva and corrected distance visual acuity ( cdva ) were assessed on postoperative day 30 and at 6 months .
statistical analysis was done using statistical package for the social sciences ( spss 11.0 ; spss inc . ,
chicago , il , usa ) . normally distributed continuous variables were expressed as mean standard deviation and were compared using independent samples t - test .
nominal data were compared using chi - square test or fisher s exact test as appropriate . a p - value less than 0.05 was considered significant .
the mean age of the patients was 62.99.1 years in group i and 64.88.3 years in group ii ( p=0.34 ) .
group i consisted of 20 males and 20 females ; group ii had 17 males and 23 females .
a continuous capsulotomy / capsulorhexis was achieved in 97.5% ( 39/40 ) of eyes , each in groups i and ii .
type i ( free floating ) , type ii ( microadhesions ; ie , an area of complete cut mixed with minute areas of adhesions ) , type iii ( incomplete treatment pattern no visible femtosecond laser cut in the anterior capsule ) , and type iv ( irregular complete pattern ) .
in group i , free - floating capsulotomies ( type i ) were achieved in 52.5% ( 21/40 ) of eyes . however , 47.5% ( 19/40 ) of eyes needed manual completion of the capsulotomy , of these 37.5% ( 15/40 ) had microadhesions ( type ii capsulotomy ) and
10% ( 4/40 ) had incomplete area of capsulotomy in 12 clock hours ( type iii capsulotomy ) . in group
the mean diameter of the capsulotomy / capsulorhexis was 4.90.1 mm in group i and 5.30.4 mm in group ii ( p<0.001 , difference 0.39 ; 95% confidence interval [ ci ] : 0.27 , 0.52 ) .
the mean circularity index was 0.9960.003 in group i and 0.9100.047 in group ii ( p - value < 0.001 , difference : 0.09 [ 95% ci : 0.07 , 0.10 ] ) .
inadequate coverage of iol by the capsulotomy / capsulorhexis edge was noted in 7.5% ( 3/40 ) cases in group i and 12.5% ( 5/40 ) cases in group ii ( p=0.712 ) . at 6 months ,
the mean diameter of the capsulotomy / capsulorhexis was 4.90.1 mm in group i and 5.30.4 mm in group ii ( p<0.001 , difference : 0.37 [ 95% ci : 0.25 , 0.50 ] ) .
the mean circularity index was 0.9910.023 in group i and 0.9100.047 in group ii ( p - value < 0.001 , difference : 0.08 [ 95% ci : 0.06 , 0.10 ] ) . the cumulative dissipated energy , total ultrasound time , total aspiration time , and total surgical time were comparable between the two groups ( table 2 ) .
there was no case of posterior capsular rent , vitreous loss , nucleus drop , or inability to implant iol in group i or ii .
the mean logarithm of the minimum angle of resolution ( logmar ) udva was 0.1280.122 in group i and 0.1150.127 in group ii ( p=0.655 ) at 1 month postoperatively .
the mean logmar cdva was 0.0100.044 in group i and 0.0150.053 in group ii ( p=0.649 ) at 1 month postoperatively . at 6 months ,
mean logmar udva was 0.130.12 in group i and 0.100.12 in group ii ( p=0.315 ) . at 6 months ,
mean logmar cdva was 0.0050.031 in group i and 0.0100.044 in group ii ( p=0.562 ) .
the white cataracts in each group were divided into two subgroups based on the release of white milky fluid on initiation of the capsulotomy / capsulorhexis .
the assessment of milky fluid egress was qualitative , and no attempt was made to quantify the amount of fluid by the surgeon . in group
i , 17 cases had release of white milky fluid ( subgroup a ) and 23 cases did not ( subgroup b ) . in group
ii , 19 cases were in the fluid group ( subgroup a ) and 21 cases were in the no - fluid group ( subgroup b ) .
the capsulotomy / capsulorhexis characteristics in the fluid cases were compared with the no - fluid cases in each group .
continuous capsulotomies were achieved in 94.1% ( 16/17 ) cases with fluid and 100% ( 23/23 ) cases with no - fluid ( p=0.42 ) . in the cases with fluid ,
free - floating ( type i capsulotomy ) capsulotomies were achieved in 23.5% ( 4/17 ) cases .
manual completion of the capsulotomy was needed in 76.5% ( 13/17 ) cases , of these 52.9% ( 9/17 ) had microadhesions ( type ii capsulotomy ) and 23.5% ( 4/17 ) had incomplete area of capsulotomy in 12 clock hours ( type iii capsulotomy ) . in cases with no - fluid ,
approximately 26.1% ( 6/23 ) of eyes needed manual completion of the capsulotomy and release of the microadhesions ( type ii capsulotomy ) .
the incidence of residual adhesions and incomplete capsulotomies was significantly more in cases with release of white milky fluid ( p=0.003 ) .
anterior capsular extension with radial tear was observed in one eye in fluid release group only ( p=0.42 ) .
the mean diameter of the capsulotomy was 4.90.1 mm in fluid and no - fluid group ( p=0.9 ) .
the mean circularity index was 0.9960.003 in the fluid group and 0.9970.003 in the no - fluid group ( p=0.1 ) .
inadequate coverage of iol by the capsulotomy edge was noted in 17.6% ( 3/17 ) cases in fluid group only ( p=0.09 ) .
a continuous capsulorhexis was achieved in 100% ( 19/19 ) cases with fluid and 95.2% ( 20/21 ) cases with no - fluid ( p=1.0 ) .
a multistep capsulorhexis was performed in 84.2% ( 16/19 ) cases with fluid and 57.1% ( 12/21 ) cases with no - fluid .
there was one case of anterior capsular extension with radial tear in no - fluid group only ( p=1.00 ) .
the mean diameter of the capsulorhexis was 5.30.3 mm in the fluid group and 5.40.4 mm in the no - fluid group ( p=0.7 , difference : 0.05 [ 95% ci : 0.3 , 0.2 ] ) .
the mean circularity index was 0.880.04 in the fluid group and 0.940.04 in the no - fluid group ( p - value < 0.001 , difference : 0.05 [ 95% ci : 0.02 , 0.08 ] ) .
inadequate coverage of iol by the capsulorhexis edge was noted in 15.8% ( 3/19 ) cases with fluid and 9.5% ( 2/21 ) cases with no - fluid ( p=0.65 ) .
continuous capsulotomies were achieved in 94.1% ( 16/17 ) cases with fluid and 100% ( 23/23 ) cases with no - fluid ( p=0.42 ) . in the cases with fluid ,
free - floating ( type i capsulotomy ) capsulotomies were achieved in 23.5% ( 4/17 ) cases .
manual completion of the capsulotomy was needed in 76.5% ( 13/17 ) cases , of these 52.9% ( 9/17 ) had microadhesions ( type ii capsulotomy ) and
23.5% ( 4/17 ) had incomplete area of capsulotomy in 12 clock hours ( type iii capsulotomy ) . in cases with no - fluid ,
approximately 26.1% ( 6/23 ) of eyes needed manual completion of the capsulotomy and release of the microadhesions ( type ii capsulotomy ) .
the incidence of residual adhesions and incomplete capsulotomies was significantly more in cases with release of white milky fluid ( p=0.003 ) .
anterior capsular extension with radial tear was observed in one eye in fluid release group only ( p=0.42 ) .
the mean diameter of the capsulotomy was 4.90.1 mm in fluid and no - fluid group ( p=0.9 ) .
the mean circularity index was 0.9960.003 in the fluid group and 0.9970.003 in the no - fluid group ( p=0.1 ) .
inadequate coverage of iol by the capsulotomy edge was noted in 17.6% ( 3/17 ) cases in fluid group only ( p=0.09 ) .
a continuous capsulorhexis was achieved in 100% ( 19/19 ) cases with fluid and 95.2% ( 20/21 ) cases with no - fluid ( p=1.0 ) .
a multistep capsulorhexis was performed in 84.2% ( 16/19 ) cases with fluid and 57.1% ( 12/21 ) cases with no - fluid .
there was one case of anterior capsular extension with radial tear in no - fluid group only ( p=1.00 ) .
the mean diameter of the capsulorhexis was 5.30.3 mm in the fluid group and 5.40.4 mm in the no - fluid group ( p=0.7 , difference : 0.05 [ 95% ci : 0.3 , 0.2 ] ) .
the mean circularity index was 0.880.04 in the fluid group and 0.940.04 in the no - fluid group ( p - value < 0.001 , difference : 0.05 [ 95% ci : 0.02 , 0.08 ] ) .
inadequate coverage of iol by the capsulorhexis edge was noted in 15.8% ( 3/19 ) cases with fluid and 9.5% ( 2/21 ) cases with no - fluid ( p=0.65 ) .
the main challenge in phacoemulsification in cases of white cataracts is achieving a continuous curvilinear capsulorhexis .
the absence of a red reflex , raised intralenticular pressure , and a fragile anterior capsule complicate the management of white cataracts , and an incomplete capsulorhexis has been reported in 3.85%28.3% cases of white cataracts.912,16 an ideal capsulorhexis is a well - centered circular opening with smooth margins and a slightly smaller diameter than the iol providing 360 iol coverage .
inadequate coverage of iol may lead to posterior capsular opacification and change in the effective lens position,17 whereas an excessively small capsulorhexis may cause anterior capsular contraction.18 in our study , reproducible circular capsulotomies were achieved with the help of femtosecond laser , providing adequate iol coverage in 92.5% ( 37/40 ) of cases .
the femtosecond laser - assisted capsulotomies may be of four types based on the pattern of completion.15 in our study , type i free - floating capsulotomies were achieved in 52.5% ( 21/40 ) cases .
type ii capsulotomy with microadhesions was observed in 37.5% ( 15/40 ) cases and 10% ( 4/40 ) had type iii capsulotomy with incomplete treatment pattern in 12 clock hours .
a significantly higher incidence of residual adhesions ( type ii and type iii capsulotomies ) was observed in the subgroup with release of white milky fluid after femtosecond laser delivery ( p<0.003 ) .
the reason for microadhesions / incomplete capsulotomies was the explosive egress of white milky fluid on initiation of the capsulotomy , which obscures the visual field and hampers the subsequent delivery of the laser at the same plane .
the release of the intralenticular pressure after initiation of the capsulotomy causes a slight change in the position of the anterior capsular plane and hence may result in the occurrence of incomplete capsulotomy . during the lifting of the capsulotomy flap with the microcapsulorhexis forceps ,
the areas obscured by the white milky fluid during femtosecond laser application should be carefully assessed , as they are likely to have microadhesions .
it is imperative to use trypan blue dye to stain the anterior capsule in all cases to delineate the area of microadhesions or incomplete treatment pattern . in each of these cases ,
the free edge of the capsulotomy was grasped with the help of microcapsulorhexis forceps and a circumferential motion tracing the capsulotomy margins was performed , which was akin to the maneuver that one does while performing a manual capsulorhexis ( figure 1 , video s1 ) .
this crucial step ensures the effective release of the underlying residual adhesions in femtosecond laser - assisted capsulotomies . despite the presence of microadhesions and incomplete treatment patterns ,
the continuity and circularity of the capsulotomies was achieved in 97.5% ( 39/40 ) of the eyes .
the incidence of incomplete capsulotomies and microadhesions is more in white hypermature cataracts as compared to immature senile cataracts . in a case
series of 1,300 cases of senile cataract undergoing flacs , 96% capsulotomies were free floating or had small areas of nonperforations.19 in our study , one case of anterior capsular extension with radial tear was noted during flacs .
the radial extension occurred while polishing the anterior capsule after iol implantation ( figure 3 ) .
this case was characterized by raised intralenticular pressure as evidenced by a gush of white milky fluid after the initial capsulotomy opening and had a type ii capsulotomy with microadhesions . in cases with microadhesions ,
the capsular edge is fragile and careful anterior capsular polishing is needed to prevent extension and radial tears . in our experience , a raised intralenticular pressure with release of white milky fluid is the most significant factor affecting the femtosecond laser application . the milky fluid results in microadhesions and incomplete sectors of capsulotomy , which may increase the chances of tear extension during subsequent steps of phacoemulsification .
this is in contrast to the manual capsulorhexis where the release of fluid is associated with a subsequent decrease in the intralenticular pressure and more safety in completion of capsulorhexis .
a two - stage femtosecond laser capsulotomy has also been described in six cases of intumescent white cataract ; however , remnant tissue bridges were present in one - third of the mini - capsulotomies.20 in cases undergoing conventional phacoemulsification , a multistep capsulorhexis was performed in 70% cases to achieve an adequately sized capsulorhexis .
the circularity of the capsulorhexis was compromised , more so in cases with release of milky fluid .
microadhesions if present can be easily released during capsulotomy removal with forceps , without jeopardizing the size , circularity , and continuity of the capsulotomy .
a previous study has demonstrated the safety and efficacy of femtosecond laser - assisted capsulotomy in 25 cases of white cataracts , with radial anterior tears in two eyes , an adherent tongue - like capsule adhesion in nine eyes , and an incomplete capsulotomy in three eyes.13 the total aspiration time and total surgical duration was longer in flacs , but the difference between the two groups was not statistically significant .
a hybrid technique of ia using a combination of coaxial and bimanual ia hand pieces was frequently employed to aspirate the subincisional cortical matter in cases undergoing flacs , which may explain the longer aspiration times.14
to conclude , femtosecond laser creates single - step , circular , adequately sized capsulotomies and eliminates the difficulty associated with capsulorhexis in white cataracts .
the release of white milky fluid during femtosecond laser delivery is the most important factor affecting the creation of a free - floating capsulotomy , and microadhesions and incomplete capsulotomies may be present in up to 47.5% cases of flacs .
there is no significant difference in terms of the intraoperative complications and the final visual outcome between flacs and conventional phacoemulsification . to the best of our knowledge ,
this is the first prospective study comparing conventional phacoemulsification with flacs in white cataracts in terms of intraoperative parameters and postoperative outcomes .
further randomized control trials with a larger sample size should be undertaken to further evaluate the long - term superiority of femtosecond laser over conventional phacoemulsification . | purposeto compare femtosecond laser - assisted capsulotomy with conventional manual capsulorhexis in cases of white cataract.patients and methodsthe prospective comparative study enrolled 80 eyes ( 80 patients ) with white cataract that underwent either femtosecond laser - assisted cataract surgery ( group i , n=40 ) or conventional manual phacoemulsification ( group ii , n=40 ) at a tertiary care ophthalmic institution .
the groups were divided based on the patient s choice and affordability of the procedure .
capsulotomy / capsulorhexis was evaluated in terms of size , circularity index ( 4 [ area / perimeter2 ] ) , intraocular lens coverage , and continuity .
each group was further subdivided based on the release of white milky fluid on initiation of the capsulotomy / capsulorhexis , and the fluid cases were compared with the no - fluid cases .
the primary outcome measure was capsulotomy / capsulorhexis characteristics in the two groups .
the secondary outcome measures were intraoperative phacoemulsification parameters , intraoperative complications , and postoperative visual acuity.resultsthe size of the capsulotomy / capsulorhexis was 4.90.1 mm in group i and 5.30.4 mm in group ii ( p<0.001 ) .
mean circularity index was 0.9960.003 and 0.9090.047 in groups i and ii , respectively ( p<0.001 ) .
in group i , free - floating circular capsulotomies were obtained in 52.5% ( 21/40 ) eyes ; 37.5% ( 15/40 ) eyes had microadhesions ; and 10% ( 4/40 ) eyes had incomplete capsulotomy in 12 clock hours .
the incidence of residual adhesions was more in cases with release of white milky fluid ( p=0.003 ) . in group
ii , a multistep capsulorhexis was performed in 70% ( 28/40 ) of the eyes .
there was no difference in terms of visual outcomes and intraoperative complications.conclusionfemtosecond laser - assisted cataract surgery has the advantage of creating a circular and optimally sized capsulotomy in cases of white cataract .
the release of white milky fluid during femtosecond laser delivery is the most important factor affecting the creation of a free - floating capsulotomy . | Introduction
Patients and methods
Surgical technique
Statistical analysis
Results
Capsulotomy characteristics in cases with fluid and no-fluid in Group I
Capsulorhexis characteristics in cases with fluid and no-fluid in Group II
Discussion
Conclusion
None |
according to world health organization , sadness , loss of confidence , low self - esteem , and less energy are more common among females . in india ,
about one - fourth ( 27.7% ) of the female population falls in the 15 - 29 years age - group .
this age is a transition phase of life associated with spurt of physical , mental , emotional , and social development .
some degrees of premenstrual problems are experienced especially in the initial years of reproductive life by majority of young women .
epidemiologic surveys have estimated that as many as 80% of women of reproductive age experience some symptoms attributed to the premenstrual phase of the menstrual cycle .
premenstrual dysphoric disorder ( pmdd ) is the severe form of premenstrual syndrome ( pms ) .
somatic symptoms include edema , weight gain , mastalgia , headache , syncope , and paresthesia .
they appear about 1 week before the onset of menses and disappear soon after onset of menses .
the morbidity associated with pms is because of severity of symptoms , chronicity , the resulting emotional distress or impairment in work , relationships , and activities .
the level of impairment of pms is significantly higher than community norms on assessment by standard measures and similar to that of major depression .
women with pms report significant impairment in personal relationships , compromised work levels and increased absence from work , school , or college .
we considered that pms is relatively under - investigated area of psychiatry in india ; hence , this study was planned .
the objectives of the study are to find the prevalence of pms and pmdd among college students of bhavnagar ( gujarat ) , study its associated demographic and menstrual factors , rank common premenstrual symptoms , and compare premenstrual symptom screening tool ( psst ) with structured clinical interview for dsm - iv - tr defined pmdd ( scid - pmdd ) for sensitivity and specificity .
a cross - sectional study was done among undergraduate students of five colleges of bhavnagar city ( gujarat ) including government nursing college , excel school of nursing , shree sahajan and institute of nursing , mahila arts and commerce college , and government medical college bhavnagar from january to august , 2012 .
the sample size was calculated using the openepi version 2 ( atlanta , ga , usa ) open source epidemiological calculator with hypothesized 15% 4% prevalence of pms and pmdd at 99% confidence level .
the design effect was kept one . the minimal sample size which came on estimation at 95%
college students of 1730 years , having regular menstrual cycles ( 2135 days ) and willing to give written informed consent , were invited to participate in the study . those who could not participate in the research due to medical and gynecological illnesses such as anemia , diabetes , hypothyroidism , asthma , migraine , epilepsy , pelvic inflammatory disease , endometriosis , and amenorrhea were excluded .
it is the screening tool developed by steiner et al . , which reflects and translates categorical dsm - iv - tr criteria into a rating scale with degrees of severity .
it includes 14 items assessing premenstrual symptoms of mood , anxiety , sleep , appetite , and physical symptoms .
participants rated their experience of each symptom and functional impairment item on four - point likert scale as not at all ,
pmdd , moderate to severe pms , and no / mild pms subjects were identified using psst scoring criteria .
the translation was validated by back translation and comparison with original form by group of experts who were well - versed with both languages .
scid - pmdd is a clinician - administered structured interview developed and validated by accortt et al .
it includes 11 psychological and physical symptoms of criterion a phrased in a detailed layperson format similar to items on the scid to facilitate the assessment of the specific dsm - iv - tr criteria for pmdd .
section ii included menstrual history , premenstrual symptoms , hormonal pills use , and family history of pms symptoms in first - degree relatives .
written informed consent was obtained from each participant after explaining the objectives and procedure of the study . the questions and meaning of related terms
total 170 participants including all moderate to severe pms and pmdd group and 80 participants ( 20% of no / mild pms group ) were called for the structured clinical interview for pmdd ( scid - pmdd ) according to the dsm - iv - tr criteria .
thirty - four participants did not come for the interview ( 80% response rate for structured interview ) .
flowchart of research methodology the data was analyzed with openepi version 2 open source calculator .
data was expressed as mean standard deviation for continuous variables and percentage for categorical variables .
prevalence of pms and pmdd according to dsm - iv - tr research criteria was calculated .
prevalence of premenstrual tension syndrome according to the international classification of diseases , 10 edition ( icd-10 ) criteria was also calculated .
chi - square test was used for qualitative variables to find the significance of difference between proportion among respective groups : no / mild pms , moderate to severe pms , and pmdd .
analysis of variance test with post hoc analysis ( kruskal wallis test ) was used to find out the significance of difference between the means of respective groups with graph pad instat version 3.06 ( graphpad software inc . ) .
psst was compared with scid - pmdd between moderate to severe pms and pmdd versus no / mild pms group in terms of sensitivity and specificity .
it is the screening tool developed by steiner et al . , which reflects and translates categorical dsm - iv - tr criteria into a rating scale with degrees of severity .
it includes 14 items assessing premenstrual symptoms of mood , anxiety , sleep , appetite , and physical symptoms .
participants rated their experience of each symptom and functional impairment item on four - point likert scale as not at all ,
pmdd , moderate to severe pms , and no / mild pms subjects were identified using psst scoring criteria .
the translation was validated by back translation and comparison with original form by group of experts who were well - versed with both languages .
scid - pmdd is a clinician - administered structured interview developed and validated by accortt et al .
it includes 11 psychological and physical symptoms of criterion a phrased in a detailed layperson format similar to items on the scid to facilitate the assessment of the specific dsm - iv - tr criteria for pmdd .
section ii included menstrual history , premenstrual symptoms , hormonal pills use , and family history of pms symptoms in first - degree relatives .
written informed consent was obtained from each participant after explaining the objectives and procedure of the study . the questions and meaning of related terms
total 170 participants including all moderate to severe pms and pmdd group and 80 participants ( 20% of no / mild pms group ) were called for the structured clinical interview for pmdd ( scid - pmdd ) according to the dsm - iv - tr criteria .
thirty - four participants did not come for the interview ( 80% response rate for structured interview ) .
flowchart of research methodology the data was analyzed with openepi version 2 open source calculator .
data was expressed as mean standard deviation for continuous variables and percentage for categorical variables .
prevalence of pms and pmdd according to dsm - iv - tr research criteria was calculated .
prevalence of premenstrual tension syndrome according to the international classification of diseases , 10 edition ( icd-10 ) criteria was also calculated .
chi - square test was used for qualitative variables to find the significance of difference between proportion among respective groups : no / mild pms ,
analysis of variance test with post hoc analysis ( kruskal wallis test ) was used to find out the significance of difference between the means of respective groups with graph pad instat version 3.06 ( graphpad software inc . ) .
psst was compared with scid - pmdd between moderate to severe pms and pmdd versus no / mild pms group in terms of sensitivity and specificity .
pmdd is associated with relatively young age group as compared to no / mild pms .
there was no statistically significant difference among three groups with respect to residence , religion , and marital status .
commerce students had higher rates of pms and pmdd compared to nursing and mbbs students [ table 1 ] .
characteristics of participants on screening by psst , 18 participants ( 3.7% ) met the dsm - iv - tr criteria for the diagnosis of pmdd .
seventy - two participants ( 14.7% ) marginally missed the dsm - iv tr criteria for the diagnosis of pmdd .
hence , they were identified as moderate to severe pms . remaining 399 participants ( 81.6% ) experienced no / mild pms . according to icd-10 , 91.4% participants ( n = 447 ) had , at least , one premenstrual symptom of any given severity ( mild to severe ) in at least more than or equal to half of the menstrual cycles during last 12 months duration . they were identified as having premenstrual tension syndrome according to icd-10 .
almost all participants ( 98.6% ) of moderate to severe pms group and majority of pmdd group ( 94.4% ) reported fatigue / lack of energy as moderate to severe .
all participants of pmdd group and majority of moderate to severe pms group ( 94.4% ) , and near two - third of all ( 60.1% ) participants reported decrease interest in work .
anger / irritability remained on third rank , its overall prevalence was 59.9% which was almost similar to the prevalence of decrease interest in work
group , and large number ( 94.4% ) of pmdd group reported anger / irritability [ table 2 ] . frequency of premenstrual symptoms among three groups total 298 participants reported , at least , one area of impaired functioning .
it was seen among 76.8% of the total respondents , 90.3% of moderate to severe pms , and 16 of 18 among pmdd group [ table 3 ] .
frequency of functional impairment among groups tables 4 and 5 show the menstrual characteristics and demographic correlates among groups , respectively .
menstrual correlates among three groups demographic correlates among three groups the mean menstrual cycle length was 28.9 2.3 days with mean 4.6 1.6 days of bleeding .
there was no statistically significant difference among groups with respect to age of menarche , length of the menstrual cycle , and days of the menstrual bleeding .
group experienced more number of days and years with premenstrual symptoms as compared to no / mild pms group .
there was no significant difference among groups with respect to regularity of cycles at the time of menarche ( p = 0.84 ) .
there was statistically significant difference among groups with respect to menstrual cramps , positive family history in first - degree relative , and symptoms onset since menarche .
more number of participants in moderate to severe pms and pmdd groups reported that they had symptoms since menarche as compared to no / mild pms group ( p < 0.00001 ) .
there was no statistically significant difference among groups with respect to regular exercise ( p = 0.1143 ) or regular games ( p = 0.7316 ) .
eighteen of them were from moderate to severe pms group and two participants from no / mild pms group .
sensitivity of psst is 90.9% , specificity 57.01% , predictive value of positive psst 28.98% , and predictive value of the negative psst 97.01% [ table 6 ] .
premenstrual symptom screening tool results compared with structured clinical interview for dsm - iv - tr - premenstrual dysphoric disorder ( n=136 )
the sample of this study is comparable with previous similar studies because mean age of all participants is 18.9 1.6 years and the majority of them are urban resident and unmarried .
the participants from previous studies were also from similar age group college students , had urban residence , and were unmarried . according to dsm - iv - tr research criteria ,
the prevalence of pms is 18.4% ( 14.7% for moderate to severe pms and 3.7% for pmdd ) among college students in our study .
it is in agreement with the study done by rapkin and mikacich and other studies from asian countries among this population .
the prevalence of severe pms and pmdd in this study is not in agreement with the study by steiner et al . who reported 21.3% and 8.3% , respectively , and also differs from study by chayachinda et al . who reported 25.1% of pmdd among thai nurses
the lower prevalence in our study can be explained by influence of cultural beliefs , socialization factors , actual experiences , and concomitant life stresses about menstruation in indian context which affects both experiencing and reporting of the premenstrual symptoms .
the prospective study design , relatively smaller sample size ( n = 62 ) , and higher age group of that study can explain the difference of prevalence from our study . according to icd-10 diagnostic criteria of premenstrual tension syndrome , the prevalence of pmts in our study is 91.4% .
reported 86% , and tabassum et al . reported 53% among young girls according to icd-10 .
bakhshani et al . reported that 98.2% had , at least , one mild to severe premenstrual symptom in their study . a study done by cleckner - smith et al . in an adolescent sample showed that all participants ( n = 78 ) reported , at least , one premenstrual symptom of minimal severity .
the prevalence rates are higher according to icd-10 criteria as the criteria are relatively less stringent and do not require the prospective diary for confirmation of the diagnosis .
the study indicates that overall most commonly reported symptom is fatigue / lack of energy ( 68.3% ) .
it was the third most common symptom reported by tabassum et al . , nisar et al . , and pearlstein et al
. other highest reported symptoms were decreased interest in work ( 60.1% ) and anger / irritability ( 59.9% ) on the second and third rank , respectively .
anger / irritability has been reported as most common symptom by previous several studies . decreased energy and being irritable were most common reported premenstrual symptoms in a community - based nonpatient sample of 321 black and 462 white women studied by stout et al . a cross - sectional study done among indian college students by singh et al .
reported that the most common symptom reported by subjects not having any impairment was irritability and those having impairment , the most common symptom was tiredness and lack of energy .
there is repositioning of symptoms in diagnostic criteria of pmdd within the revised manual of dsm-5 .
markedly depressed mood was at the top in the dsm - iv tr research criteria of pmdd . hence , finding of this study is consistent with this context of change in dsm-5 .
this study reports that the most frequent functional impairment item reported was school / work efficiency and productivity ( 46.8% ) .
steiner et al . found that nearly three - quarters of the pmdd and almost half of the severe pms cases reported symptoms interfered with their relationships with friends , classmates , and/or coworkers , and/or school / work efficiency / productivity .
although both groups had body mass index ( bmi ) within normal range , the study suggests association of relatively higher bmi with
moderate to severe pms and pmdd group than no / mild pms group ( p = 0.0004 ) .
this is in agreement with review article from india by bansal et al . and literature .
no statistically significant difference in length of the menstrual cycle ( p = 0.3 ) as well as days of the menstrual bleeding ( p = 0.45 ) was found by us among all the three groups .
the study findings admit that pmdd group and moderate to severe pms
group experienced statistically significant more number of days as well as more number of years with premenstrual symptoms than no / mild pms group .
this can be explained with finding of association of pms with onset of symptoms since menarche as well as chronic , relapsing , and remitting nature of illness .
steiner et al . found that moderate to severe pms group and pmdd group experienced more number of days of pms per cycle as compared to no / mild pms group .
moderate to severe pms and pmdd group , the frequency of students reporting the psychological symptoms of tiredness , irritability , depression / tension , and decrease interest in work tended to increase with severity of abdominal pain and may be a psychological influence of pain on these affective symptoms .
the study reports significant association of positive family history of pms in mother / sibling with both
found that more than half of the study participants ( 57% ) had family history of pms .
the study findings indicate that more participants in moderate to severe pms and pmdd group reported the onset of symptoms when they first began to have periods . according to the literature and study by steiner et al .
, 69.3% and 54.5% adolescents reporting severe pms and pmdd often said that their symptoms began with menarche which is replicated in this study .
this study found no statistically significant association between groups with regards to physical activities such as regular exercise and games .
small trials have suggested aerobic exercise to be beneficial for pms sufferers , and one trial found high - intensity aerobic exercise to be superior to low - intensity one for pms treatment .
fewer premenstrual complaints have been found in women participating in sports than in nonathletic women .
exercise training has been associated with decreased breast , fluid , and stress complaints , but not necessarily with improvements in anxiety or depression .
the association between exercise and premenstrual symptoms needs to be further investigated by exploring the type and intensity of physical exercise .
the structured clinical interview is a clinician - administered interview which is more reliable than psst .
the interview excluded the possibility of major depressive disorder , panic disorder , dysthymic disorder , or personality disorder among provisionally
the structured clinical interview also identified two participants with provisional diagnosis of pmdd who were found to have no / mild pms on psst .
psst is highly sensitive tool ( sensitivity 90.9% ) . we can reasonably conclude that psst is a very useful screening instrument in this population
. predictive value of the negative psst is also high ( 97.01% ) , so the likelihood of in fact not having pmdd when found negative on psst is very high .
hence , it can be easily excluded those who are not having pmdd . the predictive value of positive
hence , it should be followed by more specific tests such as daily record of severity of problems or structured clinical interview for confirmation of diagnosis and planning further interventions .
findings of this study need to be confirmed by large - scale community cross - sectional survey including young girls for obtaining more precise prevalence rates among this age group .
comparison of psst with gold standard prospective daily diaries of symptoms for diagnostic agreement can be done .
psst is a useful and easy to administer screening test for probable diagnosis of pms and pmdd .
the reporting of premenstrual symptoms was based on retrospective recall of the participants adding a recall bias in data collection . as there was no prospective diary charting of pms symptoms ,
the prevalence rates are of provisional diagnosis according to dsm - iv tr research criteria .
differentiation between mild pms and no pms was not possible because both were in the same group .
pms occurs at similar rates in college students of bhavnagar as in other asian countries .
pms is associated with menstrual cramps , positive family history , symptom onset since menarche , and relatively higher bmi .
the most common symptoms are fatigue / lack of energy , decrease interest in work followed by anger / irritability .
psst is a useful , sensitive screening tool among this population for provisional diagnosis of pms and pmdd . | background : premenstrual dysphoric disorder ( pmdd ) is a severe form of premenstrual syndrome ( pms ) characterized by mood changes , anxiety , and somatic symptoms experienced during the specific time of menstrual cycle .
prevalence data of pms and pmdd is sparse among college girls in india.aims:the aim of this study is to study the prevalence of pms and pmdd among college students of bhavnagar ( gujarat ) , its associated demographic and menstrual factors , to rank common symptoms and compare premenstrual symptom screening tool ( psst ) with structured clinical interview for dsm - iv - tr defined pmdd ( scid - pmdd ) for sensitivity and specificity.materials and methods : a cross - sectional survey was done in five colleges of bhavnagar .
of 529 subjects approached , 489 college girls were finally analyzed for sociodemographic data , menstrual history , and psst .
scid - pmdd was applied among those who were positive on psst and 20% of those who were negative .
the data were analyzed using openepi version 2 .
chi - square test was done for qualitative variables and analysis of variance for quantitative variables .
sensitivity , specificity , and predictive values were calculated for psst.results:the prevalence of pms was 18.4% .
moderate to severe pms was 14.7% and pmdd was 3.7% according to dsm iv - tr and 91% according to international classification of diseases , 10th edition criteria .
the symptoms commonly reported were
fatigue / lack of energy ,
decrease interest in work , and anger / irritability .
the most common functional impairment item was school / work efficiency and productivity .
psst has 90.9% sensitivity , 57.01% specificity , and 97.01% predictive value of negative test.conclusion:prevalence of pms among college students is similar to other studies from asia .
psst is a useful screening tool for pms , and it should be confirmed by more specific tool as by scid - pmdd .
routine screening with psst can identify college girls who can improve with treatment . | INTRODUCTION
MATERIALS AND METHODS
Premenstrual symptoms screening tool
Structured clinical interview for DSM-IV-TR defined premenstrual dysphoric disorder
RESULTS
DISCUSSION
CONCLUSION
Financial support and sponsorship
Conflicts of interest |
bilateral sagittal split ramus osteotomy ( bssro ) has most frequently been used to treat various dentofacial deformities .
however , in cases of moderate to severe asymmetry , when the mandibular midline is rotated laterally , flaring of the proximal segment on the short side can occur and results in a gap between the fragments .
displacement of the condyles within the mandibular fossa can occur when the proximal and distal segments are not passively positioned during the application of internal fixation devices .
this condylar displacement may cause skeletal or occlusal instability and temporomandibular joint ( tmj ) dysfunction1,2,3,4 .
careful bone removal can be performed to minimize or eliminate bony interference between the proximal and distal segments , but it is not always possible to eliminate enough bone for sufficient bony contact due to structural limitations1 .
recently , additional vertical osteotomy of the distal segment , just behind the terminal molar , was proposed to passively align the proximal segment and distal segment and eliminate all bony interference , even in cases of severe asymmetry2,3 .
no medial force has to be applied to the proximal fragment to align the segments after interference between the fragments has been eliminated with the secondary osteotomy3 .
another modification of sagittal split ramus osteotomy ( ssro ) is described as follows . on the long side ,
a conventional osteotomy is performed . on the short side , unlike a usual lingual osteotomy made horizontally above the lingual osteotomy , the osteotomy was angled downward and the buccal osteotomy was made horizontally below the lingual osteotomy .
the angulation of the lingual osteotomy made the posterior aspect of the distal segment shorter , thereby preventing bony interference of the two segments during fixation4 .
the authors used a unilateral intraoral vertical ramus osteotomy ( uivro ) on the short side combined with a contralateral ssro to overcome the condylar displacement and its sequelae in asymmetric cases , especially in cases of rotational mandibular asymmetry .
all patients were explained for the use of clinical images on this article and informed consent was gained .
an 18-year - old male visited our hospital with a chief complaint of right chin deviation .
cephalometric analysis of the patient revealed that the menton ( me ) of the mandible was deviated 6.5 mm to the right and the left maxilla was positioned 3.5 mm downward at the upper canine position compared to the right.(fig .
1 ) through cephalometric tracing and model surgery , we determined the amount and direction of maxillary and mandibular movements . in the mandible , the chin midline should be rotated to the left and the amount of setback was estimated to be 1 mm on the short side ( the right side ) and 6.5 mm on the long side ( the left side ) .
bony interference between the fragments and flaring of the proximal segment on the right side would be anticipated if a bssro was performed .
therefore , we planned to use uivro on the short side and ssro on the contralateral side of the mandible . during the maxillary surgery
, a le fort i osteotomy was performed to correct the canting and yawing of the maxilla in a standard fashion based on the intermediate surgical wafer . in the mandible , conventional ssro
was begun on the long side of the mandible ( the left side ) and then ivro was performed on the short side ( the right side ) . on the left side
a ssro was performed , when the osteotomized distal segment was positioned using the final surgical wafer and the condyle was repositioned within the glenoid fossa without compression , initial bone contact occurred anteriorly and a large gap was noted posteriorly between the segments . a 2.0 mm monocortical miniplate was placed first and then two bicortical position screws were placed to prevent condylar torque . in the ivro , an oblique osteotomy from the sigmoid notch to the inferior border of the mandibular angle and coronoidotomy were performed . during the ivro procedure , no bony interference between the segments was seen .
we did not perform repositioning or fixation of the condylar and proximal segments on the short side of the ivro side .
2 ) intermaxillary wire fixations were maintained postoperatively for two weeks with the final surgical wafer to stabilize the occlusion and mandibular segments .
after release of intermaxillary fixation at two weeks , two elastic bands were used for mouth opening exercises .
the wafer was maintained for 6 weeks postoperatively for training and adaptation to the new anatomical circumstances .
the dental midline discrepancy , canting of the occlusal plane , and chin deviation were significantly improved and the temporomandibular symptoms including pain or tenderness over the tmj and joint noise were significantly decreased.(fig .
3 ) a 24-year - old male visited our clinic with a chief complaint of chin deviation .
the patient previously received presurgical orthodontic treatment at a private clinic for a total of 10 months .
clinically , the chin of the patient was deviated to the left side and canting of the rima oris was observed .
the right maxilla was down 3.5 mm at the upper canine position compared to the left and the maxillary arch and upper dental midline were rotated to the left .
the lower dental midline of the incisors was deviated 4.0 mm to the left side .
4 ) through presurgical planning , we determined the amount and direction of maxillary and mandibular movements .
a sagittal ramus osteotomy with a 11.5 mm setback was begun on the right side of the mandible .
one 2.0 mm monocortical miniplate and two bicortical positional screws were used for internal fixation of the ssro . on the short - left side ( deviated side ) , a ivro of 6.0 mm setback and coronoidotomy were performed . during the ivro procedure
, we determined that the distal segment was excessively rotated and positioned laterally to the condylar segment .
5 ) on postoperative radiographs and cone - beam computed tomography , we found that the most posterior aspect of the distal segment on the left side ( deviated side ; ivro performed ) was rotated laterally on a large scale and positioned lateral to the proximal segment.(fig .
6 ) during the follow - up period , temporary paresthesia over the left side of the lower lip and chin was observed ; however , the sensory disturbances improved 3 months after surgery and completely disappeared at the sixth postoperative month .
additionally , the patient showed a normal range of mouth opening and did not complain of any other tmj symptoms.(fig .
7 ) a 19-year - old female was referred from the department of orthodontics for orthognathic surgery .
she wanted to improve her facial appearance of chin protrusion and also complained of pain and noise from the left tmj .
vertical and anteroposterior position of the maxilla was acceptable and occlusal canting or yawing of maxilla was not identified .
the lower dental midline of the incisors was deviated 3 mm to the left side compared with the upper dental midline and the overjet was -2.0 mm.(fig .
8) we decided to perform only mandibular surgery and the estimated amount of setback was 7.0 mm on the long side ( right side ) and 3.0 mm on the short ( left side ) .
we did not anticipate considerable bony interference or a gap between the fragments during the bssro .
however , she consistently complained of tmj symptoms , so we chose to perform a uivro on the deviated side rather than bssro .
the ssro was started on the right and left sides and a ivro setback was performed with a coronoidotomy . during the ivro procedure , we found lateral flaring of the proximal segment so minimal bony removal at the inner surface of the proximal condylar segment was performed to minimize bony interference between the segments.(fig .
joint noise was detected on her left tmj with wide mouth opening , but she has not reported any painful episodes with mouth opening or mastication.(fig .
an 18-year - old male visited our hospital with a chief complaint of right chin deviation .
cephalometric analysis of the patient revealed that the menton ( me ) of the mandible was deviated 6.5 mm to the right and the left maxilla was positioned 3.5 mm downward at the upper canine position compared to the right.(fig .
1 ) through cephalometric tracing and model surgery , we determined the amount and direction of maxillary and mandibular movements . in the mandible , the chin midline should be rotated to the left and the amount of setback was estimated to be 1 mm on the short side ( the right side ) and 6.5 mm on the long side ( the left side ) .
bony interference between the fragments and flaring of the proximal segment on the right side would be anticipated if a bssro was performed .
therefore , we planned to use uivro on the short side and ssro on the contralateral side of the mandible . during the maxillary surgery
, a le fort i osteotomy was performed to correct the canting and yawing of the maxilla in a standard fashion based on the intermediate surgical wafer . in the mandible , conventional ssro
was begun on the long side of the mandible ( the left side ) and then ivro was performed on the short side ( the right side ) . on the left side
a ssro was performed , when the osteotomized distal segment was positioned using the final surgical wafer and the condyle was repositioned within the glenoid fossa without compression , initial bone contact occurred anteriorly and a large gap was noted posteriorly between the segments .
a 2.0 mm monocortical miniplate was placed first and then two bicortical position screws were placed to prevent condylar torque . in the ivro , an oblique osteotomy from the sigmoid notch to the inferior border of the mandibular angle and coronoidotomy were performed . during the ivro procedure ,
we did not perform repositioning or fixation of the condylar and proximal segments on the short side of the ivro side .
2 ) intermaxillary wire fixations were maintained postoperatively for two weeks with the final surgical wafer to stabilize the occlusion and mandibular segments .
after release of intermaxillary fixation at two weeks , two elastic bands were used for mouth opening exercises .
the wafer was maintained for 6 weeks postoperatively for training and adaptation to the new anatomical circumstances .
the dental midline discrepancy , canting of the occlusal plane , and chin deviation were significantly improved and the temporomandibular symptoms including pain or tenderness over the tmj and joint noise were significantly decreased.(fig .
a 24-year - old male visited our clinic with a chief complaint of chin deviation .
the patient previously received presurgical orthodontic treatment at a private clinic for a total of 10 months .
clinically , the chin of the patient was deviated to the left side and canting of the rima oris was observed .
the right maxilla was down 3.5 mm at the upper canine position compared to the left and the maxillary arch and upper dental midline were rotated to the left .
the lower dental midline of the incisors was deviated 4.0 mm to the left side .
4 ) through presurgical planning , we determined the amount and direction of maxillary and mandibular movements .
a sagittal ramus osteotomy with a 11.5 mm setback was begun on the right side of the mandible .
one 2.0 mm monocortical miniplate and two bicortical positional screws were used for internal fixation of the ssro . on the short - left side ( deviated side ) , a ivro of 6.0 mm setback and coronoidotomy were performed . during the ivro procedure
, we determined that the distal segment was excessively rotated and positioned laterally to the condylar segment .
5 ) on postoperative radiographs and cone - beam computed tomography , we found that the most posterior aspect of the distal segment on the left side ( deviated side ; ivro performed ) was rotated laterally on a large scale and positioned lateral to the proximal segment.(fig .
6 ) during the follow - up period , temporary paresthesia over the left side of the lower lip and chin was observed ; however , the sensory disturbances improved 3 months after surgery and completely disappeared at the sixth postoperative month .
additionally , the patient showed a normal range of mouth opening and did not complain of any other tmj symptoms.(fig .
a 19-year - old female was referred from the department of orthodontics for orthognathic surgery .
she wanted to improve her facial appearance of chin protrusion and also complained of pain and noise from the left tmj .
vertical and anteroposterior position of the maxilla was acceptable and occlusal canting or yawing of maxilla was not identified .
the lower dental midline of the incisors was deviated 3 mm to the left side compared with the upper dental midline and the overjet was -2.0 mm.(fig .
8) we decided to perform only mandibular surgery and the estimated amount of setback was 7.0 mm on the long side ( right side ) and 3.0 mm on the short ( left side ) .
we did not anticipate considerable bony interference or a gap between the fragments during the bssro .
however , she consistently complained of tmj symptoms , so we chose to perform a uivro on the deviated side rather than bssro .
the ssro was started on the right and left sides and a ivro setback was performed with a coronoidotomy . during the ivro procedure , we found lateral flaring of the proximal segment so minimal bony removal at the inner surface of the proximal condylar segment was performed to minimize bony interference between the segments.(fig .
joint noise was detected on her left tmj with wide mouth opening , but she has not reported any painful episodes with mouth opening or mastication.(fig .
bssro is a versatile and reliable surgical technique for the correction of prognathic or retrognathic patients .
rigid internal fixation is routinely used to stabilize the proximal and distal segments following ssro , for fast bone healing , initiating early postoperative jaw function , and decreasing the amount of relapse . without intermaxillary fixation ,
postoperative airway management is much easier and the convenience of oral hygiene maintenance is an additional advantage of ssro .
the author suggests that in orthognathic surgery for asymmetric mandibles , mandibular movements required to achieve an appropriate occlusal relationship to the maxilla can be classified into two types according to the subtype of mandibular asymmetry ; rotational or translational5 . in surgical treatment for rotational mandibular asymmetry ,
when the mandibular midline is shifted laterally , the most posterior aspect of the distal segment is rotated medially and the other side is rotated laterally .
displacement of the condyles medially or laterally within the mandibular fossa can occur when the proximal and distal segments are not passively positioned during the application of internal fixation devices3 .
this condylar displacement can cause malocclusion associated with the risk of early relapse and favor the development of temporomandibular disorders1,2,3,4,6,7,8,9 . to avoid flaring of the mandibular segments , several modifications or additional procedures for ssro were advocated .
the simplest method among the procedures was removal of the bony interferences between the segments to minimize flaring of the proximal segment .
careful bone removal prevents displacement of the proximal segment and possible condylar torque after distal segment repositioning .
however , because of the neuromuscular bundle and other anatomical limitations , removing sufficient bone to remove all bony interferences between the segments is not possible in many cases1 .
modifications of ssro have been implemented to improve the efficiency and predictability of the split , increase bony overlap to improve union , and maintain condylar position .
ellis3 proposed that the additional osteotomy of the distal segment behind the last molar had several benefits including elimination of all premature contact areas and bony interferences .
this secondary osteotomy might cause less displacement of the mandibular condyle ; however , the main disadvantage of the secondary osteotomy is that the nerve may undergo a second surgical insult when the greenstick fracture occurs or potentially during instrumentation .
yoshida et al.4 suggested a modified ssro designed to minimize displacement of the proximal segment in asymmetric cases .
usually , a lingual osteotomy is made horizontally above the lingula , but in their cases , because the distal segment on the short side needed to be shifted more than 5 mm , the osteotomy was angled downward and the buccal osteotomy was made horizontally below the lingual osteotomy rather than in the region of the mandibular body . this procedure prevented overlap of the two segments during fixation . through this procedure , they avoided displacement of the proximal segment . however , because the area of bone contact produced by this procedure is narrow , it may result in nonunion between the proximal and distal segments . in comparison with ssro , there are fewer bony contact areas between the segments during the ivro procedure .
furthermore , it does not require rigid fixation and allows for postoperative positional changes of rotated or displaced condylar segments .
bell and colleagues10,11 reported that the condyle was positioned anteriorly and inferiorly after ivro but the condyles tended to return to their preoperative position after systemic neuromuscular rehabilitation12 .
jung et al.13 also reported that lateral rotation of the condyles occurred after ivro setback and the laterally rotated condylar angles progressively reversed towards the original angulations . therefore , ivro causes less rotational displacement of the proximal segment on the deviated side during the surgical procedure and displaced or rotated condylar segments returned to a physiologic position .
therefore , this technique may bring stable postoperative results without condylar displacement and adverse sequelae when surgically correcting mandibular asymmetry .
after ivro , postoperative disappearance of signs and symptoms of tmj disorders has been reported13,14,15 .
the improvements of symptoms associated with tmj disorders after ivro was contingent on producing a more functional articular disc - condylar relationship and decreased pressure between the mandibular condyle and mandibular fossa11,16 .
lai et al.17 reported a high incidence of tmj disorders in patients with mandibular asymmetries .
he also endorsed that uivro and ssro can be useful in improving signs and symptoms of tmj disorders as well as correcting mandibular deviation .
this was also shown in our cases . in our patients with rotational mandibular asymmetry , uivro combined with
contralateral ssro was effective in correcting mandibular asymmetry , because it helped avoid mediolateral flaring of the bone segments and condylar dislocation of the deviated side .
additionally , the signs and symptoms of tmj disorders on the deviated side were improved . through this experience ,
we recommend uivro combined with contralateral ssro as a useful technique for the treatment of rotational mandibular asymmetry . | in surgery for facial asymmetry , mandibles can be classified into two types , rotational and translational , according to the required mandibular movements for surgery . during surgery for rotational mandibular asymmetry ,
a bilateral sagittal split ramus osteotomy ( bssro ) may cause a large bone gap between the proximal and distal segments as well as condylar displacement , resulting in a relapse of the temporomandibular joint disorder , especially in severe cases .
the intraoral vertical ramus osteotomy has an advantage , in this respect , because it causes less rotational displacement of the proximal segment on the deviated side and even displaced or rotated condylar segments may return to their original physiologic position .
unilateral intraoral vertical ramus osteotomy ( uivro ) on the short side combined with contralateral ssro was devised as an alternative technique to resolve the spatial problems caused by conventional ssro in cases of severe rotational asymmetry .
a series of three cases were treated with the previously suggested protocol and the follow - up period was analyzed . in serial cases , uivro combined with contralateral ssro may avoid mediolateral flaring of the bone segments and condylar dislocation , and result in improved condition of the temporomandibular joint .
uivro combined with contralateral ssro is expected to be a useful technique for the treatment of rotational mandibular asymmetry . | I. Introduction
II. Cases Report
1. Case 1
2. Case 2
3. Case 3
III. Discussion |
since the first case of transcatheter closure of patent ductus arteriosus ( pda ) by porstmann in 1967,1 device closure has become a mainstream form of intervention for this lesion with a wide variety of devices.2
the amplatzer pda occluder is a self - expanding nitinol double - disk device and consists of two disks of varying sizes with the larger disk positioned at the aortic end of the duct .
since its introduction , this device remains , to date , the device of choice for the transcatheter occlusion of large ( > 3 mm ) pdas,3 and the exact technique for device deployment has been previously described.4
we report one child who required device closure of pda with two amplatzer pda devices on two separate occasions .
our patient was born in march 2001 and a murmur was noted shortly after birth .
echocardiography eventually showed a large pda , and followup did not reveal signs of pulmonary hypertension .
an amplatzer pda device ( 8 by 6 mm ) was implanted at almost 3 years of age ( figure 1 ) .
repeat cardiac catheterization showed a significant residual shunt ( figures 2 and 3 ) and a second device ( 10 by 8 mm ) was implanted at 4 years and 3 months of age , 1 years after the first device was implanted ( figures 4 and 5 ) , with little residual shunting .
the amplatzer ductal occluder is a safe device and has been utilized extensively with few complications in competent hands.5 closure rates of > 99% have been documented,5 and follow - up has not revealed any episodes of delayed device migration , endocarditis , thromboembolism , or wire fracture / device disruption.6 our patient is unusual in that despite standard placement of an appropriately sized amplatzer device in the usual position , significant residual shunting necessitated the placement of a second device . | it is accepted practice to close large patent arterial ducts ( pda ) with amplatzer duct occluder devices , with extremely low rates of residual pda .
we report a child who required device closure of pda with two amplatzer pda devices on two separate occasions , despite the first device deployment being a standard placement of an appropriately sized amplatzer device in the usual position . | Introduction
Patient
Discussion |
parasites - a strain of a.
cantonensis has been maintained in our laboratory in
biomphalaria glabrata snails and sprague - dawley rats since 1980
( wang et al .
young adults and adult worms were collected on days 21 and 50
post - infection , respectively , from the cerebral tissues and pulmonary arteries of
rats .
the sex of these worms was determined based on their morphological
characteristics : male worms are usually shorter and exhibit copulatory bursa and
long spicules .
infective larvae were collected from the tissues of infected snails
through digestion with 0.6% ( w / v ) pepsin - hcl ( ph 2 - 3 ) for 1 h. these worms were
washed with normal saline , phosphate buffered saline and distilled water and then
stored at -80c for further analyses ( hwang et al .
this experiments performed in this study followed the
recommendations of the institutional animal care and use committee of chang gung
university .
small rna library construction and high - throughput
sequencing - total rna was isolated from young adults of
a. cantonensis ( 500 worms of each sex ) using
the tri reagent , according to the instructions of the manufacturer ( molecular
research center , cincinnati , oh , usa ) .
rna integrity was assessed via 1% ( w / v )
agarose gel electrophoresis , while rna purity was determined based on the absorbance
recorded at 260/280 nm using an sma1000 uv spectrophotometer ( merinton technology ,
beijing , china ) .
rna fragments of 18 - 30 nt in length were separated from total rna using the small rna
sample prep kit ( illumina , san diego , ca , usa ) .
following 15% novex tbe - urea
polyacrylamide gel electrophoresis ( page ) , the purified fragments were ligated to 5
and 3 rna adaptors , reverse transcribed to produce single - stranded cdnas and
amplified via pcr .
rna fragments ( approximately 92 bp ) were isolated from the pcr
products and sequenced using the illumina hiseq 2000 system ( illumina , san diego ,
ca , usa ) .
bioinformatic analysis - the small rna library was analysed through
a deep - sequencing small rna analysis pipeline ( dsap ) ( dsap.cgu.edu.tw ) ( huang et al .
2010 ) . following the removal of
adaptors and poly - a / t / c / g / n nt , sequences longer than 16 nt were considered clean
sequence tags . using the clustering module of dsap ,
the reads for each unique tag were counted as its
expression abundance . to identify transfer rnas ( trnas ) , ribosomal rnas ( rrnas ) , small nucleolar rnas
( snornas ) , small nuclear rnas ( snrnas ) and other annotated non - coding rnas ( ncrnas ) ,
the unique tags were subjected to searches against the transcribed sequence library
of the ncrna ( rfam ) database ( version 10.0 ) .
the remaining sequences were compared
with mature mirna sequences in mirbase ( version 16 ) using blastn .
stem - loop rt - pcr - total rnas
were isolated from infective larvae ( 20,000 worms ) , young adults ( 500 worms of each
sex ) and adult worms ( 50 worms of each sex ) .
the expression levels of aca - mir-1 - 1
and aca - mir-71 - 1 were determined via modified stem - loop rt - pcr ( chen et al .
the stem - loop reverse
transcription primer and forward primer for aca - mir-1 - 1 were
5-gtcgtatccagtgcagggtccgaggtattc - gcactggatacgactacatac-3 and
5-cgcggc - tggaatgtaaagaagt-3 , respectively , and those for aca - mir-71 - 1 were
5-gtcgtatccagtgcagggt - ccgag - gtattcgcactggatacgaccgtctca-3 and
5-gcgcggtgaaagacatgg - gtagtg-3 , respectively .
the reverse primer employed in these
assays was 5-gtgcagggtccgaggt-3. small rnas from a. cantonensis at different
developmental stages were extracted using an mirna isolation kit ( geneaid , sijhih
city , taipei county , taiwan ) according to the instructions of the manufacturer .
first - strand cdnas were synthesised using superscript iii reverse transcriptase
( invitrogen , carlsbad , ca , usa ) . briefly , reaction mixtures ( 20 l ) containing the
purified small rnas ( 160 ng ) , 5x first - strand buffer ( 4 l ) , individual specific
stem - loop rt primers ( 0.5 m ) , dntp mix ( 0.5 mm ) , dtt ( 5 mm ) , superscript iii
reverse transcriptase ( 10 units ) and rnaseout ( 2 units ) were incubated at 55c for
50 min , then inactivated by heating at 70c for 15 min and subsequently incubated
with two units of rnase h at 37c for 20 min .
quantitative rt - pcr was performed using realq pcr master mix ( ampliqon a / s ,
skovlunde , denmark ) in the stratagene mx3000p qpcr system ( agilent technologies ,
santa clara , ca , usa ) .
the pcr mixtures ( 20 l ) included the reverse transcription
product for each mirna ( 3 l ) , realq - pcr 2x master mix ( 10 l ) , a specific forward
primer ( 0.5 m ) and the reverse primer ( 0.5 m ) .
the rt - pcr assays were carried out
with an initial step at 95c for 10 min , followed by 40 cycles of amplification ,
with denaturation at 95c for 30 s , primer annealing at 58c for 1 min and
elongation at 72c for 30 s. the specificity of this assay was confirmed via 15%
page . finally , the expression levels of the targeted mirnas were determined through
three rounds of stem - loop rt - pcr amplification and analysed according to the
2 method ( livak & schmittgen
2001 ) .
statistical analysis - the expression levels of the mirnas were
expressed as the mean standard deviation .
means were compared via one - way anova
and the least significance difference test was used for post - hoc multiple range
comparisons .
analysis of short rnas - a total of 22,484,156 raw sequence reads
were obtained through high - throughput sequencing from the small rna library
generated for young adults of a. cantonensis .
the
removal of adapters , contaminated nt and low - quality sequences resulted in
16,880,456 ( 75.1% ) high - quality , clean reads of 16 - 31 nt in length , averaging 22.8
nt .
a majority of the sequences were 23 nt in length ( 46.1% ) , followed by lengths of
22 nt ( 26.3% ) and 24 nt ( 12.1% ) sequences . among the clean reads , 10,766,590 ( 63.8% )
they included 7,736,727
trnas ( 45.8% ) , 1,191,869 rrnas ( 7.1% ) , 228,262 snornas ( 1.4% ) , 174,633 snrnas ( 1% )
and 1,435,099 ncrnas ( 8.5% ) ( fig .
1 : classification of small rnas of angiostrongylus cantonensis young
adults identified by a deep - sequencing approach .
mirna : micrornas ;
ncrna : non - coding rnas ; rrna : ribosomal rnas ; snorna : small nucleolar
rnas ; snrna : small nuclear rnas ; trna : transfer rnas .
identification of conserved mirnas - from the remaining 7,548,965
clean reads , 252 conserved mature mirnas including 10 antisense mirnas were
identified based on comparison with entities in mirbase .
all of the identified
mirnas were homologous to mirnas from metazoa and their lengths ranged from 20 - 24
nt , with most being 22 nt in length ( 117 ) , followed by lengths of 21 nt ( 54 ) , 23 nt
( 49 ) , 20 nt ( 19 ) and 24 nt ( 13 ) .
these mirnas belonged to 90 families , in addition
to which 10 antisense mirnas were discovered .
the number of reads obtained was 50 or
more for 53 of these mirnas , 21 - 49 for 28 mirnas , 11 - 20 for 14 mirnas , two-10 for 82
mirnas and only a single read was observed in the remaining 75 mirnas .
supplementary data lists
the 53 mirnas with 50 or more reads , which belonged to 25 families .
more than one
mirna was identified from the following families : let-7 , mir-1 , mir-34 , mir-87 ,
mir-71 mir-99 , mir-2 , mir-9 , mir-31 , mir-50 and mir-103 .
aca - mir-1 - 1
exhibited the highest number of reads , at 184,946 , followed by aca - mir-71 - 1
( 92,433 ) .
these two highly expressed mirnas constituted 50.7% and 25.3% of the total
reads ( 365,112 ) , respectively , among this group of 53 mirnas .
phylogenic distribution - to analyse the evolutionary features of
a. cantonensis mirnas , the identified mirnas
showing 50 or more reads , from 25 families , were compared with those from other
nematodes in mirbase .
the families let-7 , mir-1 , mir-2 , mir-9 , mir-31 , mir-34 ,
mir-44 , mir-50 , mir-67 , mir-71 , mir-81 , mir-87 and mir-124 contained members that
were homologous to parasitic nematodes ( ascaris suum and
brugia malayi ) and free - living nematodes ( c.
elegans , caenorhabditis briggsae ,
caenorhabditis remanei and pristionchus
pacificus ) .
members of the mir-60 and mir-235 families were homologous
to sequences from free - living nematodes , but not parasitic nematodes .
the family
mir-99 was homologous only to a. suum , while
members of the mir-21 , mir-29 , mir-30 , mir-103 , mir-140 , mir-146 , mir-185 , mir-191
and mir-320 families did not exhibit homology with sequences from other nematodes
( table ) .
tablephylogenic distributions of conserved micrornas families of
angiostrongylus cantonensis young adults with 50 or more readsfamily
a.
cantonensis
ascaris
suum
brugia
malayi
caenorhabditis
elegans
caenorhabditis
briggsae
caenorhabditis
remanei
pristionchus
pacificus
let-7+++++++mir-1+++++mir-2+++++mir-9+++++++mir-21+mir-29+mir-30+mir-31++++mir-34++++++mir-44++++++mir-50++++++mir-60++++mir-67+++++mir-71++++++mir-81+++++mir-87+++++++mir-99++mir-103+mir-124+++++++mir-140+mir-146+mir-185+mir-191+mir-235+++mir-320+
expression of mirnas at different developmental stages - to confirm
the expression of the mirnas from a. cantonensis
young adults that were identified through the applied high - throughput approach and
to determine the expression levels of these mirnas at different developmental
stages , the levels of aca - mir-1 - 1 and aca - mir-71 - 1 transcripts were validated in a
modified stem - loop quantitative rt - pcr analysis .
significant differences in the
expression levels of these mirnas were observed among different developmental stages
( aca - mir-1 - 1 : f = 521.55 , p < 0.001 ; aca - mir-71 - 1 : f = 1585.86 , p < 0.001 ) . in
male worms ,
the expression of the two mirnas was significantly higher in young
adults than in infective larvae or adult worms ( p < 0.05 ) . additionally , the
expression in adult worms was significantly higher than in infective larvae ( p <
0.05 ) . in female worms ,
significantly higher expression was also observed in young
adults ( p < 0.05 ) .
however , there was no significant difference in aca - mir-1 - 1
expression observed between infective larvae and adult worms ( p > 0.05 ) and the
infective larvae exhibited significantly higher aca - mir-71 - 1 expression than adult
worms ( p < 0.05 ) . moreover , male worms displayed significantly higher expression
than female worms in both the young adult and adult stages ( p < 0.05 ) ( fig .
2:expression profiles of selected micrornas of angiostrongylus
cantonensis young adults in different developmental stages .
fa : female
adults ; fya : female young adults ; il : infective larvae ; ma : male adults ;
mya : male young adults .
using a deep - sequencing approach , based on 7,548,965 reads , we identified and
characterised 252 conserved mature mirnas including 10 antisense mirnas that
belonging to 90 families from young adults of a.
cantonensis .
previous authors identified mirnas in adult male
and female worms from 592,899 and 458,447 reads , respectively ( chen et al .
however , no novel mirnas were discovered in
either the present or previous studies .
the sequences obtained from the adult male
and female worms were matched to the c. elegans
genome , although the percentage of perfect matches was quite low ( 18.94% in females
and 22.58% in males ) .
although c. elegans and
a. cantonensis are both nematodes , the former
species is free - living in soil or water , whereas the latter is parasitic , being
found in the pulmonary arteries of its definitive host and requiring a mollusc as an
intermediate host ( chen et al .
we hypothesise that novel mirnas will be identified only when a reference
genome for a. cantonensis becomes available . in the present study
, we identified nine mirnas in young adults of
a. cantonensis displaying more than a 1,000 reads :
two in the let-7 family , four in the mir-1 family , one in the mir-44 family , one in
the mir-71 family and one in the mir-99 family . in male adult worms ,
seven mirnas
exhibited more than 1,000 reads : mir-1 , mir-228 , mir-44 , mir-45 , mir-71 , mir-72 and
mir-81 . in the female worms , 10 mirnas showed more
than a 1,000 reads : mir-1 , mir-2 ,
mir-228 , mir-44 , mir-45 , mir-60 , mir-71 , mir-72 , mir-81 and mir-87 ( chen et al .
mirr-1 , mirr-71 and mir-44
show high expression in both the young adult and in adult stages .
in contrast , let-7
and mir-99 are highly expressed only in young adults , whereas mir-45 and mir-81 are
expressed only in adult worms .
these findings indicate that a stage - specific
expression of mirnas occurs in a. cantonensis .
moreover , the regulatory functions of mir-99 require further investigation . let-7 and lin-4 are two important mirna families associated with the lifespan of
c. elegans .
these mirnas have been
characterised as playing an essential role in the developmental timing of the worm
by downregulating specific targets , such as the trim protein lin-41 and the
transcription factor lin-14 ( ibez - ventoso et al .
let-7 is an
mirna families that was discovered in ancient animals ( christodoulou et al .
the let-7 family is expressed in a
wide range of animals and the sequences of its members are highly conserved .
however , significant variations in the size of the let-7 family occur among
organisms : of the 55 organisms known to express members of the let-7 family , 13
express only one let-7 mirna , including the nematodes p.
pacificus , c. remanei ,
c. elegans , c.
briggsae and b. malayi ,
whereas 19 mature let-7 sequences have been identified in the zebrafish
( danio rerio ) ( pasquinelli et
al . 2003 ) . in the present study
, we identified 19 members of the let-7
family in young adults of a. cantonensis , 11 of
which exhibited 50 or more reads . in adult worms ,
the copy number of this mirna was
determined to be less than 50 in both sexes .
these finding suggests the importance
of let-7 in gene regulation in young adults of a.
cantonensis .
however , understanding the role of let-7 in the
development of this parasite will require further studies .
among the mirna families found to be expressed in young adults of a.
cantonensis , mir-1 displayed the highest number of total reads .
members of this family have been found in a wide range of organisms , including
worms , flies , fishes , mice and humans ( bentwich et
al .
they are evolutionarily
conserved and have been characterised as playing essential roles in regulating
proliferation and the differentiation of muscle development via the regulation of
synaptic transmission ( simon et al . 2008 ,
the
mir-71 family presented the highest number of reads in both sexes ( chen et al .
this family has been
reported to promote longevity and stress resistance in worms ( pincus et al . 2011 ) and is involved in the sexual maturation of
female worms ( gomes et al .
these
expression patterns suggest the different roles of mirnas at different developmental
stages .
although the phylogenetic distribution has been reported for clonorchis
sinensis ( xu et al . 2010 ) , there
is no such information available for parasitic nematodes .
the 25 conserved mirna
families found in a. canto - nensis young adults
showed a distribution bias .
these conserved families can be divided into four
groups : 13 families were homologous to sequences of other parasitic nematodes , two
to sequences of free - living nematodes , but not parasitic nematodes , and one to
a. suum sequences .
nine families did not
exhibited any member that was homologous to either a free - living or parasitic
nematode .
moreover , these mirnas observed in young adults of a.
cantonensis were not found in adult worms ( chen et al .
it is possible that the
first two groups regulate general biological or physiological functions in
nematodes .
the mirnas showing homology to a. suum
may be specific to parasitic nematodes . as adult worms of a.
cantonensis
live within the central nervous system , the last
group may regulate adaptive functions of worms related to this special environment ,
which may also cause pathological changes in the central nervous system .
analysis of the levels of aca - mir-1 - 1 and aca - mir-71 - 1 expression via the stem - loop
rt - pcr revealed different expression patterns based on developmental stages and sex .
these two mirnas were selected because they are highly expressed not only in young
adults , but also in adult worms of both sexes . in both male and female worms ,
the
level of expression of these mirnas increased dramatically from the levels observed
in infective larvae and peaked in young adults , subsequently declining to a low
level in adult worms .
overall , the expressions levels of these mirnas were found to
be highest in male adult males .
similar expression patterns have been reported for
18 mirnas in adult worms ( chen et al .
.
these mirnas may be important in regulating sex differentiation , rather than
developmental stages .
the lower expression levels of these mirnas observed in female
worms indicate that females may require a lower degree of post - transcriptional
regulation than male worms .
moreover , the higher expression levels of the mirnas
detected in young adults suggest that more significant changes may occur during the
young adult stage than in the adult stage .
replicate analyses were difficult in the present study because of the technical
difficulties involved in obtaining sufficient sample sizes from infected animals .
however , we
identified 53 mirnas , belonging to 25 families , that displayed 50 or more reads .
these findings provide reliable information about the global mirna expression
profiles found in a. cantonensis .
although
northern blotting is considered a gold - standard approach for detecting mirnas , this
method is limited by its low sensitivity and difficulties in distinguishing
homologous mirnas from highly similar sequences ( van
rooij 2011 , pritchard et al .
moreover , we succeeded in confirming the expression of two mirnas
initially identified via the high - throughput approach in a.
cantonensis young adults through the more sensitive and
specific technique of stem - loop quantitative rt - pcr .
based on the results of the present study , there are significant differences in the
expression of mirnas between young adults and adult worms of a.
canto - nensis .
these differences are not only qualitative , but
also quantitative . in the present study ,
we identified nine mirna families without
homologous members in the available sequences of other nematodes in the adult stage .
moreover ,
the expression levels of mir-1 and mir-71 increase from a low expression
level in infective larvae to a peak in young adults and subsequently decrease in
adult worms .
these results suggest that mirnas play a more important role in the
regulation of biological functions in young adults than in adult worms of
a. cantonensis . |
angiostrongylus cantonensis is an important causative agent of
eosinophilic meningitis and eosinophilic meningoencephalitis in humans .
micrornas ( mirnas ) are small non - coding rnas that participate in a wide range of
biological processes .
this study employed a deep - sequencing approach to study
mirnas from young adults of a. cantonensis .
based on 16,880,456
high - quality reads , 252 conserved mature mirnas including 10 antisense mirnas
that belonging to 90 families , together with 10 antisense mirnas were identified
and characterised . among these sequences ,
53 mirnas from 25 families displayed
50 or more reads .
the conserved mirna families were divided into four groups
according to their phylogenetic distribution and a total of nine families
without any members showing homology to other nematodes or adult worms were
identified .
stem - loop real - time polymerase chain reaction analysis of
aca - mir-1 - 1 and aca - mir-71 - 1 demonstrated that their level of expression
increased dramatically from infective larvae to young adults and then decreased
in adult worms , with the male worms exhibiting significantly higher levels of
expression than female worms .
these findings provide information related to the
regulation of gene expression during the growth , development and pathogenesis of
young adults of a. cantonensis . | MATERIALS AND METHODS
RESULTS
DISCUSSION |
within and beyond the world of nanoscience , images abound . there are lots of colourful images of structures at the nanoscale , based on visualizations of digital data created by scanning probe microscopy or other imaging instruments ( as are made available to colleague nanoscientists ) .
there are also artist s impressions , ranging from impressions of entities at the nanoscale to envisioning nanoachievements to be realized in the near or long - term future , including science - fiction type images of nanobots .
one can distinguish imaging , that is , creating images based on data and aiming at resemblance , from imagining , where imagination is mobilized to create a vision of the nanoworld . actually , imaging and imagining
are always entangled , already in so - called scientific visualizations where expectations about how the nanoscale could look like steer the choices involved in making images .
a subsequent question then is what such entangled images stand for , not only representing in the sense of resemblance , but also in terms of what images do when representing the nanoscale .
a clear example are images which demonstrate of technoscientific achievements . in practice , there is a continuum ranging from visualizations of the nanoscale adapted from original instrument - based data to so - called
artist s impressions ( which need not be produced by artists ; the phrase is used to indicate some freedom in visualizing ) of how the nanoscale could look like , or how audiences may expect that it looks .
this occurs already within science , for example when images indicate possible functions of complex molecular structures . to capture the continuum of imaging and imagining
, we will write imag(in)ing.1 we will start by analyzing occurrences of imag(in)ing and the tensions involved . while imag(in)ing has to do with representation , which is often focused on making something present through resemblance , we emphasize representation as standing for and being able to
political representation ( cf . ) . standing for and being able to act for , is somewhat independent of what is being
stood for. thus , this notion of representation is broader than the epistemological puzzles , and debates , about reality ( out there and/or in contrast with fiction ) . in the final part of our paper
right representation is , in terms of images that become iconic , and in that sense stand for , and are allowed to speak for , nanotechnology .
the nanoscale , invisible to the naked eye , is visualized through the use of a variety of imaging instruments . at the outset , it is not clear what the right imaging tools would be , and this relates to the basic problem how one can know whether the visualizations obtained actually visualize the nanoscale
harry collins highlighted the problem of choice between instruments that would be adequate to the task of studying unknown phenomena a problem which he introduced as an experimenter s regress because there is no independent check of the correctness of the choice .
for the production of visualizations there is the additional question about the ways to produce images / pictures that lead to reliable representations of the invisible . just as the experimenter s
regress can ( and will ) be stopped in practice when expectations about the unknown phenomenon become shared , expectations about how the invisible phenomena should look like , can provisionally stop the visualization regress (: 5 ) .
a subsequent imaging challenge is to reach audiences which are not familiar with the production processes of the images .
there will be ( .. ) a diffuse message about the nanoscale which has to be presented as clearly and convincingly as possible (: 9 ) to intended audiences .
artist s impressions may do such a job better than data - based images . in visualization practices expectations about what can be
seen at the nanoscale and how the nanoscale should be visualized are to some extent internalized as rules about how to do it .
the data - based images are manipulated to highlight the information they should convey , which is an accepted practice in the domain of science , as long as the scientific content remains unchanged .
artist s impressions of how the nanoscale could look like are similar , in the sense that imaging and imagining are also entangled . in other words
visualizations of the nanoscale as well as artist s impressions are used in scientific journals to show research results.2 such practices are not uncontested .
correctly , make it to the cover of scientific journals.3 when they do so , they come to stand for scientific achievements , and cover pictures are often presented on research groups websites next to their list of publications .
1artist s impression of an array of nanotubes fets overlaid with gold source and drain electrodes .
this image was used for a cover of science , and was subsequently criticized by ottino , who argued that
if the carbon atoms are visible , then the much larger gold atoms in the structure should also be on view
courtesy of : c. dekker , tu delft / tremani artist s impression of an array of nanotubes fets overlaid with gold source and drain electrodes .
this image was used for a cover of science , and was subsequently criticized by ottino , who argued that if the carbon atoms are visible , then the much larger gold atoms in the structure should also be on view
as an emerging technology , nanotechnology comprises present achievements and visions of what it may become . while such combinations occur for all sorts of sciences and technologies ( see van lente on promising technologies ) this appears particularly striking in nanotechnology .
mody argues that nanotechnology , in contrast to , for example , physics and chemistry , seems decidedly non - presentist and that nanotechnologists work as much in this future world as in the present (: 108 ) .
then , there is the design orientation in nanotechnology , where a possible future is projected to be realized by a present design . with computer simulations playing an important role , much of nanotechnology s created reality thus has a virtual , yet - to - be - realized quality .
kaiser adds another twist:they [ future visions ] have been invented and are presented with the strong probability claim that they will become reality in the future . from a modal logical point of view , they do nt represent possible worlds in the fictional universe ; on the contrary , they constitute future worlds in ours (: 667 ) .
they [ future visions ] have been invented and are presented with the strong probability claim that they will become reality in the future . from a modal logical point of view , they do nt represent possible worlds in the fictional universe ; on the contrary , they constitute future worlds in ours (: 667 ) .
if one wants to use categories like reality and fiction ( as actors often do ) , one can say that boundaries between reality and
fiction are blurred in the nanorealm , and this will be reflected in images of nanotechnology .
scientists produce images equivalent to artist s impressions that show what could be possible applications for nanotechnology .
images of bucky balls , molecular machines , new uses of carbon nanotubes , are created to make a possible future present .
artists offer their ( own or commissioned ) visions of nanotechnology s potential future applications .
as soon as the future is incorporated , there is no sharp boundary between images that articulate directions of further research and more open - ended visions of new performances which then merge with futuristic visions . some actors will attempt to separate science
( reality ) from science fiction. this can be a tactic to have their project prevail over that of others ( this tactic has been deployed by critics of drexler s visions of molecular manufacturing , cf . ) .
or it can be a defensive move to avoid being called to account for possible negative implications of investing in nanotechnology research ( that s only fiction ) .
arguments for disentangling the future from the present also occur in relation to lay - audiences .
such an argument would run like : it should be made clear which images are realistic and which are fictive , so as to avoid giving the false impression that ( say ) nanobots have already been built .
ottino extended his crusade for correctness to the nanolouse image ( see fig .
2 ) :
fig . 2the nanolouse image ; over - hyped or a possible application of nanotechnology in medicine in the future .
source : ottino the image looks so real that it is easy to imagine a viewer being fooled into believing it has already been built .
this is important in terms of public reaction , especially in the backdrop of scenarios such as in michael crichton s new novel prey , which portrays swarms of self - replicating nanomachines destroying all other life forms that they encounter (: 476 ) . the nanolouse image ; over - hyped or a possible application of nanotechnology in medicine in the future .
source : ottino the image looks so real that it is easy to imagine a viewer being fooled into believing it has already been built .
this is important in terms of public reaction , especially in the backdrop of scenarios such as in michael crichton s new novel prey , which portrays swarms of self - replicating nanomachines destroying all other life forms that they encounter (: 476 ) .
ottino links his criticism with a concern about public acceptance of nanotechnology , if such images should come to stand for nanotechnology in the public eye .
the public , however , may well be more discerning than he projects it to be . still , the image does contain an ambivalence , which is brought out in how it has been presented on the bbc website ( www.bbc.co.uk ) .
on one occasion it was positioned as the 2002 winner of the visions of science award : the more over - hyped applications see tiny machines roaming the body to cure diseases. on another occasion , realistic possibilities were emphasized : the nanolouse image intends to show one of the possible applications of nanotechnology in medicine in the future microscopic machines roaming the body , injecting or taking samples for tests. continuing with this example , it is interesting that the nanolouse image has been often used in the world of science . in the period 20052007 ,
the image was used in presentations about drug delivery , nano - probes and ( n)mems , as an illustration and occasionally as a possible future application .4 in general terms , images of nanotechnology that import the future into the present are used to communicate what nanotechnology is as well as to indicate nanotechnology s potential . in doing so , within science and beyond ,
such images are used strategically to put audiences in desired positions and at the same time to strengthen one s own position .
an interesting example is how the foresight nanotech institute used the nanogear image to position itself . on their website , they present the nanogear image ( fig . 5 ) ( and the image of the strained - shell sleeve bearing ) to indicate that 1 day , surely , productive nanosystems will be realized .
respirocytes ( artificial blood cells able to carry 236 times more oxygen than human s red blood ) as designs , implying that they can ( and thus will ) be built in the future .
what is new in nanotechnology is that these images are about aimed - for possibilities rather than an actual construction plan of such a future .
the nanogear image is an extreme example , but these kind of images and their use are widespread .
nanoscientists play with the entanglement of data - based imaging and impressionistic imagining , and with the entanglement resulting from projecting of the future into the present .
they produce and use images to illustrate scientific breakthroughs and to create expectations about the potential realization of scientific achievements , or to highlight socio - political debates .
in addition , the aesthetic appeal of the images that are produced as visualizations of the nanoscale , is actively pursued , for example through impressive colouring , as in ibm s image of the quantum corral ( fig . 7 ) .
the fact that images are now given a name , and an evocative name at that , is an indication that they are seen as works of art , which have titles.5 this link with the world of art , at least with the world of being creative in making images , is not just an excursion of scientists .
an interesting development is how artists make use of , or even get involved in , the production of images through imaging instruments .
as chris orfescu noted , there appear to be two ways to do so : nanolandscapes in which given structures of matter at the nanoscale are depicted , and nanosculptures , which are created through the manipulation of matter at the nanoscale by nanoscientists , and then visualized.6 one sees how such images offer a view to a new world that is in the process of being explored .
many of the nano- and microsculptures like the nano - guitar , nano - opera house , nano - toilet and the nano - bull ( see fig .
interestingly , the methods which are used to create such nanosculptures are of scientific interest .
fig .
a team of japanese engineers has created the smallest sculpture of a bull , which could only be viewed with a scanning electron microscope .
a team of japanese engineers has created the smallest sculpture of a bull , which could only be viewed with a scanning electron microscope .
source : kawata et al . for example , kawata et al . created a model bull , measuring 10 by 7 m , which is about the size of a red blood cell .
the nano - bull was used to show the potential of two - photon photopolymerization .
but the fact that it was a bull was the immediate message , and kawata et al.s claim about their technoscientific achievement piggy - backed ( if we may say so ) on this message .
another example comes from a nanoart project in which imaging tools like the scanning tunneling microscope ( stm ) and atomic force microscope ( afm ) are deliberately used for artistic purposes .
scali and goode produced the smallest map ever of the continent africa , created through the use of a scanning electron microscope ( sem ) and visualized with an afm ( see fig .
the actual size is 200 m 130 m , and it is meant to highlight the paradox of africa being geographically and anthropological central to our world , yet unrecognizable , unexplored , and invisible (: 408 ) . apart from the political message that requires text to be conveyed , a visualization is produced to create an aesthetic paradox : a piece of art that you can never see .
yet that exists and carries a message.7 at the same time , it shows the research group s abilities to work at the nanoscale and to visualize it , and so illustrate / demonstrate the innovative character of nanotech developments .
the artwork is a small sliver of silicon , visualized with an afm , and only visible by using the same instrument .
the artwork is a small sliver of silicon , visualized with an afm , and only visible by using the same instrument .
source : http://www.nanoarte.it in this way , nanoart also becomes a showcase for nanoscience . by crafting impressive nanosculptures , scientists capacities to manipulate matter at the nanoscale
are highlighted , and expectations are created about the possible applications of the new methods .
then there are artists ( often graphic artists ) who create impressions of how the nanoscale could look , or give their impressions of possible future applications for nanotechnology developments .
they can be commissioned to do so by scientists to enhance the visual appeal of their achievements .
the aesthetic appeal of images becomes more relevant when images are intended to circulate more widely and to reach broader audiences .
this happens when imaging contests are organized where beautiful visualizations of the nanoscale are selected , and which then may become linked to more general issues and foreground nanotechnology developments and science in general , and , importantly , the beauty of the nanoscale . such images might then stand for nanotechnology .
the image of the nanoflower , for example , is a nanosculpture , it was created in a laboratory , and its colouring was intentionally chosen to enhance its appeal to wider audiences.8 it was indeed used as a general illustration in texts explaining nanotechnology .
how can images of nanotechnology become iconic , in the sense of standing for nanotechnology and its further development ? there are two parts to this question about the process and what is involved .
the overall process is their reception and further circulation , where the message that is conveyed also plays a role . at some moment
, the image has so much standing that it can stand for nanotechnology in its own right .
secondly , there are struggles between actors with an interest in which image will eventually come to stand for nanotechnology . in a sense , whether an image becomes iconic or not is the outcome of such struggles . on the basis of these two processes
2 ) , the nanogear ( see fig . 5 ) and the ibm - nanologo ( see fig . 6).9fig . 5the nanogear image .
the nanogear image features a complex molecular structure which is envisioned to be used to build products from the bottom - up . this structure is designed through molecular construction software developed by nanorex .
it stands for the idea that 1 day atoms could be used as the ultimate building blocks .
source : http://nanoengineer-1.com/content/index.php?option = com_content&task = view&id = 52&itemid = 62fig .
the ibm logo was created at the nanoscale by moving 35 xenon atoms on a nickel surface .
this image showed that atoms could not only be visualized , but also be moved through the use of an stm .
the nanogear image features a complex molecular structure which is envisioned to be used to build products from the bottom - up . this structure is designed through molecular construction software developed by nanorex .
it stands for the idea that 1 day atoms could be used as the ultimate building blocks .
source : http://nanoengineer-1.com/content/index.php?option = com_content&task = view&id = 52&itemid = 62 ibm nano - logo .
the ibm logo was created at the nanoscale by moving 35 xenon atoms on a nickel surface .
this image showed that atoms could not only be visualized , but also be moved through the use of an stm .
eigler and schweizer in the case of the nanolouse image , we have traced its circulation and reception ( see ) . after winning the science visions award in 2002 ,
the nanolouse image draws on , and reinforces , ideas about magic bullets redressing our sorrows . while contested within science that it might create wrong ideas about nanotechnology when presented to lay audiences ( cf . )
it was actually nanoscientists who continued to use the nanolouse image in their presentations , making it available on their websites .
there is a reversal in its use : first , the nanolouse was accompanied by text explaining what the image depicted , but later , such explanations were not needed anymore ; the image could speak for itself and came to stand for the future of nanomedicine . in the case of the nanogear image
there was a general appreciation of the image in the 1990s , and a widespread uptake which made it iconic according to our definition . but with the downturn in the standing of the drexlerian vision , it is not generally accepted anymore as standing for nanotechnology .
the nanogear image builds on ideas that atoms can be used to engineer products from the bottom - up , and is used as standing for molecular manufacturing , the drexlerian vision .
the image was designed by the foresight ( nanotech ) institute to carry that message , and was used almost as a logo .
when the vision of molecular manufacturing lost its general standing in the early / mid 2000s , at least within the nanotechnology establishment , the use of the nanogear image as standing for nanotechnology became contested .
but it continued to perform outside the immediate world of nanotechnology , up to appearing in official publications and brochures of research institutes wanting to show they were into nanotechnology as well.10 our third iconic image , the ibm nanologo ( see fig .
[ it ] became visually compelling evidence of the human capacity to manipulate the world
atom - by - atom and to build various molecular devices in the future (: 54 ; cf . ) . the ibm logo seems to suggest progression toward the full potential of nanotech (: 272 ) , and stimulated imaginations of the discovery and conquest of new spaces .
writing of the ibm logo with the use of the american stars and stripes flag to mark territory.11 other images produced by ibm almaden like the elliptical corral of cobalt atoms on a copper substrate , with its judicious use of colours to create an aesthetically pleasing image ( fig .
7 ) , were used as illustrations , but never became iconic .
fig .
ring of atoms are shown in light shade of green , in which the ripples ( colored in blue ) are wave patterns of some of the electrons trapped in the corral .
ring of atoms are shown in light shade of green , in which the ripples ( colored in blue ) are wave patterns of some of the electrons trapped in the corral .
source : http://www.almaden.ibm.com/vis/stm/images/stm_small.gif a large variety of images of nanotechnology circulates inside as well as outside the world of nanotechnology , but most of them do not become iconic . that depends on their reception and if and how they take on a life of their own , including the struggles linked to their being
the three images that did become iconic all depict actual or imagined technoscientific objects , and are widely seen as representing technoscientific achievements , even when they only offer a promise .
the entanglement of imaging and imagining occurs all the time , and it can stabilize into specific patterns and established rules .
this is very clear in practices of visualizing the nanoscale . while imaging is what these practices are about , imagining is an integral part , both in expectations about how the nanoscale could / should look like , and in the highlighting of the images , e.g. with colours , to enhance their visual appeal within the world of nanotechnology and for wider audiences . how to do this is broadly accepted , even if there are some debates . in concrete situations , there will always be choices to be made which require judgment rather than following a stabilized rule . incorporating the future in the present occurs in various ways , already in how images are used to visualize a design that might / should be realized .
while there are debates about the plausibility of the futures that are imagined , there is widespread acceptance of such imagining , e.g. in the use of the nanolouse image .
the cross - traffic between the world of nanotechnology and the wider world is premised on promises , and images embodying such promises are an integral part of this cross - traffic .
while there is interest from both sides , there is little stabilization ( and perhaps there should nt be ) . seen from the world of nanotechnology , art is peripheral , so there is no pressure to stabilize the entanglements .
this is different from the situation of visualization of the nanoscale , where the entanglement of imaging and imagining is addressed daily , and stabilization is necessary to work productively . for the entanglement of the present and the future
, there is some pressure to stabilize , but also opportunism : if images like the nanolouse appear to work , they are used even if they could be ( and had been ) criticized .
there are tensions in the entanglements and their stabilization . already within scientific practices , struggles become clearly visible when images are used to reach out to broader audiences . because the future and the present are entangled in nanotechnology and its images , there are always possibilities to emphasize one side over the other , in terms of simple actor s categories of
the example of the nanolouse image shows that its fictional character is often downplayed in order to profit from the associations ( like magic bullet ) elicited by the image .
this went as far as the image being featured in the documents of the european technology platform nanomedicine . at some moment
, there may be a backlash , however , when actors in the world of nanomedicine get frustrated by the expectations that were induced by the wide use of the nanolouse image . for nano and art , there may be tensions between nano - actors thinking in terms of aesthetics , while artists focus on creating a new reality.12 there are no antagonisms , because the worlds of artists and of nanoscientists are far apart , and the interactions are seen merely as intriguing curiosities .
there is a gray area where graphic designers produce images , and nanoscientists like chris ewels dabble in graphic design .
at the moment , there is space for all of these ventures . the umbrella term
this will change when images ( of whatever provenance ) might come to stand for nanotechnology as a whole.13 then there is something at stake : nanotechnology is not something given it lives on promises .
so , the struggle will not be about what nanotechnology is now ( even if that is one element ) , but about what nanotechnology could be and should be .
these struggles occur in a variety of arenas , like funding programs , national science and technology priority setting , and eligibility of who is allowed to speak for nanotechnology .
images play a role as resources in these struggles , but also as agents in their own right when they have a life of their own .
not as an active force , but as an affordance or a repertoire which will shape what happens without being determinant .
it is the entangled imag(in)ing which creates such affordances and repertoires , not the force of images as such . | images , ranging from visualizations of the nanoscale to future visions , abound within and beyond the world of nanotechnology . rather than the contrast between imaging , i.e. creating images that are understood as offering a view on what is out there , and imagining , i.e. creating images offering impressions of how the nanoscale could look like and images presenting visions of worlds that might be realized , it is the entanglement between imaging and imagining which is the key to understanding what images do .
three main arenas of entanglement of imag(in)ing and the tensions involved are discussed : production practices and use of visualizations of the nanoscale ; imag(in)ing the future and the present ; and entanglements of nanoscience and art . in these three arenas
one sees struggles about which images might stand for nanotechnology , but also some stabilization of the entanglement of imag(in)ing , for example in established rules in the practices of visualizing the nanoscale .
three images have become iconic , through the combination of their wide reception and further circulation .
all three , the ibm logo , the foresight institute s nanogear image , and the so - called nanolouse , depict actual or imagined technoscientific objects and are thus seen as representing technoscientific achievements while marking out territory . | Introduction
Imag(in)ing the Invisible Nanoscale
Practices of Entangling the Future and the Present
Entanglements of Nanoscience and Arts
Images Standing for Nanotechnology
In Conclusion |
nasopharyngeal carcinoma ( npc ) is rarely reported in children13 and is more often of undifferentiated type .
combined chemoradiotherapy is the treatment of choice for this malignancy , and has shown promising results.35 overall survival rates of 50%77% are reported.24 however , the high radiation doses needed to provide effective treatment have resulted in long - term toxicity , with hard and soft tissue growth complications , particularly in young children who are still growing.45 maxillofacial and dental abnormalities are well - known long - term chemoradiotherapy - related complications in children with head and neck cancer.611 severity of the developmental disturbances are related to the patient s age at the time of treatment .
the younger the child , the more severe the abnormalities , especially in those under six years.7 another factor influencing the severity of developmental disturbances is the radiation dose , with doses between 10 to 30 gy leading to significant bone growth disturbance and arrested tooth development.12 according to guyuron et al13 30 gy can be considered to be a harmful dosage for the development of the maxillofacial bones , and 4 gy harmful to development of the soft tissues .
xerostomia , oral mucositis , and late visual and auditory toxicity have also been reported as frequent and potentially severe complications of radiotherapy.14,15 although treatment - related skeletal and dental complications from a range of malignancies have been often reported in children , there are few published studies concerning those with npc in children.2,16 in addition , oral health after npc treatment was reported by schwarz et al17 but not for children .
we report here on a 20-year - old woman with dental and maxillofacial skeletal complications six years after chemoradiotherapy for npc . the rarity of npc in children and the absence of clear data regarding the safety of the radiation dose delivered to the oral area makes this study of interest to all dentists and orthodontists involved in improving quality of life for these young patients .
a 20-year - old woman was referred by radiation oncology to our orthodontics department for dental assessment and subsequent orthodontic consultation and treatment .
she had a known six - year history of histologically diagnosed npc , ( type ii according to who criteria , ct3cn3m0 , grade i. she had been treated with chemoradiotherapy comprising concurrent cisplatin ( 100 mg / m on days 1 , 22 , and 43 ) chemoradiotherapy , followed by three cycles of adjuvant chemotherapy consisting of cisplatin 80 mg / m and 5-fluorouracil 500 mg / m at 28-day intervals.18 she did not receive any nonchemotherapeutic agents .
the radiotherapy plan was conducted using a two - dimensional computerized treatment planning system ( telemaque technos , technologies - informatiques s.a . , trappes ) .
the primary site and bilateral upper neck received 60 gy in 33 fractions over 6.5 weeks and the lower neck and supraclavicular fossae received 40 gy in 22 fractions over 4.5 weeks .
a two - phase technique was used . following conventional simulation and using a cobalt-60 gamma ray unit , radiotherapy
was initially delivered by large parallel - opposed lateral fields to a dose of 36 gy given over four weeks at 180 cgy per day .
the treatment field extended superiorly to the inferior orbital margin , inferiorly to the c6 spinous process , anteriorly to the anterior border of the masseter muscle , and posteriorly to the t2 spinous process , encompassing all macroscopic disease , including that in the spinal cord . to target undetectable microscopic disease ,
the clinical volume included the base of the skull , posterior half of the nasal cavity , nasopharynx , sphenoid base , parapharyngeal space , and lateral pharyngeal , and posterior and upper deep cervical nodes .
the brainstem , optic chiasm , and anterior half of the orbit were shielded . during the second phase of treatment
, the parallel - opposed lateral fields were reduced posteriorly to exclude the spinal cord , and a further dose of 24 gy was given over 2.5 weeks , at 180 cgy per day , achieving a total dose of 60 gy in 33 fractions . in order to assess the delivered radiation dose on dental and skeletal structures in the present study
, we used the central slice of the magnetic resonance imaging ( mri ) , including the mandibular teeth ( figure 1 ) .
the total radiation dose delivered was evaluated for the large parallel - opposed lateral field ( phase 1 , figure 2a ) and for the reduced parallel - opposed lateral field ( phase 2 , figure 2b ) in different levels representing mandibular tooth groups .
thus , the internal volume 1 ( a ) represents the central incisors , internal volume 2 ( c ) the canines , internal volume 3 ( e ) the second premolars , internal volume 4 ( f ) the first molars , internal volume 5 ( g ) the second molars , and internal volume 6 ( h ) the third molars .
the isodose calculation was conducted by the two - dimensional planning system for a 11 15 cm and a 7 15 cm 1.25 mv photon beam for phase 1 and phase 2 lateral fields , respectively .
the isodose curves in figure 2 , which are the lines with the different colors , corresponded to different percentages of the total dose delivered during both phases of radiotherapy .
radiation dose , as a percentage of the total dose , and total irradiation delivered are shown in table 1 . according to the isodose calculation
, it appears that the delivered doses decreased from level 6 , the nearest to the radiation field , to level 1 , the most deviated . in summary , during phase 1 , the delivered dose at level 1 was 0% and at level 6 was 97% ; for phase 2 , at level 1 the dose was 0% and at level 6 was 98% . in total , the incisors received 0 gy and the third molars received 58.44 gy ( table 1 ) .
the lower deep cervical and supraclavicular fossae lymph nodes were treated with a direct anterior photon field because of the position of the shoulders to a dose of 40 gy in 22 fractions given over 4.5 weeks .
a half - beam blocking technique was used along the superior margin of the anterior field to reduce divergence , central shielding to protect the spinal cord and larynx , and bilateral shielding to protect apical parts of both lungs .
focusing on the anatomic structures of the jaw and oral cavity , the irradiated area at the midplane included the major salivary glands , mucosal surface , posterior part of the maxilla and of the body of the mandible to the anterior border of the masseter muscle , and the ramus of the mandible along with the coronoid process and the condyle .
these structures received 50% of the prescribed dose at the lateral field margins , 95%104% at the center of the fields , and less than 50% at the anterior part of the jaw . in order to manage the expected xerostomia ,
the patient was advised to take frequent sips of water and maintain an adequate daily fluid intake .
sugar - free gums were used to stimulate saliva flow , and scrupulous oral hygiene was recommended .
moreover , amifostine , the most comprehensively tested radioprotective agent , was utilized to prevent primarily radiation - induced xerostomia and mucositis , providing protection for the salivary glands,19 as well as preventing cisplatin - induced neurotoxicity , ototoxicity , and renal toxicity .
the size of the malignancy before and after treatment was estimated by mri ( figures 3a , b , and c ) .
a complete response , both of the primary tumor and locoregional lymph nodes , was achieved one month after the end of treatment ( figures 3d , e , and f ) .
toxicity from chemotherapy was predominantly grade 2 nausea / vomiting and grade 1 hematologic toxicity .
the acute toxicity of radiotherapy consisted of grade 2 mucositis and a grade 2 skin reaction .
late complications of radiotherapy were mainly grade 2 xerostomia and fibrosis in the soft tissues of the neck ( figure 4 ) .
five years after radiotherapy , the complications were edema of the eye lids requiring reconstructive surgery and hypothyroidism treated with thyroxine at a maintenance dose of 0.05 mg / day orally , respectively .
follow - up was scheduled every three months for the first two years , every six months for the next two years , and annually thereafter .
the patient remained disease - free six years post - chemoradiotherapy , and extraoral examination showed no apparent signs of deformity .
facial examination showed no asymmetry in the frontal view ( figure 5a ) and the soft tissue profile was acceptable ( figure 5b ) .
oral examination revealed that the patient had class ii , division 1 malocclusion in her permanent dentition . left first molars and left and right canines showed a class i tooth relationship , while the right first molars showed a class iii tooth relationship
the overjet was 7 mm , and the overbite 5 mm ( figures 6a , b , and c ) .
the maxilla was narrow anteriorly , maxillary anterior teeth were crowded , and the mandibular dental arch had spaces distal to the canines . left maxillary and right and first left mandibular molars , as well as lower the right and third left molars , were extracted ( figures 6d and e ) .
multiple caries lesions were found in almost all teeth , but the lesions of the canines , premolars , and molars were more significant .
maxillary and mandibular posterior teeth showed class i caries and enamel decalcification , while the anterior teeth showed proximal , distal , and mesial caries .
the patient s oral hygiene was poor , with plaque accumulation , severe localized inflammatory gingivitis , and gingival hyperplasia ( figure 6 ) .
comparison of two panoramic radiographs at the end of chemoradiotherapy ( figure 7a ) and six years later ( figure 7b ) revealed that the third mandibular molars were presented initially .
they were , however , extracted after chemoradiotherapy prior to the start of six - year follow - up .
the extraction spaces of the left maxillary and right and left mandibular first molars were not totally closed initially ( figure 7a ) . during the six years of follow - up , the corresponding first molars were moved forward to close the remaining spaces , but with significant mesial inclination ( left maxillary and right mandibular first molar ) accompanied by periodontal pockets located at the mesial aspect of their mesial roots ( figure 7b ) .
six years after chemoradiotherapy , the right and left third maxillary molars showed good positioning in the dental arch , the pulp chamber was formed and the apex was fully closed , although the later was not evident immediately after chemoradiotherapy .
it was also observed that , during the same follow - up period , six endodontic treatments were performed in a total of 27 preserved teeth .
bone density and mandible bone volume did not seem to differ from the non - irradiated bones .
furthermore , following extraction of the third molars after chemoradiotherapy , normal bone healing was observed at the corresponding extraction sites ( figure 7b ) .
cephalometric analysis revealed maxillary protrusion in relation to the anterior skull base , mandibular retrusion , a dolichofacial growth pattern , normal lower facial height , normal mandibular length , and anterior rotation of the mandible .
lower incisors were positioned at a normal distance to the a - pog plane , but with lingual inclination . the lower lip was found in a posterior position in relation to the esthetic line , and the nose seemed pronounced ( figure 8 , table 2 ) .
concomitant chemotherapy enhances the effects of radiotherapy , resulting in improved outcome in npc , but with a significant increase in acute toxicity , especially mucositis , due to the use of cisplatin as a radiosensitizer.20 direct and indirect long - term radiation effects on developing organs have been reported in long - term survivors.11,17,21 the effects of chemotherapy appear to be similar to those reported for irradiation , although generally milder.20 in our patient , long - term chemoradiotherapy - related effects on dental development were compared only in the limited area of posterior teeth , because the first panoramic radiograph was of poor quality , 9,5 of as high as 60 gy , did not significantly affect completion of their root formation .
caries development in patients treated for cancer is attributed to post - radiation xerostomia and its duration.11,17,2325 in the present patient , radiation caries was present mainly in the posterior maxillary and mandibular teeth .
minor caries was observed on the anterior teeth of both dental arches , located mainly in their proximal , mesial , and distal aspects .
cervical caries indicative of xerostomia , usually manifested as an indirect effect post - irradiation , was not evident .
this difference in caries manifestation between the anterior and posterior teeth could be attributed to the difference in the radiation dose received by different tooth groups , achieved by the two - dimensional planning system .
consequently , although caries of the posterior teeth can be attributed to radiation , the corresponding caries lesions in the anterior teeth are not related to radiation - xerostomia effects for two main reasons , ie , the high radiation dose was limited in the posterior teeth , mainly on the second and third molars , and the submandibular and sublingual salivary glands were out of the radiation field and therefore were not affected by radiation , thus obtaining restricted but continuous saliva flow .
it is probable that the caries present six years after chemoradiotherapy in our patient was due to poor oral hygiene .
no major skeletal problems attributable to radiotherapy were found in our patient . on the contrary ,
a more significant degree of aberrant skeletal effects has been expected because the patient received 60 gy on the upper neck and 40 gy on the lower neck , and bone growth damage has been reported to occur at doses of 10 to 30 gy,12 and micrognathia at doses of 35 gy.26 the lack of major skeletal effects is probably due to the age of this patient at time of irradiation ( 14 years ) when maxillary growth was almost complete and only residual mandible growth potential remained , probably leading to development of the mandibular retrusion observed six years after chemoradiotherapy .
however , the patient s normal mandible sagittal linear value , symphysis morphology , and pogonion prominence six years after treatment , indicates that some compensation had occurred and that a developmental effect existed post - irradiation .
moreover , it seems that the present dental and skeletal relationships in our patient are more the result of evolution of a pre - existing malocclusion than the effect of chemoradiotherapy . finally , at the present time , mandible bone density and volume in this patient do not seem to be adversely affected , osteoradionecrosis is not apparent , and bone regenerative capacity had been preserved after third molar extraction post - chemoradiotherapy .
use of individualized radiation fields by means of a two - dimensional computerized treatment planning system in our patient limited the severe damage to maxillofacial , dental , and skeletal structures that usually follows chemoradiotherapy .
teeth and bones were mildly affected , but with an appropriate long - term follow - up program for oral hygiene and an oral care protocol,27 orthodontic treatment could be initiated according to the needs of individual patients . | we describe the long - term complications six years after chemoradiotherapy in a 20-year old woman with nasopharyngeal carcinoma .
we wanted to know whether the radiation dose was constant throughout the oral cavity , and thus uniformly affecting the corresponding dental and skeletal structures .
clinical and radiologic findings are described six years after chemoradiotherapy based on a two - dimensional computerized treatment planning system .
this revealed radiation caries limited only to posterior teeth , proximal caries in the anterior teeth , limited but continuous salivary flow , mild periodontal infection , mild xerostomia , and a regenerative capacity of bones and the developmental process .
the quantitative assessment of radiation delivered to the mandible revealed a high radiation dose in the posterior area and a minimal dose in the anterior area .
this explains the differences in caries manifestation between the anterior and posterior teeth . according to the present study , individualized radiation fields , using a two - dimensional treatment planning system ,
result in restriction of severe damage of the dental and skeletal structures , which usually follows chemoradiotherapy .
orthodontic treatment could be initiated according to individual patient needs . | Introduction
Materials and methods
Results
Discussion |
natural uranium ( nu ) is an alpha particle emitter radionuclide of the actinide series and a ubiquitous environmental trace metal found in almost all types of rocks , soils , plants , and water .
surface water and especially ground water play a significant role in the migration and redistribution of this nuclide in the environment .
increased nu levels in groundwater are associated with uranium - rich ores and its high solubility under oxidising conditions in soft and bicarbonate - rich waters .
consequently , populations may be exposed to nu in some countries and regions with high nu levels in drinking water [ 24 ] .
the harmful effects on human health of high levels of nu in drinking water are naturally of great interest to the scientific community and the general public .
nu comprises three isotopes : u , 99.28% ; u , 0.715% ; and u , 5.5 10% .
techniques have been developed in which uranium ore is chemically enriched , thereby increasing the concentration of u to 24% .
the different stages of nuclear fuel cycle lead to the production of enriched uranium ( eu ) and a by - product with a lower proportion of u , called depleted uranium ( du ) .
the radiological hazard is more important into the following order : eu > nu > du , but all these uranium have the same chemical toxicity .
although the central nervous system is a target organ for many toxic heavy metals and is a radiosensitive organ [ 68 ] few studies have looked for in vivo neurological and neurobehavioural effects following internal contamination with uranium .
a few studies on nuclear workers or gulf war veterans have looked at its brain effects [ 911 ] .
experimental studies show that after exposure , uranium can reach the brain and lead to neurobehavioural effects on locomotor activity , the sleep - wake cycle , memory , and anxiety .
almost all of these data have been recorded with du and supraenvironmental levels ( i.e. , 40 mgl ) .
the toxicity of du is expected to be mainly chemical rather than radioactive , so the radiological hazards of uranium have been little investigated .
several in vivo studies have shown that uranium can affect the brain , but a still more sensitive approach is necessary to overcome the specific limitations due to low doses .
metabolomics , the comprehensive analysis of a wide range of metabolites , provides a novel tool in the search for new biomarkers of exposure or diagnostic and is an alternative and complementary approach to establish more -omics techniques such as genomics , transcriptomics , or proteomics .
metabolomics provides the ultimate response of a biological system through the analysis of small molecules ( < 1000 da ) and the characterisation of metabolic phenotypes .
metabolomics has recently been found efficient for identifying a discriminant metabolic signature of chronic low - dose cesium 137 or uranium contamination in urine of rats [ 13 , 14 ] .
. the metabolites in cerebrospinal fluid ( csf ) reflect central nervous system metabolism and the balance between blood and csf
the purpose of the present work was to establish for the first time whether chronic exposure to nu can induce behavioural effects and whether the csf metabolome is modified . to mimic environmental contamination of drinking water , especially among children , who are known to be a sensitive subgroup in toxicology and radiobiology [ 17 , 18 ] ,
male rats were exposed from birth to adulthood , that is , over a continuous 9-month period , through lactation and next drinking water containing concentrations of nu known not to be toxic to the kidneys .
we used nu concentrations of 1.5 , 10 , and 40 mgl , since the highest concentration of naturally occurring uranium in spring water is 12 mgl . in order to determine the influence of sex , female rats were exposed to the highest nu concentration ( 40 mgl )
female sprague - dawley rats ( n = 48 ) were purchased at gestational day 18 ( charles river , france ) and were individually housed under standard conditions ( 21 1c ) with a 12:00 h/12:00 h light / dark cycle ( lights on from 08:00 a.m. to 08:00 p.m. ) .
the study was conducted in accordance with french legislation concerning the protection of animals used for experimental purposes .
all procedures were performed by scientists certified by the french ministry of agriculture ( license of first author number 92 - 254 ) . at the birth of their pups , mothers were subdivided into four groups ( n = 12 mothers for each group ) .
one group was contaminated using mineral drinking water supplemented with nu ( in its uranyl nitrate form ; from areva ) at a concentration of 1.5 mgl ( dose about 0.04 mgday per female rat ) .
a second group was contaminated using mineral drinking water supplemented with nu ( in its uranyl nitrate form ; from areva ) at a concentration of 10 mgl ( dose about 0.25 mgday per female rat ) .
a third group was contaminated with nu in drinking water at a concentration of 40 mgl ( dose about 1 mgday per female rat ) .
control mothers drank noncontaminated water ( fourth group ) . after weaning on postnatal day 21
, male pups were still exposed to nu via drinking water ( 1.5 , 10 , or 40 mgl ) until they reached 9 months of age .
female pups were also still exposed to nu via drinking water ( 40 mgl ) until they reached 9 months of age .
one male or female offspring per litter was assigned to behavioural tests ( n = 12 for each group ) .
health parameters , that is , body weight , water consumption , and food intake , were measured at the end of nu exposure ( at 9 months of age ) .
male or female pups ( n = 12 for each experimental group ) were submitted to behavioural evaluation tests at 9 months of age .
six days are necessary to perform all behavioural tests following this order . on the first and second days
, each animal was individually placed in an open field ( 45 45 cm ) and was monitored by an automated activity monitoring system ( bioseb , chaville , france ) .
lateral and horizontal movements were recorded over a 15 min session , only on the first day . on the third day when the rats were acclimated to the open field , they were tested in a two - object recognition task .
the animal was placed in the open field with two identical objects for 3 min ( first session ) . after a 1-hour delay
, the rat was returned to the open field and allowed to explore two objects , one identical to those presented at the first session ( familiar object ) and the other different ( novel object ) , for an additional 3 min period ( second session ) .
spatial working memory was assessed on the fourth day in a y - maze with three arms ( 70 cm long , 50 cm high , 10 cm wide at the bottom , and 20 cm wide at the top ) which converged at an equal angle .
each rat was placed at the centre of the maze and was allowed to move freely through the maze for a 10 min test session .
anxiety was assessed on day five in an elevated plus maze comprising a wooden cross at a height of 70 cm with two open ( 10 cm70 cm ) and two closed arms with walls ( 10 cm55 cm70 cm ) , arranged such that the arms of the same type were opposite to each other and connected by a common open central platform ( 5 cm5 cm ) . at the beginning of the session ,
the rat was placed at the centre of the maze always facing the same open arm .
standard spatiotemporal measures were recorded , including the number of entries in the open and closed arms and the cumulative time spent in the different parts of the maze ( open and closed arms ) .
an arm entry was recorded if all four of the animal 's paws were in the arm . between the testing of each animal
, the maze was cleaned with a 10% ethanol solution . the forced swimming test , which was the most stressful test , was performed last , on day 6 .
the rats were individually placed in a glass cylinder ( height of 60 cm and diameter of 40 cm ) , containing enough water such that the hind legs could not reach the bottom of the cylinder but the tail could .
the water was maintained at 2325c and the rats were left for 10 min .
immobility was measured during the last 5 min of the test ( the animal was judged to be immobile when it floated in an upright position and made only minimal movements to keep its head above water ) .
all the tests were recorded by a video camera and were read by an observer blind to the exposure conditions . at the end of behavioural tests ,
each animal was euthanised with isoflurane , placed prone on the stereotaxic instrument and the head of the rat was fixed in a holder .
a terminal csf sample was obtained by direct insertion of an insulin syringe needle ( myjector , 29 g 9 1/200 ) via the arachnoid membrane into the cisterna magna . for this purpose a skin incision was made followed by a horizontal incision in the descending part of the trapezius muscle to reveal the arachnoid membrane .
each sample was transferred into a polypropylene tube , immediately snap frozen in liquid nitrogen , and stored at 80c for further analysis .
previous experiments have shown that collecting up to 100 l using this technique and these conditions provides haemoglobin - free csf samples .
metabolomics analyses have been performed by criblage biologique marseille ( cribiom ) platform . for the analysis of csf , protein of 50 l
was removed by methanol precipitation using 200 l of cold methanol ( 20c ) followed by 5 min centrifugation at 14000 rpm .
the supernatant was recovered and filtered through 10 kda filters to remove all proteins .
the extracts were evaporated to dryness under a stream of nitrogen at room temperature and redissolved with 25 l of water / acetonitrile = 90/10 ( v / v ) . to check for data quality , a blank sample ( deionised water ) and a pool sample ( a mixture of all csf samples )
the samples were analysed on a dionex ultimate 3000 ( thermo fisher scientific , france ) coupled to a q - exactive plus mass spectrometer ( thermo fisher scientific , france ) .
the lc conditions were autosampler temperature , 4c ; column temperature , 40c ; solvent flow , 0.4 ml / min ( solvent a : water , 10 mm ammonium formate , 0.1% formic acid , and solvent b : acetonitrile , 10 mm ammonium formate , 0.1% formic acid ) ; and gradient , 5% b for 1 min , 550% b for 2 min , 5097% b for 6 min , 97% b for 2 min , 975% b for 1 min , and 5% b for 4 min ( running time , 16 min ) .
the ms conditions were as follows : acquisition mode , positive electrospray ionisation , and full scan 801000 m / z ; capillary voltage , 4.5 kv ; capillary temperature , 320c ; cone voltage , 55 v ; drying gas flow rate , 8 lmin .
multivariate statistical analyses were performed using simca - p+ ( version 12 , umetrics ) .
statistical models were validated by anova in the cross - validation mode , where p values less than 0.05 were considered significant .
the robustness of the models was assessed by calculating the explained variance values ( r2y ) and predicted variances ( q2y ) and by the decrease to negative values of the predicted variance after multiple permutations .
principal component analysis and partial least squares discriminant analysis ( pls - da ) were performed on the processed data in log 10[1 + 10e ] and scaled in pareto mode .
data quality and filtering was performed using appropriately tuned xcms and less stable features removal [ 14 , 25 ] .
to select the most discriminant variables , we found most appropriate to examine the clustering of features with the variable score values as calculated by hierarchical cluster analysis applied to wc loadings of the pls - da model .
the most discriminant mass features were tentatively annotated using mzeddb from the chemical formulas generated from the accurately measured masses ( accuracy < 5 ppm ) generated by the thermo xcalibur qual browser molecular formula engine .
the kegg compound i d of any hits was recorded , and all recorded ids were inserted into the kegg mapper ( http://www.genome.jp/kegg/tool/map_pathway2.html ) for tentative pathway identification .
samples ( cerebral cortex and csf ) were prepared by adding 8 ml of 70% ultrapure nitric acid and 2 ml of hydrogen peroxide .
samples were then mineralised using a 1000 w microwave ( ethos touch ; milestone microwave laboratory systems ; begamo , italy ) with a 20 min ramp to 180c , followed by 10 min at 180c .
the uranium content of samples was determined using an inductively coupled plasma mass spectrometer ( icpms - vgpq , excell , thermo electron corporation ) with bismuth ( 1 gl ) as internal standard . for uranium ,
values were expressed as nanograms per gram of fresh tissue or nanograms per l of csf and presented as mean sem . in all the experiments ,
data are expressed as mean sem and were analysed by two - way anova with the main factors of group and dose .
body weight was not significantly modified in rats exposed to 1.5 , 10 , or 40 mgl nu compared with the control group ( table 1 ) .
food intake was also not significantly changed in nu - exposed rats in comparison with control rats ( table 1 ) .
daily water consumption did not significantly change in rats exposed to 1.5 , 10 , or 40 mgl nu , when compared with control rats ( table 1 ) .
the locomotor and exploratory behaviours of rats were assessed by the total number of lines crossed and total number of rearings in the open field over 15 minutes .
the results for both parameters are depicted in figure 1 . in rats exposed to 1.5 , 10 , or 40 mgl nu , no significant effect on lines crossed or rearing
the medium - term memory of rats was assessed by the time spent exploring novel and familiar objects .
, all groups of animals spent the same overall time exploring the left and right objects ( figure 2(a ) ) .
but during the second session , control group rats spent significantly more time exploring the novel object than the familiar object ( 5.1 1.4 versus 2.3 0.4 s ) ( figure 2(b ) ) .
groups exposed to 1.5 , 10 , or 40 mgl nu did not prefer the novel object to the familiar object ( figure 2(b ) ) .
this indicated a loss of medium - term memory in rats exposed to nu without dose effect .
the spatial working memory capacities of rats were assessed by spontaneous alternation and number of arm visits , in the y - maze .
the percentage alternation was significantly higher than 50% , indicating that spatial memory was present for the four groups .
however , in rats exposed to 40 mgl nu , a significant decrease in the percentage of spontaneous alternation was observed in comparison with the control group ( 16% , p < 0.05 ) ( figure 3(b ) ) .
this decrease in alternation behaviour was not associated with changes of general locomotor activity , measured as the number of arm visits ( figure 3(a ) ) . for rats exposed to 1.5 or 10
mgl nu , no significant effect was found on the percentage alternation or on the number of visits to each arm , when compared with controls ( figure 3 ) .
the anxiety - like behaviour of rats was assessed by the time spent in the closed arms and the number of closed arm entries in the elevated plus maze .
rats exposed to 40 mgl nu spent significantly more time in the closed arms than did the controls ( 31% , p < 0.01 ) , the rats exposed to 1.5 mgl nu ( + 18% , p < 0.05 ) , and the rats exposed to 10 mgl nu ( + 18% , p < 0.05 ) ( figure 4(b ) ) .
their number of visits to the closed arms did not differ significantly from that of the other groups ( figure 4(a ) ) . for rats exposed to 1.5 or 10
mgl nu , no significant difference was observed in the time spent in or the number of visits to the closed arms compared with controls ( figure 4 ) .
the depressive - like behaviour of rats was assessed by the time they spent immobile during the 5 last minutes of the test .
the immobility time did not differ in rats exposed to 1.5 or 10 mgl nu in comparison with control rats ( figure 5 ) , but it increased significantly ( + 163% , p < 0.05 ) when rats were exposed to 40 mgl for 9 months ( figure 5 ) . as this parameter
is usually used to evaluate depressive - like behaviour , this result indicates that the depressive - like behaviour was not affected by exposure to 1.5 or 10 mgl nu but increased after 9 months of exposure to 40 mgl nu . the number of lines crossed during the open - field test and the number of closed arm entries in the elevated plus maze increased significantly ( + 26% , p < 0.05 and + 27% , p < 0.05 , resp . ) in females exposed to nu compared with controls ( figures 6(a1 ) and 6(c1 ) ) . the number of rearings during the open - field test , spontaneous alternation and the number of arm visits in the y - maze , the time spent in the closed arms of the elevated plus maze , and the immobility time during the forced swimming test were not significantly modified in female rats exposed to 40 mgl nu compared with control female rats ( figure 6 ) . during the object recognition test , exposed and controls groups spent significantly more time exploring the novel object than the familiar object ( figure 6(d ) ) .
the variables responsible for the discrimination between control rats and rats exposed to 40 mgl nu are shown in figure 7 . using principal component analysis , pls - da and hierarchical ascendant classification ,
a model was created with the 86 most discriminating variables from the initial 1244 detected csf analytical features .
this model was built on a single pls - da component and it was validated by permutation tests and cv - anova ( p = 3.91721e ) . from this model , we were able to observe and select the best discriminating variables of the 86 significant ones that discriminate control from exposed rats , for male , female , and both animals . when comparing males to females , from the top 18 control to nu discriminating variables , 7 were found exclusively related to female rats from control rats and 7 others to male rats .
four variables were common for female rats and male rats , corresponding to variables discriminating exposed rats versus control rats , regardless of gender ( figure 7 ) .
these 4 variables have been putatively identified as n2-succinyl - l - arginine , n4-acetylaminobutanoate , and n - methylsalsolinol , which decreased in nu - exposed rats compared to control rats , and butyric acid , which increased in nu - exposed rats ( table 2 ) .
this metabolomics analysis thus showed that some metabolites differed in the csf of male versus female and the nu - exposed versus control groups , whereas others were only specific of nu exposure , irrespective of gender .
uranium concentrations in the cortex of male rats exposed to 10 or 40 mgl nu were significantly increased ( resp .
, + 110% and + 218% ) in comparison with control rats ( table 1 ) .
no significant difference was observed between rats exposed to 1.5 mgl nu and control rats ( table 1 ) .
the concentration of uranium in csf increased significantly in male rats exposed to 40 mgl nu compared with control rats ( 19.7 6.0 ngl versus 8.1 2.5 ngl , p < 0.05 ) .
although there is an undeniable risk of radiological toxicity from orally ingested nu , the hazards of nu have been little investigated , especially after chronic exposure .
the primary objective of this experimental study was to obtain new data to shed light on the long - term central effects of nu chronically ingested through drinking water at environmental doses .
more specifically , we sought to obtain ( i ) a phenotypic brain signature associated with nu exposure and ( ii ) a comparison of the gender related response to nu to reveal any sexual dimorphism associated with exposure .
the strength of the present study lies in its combination of a wide range of uranium levels ( 1.5 to 40 mgl ) , a large panel of behavioural tests ( locomotor activity , memory , anxiety , and depression ) , and the use of a highly relevant , innovative , and sensitive metabolomics approach , which yields a metabolic fingerprint relevant to nu exposure .
body weight , food intake , and water consumption were evaluated as endpoints of the general toxicity of nu .
they were not significantly affected by nu exposure in our experimental conditions , which is in accordance with previous studies in adult rats chronically exposed to du [ 27 , 28 ] .
we observed no substantial brain weight loss or macroscopic brain tissue damage suggestive of deterioration in health status .
these results are not surprising since low doses of nu were used in the present study . to study the potential adverse effects of uranium on the neurobehaviour of rats chronically exposed to nu , we first investigated total activity .
the open - field procedure involves primary motor activity , evaluated by calculating the number of line crossings , and exploratory activity , evaluated by calculating the number of rearings on the hind limbs . in our experimental conditions , motor activity and exploratory activity were not significantly modified in male rats exposed to nu , regardless of the dose .
these results are in accordance with a report that there was no significant effect on motor / exploratory activity after 9-month exposure to 40 mgl du or 4%-eu in adult rats
. however , the opposite results , that is , hyperactivity or hypoactivity , in terms of line crossing and rearing or the distance travelled , have also been observed in rats exposed to du [ 2931 ] .
locomotor activity is closely related to the cholinergic system and exploratory rearing behaviour is evidently related to glutamatergic mechanisms .
it is also known that dopamine modulates glutamatergic inputs in the brain and that dopamine - excitatory amino acid interaction is involved in the locomotor behaviour .
verification is therefore needed where uranium - induced impairment of activity is mediated by changes in glutamatergic and dopaminergic neurotransmitters .
we also analysed the effects of nu on emotional behaviour using the forced swimming test , which is generally considered as an animal model of depression .
forced swimming data revealed that male rats that received the highest dose of nu showed increased susceptibility to depressive - like behaviour .
the results of the present study suggest also that exposure to 40 mgl nu significantly affects anxiety - like behaviour in the elevated plus maze test , one of the tests most frequently used in behavioural psychopharmacology to assess the potential anxiolytic properties of drugs .
this result is consistent with previous data demonstrating a significant effect on anxiety - like behaviour in rats exposed to 4%-eu or du since birth [ 27 , 37 ] .
monoamine transport systems might play a physiological role in the response to mood disorders induced by uranium . among them , oct2 , a member of the polyspecific organic cation transporter family , is expressed notably in the limbic system , is implicated in anxiety and depression - related behaviour , and could be a target of uranium .
data obtained with the y - maze test indicated that exposure of male rats to 40 mgl nu resulted in impairment of spatial working memory , as previously observed in adult rats exposed to 4%-eu for 9 months , but not in adult rats exposed to du for 9 months , suggesting that the percent of u plays a role . whatever the dose used in the present experimental study
these results suggest that sensitivity to nu may differ according to the kind of memory studied .
the hippocampus for working spatial memory and the hippocampus / entorhinal cortex for medium - term memory may be responsible for this differential sensitivity . our behavioural tests showed a strong gender effect , with changes more evidently in males than in females .
the single study to date of the involvement of sexual dimorphism in the effects of uranium on behaviour showed increased locomotor activity in male rats , but not females , after ingestion of du .
brain differences between males and females are a common phenomenon , since sexual differentiation in the brain takes place during a perinatal sensitive window as a result of gonadal steroid hormone - induced developmental organisation .
there is considerable evidence for the involvement of sex steroid hormones , such as oestrogen and androgen , in neurotransmitter systems and consequently in possible interactions with cognitive impairment .
a noael ( no - observed - adverse - effect level ) threshold , less than 1.5 mgl , may be suggested on the basis of these observed behavioural effects .
recently demonstrated that the brain is the organ most sensitive to chronic exposure by du ingestion .
it is becoming evident that uptake transporters are essential in mediating the entry of large numbers of xenobiotics into cells .
some transporters present at the blood - brain barrier , such as organic anion transporting polypeptide 1c1 ( oatp1c1 ) and monocarboxylate transporter 8 ( mct8 ) , may alter brain development , locomotion , or cognition .
this raises the question of their role after nu exposure and thus opens up new perspectives in studying the mechanisms of its toxicity .
the exact mechanisms underlying these neurotoxic effects of uranium have not yet been specifically addressed and are probably complex .
legrand et al . have demonstrated that some steps of neurogenesis , that is , cell proliferation and cell death , are disturbed during prenatal and postnatal brain development after du exposure .
these effects on neurogenesis could impair synaptic plasticity and might cause cognitive dysfunction in adulthood .
we used a ms - based metabolomics approach to reveal any metabolic disruption associated to nu exposure that we found highly suitable to reveal low - dose radionuclide contamination [ 13 , 14 ] .
the objective of this preliminary study was to use csf metabolomics to discriminate between groups of rats exposed or not to nu and to determine whether there is a difference between males and females .
we have shown here that some variables specifically discriminated either male and/or female rats exposed to nu from controls at the onset of behavioural deficits , whereas others were only nu specific , irrespective of gender . among these latter variables that discriminated exposed and nonexposed rats to nu ,
4 metabolites were putatively identified as n2-succinyl - l - arginine , n4-acetylaminobutanoate , n - methylsalsolinol , and butyrate .
this result demonstrates for the first time that nu has an effect on metabolism of csf .
for instance , the two first belong to the metabolic pathway of arginine and proline and n - methylsalsolinol is implicated on the balance impairment between dopamine and acetylcholine .
these results could be paralleled to studies using metabolomics as a diagnostic marker in neurodegenerative diseases and/or cognitive impairment .
butyric acid which can be found in csf ( database accession number hmdb00039 ) is also an end - product of ketone bodies metabolism ( kegg pathway map00650 ) , which are compounds used by brain for alternative energy production to glucose .
when injected in csf it has been associated with memory function as well as mood stabilization in rats . in conclusion
, our study demonstrates that the behavioural approach and the application of metabolomics are relevant in the field of low - doses radiation toxicology .
our finding is the first evaluation of the nu - induced health risk in the case of chronic environmental exposure .
it suggests that exposure to low - dose nu during development and adulthood can have an impact on behaviour and on the csf metabolome , highlighting an impact on the brain function and activity in our rat model .
the next question is to find out whether and how the changes in the csf metabolome are related to behavioural changes .
the goal now is to continue the identification of these metabolites in order to understand signalling pathways that could explain the behavioural observed effects . | natural uranium ( nu ) , a component of the earth 's crust , is not only a heavy metal but also an alpha particle emitter , with chemical and radiological toxicity .
populations may therefore be chronically exposed to nu through drinking water and food . since the central nervous system is known to be sensitive to pollutants during its development , we assessed the effects on the behaviour and the cerebrospinal fluid ( csf ) metabolome of rats exposed for 9 months from birth to nu via lactation and drinking water ( 1.5 , 10 , or 40 mgl1 for male rats and 40 mgl1 for female rats ) .
medium - term memory decreased in comparison to controls in male rats exposed to 1.5 , 10 , or 40 mgl1 nu . in male rats , spatial working memory and anxiety- and depressive - like behaviour were only altered by exposure to 40 mgl1 nu and any significant effect was observed on locomotor activity . in female rats exposed to nu , only locomotor activity
was significantly increased in comparison with controls .
lc - ms metabolomics of csf discriminated the fingerprints of the male and/or female nu - exposed and control groups .
this study suggests that exposure to environmental doses of nu from development to adulthood can have an impact on rat brain function . | 1. Introduction
2. Materials and Methods
3. Results
4. Discussion |
amphotericin b is commonly the treatment of choice in invasive fungal infections ( ifis ) .
clinicians may choose among amphotericin b deoxycholate ( conventional amphotericin b [ cab ] ) or a number of lipid - based formulations ( lf - amb ) , such as liposomal amphotericin b and amphotericin b lipid complex .
many factors influence the treatment decision , including the patient s current clinical condition and the potential to experience and/or tolerate adverse effects , cost of the drugs , and formulary specifications .
the indications for lf - amb , in part , include patients who are refractory to or intolerant of cab therapy.1,2 this potential for toxicity associated with cab including infusion - related reactions acutely , and nephrotoxicity associated with chronic use and the lower risks associated with lf - amb are well documented.310 however , in real world clinical practice , hospitals and/or physicians may reserve lf - amb for the sickest patients and chance administering cab to only the lower acuity patients perceived to be at low risk for adverse consequences.11 these underlying differences in patients clinical characteristics are likely to affect outcomes , potentially skewing the results of effectiveness research efforts .
few real - world data are available on the use of cab and lf - amb and associated outcomes among patients with conditions precluding the use of cab .
alvarez - lerma et al conducted a subanalysis on 49 critically ill patients with elevated serum creatinine ( greater than 1.5 mg / dl ) at initiation of treatment in an observational study of liposomal amb.12 there was minimal effect on renal function , though overall in - hospital mortality was 67.3% .
the aims of the current study were to examine the use and outcome of cab and lf - amb therapies in patients with known renal disease or other potential contraindications to cab and to determine factors associated with lf - amb initiation vs ( versus ) cab , using a large , multicenter database .
this was a retrospective cohort study using data collected from hospitals in the health facts electronic health record ( ehr ) database ( cerner corporation , kansas city , mo , usa ) .
cerner corporation develops , implements , and supports ehr software for hospitals and health systems globally .
us - based institutions using cerner s comprehensive suite of solutions can opt to contribute their ehr data to a database for use in research and quality improvement initiatives .
health facts contains a comprehensive clinical record for each encounter and includes pharmacy , clinical and microbiology laboratory , admission , and billing information from affiliated patient care locations .
clinical information is date- and time - stamped , providing a temporal relationship between clinical information relating to the drugs dispensed and the results of diagnostic laboratory testing .
cerner corporation has established health insurance portability and accountability act - compliant operating policies to establish deidentification for health facts .
patients were selected if they were hospitalized between january 2001 and june 2010 , aged 18 years or older upon admission and had orders for lf - amb or for cab on 2 or more calendar days .
additional requirements to capture patients with conditions that may constitute a relative contraindication to the use of cab were the presence of at least one of the following : evidence of renal insufficiency or other conditions and characteristics such as a history of organ transplant or advanced age ( appendix a ) , exposure to nephrotoxic agents during the index encounter ( appendix b ) , or cab exposure within 90 days prior to the admission date ( suggesting a cab - refractory infection ) . finally evidence of infection with aspergillus , candida , and/or cryptococcus during the index encounter or within 90 days prior to the index encounter was required as indicated by a positive blood culture and/or relevant international classification of diseases , ninth revision , clinical modification ( icd-9-cm ) codes as a discharge diagnosis . for patients with multiple eligible encounters in health facts ,
all patients had exposure to amphotericin b. the two study groups were defined by having a first amphotericin b order for cab or for lf - amb and were required to have an active order for this first formulation on at least 2 calendar days .
patients could have subsequent orders for the alternate amphotericin b formulation or for other antifungal agents .
patient clinical characteristics and comorbidities of interest were derived from administrative ( eg , icd-9-cm codes ) and clinical ( eg , pharmacy , laboratory ) records of encounters within the previous 12 months , including the current encounter . the diagnosis - related group ( drg ) classified the patient as surgical or medical .
evidence of impaired immune function comprised medications ( eg , systemic corticosteroids , chemotherapy ) and discharge diagnoses ( eg , autoimmune diseases , certain malignancies ) .
organ dysfunction was identified within a 48-hour window surrounding the time of admission using measures modeled after and intended to equate to a sepsis - related organ failure assessment score 2.13 critical care exposure was defined as having two or more orders from an intensive care unit 12 or more hours apart , mechanical ventilation , or orders for vasopressors . to determine the predictors most strongly associated with initial exposure to lf - amb vs cab
, we used a multilevel ( ie , hierarchical ) mixed - effects logistic regression model structure with random intercepts at the hospital level to allow for the fact that the choice of drugs given to patients within each hospital ( but not between hospitals ) may not be independent ( eg , influenced by hospital formulary).14 to avoid including potential complications of amphotericin b use , we limited the candidate variables to chronic comorbidities and events that occurred prior to amphotericin b initiation .
the final model was chosen based on a stepwise bootstrapping procedure15 combined with an analysis of the bayesian information criterion among nested models.16 the influence of hospital on treatment choice was assessed using a likelihood ratio test for the significance of random intercepts .
outcomes of interest were length of stay ( los ) following the first order for amphotericin b ( post - amphotericin b los ) among survivors , and in - hospital mortality .
bivariate differences by amphotericin b type were assessed with either a chi - square test or a t - test , with p values < 0.05 being considered statistically significant .
a logistic regression model that adjusted for serial correlation at the hospital level was used to generate a propensity score with the outcome of initiation on cab vs lf - amb .
namely , patient demographics , comorbid conditions , encounter events , microbiology results , laboratory values prior to initiation of amphotericin b , and pre - amphotericin b los were included in the propensity score .
variables that showed colinearity were removed ( and this was only true for hepatic organ dysfunction , which was collinear with laboratory measures of bilirubin or aspartate aminotransferase ) .
baseline total bilirubin and aspartate aminotransferase were defined as binary variables ( normal vs abnormal ) and missing values in these variables were assumed to be normal .
for the small number of patients with missing values for mechanical ventilation ( 7.9% ) or organ dysfunction ( 1.2% ) , ventilation or organ dysfunction was also assumed to be absent . for baseline serum creatinine ,
a univariate imputation sampling method was used which predicted missing values based on all other predictor variables used in the propensity score .
the primary matching algorithm was kernel matching , a one - to - many approach in which patients with smaller propensity score differences were weighted more heavily in deriving matched estimates .
two sensitivity analyses were then done.17 the first used the propensity scores based only on predictors that entered the model with a p value < 0.25 after a stepwise regression procedure . in the second sensitivity analysis ,
a 5:1 greedy matching algorithm was applied to the non - parse- and stepwise - regression - based propensity scores . to explore which categories of variables most explained differences in mortality between the cab and lf - amb initiator groups , we created a series of multilevel ( ie , hierarchical ) mixed - effects logistic regression models of increasing size .
namely , the variable order was demographics , chronic comorbidities , surgical vs medical drg , laboratory values , and finally clinical variables indicating acuity . for each model
, we present the odds ratio ( or ) related to treatment choice ( lf - amb vs cab ) and its adjusted p value with 95% confidence intervals ( cis ) .
this was a retrospective cohort study using data collected from hospitals in the health facts electronic health record ( ehr ) database ( cerner corporation , kansas city , mo , usa ) .
cerner corporation develops , implements , and supports ehr software for hospitals and health systems globally .
us - based institutions using cerner s comprehensive suite of solutions can opt to contribute their ehr data to a database for use in research and quality improvement initiatives .
health facts contains a comprehensive clinical record for each encounter and includes pharmacy , clinical and microbiology laboratory , admission , and billing information from affiliated patient care locations .
clinical information is date- and time - stamped , providing a temporal relationship between clinical information relating to the drugs dispensed and the results of diagnostic laboratory testing .
cerner corporation has established health insurance portability and accountability act - compliant operating policies to establish deidentification for health facts .
patients were selected if they were hospitalized between january 2001 and june 2010 , aged 18 years or older upon admission and had orders for lf - amb or for cab on 2 or more calendar days .
additional requirements to capture patients with conditions that may constitute a relative contraindication to the use of cab were the presence of at least one of the following : evidence of renal insufficiency or other conditions and characteristics such as a history of organ transplant or advanced age ( appendix a ) , exposure to nephrotoxic agents during the index encounter ( appendix b ) , or cab exposure within 90 days prior to the admission date ( suggesting a cab - refractory infection )
. finally evidence of infection with aspergillus , candida , and/or cryptococcus during the index encounter or within 90 days prior to the index encounter was required as indicated by a positive blood culture and/or relevant international classification of diseases , ninth revision , clinical modification ( icd-9-cm ) codes as a discharge diagnosis . for patients with multiple eligible encounters in health facts ,
all patients had exposure to amphotericin b. the two study groups were defined by having a first amphotericin b order for cab or for lf - amb and were required to have an active order for this first formulation on at least 2 calendar days .
patients could have subsequent orders for the alternate amphotericin b formulation or for other antifungal agents .
patient clinical characteristics and comorbidities of interest were derived from administrative ( eg , icd-9-cm codes ) and clinical ( eg , pharmacy , laboratory ) records of encounters within the previous 12 months , including the current encounter . the diagnosis - related group ( drg ) classified the patient as surgical or medical .
evidence of impaired immune function comprised medications ( eg , systemic corticosteroids , chemotherapy ) and discharge diagnoses ( eg , autoimmune diseases , certain malignancies ) .
organ dysfunction was identified within a 48-hour window surrounding the time of admission using measures modeled after and intended to equate to a sepsis - related organ failure assessment score 2.13 critical care exposure was defined as having two or more orders from an intensive care unit 12 or more hours apart , mechanical ventilation , or orders for vasopressors .
to determine the predictors most strongly associated with initial exposure to lf - amb vs cab , we used a multilevel ( ie , hierarchical ) mixed - effects logistic regression model structure with random intercepts at the hospital level to allow for the fact that the choice of drugs given to patients within each hospital ( but not between hospitals ) may not be independent ( eg , influenced by hospital formulary).14 to avoid including potential complications of amphotericin b use , we limited the candidate variables to chronic comorbidities and events that occurred prior to amphotericin b initiation .
the final model was chosen based on a stepwise bootstrapping procedure15 combined with an analysis of the bayesian information criterion among nested models.16 the influence of hospital on treatment choice was assessed using a likelihood ratio test for the significance of random intercepts .
outcomes of interest were length of stay ( los ) following the first order for amphotericin b ( post - amphotericin b los ) among survivors , and in - hospital mortality .
bivariate differences by amphotericin b type were assessed with either a chi - square test or a t - test , with p values < 0.05 being considered statistically significant . the primary analysis was performed using propensity score matching .
a logistic regression model that adjusted for serial correlation at the hospital level was used to generate a propensity score with the outcome of initiation on cab vs lf - amb .
namely , patient demographics , comorbid conditions , encounter events , microbiology results , laboratory values prior to initiation of amphotericin b , and pre - amphotericin b los were included in the propensity score .
variables that showed colinearity were removed ( and this was only true for hepatic organ dysfunction , which was collinear with laboratory measures of bilirubin or aspartate aminotransferase ) .
baseline total bilirubin and aspartate aminotransferase were defined as binary variables ( normal vs abnormal ) and missing values in these variables were assumed to be normal . for the small number of patients with missing values for mechanical ventilation ( 7.9% ) or organ dysfunction ( 1.2% ) , ventilation or organ dysfunction was also assumed to be absent . for baseline serum creatinine ,
a univariate imputation sampling method was used which predicted missing values based on all other predictor variables used in the propensity score .
the primary matching algorithm was kernel matching , a one - to - many approach in which patients with smaller propensity score differences were weighted more heavily in deriving matched estimates .
two sensitivity analyses were then done.17 the first used the propensity scores based only on predictors that entered the model with a p value < 0.25 after a stepwise regression procedure . in the second sensitivity analysis ,
a 5:1 greedy matching algorithm was applied to the non - parse- and stepwise - regression - based propensity scores .
to explore which categories of variables most explained differences in mortality between the cab and lf - amb initiator groups , we created a series of multilevel ( ie , hierarchical ) mixed - effects logistic regression models of increasing size .
namely , the variable order was demographics , chronic comorbidities , surgical vs medical drg , laboratory values , and finally clinical variables indicating acuity .
for each model , we present the odds ratio ( or ) related to treatment choice ( lf - amb vs cab ) and its adjusted p value with 95% confidence intervals ( cis ) .
a total of 655 patients from 53 hospitals were identified ; 333 patients first amphotericin b order was for lf - amb and 322 were initiated on cab . of these ,
81% and 70% , respectively , also received another systemic antifungal agent during their hospitalization .
fifty - three percent of patients were identified during the first half of the study period .
clinically , the cohorts were heterogeneous : lf - amb patients were younger and more likely to be male , and had greater underlying disease severity ( table 1 ) .
mean charlson comorbidity index score was higher among lf - amb initiators , as was the frequency of several individual comorbidities : hematologic malignancy , solid tumor , human immunodeficiency syndrome or acquired immunodeficiency syndrome , and history of solid organ transplant .
lf - amb patients were far more likely to have any evidence of impaired immune function . during the hospital encounter itself , multiple measures of patient acuity were more common among lf - amb initiators : organ dysfunction upon admission , bacteremia , diagnosis of sepsis , critical care use , and use of systemic corticosteroids or chemotherapy .
more cab initiators had an icd-9-cm discharge diagnosis of candidiasis during the encounter , while more lf - amb patients were diagnosed with aspergillosis .
cab initiators were more likely to have a history of diabetes , hypertension , or heart failure and to have higher mean baseline serum creatinine values .
we found several clinical factors that were significantly associated with starting lf - amb rather than cab ( table 2 ) .
patients with critical care exposure prior to amphotericin b , impaired immune function , liver dysfunction upon admission , or aplastic anemia / pancytopenia were more likely to be started on lf - amb .
diabetes , cryptococcosis , candidiasis , and history of stem cell transplant were associated with starting on cab .
the specific hospital had a strong influence , perhaps driven by formulary guidelines , on the choice of amphotericin b formulation , as allowing each hospital to have its own intercept significantly improved model fit ( p < 0.001 ) .
crude analysis of in - hospital mortality favored initiation of cab , with an or of 1.53 for initiating lf - amb ( p = 0.02 ) ( table 3 ) . among survivors ,
the observed pointestimate of post - amphotericin b los was nonsignificantly shorter in the cab group ( difference in los = 2.5 days shorter for cab group , 95% ci : 6.11.1 ; p = 0.17 ) .
the primary propensity score model and the less parse , secondary model based on stepwise regression both exhibited good calibration ( hosmer lemeshow statistics were either borderline significant [ p = 0.03 ] for the primary model or nonsignificant [ p = 0.16 ] for the stepwise model ) .
the mean propensity scores for the cab and lf - amb groups were 0.35 and 0.66 , respectively . while not a goal of the propensity score modeling , we did observe relatively strong discrimination ( high area under the receiver - operating characteristic curve values ) of 0.83 and 0.82 for the primary and secondary models , respectively . matching on the propensity to receive lf - amb eliminated the significant differences in odds of mortality ( or = 1.05 , 95% ci : 0.621.77 ; p = 0.85 ) and reversed the directionality of observed differences in post - amphotericin b los ( difference in los = 2.6 days longer in the cab group , 95% ci : 2.67.9 ; p = 0.32 ) .
sensitivity analyses using the secondary propensity score based on stepwise regression and the alternative matching procedure based on greedy matching produced similar findings ( results not shown ) . sequentially adding covariates into our models for hospital mortality explained the effect of initial treatment ( table 4 ) .
addition of variables for demographics and baseline clinical status to the models had little impact , but addition of acuity variables eliminated differences in the odds of mortality across the treatment groups .
a total of 655 patients from 53 hospitals were identified ; 333 patients first amphotericin b order was for lf - amb and 322 were initiated on cab . of these ,
81% and 70% , respectively , also received another systemic antifungal agent during their hospitalization .
fifty - three percent of patients were identified during the first half of the study period .
clinically , the cohorts were heterogeneous : lf - amb patients were younger and more likely to be male , and had greater underlying disease severity ( table 1 ) .
mean charlson comorbidity index score was higher among lf - amb initiators , as was the frequency of several individual comorbidities : hematologic malignancy , solid tumor , human immunodeficiency syndrome or acquired immunodeficiency syndrome , and history of solid organ transplant .
lf - amb patients were far more likely to have any evidence of impaired immune function . during the hospital encounter itself , multiple measures of patient acuity were more common among lf - amb initiators : organ dysfunction upon admission , bacteremia , diagnosis of sepsis , critical care use , and use of systemic corticosteroids or chemotherapy .
more cab initiators had an icd-9-cm discharge diagnosis of candidiasis during the encounter , while more lf - amb patients were diagnosed with aspergillosis .
cab initiators were more likely to have a history of diabetes , hypertension , or heart failure and to have higher mean baseline serum creatinine values .
we found several clinical factors that were significantly associated with starting lf - amb rather than cab ( table 2 ) .
patients with critical care exposure prior to amphotericin b , impaired immune function , liver dysfunction upon admission , or aplastic anemia / pancytopenia were more likely to be started on lf - amb .
diabetes , cryptococcosis , candidiasis , and history of stem cell transplant were associated with starting on cab .
the specific hospital had a strong influence , perhaps driven by formulary guidelines , on the choice of amphotericin b formulation , as allowing each hospital to have its own intercept significantly improved model fit ( p < 0.001 ) .
crude analysis of in - hospital mortality favored initiation of cab , with an or of 1.53 for initiating lf - amb ( p = 0.02 ) ( table 3 ) . among survivors ,
the observed pointestimate of post - amphotericin b los was nonsignificantly shorter in the cab group ( difference in los = 2.5 days shorter for cab group , 95% ci : 6.11.1 ; p = 0.17 ) .
the primary propensity score model and the less parse , secondary model based on stepwise regression both exhibited good calibration ( hosmer lemeshow statistics were either borderline significant [ p = 0.03 ] for the primary model or nonsignificant [ p = 0.16 ] for the stepwise model ) .
the mean propensity scores for the cab and lf - amb groups were 0.35 and 0.66 , respectively . while not a goal of the propensity score modeling , we did observe relatively strong discrimination ( high area under the receiver - operating characteristic curve values ) of 0.83 and 0.82 for the primary and secondary models , respectively . matching on the propensity to receive lf - amb eliminated the significant differences in odds of mortality ( or = 1.05 , 95% ci : 0.621.77 ; p = 0.85 ) and reversed the directionality of observed differences in post - amphotericin b los ( difference in los = 2.6 days longer in the cab group , 95% ci : 2.67.9 ; p = 0.32 ) .
sensitivity analyses using the secondary propensity score based on stepwise regression and the alternative matching procedure based on greedy matching produced similar findings ( results not shown ) .
sequentially adding covariates into our models for hospital mortality explained the effect of initial treatment ( table 4 ) .
addition of variables for demographics and baseline clinical status to the models had little impact , but addition of acuity variables eliminated differences in the odds of mortality across the treatment groups .
to our knowledge , this is the first study to use real - world data to compare los and mortality in patients with ifis initiated on cab vs lf - amb with clinical conditions warranting the use of lf - amb . in evaluating 10 years of data on hospitalized patients with ifis and evidence of renal impairment or other comorbidities or exposures that might put them at risk for cab - associated toxicity
when physicians believe amphotericin b treatment is needed for patients with serious fungal infections , they have a choice between cab and lf - amb .
the risk of nephrotoxicity associated with cab is well documented,4,18 and thus , particularly in patients with renal compromise or otherwise at risk for toxic effects , lf - amb may be more appropriate.19,20 preliminary descriptive analysis demonstrated that patients initiated on lf - amb were generally sicker than those initiated on cab .
the multivariate model predicting lf - amb initiation ( vs cab ) extended this , and showed that critical care exposure and impaired immune function both doubled the odds of receiving lf - amb .
based on the inclusion criteria ( eg , history of kidney disease ) , all patients in the study were at risk for adverse effects of cab .
absent these restrictions , we would have expected to see even more pronounced differences between the treatment groups , with greater acuity and comorbidity burden particularly related to renal disease among lf - amb patients .
we observed no clear trend toward certain types of variables ( eg , higher baseline serum creatinine or a diagnosis of end - stage renal disease ) being associated with lf - amb .
most striking was the clustering of amphotericin b formulation by hospital , which may indicate that formulary requirements or other institutional practices are important drivers of amphotericin b choice .
this implies that the clinical drivers of choice were very powerful to have emerged in the setting of apparently common administrative constraints .
as many of the patients included here were from early in the study period , further research should examine trends in choice of formulation over time .
raw hospital mortality was significantly higher and observed post - amphotericin b los nonsignificantly longer among patients initiated on lf - amb prior to adjustment .
absent further analysis , a nave interpretation would be that lf - amb was inferior , with increased mortality potentially due to toxicity or to limited effectiveness in treating the fungal infection .
propensity score matching eliminated the differences in both acuity and effect , indicating that outcomes were driven by factors affecting choice of therapy .
this was confirmed by the nested model exercise , which demonstrated that acuity variables accounted for the differences in mortality between the groups .
these findings suggest that , contrary to the impression given by nave analyses , the real - world effectiveness of the treatments is consistent with that found in randomized clinical trials.9,2124 a strength of our analysis is that our ehr - based data source includes clinical characteristics that are not available in administrative claims - based data , such as laboratory results .
we attempted to minimize confounding in our multivariate adjustment by including numerous demographic characteristics , comorbidities , and encounter events in the propensity score and regression models .
, we did not collect data on anti - fungal exposure subsequent to the amphotericin b orders , which may have provided further insight into patients course of illness and , indirectly , severity of the fungal infection .
future analyses should investigate use of additional antifungals to better understand treatment sequencing and duration following initiation of amphotericin b. information on specific institutional formulary policies would have been useful in controlling for a patient s potential to be treated with cab vs lf - amb , but was not available in health facts at the time this study was conducted . however , we observed in our analyses that a given hospital influenced its patients starting formulations , and accounted for this in our outcomes analysis .
in an ehr database of patients with ifis and contraindications to use of cab , clinical factors appeared to drive therapeutic decisions regarding initiation of lf - amb or cab .
real - world outcomes may initially appear to contradict what has been demonstrated in clinical trials .
proper adjustment for underlying patient acuity is needed to accurately estimate comparative effectiveness between cab and lf - amb . | backgroundlipid - based formulations of amphotericin b ( lf - amb ) are indicated for treatment of invasive fungal infections in patients intolerant to conventional amphotericin b ( cab ) or with refractory infections .
physicians still may choose to administer cab to such patients .
we described the use of cab and lf - amb in this population and quantified differences in post - amphotericin b length of stay ( los ) among survivors and hospital mortality in matched patients.methodsdata were extracted from health facts ( cerner corporation , kansas city , mo , usa ) for a retrospective cohort analysis .
inpatients aged 18 years with evidence of fungal infection and with orders for lf - amb or cab on 2 days from january 2001 to june 2010 were identified .
patients were required to have renal insufficiency or other relative contraindications to use of cab , exposure to nephrotoxic agents , or evidence of a cab - refractory infection .
multilevel ( hierarchical ) mixed - effects logistic regression was used to determine factors associated with initial exposure to lf - amb versus cab .
multivariate adjustment of outcomes was done using propensity score matching.results655 patients were identified : 322 patients initiated therapy with cab and 333 initiated treatment with lf - amb . compared to those initiating cab , patients initiating lf - amb had greater acuity and underlying disease severity . in unadjusted analyses ,
hospital mortality was significantly higher in the lf - amb group ( 32.2% versus 23.7% ; p = 0.02 ) . after propensity score matching and covariate adjustment , mortality equalized and observed differences in los after amphotericin b initiation decreased.conclusionamong patients at risk for amphotericin b toxicity , differences between cab and lf - amb seen in crude outcomes analyses relate to channeling of sicker patients to initiate treatment with lf - amb . failing to account for differences among patients that drive clinical decision - making will result in inaccurate conclusions about the real - world effectiveness of different amphotericin b formulations . | Introduction and objectives
Methods
Study design and data source
Population selection
Study group definitions and other measures
Predicting initial exposure
Outcomes analysis
Nested variable analysis of mortality
Results
Patient and clinical characteristics
Predictors of LF-AMB initiation
Outcomes
Nested model analysis
Discussion
Conclusion |
a disintegrin and metalloproteinase with thrombospondin motifs ( adamts ) family consists of a precisely ordered modular organization that includes at least one thrombospondin type i repeat .
this family is thought to be comprised of a zinc - dependent group of proteases , which play vital roles in a variety of normal and pathological conditions [ 27 ] .
the adamts family has grown to include 19 members , which are involved in a plethora of diseases ranging from arthritis to coagulation disorders [ 1 , 919 ] .
the adamts family is divided into four subgroups based on their structural and functional similarities [ 8 , 2022 ] .
adamts-17 and -19 , adamts-16 and -18 , adamts-7 and -12 , and adamts-6 and -10 compose the structurally related adamts pairs division .
it has been well established that the adamts-12 gene is expressed in the musculoskeletal system ( skeletal muscles , cartilage , and tendons ) and in the fetal lung [ 1 , 23 , 24 ]
for instance , adamts-12 has been proven to be associated with the pathogenesis of arthritis [ 816 ] , intervertebral disc degeneration [ 25 , 26 ] , inflammation [ 27 , 28 ] , and invasion and metastasis of tumor [ 2931 ] .
although adamts-7 and -12 share similar structure and domain organization , adamts-7 and -12 may have different pathological effects or be responsible for different phases in a disease [ 26 , 32 ] .
for instance , adamts-7 mrna is found to be significantly increased in the cartilage of patients with rheumatoid arthritis ( ra ) and only slightly increased in the cartilage of patients with osteoarthritis ( oa ) , whereas adamts-12 mrna is significantly increased in both oa and ra cartilage [ 10 , 32 ] .
moreover , in intervertebral disc degenerative ( ivd ) rat model , the level of adamts-7 was significantly increased in the early phase while the level of adamts-12 was increased in the latter phase . in this review
, we will discuss the structure and perspective of adamts-12 and focus on its roles and the underlying mechanisms in arthritis ( especially osteoarthritis ) and other diseases , including inflammation , tumorigenesis and antiangiogenesis , intervertebral disc degenerative disease , schizophrenia , gonad differentiation , trophoblast invasion , and pediatric stroke ( figure 1 ) .
in addition , we used adamts12 and adamts-12 as keywords to search articles through pubmed , google scholar , and web of science .
the structure of adamts-12 includes a signal peptide , a prodomain , a catalytic domain , a disintegrin - like domain , a central thrombospondin i ( ts ) repeat , a cysteine - rich domain , two spacer regions , and c - terminal tsp - like repeat region ( figure 2 ) [ 33 , 34 ] .
it was believed that the c - terminal tail of adamts-12 might be important for the ability of adamts-12 binding to the components of extracellular matrix ( ecm ) .
indeed , it was found that the four tsp - like repeat regions of adamts-12 directly bound to the egf - like domain of cartilage oligomeric matrix protein ( comp ) .
it was also reported that the c - terminal four tsp - like repeat inhibited chondrocyte differentiation . to determine the effects of each functional domain of adamts-12 on chondrocyte differentiation , numerous deleted mutants were generated , such as the removal of c - terminal four thrombospondin motifs known to bind comp , the removal of a spacer-2 domain , the deletion of three thrombospondin motifs , and the deletion of a spacer-1 domain .
all of the above mentioned deletions did not change the cell surface localization of the protein in chondrocytes .
however , the deletion of the cysteine - rich domain released the enzyme from cell surface into the medium .
these data indicated that the cysteine - rich domain of adamts-12 was required for its binding to ecm and cell surface appearance in chondrocytes .
in addition , the antiangiogenesis properties of adamts-12 did not rely on the catalytic domain , but , more likely , on its tsp-1 domains .
in contrast , the catalytic activity was implicated in the protective effect against allergen - induced inflammation .
arthritis is the leading cause of physical disability , health care usage , and impaired quality of life [ 3638 ] .
the impact of arthritic conditions is expected to grow as the elderly population increases in the coming decades [ 39 , 40 ] .
osteoarthritis ( oa ) and rheumatoid arthritis ( ra ) are the most common categories of arthritis [ 8 , 4143 ] .
oa is associated with age - related loss of homeostatic balance between degradation and repair mechanisms in articular cartilage , which is characterized by synovitis , cartilage degeneration , and osteophyte formation [ 4447 ] .
oa is a multifactorial disorder which can be affected by genetic alternation , inflammation , mechanical stress , obesity , and aging as well as biochemical , molecular , and enzymatic factors [ 4851 ] .
ra is a chronic systemic inflammatory disease that is characterized by the inflammatory proliferation of synovial tissues , leading to cartilage and bone damage and eventual disability [ 5254 ] .
both genetic and environmental factors , as well as aberrant immune responses , play a key role in the pathogenesis of ra [ 55 , 56 ] .
the dysregulation in both oa and ra induces senescence , differentiation , proliferation , and cell death in joint cells through gene and/or protein expression networks that switch from anabolic to catabolic outcomes .
recent evidence has demonstrated the significance of proteases , in the pathological processes of arthritis [ 5759 ] .
the destruction of the extracellular matrix of articular cartilage and bone in arthritic joints is thought to be mediated by excessive proteolytic activity . in accordance with this concept , recent studies show that adamts-12 also plays a critical role in the pathological process of arthritis [ 8 , 32 , 35 , 43 , 61 ] .
osteoarthritis is an age - related or posttraumatic degenerative disease of the joint that is characterized by loss of articular cartilage , chondrocyte proliferation and hypertrophic differentiation , subchondral bone remodeling , inflammation , and finally osteophyte formation [ 62 , 63 ] .
there is a strong relevance between cartilage degradation and osteoarthritis [ 6466 ] . in that case ,
anything that can affect cartilage may play a role in the initiation and progression of osteoarthritis .
the finding that adamts-12 was isolated as a binding metalloproteinase of comp , an extracellular matrix highly expressed in cartilage [ 8 , 32 , 6771 ] , promoted us to determine the role of adamts-12 in cartilage development and degeneration .
it was reported that adamts-12 , functioning as a downstream molecule of parathyroid hormone related peptide ( pthrp ) signaling , negatively regulated chondrogenesis .
adamts-12 was prominently expressed in proliferating and prehypertrophic chondrocytes within the wild - type embryonic growth plate , whereas adamts-12 was hardly detected in pthrp(/ ) embryos .
in addition , within the adamts-12 overexpressing cells , the expressions of both early ( collagen ii and sox9 ) and late ( collagen x ) marker genes for chondrogenesis were all repressed .
furthermore , pthrp signaling was nearly abolished when adamts-12 was repressed , and pthrp action was largely restored when adamts-12 was reexpressed .
notably , the negative regulation of chondrocyte differentiation by adamts-12 depended on its enzymatic activity since its point mutant lacking enzymatic activity completely lost this activity .
the expression of adamts-12 in the course of chondrogenesis was regulated by c - maf transcription factor .
c - maf , the cellular homologue of the avian viral oncogene c - maf , was a member of the basic leucine zipper ( bzip ) superfamily [ 7375 ] .
c - maf proteins bind to a specific dna sequences termed the maf recognition element ( mare ) through the basic dna recognition domain .
in addition , c - maf was overexpressed during embryonic development and postnatal growth in hypertrophic chondrocytes as well as in the osteoarthritic chondrocytes , which was similar to the expression pattern of that of adamts-12 [ 7375 ] .
furthermore , c - maf transcriptional factor directly binds to the proximal mare sequences of adamts-12 at position -61 in vitro .
interestingly , adamts-12 was found to function as the downstream target of parathyroid hormone - like hormone / parathyroid hormone related peptide ( pthlh / pthrp ) in chondrocytes , and both pthlh and adamts-12 were all downregulated along with impaired chondrogenic differentiation within brachydactyly type e ( bde ) .
bde is an autosomal - dominant disease characterized by bilateral manifestation of shortened metacarpals , metatarsals , and/or phalanges [ 7880 ] .
additionally , pthlh and both of its targets , adamts-7 and -12 , were downregulated in the fibroblasts of bde patients .
furthermore , the expressions of chondrogenic markers ( aggrecan , collagen ii , collagen x , and indian hedgehog ( ihh ) ) in chondrogenically differentiated bde were all significantly altered .
collectively , adamts-12 , whose expression was regulated by c - maf transcription factor , acted as a downstream molecule of pthrp signaling , negatively regulated chondrocyte differentiation , and hypertrophy ( figure 3 ) .
in addition , proper expression of adamts-12 is required for normal cartilage development and its dysregulation may lead to pathologies with defects in the musculoskeletal system , such as bde .
abnormal level and/or function of adamts-12 may induce dysregulation of cartilage , which finally leads to arthritis .
adamts-12 's involvements in osteoarthritis is most probably due to its association and degradation of cartilage oligomeric matrix protein ( comp ) [ 1 , 8 , 32 , 6771 ] .
comp , a prominent noncollagenous component of cartilage , accounts for approximately 1% of the wet weight of the tissue .
the function of comp may be involved in stabilizing cartilage ecm via specific interactions with matrix components such as collagen types ii and ix , aggrecan , and fibronectin [ 8183 ] .
comp also has a role in mediating chondrocyte attachment via an integrin receptor [ 8487 ] .
it was reported that mutations in the type iii or c - terminal globular domain of the human comp gene have been linked to the development of pseudoachondroplasia and multiple epiphyseal dysplasia , which were autosomal - dominant forms of short - limb dwarfism [ 88 , 89 ] .
comp fragments have been detected in the diseased cartilage , synovial fluid , and serum of patients with knee injuries .
the level of adamts-12 was significantly increased in the cartilage and synovium of patients with ra or oa [ 9 , 10 ] .
both the in vitro glutathione s - transferase ( gst ) pull - down assay and coimmunoprecipitation assay demonstrated that adamts-12 could bind to comp directly .
importantly , the size of comp fragments generated by adamts-12 was similar to those of comp - degraded fragments seen in arthritic patients .
in addition , antibodies against adamts-12 dramatically inhibited tumor necrosis factor - induced ( tnf - induced ) and interleukin-1-induced ( il-1-induced ) comp degradation in cartilage explants .
suppression of adamts-12 expression using the small interfering rna silencing approach in human chondrocytes also markedly prevented comp degradation .
in addition , adamts-7 and -12 were colocalized with comp both in the cytoplasm and on the surface of human chondrocytes [ 25 , 35 ] .
while adamts-7 was unable to digest aggrecan , adamts-12 , with a similar structure , did have the ability to digest aggrecan .
it was reported that alpha-2-macroglobulin ( 2 m ) acted as a substrate for both adamts-7 and adamts-12 and efficiently protected comp degradation by these enzymes by in vitro digestion assays .
in addition , granulin - epithelin precursor ( gep , a newly identified chondrogenic growth factor , which was also known as proepithelin , acrogranin , progranulin ( pgrn ) , and gp88/pc cell - derived growth factor ) inhibited the action of adamts-12 preventing comp degradation via two distinct mechanisms [ 61 , 9297 ] . in detail , gep inhibits the induction of adamts-12 by inflammatory cytokines such as tnf- and gep is able to disrupt the association between adamts-12 and comp via a direct protein - to - protein interaction [ 8 , 61 ] .
it was approved that adamts-12 , comp , aggrecan , gep , 2 m , and tnf- constitute an interplay and interaction network in mediating cartilage degradation in arthritis ( figure 4 ) .
tnf- upregulates adamts-12 leading to the degradation of comp [ 43 , 98 , 99 ] .
in addition , tgf- was reported to significantly induce the adamts-12 in human fetal fibroblasts .
this in vitro data provide insight into the critical role of adamts-12 in the initiation and progression of osteoarthritis which needs to be further confirmed using in vivo genetically modified animal models .
interestingly , such in vivo models for adamts-7 , which shares similar domain organization and structure , have been generated , and the critical role of adamts-7 in the pathogenesis of oa has been elucidated .
it was reported that adamts-7 formed a positive feedback loop with tnf- in the pathogenesis of osteoarthritis .
targeted overexpression of adamts-7 in chondrocytes led to chondrodysplasia characterized by short - limbed dwarfism and a delay in endochondral ossification in young mice and a spontaneous oa - like phenotype in aged mice .
in addition , overexpression of adamts-7 led to exaggerated breakdown of cartilage and accelerated oa progression , while knockdown of adamts-7 attenuated degradation of cartilage matrix and protected against oa development , in surgically induced destabilization of medial meniscus oa models [ 58 , 100 ] .
adamts-7 upregulated tnf- and metalloproteinases associated with oa ; in addition , tnf- induced adamts-7 through nf-b signaling .
these data indicated that adamts-7 and tnf- form a positive feedback loop in the regulation of cartilage degradation and oa progression [ 58 , 101 ] . aside from the fact that adamts-12 shares a similar structure with adamts-7 , adamts-12 may play a critical role in the oa development in vivo [ 10 , 23 , 58 ] . rheumatoid arthritis ( ra ) is a chronic systemic inflammatory disease , characterized by inflammation of the synovial membrane and progressive destruction of the articular cartilage and bone [ 102 , 103 ] .
as we have previously stated , adamts-12 is an inflammation - related protein , which can digest comp ; it was reported that adamts-12 might play a role in ra [ 104 , 105 ] .
three single nucleotide polymorphisms ( snps ) ( rs1364044 , intron c / t ; rs10461703 , intron c / t ; rs25754 , missense thr1495ile ) of adamts12 were genotyped by using a direct sequencing method in 303 ra patients and 495 control subjects .
multiple logistic regression models , snpstats and snpanalyzer pro programs , and bonferroni 's correction ( pc ) were used and found that the genotype frequency of rs10461703 was associated with the ra development . however , no significant correlation was observed between the three tested snps and ra patients with regard to their clinical features .
adamts-12 was reported to associate with sex - specific disparities in ra resulting in cartilage degradation .
the involvement of sex chromosomes in ra and the relationship between animal models of ra and gender have been reported by several laboratories [ 108114 ] . in addition , it was suggested that collagen antibody - induced arthritis ( caia ) in congenic mice can be used to identify homologous ra associated molecular pathways .
it was reported that balb / c.dba/2-pgia8- ( c.d2-pgia8- ) congenic mice carry a sex - affected arthritis - suppressive genomic interval which was associated with pgia .
it was revealed that caia severity in pgia8-congenic females was 20% higher than in balb / c females .
however , the inflammation severity of the pgia8-congenic males was 3045% lower than wild - type balb / c males , indicating that the genetic anti - inflammatory effect was specific towards male .
criteria were set as a 1.5-fold change threshold in the caia severity change and three genes were found including collagen triple - helix repeat - containing 1 ( cthrc1 ) , c1q and tnf - related protein 3 ( c1qtnf3 ) , and adamts-12 , which were all associated with both gender and arthritis .
in addition , these three genes were highly involved in the severity of arthritis with r = 0.91 , 0.89 , and 0.87 , respectively ; thus there is a strong correlation among these 3 genes .
it was also demonstrated that the cthrc1 protein positively regulated the pcp - wnt pathway altering chondrocyte maturation and cartilage formation [ 115117 ] .
collectively , these genetic and in vitro studies indicate that adamts-12 plays an important role in the pathogenesis of arthritis and may be a potential target for developing new treatments for arthritis .
adamts-12-deficient mice model with arthritis are critical for verifying its role in the course of both osteoarthritis and rheumatoid arthritis in vivo .
adamts-12 has also been reported to be a critical mediator in inflammation , especially allergic inflammation [ 24 , 27 , 28 ] .
adamts-12 has been identified as one asthma - associated gene in the human genome screening program .
asthma is characterized by a specific pattern of inflammation and airway / bronchial hyperresponsiveness ( ahr / bhr ) [ 118 , 119 ] .
fine mapping and positional candidate studies were performed in the hutterites ( south dakota ) and an outbred case - control sample from germany .
genotyping on chromosome 5p showed that snps in adamts-12 were primarily associated with bronchial hyperresponsiveness ( bhr ) in the hutterites . in addition ,
furthermore , there was a significant difference between asthma cases and controls in the frequencies of long range haplotypes composed of snps at adamts-12 .
recently , asthma ova and hdm model were generated in the adamts-12-deficient mice to determine the role of adamts-12 in this disease .
it was found that adamts-12 deficiency could exacerbate an allergen - induced inflammatory and airway response by inducing th2 inflammation .
adamts-12-deficient mice models displayed a more severe phenotype of allergen - induced ahr when compared to their corresponding wt littermates by histological analysis .
in addition , the markers of th2-skewed inflammatory response , such as ag - specific ige and ag - specific igg1 , were all significantly increased in allergen - induced mice .
and there appeared to be no difference between the groups when evaluating the th1-associated marker , igg2a .
the cytokine levels of il-4 and il-13 ( typical th2 cytokines ) were highly increased in adamts-12-deficient mice . on the other hand
the levels of il-10 and ifn- ( th1 cytokines ) did not exhibit significant changes .
furthermore , the levels of rantes ( ccl5 ) ( a major eosinophil chemoattractant ) , il-5 ( known to regulate eosinophil differentiation and survival ) , and il-33 ( known to further contribute to exacerbated eosinophil [ 122 , 123 ] ) were all increased and coordinate with the increased amount of eosinophilia .
the levels of both the mast cells and st2 receptor were higher within the lungs of allergen - induced adamts-12-deficient mice [ 124 , 125 ] .
in addition to its involvements in allergic inflammation , adamts-12 was found to be required in normal inflammation . to elucidate the role of adamts-12 in normal inflammation , several in vivo murine models
adamts-12-deficient mice were used to create the animal models for colitis , endotoxic sepsis , and pancreatitis .
they also experienced a delay in the recovery process from these challenges by comparison with their wild - type littermates .
the adamts-12-deficient tissues showed a significant increase in several inflammatory markers in both rna and protein levels after analysis .
in addition , all adamts-12-deficient mice models exhibited severe inflammatory symptoms accompanied by neutrophilia in the affected tissues .
furthermore , hemopexin and cytokines such as granulocyte - colony stimulating factor ( gcsf ) and il-6 were increased in the adamts-12-deficient mice .
notably , hemopexin and gcsf had the ability to promote duration and inhibit the apoptosis of neutrophils [ 126128 ] .
above all , adamts-12 has a genetic linkage with asthma and a deficiency in adamts-12 leads to defects in both the normal and hyperresponsive inflammatory response .
it may act as an important mediator maintaining the immune balance in both biological and pathological process . clearly , the molecular events and mechanisms underlying adamts-12-mediated regulation of inflammation warrant further investigations . within intervertebral disc ( ivd )
this process may negatively influence both the diffusion and nutrition of the ivd , which can lead to a more sever phenotype .
it was reported that the expressions of adamts-7 and adamts-12 in the endplate cells isolated from patients with degenerative disc disease were significantly increased .
a rat caudal intervertebral disc model was used to examine the expression profiling of adamts-7 and -12 in the course of the degeneration of intervertebral disc . adamts-7 and adamts-12 were detected in the nps and their expressions were slightly changed within the first 18 hours after loading .
after that window of time both adamts-7 and -12 increased significantly and coordinated with the dramatic increase of comp . within a recent
load - induced ivd degenerative rat model , the expression of adamts-7 peaked on the first day and adamts-12 expression reached peak level on the 7th day . however , on 7th day , the level of adamts-12 was much higher than that of adamts-7 .
this data suggests that adamts-7 and adamts-12 may contribute to the early and late degeneration stage of ivd , respectively .
adamts-12 was found to be expressed in the fibroblasts adjacent to the tumor cells in the colorectal cancer specimens from human patients .
in addition , the expression of adamts-12 was not associated with the tumor origin , nor gender or age , but depended on the differentiation of the cancer cells .
well - differentiated cells exhibited a higher staining score while poorly differentiated cells displayed negative staining .
moreover , the adamts-12 expression in cancer stroma of patients with lymph node metastasis was greater than that within the patients without lymphatic metastasis
the adamts-12 gene promoter was hypermethylated in colorectal carcinomas and colon cancer cell lines resulting in the silence of adamts-12 expression .
in addition , it was reported that adamts-12 was expressed in fibroblastic - like cells surrounding malignant cells , and it was confirmed by histological staining from clinic .
moreover , well and moderately differentiated carcinomas showed a strong immunoreactivity for adamts-12 whereas poorly differentiated cells showed weak staining .
the expression of adamts-12 was doubled when fibroblasts coculture with colon cancer cells compared with fibroblasts cultures alone .
it has been documented that the tumor cell growth rate was significantly decreased when fibroblasts coculture with colon cancer cells , as compared to colon cancer cell cultures alone .
furthermore , the apoptotic cancer cell population of cocultured cells with colon fibroblasts was much higher than that of tumor cell cultures alone .
it was reported that fibroblasts - expressed adamts-12 acted as a compensatory strategy for the epigenetic silencing of this gene within malignant cells .
adamts-12 was reported to exact an tumorigenesis and angiogenesis - inhibitory effect [ 5 , 2931 , 131 ] .
adamts-12 was found to play a protective role in angiogenesis and cancer progression via using adamts-12-deficient - mice models .
malignant keratinocyte ( pdva cell line ) transplantation demonstrated that tumor vascularization and invasion were increased in adamts-12-deficient - mice .
the aortic explants assay and basic fibroblast growth factor ( bfgf ) injection indicated that adamts-12 was a negative regulator of angiogenesis . additionally , the overexpression of adamts-12 in breast carcinoma ( mcf7 cell line ) resulting in reduced new vessel formation exhibited an inhibitory effect in angiogenesis as well .
adamts-12 was also found to abolish vascular endothelial growth factor- ( vegf- ) induced tubule formation in the bovine aortic endothelial ( bae ) cells .
furthermore adamts-12 inhibited tumor growth in vivo as well , since injection of a549 cells overexpressing adamts-12 into the immunodeficient - scid - mice showed a reduced tumor growth .
adamts-12 was reported to play its tumorigenesis role by modulating the ras - dependent erk signaling pathway .
there was a notable lower level of phosphorylated erk in the madin - darby canine kidney ( mdck ) cells expressing adamts-12 than those lacking adamts-12 after being stimulated by hepatocyte growth factor ( hgf ) .
in addition , adamts-12 may function as a tumor suppressor through limiting the proliferation of tumor cells .
interestingly , the catalytic activity of adamts-12 appeared to be dispensable for its angiogenic - inhibitory function , since the mutations in the catalytic domain inactivated its enzymatic activity but did not impair the antiangiogenic effect .
new findings have illustrated that adamts-12 could elicit tumorigenesis effects when it interacts with fibulin-2 in breast cancer .
fibulin-2 belongs to fibulins , which are components of basement membranes and elastic matrix fibers in connective tissue and also play a role in tumorigenesis [ 134136 ] . both in vitro and in vivo data
have shown that adamts-12 itself could exhibit protumor effect while interaction of adamts-12 and fibulin-2 could exhibit tumorigenesis effect .
furthermore , clinically detection of both proteins in breast cancer patients predicted a good prognosis .
taken together , both in vivo and in vitro experiments demonstrate that adamts-12 expression associates with the differentiation of the cancer cells and has tumorigenesis and antiangiogenic effects .
thus , adamts-12 may provide a new molecular target for treating various types of cancer in addition to the potential of being employed as a prognostic indicator in tumor malignant grade and metastasis .
members of adamts family have been implicated in neurodegenerative and neuroinflammatory diseases [ 137139 ] .
in addition , some metalloproteinases , including mmp-9 and adamtsl3 , were found to be implicated in schizophrenia [ 140 , 141 ] .
the adamts-12 gene had been shown to be a functional and positional candidate in the susceptibility of schizophrenia by mutation analysis in puerto rican patients of spanish descent . moreover ,
the intronic variant rs256792 and the two - snp haplotype rs256603rs256792 were closely associated with the disorder , although the function of single nucleotide polymorphisms remains largely unknown .
, 110 genes were selected for evaluation of their expression during chicken gonad differentiation , and adamts-12 showed higher level of expression within the testis and was increased during gonadal development . furthermore , whole mount in situ hybridization assay reveled that adamts-12 was expressed in the testis on day 7 , the time of histological differentiation of the gonads .
a previous study reported that adamts-12 acted as an inhibitor of sox9 expression during in vitro chondrocyte differentiation and the reverse expression profiling between adamts-12 and sox9 in the course of chicken gonad differentiation indicating that adamts12 may be a novel regulator of gonad differentiation through modulating sox9 transcription factor .
in addition , it was reported that adamts-12 might be an early marker of male gonad differentiation .
in addition to its potential role in male gonad differentiation , adamts-12 was also found to be involved in the trophoblastic cell invasion [ 144 , 145 ] .
adamts-12 was found to be detectable in samples of human placental tissue from the first trimester .
adamts-12 altered the cell - extracellular matrix ( ecm ) interactions leading to the reduction of cell adhesion capability and promotion of cell invasion by measuring the first trimester trophoblastic cells .
expression of adamts-12 was significantly higher in cultures of invasive extravillous cytotrophoblast ( evt ) than in poorly invasive jeg-3 choriocarcinoma cells .
in addition , it was reported that gonadotropin - releasing hormone- ( gnrh- ) i and ii increased adamts-12 's expression in evt within a time- and concentration - dependent manner and transforming growth factor-1 ( tgf-1 ) promoted cytotrophoblast invasion in vitro while interleukin-1 ( il-1 ) restrained cytotrophoblast invasion in vitro . in addition , adamts-12 reduced cell - emc adhesion by regulating the v3 integrin heterodimer .
furthermore , the ability of adamts-12 to promote invasion largely depended on the disintegrin - like domain and ancillary domains .
it was reported that there was a relationship between the adamts family and pediatric stroke .
although snps residing in adamts12 were strongly associated with pediatric stroke , the mechanisms through which the genetic variants in adamts genes lead to pediatric stroke still remain unknown .
the dysregulation of adamts-12 is associated with musculoskeletal degenerative diseases , including arthritis and ivd degeneration , which probably resulted from its degradation of comp , aggrecan , and other unidentified matrix proteins and its role in inflammation . in addition ,
adamts-12 functions as a protective mediator in both normal and hyperresponsive inflammation by inducing neutrophil apoptosis and interfering with the t response , respectively .
furthermore , adamts-12 is found to exhibit tumorigenesis and angiogenic - inhibitory effect in certain cancer types and adamts-12 has the potential to be used as an indicator of cancer prognosis .
adamts-12 also promotes the invasive ability of trophoblastic cells and acts as an early marker of male gonad differentiation in chicken .
although growing evidence indicates that adamts-12 is a metalloproteinase with multiple functions , the exact expression profiling , regulation , and function of adamts-12 in various pathophysiological processes , especially the signaling pathways and molecular events involved , remain to be delineated . moreover , the function of each domain should be taken into account since it has been reported that thrombospondin type 1 repeats interact with mmp-2 , whose role in osteoarthritis is currently emerging . by determining the functional domain of adamts-12 in osteoarthritis , we can develop a more efficient inhibitor to rescue this disease .
in addition , the protein partner of adamts-12 in the progression of osteoarthritis is also a big challenge to us .
although global knockout mice of adamts-12 are viable , timely controlled ( i.e. , inducible ) , tissue - specific knockout and/or transgenic mice are needed for precisely dissecting the role of adamts-12 in the development of various tissues .
in addition , these mouse strains are especially useful for generating various kinds of diseases models . for instance , in order to figure out the potential effect of adamts-12 in cartilage development and the initiation and/or progression of oa , cartilage specific deletion of adamts-12 in the adult mice is required for generating surgically induced oa models . | adamts-12 is a member of a disintegrin and metalloproteinase with thrombospondin motifs ( adamts ) family of proteases , which were known to play important roles in various biological and pathological processes , such as development , angiogenesis , inflammation , cancer , arthritis , and atherosclerosis . in this review ,
we briefly summarize the structural organization of adamts-12 ; concentrate on the emerging role of adamts-12 in several pathophysiological conditions , including intervertebral disc degeneration , tumorigenesis and angioinhibitory effects , pediatric stroke , gonad differentiation , trophoblast invasion , and genetic linkage to schizophrenia and asthma , with special focus on its role in arthritis and inflammation ; and end with the perspective research of adamts-12 and its potential as a promising diagnostic and therapeutic target in various kinds of diseases and conditions . | 1. Introduction
2. Structural Organization of ADAMTS-12
3. Biological Functions of ADAMTS-12
4. Other Conditions and Diseases
5. Summary and Perspective |
in spite of the absolute number of incident tb cases falling globally , tuberculosis ( tb ) continues to be the leading cause of mortality worldwide and has also been considered to be an occupational disease in the health care setup .
one of the major problems in the current treatment of tuberculosis is the noncompliance to prescribed regimens , primarily because treatment of tb involves continuous , frequent multiple drug dosing .
adherence to treatment and the outcome of therapy could be improved with the introduction of long - duration drug formulations releasing the antitubercular agents in a slow and sustained manner .
polymer - based drug delivery systems like polymeric nanoparticles have achieved a potential position in the controlled release of therapeutic agents .
polymeric nanoparticles are solid colloidal particles with diameters ranging from 1 to 1000 nm .
they consist of macromolecular materials in which the active ingredient is dissolved , entrapped , encapsulated , and adsorbed or chemically attached .
the fate of nanoparticles in the gastrointestinal tract has extensively been investigated [ 57 ] . sustained release cross - linked polymeric nanoparticles enable improvement of drug bioavailability by offering protection to the drugs in gastrointestinal environment and enhancement of solubility because of nanonization .
this approach may help in overcoming the first pass effect by getting absorbed from the intestinal tract and entering into the blood streams . here
, the uptake of polymeric nanoparticles may occur by transcytosis via m cells and intracellular uptake and transport via the epithelial cells lining of the intestinal mucosa via peyer 's patches .
the selection of polymer to develop polymeric nanoparticles is dependent on many factors like size of nanoparticles required , inherent properties of the drug , surface characteristics , biodegradability , biocompatibility , toxicity , and drug release desired profile .
chitosan is the most extensively studied polysaccharide to develop polymeric nanoparticles . as a biodegradable polymer
, chitosan is a popular choice in the application as a drug delivery carrier due to its biocompatibility , chemical versatility , and low cost . in the present study
the main objective of the present study was to formulate and optimize oral sustained release chitosan nanoparticles of rifampicin by design of experiment ( doe ) .
chitosan ( cs ) ( degree of deacetylation : 93% ) was purchased from yarrow chem products ( mumbai , india ) .
sodium tripolyphosphate ( tpp ) was sourced from sigma - aldrich ( mumbai , india ) .
a 2 full - factorial experimental design was used to optimize formulation and process parameters for the preparation of chitosan nanoparticles . in order to optimize ,
the concentration of chitosan ( x1 ) , speed of homogenization ( x2 ) , and concentration of tripolyphosphate ( tpp ) ( x3 ) were selected as independent variables .
eight formulations of drug loaded polymeric nanoparticles ( cn1 to cn8 ) were prepared according to the design as shown in table 1 .
the particle size , percentage of encapsulation efficiency , and percentage of drug loading were taken as response parameters .
the rifampicin loaded chitosan nanoparticles were prepared by modified ionic gelation method . in this method , first o / w emulsion was prepared and then ionic gelation was done by polyanionic molecule as previously reported by ajun et al . .
chitosan solutions ( 25 ml ) of different concentrations ( 1% w / v , 2% w / v ) were prepared by dissolving chitosan in 1% acetic acid under stirring at room temperature . after dissolving completely , tween-80 ( 2% v / v ) was added as a surfactant . subsequently , rifampicin ( 62.5 mg )
was dissolved in dichloromethane ( 2.5 ml ) , and then this oil phase was added dropwise to the aqueous phase .
this addition was accompanied by stirring at different speeds ( 19,000 rpm , 26,000 rpm ) with the help of high - speed homogenizer ( d-8si , art - miccra , germany ) .
stirring was continued for 5 minutes after the complete addition of the oil phase to the aqueous phase .
later cross - linking of the particles was induced by the drop wise addition of tripolyphosphate ( tpp ) solutions ( 10 ml ) of different concentration ( 0.1% w / v , 0.2% w / v ) into o / w emulsion under magnetic stirring at 500 rpm . to ensure complete evaporation of dichloromethane
nanoparticles were isolated by centrifugation at 13,500 rpm for 20 minutes at 20c using cooling centrifuge ( sigma 3k30 , germany ) , and the supernatant was used for the measurement of free rifampicin by uv spectrophotometer ( uv 1800 , shimadzu , japan ) .
the particle size of the formulations was determined by laser scattering technique using malvern nano s90 ( malvern instruments , uk ) after appropriate dilution with double distilled water .
light scattering was measured at 25c and with an angle of 90. the particle size distribution is reported as a polydispersity index ( pdi ) .
the values close to zero indicate the homogenous nature of the dispersion and those greater than 0.5 indicate the heterogeneous nature of the dispersion .
the surface characteristics of samples were studied by scanning electron microscopy ( sem ) from 1700x to 5200x magnifications .
the powder sample was dispersed in the double distilled water and dispersion drop was put on the slide .
the aluminum stubs were placed in the vacuum chamber of a scanning electron microscope ( xl 30 esem with edax , philips , the netherlands ) .
the samples were observed for morphological characterization using a gaseous secondary electron detector ( xl 30 , philips , eindhoven , the netherlands ) with working pressure : 0.8 torr , acceleration voltage : 30.00 kv .
the entrapment efficiency and drug loading of selected formulation were calculated by the following equation :
( 1)% drug encapsulation efficiency = dadsda100,% drug loading= dadsna100 ,
where da is the total amount of drug added in system , ds is the amount of drug in supernatant after the centrifugation , and na is the total amount of nanoparticles obtained .
the amount of drug in supernatant was calculated from concentration values obtained from the calibration curve on spectrophotometric analysis of the samples at 475 nm ( shimadzu uv 1800 , japan ) .
usa ) was used for the analysis of the effect of each variable on the designated response .
the statistical significance of the difference in particle size , percentage of drug encapsulation , and percentage of drug loading was tested by one - way analysis of variance ( anova ) using the following polynomial equation ( 2 ) :
( 2)y = b0+b1x1+b2x2+b3x3+b1b2x1x2+b1b3x1x3+b2b3x2x3+b1b2b3x1x2x3 ,
where y is the measured response , b0 is the arithmetic mean response , b1 is the main effect of chitosan concentration ( x1 ) , b2 is the main effect of speed of homogenization ( x2 ) , and b3 is the main effect of tpp concentration ( x3 ) ; b1b2 , b1b3 , b2b3 , and b1b2b3 are the interactions of the main factors . the significant response polynomial equations generated by design expert were used to validate the statistical design .
response surface plots were generated to visualize the simultaneous effect of each variable on each response parameter .
a checkpoint analysis was performed to confirm the utility of the established polynomial equation in the preparation of rifampicin loaded chitosan nanoparticles .
three checkpoint values of independent variables ( x1 , x2 , and x3 ) were taken and the values of dependent variables were calculated by substituting the values in the respective polynomial equation ( 7 ) .
rifampicin loaded chitosan nanoparticles were prepared experimentally by taking the amounts of the independent variables ( x1 , x2 , and x3 ) .
differences of theoretically computed values of dependent variables and the mean values of experimentally obtained value of dependent variables were compared by using student t 's test method .
the desirability function was used for optimization of the formulation . during the optimization of formulations , the responses have to be combined in order to produce a product of desired characteristics .
optimized nanoparticles should have low - particle size and high percentage of entrapment efficiency and percentage of drug loading .
the individual desirability for each response was calculated using the following method [ 14 , 15 ] .
the percentage of drug encapsulation efficiency and percentage of drug loading values were maximized in the optimization procedure , as optimized nanoparticles batch should have high percentage of drug encapsulation efficiency and percentage of drug loading .
the desirability functions of these responses were calculated using the following equation :
( 3)id1 or id2=yiyminytargetymin,id1 or id2=1 for yi > ytarget ,
where id1 is the individual desirability of percentage of drug encapsulation efficiency and id2 is the individual desirability of percentage of drug loading .
the values of ytarget and ymin for percentage of drug encapsulation efficiency are 49.36 and 20.17 , the values of ytarget and ymin for percentage of drug loading are 45.17 and 23.05 , and yi is the individual experimental result .
the particle size value was minimized in the optimization procedure , as optimized nanoparticles batch should have low particle size .
the desirability functions of this response were calculated using the following equation :
( 4)id3=ymaxyiymaxytarget , id3=1 for yi < ytarget ,
where id3 is the individual desirability of particle size .
the values of ymax and ytarget for particle size were 383.3 and 180.5 , and yi is the individual experimental result .
the overall desirability values were calculated from the individual desirability values by using the following equation :
( 5)od=(id1id2id3idn)1/n ,
where n = 3 ( number of desirable responses of the experiment ) . in vitro drug release study of polymeric nanoparticles of the best two batches according to desirability function was performed by the dialysis bag diffusion technique .
polymeric nanoparticles equivalent to 25 mg rifampicin were filled in dialysis bag ( mwco 1214 kda , pore size 2.4 nm ) and immersed in a receptor compartment containing 150 ml of phosphate buffer solution at three different ph values , 6.8 , 5.2 , and 7.4 , in the presence of ascorbic acid ( 0.2% w / v ) .
ascorbic acid was used to prevent the degradation of rifampicin in the dissolution medium due to atmospheric oxygen .
the system was stirred at 100 rpm and maintained at a temperature of 37 0.5c .
the ph values were selected to simulate intestinal fluid ph ( 6.8 ) , physiological ph ( 7.4 ) , and endosomal ph of macrophages ( 5.2 ) . at predetermined time intervals ,
five milliliter of samples was withdrawn and diluted appropriately , and the absorbance was measured by uv / visible spectrophotometer ( uv 1800 , shimadzu , japan ) at 475 nm .
various kinetic models zero order , first order , higuchi , hixson crowell and korsmeyer - peppas , and weibull models were applied to obtain the drug release mechanism from the chitosan nanoparticles [ 1719 ] .
particle size was varied in the range of 180.5 ( cn3 ) nm to 383.3 ( cn6 ) .
the drug loaded nanoparticles exhibited relatively narrow particle size distribution as indicated by relatively low pdi values in the range of 0.202 to 0.472 .
morphology of chitosan nanoparticles under scanning electron microscope ( sem ) is shown in figure 1 .
it also shows that there is only little aggregation between the prepared chitosan nanoparticles .
percentage of drug encapsulation efficiency and percentage of drug loading for respective batches are shown in table 1 .
higher drug encapsulation efficiency and drug loading were observed for the batch cn8 , and cn5 has the lowest drug encapsulation efficiency and drug loading .
a statistical design was utilized in order to derive the relationship between the response variables and the independent variables .
the analysis of variance ( anova ) results ( p value ) of the effect of the variables on particles size , percentage of drug encapsulation efficiency , and percentage of drug loading can be seen in following full - model polynomial equation :
( 6)y1=249.61 + 31.99x1(p<0.0001)22.89x2(p<0.0001)+38.39x3(p<0.0001)8.66x1x2(p<0.0001)+10.76x1x3(p<0.0001)12.86x2x3(p<0.0001)8.14x1x2x3(p<0.0001),y2=29.84 + 9.92x1(p<0.0001)2.48x2(p<0.0001)+4.41x3(p=0.0105)1.77x1x2(p= 0.0551)+1.28x1x3(p=0.1539)+3.61x2x3(p<0.0007)+1.93x1x2x3(p=0.0389),y3=30.56 + 8.40x1(p<0.0001)2.82x2(p=0.0008)+3.89x3(p<0.0084)1.21x1x2(p=0.2164)+1.67x1x3(p=0.0941)+4.02x2x3(p<0.0006)+1.59x1x2x3(p=0.1108 ) .
the terms of full - model polynomial equation having insignificant p value ( p > 0.05 ) have negligible contribution to obtained dependent variables and thus are omitted to get reduced model equation .
equations ( 7 ) representing the quantitative effect of the formulation and process variables on the particle size , percentage of drug encapsulation efficiency , and percentage of drug loading are described as follows :
( 7)y1=249.61 + 31.99x122.89x2 + 38.39x38.66x1x2 + 10.76x1x312.86x2x3 8.14x1x2x3 ; r2=0.999,y2=29.84 + 9.92x12.48x2 + 4.41x3 + 3.61x2x3 + 1.93x1x2x3 ; r2=0.925,y3=30.56 + 8.40x12.82x2 + 3.89x3 + 4.02x2x3 ; r2=0.892 .
response surface graphs were generated using the above polynomial equations , which represent the simultaneous effect of any two variables on response parameters by taking one variable at a constant level .
coefficients with one factor in polynomial equations are attributed to the effect of that particular factor , while the coefficients with more than one factor are attributed to the interaction between those factors .
a positive sign of the polynomial terms indicates a positive effect , while a negative sign indicates a negative effect of the independent factors .
polynomial equation ( 7 ) represents the effect on particle size , percentage of drug encapsulation efficiency , and percentage of drug loading , respectively .
the higher coefficient value of the main effects and interaction terms in the polynomial equation indicates that the effect of independent parameters on particle size is much higher than the effect on percentage of drug encapsulation efficiency and percentage of drug loading .
it can also be concluded that the concentration of chitosan and concentration of tpp have positive effect ; however , the speed of homogenization has a negative effect on all dependent variables .
this can also be seen in the response surface methodology indicating the effect of independent parameters on particle size ( figure 2 ) , drug encapsulation efficiency ( figure 3 ) , and drug loading ( figure 4 ) .
the increase in the particle size with an increase in the concentration of chitosan is due to the fact that at higher concentration of chitosan , viscosity is much higher and hence it affects the shear capacity of homogenizer and stirrer as well .
the reason for the increases in the particle size with an increase in the concentration of tpp would be due to the stiffness of the cross - linkage between tpp and chitosan ; as the tpp concentration increases , there would be more tripolyphosphoric ions to cross - link with amino groups on chitosan chains .
however , the increase in homogenization speed would decrease particle size , probably due to the fact that at the higher speed , smaller emulsion droplet was formed , resulting in smaller sized particles .
increase in the encapsulation efficiency and drug loading with increase of chitosan concentration would be due to the fact that the higher amount of chitosan has higher ability of ionic gel formation which prevents the rifampicin movement to the external phase and increases in the drug encapsulation efficiency hence the drug loading .
drug loading and encapsulation efficiency increase with the increase in tpp concentration indicating the better cross - linking density of chitosan matrix .
in addition , at higher speed of homogenization there is a reduction in drug encapsulation efficiency and drug loading
. it would be due to diffusion of the drug to the outer phase during emulsification by size reduction using high speed homogenizer . in order to validate the equation that describes the influence of the factors on the particle size , percentage of drug encapsulation efficiency , percentage of drug loading of nanoparticles ,
three additional checkpoint experiments ( batch cp1 , batch cp2 , and batch cp3 ) were taken and table 2 shows the actual and predicted values of independent parameters .
the t - test was applied between the actual and predicted values of independent parameters and it was observed that p value > 0.05 .
therefore , it is concluded that the polynomial equations are valid to prepare chitosan nanoparticles of desired characteristics .
therefore , this batch was considered as the best batch and the values of independent variables of this batch were considered to be optimum values to prepare chitosan nanoparticles .
release studies were carried out by using three different release medium , phosphate buffers at ph 7.4 , ph 6.8 , and ph 5.2 in order to simulate the physiological condition , intestinal condition , and the macrophage environment , respectively , shown in figure 5 . at ph 7.4 , in both of the batches , about 5% to 8% of the drug
similarly , at ph 6.8 and ph 5.2 , in both of the batches , about 8% to 13% of the drug was immediately released in 1 hour .
this finding indicates that some of the drug is localized on the surface of the nanoparticles due to the partition of the drug into the surface - active agent layer adsorbed at the surface of the emulsion droplets . after this initial burst ,
drug release is almost constant , and around 90% of the drug was released from the chitosan nanoparticles in the range of 28 hours to 34 hours .
it is concluded that rifampicin release of the chitosan nanoparticles is ph dependent : it is faster at a lower ph than around neutral ph ( ph 5.2 > ph 6.8 > ph 7.4 ) .
this is the consequence of the higher solubility of chitosan at lower ph , where the d - glucosamine residues are ionized resulting in an extensive polymer swelling and faster drug release .
moreover , rifampicin solubility is ph dependent : it increases as the ph increases . when comparing the drug release profiles from cn8 and cn4 chitosan nanoparticles , decrease of the release rate is obtained from the cross - linked nanoparticles .
this is due to the higher amount of tpp , and hence high degree of cross - linking in the case of cn8 compared with that of the cn4 .
the higuchi model was best fitted as a release kinetic of rifampicin from chitosan nanoparticles .
optimization of formulation and process parameters for the development of chitosan nanoparticles is a prerequisite to obtain the drug loaded chitosan nanoparticles with desired characteristics .
chitosan nanoparticles were modified by various factors to control particle size , percentage of drug loading , and encapsulation efficiency .
the result shows that concentrations of chitosan , concentration of tpp , and homogenization speed are significantly affecting the particle size , drug loading , and drug encapsulation efficiency .
though rifampicin is a poorly water soluble drug , it can be loaded successfully to a hydrophilic matrix of chitosan nanoparticles using modified emulsion ionic gelation method .
release of rifampicin from chitosan nanoparticles was concentration independent and sustains for a longer period of time .
thus , in vivo study can further explore the potentiality of this system for improving patient compliance by reducing the dosing frequencies in tuberculosis . |
objective .
the main objective of the present investigation was to develop and optimize oral sustained release chitosan nanoparticles ( cns ) of rifampicin by design of experiment ( doe ) .
methodology .
cns were prepared by modified emulsion ionic gelation technique . here ,
inclusion of hydrophobic drug moiety in the hydrophilic matrix of polymer is applied for rifampicin delivery using cn .
the 23 full - factorial design was employed by selecting the independent variables such as chitosan concentration ( x1 ) , concentration of tripolyphosphate ( x2 ) , and homogenization speed ( x3 ) in order to achieve desired particle size with maximum percent entrapment efficiency and drug loading .
the design was validated by checkpoint analysis , and formulation was optimized using the desirability function .
results .
particle size , drug entrapment efficiency , and drug loading for the optimized batch were found to be 221.9 nm , 44.17 1.98% w / w , and 42.96 2.91% w / w , respectively . in vitro release data of optimized formulation showed an initial burst followed by slow sustained drug release .
kinetic drug release from cns was best fitted to higuchi model .
conclusion .
design of experiment is an important tool for obtaining desired characteristics of rifampicin loaded cns . in vitro study
suggests that oral sustained release cns might be an effective drug delivery system for tuberculosis . | 1. Introduction
2. Materials and Methods
3. Result and Discussions
4. Conclusion |
the reagents used were obtained from the following sources : -mem , ( wako , # 13515175 ) ; fetal bovine serum ( fbs ) ( sigma ) ; rhodamine - phalloidin ( molecular probes , # r415 ) ; and recombinant mouse srankl ( peprotech , # 31511 ) .
raw 264.7 cells were seeded on a glass coverslip ( fisher scientific , # 1254582 ) placed in a 24-well culture dish at 1 ~2 x 10 cells in 0.5 ml -mem , 10% fbs , antibiotics , 0.1 mm non - essential amino acids , and 100 ng / ml srankl and cultured to induce osteoclastogenesis . under these conditions , raw 264.7 cells formed matured osteoclasts with the podosome belts by day 4 . for confocal microscopy , the cells were fixed with 4% paraformaldehyde in pbs for 30 min , permeabilized with 0.5% np-40 in pbs for 15 min , and blocked with 1% bsa in pbs for 1 h. the fixed cells were then incubated with rhodamine - phalloidin for 30 min .
raw 264.7 cells were seeded on a 35 mm glass bottom dish with grids ( matsunami , # d111505 ) at 1.5 x 10 cells in 0.5 ml -mem , 10% fbs , antibiotics and 100 ng / ml rankl and cultured for 3 d. the cells were fixed with 2% glutaraldehyde , 2% paraformaldehyde in 0.1 m pbs ( ph 7.4 ) at 37c for 15 min . the specimen was further fixed with 2% glutaraldehyde in 0.1 m pbs ( ph 7.4 ) at 4c .
the cells were postfixed with oso4 , dehydrated and embedded in quetol-812 ( nisshin em , # 340 ) .
the glass was dissolved by incubating with hydrofluoric acid at room temperature for 20 min .
raw264.7 cells were plated on a 35 mm glass bottomed culture dish ( mattek , # p35g-0 - 14-c ) .
the cells were then transfected with egfp - actin ( clontech , # 632453 ) using the fugene hd transfection reagent ( roche ) according to the protocol provided and allowed to differentiate into osteoclasts .
the culture medium was supplemented with 100 ng / ml rankl just before each recording .
the reagents used were obtained from the following sources : -mem , ( wako , # 13515175 ) ; fetal bovine serum ( fbs ) ( sigma ) ; rhodamine - phalloidin ( molecular probes , # r415 ) ; and recombinant mouse srankl ( peprotech , # 31511 ) .
raw 264.7 cells were seeded on a glass coverslip ( fisher scientific , # 1254582 ) placed in a 24-well culture dish at 1 ~2 x 10 cells in 0.5 ml -mem , 10% fbs , antibiotics , 0.1 mm non - essential amino acids , and 100 ng / ml srankl and cultured to induce osteoclastogenesis . under these conditions , raw 264.7 cells formed matured osteoclasts with the podosome belts by day 4 . for confocal microscopy , the cells were fixed with 4% paraformaldehyde in pbs for 30 min , permeabilized with 0.5% np-40 in pbs for 15 min , and blocked with 1% bsa in pbs for 1 h. the fixed cells were then incubated with rhodamine - phalloidin for 30 min .
raw 264.7 cells were seeded on a 35 mm glass bottom dish with grids ( matsunami , # d111505 ) at 1.5 x 10 cells in 0.5 ml -mem , 10% fbs , antibiotics and 100 ng / ml rankl and cultured for 3 d. the cells were fixed with 2% glutaraldehyde , 2% paraformaldehyde in 0.1 m pbs ( ph 7.4 ) at 37c for 15 min . the specimen was further fixed with 2% glutaraldehyde in 0.1 m pbs ( ph 7.4 ) at 4c .
the cells were postfixed with oso4 , dehydrated and embedded in quetol-812 ( nisshin em , # 340 ) .
the glass was dissolved by incubating with hydrofluoric acid at room temperature for 20 min .
raw264.7 cells were plated on a 35 mm glass bottomed culture dish ( mattek , # p35g-0 - 14-c ) .
the cells were then transfected with egfp - actin ( clontech , # 632453 ) using the fugene hd transfection reagent ( roche ) according to the protocol provided and allowed to differentiate into osteoclasts .
the culture medium was supplemented with 100 ng / ml rankl just before each recording . | we previously reported the transient appearance of an actin superstructure , called the zipper - like structure , during the primary fusion ( fusion of mononuclear precursors ) and the secondary fusion ( fusion of multinucleated cells ) of osteoclasts . here , we focus on the actin - based superstructures that link two precursor cells during the secondary fusion event . in one type of secondary fusion , the osteoclasts transformed the podosome belts into the zipper - like structure at the site of cell contact and the apposed plasma membranes in the zipper - like structure attached to each other via a discontinuous interface . in another type of secondary fusion
, the osteoclasts used a filopodium - like protrusion that linked the two cells .
both types of cell fusion required a lag period between the adhesion of the cells and the fusion of cell bodies .
thus , the secondary fusion of osteoclasts uses actin - based superstructures for cell - cell interactions before the definitive fusion of the plasma membranes . | Materials and Methods
Materials
Osteoclastogenesis
Electronmicroscopy
Live-cell imaging |
historically , the taming of singularities in classical field models has driven a great deal of research .
a particularly elegant example is the nonlinear extension of maxwell electrodynamics introduced by born and infeld to remove the divergence of both the coulomb field and the self - energy of point particles . in this determinantal form of the classical action , the modified field ( the bion )
this specific form of nonlinear electrodynamics arises in the low - energy limit of certain string theories [ 35 ] .
recovering the idea of the determinantal form of the gravitational action suggested by eddington [ 6 , 7 ] , an eddington - inspired born
infeld action ( eibi ) for the gravitational field has been introduced recently [ 8 , 9 ] . in order to avoid troubles with higher - order derivatives and ghosts ,
eibi gravity is formulated in the palatini approach , which means that the metric and connection are regarded as physically independent entities .
this implies that the connection is determined by the field equations , not constrained a priori to any particular form .
hilbert action which might allow one to remove the appearance of singularities , thus avoiding an undesirable feature of einstein s theory of general relativity ( gr ) .
the eibi theory is expected to be in agreement with gr at energies well below the planck scale , which represents the regime where quantum gravitational effects are expected to begin to become important and modify the classical description .
the naturalness of eibi gravity has been argued on the basis of canonical procedures to construct lagrangian densities with second - order field equations .
moreover , this theory is able to avoid cosmological singularities , has been employed to study properties of dark matter and dark energy [ 1315 ] , in the coupling to several kinds of fields , as an alternative to inflation , and to explore the structure of compact stars [ 18 , 19 ] .
when coupled to a perfect fluid with a given equation of state , it has been found that the theory can be interpreted as gr coupled again to a perfect fluid , but with a modified equation of state [ 20 , 21 ] .
though in its determinantal form the eibi theory may appear as lacking an intuitive motivation , here we show that , when applied to elementary systems such as electric fields generated by point - like sources ( or elementary particles ) , the theory boils down to a simple quadratic extension of gr .
this simplification occurs when the stress - energy tensor of the matter possesses certain algebraic properties , namely , when it has two double eigenvalues .
we take advantage of this property to explore in detail the internal structure of the electrovacuum solutions of the theory and find that the central singularity is generically replaced by a wormhole supported by the electric field .
the wormhole structure turns out to be crucial to regularize the total energy stored in the electric field , which occurs in a way that resembles the original born infeld electromagnetic theory . among the solutions of the theory ,
there exist a family ( characterized by a certain charge - to - mass ratio ) for which curvature invariants are finite everywhere .
these solutions , whose mass exactly coincides with the energy contained in the electric field , lose the event horizon when the number of charges drops below a critical value , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$n_q^c\sim 16$$\end{document}nqc16 , yielding remnants which are not affected by hawking s quantum instability .
the mass spectrum of these remnants can be lowered from the planck scale ( \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\sim 10^{19}$$\end{document}1019 gev ) down to the tev scale if quantum matter corrections are considered .
the action of the eibi theory with matter can be written as1\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } s\!=\!\frac{1}{\kappa ^2 \epsilon } \int \mathrm{d}^4x \left [ \sqrt{\!-\!\vert g_{\mu \nu } \!+\ !
\lambda \sqrt{\!-\!g } \right ] \!+v s_m , \qquad \end{aligned}$$\end{document}s=12d4x-|g+r()|--g+vsm , where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$g$$\end{document}g is the determinant of the space - time metric \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$g_{\mu \nu } $ $ \end{document}g , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\vert g_{\mu \nu } + \epsilon r_{\mu \nu } ( \gamma )
\vert $ $ \end{document}|g+r()| represents the determinant of a rank - two tensor \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q_{\mu \nu } \equiv g_{\mu \nu } + \epsilon r_{\mu \nu } ( \gamma ) $ $ \end{document}qg+r( ) , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\kappa ^2 \equiv 8\pi g / c^4$$\end{document}28g / c4 is a constant , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\epsilon $ $ \end{document} is a ( small ) parameter with dimensions of length squared , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r_{\mu \nu } \equiv { r^\rho } _ { \mu \rho \nu } $ $ \end{document}rr is the ricci tensor , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$${r^\alpha } _ { \beta \mu \nu } = \partial _ { \mu } \gamma ^{\alpha } _
_ { \mu \beta } + \gamma ^{\alpha } _ { \mu \lambda } \gamma ^{\lambda } _ { \nu \beta } -\gamma ^{\alpha } _ { \nu \lambda } \gamma ^{\lambda } _ { \mu \beta } $ $ \end{document}r=-+- is the riemann tensor of the connection \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \gamma _ { \mu \nu } ^{\lambda } $ $ \end{document} , which is a priori independent of the metric ( palatini formalism ) , and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$s_m$$\end{document}sm is the matter action .
the meaning of the parameter \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\lambda $ $ \end{document} can be obtained from the field equations and from the leading - order terms of an expansion in \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\epsilon \ll 1$$\end{document}1 , which reads2\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } \lim _ { \epsilon \rightarrow 0 } s&= \frac{1}{2\kappa ^2 } \int \mathrm{d}^4x \sqrt{-g } [ r\!-\!2\lambda _ { eff } ] \nonumber \\&-\frac{1}{2\kappa ^2 } \int \mathrm{d}^4x \sqrt{-g } \frac{\epsilon } { 2 } \left ( \frac{-r^2}{2 } \!+\ !
\end{aligned}$$\end{document}lim0s=122d4x - g[r-2eff]-122d4x - g2-r22+rr+sm.here \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r\equiv g^{\mu \nu } r_{\mu \nu } $ $ \end{document}rgr and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\lambda _ { eff}=\frac{\lambda -1}{\epsilon } $ $ \end{document}eff=-1. therefore , when \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\epsilon \rightarrow 0$$\end{document}0 the leading - order in ( 2 ) coincides with gr plus a cosmological constant term , with \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\lambda = 1+\epsilon \lambda _ { eff}$$\end{document}=1+eff . the action ( 1 )
can thus be seen as a high - energy modification of einstein s theory , including a cosmological constant as long as \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\lambda \ne 1$$\end{document}1 .
variation of ( 1 ) with respect to metric and connection leads to3\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned}&\frac{\sqrt{\vert q \vert } } { \sqrt{\vert g \vert } } q^{\mu \nu } -\lambda g^{\mu \nu } = -\kappa ^2 \epsilon t^{\mu \nu } , \end{aligned}$$\end{document}|q||g|q-g=-2t,4\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned}&\nabla _ { \alpha } \left ( \sqrt{q } q^{\mu \nu } \right ) = 0 , \end{aligned}$$\end{document}qq=0,where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q^{\mu \nu } $ $ \end{document}q is the inverse of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q_{\mu \nu } $ $ \end{document}q. to obtain these equations we have assumed vanishing torsion , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\gamma _ { [ \mu \nu ] } = 0$$\end{document}[]=0 , as well as \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r_{[\mu \nu ] } = 0$$\end{document}r[]=0 , which guarantees the existence of volume invariants preserved by the theory .
the connection equation ( 4 ) is formally identical to that found in the palatini version of gr and implies that \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\gamma _ { \mu \nu } ^{\lambda } $ $ \end{document} can be written as the levi - civita connection of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q_{\mu \nu } $ $ \end{document}q , which can be seen as an auxiliary metric tensor associated with the independent connection .
similarly as in other palatini theories , the relation between \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q_{\mu \nu } $ $ \end{document}q and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$g_{\mu \nu } $ $ \end{document}g is algebraic and given by5\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } \hat{q}=\sqrt{|\hat{\sigma } | } \hat{\sigma } ^{-1 } \hat{g } \ , \
\hat{q}^{-1}=\frac{\hat{g}^{-1}\hat{\sigma } } { \sqrt{|\hat{\sigma } | } } , \end{aligned}$$\end{document}q^=|^|^-1g^,q^-1=g^-1^|^|,where we have used a hat to denote matrix representation and have defined \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\sqrt{|\hat{\sigma } | } \hat{\sigma } ^{-1}\equiv \hat{i}+\epsilon \hat{p}$$\end{document}|^|^-1i^+p^ , with \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\hat{p}$$\end{document}p^ denoting the matrix \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$${p^\alpha } _
\nu \equiv g^{\alpha \mu } r_{\mu \nu } ( \gamma ) $ $ \end{document}pgr( ) .
this definition implies \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$|\hat{\sigma } |=|\hat{i}+\epsilon \hat{p}|$$\end{document}|^|=|i^+p^| . using this notation and ( 3 )
, one can easily verify that6\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } \hat{\sigma } = \lambda \hat{i}-\epsilon \kappa ^2 \hat{t } , \end{aligned}$$\end{document}^=i^-2t^,where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$${[\hat{t}]_\mu } ^\nu \equiv t^{\nu \alpha } g_{\alpha \mu } $ $ \end{document}[t^]tg. note that ( 6 ) allows one to obtain the relation between \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$g_{\mu \nu } $ $ \end{document}g and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q_{\mu \nu } $ $ \end{document}q once the matter sources have been specified .
the field equations referred to the metric \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q_{\mu \nu } $ $ \end{document}q can be written in a very compact and convenient form noting that \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\hat{q}=\hat{g}+\epsilon \hat{r}$$\end{document}q^=g^+r^ can be written as \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\epsilon \hat{r } \hat { q}^{-1}=i-\hat{g } \hat{q}^{-1}$$\end{document}r^q^-1=i - g^q^-1 . using ( 5 ) we find that \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\hat{g } \hat{q}^{-1}= \frac{\hat{\sigma } } { \sqrt{|\hat{\sigma } |}}$$\end{document}g^q^-1=^|^| , and taking ( 6 ) we finally get7\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } { r_\mu } ^\nu ( q)=\frac{\kappa ^2}{{|\hat{\sigma } |}^{1/2}}\left [ \mathcal { l}_g { \delta _ \mu } ^\nu + { t_\mu } ^\nu \right ] , \end{aligned}$$\end{document}r(q)=2|^|1/2lg+t,where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$${r_\mu } ^\nu ( q)= r_{\mu \alpha } ( \gamma ) q^{\alpha \nu } $ $ \end{document}r(q)=r()q , and we have used the fact that the gravity action in ( 1 ) can be written as \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$s_g=\int \mathrm{d}^4x \sqrt{-g}\mathcal { l}_g$$\end{document}sg=d4x - glg with \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\mathcal { l}_g\equiv ( { |\hat{\sigma } |}^{1/2}-\lambda ) / ( \kappa ^2\epsilon ) $ $ \end{document}lg(|^|1/2-)/(2 ) .
it is worth noting that the representation of the field equations given in ( 7 ) seems to be very general , since it is also valid for other families of palatini theories with lagrangians of the form \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$f(r)/(2\kappa ^2)$$\end{document}f(r)/(22 ) and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$f(r , r_{\mu \nu } r^{\mu \nu } ) /(2\kappa ^2)$$\end{document}f(r ,
rr)/(22 ) , which include gr as a particular case ( with \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\hat{\sigma } = \hat{i}$$\end{document}^=i^ ) . from ( 7 ) one clearly sees that the metric \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q_{\mu \nu } $ $ \end{document}q satisfies a system of second - order differential equations with the matter sources on the right - hand side ( recall from ( 6 ) that \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\hat{\sigma } = \hat{\sigma } [ \hat{t}]$$\end{document}^=^[t^ ] ) . since \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q_{\mu \nu } $ $ \end{document}q is algebraically related to \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$g_{\mu \nu } $ $ \end{document}g through ( 5 ) , it follows that \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$g_{\mu \nu } $ $ \end{document}g also satisfies second - order equations . on the other hand ,
it is easy to see that in vacuum , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$${t_\mu } ^\nu = 0$$\end{document}t=0 and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$|\hat{\sigma } |=\lambda ^4$$\end{document}|^|=4 , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$g_{\mu \nu } $ $ \end{document}g and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q_{\mu \nu } $ $ \end{document}q are identical up to a constant conformal factor and that \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$${r_\mu } ^\nu ( q)=\frac{(\lambda -1)}{\lambda \epsilon } { \delta _ \mu } ^\nu $ $ \end{document}r(q)=(-1) , which is equivalent to \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r_{\mu \nu } ( g)=\frac{(\lambda -1)}{\epsilon } g_{\mu \nu } $ $ \end{document}r(g)=(-1)g , thus confirming that \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\frac{(\lambda -1)}{\epsilon } $ $ \end{document}(-1) plays the role of an effective cosmological constant in the full theory . since the vacuum theory is equivalent to gr with a cosmological constant , no ghost - like instabilities are present in the theory , which is a rather general property of palatini theories .
we now couple our gravity theory to an electromagnetic field with action8\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } s_m=-\frac{1}{16\pi } \int \mathrm{d}^4x \sqrt{-g } f_{\mu \nu } f^{\mu \nu } , \end{aligned}$$\end{document}sm=-116d4x - gff,where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$f_{\mu \nu } = \partial _ { \mu } a_{\nu } -\partial _ { \nu } a_{\mu } $ $ \end{document}f=a-a is the field strength tensor . assuming a spherically symmetric and static electric field , without loss of generality we can choose coordinates such that the line element becomes9\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } \mathrm{d}s^2=-a(x)\mathrm{d}t^2+\frac{1}{a(x)}\mathrm{d}x^2+r^2(x ) \mathrm{d}\omega ^2 .
\end{aligned}$$\end{document}ds2=-a(x)dt2 + 1a(x)dx2+r2(x)d2.it is sometimes useful to use the function \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r$$\end{document}r as a radial coordinate , which turns ( 9 ) into \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\mathrm{d}s^2=-a(r)\mathrm{d}t^2+\mathrm{d}r^2/b(r)+r^2\mathrm{d}\omega ^2$$\end{document}ds2=-a(r)dt2+dr2/b(r)+r2d2 .
this replacement is possible as long as the relation between the coordinate \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$x$$\end{document}x and the radial function \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r^2(x)$$\end{document}r2(x ) is monotonic . for reasons that will become clear later
, we use \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$x$$\end{document}x instead of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r$$\end{document}r in our analysis . with this choice of coordinates
, one can verify that \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$f^{tx}=q / r^2$$\end{document}ftx = q / r2 is the only non - zero component of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$f^{\mu \nu } $ $ \end{document}f , where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q$$\end{document}q is an integration constant .
this leads to \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$${t_{\mu } } ^{\nu } = \frac{q^2}{8\pi r^4 } diag(-1,-1,1,1)$$\end{document}t=q28r4diag(-1,-1,1,1 ) , which , inserted in ( 6 ) , yields10\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } { \sigma _ { \mu } } ^{\nu } = \left ( \begin{array}{l@{\quad } l } \sigma ^{(\epsilon ) } _ { + } \hat{i } & { } \hat{0 } \\ \hat{0 } & { } \sigma ^{(\epsilon ) } _ { - } \hat{i } \end{array } \right ) , \
\sigma ^{(\epsilon ) } _ { \pm } = \lambda \pm \frac{\epsilon \kappa ^2 q^2}{8\pi r^4}. \end{aligned}$$\end{document}=+()i^0 ^ 0^-()i^,()=2q28r4.the field equations ( 7 ) then become11\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } { r_{\mu } } ^{\nu } ( q)=\frac{1}{\epsilon } \left ( \begin{array}{l@{\quad } l } \frac{(\sigma ^{(\epsilon ) } _ { - } -1)}{\sigma ^{(\epsilon ) } _ { - } } \hat{i } & { } \hat{0 } \\ \hat{0 } & { } \frac{(\sigma ^{(\epsilon ) } _ { + } -1)}{\sigma ^{(\epsilon ) } _ { + } } \hat{i } \end{array } \right ) .
\end{aligned}$$\end{document}r(q)=1(-()-1)-()i^0 ^ 0^(+()-1)+()i^.the strategy now consists on solving for \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q_{\mu \nu } $ $ \end{document}q and then use ( 5 ) to obtain \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$g_{\mu \nu } $ $ \end{document}g. to proceed , we write a line element for \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q_{\mu \nu } $ $ \end{document}q , which according to ( 5 ) and ( 9 ) takes the form12\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } \mathrm{d}\tilde{s}^2\!=\!-\sigma ^{(\epsilon ) } _ { - } a(x ) \mathrm{d}t^2\!+\!(\sigma ^{(\epsilon ) } _ { -}/a(x))\mathrm{d}x^2\!+\!\sigma ^{(\epsilon ) } _ { + } r^2(x ) \mathrm{d}\omega ^2,\nonumber \\ \end{aligned}$$\end{document}ds~2=--()a(x)dt2+(-()/a(x))dx2++()r2(x)d2,and
rewrite it as13\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } \mathrm{d}\tilde{s}^2=-c(\tilde{r } ) e^{2\psi ( \tilde{r } ) } \mathrm{d}t^2 + 1/c(\tilde{r } ) \mathrm{d}\tilde{r}^2+\tilde{r}^2\mathrm{d}\omega ^2 , \end{aligned}$$\end{document}ds~2=-c(r~)e2(r~)dt2 + 1/c(r~)dr~2+r~2d2,where we have defined \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\tilde{r}^2=\sigma ^{(\epsilon ) } _ { + } r^2$$\end{document}r~2=+()r2 , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$c(\tilde{r})=\sigma ^{(\epsilon ) } _ { - } a(x)$$\end{document}c(r~)=-()a(x ) , and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$(\mathrm{d}\tilde{r}/\mathrm{d}x)^2=(\sigma ^{(\epsilon ) } _ { -})^2$$\end{document}(dr~/dx)2=(-())2 . plugging this ansatz into ( 11 ) , we find that \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\psi ( \tilde{r})$$\end{document}(r~ ) is a constant . with the typical ansatz \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$c=1-\frac{2 g m(\tilde{r})}{c^2\tilde{r}}$$\end{document}c=1 - 2gm(r~)c2r~ we obtain14\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } m_r\equiv \frac{\mathrm{d}m}{\mathrm{d}r}=\frac{r^2(\sigma _ { + } ^{(\epsilon ) } -1)\sigma _ { -}^{(\epsilon ) } } { 2\epsilon \sigma _ { + } ^{(\epsilon ) 1/2 } } , \end{aligned}$$\end{document}mrdmdr = r2(+()-1)-()2+()1/2,where the relation \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\mathrm{d}\tilde{r}/\mathrm{d}r=\sigma _ { -}^{(\epsilon ) } /\sqrt{\sigma _ { + } ^{(\epsilon ) } } $ $ \end{document}dr~/dr=-()/+( ) , which follows from \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\tilde{r}^2=r^2 \sigma _ { + }
this relation also allows one to find that \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$(\mathrm{d}r/\mathrm{d}x)^2=\sigma _ { + } ^{(\epsilon ) } $ $ \end{document}(dr / dx)2=+( ) .
we thus conclude that the line element ( 9 ) is completely determined by15\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } a(x)=\frac{1}{\sigma ^{(\epsilon ) } _ { -}}\left ( 1-\frac{2 g m(r)}{c^2r \sqrt{\sigma _ { + }
^{(\epsilon ) } } } \right ) \ , \ \left ( \frac{\mathrm{d}r}{\mathrm{d}x}\right ) ^2=\sigma _ { + } ^{(\epsilon ) } \ , \end{aligned}$$\end{document}a(x)=1-()1 - 2gm(r)c2r+(),drdx2=+(),with \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$m(r)$$\end{document}m(r ) given by the integration of ( 14 ) .
note that , though this solution is formally equivalent to that obtained by baados and ferreira in , in the following sections we shall discuss the physical properties of those solutions with \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\epsilon < 0$$\end{document}<0 .
therefore the claims of regarding the presence of singularities in this theory when \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\epsilon > 0$$\end{document}>0 do not apply in our case , as we will explicitly show below . for a more detailed discussion on the influence of signs of the parameters in the theory see .
to discuss the physics behind the above solutions , we note that ( 7 ) , ( 10 ) , ( 14 ) , and ( 15 ) exactly coincide with those corresponding to the quadratic palatini theory16\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } s&= \frac{1}{2\kappa ^2}\int \mathrm{d}^4x \sqrt{-g}\left [ r-2\lambda + a\left ( -\frac{r^2}{2}+r_{\mu \nu } r^{\mu \nu } \right ) \right ] \nonumber \\&+\,s_m \end{aligned}$$\end{document}s=122d4x - gr-2+a - r22+rr+smwith the identifications \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\epsilon = -2a$$\end{document}=-2a and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\lambda = 1+\epsilon \lambda $ $ \end{document}=1+ [ compare with ( 2 ) ] .
the reason for this equivalence lies on the algebraic properties of the action ( 1 ) .
given the linear relation between \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$${t_\mu } ^\nu $ $ \end{document}t and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$${\sigma _ \mu } ^\nu $ $ \end{document} , in a basis in which \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$${t_\mu } ^\nu $ $ \end{document}t is diagonal the matrix \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\hat{p}$$\end{document}p^ will also be diagonal .
if \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\hat{p}$$\end{document}p^ has two double eigenvalues ( in our case \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\hat{p}=diag[p_1,p_1,p_2,p_2]$$\end{document}p^=diag[p1,p1,p2,p2 ] ) then the fourth - order polynomial defined by \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$|\hat{\sigma } |=|\hat{i}+\epsilon \hat{p}|$$\end{document}|^|=|i^+p^| turns into the second - order polynomial appearing in ( 16 ) when the squared root is evaluated . note that this quadratic polynomial coincides exactly with the series expansion of ( 2 ) , thus implying that all other higher - order terms vanish identically when \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\hat{p}$$\end{document}p^ has this structure .
the intimate relation existing between the quadratic palatini theory and the eibi theory can be used to shed useful new light on the physics of the corresponding solutions . to see this ,
let us focus on the case \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\epsilon = -2l_\epsilon ^2$$\end{document}=-2l2 , with \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$l_\epsilon $ $ \end{document}l some small length scale , for which exact solutions can be found for arbitrary \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\lambda $ $ \end{document} . for simplicity
, we consider here only the case \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\lambda = 1$$\end{document}=1 [ 2628 ] .
the function \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$m(r)$$\end{document}m(r ) appearing in ( 15 ) can be written as \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$m(r)=m_0(1+\delta _ 1 g(r))$$\end{document}m(r)=m0(1+1g(r ) ) , where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$m_0$$\end{document}m0 is an integration constant representing the scharzschild mass of the uncharged case , while17\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } \delta _ 1=\frac{1}{2r_s}\sqrt{r_q^3/l_{\epsilon } } \end{aligned}$$\end{document}1=12rsrq3/lis a dimensionless constant that controls the charge - to - mass ratio , and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$g(r)$$\end{document}g(r ) encodes the electric field contribution . for convenience ,
we replace \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$m_0$$\end{document}m0 and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q$$\end{document}q by the length scales \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r_s=2gm_0/c^2$$\end{document}rs=2gm0/c2 and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r_q^2=\kappa ^2 q^2/4\pi $ $ \end{document}rq2=2q2/4 , and measure the radial function \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r(x)$$\end{document}r(x ) in units of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r_c\equiv \sqrt{r_q l_\epsilon } $ $ \end{document}rcrql by defining \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z = z(x)=r(x)/r_c$$\end{document}z = z(x)=r(x)/rc . for \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z\gg 1$$\end{document}z1 , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$g(z)\approx -1/z$$\end{document}g(z)-1/z leads to the expected gr limit \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$a(x)\approx \left ( 1-\frac{r_s}{r}+\frac{r_q^2}{2r^2}\right ) + o(\frac{r_c^4}{r^4})$$\end{document}a(x)1-rsr+rq22r2+o(rc4r4 ) and , therefore , does not exhibit any pathological behavior1 . for \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z\rightarrow 1$$\end{document}z1 , however , the geometry strongly departs from the low - energy limit represented by gr . to understand the relevance of this region
, one should look at the behavior of the function \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z(x)=r(x)/r_c$$\end{document}z(x)=r(x)/rc:18\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } \left ( \frac{\mathrm{d}z}{\mathrm{d}x}\right ) ^2=\frac{1}{r_c^2}\left ( 1-\frac{1}{z^4}\right ) \ .
\end{aligned}$$\end{document}dzdx2=1rc21 - 1z4.for \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z\gg 1$$\end{document}z1 the relation between \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z$$\end{document}z and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$x$$\end{document}x is linear , but \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z$$\end{document}z reaches a minimum at \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z(x_c)=1$$\end{document}z(xc)=1 .
this minimum ( or bounce ) of the radial function \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z(x)$$\end{document}z(x ) is a clear signal of the presence of a wormhole .
in fact , ( 18 ) can be integrated to get the curve shown in fig .
1 , where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\mathrm{d}z/\mathrm{d}x=(1-\frac{1}{z^4})^{1/2}/r_c$$\end{document}dz / dx=(1 - 1z4)1/2/rc if \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$x\ge x_c$$\end{document}xxc and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\mathrm{d}z/\mathrm{d}x=-(1-\frac{1}{z^4})^{1/2}/r_c$$\end{document}dz / dx=-(1 - 1z4)1/2/rc if \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$x\le x_c$$\end{document}xxc.fig .
1plot of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z(x)$$\end{document}z(x ) and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\mathrm{d}g/\mathrm{d}x$$\end{document}dg / dx ( with \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r_c=1$$\end{document}rc=1 ) .
the wormhole throat is at the minimum of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z(x)$$\end{document}z(x ) ( maximum of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$g_x$$\end{document}gx ) plot of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z(x)$$\end{document}z(x ) and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\mathrm{d}g/\mathrm{d}x$$\end{document}dg / dx ( with \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r_c=1$$\end{document}rc=1 ) .
the wormhole throat is at the minimum of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z(x)$$\end{document}z(x ) ( maximum of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$g_x$$\end{document}gx ) therefore , our space - time can be seen as consisting on two identical pieces connected through a ( spherical ) hole ( the wormhole throat ) of area \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$a=4\pi r_c^2$$\end{document}a=4rc2 .
around \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z\approx 1$$\end{document}z1 , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$g(z)$$\end{document}g(z ) can be expanded as19\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } g(z)\approx \beta + 2\sqrt{z-1}-\frac{11}{6}(z-1)^{3/2}+\cdots \end{aligned}$$\end{document}g(z)+2z-1 - 116(z-1)3/2+where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\beta \approx -1.74804$$\end{document}-1.74804 is an integration constant .
with \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$g(z)$$\end{document}g(z ) and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z(x)$$\end{document}z(x ) known , the geometry can be explored in detail .
one then finds that , in general , there exist curvature divergences at \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z=1$$\end{document}z=1 , the leading order being dominated by \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\sim 1/(z-1)^3$$\end{document}1/(z-1)3 in the case of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r_{\mu \nu } ( g)r^{\mu \nu } ( g)$$\end{document}r(g)r(g ) and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$${r^\alpha }
_ { \beta \mu \nu } ( g){r_\alpha } ^{\beta \mu \nu } ( g)$$\end{document}r(g)r(g ) ( which contrasts with the much stronger divergences found in gr , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\sim 1/r^8$$\end{document}1/r8 ) .
however , if the charge - to - mass ratio defined by the constant \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\delta _ 1$$\end{document}1 is tuned to the value \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\delta _
1^*=-1/\beta $ $ \end{document}1=-1/ , the \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z=1$$\end{document}z=1 divergences disappear yielding a completely regular geometry .
one can now wonder about the nature of the sources that generate the charge \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q$$\end{document}q and the mass \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$m_0$$\end{document}m0 that characterize our solutions2 .
as first shown by misner and wheeler , an electric flux through a wormhole can define by itself an electric charge3 without the need for sources of the electric field .
therefore , the charge \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$q$$\end{document}q appearing in our solutions is entirely given by the electric flux through any two - surface \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\mathcal { s}$$\end{document}s enclosing one of the sides of the wormhole , i.e.,20\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } q=\frac{1}{4\pi } \int _ { \mathcal { s } } * f , \end{aligned}$$\end{document}q=14sf , where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$*f$$\end{document}f is the two - form dual to faraday s tensor .
the existence of a wormhole where one would naively expect to find the sources poses a more severe challenge to identify the origin of the mass \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$m_0$$\end{document}m0 .
a tempting guess would be to see \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$m_0$$\end{document}m0 as related to the energy stored in the electric field .
this idea , however , seems in conflict with the results from minkowski space - time , where the energy of a point - like charged field is defined as \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\mathcal { e}_e= 4\pi \int _ 0^{\infty } \mathrm{d}r r^2 q^2/8\pi r^4 $ $ \end{document}ee=40drr2q2/8r4 , and diverges as \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r\rightarrow 0$$\end{document}r0 .
historically , this divergence was circumvented by replacing maxwell electrodynamics ( 8) by born infeld theory , whose lagrangian reads , in determinantal form,21\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } \mathcal { l}_{bi}= \beta ^2\left ( \sqrt{-\vert g_{\mu \nu } + \beta ^{-1 } f_{\mu \nu } \vert } - \sqrt{-g } \right ) .
\end{aligned}$$\end{document}lbi=2-|g+-1f|--g.this modification yields a total finite energy for the electromagnetic field,22\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } e_e^{bi}=n_{bi } q^{3/2}(c\beta ^2)^{1/4 } , \end{aligned}$$\end{document}eebi = nbiq3/2(c2)1/4,where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$n_{bi}=\frac{\pi ^{3/2 } } { 3\gamma ( 3/4)^2}\approx 1.23605$$\end{document}nbi=3/23(3/4)21.23605 . given
that in our gravitational model the function \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r$$\end{document}r is bounded to \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r\ge r_c$$\end{document}rrc , the electric energy could be somehow regularized by the non - trivial topological structure of the space - time . since for an electric field in minkowski space
the action can be written as \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$s_\mathrm{maxwell}= \int \mathrm{d}t \times \mathcal { e}_e$$\end{document}smaxwell=dtee , to estimate the total electric energy in a gravitational scenario we propose to evaluate the total action as a means to get \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$s=\int \mathrm{d}t \times ( \mathcal { e}_g+\mathcal { e}_e)$$\end{document}s=dt(eg+ee ) . by doing this
, we find that23\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } s=\frac{4\pi r_c^3}{l_\epsilon ^2 \kappa ^2}\alpha \int \mathrm{d}t , \end{aligned}$$\end{document}s=4rc3l22dt , where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\alpha = \int _
, we find that \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\alpha = \frac{\sqrt{2}\pi ^{3/2 } } { 3\gamma ( 3/4)^2}\approx 1.74804=1/\delta _ 1^*=\sqrt{2 } n_{bi}$$\end{document}=23/23(3/4)21.74804=1/1=2nbi . with simple manipulations
, one finds that the total energy can be written as \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\mathcal { e}_t\equiv ( \mathcal { e}_g+\mathcal { e}_e)= 2m_0c^2 \delta _
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$2$$\end{document}2 stems from the need to integrate on both sides of the wormhole . remarkably , this result is finite , regardless of the value of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\delta _ 1$$\end{document}1 , which implies that the total energy is insensitive to the presence of curvature divergences .
we note that these objects , with their charge having a topological origin and their mass being generated by the electric field , naturally realize the idea of geon ( self - consistent solutions of the sourceless gravito - electromagnetic field equations ) originally introduced by wheeler .
when \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\delta _ 1=\delta _ 1^*$$\end{document}1=1 , from ( 17 ) , it is easily seen that the mass spectrum can be written as24\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } m_0=n_{bi}\left ( \frac{n_q}{n_q^c}\right ) ^{3/2}m_p \left ( \frac{l_p}{l_\epsilon } \right ) ^{1/2 } , \end{aligned}$$\end{document}m0=nbinqnqc3/2mplpl1/2,where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$n_q \equiv q / e$$\end{document}nqq / e represents the number of charges ( with \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$e$$\end{document}e being the electron charge ) , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$n_q^c=\sqrt{2/\alpha _ { e.m.}}\approx 16.55$$\end{document}nqc=2/e.m.16.55 ( with \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\alpha _ { e.m.}$$\end{document}e.m .
the fine structure constant ) is the critical number of charges and plays an important role in the existence or not of event horizons [ see paragraph below ] , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$m_p$$\end{document}mp is the planck mass , and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$l_p$$\end{document}lp is the planck length .
it is worth noting that defining the length scale \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$l_\beta ^2\equiv ( 4\pi /\kappa ^2 c\beta ^2)$$\end{document}l2(4/2c2 ) , we can write the expression for \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\mathcal { e}_{bi}$$\end{document}ebi given above as25\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } \frac{e_{bi}}{c^2}=\sqrt{2}n_{bi}\left ( \frac{n_q}{n_q^c}\right ) ^{3/2}m_p \left ( \frac{l_p}{l_\beta } \right ) ^{1/2 } , \end{aligned}$$\end{document}ebic2=2nbinqnqc3/2mplpl1/2,which , up to a factor \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\sqrt{2}$$\end{document}2 , is identical to ( 24 ) with the replacement of the electromagnetic scale \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$l_\beta $ $ \end{document}l by the gravitational scale \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$l_\epsilon $ $ \end{document}l. remarkably , ( 24 ) was derived using the maxwell electromagnetic lagrangian .
thus , besides regularizing the geometry , the eibi gravitational theory also regularizes the matter sector in a way almost identical to its electromagnetic counterpart .
a very important aspect of the \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\delta _ 1=\delta _ 1^*$$\end{document}1=1 solutions is that , as can be graphically verified ( see for details ) , for \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$n_q\le n_q^c$$\end{document}nqnqc there is no event horizon , which implies stability of that sector of the theory against hawking radiation . for \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$n_q > n_q^c$$\end{document}nq > nqc the horizon exists and its location almost coincides with the prediction of gr .
this means that black holes , understood as objects with an event horizon , can be continuously connected with horizonless configurations lying in the lowest part of the charge and mass spectrum .
such states can be naturally identified as black hole remnants and their existence could have deep theoretical implications for the information loss problem and the hawking evaporation process .
note , in addition , that for these remnants the surface \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$z=1$$\end{document}z=1 is timelike and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$s=2m_0c^2\int \mathrm{d}t$$\end{document}s=2m0c2dt coincides with the action of a point - like particle at rest , which suggests that they possess particle - like properties .
in order to test the robustness of the results obtained so far against quantum corrections in the matter sector , one can work within the effective lagrangians approach and consider the coupling of the eibi gravity model to some nonlinear theory of electrodynamics .
the born infeld electromagnetic lagrangian ( 21 ) is a well - motivated choice which , in turn , allows one to find exact analytical solutions .
one then finds that the global qualitative picture provided by maxwell s theory is preserved but with relevant quantitative differences .
in particular , following the same procedure as in the maxwell case , the mass spectrum ( 24 ) turns now into26\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\begin{aligned } m_0^{bi}=\left ( \frac{4\gamma } { 1 + 4\gamma } \right ) ^{1/4}m_0 , \end{aligned}$$\end{document}m0bi=41 + 41/4m0,where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\gamma = ( l_\epsilon /l_\beta ) ^2$$\end{document}=(l/l)2 . if the quantum effects of the matter manifest themselves much earlier than the quantum effects of gravity , i.e. , if \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$l_\beta \gg l_\epsilon $ $ \end{document}ll , then \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$m_0^{bi}$$\end{document}m0bi may become much smaller than \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$m_0$$\end{document}m0 .
in particular , if \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$l_\epsilon = l_p$$\end{document}l=lp and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\beta $ $ \end{document} is pushed to the limits of validity of the effective lagrangians scheme of quantum electrodynamics , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\beta \sim 10^{18}$$\end{document}1018 , then \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$\gamma \sim ( 10^{-17})^4$$\end{document}(10 - 17)4 and the mass spectrum for \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$m_0^{bi}$$\end{document}m0bi becomes \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$17$$\end{document}17 orders of magnitude smaller than the original \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$m_0$$\end{document}m0 .
this means that the mass spectrum may drop from \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$m_0\sim m_p\sim 10^{19}$$\end{document}m0mp1019 gev down to \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$m_0^{bi}\sim 10 ^ 2 $ $ \end{document}m0bi102 gev .
though more accurate descriptions of the matter sector might alter these numbers , the fact is that new quantum gravity phenomenology within the reach of current particle accelerators arises within a purely four - dimensional scenario .
we have shown that for spherically symmetric charged systems eibi theory recovers the gr predictions for \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r\gg r_c$$\end{document}rrc .
the theory , however , changes the microstructure of the space - time replacing the gr singularity by a wormhole .
though curvature divergences may exist at \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$r = r_c$$\end{document}r = rc , their role is uncertain , since they affect neither the properties of the flux through the wormhole nor the finiteness of the total electric energy .
the theory makes definite predictions as regards the existence of black hole remnants and their mass spectrum , with non - trivial implications for the hawking evaporation process , the information loss problem , and potentially new dark matter candidates . | we show that electrically charged solutions within the eddington - inspired born
infeld theory of gravity replace the central singularity by a wormhole supported by the electric field . as a result ,
the total energy associated with the electric field is finite and similar to that found in the born infeld electromagnetic theory . when a certain charge - to - mass ratio is satisfied , in the lowest part of the mass and charge spectrum the event horizon disappears , yielding stable remnants .
we argue that quantum effects in the matter sector can lower the mass of these remnants from the planck scale down to the tev scale . | Introduction
Theory and field equations
Electrovacuum solutions
EiBI as quadratic gravity
Charge without charges and mass without masses
Horizons and remnants
Coupling of BI matter
Conclusions and outlook |
more than 20 years have passed since stents began to be used for treating unresectable bile duct stricture in patients with obstructive jaundice .
previously , percutaneous transhepatic cholangial drainage ( ptcd ) ; also known as percutaneous transhepatic biliary drainage ( ptbd ) was employed for patients with this disease , and the patients were often forced to stay in hospital for a long period of time with an external biliary fistula .
the creation of an internal fistula is now widely used because it is as useful as surgical bypass in improving not only quality of life ( qol ) but also survival rates .
today , noninvasive endoscopic stent placement is being used for most patients with this disease as an alternative procedure to the percutaneous approach .
plastic stents ( ps ) , which have been used until now , are economical , but their shortcoming is that they give rise to obstruction at an earlier stage , so several improvements have been made .
on the other hand , metal stents ( ms ) , in which the insertion of the stents is enabled with a slender delivery system and the stents expand to a large diameter by themselves , have conferred noticeably extended patency compared with ps .
however , their shortcomings are that they are more expensive than ps and replacing them is difficult once they have been placed . here
we pose clinical questions ( cqs ) regarding stenting for obstructive jaundice in patients with unresectable biliary carcinoma , with responses in the form of recommendations ( grades of the recommendations are defined in table 11 ) .
also , levels of evidence are given ( in parentheses ) for findings in reference citations ( see definitions of levels in table 21 ) .
table 1strength of recommendations1a , strongly recommend performing the clinical actionb , recommend performing the clinical actionc1 , the clinical action may be considered although there is a lack of high - level scientific evidence for its use .
evidence insuffi cient to support or deny usefulnessd , recommend not performing the clinical actiontable 2levels of evidence1level isystematic review / meta - analysislevel iione or more randomized clinical trialslevel iiinonrandomized controlled trialslevel ivanalytic epidemiology ( cohort studies and case - control studies)level vdescriptive study ( case reports and case - series studies)level viopinions of expert panels and individual experts not based on patient s data strength of recommendations1
there are many studies reporting the approach route of drainage for unresectable malignant distal biliary obstruction , methods of stenting , and the quality of stent materials . in view of this situation
, it is thought that the relief of jaundice should be conducted as a matter of course . also , the creation of an internal fistula , where possible , is recommended . for the drainage route , there are reports of randomized controlled trials ( rcts)2,3 ( level ii ) comparing endoscopic drainage , ptbd , and surgical drainage . the success rate for the creation of an internal fistula
is reported to be 95%100%4,5 ( levels ii , iv ) . according to these reports , endoscopic drainage is preferable to the other two methods .
a metaanalysis showed that endoscopic drainage was associated with a lower risk of complications , but a higher risk of recurrent biliary obstruction than surgical drainage4 ( level ii ) .
the percutaneous procedure is performed in patients in whom the endoscopic procedure has been unsuccessful . concerning the types of stent available , there are several rcts suggesting the superiority of metal stents over plastic stents with respect to stent patency412 ( level ii ) . for hepatic hilar bile duct stricture , placement of multiple stents has been reported to confer better drainage effects than those brought about by single - stent placement13 ( level iv ) , although there are also prospective trials demonstrating that single stents are as effective as multiple stents14,15 ( levels ii , iii ) .
however , there are several questions as to hepatic hilar bile duct stricture , such as the presence of segments for which drainage is unable to be achieved and the clogging of stents , so stent placement in these patients is still controversial .
plastic stents with an outer diameter of 810 fr are now in use ( fig .
1 ) . these are easily clogged , so stents with a larger diameter have occasionally been employed in the past . however , due to the pain and technical difficulties accompanying the insertion of these stents , they have fallen into disuse .
improvements have been made in the quality of materials and the shape of stents , but no difference in patency rates has been observed1619 ( level ii ) .
1plastic stents . from left , plastic stents with outer diameters of 10 , 8.5 , and 7 fr , are shown plastic stents . from left ,
plastic stents with outer diameters of 10 , 8.5 , and 7 fr , are shown there are rcts comparing plastic stents with metal stents in the palliative treatment of distal malignant biliary obstruction411 ( level ii ) .
as for the median patency of stents , metal stents ( 3.69.1 months ) are significantly superior to plastic stents ( 1.85.5 months ) , but no difference was found in median survival ( table 3).20 although metal stents are expensive , their overall cost , including hospitalization expenses , is thought to be lower compared with that of plastic stents because of the reduced frequency of re - intervention.6,7 according to recent reports , the cost of plastic stents is low for the reasons that , in patients for whom prognosis is poor , long - term survival is not expected ( patients with liver metastasis ) and re - intervention is also unnecessary.810 in patients for whom long - term survival exceeding 6 months is expected , metal stents may be used from the initial intervention , while in patients for whom survival exceeding 6 months is not expected , similar results are achieved by using plastic stents ( level iv ) .
table 3prospective and randomized controlled trials for plastic versus metal stents in the palliative treatment of distal malignant biliary obstruction611,20referencestent groupno . of patientsstent occlusionpstent patency ( months)pmedian survival ( months)pdavids et al.,6 1992ms4916nr9.10.0065.80.45ps56304.24.9knyrim et al.,7 1993ms316nr6.2nrnrnrps31104.6nrprat et al.,8
1998ms34nrnr4.8<0.054.5nsps34nr3.25.6ps33nr3.24.8kaassis et al.,9 2003ms5911<0.007nr0.0075.1nsps59225.53.3katsinelos et al.,10 2006ms2323ns8.50.0029.1nsps24244.16.9soderlund et al.,11 2006ms4990.0093.60.0025.30.27ps51221.83.976ms , metal stent ; ps , plastic stent ; nr , not reported ; ns , not signifi ca nt stent exchanged every 3 months with or without evidence of stent dysfunction stent exchanged on evidence of stent dysfunction tannenbaum stent covered ms ms versus psa and ps prospective and randomized controlled trials for plastic versus metal stents in the palliative treatment of distal malignant biliary obstruction611,20 ms , metal stent ; ps , plastic stent ; nr , not reported ; ns , not signifi ca nt stent exchanged every 3 months with or without evidence of stent dysfunction stent exchanged on evidence of stent dysfunction ms versus psa and ps in metal stents , which are made of mesh materials , obstruction due to the ingrowth of tumors has often occurred . to cope with this problem ,
2)21 ( level iv ) , and their superior patency has been demonstrated by an rct22 ( level ii ) .
recent case series studies , however , reported that no significant difference in patency rate was found between covered and uncovered metal stents , because covered metal stents have several drawbacks , such as stent - migration and the occurrence of acute cholecystitis2325 ( level iv ) .
furthermore patients with pancreatic cancer have been included in the results of studies of stent treatment for malignant distal biliary stricture .
2covered metal stent ( wallstent ; boston scientific , natick , ma , usa ) .
this metal stent is partially covered covered metal stent ( wallstent ; boston scientific , natick , ma , usa ) .
this metal stent is partially covered there is much controversy as to the importance of establishing drainage of both liver lobes in malignant hilar biliary obstruction .
drainage with a unilateral uncovered metal stent is reported to be effective for hilar biliary obstruction15,26,27 ( level iii , iv ) ; however , there are no rcts regarding unilateral or bilateral metal stent drainage .
concerning plastic stents , an rct failed to find any difference in drainage effects between single stents and multiple stents15 ( level ii ) .
although an rct12 ( level ii ) regarding plastic stents and metal stents showed that both success and patency rates were better for metal stents than for plastic stents , the rct included only 20 patients with hilar biliary obstruction .
hence , it is still controversial which type of stents should be used in patients with hilar biliary obstruction . | together with biliary drainage , which is an appropriate procedure for unresectable biliary cancer , biliary stent placement is used to improve symptoms associated with jaundice . owing to investigations comparing percutaneous transhepatic biliary drainage ( ptbd ) , surgical drainage , and endoscopic drainage ,
many types of stents are now available that can be placed endoscopically .
the stents used are classified roughly as plastic stents and metal stents . compared with plastic stents ,
metal stents are of large diameter , and have long - term patency ( although they are expensive ) .
for this reason , the use of metal stents is preferred for patients who are expected to survive for more than 6 months , whereas for patients who are likely to survive for less than 6 months , the use of plastic stents is not considered to be improper .
obstruction in a metal stent is caused by a tumor that grows within the stent through the mesh interstices .
to overcome such problems , a covered metal stent was developed , and these stents are now used in patients with malignant distal biliary obstruction .
however , this type of stent has been reported to have several shortcomings , such as being associated with the development of acute cholecystitis and stent migration . in spite of these shortcomings
, evidence is expected to demonstrate its superiority over other types of stent . | Introduction
CQ 1 Is biliary drainage recommended for patients with unresectable disease?
CQ 2 Which type of biliary stent is appropriate for unresectable cases? |
brown tumor is one of the lesions that develop in patients with hyperparathyroidism and it affects the jaw bones occasionally .
histologically it is difficult to differentiate from other giant cell tumors , so clinical diagnosis is made with the findings of hyperparathyroidism .
although initially associated with primary hyperthyroidism , they are being seen with greater frequency of secondary hyperparathyroidism .
we report a rare case of browns tumor of maxilla , mandible , and left knee joint in a 21-year - old female patient .
a 21-year - old female reported to the department of oral and maxillofacial surgery with complaint of a painless swelling in the mandible and posterior maxilla bilaterally [ figures 13 ] , left lateral wall of the nose and left knee joint for the past three years , which was growing slowly ; swelling started in the mandible first then in maxilla and later in lateral wall of the nose and knee joint . clinical examination and ct
scan showed a diffused swelling in the mandible measuring 6 7 cm and diffused swelling in the posterior maxilla at the tuberosity region ; on the right side it measures 4 2 cm and 2 2 cm on the left side , and lateral wall of the nose measures 1 2 cm and left knee measures 10 6 cm [ figures 47 ] .
skin over the swelling was normal and pinchable , mouth opening was normal , teeth involved were mobile .
preoperative picture showing left maxillary tumor preoperative picture showing right maxillary tumor preoperative picture showing mandibular tumor ct scan showing tumor at mandibular region and right lateral wall of the nose ct scan showing tumor at mandibular region ct scan showing tumor at right maxillary region x - ray showing tumor at left knee joint ct scan was evident for a large non - homogenously enhancing mixed density lesion .
an incisional biopsy showed numerous osteoclastic giant cells with fibroblastic proliferation and areas of hemorrhage were seen with no evidence of malignancy .
routine blood investigation like hb , bt , ct , esr , total wbc count , platelet count , and biochemical examination like thyroid profile , serum calcium , parathormone levels , fbs , and urine examination for deposits and albumin was done .
the blood and urine investigation showed normal values except for the hemoglobin , which was below normal value and wide increased in the parathormone levels [ table 1 ] .
two units of pre - surgical blood transfusion and one unit of transfusion postoperatively were given to maintain the hemoglobin levels .
surgery was performed under general anesthesia ; the mandibular tumor site was approached extraorally through bilateral submandibular incision along with chin sparing lip split technique .
the mandibular mass was removed by segmental mandibulectomy , and bilateral maxillary mass was approached through the mandibular resected site and posterior maxillectomy done bilaterally till the clear pterygoid plates were seen and lateral nasal lesion was approached intra orally [ figures 8 and 9 ] .
reconstruction plate was used to maintain the contour of the mandible [ figure 10 ] ; primary closure was achieved in the mandible [ figure 11 ] and lateral wall of the nose , but posterior maxilla was left to heal by secondary intention .
the resected specimen was sent for histopathological examination ; the histopathological slide with eosin and hematoxylin section with 40 magnification diagnosed as brown tumor [ figure 12 ] .
the case was further referred to endocrinologist for further management of hyperparathyroidism and was reviewed for three years , which showed no signs of recurrence .
biochemical investigation chart resected mandibular segment resected maxillary site reconstruction plate in position postoperative extraoral picture many osteoclasts like multinucleated giant cells and fi broblast with hemosiderin deposits
ostitis fibrosa cystica as a manifestation of primary hyperparathyroidism was initially described by von recklinghausen in 1891 .
it results from direct effect of parathyroid hormone on bone , causing the conversion of potentially osteogenic cell from osteoblast to osteoclast , with bone resorption exceeding the formation of new osseous tissue .
an imbalance of osteoclastic and osteoblastic activity causes bone resorption with fibrous replacement of the marrow and thinning of the cortex .
widespread use of dialysis has led to a larger number of patients with secondary hyperparathyroidism .
histologically there is a dense fibroblastic stroma , focal areas of osteoid , cystic degeneration , hemorrhage , osteoclastic multinucleated giant cells .
brown tumors is difficult to distinguish histologically or radiologically from other giant cell tumors because of its infiltrative nature . persistent or large tumors can be removed by surgical method . the destructive nature and tumor progression necessitated surgical removal and was stabilized with external fixation .
it 's been reported that brown tumor could be treated by local radiotherapy or curettage .
it is also said that excision of the brown tumor may be required in case of the large tumor with the tissue destruction .
many methods that are used to reconstruct mandible are alloplastic implants such as bone plates and screws , autogenous bone graft , fibular free flap , scapular free flap , iliac crest , radial forearm free flap , double - flap reconstruction , osteointegrated dental implant . in our case | brown tumor is a focal lesion differentiated from other giant cell tumor by the presence of hyperparathyroidism . these lesions are non - neoplastic and they appear as a mass with partly cystic and partly solid areas .
clinically they are slow growing lesions that can be locally destructive resulting in variety of symptoms such as significant bone swelling , pain and pathological fracture . here is a female patient of 26 years with brown tumor involving mandible , maxilla and left knee joint . | I
C
D |
according to recent neuroscience findings , emotions play a significant role in decision making , and feelings shape moral judgment ( 9 , 3 , 12 , 2 )
. the conventional teaching of science ethics , however , does not target emotions ; its emphasis is on rational analysis of principles and facts and the understanding of rules and regulations .
this leaves one wondering : is it only awareness of the rules that makes scientists ethical or is it also their morality and capacity for empathy ?
i argue that issues of ethics should also be connected to the scientists emotional brain . without cultivating the latter
, the teaching of science ethics would not fully accomplish its purpose , which is the production of moral scientists with a
soul. a case can be made that over - emotionality is as bad as over - rationality ; thus , a balance between the two is the key to success in science ethics education ( 11 ) .
how can an instructor cultivate noble feelings in scientists ? images and music may be one of the answers .
it represents an innovative method to incorporate emotions into science ethics education by mixing in humanities and arts .
evaluation of conventional teaching models in science ethics , collectively known as responsible conduct of research ( rcr ) , points to mixed results ( 1 , 6 , 13 ) .
specifically , rcr instruction yields knowledge gains but appears to fall short in arousing feelings , cultivating empathy , and reinforcing moral attitudes .
a cohort of scholars now supports that emotions should play a role in ethics education ( 16 , 14 ) .
there is also support in the literature for the emotional power of music and visuals and their effect on behavioral changes ( 5 , 10 , 7 ) . in this direction ,
a few science ethics educators have incorporated some films and documentaries in their courses to good emotional effect ( 4 ) .
films associated with landmark ethics cases are popular choices . these include : and the band played on , a film on the scientific infighting during the aids discovery ; miss evers boys on the role of nurse rivers in the tuskegee syphilis experiments ; and fat man and little boy on the making and dropping of the first atomic bombs . lately
, a new breed of interactive films exemplified by the lab have made their debut ; their sole purpose is to serve as educational material in science ethics courses .
the film dear scientists embodies a different method to incorporate emotions into science ethics education .
it is neither a standard film with a plot nor a standard documentary sprinkled with interviews .
the film advances an experimental genre that works at the subconscious levelthe feelings methodmixing music and visuals of continuous high intensity .
the film s strong images leave an indelible impression of scientists ethical and social responsibility , which is a key goal of science ethics education . these visuals either create or refresh memories about the making of science .
there is intermittent narration with a contrasting calming tone that helps bring the viewer to a meditative state . aside from the value of the arts in science ethics education , central to the film
s message is also the value of humanities , especially dramatic cases drawn from the history of science . through the lenses of the past
, scientists can experience the consequences of unethical actions . by putting their feet in the protagonists shoes ,
furthermore , scientists realize some underlying commonalities in human behaviors now and then , despite regulatory progress . this realization brings home an important message : there is continuation in human predispositions , and thus , there is no way to build a better future without drawing wisdom from the past .
the visuals of the film include classroom shots , laboratory imagery showing scientists at work , archival stills , and allegoric scenes .
the scientists appearing in the film have diverse ethnic backgrounds , manifesting science s global character .
lasting about 25 minutes , the film allows time for discussion in a standard class session , where different interpretations of its metaphors can be brought up and analyzed .
the film s ultimate goal is to change the viewer s attitude toward science ethics from that of neglect or reservation to one of active participation .
in addition to introducing the feelings method , the film is meant to serve as part i in a series of short films that are forthcoming .
, the series will present the historical cases mentioned in part i and connect them with present issues and realities .
the cases that part i briefly introduces are : a ) the manhattan project and the making of the first atomic bomb ; b ) the human radiation experiments ; c ) the civilian nuclear power debate and the accident at three mile island ; d ) the tuskegee syphilis experiments ; e ) the challenger disaster at nasa ; f ) the tobacco hazard ; and g ) the case of lead poisoning . many of the film s allegoric scenes feature clio , the muse of history who is transformed to the muse of history of science and eventually to the ideal ethics instructor .
the empty chair in the theater stage represents the need for empathy in the making of science .
the young couple represents the future of humanity , embodies empathy and love , and exposes the vulnerability of the public to negative effects of certain techno - scientific and medical endeavors .
the male - female dancing also represents the coupling of rationality with emotions . in some
although not all of the film s visuals , male actors represent rationality and female actors represent sentimentality. we have reached a point in the history of humanity where scientists , irrespective of their gender , should learn to embrace their feelings and feminine side .
actually , some positive emotions can save the world by helping to overcome barriers of cultural cognition , which appear resistant to rational arguments ( 8 , 15 ) .
the theatrical scenes with the masks represent the drama of compromise in scientific endeavors , while the blindfolded scientists represent the limited connection with reality caused by bias .
the above interpretations by no means exclude other understandings that the viewer may come up with .
the film s aim is to unite people with different viewpoints and perspectives , provoke them , and motivate them to discuss and find solutions .
the arts , especially the visual and dramatic arts , should play a significant role in issues of science ethics .
being predominantly an emotional endeavor , the arts can bring together humanities , science , engineering , and medicine in challenging discussions on morality .
fusing humanities with arts , the film dear scientists is an open letter to the scientific community and aims to sensitize its members .
scientists is used broadly referring not only to scientists , but also to engineers and medical experts .
humanity is central in this film and the difference individual scientists can make for its sake is one of the film s main points .
although the latter may sound simplistic , there is no doubt that in a democracy everybody bears some responsibility when things go wrong .
the film brings the viewer to a meditative state in order to register this truth .
qualitative feedback from the science , humanities , and arts communities in the multiple festival and conference screenings of the film has been highly positive .
naturally , this feedback has to be complemented with quantitative evaluation , whose value in science ethics scholarship is repeatedly emphasized in this volume s essays .
this is part of my ongoing efforts along with the preparation of the remaining films in this collection
. more information about the film can be found at its official website , which includes a two - minute trailer : www.dearscientists.org . | there is an increasing body of evidence that not only cognition but also emotions shape moral judgment .
the conventional teaching of responsible conduct of research , however , does not target emotions ; its emphasis is on rational analysis . here
i present a new approach , the feelings method, for incorporating emotions into science ethics education .
this method is embodied in dear scientists , an innovative film that combines humanities with arts and works at the subconscious level , delivering an intense mix of music and images , contrasted by calm narration .
dear scientists has struck a chord across the science , humanities , and arts communities a promising sign . | INTRODUCTION
THE FILM
CONCLUSION |
the aforementioned model for mrna decay predicts that following deadenylation but before decapping a ribosome - free state exists1 - 4 .
we reasoned that in a decapping defective cell ( dcp2 ) , deadenylated rna would accumulate in this ribosome - free state .
we used sucrose - density gradients to survey mrna ribosome association in wild - type ( wt ) and decapping defective cells ( dcp2 ) .
greater than 90% of total cellular mrna is analyzed by this method ( data not shown ) and ribosome - free ribonucleoprotein ( rnp ) structures can be clearly separated from polyribosomes ( fig .
as predicted , inhibition of decapping did result in accumulation of deadenylated mrna ( fig .
s2a , b&f ) ; however , the mrnas continued to sediment deep into a sucrose gradient even when deadenylated ( fig .
in fact , the sedimentation profiles of several mrnas in dcp2 cells were indistinguishable from those in wild - type cells ( fig .
the rapid sedimentation of these rnas could occur either because they were sequestered in heavy particles ( perhaps p - bodies)1,2 or because they were associated with ribosomes .
the fact that sedimentation correlated with the length of the open reading frame ( fig .
s2d , g&h ) strongly suggested that the mrnas were ribosome associated ( see below ) .
because deadenylated mrnas are the substrates for decapping3 we also assessed the sedimentation profiles of decapped rnas .
this was done in cells defective for the 5-3 exonuclease ( xrn1 ) . in these cells a stable decapped decay intermediate shortened by 2 nucleotides accumulates
interestingly , the decapped intermediate showed the same sedimentation profile as the deadenylated rna ( fig .
1a ) ; the vast majority ( 83 - 95% ) of decapped mrna being present in polyribosomes ( fig .
1a & d ) . to determine if the decay intermediate was associated with ribosomes , we took four approaches
first , introduction of a premature termination codon that shortened the orf of pgk1 by 393 codons resulted in a dramatic shift to significantly lighter fractions ( fig .
second , introduction of a stem - loop to limit translation8 caused a shift towards the top of the gradient for both capped and uncapped mrnas ( fig . 1c ) .
third , treatment with edta ( known to dissociate ribosomes ) shifted the sedimentation to the top of the gradient ( fig .
finally , we showed that decapped mrnas were associated with ribosomes by ribosome immunoprecipitation9 ( fig .
s3 ) . to investigate ribosome - associated decapping further and to exclude the possibility that decapping had occurred prior to initiation of protein synthesis
, we took a transcriptional - pulse chase approach using the pgk1 mrna reporter7 . using a circularization - based rt - pcr ( crt - pcr)10 analysis we noted that decapped rna started to appear around 60 min following initiation of transcription ( fig .
separation of cell lysate into non - translating and polyribosome - associated fractions indicated that when decapping is initiated at 60 min , the vast majority of decapped mrna was polyribosome associated ( fig .
2d ) . to further exclude the possibility that association of uncapped mrna with polyribosomes is a consequence of reloading ribosomes , we used a transcriptional shut - off approach3 with the pgk1 reporter and monitored decapping using primer extension analysis .
transcription was arrested and further translation was blocked by addition of cycloheximide . because cycloheximide inhibits ribosome elongation , newly initiated strands would be arrested at 80s11 .
strikingly , mrnas trapped on ribosomes continued to be decapped until greater than 50% was achieved after 120 min ( fig .
2e & f ) . in the absence of cycloheximide , the bolus of newly decapped mrna sediments to the top of the gradient by 120 min ( fig .
these results clearly show that decapping can occur when mrnas are associated with actively translocating ribosomes .
the foregoing studies were all conducted in xrn1 cells to allow for the enrichment of decay intermediates . to detect decay intermediates in wild - type cells , we designed a reporter with 10 consecutive rare codons ( pgk1 ; fig .
we reasoned that the presence of rare codons might slow ribosome transit12 and result in accumulation of decapped , ribosome - associated decay intermediates13 .
importantly , the pgk1 reporter s decay is dependent on decapping and is not a major substrate for no - go mrna decay ( fig .
we analyzed the pgk1 reporter on sucrose gradients and detected decay intermediates using high resolution page followed by northern blot .
strikingly , using a 3 end - specific probe , decay intermediates of ~500 nt were detected in the region of the gradient associated with a single ribosome ( i.e. 80s ; fig .
, mrna intermediates of increasing length were also detected in polyribosome fractions and their size correlated well with possible ribosome occupancy ( fig .
3b ) . addition of formaldehyde prior to cell lysis was used to ensure that the decay intermediates were generated in vivo ( fig .
s6a ) . a probe complementary to the 5 end of the mrna failed to detect decay intermediates confirming that the truncated mrna was trimmed from the 5 end ( fig . 3b & fig .
most importantly , polyribosome - associated decay intermediates were lost in dcp2 and xrn1 mutants ( fig .
moreover , the pgk1 mrna decay fragments were not a result of no - go decay14 ( fig .
we used four experiments to demonstrate that the sedimentation pattern of the pgk1 mrna decay intermediates is a result of polyribosome association .
insertion of a stem - loop structure into the 5 utr ( sl - pgk1 ; fig .
s7a ) shifted the full - length mrna to the top of the gradient , and no decay intermediates were detectable deep in the gradient ( fig .
s7b ) . second , we terminated ribosome elongation before rare - codon recognition by introduction of a stop codon upstream of the rare codon stretch ( pgk1 ; fig .
terminating ribosome translocation prior to the rare codons completely inhibited the formation of polyribosome - associated decay intermediates ( fig .
s7c vs. s7d ) . further demonstrating that ribosome recognition of the rare - codon stretch is required , repositioning the rare codon stretch within the pgk1 orf resulted in a predictable size shift in polyribosome - associated decay fragments ( fig .
s8 ) . finally , we performed affinity purification of polyribosomes9 and demonstrated that the decay fragments are ribosome bound ( fig .
, these data strongly demonstrate that decapping can be detected on polyribosomes in wild - type cells if translational elongation is slowed in cis .
the foregoing experiment utilzed a reporter harboring rare codons . to determine if endogenous mrna in wild - type cells were also decapped when associated with ribosomes we developed a splinted ligation assay followed by rt - pcr ( fig .
the rna ligation mediated by the dna splint is sequence specific16 , thereby allowing us to directly detect the transient product generated by the decapping reaction ( i.e. an rna with 5 phosphate ) . using this assay ,
decapped products from endogenous pgk1 and rpl41a mrna were detected in wild - type cells ( fig .
consistent with this , in vitro removal of the 5 cap by tobacco acid pyrophosphate ( tap ) resulted in detection of rt - pcr products in both wild - type and dcp2 cells ( fig .
, these data indicate that the splinted ligation / rt - pcr assay monitors 5 decapping .
we performed this assay on rna recovered from sucrose gradient fractions of wild - type cell lysate , and found that the decapped mrnas from endogenous pgk1 and rpl41a were predominately detected on polyribosomes ( fig .
notably the sedimentation pattern of the decapped mrna correlates with the total mrna detected by northern blot ( fig .
2 ) the sedimentation of decapped mrna on polyribosomes is unlikely a result of ribosome reloading since the decapped intermediate is exceptionally transient in a wild - type cell .
collectively , these data indicate that in wild - type cells , endogenous mrna are decapped on polyribosomes .
in sum , we have shown that decapping and 5-3 degradation of mrna can occur when the transcripts are associated with actively translating ribosomes ( fig .
we experimentally demonstrate this hypothesis and show mrna remains associated with active ribosomes during the process of mrna decapping and exonucleolytic degradation .
the data clearly indicate that sequestration into a ribosome - free state ( e.g. p - bodies ) is not a prerequisite for initiation of mrna decay .
these findings are consistent with the demonstration in yeast , drosophila , and humans that mrna metabolism can be uncoupled from p - body formation19 - 22 .
moreover , they also help to explain why decay factors ( e.g. hdcp2 and xrn1p ) have been found to co - sediment with polyribosomes18,23 .
our findings raise several interesting mechanistic questions , for instance how mrna half - lives are determined in the context of on - going translation .
moreover , it is unclear how the decapping machinery associates and functions on an actively translating mrna .
interestingly , it has previously been proposed that decapping regulators promoted a ribosome - free state1,2,8,19 ; it now seems likely that they function in response to yet unknown cues to render the cap more accessible to the decapping enzyme during translation ( fig .
s1 ) . finally , we note that co - translational mrna degradation makes sense from an evolutionary point of view .
specifically , the three steps of decay each serve to systematically limit translational events without interfering with them .
deadenylation may reduce translational efficiency perhaps through loss of the poly(a ) binding protein , pab1p15 or association of decapping regulators8 .
finally , degradation from the 5 end while the mrna is ribosome associated ensures decay does not impede residual ribosomes undergoing translocation . in this way
, the final polypeptide expressed prior to the mrna being destroyed is full length and functional .
all experiments were performed using early log phase cells grown at 24 c in synthetic medium containing appropriate sugars .
the crt - pcr assay was performed as described previously10 with ojc620 for reverse transcription and ojc620/ojc635 for pcr amplification .
the pgk1 reporter was generated from fragments amplified from a previously described pgk1 reporter7 using ojc558/ojc556 and ojc557/ojc559 ; fragments were combined to produce a template for amplification of full length pgk1 using ojc558/ojc559 , followed by cloning onto the pgk1 reporter backbone at the bamhi and hindiii sites .
detection of endogenous decapped mrna was achieved by ligating an rna adaptor ( ojc706 ) to the 5 end of decapped mrna via splinted ligation , removal of the dna splint by dnase i , cdna synthesis by superscript ii reverse transcriptase using a gene specific primer , and dna amplified by pcr using a primer complementary to the rna adaptor and a gene specific primer . | the rates of rna decay and transcription determine the steady state levels of all mrnas and both can be subject to regulation . while the details of transcriptional regulation are becoming increasingly understood ,
the mechanism(s ) controlling mrna decay remain unclear . in yeast ,
a major pathway of mrna decay begins with deadenylation followed by decapping and 5-3 exonuclease digestion .
importantly , it is hypothesized that ribosomes must be removed from mrna before transcripts are destroyed .
contrary to this prediction , here we show that decay takes place while mrnas are associated with actively translating ribosomes .
the data indicate that dissociation of ribosomes from mrna is not a prerequisite for decay and we suggest that the 5-3 polarity of mrna degradation has evolved to ensure that the last translocating ribosome can complete translation . | Deadenylated mRNA remains on polyribosomes
Decapped mRNAs are found on polyribosomes
Decapping occurs on polyribosomes when translation is slowed in
Endogenous mRNAs are decapped on polyribosomes in wild-type cells
Conclusions and perspective
Methods Summary
Supplementary Material |
worldwide incidence of hypertension ( htn ) , obesity , cardiovascular disease ( cvd ) , diabetes mellitus ( dm ) , and allergic disease is rapidly rising , no longer sparing developing nations .
vulnerability to these chronic diseases appears rooted in the pre - conceptional and post - conceptional time periods .
previously presumed inevitable expressions of fixed genetic inheritance are giving way to the more hopeful realization of epigenetic modification of phenotype , first suggested by lamarck and explored by roseboom and others in their analysis of the chronic disease outcomes of offspring conceived during germany 's annexation of the netherlands , characterized by intentional and fixed - time starvation of the population .
lumey and others recognized a strong association between manifestations of specific chronic disease in adults and the trimester during which maternal starvation occurred and that neonates who were small for their gestational age ( sga ) were at the highest risk .
further , the large - forgestational - age neonates ( lga ) carried increased risk for adult expression of all four of the chronic diseases noted above and that postpartum under- or over - feeding also contributed to adult health risk .
predispositions to these morbidities , as well as osteoporosis , some cancers ( ca ) , aging , and sex - specific disease appear malleable based on availability of micronutriture , complexity of maternal / fetal gut micro - biota , dietary fatty acid and protein composition , and toxic exposure , although debate remains about the efficacy of individual nutrient levels in pregnancy .
the nutrients we chose for study and intervention reflect our belief in the likelihood of maternal and fetal benefit with potential reduction of risk in the f1 and possibly f2 generations .
for example , maternal carnitine insufficiency treated with 2000 mg of carnitine avoids a striking rise in free fatty acids , which are thought to be the main cause of insulin resistance and gestational diabetes .
because gdm is associated with lga offspring and because these offspring experience a greater than average risk for adult disease , especially adult onset dm ( aodm ) , it is reasonable to expect a reduced incidence of chronic disease if maternal carnitine insufficiency is recognized and treated .
iron status , more commonly assessed in pregnancy , is not only important in hematopoesis and neurological and cognitive development but plays a crucial role in carnitine synthesis , although carnitine precursors may be more important .
zinc insufficiency in late pregnancy disrupts neuronal replication and synaptogenesis , and maternal deficiency is associated with decreased dna , rna , and protein content of the f1 brain .
vitamin d deficiency is under investigation for its role in protection against dm , cv , some ca , osteoporosis , and optimization of immune function .
vitamin d might be an important mediator in gut homeostasis and in signaling between microbiota and host .
the intestinal microbiome in both newborns and lactating mothers influences infant and childhood food allergy and eczema .
supplementation with probiotics reduces incidence of these conditions in the offspring by 35% through 4 years of age and possibly through adolescence .
lesser known is the commonness of single - nucleotide polymorphisms such as methylene tetrahydrofolate reductase ( mthfr ) that limit methylation of folic acid and their crucial role in such disparate conditions as pregnancy - induced hypertention ( pih ) and autism .
mthfr polymorphisms affect just under 50% of most ethnic groups . if b - vitamin supplementation is inadequate during the period from 3 months before conception to 1 month postconception and if the maternal genome carries mthfr and cystathionine beta synthase ( cbs ) polymorphisms while the fetus is affected by catechol - o - methyl transferase , the offspring experience a 720% rise in the risk for autism .
pih is more common in people carrying the mthfr c677 t polymorphism , raising the possibility of preventive therapy using the methylated form of folic acid , 5-methylene tetrahydrofolate .
sga babies are born more commonly to mothers with pih - affected pregnancies , and these neonates fall within the highest quartile of risk for adult obesity , dm , htn , and cvd . recognizing that in addition to these major ones other common deficiencies such as essential fat and magnesium influence maternal / fetal health and that all nutrients work in concert , we developed a customized nutrition and lifestyle program with a supplement intended to reduce pih and dm through epigenetic and metabolic modulation and thus reduce the frequency of lga and sga babies whose neonatal disadvantages place them at increased risk for chronic disease throughout their adult lives .
all pregnant women who experienced serial consecutive delivery in our medical clinic between january 1 , 2011 , and december 31 , 2012 , were evaluated per our routine clinical practice .
this included assessment of vitamin d , carnitine , iron , zinc , and mthfr polymorphism status in the first trimester prior to supplementation .
vitamin d , carnitine , iron , and zinc were again assessed in the late second trimester following supplementation , and postpartum .
each also received standard perinatal evaluations including body mass index ( bmi ) , weight gain , blood pressure , and 1-hour non - fasting 50-gm glucose tolerance testing .
we did not test for but assumed common insufficiencies of magnesium , essential fatty acids , and probiotics .
l - methyl folate was used instead of folic acid , and if an individual had an mthfr polymorphism with conditions associated with this polymorphism her dosage of l - methyl folate was adjusted .
the two comparison groups were evaluated and treated for iron insufficiencies only . a trimester - by - trimester nutrition and lifestyle - education program
was provided at no cost to meet the general nutrient requirements of each developmental phase , with intervention beginning in the first trimester .
a customized nutrient packet was developed to meet the specific requirements of individual patients not being met by the educational program ( table 2 ) .
each woman purchased her own supplements , and those unable to afford them received donation from the medical practice .
the expected first and early trimester nausea that reduces adherence was mitigated by divided and nighttime dosing .
emphasis of nutrition education classes prenatal supplements adjusted to levels of hemoglobin , hematocrit , mean corpuscular volume , vitamin d , zinc , carnitine , and mthfr status abbreviations : cfu , colony - forming unit ; dha , docosahexaenoic acid ; epa , eicosapentaenoic acid ; mthfr , methylenetetrahydrofolate reductase . in all three groups ,
any incidence of any of the conditions under study was managed similarly , based on nationally accepted standards .
for all women giving birth at our low risk , level 1 , family practice driven community hospital between january 1 , 2011 , and december 31 , 2012 , we retrospectively evaluated the frequency of gdm , pih , sga , and lga neonates using hospital icd-9 coding data and delivery log review .
the limited resources of the low - risk hospital preclude all anticipated high - risk deliveries or preterm deliveries earlier than 36 weeks ' gestation .
we compared outcomes between our study group ( sg ) , patients of all other private practitioners ( pp ) , and patients seen by a grant - based community healthcare clinic ( chcc ) , using a 2-proportion z - test .
all three groups of patients received nearly identical prenatal care based on national standards , including prenatal education classes offered at low cost to all groups between the late second and early third trimesters delivering at the low risk community hospital .
six sessions over one and a half months surrounding labor and postpartum management contained a lamaze - based training in addition to information about waterbirth and doula attended births , but contained no formal nutritional recommendations .
lifestyle instruction emphasized sleep hygiene , finding / creating a supportive community , and encouragement to use personally held spiritual practices . a formal exception from institutional review board review based on retrospective observational study design was obtained .
gdm , pih , sga , and lga was significantly lower in our study population than in the comparison populations , with a p value of .0265 ( confidence interval [ ci ] : 97.35% ) compared to the chcc , and a p value of .0154 ( ci : 98.46% ) compared to the private practice group ( table 3 ) .
the private practice group and the study group share similar age , socioeconomic status , locality , gravidity , parity , and ethnicity ( table 4 ) .
the mean bmi was similar across all populations ( table 5 ) , however the greatest range and the highest percentage of obesity was found in the chcc group .
the federally funded community healthcare clinic and the study group differed based on socioeconomic status ( very few of its patients were privately insured ) and ethnicity ( the chcc saw a higher hispanic population ) .
percentage of governmental payor source was consistent for the study group ( 50% ) and the private population ( 46.9% ) .
drug use history and positive drug testing in the study group approximated the chcc group more closely than the private practice group .
the majority ( 86% ) of the positive drug screen results revealed a predilection for marijuana use . in the study group ,
none of the positive drug screen results were linked to gdm , pih , sga , or lga .
significant differences in pregnancy complications in clinic populations ( 2-proportion z - test ) abbreviations : ci , confidence interval ; na , not available .
a = all case size low , so slightly under typical prerequisites b = case size very low , moderately under statistic prerequisites c = case size nonexistent , unsuitable for meaningful statistics comparitive characteristics of three clinical groups body mass index ( bmi ) descriptive statistics among three clinical groups compliance data for the study group revealed variable adherence rates for individual nutrients as follows : zinc 47% , carnitine 58.7% , vitamin d3 89.3% , iron 89.3% , and l - methyl folate 75% .
insufficiency rates of all nutrient categories rose in our study group between first and third trimesters , testing as follows : zinc 37% to 85% , carnitine 56.7% to 97% , 25 oh d 55% to 69% , and hemoglobin 15.1% to 49.2% . despite the small study population size and the infrequent occurrence of the test conditions , two individual test condition comparisons proved significant : ( 1 ) study group vs chcc : gdm p value of 0.0462 ( ci : 95.38% ) and ( 2 ) study group vs private practice : pih p value of .0505 ( ci : 94.95% )
these results , though preliminary , suggest that the nutrition and lifestyle intervention in the study population is highly likely to be responsible for the reductions seen in pih , dm , sga , and lga neonates .
the acting hypothesis is that rather than one nutrient level brought to sufficiency creating benefit , it is the complex interplay of all crucial nutriture that allows for functional improvement .
given the similarities between the study group and the private group , it is a reasonable assumption that these insufficiencies exist in the private group as well , but additional study is needed . in this retrospective observational study ,
several naturally occurring selection factors work toward keeping the populations comparable : ( 1 ) all providers are family practice physicians or certified nurse midwifes restricting patients followed in their practices to lower - risk individuals ; ( 2 ) the limited resources of a low - risk hospital preclude all anticipated high - risk deliveries or preterm deliveries earlier than 36 weeks ; and ( 3 ) the ethnic and socioeconomic homogeneity of the small community in which the hospital is located .
significance of reductions in gdm , pih , sga , and lga when compared individually were limited by lack of case size in the study group ( sg ) but also by selection of a relatively low - risk population for treatment compared to us and world standards , suggesting the possibility that a higher - risk group such as the chcc would experience greater reductions in morbidity ( table 6 ) .
prevalence comparisons of gestational diabetes mellitus ( gdm ) , pregnancy - induced hypertension ( pih ) , large for gestational age ( lga ) , and small for gestational age ( sga ) dalenius k , bridley p , smith b , reinold c , grummer - stawn l. pregnancy nutrition surveillance 2010 report .
centers for disease control and prevention ; 2012 . 2011 pregnancy nutrition surveillance , summary of health indicators .
macrosomia in 23 developing countries : an analysis of a multicountry , facility - based , cross - sectional survey . lancet .
deonis m , blossner m , villar j. levels and patterns of intrauterine growth retardation in developing countries .
another glaring confounder is the lower - than - expected compliance with individual treatment plans , which illustrates the practical difficulties facing many patients during their pregnancies : ( 1 ) the physical , financial , and social requirements of traveling to a classroom four times throughout the prenatal and postpartum time periods ; ( 2 ) the revolutionary dietary and lifestyle changes demanded by the program ; and ( 3 ) the motivation , empowerment , and tools necessary to make those changes .
there is no more amenable phase in the human lifecycle for introducing habits that will lead to healthier lives for mothers and their babies .
people are open to what will improve the health of their offspring , and not too surprisingly , this time period appears to present a critical window of opportunity for epigenetic and biometabolic intervention with positive outcomes that transcend generations
. some of the difficulties in achieving compliance can be overcome by appropriate and engaging educational material . to that end
, we converted nutritional and lifestyle lessons into easily assimilated written materials ( at appropriate reading level ) , graphic materials , e - learning modules , and a web - based interactive application that allows the patient and provider ready access to customized food and lifestyle choices with a robust teaching glossary .
these materials can be easily accessed on a computer or hand - held device by both patient and provider .
thus the program facilitates an online relationship that fosters simultaneous interactive oversight for the provider .
the direct savings in public - health costs that could be achieved by significant reduction of perinatal morbidity is highly promising and warrants further investigation .
even more promising is the potential extension of health benefits into adulthood and the real possibility of generational reductions in chronic diseases , which could save millions of dollars as well as untold human suffering .
these data suggest that it is time to shift previous assumptions of inevitable maternal and fetal disease to assumptions that many of these conditions are preventable through targeted intervention during this critical perinatal window .
further investigations suggested by these data will need to be addressed in a prospective manner with a larger at - risk population , with educational and supplemental tools that empower patients to comply with nutritional and lifestyle regimes that positively affect maternal and fetal health .
it seems reasonable that generational reductions in the chronic diseases of obesity , htn , dm , cvd , osteoporosis , allergy , and mental illness could be achieved . | a retrospective chart review analyzed the effect of customized nutrition on the incidence of pregnancy - induced hypertension ( pih ) , gestational diabetes ( gdm ) , and small- and large - for - gestational - age ( sga , lga ) neonates , examining consecutive deliveries between january 1 , 2011 , and decem ber 31 , 2012 , at a low - risk community hospital .
the population was divided into 3 groups : ( 1 ) study group ( sg ) , ( 2 ) private practice ( pp ) , and ( 3 ) community healthcare clinic ( chcc ) .
all groups received standard perinatal management , but additionally the study group was analyzed for serum zinc , carnitine , total 25-hydroxy cholecalciferol ( 25 oh - d ) , methylene tetrahydrofolate reductase , and catechol - o - methyl transferase polymorphisms in the first trimester prior to intervention , with subsequent second trimester and postpartum assessment of zinc , carnitine , and 25 oh - d after intervention .
intervention consisted of trimesterby - trimester nutrition and lifestyle education , supplementation of l - methyl folate , magnesium , essential fatty acids , and probiotics for all sg patients , with targeted supplementation of zinc , carnitine , and 25 oh - d . because of small case occurrence rates of individual conditions in the study group , unreportable reductions were found , except gdm ( sg vs chcc , p value .046 with 95.38% confidence interval [ ci ] ) , and pih ( sg vs pp , p value .0505 with 94.95% cil )
. the aggregated occurrence rate of the four conditions , however , was significantly lower in the study population than in either comparison population ( pp p value .0154 with 98.46% ci , and chcc p value .0265 with 97.35% ci ) .
customized nutritional intervention appears to have significantly reduced adverse perinatal outcomes .
prospective study within larger , at - risk populations is needed to determine whether customized nutrition improves conditions individually . | INTRODUCTION
METHODS
RESULTS
DISCUSSION |
familial juvenile hyperuricemic nephropathy ( fjhn1 ; mim 162000 ) is an autosomal dominant condition characterized by defective urinary concentrating ability , gouty arthritis , interstitial nephritis , and chronic renal failure .
it is a genetically heterogeneous condition , caused due to mutation in three genes : uromodulin ( umod ) ( 40% ) , renin ( 2.5% ) , and hepatocyte nuclear factor-1 beta ( 2.5% ) .
biochemical hallmarks of the disease are hyperuricemia out of proportion to the degree of renal failure and reduced fractional uric acid excretion . here , we describe an indian family with multiple members affected with fjhn1 due to a novel heterozygous missense mutation in exon 5 of umod gene .
a 17-year - old male presented with pain and swelling in small joints of hands , feet , knees , ankles , elbows , and wrists for 2 years along with the presence of nodules on the right little finger and the left ear lobe . on examination , swellings were present on second and third metacarpophalangeal joints and third proximal interphalangeal joints .
there were tophi of size 23 cm with whitish discharge on the right little finger and of 0.5 cm on the left ear lobule [ figure 1 ] .
the serum uric acid level was 13.9 mg / dl , and serum creatinine 1.4 mg / dl ( normal uric acid level in > 18 years old : 6.2 0.8 mg / dl ) .
there were multiple family members affected with the same disorder ; some had only gouty arthropathy and others had both gouty arthropathy and renal disease [ tables 1 and 2 ] .
his father had died at the age of 42 years due to chronic kidney disease and had gouty arthritis .
one of his elder brothers and one paternal uncle 's son has gout along with kidney disease , and one brother has only gouty arthritis [ figure 2 ] .
proband showing a nodule on left ear lobe and another on right little finger with whitish discharge clinical features of proband and his family members investigations of the proband and his brother family pedigree showing multiple affected members informed consent was obtained from the three affected individuals for deoxyribonucleic acid analysis , collection of clinical data , and publication of photographs .
the 10 coding exons of umod gene were amplified by polymerase chain reaction and cycle sequenced by capillary electrophoresis using an abi 310 sequencer ( applied biosystems foster city , ca , usa ) .
a heterozygous missense variant ( c. 949 t > g ) in exon 5 [ figure 3 ] was identified in the proband and two affected brothers causing substitution of cysteine by glycine at codon position 317 ( p.c317 g ) .
it is a novel variant , not reported in 1000 genomes , clinvar , human genome mutation database , and human genome variation .
the affected residue locates within the cysteine - rich 2 domain and is immediately preceded by a highly conserved cysteine residue .
various bioinformatics tools such as mutation taster , polyphen and sorting intolerant from tolerant also predicted it to be pathogenic .
based on the above evidence , we concluded that this novel variant is very likely the causal pathogenic mutation .
g in exon 5 of uromodulin gene causing substitution of cysteine by glycine at position 317
umod also called as tamm - horsfall protein is a polymeric protein located on the tubular cells lining the thick ascending limb of the loop of henle and early distal convoluted tubules . from the apical membrane
, it is secreted into the tubular lumen where it polymerizes into a water impermeable gel - like structure that modulates salt transport , urine concentration , and urate metabolism .
common genetic variants in umod gene have been found to be associated with hypertension , reduced renal function , and increased risk of chronic renal failure .
other disorders caused by mutation in umod are medullary cystic kidney disease type 2 ( mim 603860 ) and glomerulocystic kidney disease ( mim 609886 ) . until date , more than 70 mutations have been described in umod and most of them are clustered in exon 4 ( 83.8% ) , 5 ( 8% ) , and 8 ( 8% ) of umod gene .
two - thirds of these mutations cause substitution of cysteine residues or highly conserved polar amino acids . in the present family , the mutation c. 949 t >
substitution of cysteine residue can alter the disulfide bond formation that interferes with correct folding of the umod protein .
the misfolded protein accumulates in the endoplasmic reticulum of tubular cells that elicits an adaptive response called as unfolded protein response causing cell death .
have shown that substitution of cysteine by tyrosine ( cys317tyr ) at the same position leads to delay in export of umod to plasma membrane due to longer retention time in endoplasmic reticulum .
there is marked interfamilial and intrafamilial variability that was also seen in the present family .
hyperuricemia is present in 83.3% of the cases and gout in 45% of mutation positive cases .
median age of onset of end - stage renal disease ( esrd ) was earlier in cases with mutation in epidermal growth factor ( egf)-2 and egf3 domains and later in cases with mutation in domain of 8 cysteine ( d8c ) and cysteine rich regions 1 and 2 . however , there is no correlation between the presence of hyperuricemia or gout and development of esrd .
use of uricosuric drugs such as allopurinol has a definite role in decreasing hyperuricemia and features related to gout .
however , the efficacy of these medications in slowing the progression of renal disease is still not clear . | familial juvenile hyperuricemic nephropathy ( fjhn ) , characterized by early - onset hyperuricemia , reduced fractional excretion of uric acid , and chronic renal failure is caused due to mutation in uromodulin ( umod ) gene .
we identified a novel mutation in a family with multiple members affected with fjhn .
ten coding exons of umod gene in three family members with clinical and biochemical features of fjhn and one unaffected family member were sequenced , and sequence variants were analyzed for the pathogenicity by bioinformatics studies .
a heterozygous novel missense mutation ( c. 949 t > g ) in exon 5 leading to the replacement of cysteine by glycine at position 317 was identified in all three affected family members .
this mutation has not been reported earlier in human gene mutation database , human genome variation , clinvar , and 1000 genome .
the mutation lies in the cysteine - rich 2 domain of the protein , and the affected residue is evolutionary conserved in other species . to our knowledge
, this is the first report of the identification of umod mutation in an indian family . | Introduction
Case Report
Discussion
Financial support and sponsorship
Conflicts of interest |
gelastic seizures ( gs ) are an uncommon seizure type ; they are characterized by sudden inappropriate attacks of uncontrolled and unmotivated laugh .
one century later , the term gelastic epilepsy ( from gelos : joy ) , was suggested by daly and mulder to define epileptic fits where laughter is the only or predominant symptom .
the diagnosis criteria were given by gascon ; these included stereotypical recurrence of laugh , which is unjustified by the context , associated signs compatible with seizure , and ictal or interictal abnormalities .
gs could be cryptogenic or symptomatic of a variety of cerebral lesions , most commonly hypothalamic hamartoma .
however , gs associated with other types of cerebral lesions are exceedingly rare . the physiopathologic mechanisms of this type of seizure are still undefined .
two reports have described a non - lesional gs arising from a parietal focus . in this paper
we report the first case of gs lesion associated to the parietal area of the brain in a child .
a 5-year - old boy was referred to our department for recurrent fever and uncontrolled epilepsy . the patient was the youngest one in a family of five children born out of a consanguineous marriage , but without any other significant familial history .
he was born at full - term without any perinatal problem , and weighed 3,400 g .
he walked at the age of 13 months and acquired verbal language at the age of 18 months and his first seizures occurred by the age of 14 months .
these attacks were characterized by generalized tonic clonic seizures with a frequency of 12 times per month .
he was initially treated using phenobarbital then valproate without any significant improvement . by his 4 year , the patient started expressing daily laughing attacks that were occurring 23 times a day while each was lasting for about a minute .
this stereotypical laugh was unrelated to the context ; the patient was generally unconscious during attacks and experienced post - ictal amnesia .
most often , an undescribed feeling occurred prior to seizure associated with left hemi - corporeal paresthesia .
these seizures were associated to episodes of fever up to 39.5c ; these episodes occurred almost everyday and resolved spontaneously in less than 3 h. the fever rose with the start of gelastic attack and lasted 23 hours and sometimes occurred independently .
he was 104 cm tall ( 50 percentiles ) , weighting 17 kg ( 50 percentiles ) with 50 percentiles head circumference .
complete paraclinical investigations were performed , this included c - reactive protein , sedimentation rate , leukocyte count , urinalysis , lumbar puncture , thorax radiography , cardiac and abdominal ultrasound - and were not suggestive of infection .
a cerebral magnetic resonance imaging ( mri ) revealed a lesion in the right parietal area , suggestive of cortical dysplasia .
functional mri was performed using sensory tasks which showed activation in the sensory cortical area as well as in the lesion [ figure 1 ] .
interictal electroencephalography ( eeg ) showed sporadic active spiking in the right temporal region [ figure 2 ] .
fluid attenuation inversion recovery magnetic resonance image showing a hyperintense lesion in the right parietal area interictal scalp electroencephalography indicating repetitive spikes in the parietal area
they are mostly associated to hypothalamic hamartoma , drug resistance , precocious puberty , and mental decline.[59 ] secondary gs outside diencephalic lesion are very rare ; they are most often attributed to a temporal focus . rarely
a frontal origin was usually reported,[1214 ] while parietal localization is exceptional . among these localizations
some differences in clinical profiles were noticed in reports of the literature according to the localization of the epileptic activity .
it can appear sometimes natural and forced ; and the seizure is not accompanied by a rupture of contact .
the laughter may be natural or forced , unmotivated or in response to a pleasant sensation .
the laughter is unnatural in frontal focus ; and appears as if being forced , non - communicative without any affective connotation ; and rupture of contact is frequently observed.[1214 ] a single patient was reported with parietal localization of the epilepsy , he was presenting veritable laughter attacks , described as inappropriate , involuntary and with contact rupture .
our case is probably the third one with parietal localization , and the only among the three , which is related to a cortical dysplasia
. the physiopathologic mechanisms of this type of seizure are unclear and still need elucidation .
various anatomical regions have been reported to elicit laughing ; this includes , hypothalamus , anterior cingulate gyrus , the orbito - frontal cortex , the baso - lateral temporal cortex , supplementary motor area and possibly parietal area .
several studies using electrical stimulation and ictal spect have demonstrated that joy feeling is dependent on the basal temporal cortex while motor aspect of laughter is organized in anterior cingulate area.[1720 ] in hypothalamic hamartoma , seizure is directly generated in hypothalamus and paroxysmal activity is spread in temporal area through hypothalamic - amygdala connections .
schematically , all anatomical areas mentioned above are organized in a large neuronal network , and activating one of these areas may activate a part or the whole network leading to gs .
fever has been rarely described in the literature as ictal or peri - ictal symptom and has never been associated to gs .
few cases of peri - ictal fever were reported , mainly related to non - convulsive seizure and rarely with a confusion state.[2225 ] the physiopathology of fever is not yet clear .
first , the hypothalamus might be involved in the pathogenesis , ictal activity could spread to the hypothalamus via neuronal connections and would involve the pre - optic area including localized thermoregulation center leading to central thermoregulation disturbance during few hours .
however , fever has never been reported in hypothalamic hamartoma , with the fact that ictal activity spreads from hamartoma towards the cortex , while the other way is not true .
regarding our patient , the ictal activity seems to be generated in the cortical area ; both fever and gs probably resulted from hypothalamic involvement , which supports the major role of hypothalamus in the neuronal network described above .
the two other hypotheses consist of pyrogenes production during the ictal activity and vagal nerve nuclei involvement that was demonstrated using vagal nerve stimulation treatment .
indeed , the role of the vagal nerve in temperature elevation is correlated to increased blood perfusion of the hypothalamus in - patients treated with vagal nerve stimulation .
fever might accompany the gs when it originates from cortical focus in temporal , frontal or parietal cortical areas ; this could be misdiagnosed or most often underreported as a peri - ictal symptom since infection is usually thought of in such a patient .
fever should be investigated in epileptic patients in order to better assess the prevalence of this feature as a peri - ictal symptom . in the mean time
, it is interesting to review all reported literature for better understanding the pathophysiological mechanisms involved in both gs and peri - ictal fever . | gelastic seizures ( gs ) is an uncommon seizure type characterized by sudden inappropriate attacks of uncontrolled and unmotivated laugh and its diagnostic criteria were elaborated by gascon .
these criteria included stereotypical recurrence of laugh , which is unjustified by the context , associated signs compatible with seizure , and ictal or interictal abnormalities .
gs can be cryptogenic or symptomatic of a variety of cerebral lesions , the most common being hypothalamic hamartoma .
however , gs associated with other types of cerebral lesions are exceedingly rare . the physiopathologic mechanisms of this type of seizure are still undefined .
two reports have described a non - lesional gs arising from a parietal focus . in this paper
, we report the first case of lesional gs associated to the parietal area of the brain in a child and this case has associated fever that is likely an ictal symptom . | Introduction
Case Report
Discussion |
a pregnant 23-year - old female with a six - year history of type 1 diabetes presented with a complaint of increased blur in both eyes for the previous two months .
best corrected visual acuity was 20/40 ou . slit - lamp examination was entirely unremarkable in both eyes .
dilated funduscopic examination was significant for flame - shaped , dot , and blot hemorrhages in the posterior segment , with associated macular edema and exudates bilaterally ( figures 1a and 1b ) .
optical coherence tomography ( oct ) revealed a foveal thickness of 578 5 microns and 667 8 microns in the right and left eye , respectively ( figures 2a and 2b ) .
all oct scans were performed with the stratus optical coherence tomograph ( zeiss - humphrey inc , dublin , ca ) .
examination findings were consistent with bilateral , nonproliferative diabetic retinopathy and clinically significant macular edema . after careful deliberation with the patient and her obstetrician
, a decision was made to treat the bilateral macular edema with intra - vitreal triamcinolone acetonide injection .
the patient received 0.05 ml of triamcinolone acetonide 40 mg / ml in the left eye initially and in the right eye one week later .
best - corrected visual acuity was 20/20 and 20/25 in the right and left eye , respectively .
repeat oct revealed a foveal thickness of 159 5 microns and 202 6 microns in the right and left eye , respectively ( figures 3a and 3b ) .
slit - lamp examination and goldman applanation tonometry did not reveal any intraocular hypertension or significant lenticular changes at this visit or at any point after triamcinolone injection .
the patient delivered a full - term , healthy baby boy weeks prior to this examination .
progression of diabetic retinopathy during pregnancy has been described previously by several authors.1,2 visual impairment in these cases can result from both proliferative ( eg , vitreous hemorrhage , retinal detachment ) and nonproliferative etiologies ( eg , retinal hemorrhage , papillopathy , macular edema).1 although macular edema may regress in some cases after delivery , in other cases edema can persist and can be associated with severe and persistent visual dysfunction.1 data from large , randomized clinical trials have established the benefits of argon laser photocoagulation for clinically significant macular edema.3 focal laser photocoagulation of actively leaking blood vessels or grid laser for areas of diffuse permeability can decrease clinically significant edema . however , laser photocoagulation in close proximity to the fovea increases the risk of inducing iatrogenic central scotoma as a result of thermal injury to the tissues , or subsequent glial proliferation .
there are many reports of off - label use of intravitreal triamcinolone in cases of persistent and refractory diabetic macular edema.4 improved visual acuity and decreased foveal thickness have been documented by serial oct after a single injection .
however , these effects do not appear to persist beyond 34 months without repeated administration.5 a medline search using keywords pregnancy
revealed no case reports or case series documenting the treatment of clinically significant macular edema with intravitreal corticosteroids in a pregnant patient .
side effects of systemic corticosteroid administration are well known . major ophthalmic complications of intravitreal corticosteroid injection include , but are not limited to , cataract formation and increased intraocular pressure .
although corticosteroid equivalents can be measured in the aqueous three months after a single intravitreal injection , it is not known how much corticosteroid is released into the systemic circulation after a single intravitreal injection.6 thus , it is hard to estimate the systemic effects of intravitreal corticosteroid therapy . to date , there are no reports of teratogenic outcomes with systemic corticosteroid use in pregnant human females .
however , teratogenic effects have been observed in many species receiving equivalent systemic human doses.7 many authors have noted maxillofacial deformity and , in particular , cleft palate in mice which have received corticosteroids early in gestation .
the area of greatest thickening was within the fovea of both the right and left eyes , with little edema observed in the extrafoveal area .
laser photocoagulation to this area carried a significant risk of inducing a permanent central scotoma .
given the patient s late stage of pregnancy , we felt that intravitreal steroid posed little risk to either mother or fetus .
we were able to achieve resolution of macular edema and improved visual acuity with a single intravitreal dose to each eye . in conclusion
, we propose that intravitreal triamcinolone injection may be a viable treatment modality for management of clinically significant macular edema in pregnant patients .
the safety profile with administration of this medication is enhanced if the steroid is administered after the first trimester .
we suggest a multidisciplinary approach and consultation with an obstetrician whenever using corticosteroid therapy in pregnant patients . | we present a case of diabetic macular edema in a pregnant patient treated with a single intravitreal injection of triamcinolone acetonomide .
initial presentation and serial examinations after treatment included visual acuity , slit - lamp examination , indirect ophthalmoscopy , and optical coherence tomography .
resolution of visual acuity and macular edema were present six weeks after injection and persisted throughout the duration of the pregnancy without further intervention .
no adverse outcomes for either mother or fetus were noted . to our knowledge , this is the first report of intravitreal triamcinolone administration in this patient population to be published in the medical literature . | Case report
Discussion |
implant placement in posterior maxillary jaw is more complicated because of lack available bone compared to mandible jaw bone .
success of implant in the posterior maxillary bone is complex because of type iii and iv bone .
after the extraction of the tooth residual ridge resorption occur in buccolingual and occlusoapial direction . there is a significant decrease in the height of the bone available in the posterior section of the upper arcade .
consequently , we often end up with a residual bone height of < 3 - 5 mm between the alveolar ridge of the crest and the sinus floor .
it is difficult to place > 11 mm of implant in 2 - 3 mm bone without sinus lift in posterior maxillary bone .
as such this area requires bone augmentation beneath sinus to increase vertical height of bone .
there are currently two principle techniques of penetrating crestal bone and in order to elevate maxillary sinus depending upon the availability of bone height .
the close window technique use variety of tools and materials such as bone grafts , sinus elevators , balloon , sinus condenser , sinus curettes , and collagen to lift the sinus .
lateral access window shows a more consolidation outcome in literature ; however , it is very traumatic and complex technique to perform .
the osteotome sinus floor elevation ( osfe ) procedure , introduced by summers may be less invasive , less time - consuming , cost - effective , and reduces postoperative discomfort to the patient .
the procedure consists of elevating the schneiderian membrane with osteotomes through a crestal approach , placing simultaneously platelet - rich fibrin ( prf ) , mineralized freeze - dried human bone allograft ( mfdba ) , autogenous bone and the implant at the osteotomy site .
these prf and bone grafts are thought to provide a cushion during membrane elevation and reduce sinus perforation .
the use of prf and bone graft material during simultaneous sinus lift helps to promote natural bone regeneration .
the key point of this new method is to maintain the schneiderian membrane in the highest possible position , increasing simultaneous thin residual bone height > 9 - 10 mm and width 1 - 2 mm .
although summers did not define a minimum presurgical residual bone height in the original article , other author have made recommendations ranging from 7 - 9 to 6 mm .
the aim of this case report was to evaluate a modified osfe technique for increased posterior maxillary bone height and width using prf that is rich in growth factor , autogenous bone that is full of live endosteal osteoblast cells and mbdba that has osteoinductive property .
a 67-year - old female patient reported to the department of periodontology and oral implantology with the chief complaint of having missing teeth in right and left side of the posterior maxilla .
on enquiring about previous dental treatment , it was found out that the tooth was lost because of caries and periodontal disease .
preoperative computerized tomography ( ct ) scans were performed to obtain an accurate measurement of the bone before surgery .
immediate and 8 months postoperative ct scans were performed to check the proper placement and success rate of the implants , bone formation , and sinus membrane position .
patient had maxillary posterior bone - 1.49 mm on the right side and 1.47 mm on the left side between the alveolar crest and maxillary sinus as seen in figure 1a .
preoperative computerized tomography ( ct ) scan was taken and postoperative ct after 8 months of implant placement .
( a ) bone height present is 1.49 mm between membrane and ridge preoperatively ( b ) bone height presents 15.43 mm between membrane and ridge after 8 months of implant placement preoperative and postoperative computerized tomography presurgical preparation included medical , dental , and computerized axial tomography ( cat ) scan radiographic evaluations and basic dental therapy to alleviate preexisting medical - dental problems . prior to implant surgery , informed consent for bone graft and sinus lifting of the implant , cat scan consent was obtained from the patient .
patient received 625 mg augmentin ( amoxicillin and clavulanate potassium ) twice in a day before surgery .
patient was treated with 5 mg of triazolam orally and then draped with sterile surgical barrier . before a surgical procedure start , a full mouth prophylaxis was done on surgery patient .
the posterior quadrant of the maxilla was anesthetized via local anesthesia injection 2% lidocaine hcl and epinephrine 1:100,000 in a 30-gauge needle . a direct , full thickness midcrestal incision with a # 15 blade was made through the mucoperiosteum to the crest of the ridge . full thickness reflection of buccal and palatal tissues exposed the alveolar ridge . to reflect the flap ,
the implant position was marked on the alveolar crest with a small trephine drill ( 2.0 mm ) .
after locating the implant position , the preparation was widened with two sizes internally irrigated trephine ( 3.5 mm and 4.25 mm ) drill . minimal pilot drilling ( 2.0 mm )
intra oral radiograph of the osteotomy site was taken to determine the position of the sinus membrane as seen in figure 2a .
( a ) preoperative radiograph before implant placement ( b ) bone grafting during surgery with an osteotome technique ( c ) eight months after implant placement at the same time , a 4 - 5 vials of blood was collected from the patient 's vein , and blood is spun by a special machine called a centrifuge and spun for approximately 12 min .
the drops of clindamycin and cefazolin are added into the pieces of the prf clot .
these small pieces of the membrane are placed inside the osteotomy socket as a cushion during sinus lifting .
a mixture of the mfdba were taken in the separate container saturated it with saline .
after 10 min , the excess fluid was drained , and clindamycin and cefazolin powder added into it .
autogenous bone grafts from maxillary tuberosity area or bone removed during the site preparation from trephine were used to fill out the osteotomy site .
osteotome site was packed with bone and membrane after gradually adding bone particles and tapping it with osteotome and mallet .
if bleeding does not occur from the site , it shows that perforation happened in the sinus membrane .
trial implant is placed inside the osteotome site to check adequate width of osteotome site . after checking with trial implant ,
ten to twelve small holes were made with surgical quarter round bur on the buccal surface of the posterior maxilla to initiate fast healing at the implant site .
crushed bone pieces and the rest of mfdba particles are placed around the implant mainly on the buccal surface .
occlusal clearance between maxillary ridge bone and mandibular teeth is < 5 mm than cover screws are placed on the implant .
after repositioning the soft tissues , primary closure was attained using 4 - 0 chromic gut suture .
after 4 months , abutments were placed on the implants and restorative procedure was initiated .
no pathologic conditions in the implants site were seen on radiographic follow - ups after 8 months as seen in figure 2c .
implants were stable at the time of abutment connection which was performed after a healing period of 3 - 4 months .
patient reported full satisfaction for function , phonetics , and esthetics . at the osteotomy site ,
combination use of prf and bone grafts , it served as a cushion below the maxillary sinus floor , reducing the risk of perforation of the sinus membrane .
the elevation of the sinus membrane was one of the most delicate parts of the technique , and it was performed using osteotomes , with the prf and bone graft itself .
the ct scan carried out 8 months postinsertion showed a dense mineralized bone surrounding the implants . in the case , it was difficult to delineate the border line between sinus floor and newly formed tissue .
the original bone height below the sinus floor as measured on the preoperative ct scan was 1.47 and 1.49 mm at two sites and on second ct scan evaluation after 8 months postsurgery , the bone height achieved was of 15.42 mm and 16.94 respectively [ figures 14 ] .
( a ) cross - sectional view of the site of the right molar showing approximately < 2 mm bone height ( b ) cross - sectional view of the site of the right molar after 8 months showing approximately > 15 mm bone height ( a ) preoperative computerized tomography scan showing top view of the sinus membrane ( b ) postoperative computerized tomography scan after 8 months of implant placement showing sinus floor elevation without perforation and bone formation radiographic assessment of bone levels before and after implant placement between sinus membrane and ridge
the ct scan carried out 8 months postinsertion showed a dense mineralized bone surrounding the implants . in the case , it was difficult to delineate the border line between sinus floor and newly formed tissue .
the original bone height below the sinus floor as measured on the preoperative ct scan was 1.47 and 1.49 mm at two sites and on second ct scan evaluation after 8 months postsurgery , the bone height achieved was of 15.42 mm and 16.94 respectively [ figures 14 ] .
( a ) cross - sectional view of the site of the right molar showing approximately < 2 mm bone height ( b ) cross - sectional view of the site of the right molar after 8 months showing approximately > 15 mm bone height ( a ) preoperative computerized tomography scan showing top view of the sinus membrane ( b ) postoperative computerized tomography scan after 8 months of implant placement showing sinus floor elevation without perforation and bone formation radiographic assessment of bone levels before and after implant placement between sinus membrane and ridge
summer 's osteotomes modified techniques may allow performing a safe and effective osteotome - related sinus membrane elevation with simultaneous implant placement in posterior maxillary area , thereby drastically reducing the total treatment time , expense and also improve healing time . sinus membrane perforations using a conventional osteotomy
the proposal for using a material to weaken the impact of the sinus membrane from perforations was suggested by lazara et al.;(1998 ) however , the type of material was not specified .
therefore , in the present clinical case the choice was to use prf and bone graft materials , mainly because its biocompatibility , resilience , and availability .
the survival rate was 90% when autogenous bone alone was used , and the survival rate was 87% . when freeze - dried demineralized bone ( fddb ) bone alone was used .
the survival 98% when fddb bone and autogenous bone were both used together . based on data , the authors suggested implant survival rates can increase if the combinations of materials are used in an appropriate way .
this method has proven to be highly predictable to gain > 10 mm bone height in posterior maxillary area .
no complications have occurred in the patient treated thus far , and no implant failures have occurred . compare with other technique , which requires minimum 6 - 9 months of healing , this technique typically need only 3 - 4 months of healing .
main advantage of this technique is that implant and osteotomy site gets blood supply from buccal , lingual , mesial , and distal surfaces of blood vessels while in lateral window technique implant and bone grafts gets its blood supply largely from buccal surfaces of blood vessels . in lateral window approach risks , the possibility of breaching the blood supply , since arteries supplying the area are situated very close to mucoperiosteal region of the potential window site .
second reason could be prf , which promotes bone regeneration and soft tissue healing , improving bonding between bone and implant surface
. it also serves as protection barrier to the sinus membrane , it is much less expensive than commercial membrane .
prf may allow gentle elevation of membrane , and represent an excellent source of growth factors .
the platelets and the growth factors included in the fluid released by membrane may locally enhance bone regeneration as they come in contact with schneiderian membrane .
it also has consistent regenerative power as it combine with osteoprogenitor cells from mfdba and autogenous bone .
third reason could be autogenous bone graft from maxillary tuberosity area which has an osteogenic potential related to the number of surviving osteoblasts and potential osteoinductive effect brought about by the release of bone morphogenic proteins and other growth factors and it also accelerates the bone production sequence .
fourth reason could be mfdba , which gives the signal from their proteins to neighboring mesenchymal cells and differentiate them into bone producing cells .
several studies have demonstrated that the failure rate is higher when the bone crest is inferior to 5 mm . nevertheless ,
according to li , the osteotomy technique can be used even in residual ridges with heights of 3 - 4 mm , if primary stability has been achieved . in the present clinical case ,
the height of remaining bone was 1 - 2 mm , implant success rate was higher .
further investigation is needed to establish the actual contribution of prf , bone graft materials at osteotomy site to the positive outcome obtained with this modified technique , and to determine whether less residual bone height in maxilla can be successfully achieved with this modified technique .
the use of prf , mfdba , and autogenous bone during osfe technique and implantation is a secure and reliable option .
this autologous and inexpensive material can be considered as appropriate materials for adequate natural bone regeneration and soft tissue healing . however , in this technique the alveolar bone ridge height and its width is of prime importance and considerations .
the use of prf during a sinus lift , with a combination of mfdba and autogenous bone , may be beneficial , particularly for the posterior maxillary bone growth .
this modified method reduced total treatment time , expense of the patients and should be analyzed in further studies . | the osteotome technique is more predictable with simultaneous implant placement when there is < 5 - 7 mm of preexisting alveolar bone height beneath sinus
. proper combination of platelet rich fibrin , mineralized freeze - dried human bone allograft , and autogenous bone has been recommended for this situation .
the purpose of this article was to describe the proper method and materials which can grow > 10 mm bone with osteotome technique and grafting materials where the edentulous posterior maxilla radio - graphically showed less bone between the alveolar crest and sinus floor . | INTRODUCTION
CASE REPORT
RESULT
Computerized tomography scan results
DISCUSSION
CONCLUSION |
it is proving difficult to promote a high - level and fair distribution of health in the world s rapidly growing urban settings.1 urban health promotion is not simply a matter of the right interventions , or even the necessary resources .
urban ( and indeed global ) health depends , to an important extent , on governance , the institutions and processes through which societies manage the course of events .
there is a growing literature on governance and its impact on health.25 more importantly , people throughout the world are experimenting with governance strategies to improve urban life .
this paper draws on a thematic review of urban governance innovation prepared for the knowledge network on urban settings of the who commission on the social determinants of health ( csdh).6 here we describe the concept of governance , highlight exemplary innovations and describe strategies urban governors can use to maximize their influence on the national and international decisions that structure urban life .
we conclude with some observations on the limitations of local governance strategies and topics for further study .
governance is the management of the course of events in a social system.7 in the urban setting , it is the sum of the many ways individuals and institutions , public and private , plan and manage the common affairs of the city.8 responsible , capable and fair public institutions continue to be vital to good governance , but governance can not be understood as the work only of government.9 governance is polycentric , distributed among multiple organizations exercising diverse forms of power .
states do not enjoy a monopoly on governance , and themselves are often governed by non - state actors.10,11 governance thus comprises both institutions and procedures formalized in constitutions and laws , and the many institutions corporations , ngo coalitions and methods of power bribery , media campaigns that are only obscured by equating governance with government .
students of governance increasingly emphasize complexity , both of contemporary social and economic systems and of the governance networks that have emerged to manage them .
governance is understood not as an orderly , stable political science but as an art , a dynamic process of collective social improvisation in which a plethora of actors are striving to organize matters for their own advantage .
any given contemporary governance system may be inefficient , corrupt or unresponsive to the needs of the governed . aside from efficiency in delivering good results ,
good governance is commonly defined in terms of practical virtues rooted in human rights and the principle that governors derive their authority from the people .
these include participation , fairness , decency ( the degree to which rules are formed and implemented without humiliating or harming particular groups of people ) , accountability , sustainability and transparency.8 governance has always developed as an adaptation to social conditions .
this process of adaptation has produced some marvelous and durable institutions , practices and norms , but it can not be expected that governance solutions devised in 1648 or 1787 or even 1948 will in every case be adequate to the conditions of the present.12 even the best forms of governance can be worn down by the unrelenting efforts of competing factions to game or capture the system.7 leading thinkers on governance have criticized the tendency to treat past ways of delivering good government as the only possible forms , emphasizing the need for democratic experimentalism and institutional innovation.1113 innovation is crucial because the prevailing design principles of democratic governance like separation of powers , or even a written constitutionare losing their vitality.12 real governance may so differ from the formal rules that the formal local government decision - making process may be largely irrelevant to what actually happens.14 for some , taking complexity seriously means embracing the polycentric character of governance and designing governance systems that emphasize social learning and coordination rather than centralized , top - down management.11,15 one of the most important consequences of recognizing governance beyond government is the possibility of applying the norms that have traditionally constrained only states to powerful private governors . in a world
in which multinational corporations and wealthy foundations may wield as much power over certain decisions as governments , people are beginning to ask whether and how private governors can be required to be fair , transparent and accountable.16 governance is a necessary consideration in any program to understand and influence the social determinants of health.2,4 in the csdh s view , the level and distribution of health in a population depend on social and environmental factors operating at various levels of social organization and unfolding over time.17 governance reflects social structure and acts as one of the social mechanisms that sort people to unequal health outcomes by upholding existing distributions of resources like power , money and knowledge.18 those with the power to shape events in the community are able to organize matters in ways that benefit them and externalize undesirable effects on those less able to exert influence.19 participation in governance is at once a function and a catalyst of people s empowerment , and can therefore be seen as a pathway linking autonomy and social engagement to health.20 although data on the link between politics , policy and health are limited , there is some evidence that countries controlled by political parties with more egalitarian ideologies tend to have more economically redistributive policies and more equitable health outcomes.5 there is also evidence suggesting that participation in governance may be healthy for individuals and communities.21
our paper for the csdh examined cases of governance innovation in areas like policing , sanitation and housing .
we divided what we saw into two categories , reinventing government and reinventing governance .
reinventing government involves efforts to recalibrate traditional state institutions and practices to improve their capacity , often paradoxically by ceding the implementation of policy to non - state actors through devices like governance partnerships , self - regulation , and the use of markets as regulatory tools ( for example , environmental emissions trading schemes).22,23 many reinventing government schemes have been linked to a problematic neoliberal , smaller government ideology , and experience with measures like the privatization of water and sewer systems has not been entirely happy.24 we also found many instances of government reinvention that seemed to promote good government and healthy public policies .
participatory public expenditure management ( ppem ) is an excellent example.25 over the last two decades , participatory budgeting in which citizens take part in budget planning , overseeing public expenditures , and monitoring delivery of goods and services has grown from a brazilian experiment to an international model for socially accountable urban governance.26 the reform of land - tenure registration systems is another example .
uncertainty about ownership and tenure deprives poor people of the opportunity to convert property into capital for investment or home improvement , and undermines the incentive to improve housing stock and neighborhood amenities.27 reforms in property governance have simplified title registration systems and zoning rules.28 similar efforts have been made to eliminate bureaucratic barriers to small business entrepreneurship.29 reinventing governance aims more broadly to mobilize governors with little or no connection to the state.10,12,13 innovation has entailed developing new institutions and new tools of governance that can be placed at the disposal of stakeholders acting independently of or even in competition with traditional government institutions .
these typically involve ngos deploying soft strategies like information sharing and shaming ( see , for example , the people s health movement s alternative global health report30 ) but also harder market strategies like voluntary product certification schemes.31 our review found many successful examples in the urban setting .
community organizations have performed well in developing water and sewer systems , garbage collection , and local health promotion programs.3234 indeed , the world development report in 2006 called community participation probably the biggest influence on the success or failure of public sanitation facilities.35 unsatisfactory results from a thai government housing improvement program in the 1990s led to the creation of an independent public agency , the community organizations development institute ( codi ) .
codi has a partnership structure , with a board of government and civil society representatives , but works primarily through organizations and networks in the target communities that plan and implement housing upgrades in their own neighborhoods .
as of the end of 2004 , upgrading programs were proceeding on this model in 175 communities involving more than 14,000 households.36 the landscape of governance is littered with governance deficits , gaps between people s stake in governance and their access to governance institutions.37 many governance innovators have focused on developing models of governance that ensure that people have substantial and equal opportunities to participate directly in decisions that affect them.7,14,38 what has been called microgovernance involves seeding communities that have been excluded from governance with small institutions around which people can mobilize their knowledge and capacity.3 in south african townships , residents provide dispute resolution and community development services that traditional state bodies were failing to deliver through a new institution called the peace committee . in india ,
health promotion for sex workers has been built around collectives like the durbar mahila samanwaya committee in sonagachi.39 new governance practices like these not only change how specific activities are managed , but also potentially the dynamics of the larger urban governance system .
urban governors do not control many of the important determinants of urban well - being , from the amount of the national budget available to meet urban needs to the business decisions of leaders in the global economy . reinventing urban governance for health
is in practical terms a project of the weak . in the urban setting , it turns on poorer residents gaining a greater share of control and resources . at the national and global levels , it turns on local governors ability to influence the upstream determinants of their situation .
john braithwaite has described a set of strategies that the winners in the global game of governance have used to advantage themselves , and asked how these methods of power used by the strong might be adapted by the weak.37,40 in this section of the paper , we apply these strategies to healthy urban governance .
build and rebuild institutions of governance to increase participation and effectiveness.those who have little must manage what they have well .
defining the territorial and subject matter jurisdiction of metropolitan government structures is also fundamental , although decades of effort have not produced a generally applicable solution.41 new governance strategies of privatization and self - regulation can be tools of more efficient public management .
ppem , community policing and other practices that increase the meaningful involvement of stakeholders have shown good results , but do not replace and indeed may depend on the vitality of governance institutions outside the government . funding ( and minimizing legal barriers on ) ngos , microgovernance initiatives and institutional innovations that devolve power to stakeholders can all increase urban governance capacity by mobilizing the resources and capacities of communities that currently have no real access to governance.network governance.once a wide range of governance institutions are active , building connections among them and with compatriots in other urban settings allows the weak to increase their resources for advocacy and upstream governance .
networks like the asian coalition for housing rights and slum / shack dwellers international ( sdi ) not only take local action but also work together to support each other from community to community within cities , from city to city within nations , and internationally.42(p 2),4345 the healthy cities movement and regional health promotion networks , through which areas in close geographic proximity pool resources and expertise , exemplify the type of cooperation necessary to global health.46concentrate technical competence at network nodes.effective networks of governance typically create nodes on the network that concentrate resources and technologies for the purpose of achieving a common goal.7,47 technical expertise and the capacity to rapidly gather , interpret and respond to information helps weaker actors compete successfully with stronger ones.37 the campaign of developing countries and hiv / aids advocates to mitigate the impact of the trips agreement on access to essential medicines demonstrated the importance of organizing networks around institutions of technical competence such as medecines sans frontieres and the consumer project on technology.48 another example is the health promotion foundation , like vichealth in australia , designed as a reliably funded source of expertise and advocacy in the cause of better health governance.49focus on forums where urban governors can be creative and assertive.many powerful governing institutions and systems are not concerned about the welfare of urban settings .
if weak actors engage in governance in and through organizational nodes that others , particularly rich and powerful others , have established and work through , they will typically find themselves at a disadvantage because they will find that the agendas of others have been built into nodal processes.37 forum shifting may be defined as relocating interactions ( like negotiation or regulation ) from an institution of governance in which an actor encounters resistance to one where it is likely to achieve its objective .
forum shifting has been an extremely useful tool of the powerful ; it can also work for weaker players like cities and ngos .
local governments are forum shifting when , for example , they file law - suits against gun makers in places where provincial and national legislatures have rejected gun - control regulation.50 ppem creates a new forum for spending decisions in which non - state actors have more authority in relation to local government officials.51 ngos like peace committees and water cooperatives also represent a forum shift : unsatisfied with the services they are getting within a scheme of government provision , they create a new service - providing institution in which they have greater control over processes and outcomes.have a responsive regulatory strategy.this is a generic best practice of power in any forum .
responsive regulation entails using the least expensive and intrusive form of action needed to secure compliance.52 dialogue is more efficient than threats ; threats are more efficient than actually imposing sanctions .
but as braithwaite points out , a responsive strategy is more than good technique : it has two even deeper virtues .
first , it represents a way of understanding governance in a democracy based on responding to peoples problems , environments , demands .
the obligation to respond to others in the society is a vital example of the relational checks and balances that constrain power in a polycentric governance system .
second , responsiveness embodies the capacity for learning and the openness to new information that are characteristic of effective governance institutions.53have a big stick and threaten to use it.even responsive regulators sometimes crack down hard .
urban communities are weak in relation to national governments , multinational corporations and international donors , but they are not powerless .
urban governors have a variety of sticks , from networked advocacy and shaming strategies , through regulations and taxes , to debt default . weak
actors have proven reasonably effective at influencing global policy not just by speaking up for the interests of poorer regions in international fora , but by taking the battle into the media and domestic politics.40 build and rebuild institutions of governance to increase participation and effectiveness .
defining the territorial and subject matter jurisdiction of metropolitan government structures is also fundamental , although decades of effort have not produced a generally applicable solution.41 new governance strategies of privatization and self - regulation can be tools of more efficient public management .
ppem , community policing and other practices that increase the meaningful involvement of stakeholders have shown good results , but do not replace and indeed may depend on the vitality of governance institutions outside the government .
funding ( and minimizing legal barriers on ) ngos , microgovernance initiatives and institutional innovations that devolve power to stakeholders can all increase urban governance capacity by mobilizing the resources and capacities of communities that currently have no real access to governance .
once a wide range of governance institutions are active , building connections among them and with compatriots in other urban settings allows the weak to increase their resources for advocacy and upstream governance .
networks like the asian coalition for housing rights and slum / shack dwellers international ( sdi ) not only take local action but also work together to support each other from community to community within cities , from city to city within nations , and internationally.42(p 2),4345 the healthy cities movement and regional health promotion networks , through which areas in close geographic proximity pool resources and expertise , exemplify the type of cooperation necessary to global health.46 concentrate technical competence at network nodes . effective networks of governance typically create nodes on the network that concentrate resources and technologies for the purpose of achieving a common goal.7,47 technical expertise and the capacity to rapidly gather , interpret and respond to information helps weaker actors compete successfully with stronger ones.37 the campaign of developing countries and hiv / aids advocates to mitigate the impact of the trips agreement on access to essential medicines demonstrated the importance of organizing networks around institutions of technical competence such as medecines sans frontieres and the consumer project on technology.48 another example is the health promotion foundation , like vichealth in australia , designed as a reliably funded source of expertise and advocacy in the cause of better health governance.49 focus on forums where urban governors can be creative and assertive .
many powerful governing institutions and systems are not concerned about the welfare of urban settings .
if weak actors engage in governance in and through organizational nodes that others , particularly rich and powerful others , have established and work through , they will typically find themselves at a disadvantage because they will find that the agendas of others have been built into nodal processes.37 forum shifting may be defined as relocating interactions ( like negotiation or regulation ) from an institution of governance in which an actor encounters resistance to one where it is likely to achieve its objective .
forum shifting has been an extremely useful tool of the powerful ; it can also work for weaker players like cities and ngos .
local governments are forum shifting when , for example , they file law - suits against gun makers in places where provincial and national legislatures have rejected gun - control regulation.50 ppem creates a new forum for spending decisions in which non - state actors have more authority in relation to local government officials.51 ngos like peace committees and water cooperatives also represent a forum shift : unsatisfied with the services they are getting within a scheme of government provision , they create a new service - providing institution in which they have greater control over processes and outcomes .
responsive regulation entails using the least expensive and intrusive form of action needed to secure compliance.52 dialogue is more efficient than threats ; threats are more efficient than actually imposing sanctions .
but as braithwaite points out , a responsive strategy is more than good technique : it has two even deeper virtues .
first , it represents a way of understanding governance in a democracy based on responding to peoples problems , environments , demands .
the obligation to respond to others in the society is a vital example of the relational checks and balances that constrain power in a polycentric governance system .
second , responsiveness embodies the capacity for learning and the openness to new information that are characteristic of effective governance institutions.53 have a big stick and threaten to use it . even responsive
urban communities are weak in relation to national governments , multinational corporations and international donors , but they are not powerless .
urban governors have a variety of sticks , from networked advocacy and shaming strategies , through regulations and taxes , to debt default .
weak actors have proven reasonably effective at influencing global policy not just by speaking up for the interests of poorer regions in international fora , but by taking the battle into the media and domestic politics.40
strong local governance has its pitfalls.54,55 those with greater resources of experience , money or skill can game the local system as they can a national government.56 the voices of the poorer , weaker , more socially marginal can be ignored .
urban settings often have large populations of illegal internal or international migrants whose right to participate is contested.57 urbanites do not necessarily , or even most of the time , organize themselves and vote as urban dwellers , but rather act as members of ideological or ethnic blocks organized around national political issues that may reflect and worsen divisions at the local level.14 urban governors are part of a system that works best as it approaches the ideal of a virtuous circuit ( see figure 1 ) . at any level of social organization ,
governing institutions require the capacity to mobilize and coordinate local resources , but from a global governance perspective , vertical coordination and participation are essential .
the best of interventions organized at the global level will suffer if the national , provincial and especially the local institutions of governance are bypassed or lack the capacity for effective implementation .
even the imposition of good solutions in a top down manner , without real decision - making participation by those most affected , is paternalistic and illegitimate from a democratic perspective .
good governance requires the interplay of power and constraint to forestall dysfunctional phenomena such as capture .
good national and international governance can be a source of norms , and a recourse for those excluded from local decision making.55 national governments provide the policy environment in which local government and governance can innovate , or not.58,59 it is not even clear that empowering urban areas leads to greater attention to urban inequities : although central governments are unlikely to be generally more pro - poor than local governments , it may be easier for central governments to insist on pro - poor use of grant resources than for local governments to use their own resources in that way.14(p 14 ) local governments typically are short not just on cash but on properly trained bureaucrats with the skills and incentives to use their power productively .
the strategies we have discussed here are hardly new to local health advocates ; the problem is that lack of resources can limit efficacy at every step . improving skills in governance , widening the repertoire of strategies , will make poor urbanites more effective , but local governors also need access to the resources controlled by higher levels of governance .
the promotion of innovation in healthy urban governance will benefit from a significant investment in research and practice . on the research side ,
more support is required for the study of the design principles or grammars of successful governance , particularly outside of and in partnership with government.60 it is even more important to fund governance entrepreneurs reinventing governance in communities around the world , and to support ongoing community processes of governance reinvention .
stories for researchers , governments and ngos unless they can be replicated at a sufficient scale to influence the condition of the mass of urbanites.58,61 international funders and governments speak about the importance of good governance and strong civil society , but investment in general governance capacity , unlinked to a particular categorical program or specific objective , is still too rare .
people can learn to better improvise , but no amount of research or technology transfer will turn governance from an art into a science .
it will be difficult to prove that any particular form or process of governance causes urban health to improve , yet we have more than enough reasons to prefer good governance over the alternative .
good governance is not just valuable for the ends it promotes , but for the process of collective cultural imagination it represents .
urban settings are places where the world can be re - imagined , where efforts at reform create the context for new ideas and further action , and where new norms are formed.62,63 the world s urban settings present an enormous opportunity to define and implement healthy public policy through governance innovation . | urban health promotion is not simply a matter of the right interventions , or even the necessary resources . urban ( and indeed global ) health depends to an important extent on governance , the institutions and processes through which societies manage the course of events .
this paper describes the concept of governance , distinguishing between reforms aimed at improving how government works and innovations that more fundamentally reinvent governance by developing new institutions and processes of local stakeholder control .
the paper highlights strategies urban governors can use to maximize their influence on the national and international decisions that structure urban life .
it concludes with some observations on the limitations of local governance strategies and the importance of establishing a virtuous circuit of governance through which urban dwellers play a greater role in the formation and implementation of policy at the national and global levels . | INTRODUCTION
GOVERNANCE AND THE SOCIAL DETERMINANTS OF HEALTH
THE LANDSCAPE OF GOVERNANCE INNOVATION: FROM REINVENTING GOVERNMENT TO REINVENTING GOVERNANCE
INNOVATIVE STRATEGIES FOR URBAN GOVERNANCE: HEALTHY AND POWERFUL CITIES
CONCLUSION: CHALLENGES OF HEALTHY URBAN GOVERNANCE |
the clustered regularly interspaced short palindromic repeat ( crispr)-associated system ( cass ) comprises the particular repeated element crispr itself , the promoter for its transcription ( also called the leader ) and a set of cas genes responsible for its maintenance and function ( 1,2 ) .
it is found in most archea and 40% bacteria , and is linked to a mechanism of acquired resistance against bacteriophages ( 3 ) .
some genomes harbour a significant number of crisprs [ 18 in methanocaldococcus jannaschii dsm 2661with three different direct repeats ( drs ) ] ( 4 ) .
when different crisprs with the same dr are present in a genome , they have a very similar leader , generally different spacers , and only one is associated with cas genes ( 5 ) . when crisprs from different crispr families exist in the same genome ,
one set of cas genes specific for each family is present . finally , within a species
the example of the three sequenced strains of streptococcus thermophilus is very illustrative of this situation , since three crisprs were identified in this species but only strain lmd-9 possesses the three of them ( 4 ) .
crisprs evolve either by deletion or acquisition of units ( a dr and a spacer ) following a mechanism proposed firstly by pourcel et al .
( 6 ) and recently confirmed ( 79 ) . in the majority of cases ,
new units are added at one end of the crispr adjacent to the leader , whereas motif deletions can occur randomly .
the independent acquisition of the same spacer twice is possible but is not frequent and easily detected .
thus , the presence of identical spacers in the same crispr locus in distinct strains reflects shared ancestry .
the standard and classical technology developed for mycobacterium tuberculosis typing ( 10 ) is the spoligotyping , which consists in detecting the presence / absence of a range of spacers .
this technique and other pcr - based typing methods have been applied in crispr genotyping to study other bacterial species ( 6,1116 ) .
we recently implemented a program ( crisprfinder ) allowing the identification of a crispr structure based on a thorough characterization of its components , i.e. the dr and the spacers ( 17 ) . using this program ,
public genome sequences are analysed and the extracted crisprs are stored into a database ( crisprdb ) ( 4 ) .
crisprfinder and crisprdb are accessible on the web together with different tools that assist in recovering spacers and dr sequences , and blasting them against genbank .
we now report on the development of a new website dedicated to the comparison of crisprs between strains and the labelling of spacers when multiple alleles are analysed .
crisprcompar is a friendly web resource offering tools to compare crisprs between strains of a given species or between closely related species , and to classify the spacers .
crisprcomparison identifies and compares the crisprs of two or more genomes ( complete or partial sequences ) .
it is particularly useful when strains of a species possess several crisprs for which positions on the genome might vary , as a result for instance of large - scale genome rearrangements , or of presence absence polymorphism of crispr loci in the genomes of interest .
the similarity criteria are based on having an identical consensus dr and similar flanking sequences .
the flanking sequences are compared by the clustalw alignment of the 200 bp adjacent sequences to the crispr with a threshold of 90% of similarity . in the majority of cases , when multiple crisprs with the same dr are present in a genome , only one flanking sequence is similar , the one corresponding to the leader .
crisprtionary lists the spacers from different alleles derived from the same crispr locus and annotates them in a polarized fashion .
such data will be produced for instance when investigating the diversity ( evolution ) of crisprs within a species by sequencing the locus in different isolates .
crisprfinder is used to identify the dr and order the spacers according to the dr sequence . when sequencing pcr products , the first few nucleotides may be missed or the data may be of poor quality .
in addition , the first , often partial and degenerated dr ( up to 50% of differences have been observed ) may be missed by crisprfinder in this context .
for this reason , a filter exploring the existence of stretches of additional dr in the flanking sequence was added so as to correctly identify the first spacer .
it consists in blasting the two halves of the dr against the remaining nucleotides of the allele sequence .
given the mechanism of acquisition of new spacers , we recommend to orientate the crispr such that the degenerated dr is located on the left extremity and the leader is on the right .
these criteria are convenient to attribute increasing numbers to the spacers from left to right , according to their acquisition order , i.e. the more recently added spacer close to the leader will be given the highest number .
the crisprcompar program automatically recovers from crisprdb all strains containing a crispr and proposes to compare each of them using the alphabetic list ( alternatively , all strains from a given genus can be selected at once using the strain taxonomy browser ) . to compare unpublished sequences and genomes , a private database on the model of crisprdb ( 4 )
once a selection of sequences has been performed , the compare button leads to a page where it is possible to choose the strain that will be used as a reference for the crisprs annotation . at this step ,
when several alleles of a given locus are present in the submitted sequences , their spacers can be annotated using crisprtionary .
fasta files containing sequenced crispr alleles can also be directly submitted to crisprtionary . for the crisprcomparison application ,
information is given on the crispr position and on the number of repeats ( figure 1a ) .
when two or more alleles of a given crispr are found , the flanking sequences can be aligned and a link is provided to the second application crisprtionary to annotate and classify the spacers . by activating the compare spacer button a table is shown in which the crispr sequences are provided in fasta format ( figure 1b ) . at this step , it is possible to upload a previous dictionary of spacers to which the spacers of the new crispr alleles will be compared .
if no pre - determined dictionary exists , one will be created in the following steps . with the findcrispr button ,
one is due to the existence of several possible drs , especially with short sequences ( less than four units ) and another is due to the crispr orientation on the genome . indeed , when the submitted alleles are in different orientations , two dr sequences will be proposed .
therefore , the user should select the appropriate consensus dr or introduce a dr sequence .
the find spacer button leads to a page where spacers are labelled ( figure 1c ) and different files can be recovered : ( i ) different formats of text and tab - delineated text files representing the corresponding crisprs and spacers labels ( annotfasta , annotfasta_codedalleles , fasta_codedalleles , table_coded_alleles ) , ( ii ) spacers dictionary which is a tab - delineated text file containing a catalogue of the found spacers and their labels and ( iii ) binary file : a tab - delineated text - file where columns represent the spacer labels and rows represent the queried alleles . for each crispr
the binary file is especially interesting for providing a spoligotyping - like profile of the crispr and to visually illustrate the spacer composition in the strains .
the different files may be used in further studies such as the evolutionary analysis of the species according to the spacer organization in the different strains or for epidemiological purposes .
figure 1.example of crisprcompar and crisprtionary output using the three s. thermophilus genomic sequences ( refseq : nc_006449 , nc_008532 , nc_006448 ) .
three crisprs are identified , of which two are found in two or more strains .
example of crisprcompar and crisprtionary output using the three s. thermophilus genomic sequences ( refseq : nc_006449 , nc_008532 , nc_006448 ) . ( a ) table showing the classification of the different crisprs .
three crisprs are identified , of which two are found in two or more strains .
the last step may be added to improve the output ; this is called the re - annotation step .
it might be interesting when a collection of alleles has been analysed to re - annotate the spacers such that numbering is increasing starting from one end of the crispr .
we propose that the oldest spacer , i.e. the one near the degenerated dr , when the later is identified , be given the label 1 and subsequent ones increasing numbers .
the re - annotation tool modifies the labels such that all the labels inside an allele are in an increasing order and a new set of output files is produced .
sometimes , a duplication of one or several spacers may occur and in this case , the term
on figure 2 is shown the distribution and annotation of spacers in six members of the m. tuberculosis complex ( mtbc ) .
the profile corresponds to the order of spacers described upon sequencing of a collection of alleles ( 18 ) .
however , and similarly to a real spoligotype , the presence in the same allele of two identical spacers is not indicated .
figure 2.schematic representation of the crispr repeats organization in four m. tuberculosis and two m. bovis strains .
the binary file produced by crisprtionary , after the spacers have been re - annotated , is used to produce a figure in which the presence of a spacer is indicated by a dark square .
the detail of the spacer composition for each strain is indicated in the bottom part of the figure .
schematic representation of the crispr repeats organization in four m. tuberculosis and two m. bovis strains . the binary file produced by crisprtionary , after the spacers have been re - annotated ,
is used to produce a figure in which the presence of a spacer is indicated by a dark square .
the detail of the spacer composition for each strain is indicated in the bottom part of the figure .
the crisprcompar program automatically recovers from crisprdb all strains containing a crispr and proposes to compare each of them using the alphabetic list ( alternatively , all strains from a given genus can be selected at once using the strain taxonomy browser ) . to compare unpublished sequences and genomes , a private database on the model of crisprdb ( 4 )
once a selection of sequences has been performed , the compare button leads to a page where it is possible to choose the strain that will be used as a reference for the crisprs annotation . at this step ,
when several alleles of a given locus are present in the submitted sequences , their spacers can be annotated using crisprtionary .
for the crisprcomparison application , the result is shown in a table where crisprs are grouped .
information is given on the crispr position and on the number of repeats ( figure 1a ) .
when two or more alleles of a given crispr are found , the flanking sequences can be aligned and a link is provided to the second application
crisprtionary to annotate and classify the spacers . by activating the compare spacer button a table is shown in which the crispr sequences are provided in fasta format ( figure 1b ) . at this step , it is possible to upload a previous dictionary of spacers to which the spacers of the new crispr alleles will be compared .
if no pre - determined dictionary exists , one will be created in the following steps . with the findcrispr button ,
one is due to the existence of several possible drs , especially with short sequences ( less than four units ) and another is due to the crispr orientation on the genome . indeed ,
when the submitted alleles are in different orientations , two dr sequences will be proposed .
therefore , the user should select the appropriate consensus dr or introduce a dr sequence .
the find spacer button leads to a page where spacers are labelled ( figure 1c ) and different files can be recovered : ( i ) different formats of text and tab - delineated text files representing the corresponding crisprs and spacers labels ( annotfasta , annotfasta_codedalleles , fasta_codedalleles , table_coded_alleles ) , ( ii )
spacers dictionary which is a tab - delineated text file containing a catalogue of the found spacers and their labels and ( iii ) binary file : a tab - delineated text - file where columns represent the spacer labels and rows represent the queried alleles . for each crispr
the binary file is especially interesting for providing a spoligotyping - like profile of the crispr and to visually illustrate the spacer composition in the strains .
the different files may be used in further studies such as the evolutionary analysis of the species according to the spacer organization in the different strains or for epidemiological purposes .
figure 1.example of crisprcompar and crisprtionary output using the three s. thermophilus genomic sequences ( refseq : nc_006449 , nc_008532 , nc_006448 ) .
three crisprs are identified , of which two are found in two or more strains .
example of crisprcompar and crisprtionary output using the three s. thermophilus genomic sequences ( refseq : nc_006449 , nc_008532 , nc_006448 ) .
three crisprs are identified , of which two are found in two or more strains .
the last step may be added to improve the output ; this is called the re - annotation step .
it might be interesting when a collection of alleles has been analysed to re - annotate the spacers such that numbering is increasing starting from one end of the crispr .
we propose that the oldest spacer , i.e. the one near the degenerated dr , when the later is identified , be given the label 1 and subsequent ones increasing numbers .
the re - annotation tool modifies the labels such that all the labels inside an allele are in an increasing order and a new set of output files is produced .
sometimes , a duplication of one or several spacers may occur and in this case , the term
is shown the distribution and annotation of spacers in six members of the m. tuberculosis complex ( mtbc ) .
the profile corresponds to the order of spacers described upon sequencing of a collection of alleles ( 18 ) .
however , and similarly to a real spoligotype , the presence in the same allele of two identical spacers is not indicated .
figure 2.schematic representation of the crispr repeats organization in four m. tuberculosis and two m. bovis strains .
the binary file produced by crisprtionary , after the spacers have been re - annotated , is used to produce a figure in which the presence of a spacer is indicated by a dark square .
the detail of the spacer composition for each strain is indicated in the bottom part of the figure .
schematic representation of the crispr repeats organization in four m. tuberculosis and two m. bovis strains . the binary file produced by crisprtionary , after the spacers have been re - annotated ,
is used to produce a figure in which the presence of a spacer is indicated by a dark square .
the detail of the spacer composition for each strain is indicated in the bottom part of the figure .
the crisprcompar web server proposes a set of bioinformatic tools assisting biologists in the development and the setting up of a crispr genotyping scheme . in the pre - processing phase ,
the comparison of crisprs is mandatory and may be fulfilled using the crisprcomparison tool , which helps in selecting the most appropriate crispr loci and associated primers for the pcr amplification .
crisprcomparison allows the identification of families of strains that share a crispr , inside species with high genetic diversity or the identification of homologous crisprs within species containing multiple crispr loci . in the post - processing phase ,
the crisprtionary program is very interesting since it allows the user to easily compare multiple alleles of a crispr locus investigated in a collection of strains and to obtain pre - calculated files that may be directly used in clustering analysis .
many clustering methods are applicable and may provide a good clustering of the strains even if these methods usually do not take full advantage of the crispr rules of evolution , which could be used to better assess in addition to forming groups of related strains parental relations between taxa .
the primary evolutionary events considered are motifs insertion and deletion . in the case of inactive ( in terms of spacer acquisition ) crisprs , only deletions are possible , and the camin soakal ( 19 ) parsimony model may be considered . in camin
soakal parsimony , two states are considered ( 0 and 1 for example ) , and no transition from derived state back to ancestral state is allowed . for an inactive crispr locus ,
the ancestral state is the presence of a unit and the derived state is unit absence ; thus only deletion changes are allowed .
our future developments of crisprcompar will incorporate applications such as the mix program of the package phylip ( felsenstein ) , which carries out the camin | clustered regularly interspaced short palindromic repeat ( crispr ) elements are a particular family of tandem repeats present in prokaryotic genomes , in almost all archaea and in about half of bacteria , and which participate in a mechanism of acquired resistance against phages .
they consist in a succession of direct repeats ( dr ) of 2447 bp separated by similar sized unique sequences ( spacers ) . in the large majority of cases , the direct repeats
are highly conserved , while the number and nature of the spacers are often quite diverse , even among strains of a same species .
furthermore , the acquisition of new units ( dr + spacer ) was shown to happen almost exclusively on one side of the locus .
therefore , the crispr presents an interesting genetic marker for comparative and evolutionary analysis of closely related bacterial strains .
crisprcompar is a web service created to assist biologists in the crispr typing process .
two tools facilitates the in silico investigation : crisprcomparison and crisprtionary .
this website is freely accessible at http://crispr.u - psud.fr / crisprcompar/. | INTRODUCTION
METHODS AND IMPLEMENTATION
Input
Output
DISCUSSION AND CONCLUSIONS |
the reverse shoulder prosthesis is one surgical option for treatment of cuff tear arthropathy and shoulder pseudoparalysis resulting from a massive cuff tear , severe fractures , prosthetic revision , and tumor surgery .
owing to the mechanical advantage of a medialized center of rotation , the reverse shoulder prosthesis offers a potentially valuable surgical option and has become an alternative in situations in which the rotator cuff and/or the proximal humerus are destroyed or absent , with a satisfying reduction of pain after surgery [ 12 , 31 ] .
however , because of the wide variation in published values for active elevation after reverse shoulder replacement ( ranging from 88 to 138 [ 3 , 36 ] ) , the degree to which this prosthesis restores arm strength is not fully defined .
previously found a better passive than active rom and presumed that the limited glenohumeral motion of the reverse prosthesis resulted from a lack of joint torque generation rather than a structural limitation caused by the prosthetic design .
shoulder strength mostly has been evaluated using subjective methods such as traditional manual muscle testing and handheld dynamometry , which mainly focus on isometric muscle strength . the strength measure in the constant - murley score
because most functional activities are dynamic , evaluating isokinetic shoulder strength may be more appropriate when relating strength to functional performance and clinical outcome .
however , data for isokinetic strength measurements around the shoulder are available only for normal healthy subjects , patients after open fixation of glenoid rim fractures , open [ 1 , 10 ] and arthroscopic anterior stabilization [ 15 , 21 ] , rotator cuff surgery [ 4 , 11 , 14 , 34 , 43 ] , with adhesive capsulitis [ 26 , 27 , 41 ] , subacromial impingement [ 16 , 24 , 30 ] , and pectoralis major muscle rupture , but not for patients with a reverse shoulder prosthesis .
our objective was to perform a pilot study to measure isometric shoulder strength in patients who underwent either a primary or revision reverse shoulder replacement .
we asked the following questions : ( 1 ) what joint torques can patients with a reverse shoulder prosthesis produce isokinetically , and ( 2 ) does this force - generating capacity correlate with functional scores ?
between may 2000 and september 2007 , we treated 45 patients ( 49 shoulders ) with a reverse shoulder prosthesis ( tornier ; edina , mn , usa ) .
of these , 33 patients ( 19 women and 14 men ) , volunteered to participate in this study .
ten patients had surgery on the left side , 19 on the right side , and four on both sides ( total of 37 shoulders ) . in 21 patients ,
the indication for the reverse prosthesis was cuff tear arthropathy , and in 16 patients the indication was revision after a failed primary placed hemiprosthesis or total shoulder prosthesis .
the average time between surgery and measurement was 23 14 months ( range , 463 months ) .
mean age of the patients was 72 8 years ( range , 5885 years ) .
the minimum clinical followup was 4 months ( mean , 23 months ; range , 463 months ) .
the institutional ethics committee approved the research protocol and all patients gave their written informed consent before the experiment .
all patients underwent surgery under general anesthesia with an interscalene nerve block in the beach - chair position .
all glenoid components had been placed inferior on the glenoid surface with no inferior or superior inclination .
the humeral components had all been placed in 10 to 20 retroversion , and in 32 patients , the teres minor and subscapularis muscles were still intact .
postoperative management was the same for all patients , consisting of a sling and passive rom exercises for 6 weeks .
after 6 weeks , active assisted rom exercises were started and at 3 months , strengthening exercises were added to the rehabilitation program .
shoulder strength was measured with an isokinetic dynamometer , which provides constant velocity with accommodating resistance throughout a joint s rom .
this resistance is provided using an electric or hydraulic servo - controlled mechanism at a user - defined constant velocity .
two isokinetic protocols were performed to measure the strength of the subjects shoulder muscles on the surgically treated side using the biodex system 3 pro dynamometer ( biodex medical systems , new york , ny , usa ) .
these protocols consisted of an abduction and adduction task and an external and internal rotation task with the arm in 60 abduction in a sitting position with securing bands around the subject s chest and pelvis . for the abduction and adduction task ,
the chair was rotated 75 around the vertical axis with the dynamometer in neutral position and 10 tilted . for the external and internal rotation task ,
the chair was in the neutral position with the dynamometer rotated 20 and 50 tilted .
after one session of the abduction and adduction or the external and internal rotation task , the subject had a 60-second recovery time after which the same task was repeated .
all tasks were repeated five times at 60 per second with a minimum standard threshold of 15 per second to start the measurements defined by the biodex system . for each motion , the average maximal torque ( nm )
the subjects were instructed and encouraged to reach the highest possible force level during these tasks .
negative axial rotation was defined as external rotation and positive axial rotation as internal rotation .
reported a systematic review of the literature on isokinetic strength of the shoulder until 2005 .
we used pubmed to identify other articles providing data for normal shoulder torque values from 2005 and onward [ 2 , 20 , 37 , 42 ] . from those studies we took the abduction - adduction and/or external - internal rotation torque values for 60 per second or less and combined those to make comparison possible with our obtained data ( table 1).table 1maximum generated force in nm for our data compared with the literature at similar or lower velocitiesstudysubjectmean age ( years)dominance or sidevelocityabductionadductionexternal rotationinternal rotationambrosio et al .
m = male ; f = female ; d = dominant ; nd = nondominant .
maximum generated force in nm for our data compared with the literature at similar or lower velocities m = male ; f = female ; d = dominant ; nd = nondominant . for clinical evaluation
, we obtained preoperative and postoperative ( absolute and relative ) constant - murley scores [ 8 , 9 ] , postoperative dash score , and the ( d)sst [ 23 , 40 ] .
the absolute constant - murley score assesses the overall shoulder function and has a maximum score of 100 points .
the relative constant - murley score is corrected for the age- and sex - related decline in force - generating capacity .
the dash is a 30-item questionnaire that evaluates functional disability in everyday activities , work , and sports .
a dash score of 0 indicates good shoulder function , or no disability , and the maximum score of 100 indicates no function . the ( d)sst is a questionnaire consisting of 13 yes or no questions including subjective items and items that require patients to complete a physical exercise .
it evaluates shoulder function in daily activities and a maximum score of 13 indicates good shoulder function .
we used a t - test to determine the difference in mean maximum generated torque at 60 per second between primary and revision cases .
for this same group , the effect size was determined by calculating the cohen s d. the relationship between the clinical outcome scores ( constant - murley , dash , and [ d]sst ) and strength data was evaluated on the basis of a pearson product - moment correlation .
only 23 patients ( 24 shoulders ; 13 primary and 11 revisions ) were able to generate sufficient velocity to perform the test , resulting in a mean abduction torque of 15.2 nm 6.6 nm for the whole group with no substantially better value for the primary prostheses compared with the revisions ( table 2 ) .
for the external and internal rotation torques , these values varied between 13% and 71% .
we found similar torque values for adduction also with no major difference between primary and revision cases .
the external and internal rotation tasks could be performed by only 13 patients ( 14 shoulders ; nine primaries , five revisions ) .
mean external rotation torque was 9.3 nm 4.4 nm for the whole group with no major differences between the primary and revision groups .
internal rotation force tended to be higher ( p = 0.07 ) for primary prostheses with a torque of 8.2 nm 2.6 nm for the whole group ( table 2 ) . compared with normal healthy subjects ( table 1 ) ,
patients with a reverse prosthesis who could generate sufficient force to perform the tasks had abduction and adduction torques of 19% to 78% of those of a normal shoulder at a velocity of 60 per second.table 2mean maximum generated force ( nm ) and sd at 60 per second for the whole groupmaximum torque at 60 per secondall shoulders ( n = 24)primary ( n = 13)revision ( n = 11)p value primary versus revisioncohen s d primary versus revisionabduction15.2 6.616.3 5.613.4 7.60.300.43adduction16.1
= 14)(n = 9)(n = 5)external rotation9.3 4.49.3 4.77.9
4.00.580.32internal rotation8.2 2.69.2 2.16.0 2.50.071.38 mean maximum generated force ( nm ) and sd at 60 per second for the whole group we found a correlation between the postoperative constant - murley score and the abduction and external rotation torques ( fig . 1 ) .
similar correlations were found for the dash score and ( d)sst ( table 3 ) , with the maximum torque values at 60 per second .
an overview of all the clinical outcome scores of the whole group , the primary and the revision cases is presented ( table 4).fig .
1pearson s correlation between the maximal abduction and external rotation torque at 60 per second and the postoperative constant - murley score show a correlation between the force - generating capacity of patients with a reverse shoulder prosthesis and their postoperative constant - murley score for abduction and external rotation.table 3pearson s correlation between maximum torque at 60 per second and the postoperative constant - murley score , dash , and ( d)sstmaximum torque at 60 per secondconstant - murley scoredash(d)sstabduction0.507p = 0.0140.572p = 0.0040.519p = 0.011adduction0.393p = 0.1830.319p = 0.290.408p = 0.166external rotation0.614p = 0.0260.531p = 0.0620.600p = 0.03internal rotation0.441p = 0.2160.498p = 0.2050.455p = 0.206(d)sst = dutch translation of the simple shoulder test.table 4constant - murley scores , relative constant - murley scores , dash scores , and ( d)sstscoresall shoulders sd ( range)primary sd ( range)revision sd ( range)constant - murley preoperative24 11 ( 547)28 9 ( 1347)20 12 ( 547)constant - murley postoperative50 21 ( 887)59 20 ( 887)38 18 ( 1173)relative constant - murley preoperative33% 17% ( 771)38% 14% ( 1968)27% 18% ( 771)relative constant - murley postoperative70% 31% ( 9124)83% 30% ( 9124)53% 22% ( 1492)dash postoperative43.9 25.6
( 1.784.2)31.5 24.4 ( 1.777.5)60.3 17.1 ( 31.284.2)(d)sst postoperative7 4 ( 013)8 4 ( 013)4 3 ( 110)(d)sst = dutch translation of the simple shoulder test .
pearson s correlation between the maximal abduction and external rotation torque at 60 per second and the postoperative constant - murley score show a correlation between the force - generating capacity of patients with a reverse shoulder prosthesis and their postoperative constant - murley score for abduction and external rotation .
pearson s correlation between maximum torque at 60 per second and the postoperative constant - murley score , dash , and ( d)sst ( d)sst = dutch translation of the simple shoulder test .
constant - murley scores , relative constant - murley scores , dash scores , and ( d)sst ( d)sst = dutch translation of the simple shoulder test .
the reverse shoulder prosthesis provides a surgical option for conditions such as cuff tear arthropathy , shoulder pseudoparalysis resulting from massive cuff tear , severe fractures , prosthetic revision , and tumor surgery with generally satisfying postoperative results [ 12 , 31 ] .
however , the contribution of this prosthesis to restoration of arm function is less clear .
previous research suggests the limited glenohumeral motion of the reverse prosthesis seems to be the result of a lack of joint torque generation rather than a structural limitation caused by the prosthetic design .
therefore , the evaluation of isokinetic shoulder strength after reverse shoulder replacement may be of interest in modeling dynamic upper extremity function , particularly where comparative data are not currently available for this clinical scenario .
we therefore ( 1 ) determined joint torques in patients with a reverse shoulder prosthesis and ( 2 ) determined whether force - generating capacity correlates with functional scores .
we note limitations to our study , one of which is the absence of proper control data .
first , ideally a comparison would be made with an age - matched control group without cuff disorders .
however , with a prevalence of 31% of asymptomatic ( ie , unrecognized ) cuff tears in individuals between 70 and 79 years old and a prevalence of 51% in individuals
another possibility would be to compare the outcomes with those of the contralateral side in the same patient . however , cuff disorders in the contralateral shoulder are not uncommon , as reported by yamaguchi et al . in their demographic and morphologic study of rotator cuff disease .
the average age for patients with a bilateral cuff tear in their group was 67.8 years and logistic regression analysis indicated a 50% likelihood of a bilateral tear after the age of 66 years .
furthermore , patients with a full - thickness symptomatic tear had a 35.5% prevalence of a full - thickness tear on the contralateral side . in our patient population ,
12% already had a reverse prosthesis on both sides , showing that our patient group was not suitable to use the contralateral side as a comparison .
second , we had a broad range of followup times for the force measurements and clinical outcome scores .
ideally the measurements should have been performed at the same time postoperatively for every patient with a minimum followup of 1 year .
this is also true for the clinical outcome scores , because they require time to stabilize . in the scope of this study , it was not possible to include patients with the same followup period , as this would have required an inclusion period of several years .
we therefore chose to include all patients available from our pool of treated patients , which inevitably led to a large range in followup times .
it is not certain what effect the followup time will have had , which especially applies for the elderly population for whom recovery might be counteracted by ageing effects . given the number of available patients , controlling for age and followup will be virtually impossible whereas including larger groups and testing for those factors also do not seem to be realistic options .
isokinetic strength measurements have been performed at different velocities , mostly from 60 per second to 300 per second with some exceptions at 30 per second ( table 1 ) . in these measurements , the applied torque needs to increase above a threshold value to successfully perform a certain task at higher speeds .
because the physiologic changes at older age lead to a decline in force - generating capacity and the reverse shoulder prosthesis is implanted mainly in patients with a mean age of 72 years [ 18 , 36 ] , similar to the average age of the participants in our study , we decided to apply a relatively low velocity of 60 per second . considering our data and the number of patients unable to perform the tests ( table 2 ) , it appeared that even 60 per second was too high for most of the patients with a reverse prosthesis .
future research investigating force production of this patient population should incorporate velocities less than 60 per second .
whether a lower velocity would lead to substantially more successful tests however is unknown ; in our protocol a standard threshold of 15 per second was used to start measurements , which even proved to be too much for some of our patients . trying to place our obtained torque values ( table 2 ) in perspective , we compared our data with those of normal healthy subjects ( table 1 ) . from this comparison
we can conclude that patients with a reverse prosthesis who can generate sufficient force to perform the tasks have abduction and adduction torques of 19% to 78% of those of a normal shoulder at a velocity of 60 per second .
for the external and internal rotation torques , these values vary between 13% and 71% .
however , those normal values were based on younger subjects than our group of patients and in most series they include groups of athletes . if we compare our data with the only age - related series of verney et al .
, our patients have an abduction torque of 33% of that of 10 male elderly volunteers .
it is not clear what causes this relatively low abduction torque . from the total of 37 shoulders ,
only 23 patients ( 24 shoulders ) could generate enough force to perform the abduction and adduction tasks and for the external and internal rotation , the number of patients was even less ( table 2 ) .
the difference between those two tasks can be explained by the changed biomechanics caused by the reverse shoulder prosthesis . by displacing the center of rotation medially , more fibers of the anterior and posterior parts of the deltoid muscle
are recruited for anteflexion or abduction of the arm and therefore fewer fibers are available to internally or externally rotate the arm .
our study group included patients with primary and revision implantations . in revision surgery with a reverse prosthesis ,
the improvement of function is reportedly only to approximately 70 of active elevation , with a higher complication rate than with primary surgery .
therefore , we expected to find a difference in force - generating capacity between the two groups ( table 2 ) in favor of the primary prosthesis . however , this could not be confirmed for the abduction and adduction tasks because 62% of the primary and 69% of the revision cases were able to generate enough force . for the internal and external rotation tasks , it was 43% and 31% respectively , confirming our expectation and explained by the previously mentioned change of biomechanics after a reverse prosthesis .
the correlations we found between clinical outcome scores ( constant - murley , dash , and [ d]sst ) and the abduction and external rotation torque values ( table 3 ) support this contention .
functional outcome probably is not determined by simple rom ranges alone , but also by the actual capacity for material handling in elevated and axially rotated arm positions .
for example , it can be expected that patients who have good anteflexion or abduction with limited external rotation strength define their functional outcome as poor .
therefore , it seems logical that greater external rotation torque provides a better functional outcome .
although our findings support this notion , only 13 of a total of 37 shoulders actually were able to generate enough force to perform the tasks at 60 per second .
testing under lighter conditions ( 30 per second ) could have provided more data but probably would not have led to another observation .
patients with a reverse prosthesis were moderately to strongly limited in strength , which was the case for abduction and adduction and even more for external and internal rotation . however , future isokinetic data collection in these patients should be performed at a lower velocity than 60 per second .
results for strength correlated with clinical outcome scores ( constant - murley , dash , and [ d]sst ) indicating moderately strong relationships and a moderate predictive value of the outcome scores .
although it is likely that lower isokinetic shoulder strength in patients with joint arthroplasties is a major factor in reduced rom , the actual causes of loss of strength would need to be identified in future studies .
this article is distributed under the terms of the creative commons attribution license which permits any use , distribution , and reproduction in any medium , provided the original author(s ) and the source are credited . | backgroundit has been suggested that limited active rom of reverse shoulder prostheses relates to lack of strength .
however , the postoperative strength has not been quantified.questions/purposeswe therefore measured joint torques in patients with reverse shoulder prostheses and correlated torques with functional scores.methodswe recruited 33 patients ( age , 72 8 years ) with a reverse prosthesis ( 37 shoulders , 21 primary and 16 revisions ) .
we obtained constant - murley , dash , and simple shoulder test ( [ d]sst ) scores , and performed two isokinetic protocols ( abduction / adduction and external / internal rotation ) at 60 per second .
minimum followup was 4 months ( average , 23 months ; range , 463 months).resultstwenty - three patients ( 24 shoulders ; 13 primaries , 11 revisions ) were able to perform at least one of the defined tasks .
mean abduction and adduction torques were 15 nm 7 nm and 16 nm 10 nm ( 19%78% of normal shoulders )
. external and internal rotation tasks could be performed by only 13 patients ( 14 shoulders ; nine primary , five revisions ) generating 9 nm 4 nm and 8 nm 3 nm , respectively ( 13%71% of normal shoulders ) .
we found moderate correlations between constant - murley , dash and ( d)sst ( d = dutch translation ) scores and abduction and external rotation.conclusionspatients with a reverse prosthesis had reduced strength when compared with normal values reported in the literature ( only 65% of patients could perform the protocol ) .
this effect was greatest for external rotation and might explain clinical outcomes with which a moderately strong relationship was observed .
our observations suggest limited strength is a major factor in reduced rom . | Introduction
Materials and Methods
Results
Discussion
Open Access |
it is well - known that crystalline materials obtain their fundamental physical properties from the molecular arrangement within the solid , and altering the placement and/or interactions between these molecules can , and usually does , have a direct impact on the properties of the particular solid.(1 ) currently , solid - state chemists call upon a variety of different strategies when attempting to alter the chemical and physical solid - state properties of apis , namely , the formation of salts , polymorphs , hydrates , solvates , and cocrystals , as illustrated in figure 1 . pictures displaying the more common solid - state strategies and their respected components .
currently , salt formation is one of the primary solid - state approaches used to modify the physical properties of apis , and it is estimated that over half of the medicines on the market are administered as salts.(2 ) however , a major limitation within this approach is that the api must possess a suitable ( basic or acidic ) ionizable site . in comparison ,
cocrystals ( multicomponent assemblies held together by freely reversible , noncovalent interactions ) offer a different pathway , where any api regardless of acidic , basic , or ionizable groups , could potentially be cocrystallized .
this aspect helps complement existing methods by reintroducing molecules that had limited pharmaceutical profiles based on their nonionizable functional groups .
in addition , the number of potential nontoxic cocrystal formers ( or coformers ) that can be incorporated into a cocrystalline reaction is numerous.(3 ) it should be made clear that no one particular strategy offers a solution for property enhancement of all apis .
each api must be examined and evaluated on a case - by - case basis in terms of molecular structure and desired final properties . for this purpose ,
to date , a universal and agreeable definition of what constitutes a cocrystal is still unavailable . within the academic literature ,
various parameters have been applied to the definition of what is and is not considered a cocrystal ( table 1 ) ; however , one broad commonality that is agreed upon is that all cocrystals are crystalline materials comprised of at least two different components ( or commonly called multicomponent crystals ) .
now , one s opinion as to what constitutes a component can be dramatically different , for example , solid , liquid , or gas and/or neutral or ionic species , etc . , and
furthermore , the use of pharmaceutical cocrystal is commonplace and usually applied when an api is one of the molecules in the multicomponent crystal . even though there are limitations with the cocrystal definitions currently found in the literature , we do not see it necessary to complicate the existing debate by generating yet another definition for what constitutes a cocrystal .
in this review , the cocrystalline examples presented herein will possess the following criteria : ( 1 ) an api , neutral ( example 1 , figure 2 ) , or ionic form ( example 2 , figure 2 , or a zwitterion ) , along with a neutral coformer , held together through noncovalent , freely reversible interactions , ( 2 ) a coformer , which may or may not be pharmaceutically acceptable , ( 3 ) and at least one measured physicochemical property . a pictorial description of possible multicomponent systems , including cocrystals,(11 ) salt cocrystals , and salts along with their respective hydrates and solvates are displayed in figure 2 .
when necessary for property or structural comparison , examples of pharmaceutical salts ( example 3 , figure 2 ) will be introduced and discussed .
the examples used throughout the paper are representative of the literature reported for the physicochemical properties measured for pharmaceutical cocrystals , but it is not an exhaustive list of all the cocrystal studies available .
possible multicomponent systems : cocrystals , salt cocrystals , and salts along with their respective solvate / hydrate forms .
the number of publications and reviews detailing the topics of crystal engineering and supramolecular synthesis of api - based cocrystals is extensive and continuing to grow.(14 ) more specifically , researchers usually highlight themes pertaining to functional group compatibility ( synthons ) , for example , acid / n - heterocycle , acid / amide , phenol / n - heterocycle , and/or cocrystal growth strategies such as evaporation,(15 ) solid - state grinding,(16 ) sonication,(17 ) and melting.(18 ) to complement these topics , we would like to briefly mention the initial steps that should be considered ( before a reaction is ever conducted ! ) when attempting to maximize the experimental effectiveness of generating cocrystalline materials . in the beginning ,
an evaluation of the api should be carried out , including but not limited to , number and arrangement of hydrogen bond donors and acceptors , salt forming ability ( pkas),(20 ) conformational flexibility , and solubility requirements.(21 ) usually apis that are rigid , highly symmetrical , possess strong nonbonded interactions , and low molecular weight are more apt to cocrystallize with additional components ( coformers or counter - molecules).(4 ) frequently , suitable coformers are selected based on hydrogen bonding rules,(22 ) probable molecular recognition events,(23 ) and toxicological profiles ; however , one should not be limited to just these criteria because cocrystals could easily be missed . finally ,
as mentioned above , a variety of methods exist for preparing cocrystals . to date , predicting whether or not a cocrystallization reaction will be successful is not yet possible,(25 ) and thus reactions must be carried out experimentally under varied conditions with different techniques to find available cocrystals .
single crystal x - ray diffraction is the preferred characterization technique in determining whether a cocrystalline material has been generated ; however , suitable x - ray quality crystals can not always be produced . additionally , even if single crystals can be grown of sufficient size and quality , the exact location of the hydrogen atom ( determination if proton - transfer has occurred from the acid to the base or not ) may be ambiguous .
thus , it is advantageous to utilize a variety of solid - state , spectroscopic techniques ( raman , infrared , and solid - state nmr ) when attempting to characterize potentially new cocrystalline materials.(27 ) such an exercise was carried out when single - crystal x - ray crystallography and n solid - state cross - polarization magic angle spinning ( cpmas ) nmr spectroscopy were used to complement one another in the determination of hydrogen bonding interactions and the extent of proton - transfer between a heterocyclic - containing api and a variety of dicarboxylic acids.(28 ) three acidbase complexes were obtained and characterized : a sesquisuccinate , a dimalonate , and a dimaleate . through single - crystal x - ray analysis ,
measured hydrogen bond distances were used to characterize the materials as one cocrystal ( sesquisuccinate ) , one mixed ionic and zwitterionic complex ( dimalonate ) , and one disalt ( dimaleate ) .
these results were confirmed by comparing the n chemical shifts of each species to those of the free base .
small shifts , in comparison to the free base , were observed for the sesquisuccinate cocrystal , while the largest shifts , due to complete protonation , were seen from the dimaleate salt .
in addition , short contact time cpmas nmr experiments were used to further characterize the dimalonate and dimaleate complexes as a mixed ionic species and a disalt .
for example , if a nitrogen atom had a proton attached to it , then a signal would appear ; thus the disalt ( dimaleate ) displayed two additional peaks in comparison to the free base , while the mixed ionic species ( dimalonate ) only showed one new peak .
the results from the n solid - state cpmas nmr spectroscopy along with single - crystal x - ray crystallography proved sufficient to successfully identify each new form as either a cocrystal , salt , or mixed ionic complex .
infrared spectroscopy can be a very powerful tool in detecting cocrystal formation , especially when a carboxylic acid is used as a coformer and/or when a neutral ohn hydrogen bond is formed between an acid and a base .
distinct differences , within the ir spectra , can be observed between a neutral carboxylic acid moiety and a carboxylate anion .
a neutral carboxylate ( -cooh ) displays a strong c = o stretching band around 1700 cm and a weaker co stretch around 1200 cm , while a carboxylate anion ( -coo ) , due to resonance , displays a single co stretch in the fingerprint region of 10001400 cm .
additionally , if a neutral intermolecular ohn hydrogen bond has formed between the components , then two broad stretches around 2450 and 1950 cm will be observed.(29 ) observations about the state of the carboxylic moiety ( neutral or ionic ) can also be verified through measuring the co and c = o bond distances from the single - crystal x - ray data .
a typical c = o bond distance is around 1.2 , while the co bond distance is around 1.3 ; however , if deprotonation has occurred then the resonance stabilized co bond distances will be very similar .
outlined above are a number of different characterization techniques used to help distinguish between cocrystals and salts , and it should be noted that in some cases differentiation between the two may be difficult.(20c ) it should also be pointed out that although salts and cocrystals often possess different properties ( see sections on stability ( ) and solubility ( ) ) , these issues from a development standpoint may not be influential as long as the process can be monitored and closely controlled . however , for intellectual property ( ip ) rights and regulatory issues , differentiating between a cocrystal and a salt can be important , as discussed in .
the physical and chemical properties of a cocrystal need to be investigated in the same manner as any other solid form in order to determine developability into a marketed dosage form.(31 ) physicochemical properties , such as crystallinity , melting point , solubility , dissolution , and stability , are important when moving a new compound , such as a cocrystal , through early development . the information from these studies can be used to prioritize the available forms , and a flowchart can help organize the process for solid form selection .
an example of a flowchart that could be used to choose the best cocrystal candidate is given in figure 3 .
it combines a number of properties inherent to drug development ; however , it should be used as a guide only since every compound will have its own challenges , and the properties in the flowchart will be unique to the situation at hand .
. the primary focus of this article is centered on highlighting cases where the physicochemical properties of an api have been adjusted through the formation of api - based cocrystals .
the properties and questions are related topics , such as scale - up , polymorphism , intellectual property , and lifecycle management are also discussed for the development of pharmaceutical cocrystals .
the melting point is a fundamental physical property , which is determined by the temperature at which the solid phase is at equilibrium with the liquid phase . since melting point is a thermodynamic process where the free energy of transition is equal to zero , the value is determined by the ratio of change in the enthalpy of fusion over the change in the entropy of fusion.(32 ) if available , differential scanning calorimetry ( dsc ) is the preferred technique for obtaining comprehensive melting point data , over a standard melting point apparatus or kofler method , because additional thermal data such as the enthalpy of fusion can be determined .
for example , the melting point and heat of fusion , both determined from dsc , are necessary when attempting to characterize a polymorphic pair of compounds as monotropic or enantiotropic.(33 ) it is standard practice to determine the melting point of a compound as a means of characterization or purity identification ; however , within pharmaceutical sciences , the melting point is also very valuable due to its correlations to aqueous solubility and vapor pressure.(34 ) in fact , the melting point has been directly correlated to the log of solubility , although assumptions pertaining to the entropy of fusion had to be drawn.(35 ) thus , being able to determine the melting point of a particular api before it was synthesized would be very beneficial in order to tailor its aqueous solubility toward a particular function .
unfortunately , correlations relating chemical structure directly to melting point data remain elusive.(36 ) given the number of factors contributing to the melting point of a crystalline solid including , but not limited to , the molecular arrangement within the crystal lattice , molecular symmetry , intermolecular interactions , and conformational degrees of freedom for a molecule , one clearly sees the difficulties in attempting to draw strict comparisons from molecular structure to crystalline lattice energy to melting point .
the situation only becomes more complex when observing multicomponent systems because each component has its own characteristic properties and those can influence the environment ( and intermolecular interactions ) around its neighbors . in this section
we will examine the thermal behavior of cocrystals in which one component is an api , although findings and trends should be translatable to all cocrystalline materials .
one literature example compares the melting points of 10 cocrystals to the api amg517 and their respective coformers.(37 ) each of the cocrystals displayed a melting point that fell between the melting point of amg517 and their coformer .
a plot was generated using the melting points of the cocrystals and coformers , which displayed a direct proportionality between the two ( figure 4 ) .
a correlation coefficient of 0.7849 was determined , meaning that 78% of the variability of melting point of the cocrystal can be attributed to the variability of the coformers melting point .
these data show that within the set of amg517 cocrystals the melting point can typically be tuned according to which coformer is chosen ; for example , if a higher melting cocrystal is desired , then a higher melting coformer should be selected and vice versa . melting points of amg517 cocrystals and their respected coformers ( left ) ; melting onset of coformer versus cocrystal ( right ) .
we compiled a larger survey based on reported cocrystal melting points , and these were compared with the melting points of the coformer and api .
the purpose was to determine if any correlation can be drawn , with regard to where the melting point of the cocrystal falls : higher , lower , or in between that of the api and coformer .
it should be noted that this exercise is not taking into account stoichiometry of components , solvation or hydration , polymorphism , and/or types of intermolecular interactions present within the crystalline lattice .
range : cocrystal has h - higher melting points than api and coformer , m - melting point in between that of the api and coformer , l - lower melting point than api or coformer . within the survey 50 cocrystalline samples were analyzed ; 26/50 ( 51% ) cocrystals had melting points between those of the api and coformer , while 19/50 ( 39% ) were lower than either the api or coformer , only 3/50 ( 6% ) were higher , and 2/50 ( 4% ) had the same melting point as either the api or coformer . these statistics clearly show that the melting point of an api can be altered through forming cocrystals , and the outcome will usually be a product having a melting point that is in between that of the api and coformer or lower than the api or coformer .
thus , if a lower melting solid is necessary and covalent modifications to the api can not be achieved , then cocrystallizing the api is a viable pathway . within a homologous set of cocrystals ( either the api or coformer
is kept constant ) , where single crystal x - ray structures have been determined , comparisons could potentially be drawn between the intermolecular interactions and/or crystal packing existing within the lattice and the thermal behavior of the sample .
this knowledge could be beneficial when attempting to determine the behavior of a particular material from its three - dimensional structure . in one example
, a set of dipyridyl coformers are cocrystallized with ibuprofen , flurbiprofen , and aspirin producing four cocrystals : ( ibuprofen)2(4,4-bipyridine ) , ( flurbiprofen)2(4,4-bipyridine ) , ( flurbiprofen)2(trans-1,2-bis(4-pyridyl)ethylene ) , and ( aspirin)2(4,4-bipyridine).(40 ) in all cases the compounds crystallize in a 2:1 api / coformer ratio through heteromeric ohn hydrogen bonds ; however , the overall packing arrangements of the 2:1 supermolecules are different .
the first three examples listed all take on a herringbone packing arrangement and have melting points higher than either the api or coformer , while the last example is a channel structure and possess a melting point considerably lower than either of the two reactants .
although this study is on a small number of samples , it shows the impact that crystal packing has on physical properties such as melting point .
as mentioned earlier , correlations have been drawn between a compound s melting point and its log of solubility ; however , the literature remains sparse when making comparisons to cocrystals .
only one study was found where cocrystals had their melting points and aqueous solubilities determined and compared . in the amg517 study ,
the authors note that after a correlation analysis of the solubility parameters , the highest interdependence was the log of solubility ( log smax ) versus the melting point.(37 ) a correlation plot of log smax versus cocrystal melting point , of the nine amg517 cocrystals , indicated a 55% correlation of the variability in log smax to variability in melting point of the cocrystal ( figure 5 ) .
this study , albeit on a homologous set of cocrystals , provides a foundation for attempting to compare the factors influencing a cocrystals melting point and its solubility .
solubility and log smax values for amg517 cocrystals ( left ) ; smax as a function of cocrystal melting point ( right ) .
recently , a second cocrystallization study was conducted on a series of molecules with structures similar to amg-517 along with a number of structurally diverse coformers.(42 ) comparisons were made between the melting points of the cocrystals and coformers as well as between the melting points and the log solubility values .
the conclusions showed low correlations between the melting points of the cocrystals to the coformers and no correlation between the melting points of the cocrystals and the log solubility .
these findings clearly stress the difficulties when attempting to draw lines between series of molecules with different structures , especially as it pertains to solubility and melting point .
high melting points are usually desirable , but may contribute to poor solubility and are as troublesome as low melting points , which can hinder processing , drying , and stability .
correlation of melting points with other development parameters is an ongoing area of study , and the multicomponent nature of the cocrystals will add another level of complexity to these analyses .
different types of stability need to be considered depending on the structure and characteristics of the molecule .
chemical and physical stability data are commonly obtained at accelerated stability conditions to determine developability and shelf life.(43 ) water uptake is included from a handling and packaging point of view .
the amount of water present can also lead to form changes , degradation , and worse if the effect of the water uptake is not investigated early in the process.(44 ) thermal stress studies are also incorporated , and extra work may be warranted for hydrates or thermally labile materials . in the case of cocrystals and salts , solution stability may be a factor due to dissociation of the material resulting in precipitation of the less soluble parent compound or a less soluble form ( such as a hydrate in aqueous media ) .
as with other solid forms , changes over a wide relative humidity ( rh ) range are a key consideration when developing a cocrystal .
automated moisture sorption / desorption studies are commonly performed to determine problem areas and to provide direction for more detailed studies when the need arises .
x - ray powder diffraction ( xrpd ) data collected on the solid at the end of the moisture balance experiment provides information on the final form , but not necessarily on any form conversions that may have occurred during the experiment . significant moisture uptake
during the course of the experiment may warrant longer exposure at a specific relative humidity using a relative humidity chamber and subsequent analysis of the sample after equilibration .
one example for a 1:1 indomethacin / saccharin cocrystal showed minimal uptake ( < 0.05% water ) up to 95% rh.(46 ) the data suggested no solid - state transformation , although xrpd data of the sample after the moisture balance experiment were not reported .
the second example for a 1:1 amg 517/sorbic acid cocrystal again showed a minimal uptake of 0.7% water at 90% rh.(47 ) the xrpd data showed only the presence of the amg 517 sorbic acid cocrystal after the experiment indicating that the initial form was obtained after the sorption / desorption cycle .
these studies showed that relative humidity is not a major concern for these cocrystals ; however , longer term studies would be advisible to determine the effects of water under more equilibrium conditions .
another system involved a glutaric acid cocrystal of 2-[4-(4-chloro-2-fluorphenoxy)phenyl]pyrimidine-4-carboxamide.(48 ) this material sorbed less than 0.08% up to 95% rh over repeated sorption / desorption cycles .
a long - term study at 40 c/75% rh for 2 months also showed no form change by xrpd and dsc as well as no significant increase in degradation by hplc .
this combined information indicates that the cocrystal will likely be stable under normal processing and storage conditions , which helps reduce risk during development .
longer term cocrystal stability studies with respect to rh have been reported for a small number of cocrystal systems and a range of parameters have been used . as mentioned above for the glutaric acid cocrystal of 2-[4-(4-chloro-2-fluorphenoxy)phenyl]pyrimidine-4-carboxamide , 40
c/75% rh is a common condition to use during development based on ich guidelines.(43 ) a pharmaceutical cocrystal of a monophosphate salt with phosphoric acid resulted in no detectable form change or degradation after 8 weeks of storage at 40 c/75% rh.(13b ) a study on nine amg-517 cocrystals showed no change in the xrpd patterns after one month at 40 c/75% rh.(37 ) these types of results certainly suggest adequate physical stability for development ; however , each system needs to be evaluated on an individual basis .
other studies target a range of rh conditions , such as 0 , 43 , 75 , and 98% rh over a period of time ( table 3 ) . in a study of caffeine
cocrystals,(49 ) the focus was to produce a cocrystal that was physically stable at all rh conditions , unlike caffeine , which is known to readily form a hydrate upon exposure to water or water vapor.(50 ) six cocrystals were successfully produced : 2:1 caffeine / oxalic acid , 2:1 caffeine / malonic acid , 2:1 caffeine / maleic acid , 1:1 caffeine / maleic acid , and two forms of 1:1 caffeine / glutaric acid .
samples were placed at four rh conditions and analyzed after 1 , 3 , and 7 days and 7 weeks .
the 2:1 caffeine / oxalic acid sample was found to be stable at all rh conditions through 7 weeks .
the other cocrystals exhibited behavior similar to caffeine , and one case was found to be worse than caffeine with evidence of dissociation and conversion to caffeine monohydrate .
it was noted that the strongest acid used ( oxalic acid ) resulted in the most stable cocrystal , while the weakest acid ( glutaric acid ) produced the least stable cocrystal .
it is not known at this point if this is a general trend for a homologous series or is isolated to certain compounds .
the same set of rh conditions ( 0 , 43 , 75 , and 98% rh ) were used with four cocrystals of theophylline ( 2:1 theophylline / oxalic acid , 1:1 theophylline / malonic acid , 1:1 theophylline / maleic acid , and 1:1 theophylline / glutaric acid).(51 ) the 2:1 theophylline / oxalic acid showed better physical stability than theophylline alone , and the remaining cocrystals exhibited the same stability as theophylline after 7 weeks .
humidity chambers were set at 0 , 43 , 75 , and 98% , while observations were made at durations of 1 day , 3 days , 1 week , and 7 weeks .
the symbol represents that the co - crystal was stable at that condition and time . the symbol x represents that the cocrystal exhibited physical instability at that condition and time . modified table from refs ( 49 ) and ( 51 ) .
while cocrystal hydrate formation was investigated by grinding , a 1:1 theophylline / citric acid cocrystal was compared with a 1:1 caffeine / citric acid cocrystal.(52 ) the materials were exposed to a variety of rh conditions including 98% rh . it was found that the caffeine / citric acid cocrystal converted to caffeine hydrate upon exposure to 98% rh for 7 days , similar to the other caffeine cocrystals.(49 ) the theophylline / citric acid cocrystal converted to a cocrystal hydrate upon exposure to 98% rh for 3 days . the theophylline / citric acid cocrystal hydrate was found to be stable and did not change form after 7 days at 0 , 43 , 75 , and 98% rh .
this stable hydrate could be an acceptable form for development based on the rh stability results .
this example illustrates that cocrystals can exhibit hydrate formation in the solid state , similar to other crystalline forms , and should be investigated during the development process .
the rh stability of chiral and racemic cocrystals has also been reported for caffeine and theophylline using malic and tartaric acids.(53 ) samples were exposed to 43 , 75 , and 98% rh for up to 7 days . the racemic cocrystal was found to be more resistant to hydration than the single enantiomer form in all the systems studied . it is suggested that the stability of the theophylline cocrystals resulted from intermolecular ( molecular packing ) and intramolecular ( conformational strain ) factors . a cocrystal physical stability study
can also be compared to the api material to assess any improvement in this property . for a 1:1 carbamazepine / saccharin cocrystal ,
a physical stability study was performed at 25 c/60%rh , 40 c / ambient rh , and 40 c/75% rh for two weeks.(54 ) carbamazepine ( form iii ) was also included , and the samples were analyzed by xrpd to determine any form change .
this study showed comparable physical stability between the two materials , and similar studies could be used to determine any improvement that a cocrystal may impart for a difficult - to - develop compound .
this section illustrates that rh stress of cocrystals is an important step in evaluating these materials for development .
rh conditions should be chosen based on the information needed for development of the compound .
hydrate formation as well as dissociation need to be understood early in the process in order to prevent problems during later phases .
high temperature stress is another common condition used to determine chemical and physical stability based on accelerated stability conditions.(43 ) very few reports discuss thermal stress experiments on cocrystals . for the cocrystal of a monophosphate salt with phosphoric acid
an 8-week exposure at 60 c resulted in no detectable degradation or form change.(13b ) two other studies discuss dsc data and the effect of temperature on stability .
paracetamol cocrystals of 4,4-bipyridine , 1,4-dioxane , n - methylmorpholine , morpholine , n , n - dimethylpiperazine , and piperazine were analyzed by dsc.(55 ) the paracetamol/4,4-bipyridine sample was the only cocrystal that did not lose the guest upon heating and exhibit a melting endotherm corresponding to the monoclinic form of paracetamol .
additional data were not included to confirm the conversion , but these types of studies provide valuable information that should be explored in relation to other processes , such as drying and accelerated stability .
another dsc and high - temperature study was performed on nonstoichiometric cocrystals of l-883555 , a phosphodiesterase - iv inhibitor , and l - tartaric acid , with stoichiometries ranging from 0.3:1 to 0.9:1.(56 ) dsc curves showed a single melting endotherm for stoichiometries close to 0.5:1 tartaric acid / l-883555 .
additional thermal events were observed at the other stoichiometries . when the two complexes with the higher stoichiometries ( 0.7:1 and 0.89:1 tartaric acid / l-883555 ) were heated above the first observed dsc endotherm , titration and nmr analysis showed values equivalent to the 0.5:1 stoichiometry , indicating a loss of some of the tartaric acid .
these data indicated that tartaric acid incorporated in excess of 0.5:1 was bound at a different site , and this binding was more labile when compared to the first type of binding occurring within the structure .
variable temperature xrpd also showed a significant contraction of the lattice when heated above the first endotherm , which was attributed to the loss of the tartaric acid .
it was hypothesized that the acid content above the 0.5:1 stoichiometry was likely occupying channels within the crystal , which was in agreement with the multiple binding modes established from spectroscopic data .
the 0.5:1 stoichiometry was found to be the most thermally stable and was chosen for development based on these data and bioavailability data .
these limited reports show that heating studies can provide valuable information about physical and chemical stability .
information on elevated temperature transitions can give clues about possible problems in long - term stabilities and can provide guidance on drying steps .
these results can be translated into a better understanding of the solid - state system and can help develop more robust compounds and processes .
chemical stability is commonly investigated early in the development of a new compound and during formulation studies in order to minimize any chemical degradation that may occur . accelerated stability conditions , such as 40 c/75% rh and 60 c/75% rh ,
very few reports of chemical stability of cocrystals were found when reviewing the literature . in one example , a pharmaceutical cocrystal of a monophosphate salt with phosphoric acid was reported to have no detectable degradation after 8 weeks of storage at 40 c/75% rh and 60 c.(13b ) samples of a glutaric acid cocrystal of 2-[4-(4-chloro-2-fluorphenoxy)phenyl]pyrimidine-4-carboxamide were placed at the same conditions for 2 months , and hplc impurity analysis did not show any significant increases in known degradants.(48 ) a direct comparison of a cocrystal to the parent api can provide important information for development . a 1:1 carbamazepine : saccharin cocrystal
was compared to carbamazepine ( form iii ) in a chemical stability study using temperature ( 5 , 40 , and 60 c at ambient humidity ) and elevated rh conditions ( 25 c/60% rh and 40 c/75% rh ) over 2 months.(54 ) degradation was not observed for either material at the elevated temperatures ; however , both materials showed similar degradation patterns under the second set of conditions . in this case , a significant improvement in chemical stability was not needed , and the cocrystal proved to be as stable as the marketed carbamazepine form under these conditions .
although few reports exist , assessing chemical stability of cocrystals is important in understanding the developability of these materials . assessing chemical stability in the presence of excipients for
it is possible that cocrystals may exhibit superior chemical stability when this is an issue with the parent compound , and crystal engineering techniques may provide approaches to prevent known degradation pathways .
solution stability for this discussion is defined as the ability of the cocrystal components to stay in solution and not readily crystallize .
solution stability can be an important parameter to assess during development , not only for solutions or suspensions , but also for solid dosage forms that will dissolve in the gi tract .
a variety of vehicles can be used , including water , simulated gastric fluid ( sgf ) , simulated intestinal fluid ( sif ) , formulation vehicles , and buffered solutions . in many instances ,
these experiments can be coupled with solubility or dissolution experiments to get a more complete picture of the behavior and the solid form remaining at the end of the experiment .
because dissociation of a cocrystal can occur , solution stability can be a key consideration for development .
studies of cocrystals in water can give an indication of possible dissociation and precipitation of another form such as a hydrate .
in the study of caffeine cocrystals,(49 ) the 2:1 caffeine / oxalic acid cocrystal was found to be stable at all relative humidities up to 98% rh for 7 weeks . in order to further test the stability , the material was slurried in water at ambient temperature for 2 days .
no change in physical form was observed , demonstrating the stability of the material . in order to determine the form present in aqueous solutions of a 1:1 carbamazepine / saccharin cocrystal ,
the material was slurried with equal parts carbamazepine dihydrate and saccharin in solution.(54 ) after 24 h , only the cocrystal was evident based on xrpd data and the carbamazepine dihydrate was not detected .
this is likely based on the concentration of the coformer present , which has been investigated for a number of systems.(57 ) in another example , a carbamazepine cocrystal screen resulting in 24 unique solid phases using 18 coformers studied the formation of carbamazepine dihydrate when the cocrystals were slurried in water for 2048 h.(21b ) of the 20 cocrystals studied , seven maintained the cocrystal structure and the rest converted to carbamazepine dihydrate .
the aqueous solubility of the coformer appeared to be an important parameter for the dihydrate formation .
it was noted by the authors that cocrystals containing coformers with relatively high aqueous solubility converted to the dihydrate , while the coformers with relatively low water solubility remained as the cocrystal .
other studies would be needed to determine if this is a general trend or specific to this system .
it should be noted that many of the carbamazepine cocrystals were successfully produced directly from water by increasing the concentration of the coformer based on the ternary solubility phase diagrams .
the phase diagrams show the conditions where the cocrystal is supersaturated in solution and is the favored solid phase for crystallization ; using these conditions will avoid crystallization of the individual components .
simulated gastric or intestinal fluids ( sgf and sif , respectively ) are also common systems for assessing solubility and dissolution rate . for amg 517 cocrystals ,
solubility was determined in fasted simulated intestinal fluid ( fasif ) at 25 c for 24 h. four of the cocrystals ( trans - cinnamic acid , 2,5-hydroxybenzoic acid , 2-hydroxycaproic acid , benzoic acid ) did not dissociate , and xrpd data at the end of the experiment showed no form conversion .
it was noted that the maximum solubility of three of these cocrystals was relatively low ( <3
g / ml ) ; therefore , the 24 h experiment may not have allowed enough time for conversion to occur .
the benzoic acid cocrystal is the only one that exhibited a higher solubility ( 21 g / ml ) and did not dissociate .
the benzoic acid cocrystal exhibited a bell shaped curve indicative of form conversion , but no conversion was observed by xrpd .
dsc data indicated that the benzoic acid was no longer in the crystal , and the concentration of benzoic acid in solution increased over time .
one explanation suggested that a free base form , similar in structure to the cocrystal , was formed and was not readily differentiated by xrpd .
the remaining five cocrystals ( glutaric acid , glycolic acid , sorbic acid , trans-2-hexanoic acid , and l-(+)-lactic acid ) dissociated during the experiment and crystalline amg 517 resulted .
the solubility ( smax ) of these cocrystals ranged from 9 to 17 g / ml , which was higher than amg517 and three other cocrystals ( trans - cinnamic acid , 2,5-hydroxybenzoic acid , and 2-hydroxycaproic acid ) , but less than the solubility of the benzoic acid cocrystal .
dissolution experiments of a 1:1 carbamazepine / saccharin cocrystal in sgf used sieve fractions to investigate the effect of particle size on dissolution.(54 ) sieved cocrystal fractions of particles less than 150 m showed the fastest initial dissolution , and dissolution was essentially complete when the particles were less than 500 m .
the large particles ( 500 m to greater than 1 mm ) were found to contain a mixture of the cocrystal and carbamazepine dihydrate by xrpd when exposed to sgf overnight .
conversion to the dihydrate on the surface of the particles was likely responsible for the slower dissolution rate observed for the sample compared to the smaller particle size sample ; however , further work on the particle size and conversion to the dihydrate was not conducted .
buffered solutions are commonly used during development and solubility data at various ph conditions can be valuable . a solubility study at ph 7.4 and two buffer strengths ( 60 and 200 mm ) was conducted on an indomethacin / saccharin cocrystal and compared to the -form of indomethacin.(46 ) at the 60 mm strength , the cocrystal dissolved immediately and was followed by a drop in ph to 6.8 and precipitation of an amorphous material with traces of the -form of indomethacin . by raising the buffer strength to 200 mm ,
the cocrystal rapidly dissolved and remained in solution for several hours , giving a 50 increase in solubility over the indomethacin -form .
xrpd data of the remaining solid did not show peaks indicative of the cocrystal indicating that the phase in equilibrium is not the crystalline indomethacinsaccharin cocrystal .
possible salt formation with the buffer components was not addressed and further characterization of the remaining solid was not reported .
studies are continuing to investigate the ionization of the ligand , complexation phenomenon , and solution chemistry of the system .
intrinsic dissolution studies of a glutaric acid cocrystal of 2-[4-(4-chloro-2-fluorphenoxy)phenyl]pyrimidine-4-carboxamide showed very minor conversion of the cocrystal to the parent compound after 90 min in water at 37 c.(48 ) discs left in the dissolution apparatus for 24 h under the same conditions showed full conversion to the parent compound . in another study ,
the aqueous solubility of fluoxetine hydrochloride cocrystals made from benzoic acid , fumaric acid , and succinic acid were measured.(12 ) the benzoic and fumaric acid cocrystals were stable for several hours and xrpd data of the solids at the end of the experiment confirmed that the form had not changed .
the succinic acid cocrystal showed a full conversion to fluoxetine hydrochloride after the experiment , in agreement with the powder dissolution data . the powder dissolution profile for this material exhibited high solubility initially with a subsequent decrease in solubility due to the recrystallization of the fluoxetine hydrochloride .
succinic acid exhibited the highest solubility of the three coformers and was the only cocrystal to dissociate .
this is similar to what was found in the carbamazepine cocrystal study where cocrystals produced from coformers with the highest solubility tended to dissociate.(21b ) solution stability results found in the literature were compiled in table 4 and compared to the aqueous solubility of the coformer used .
a total of five apis were included , but the majority of the data were on carbamazepine .
the aqueous solubilities of the coformers were primarily taken from the handbook of aqueous solubility data(58 ) when available ; solubility data for coformers that were not found were estimated in ssci s laboratory .
the solution stability studies reported were in water except for one study , which was fasif ( amg517 ) .
this study was included since it is water based , but it is not a direct comparison of the cocrystal and coformer solubilities .
this limited data set seems to show that in general , cocrystals comprised of low aqueous solubility coformers do appear to have better solution stability , and especially with coformer solubility values less than 10 mg / ml .
one exception is the amg517/sorbic acid cocrystal which exhibits poor solution stability with a low solubility coformer .
this could be due to the use of fasif for the studies rather than water where other factors may be contributing to the solubility .
it is interesting to note that this cocrystal exhibited an intermediate solubility for this series in fasif ( 12 g / ml ) ; therefore , cocrystal solubility was not able to explain the deviation in this case .
although this limited data set is interesting , further work would be needed to determine if low solubility coformers result in cocrystals that are more stable in solution .
the effect of the cocrystal solubility versus the coformer solubility would also be an interesting factor when investigating solution stability .
solution stability performed in water for all compounds except amg517 , which was determined in fasif .
plot of the solution stability of pharmaceutical cocrystals versus the estimated aqueous solubility of the corresponding coformer .
the dissociation of cocrystals and the resulting solid produced presents a possible complication during development of a drug product .
a celecoxib / nicotinamide cocrystal was studied in various formulation vehicles ( 110% sodium dodecylsulfate ( sds ) and polyvinylpyrrolidone ( pvp ) ) in order to understand the solid form that may result upon contact with simulated gi fluids.(59 ) four crystal forms of celecoxib have been reported with form iii being the marketed form.(60 ) dissolution and solubility of the celecoxib / nicotinamide cocrystal were dependent on the medium and have been attributed to the dissociation of the cocrystal and recrystallization of celecoxib form i and iii .
it was found that the addition of surfactants affected this conversion . when a mixture of sds with a 1/1 celecoxib : nicotinamide / pvp was exposed to 0.01 n hcl the following was found to occur : ( a ) a portion of the drug becomes amorphous , presumably stabilized by pvp ; ( b ) the crystalline material is present as a metastable celecoxib form iv ; and ( c ) the crystalline material present is mostly nonaggregated and has a very small particle size .
this resulted in a shelf stable formulation that dissolved rapidly , which could lead to faster absorption , although animal bioavailability studies were not performed .
this study highlights the importance of investigating formulation approaches for cocrystals and understanding the possible conversions that could take place upon contact with simulated gi fluids and ultimately in animal or human subjects .
solution stability is important not only for solution or suspension products , but can also impact other properties such as solubility and dissolution data for other types of dosage forms .
the effects of dissociation , recrystallization , ionization , complexation , and solution chemistry are all areas that will need further work to better understand how cocrystals will behave in various media .
one of the main reasons to investigate cocrystals is to increase the solubility of a poorly soluble compound . for neutral molecules
for a free acid or free base , both salts and cocrystals can be used to improve the solubility ; however , it is not always straightforward to determine whether a salt or a cocrystal has been formed(4 ) and a variety of techniques may be needed to understand the system .
kinetic solubility values are approximate values usually based on one measurement at one time point . unless preliminary experiments have been performed , it is not known if equilibrium has been reached in the time frame used . for equilibrium solubility
, a number of time points and measurements are taken to ensure that the solution has reached equilibrium as evidenced by a plateau in the concentration data .
can also be a factor for development based on the residence time in the stomach and intestines .
it is desirable to have the drug dissolve while it is in the gastrointestinal tract and very long dissolution times may result in less absorption of the drug .
powder dissolution rates can also be dependent on particle size ; therefore intrinsic dissolution rate may be a better assessment of this parameter .
a second consideration is form changes during the experiment , as discussed previously for solution stability .
when form changes occur , the solubility data obtained may not be relevant to the starting compound in the experiment .
form changes can be suggested by solubility data collected at various time points by a precipitous drop in concentration indicating crystallization of a less soluble form ( as shown in figure 7 ) . in these cases ,
the maximum solubility observed over the time profile ( smax ) may be reported along with the time it occurred ( it should be noted that the smax value is likely not an equilibrium solubility value ) .
any suggested form changes can then be confirmed by analysis of the solid form remaining at the end of the experiment .
however , the native ph produced in an aqueous solution of a molecule with acidic or basic groups may also play a role in solubility .
schematic of a solubility curve due to a form change and precipitation of a less stable form ( curve a ) ; at equilibrium , the curve will level out to the solubility of the less soluble form .
the solubility of cocrystals has been reported in a number of cases and in a variety of media , including water , 0.1 n hcl , phosphate buffer , sgf , and sif .
particle size was controlled by sieving samples , in some there was no reported control , and in others different particle size ranges were used for comparison .
this shows the wide range of experimental variables that can be used for solubility testing which can be tailored to obtain the desired information .
intrinsic dissolution profile of fluoxetine hcl and its cocrystals measured in water at 10 c .
( top ) fluoxetine hcl / succunic acid cocrystal ; ( middle ) fluoxetine hcl ; ( middle ) fluoxetine hcl / fumaric acid cocrystal ; ( bottom ) fluoxetine hcl / benzoic acid cocrystal . figure modified from ref ( 12 ) .
three itraconazole cocrystals ( succinic acid , l - malic acid , and l - tartaric acid ) were compared with crystalline itraconazole ( particles less than 10 m ) and commercial sporanox beads ( amorphous itraconazole).(61 ) solutions of 0.1 n hcl were used and sampled over 500 min . the cocrystals all exhibited higher solubility than the crystalline itraconazole .
the l - malic and l - tartaric acid cocrystals exhibited solubilities similar to that obtained for the sporonax beads ( approximately 7 10 m ) and the succinic acid was lower ( approximately 2 10 m ) .
the cocrystalline forms achieved and sustained from 4- to 20-fold solubility increases over the crystalline itraconazole .
polymorphic cocrystals of 1:1 carbamazepine / saccharin.(77 ) for cocrystals of fluoxetine hcl , the aqueous solubility ( called powder dissolution in the paper ) was measured at various time points up to 120 min , and the solutions were analyzed by uv.(12 ) samples were sieved to obtain a particle size range of 53150 m . the fluoxetine hydrochloride solubility was 11.4 mg / ml . the benzoic acid cocrystal solubility was lower at 5.6 mg / ml and the fumaric cocrystal solubility was higher at 14.8 mg / ml .
the succinic acid cocrystal had a peak solubility of 20.2 mg / ml after about 1 min , but then decreased to that of fluoxetine hcl based on the dissociation of the cocrystal to fluoxetine hydrochloride .
this system exhibited higher and lower solubilities along with dissociation , making it a very interesting and complex set of cocrystal solubilities . for nine cocrystals of amg517,(37 )
solubility was measured in fasted simulated intestinal fluid ( fasif ) , and samples were taken out to 24 h and analyzed by hplc .
smax ranged from 1 g / ml for trans - cinnamic acid to 21 g / ml for benzoic acid and log smax ranged from 0.00 for trans
six of the nine cocrystals reached maximum solubility within 12 h ( glutaric acid , glycolic acid , sorbic acid , trans-2-hexanoic acid , lactic acid , benzoic acid ) with a noticeable decrease in solubility after that time .
the decrease was attributed to formation of the free base hydrate , which was confirmed by analysis of the remaining solids .
four cocrystals with smax values below 3 g / ml exhibit no form change after the experiment ( trans - cinnamic acid , 2,5-dihydroxybenzoic acid , 2-hydroxycaproic acid , and benzoic acid ) possibly due to insufficient time to undergo conversion in the 24 h time frame . as discussed previously ,
correlation analysis showed the highest interdependence between melting point and log smax for nine cocrystals with r = 0.546 .
previous reports of correlations between melting point and log s have been better , but were performed on unicomponent systems with equilibrium solubility values , not multicomponent systems with only maximum solubility values .
association and dissociation of cocrystals in various media are not well understood and may be a contributing factor .
it should be noted that the initial solubility advantages of the cocrystals may be sufficient to give an exposure advantage in pharmacokinetic studies even if they dissociate .
the powder dissolution profile of a 1:1 indomethacin / saccharin cocrystal was measured in phosphate buffer ( ph 7.4 , 60 and 200 mm strengths ) and compared to crystalline -indomethacin.(46 ) samples were sieved to obtain a particle size less than 125 m .
the solubility of the -indomethacin ranged from 0.72 mg / ml in 60 mm buffer to 1.3 mg / ml in 200 mm buffer with peak dissolution obtained after 250 min ; the solids did not change form during the experiment .
the cocrystal was found to dissolve instantaneously in the 60 mm buffer followed by precipitation and ph drop to 6.8 .
analysis of the solids showed mainly amorphous material with evidence of -indomethacin peaks . when the buffer strength was increased to 200 mm , rapid dissolution
analysis of the remaining solids did not show peaks indicative of the crystalline cocrystal . as noted , it is important to consider ionization of the ligand , complexation , and solution chemistry to understand the solubility behavior of cocrystals .
the dissolution and solubility of a 1:1 celecoxib / nicotinamide cocrystal was found to be medium dependent where transformation of the cocrystal to celecoxib forms i and iii was affected.(59 ) cocrystal solids were gently ground with pvp - k-30 alone or with sds to make a formulation for comparison with the cocrystal solid alone .
small amounts of surfactants ( sds and triton - x100 ) were added to 20 mm sodium phosphate buffer or 0.1 n hcl .
samples were equilibrated for up to 60 min in most cases and analyzed by hplc .
the presence of the surfactants in solution resulted in a rapid dissolution of the cocrystal and conversion to large aggregates of celecoxib form iii .
the formulated cocrystal containing sds and pvp were found to wet rapidly and convert to a mixture of amorphous celecoxib and small particles of celecoxib form iv .
this study illustrates the importance of understanding form conversions in solution and their effect on not only solubility and dissolution , but also on bioavailability .
it is also a demonstration of how simple formulations can be used to overcome the dissociation of cocrystals and recrystallization of poorly soluble forms .
two studies investigated the effect of particle size on the powder dissolution of cocrystals . for a 1:1 carbamazepine / saccharin cocrystal
, experiments were conducted in sgf using six particle size fractions ranging from < 53 m to > 1000 m.(54 ) samples were analyzed out to 120 min .
the study focused on the initial rate of dissolution , which has been correlated to increased bioavailability for carbamazepine.(62 ) as expected , faster initial dissolution was observed with the smaller particles .
dissolution rates for sieve fractions > 500 m slowed to the point where carbamazepine concentrations were significantly lower after 2 h than the smaller particles .
sieved fractions > 500 m were less than 50% dissolved after 60 min ; however , fractions < 150 m were greater than 80% dissolved at the same time point .
presence of carbamazepine dihydrate was found in large particle size samples equilibrated overnight in sgf and could be contributing to the low solubility ; however , the amount present at 60 min was not reported .
another report on a 1:1 exemestane / maleic acid cocrystal and a 1:1 megestrol acetate / saccharin cocrystal looked at powder dissolution in fasif with three particle size fractions ( 150300 m , 106150 m , and fines).(63 ) agglomeration and wettability were improved by physically mixing the cocrystals with lactose ( 1:10 drug / lactose ) .
samples were tested in fasif for 30 min , and samples were analyzed by hplc .
the 1:1 exemestane / maleic acid cocrystal was found to be similar to the exemestane fine crystals and did not show improved dissolution , likely due to transformation of the cocrystal to the parent compound .
the dissolution profile of the 1:1 megestrol acetate / saccharin cocrystal fines showed a significant improvement , with a six times increase in concentration at 15 min compared to megestrol fines alone ; however , a drop in concentration was observed after this time point for the cocrystal fines .
transformation studies showed that the exemestane / maleic acid cocrystal transformed much more quickly than the megastrol acetate / saccharin cocrystal and can help explain the observed differences between the two systems .
it was also found that the transformation rate for the small crystals in both systems was slower than the large crystals . understanding the solid transformations occurring in solution
the significant increase in concentration with the fine 1:1 megestrol acetate / saccharin crystals may have an impact on absorption and ultimately solubility , and particle size reduction of cocrystals should be considered as an additional option during development . in a number of cases , both salts and cocrystals have been prepared and the solubilities compared , as summarized in table 5 . for norfloxacin , a cocrystal was formed with isonicotinamide and three salts were prepared ( succinate , malonate , and maleate).(41 ) apparent aqueous solubility was measured after 72 h and the solution was analyzed by uvvis ; the form remaining at the end of the experiment was not reported .
norfloxacin apparent solubility was 0.21 mg / ml , whereas the apparent solubility ranged from 0.59 mg / ml for the isonicotinamide cocrystal to 3.9 mg / ml for the malonate salt and 9.8 mg / ml for the maleate salt .
this resulted in a 3 increase in solubility for cocrystal and 2045 increase for salts .
a similar trend was reported for a pfizer compound ( pfizer 1).(28 ) it is a weak base with poor aqueous solubility ( 0.0008 mol / ml ) .
the goal was to find a form that showed significant increases in solubility and bioavailability compared to the free base .
three of these were dicarboxylic acidbase complexes : a sesquisuccinate ( neutral ) , a dimalonate ( mixed ionic and zwitterionic ) , and a dimaleate ( salt ) .
aqueous solubility data showed that the sesquisuccinate cocrystal was better than the parent compound ( 0.79 mol / ml ) , the dimalonate mixed ionic state was more of an improvement ( 3.83 mol / ml ) , and the dimaleate salt exhibited the best solubility ( 10.4 mol / ml ) .
the reported solubility values are listed in table 5 displaying a value of < 0.01 mg / ml for the cocrystal and piroxicam free base to a range of 2.08 to > 300 mg / ml for the various salts .
eight of the 10 salts exhibited a higher solubility than the free base , one was lower than the free base ( lamivudine ) , and one ( amlodipine ) could not be measured due to hygroscopicity issues .
it was interesting to note that the solution ph of the saccharin cocrystal was much lower ( 3.27 ) than the salts ( 5.256.25 ) .
a follow - up study compared calculated solubility values for salts and cocrystals formed with saccharin.(66 ) the thermodynamic solubility product ( ksp ) was calculated for the saccharin cocrystal ( piroxicam ) and the nine saccharinate salts based on one solubility value at a known ph and the pk of each component reported in the literature .
the calculations showed that in water , salts can form for all 11 compounds in the study including piroxicam which formed a cocrystal .
it was suggested that piroxicam was isolated as a cocrystal due to the shift in pk values when chloroform or ethanol solutions were used for crystallization . on the basis of the calculations , the general conclusion that the saccharinate salts were more soluble than the cocrystal
it was also noted that cocrystal solubility needs to take into account a revised definition of the solubility product as well as any possible complexation in solution and underlying factors related to both solid - state and solution chemistry .
as expected , the limited examples in this section show that solubility may be improved using cocrystals , but not in all cases . for a poorly soluble compound ,
especially if it does not have ionizable groups , it is worth trying cocrystals to see if an improvement can be obtained . in the case of cocrystals versus salts
, there appears to be a trend that salts may offer a greater solubility advantage , as shown with limited data in table 5 , but more work needs to be performed to determine if this is a general trend .
this is accomplished by pressing a disk or pellet , commonly using a woods apparatus in a dissolution vessel.(67 ) solution concentration is measured over time to determine the dissolution rate ( in mg / cmmin ) .
the disk needs to remain intact during the experiment , so compression pressures may be critical for poorly compressible powders .
it is also important that there is no form change upon pressing the pellet or during the dissolution study .
xrpd data can be obtained on the initial disk and the remaining disk after completion of the experiment to determine any major form changes that may affect the dissolution data .
data for the glutaric acid cocrystal of 2-[4-(4-chloro-2-fluorphenoxy)phenyl]pyrimidine-4-carboxamide(48 ) were collected in water over 90 min and showed that the cocrystal dissolution was approximately 18 times faster than the parent compound .
xrpd of the remaining solid showed mainly the glutaric acid cocrystal , with only minor peaks for the parent material , indicating that the results were not skewed by significant form changes over the course of the experiment .
the intrinsic dissolution rates for fluoxetine hcl cocrystals were also measured in water , figure 8.(12 ) the dissolution of the 2:1 fluoxetine hcl / succinic acid cocrystal was too fast to measure an accurate value for the dissolution rate , but a 3fold increase over fluoxetine hcl was estimated based on early time points .
the 1:1 fluoxetine hcl / benzoic acid cocrystal was roughly half - that of the api and the 2:1 fluoxetine hcl / fumaric acid cocrystal was approximately the same as that of the api .
these results show that cocrystals can enhance the dissolution rate , but can also show no improvement or a slower dissolution rate .
it was interesting to note that the aqueous solubility of the guest molecule appears to correlate with the aqueous dissolution rates of the corresponding cocrystal , with benzoic acid being the least soluble ( 0.34 g/100 g ) , fumaric acid being intermediate in solubility ( 0.61 g/100 g ) , and succinic acid being the most soluble ( 7.5 g/100 g ) .
other examples will be needed to determine if this is a general trend or specific to this system . in a third study , measurements were obtained on 1:1 exemestane / maleic acid and 1:1 megestrol acetate / saccharin cocrystals in fasif.(63 ) the 1:1 exemestane / maleic acid cocrystal showed essentially the same dissolution rate as the exemestane alone ; however , analysis of the remaining solid material showed a conversion to exemestane during the experiment .
the 1:1 megestrol acetate / saccharin cocrystal was 34 times higher than megestrol acetate , but there were significant variations in the data .
analysis of the remaining solid showed only a small amount of conversion to megestrol acetate .
these data show that the initial dissolution rate of megestrol acetate was improved by using the cocrystal .
as discussed for solubility and solution stability , intrinsic dissolution is an important parameter to investigate , but it may become more complicated with cocrystals .
various factors need to be considered and extra experiments may be needed to correctly obtain and interpret intrinsic dissolution data on cocrystals .
bioavailability is a measurement of the rate and extent of the active drug that reaches systemic circulation.(68 ) animal bioavailability is an important parameter to consider when preparing new forms of a compound , and studies can be set up in a number of different ways to obtain specific information for development .
species for animal studies can include rodents , rabbits , dogs , pigs , and primates . these studies are usually performed during early development and can be small studies ( 46 animals ) to determine pharmacokinetic data quickly on a new form .
usually the same animals are used for all forms / formulations with a washout period , typically , a week in length , between the doses .
this gives a direct comparison within the same animals for all the materials in the study .
a study with both the parent material and the cocrystal will give a direct assessment of bioavailabiliy improvements due to the cocrystal . in a relative or comparative bioavailability study , the amount of drug in the blood is measured after oral administration of the original form and then the cocrystal .
it is important to note that the materials used in the study need to be formulated in the same way if a direct comparison is desired .
most dosing is done orally and formulation possibilities include powder in a capsule , powder and excipient in a capsule , or liquid formulations ( solutions or suspensions ) .
it is important to differentiate between solutions and suspensions since dissolution of the solid in a solution could significantly improve bioavailability . for suspensions it is helpful to know how much of the compound may actually be dissolved in order to determine how that may affect the results .
absolute bioavailability includes not only the cocrystal formulation , but an iv formulation as well to determine maximum exposure based on the iv data and a comparison with the oral formulation . a limited number of animal bioavailability studies
one study on the pharmaceutical cocrystal of a monophosphate salt with phosphoric acid mentions that excellent in vivo performance was observed , but no details about the study are given.(13b ) a hemitartaric acid cocrystal of l-883555 was given orally to rhesus monkeys.(56 ) four animals were used and a dose of 3 mg / kg ( based on the parent compound ) was administered .
a methocel formulation was used , but it was not clear if a solution or suspension was produced .
the cocrystal was found to be 15 times more bioavailable than the parent compound based on the maximum blood concentration ( cmax ) values .
a dog study compared a 1:1 carbamazepine / saccharin cocrystal with the marketed immediate release tablets of carbamazepine(54 ) ( tegretol containing carbamazepine form iii ) .
four dogs were used and samples were taken up to 12 h post dose . the ground cocrystal ( particle size < 53 nm ) was mixed with lactose in a dry blending step and placed into capsules containing a dose of 200 mg of carbamazepine . the pharmacokinetic parameters ( auc , cmax , tmax ) were all found to be similar to the marketed product .
this study noted that cocrystals can serve as a model for addressing physicochemical problems of a pharmaceutical compound ( i.e. , stability , solubility , dissolution ) , but will not overcome issues of metabolism or pharmacology . for dog studies of a 1:1 2-[4-(4-chloro-2-fluorphenoxy)phenyl]pyrimidine-4-carboxamide / glutaric acid cocrystal ,
a simple powder in capsule formulation was used at two dose levels ( 5 and 50 mg / kg).(48 ) the cocrystal was compared directly to the crystalline api ( 2-[4-(4-chloro-2-fluorphenoxy)phenyl]pyrimidine-4-carboxamide ) .
the mean cmax values for the 5 mg dose were 89 and 25 ng / ml for the cocrystal and parent compound , respectively .
for the 50 mg dose , the cmax values were 278 and 89 ng / ml for the cocrystal and parent compound , respectively .
the cocrystal was found to be over three times more bioavailable than the parent material in these studies using only powder in a capsule as a formulation .
it should be noted that the increase in dose was not proportional to the increase in exposure .
intrinsic dissolution experiments showed the cocrystal to be 18 times more soluble than the parent material in pure water and after 90 min the pellet showed very minor xrpd peaks due to the parent material .
exposure of the pellets to water for 24 h showed complete conversion to the parent material . even though it is possible that the cocrystal may have dissociated in the animal studies , the increase in bioavailability and exposure was still significant .
the 1:1 amg 517/sorbic acid cocrystal(47 ) was compared to the parent free base in a rat bioavailability study using 10% ( w / v ) pluronic f108 in oraplus suspensions of free base ( 500 mg / kg ) and cocrystal ( 10 , 30 , 100 , 500 mg / kg ) .
it was found that a 30 mg / kg dose of the cocrystal resulted in comparable exposure to a 500 mg / kg dose of the free base .
this is another example where the cocrystal was found to dissociate in fasif , but displayed significantly higher solubility than the parent compound before it dissociated .
this higher solubility may increase exposure if it stays in solution while it passes through the small intestine .
although the number of examples is limited , cocrystals can significantly increase the bioavailability of poorly soluble compounds .
there is not always a direct in vitro / in vivo correlation and even examples of dissociated cocrystals in in vitro studies can provide improved performance in animal studies .
in order for pharmaceutical cocrystalline materials to move from small scale screening exercises to a viable option for development and ultimately drug products , scalable ( kilo to multikilo ) processes offering high cocrystal purity and yields must be devised and established .
cocrystal quantities of milligrams to a few grams are typically produced depending on the types of characterization and/or initial physicochemical studies ( rate dissolution , solubility , bioavailability , etc . )
a recent survey of the open literature showed that slow evaporation and grinding are the two most common techniques for cocrystal growth ; however , these approaches possess obvious limitations upon scale - up , and thus additional routes must be formulated.(69 ) in one account , the preparation of a carbamazepine / saccharin cocrystal was produced on a 30 g scale through solution crystallization.(54 ) within this procedure , the components were dissolved in a mixture of ethanol and methanol ( 3:1 ) and refluxed at 70 c for 1 h. the temperature was then lowered , and the precipitate was filtered , dried , and characterized as the 1:1 cocrystal of carbamazepine and saccharin . interestingly , under the reaction conditions selected , seeding was not necessary to produce the desired cocrystalline form in high purity .
recently a detailed report on the scalable solution - crystallization process of a carbamazepine / nicotinamide cocrystal was described.(69 ) outlined within the crystallization methodology are three criteria to be examined : ( a ) determine an appropriate solvent system ; ( b ) identify the pathway , through multicomponent solidliquid phase equilibrium diagrams , to produce the desired form ; ( c ) determine a mechanism to induce nucleation and control the desaturation kinetics of the process . through a seeding strategy in ethanol ,
the cocrystal was successfully produced on a 1 l scale with yields in excess of 90% .
the construction and use of ternary phase diagrams should be considered when scaling up cocrystals from solution because information about the relationship between equilibria of the solid phases and solvent choices is obtainable .
it is critical to determine and map the solubilities of the individual components since the phase region where the most thermodynamically stable cocrystal is located will be altered based on whether or not they possess similar solubilities in a given solvent . as pharmaceutically based cocrystalline materials move further into development and become viable options as marketed products , scaleable cocrystal processes must be evaluated and optimized . searching for polymorphs of a particular compound
since polymorphic compounds can potentially possess drastically different physical and chemical properties , considerable efforts are taken to identify and characterize all forms during development .
it is not surprising that polymorphic cocrystals can also exist(72 ) and possess varying physicochemical properties between forms .
detailed below are three examples of api - based polymorphic cocrystals and one example of an extensive polymorph screen on a cocrystalline material .
a conformational polymorphic set of 1:1 cocrystals was observed when a chloroform solution of caffeine and glutaric acid were allowed to slowly evaporate.(73 ) the two different morphologies , rods ( form i ) and blocks ( form ii ) , crystallize concomitantly with identical molecular connectivities ; however , differences arise in the torsional angles of the methylene carbons on the acid .
interestingly , each of the forms could be produced individually through mechanical grinding . in the absence of solvent or when
a fairly nonpolar solvent was used , form i was formed ; however , when a more polar solvent was utilized , form ii resulted .
form ii was found to be more stable with respect to humidity , as form i displayed partial conversion to form ii after 1 day at 43% rh , with full conversion to form ii after 1 day at 75% rh.(49 ) this example clearly shows the differences in stability that polymorphic cocrystalline forms can possess . in another example , when an equimolar mixture of chlorzoxazone and 2,4-dihydroxybenzoic acid are evaporated from tetrahydrofuran ( form i ) or ethyl acetate ( form ii ) , 1:1 polymorphic cocrystals are generated.(74 ) upon mechanical grinding of the individual components form ii was only produced , and solvent - assisted grinding or heating a sample of form i results in full conversion to form ii .
piroxicam is known to exist in two tautomeric forms in the solid state , a nonionized tautomer and a zwitterionic tautomer . from a cocrystallization screen , two 1:1
polymorphic cocrystals were formed between piroxicam and 4-hydroxybenzoic acid.(6 ) interestingly , the hydrogen bonding patterns are different between forms ( this is arguably the first report of cocrystal synthon polymorphism),(75 ) as well as , in one form the piroxicam nonionized tautomer exists , while in the other the zwitterionic tautomer is observed .
unlike the previous two examples , in the case of the 1:1 cocrystal of carbamazepine and saccharin ( form i ) , an extensive polymorphic screen was conducted on one form.(54 ) by means of high - throughput crystallization , 480 experiments including saccharin and carbamazepine in various solvents and solvent mixtures were performed , yielding 156 solid materials which were characterized by xrpd or raman spectroscopy .
no polymorphic forms of the cocrystal were observed . additionally , solvent - assisted mechanical grinding experiments were tried , using 24 different solvents .
the remaining solids were characterized by xrpd , resulting , once again , in only the original cocrystal form . finally , slurry conversion experiments utilizing seven different solvents at ambient temperatures for four days were attempted .
furthermore , dissociation of the cocrystal was not observed from the seven solvents , giving additional insight into the solution stability of the cocrystalline material .
it should be noted , however , that a second polymorph of a 1:1 cocrystal of carbamazepine / saccharin ( form ii ) was found using a polymer heteronuclei crystallization media , and the hydrogen bonding patterns for the two forms are shown in figure 9.(76 ) polymorphism of cocrystals will attract more attention as cocrystals continue to gain momentum during the development of new pharmaceuticals .
as with salts , cocrystal polymorphs offer additional options to alter properties , increase patent protection , and improve marketed formulations .
patents have become a critical element of drug development , especially when covering solid forms .
there have been limited reports on cocrystals and ip , but more information on this area is expected as the field grows .
pharmaceutical patents can cover a number of different areas , including composition of matter ( molecular structure , solid form , or formulation ) , method of use ( medical indication ) , and manufacturing processes . in order for an invention to qualify for patent coverage , it must satisfy three criteria : novelty , utility , and nonobviousness . for solid form patent applications directed to pharmaceuticals in general
, utility is not usually problematic , and the examples in this paper readily show examples of utility of new cocrystals above and beyond the therapeutic effect of the api . for a solid form to be novel , it can not appear in the prior art either expressly or inherently .
for most pharmaceutical cocrystals , prior art is limited since the coformer would likely not be published in connection with the crystallization of the api .
the third area is being nonobvious , which may be viewed , in at least some circumstances , as correlating with predictability .
crystal engineering is certainly an advantage when trying to decide on possible coformers , but there is no guarantee that a cocrystal will form .
computational analyses are also not able to reliably predict the structure or properties of cocrystals at this point in time , which adds to the nonobvious nature of solid forms in general and especially cocrystals .
cocrystals represent a broad patent space since there is a large number of coformers available based on the possible compounds in the eafus ( everything added to food in the us ) and gras ( generally regarded as safe ) lists.(24 ) however , because of the lack of predictability in the field , it is expected that in many circumstances patent coverage will be narrow .
cocrystals can also play a role in lifecycle management.(78 ) lifecycle management can involve drug product improvements along with new solid forms .
early in the development process , chemical structures are patented and additional ip protection can be obtained by patenting different solid forms throughout development . if an approved drug product contains a new patented solid form , especially where the solid form offers a commercial advantage over the original form , the solid form patent might provide meaningful ip protection after the expiration of the original patent .
however , a solid form that was not found by the innovator , but was found and patented by a competitor , could significantly alter this strategy .
cocrystal screens for potential blockbuster drugs could end up being very large in order to protect , not only the cocrystals found , but also any polymorphs , hydrates , solvates , or other solid forms of the individual cocrystals . from a regulatory point of view for generic products , cocrystals may present an interesting option .
currently , when generic pharmaceutical companies use polymorphs and hydrates as alternatives to ethical drugs , they file abbreviated new drug applications ( andas ) , which requires the submission of minimal bioavailability and clinical data and does not require proving safety or efficacy
. new salts of an api , however , use a slightly different regulatory pathway , a so - called 505(b)(2 ) application , and require more testing and clinical data than an anda submission .
the classification of cocrystals as a generic has not yet been addressed.(78 ) cocrystals contain nonionic interactions like hydrates , but they also contain substances with possible toxicity issues , similar to salts .
the decision on how to regulate cocrystals for generic products may affect their use in the generic industry .
cocrystals will raise ip and regulatory questions as more of these compounds are developed , moved later into development , and eventually marketed .
as with any solid form , they will offer their own challenges and many issues will need to be dealt with on a case by case basis .
one can clearly see a place for cocrystals within the pharmaceutical market . on the basis of the limited examples available ,
melting points are altered for most cocrystals , with approximately 51% resulting in melting points between those of the api and coformer and 39% resulting in lower melting points . correlations with other parameters , such as solubility , are limited and will be complex due to the multicomponent nature of the cocrystals . in many cases , improved stability , such as resistance to hydrate formation , has been shown for cocrystals . however , general trends are not evident and each system needs to be evaluated to determine if improvements are obtained . improved solubility for poorly soluble compounds
limited studies suggest that salts will provide a larger increase in solubility if they are available . for poorly soluble neutral compounds ,
it was shown that significant increases in bioavailability are possible with cocrystals , even when dissociation of the cocrystal is suspected based on in vitro studies .
other aspects of development , such as polymorphism and scale - up , will need to be examined for cocrystals .
processes to produce cocrystals on a large scale will likely require different approaches , such as those based on ternary solubility phase diagrams .
cocrystals will provide additional options for ip , regulatory , and lifecycle management for new and old drugs and will provide additional challenges as they continue through the development process . to date , no cocrystalline drug products appear to be on the market , although there is no doubt that cocrystals are present in pharmaceutical drug pipelines and it is only a matter of time before this imagination becomes a reality . | over the last 20 years , the number of publications outlining the advances in design strategies , growing techniques , and characterization of cocrystals has continued to increase significantly within the crystal engineering field .
however , only within the last decade have cocrystals found their place in pharmaceuticals , primarily due to their ability to alter physicochemical properties without compromising the structural integrity of the active pharmaceutical ingredient ( api ) and thus , possibly , the bioactivity .
this review article will highlight and discuss the advances made over the last 10 years pertaining to physical and chemical property improvements through pharmaceutical cocrystalline materials and , hopefully , draw closer the fields of crystal engineering and pharmaceutical sciences . | Introduction
Physicochemical Property Review
Additional Development Factors
Conclusions |
autism is a complex developmental disorder which has lifelong effects on several aspects of an individual .
although , the autism spectrum disorder ( asd ) is known to be neurogenetic in origin , its diagnosis is primarily based on behavioral and clinical signs and symptoms . according to diagnostic and statistical manual of mental disorders , 4 edition , text - revision ( dsm - iv - tr ) , and international classification of diseases ( icd ) ,
there are three main diagnostic criteria for autistic disorders : impairments in social interaction , impairments in communication and language and restricted , stereotyped behaviors , interests and activities . regarding the neurologic and genetic basis of autism ,
however , so far regularly standard diagnostic tests are based on psychological and behavioral assessments such as autism diagnostic interview - revised ( adi - r ) , autism diagnostic observation schedule ( ados - g ) and childhood autism rating scale ( cars ) .
recently , autism studies have shown an increased interest in examining the effect of different developmental , educational and behavioral interventions on children with asd after their diagnosis is confirmed by diagnostic instruments .
several researchers have administered longitudinal studies to monitor the long lasting improvement of autistic children . as an example glen
et al evaluated outcomes including cognitive , language , adaptive , social and academic measures after 4 years of intensive behavioral treatment .
they found that about half of their autistic children achieved average post treatment scores and succeeded in regular education classrooms by showing rapid learning .
however , till recent , to choose a valid and proper measure assessing the changes and progress in autistic populations is a major controversial issue . for years
, there was no specific measure while instead , measures such as ados , adi - r or cars have being used to examine the symptoms , evaluate changes and improvement in response to different interventions .
although these measures display overall stability over time , they are primarily designed as diagnostic tools but not sensitive enough to examine symptom severity and also intra - subject changes . moreover ,
the assessment tools provided for typically developing ( td ) children have been used to evaluate autistic individuals . however , these measures are not often suitable for autistic children since they commonly show a too far different developmental pattern compared to their td peers .
another problem in assessing long - term changes is the lack of an instrument which can evaluate autism severity along with developmental deficits .
although , some of them such as vineland adaptive behavior scales ( vabs ) as an informant based measure do cover a wide age range , it is not appropriate for comparing autistic with normative data .
hence this schedule focuses mainly on developmental profile which in autism is very delayed and deviant . increasing number of children classified as asd over the past decade , alarms a vital need for early life interventions .
hence , in order to establish a reliable baseline for tracking the trajectory of early treatments , sensitive monitoring tools are becoming more mandatory .
however , given several constraints of families , schools and service providers of individuals with asd , it is important to provide symptom severity profile in a time - efficient , economic and practical way .
autism treatment evaluation checklist ( atec ) is a one paged checklist designed to be completed by parents , teachers or caretakers and is a simple but effective tool to assess the severity of symptoms as well as developmental aspects of autism .
in other words atec also fulfills the need for a valid , easy to administer and sensitive to change instrument .
the atec which totally contains 77 items , covers four main impairment areas of asds including communication , sociability , sensory - cognitive awareness and health - physical - behavior ( for more details on the scale , see methods ) .
the atec is freely available and can be scored online with minimal training and resources .
a considerable amount of literature administered autism treatment evaluation checklist , has described that atec is sensitive to intra - subject changes after treatment programs . in a recent investigation , megiati
given their findings , they introduce atec as a potentially useful and promising tool for gathering reliable data on current behaviors and skills as well as general functioning of children with autism spectrum disorders .
moreover , other findings have shown that atec data were significantly correlated with other equivalent diagnostic tools ( ( e.g .
pervasive developmental disorders behavior inventory ( pdd - bi ) : r=0.87 or severity of autism scale ( sas ) : r=0.7 ) ) . given together
, one can argue that atec is a potentially reliable and valid tool for monitoring progress over time .
it is noteworthy that exploring the standardization of a questionnaire is a continuing dynamic process and different investigations with different samples are supposed to examine the validity and reliability of the instrument .
in addition , concerned for the fact that most of the health related questionnaires and scales have been developed in english speaking countries , the need to adapt the questionnaires in other than the source language has grown rapidly . cross - cultural adaptation is a valid process through which reliable health status measures may be obtained in order to be used in different countries in spite of different sociocultural conditions .
the process of adaptation provides a ground to measure a same phenomenon using a same instrument across different cultures .
so far , however , there have been few studies applying atec in different countries in order to be implemented in other languages than english as well as monitoring the validity of the instrument .
thus , the purpose of the present study is to investigate the cross - cultural adaptation , validity and reliability of atec questionnaire in an iranian autistic sample .
this project used a convenience sample of 134 children and adolescents with autism spectrum disorders ( 111 boys and 23 girls ) aged 6 - 15 years ( mean : 9.6 , sd : 1.97 ) .
all children met criteria for a diagnosis of autism on both the dsm - iv , and adi - r , while the diagnosis was established in a previous assessment by either a child psychiatrist or psychologist .
the child 's parent or caregiver completed written informed consent before they were assigned to the study .
the study was approved by the medical ethics committee of tehran university of medical sciences .
the current study used the essential methodological steps suggested by internationally recognized publications for the procedures involved in the cultural adaption of measurement instruments .
cross - cultural adaption stages were followed as below :
forward translation : in this stage , the questionnaire was translated from original language ( english ) to target language ( persian ) by 2 bilingual translators whose mother tongue was persian .
one of the translators was aware of the concepts examined by the instrument and had translated such medical questionnaires before . the other translator ( also called native translator ) was neither aware nor informed of the concepts and aims of the measurement instrument and had no medical background . in order to approach to a conclusive data ,
the results produced by both translators were compared with each other by the translators and a recording observer ( one of the researchers involved in the present study ) .
back translation : the final persian translation was again back translated into english by 2 bilingual , native english - speaking translators who were totally blind to the original version .
they were neither aware of the concepts and aims of the questionnaire nor had academic training in autism .
expert committee : the final persian translation and the back translation were compared and reviewed by a multidisciplinary , expert committee to obtain a final version .
the committee was composed of the translators , a psychologist , a methodologist , and a medical doctor . on the way to guarantee accurate comprehension , the members of the committee evaluated and reviewed the topics of each section while taking into account the semantic , idiomatic and cultural equivalents and the intelligibility of the items .
the committee also reviews all the atec drafts ( i.e. the original , forward and back translation drafts ) and reveals their suggestions about each item ; finally the last version of the draft was produced .
a sample of 20 primary caregivers of autistic children and adolescents was pretested in order to verify the comprehensibility of the statements and questions , to assess the equivalence of the instrument within the iranian culture and to recognize the errors in the final version . in order to assess the psychometric properties of the translated version of the instrument ,
the standardized factors were evaluated :
content validity : the content quality of the autism treatment evaluation checklist was reviewed by the expert committee all through the cultural adaptation procedure .
the items or questions would also have been revised if 15% of the participants had difficulty in the comprehension of the items in the pretest stage .
construct validity : the construct quality of the questionnaire was evaluated in order to ascertain that the persian version of the atec really measures what it is expected to measure by comparison of the adapted version of the instrument with similar tests that assess similar factors .
each subscale of atec was examined with its equivalent from adi - r ; for example atec subscale 1 entered the analysis paired with verbal subscale of adi - r . in this way
, there was more assurance that the adapted version is measuring a construct comparable to the original .
reliability : the reliability of the questionnaire was evaluated by measuring the internal consistency of all the items within each subscale of the questionnaire and stability of the instrument as well ( test - retest ) .
measures : autism treatment evaluation checklist atec consists of 4 subscales : 1 : speech / language/ communication ( 14 items ; maximum score : 28 ) ; 2 : sociability ( 20 items ; maximum score : 14 ) ; 3 : sensory / cognitive / awareness ( 18 items ; maximum score : 36 ) , and 4 : health / physical/ behavior ( 25 items , maximum score : 75 ) .
items on subscales 1 - 3 are scored from 0 ( not descriptive ) to 2 ( very descriptive ) .
scoring on subscale 4 ranges from 0 ( not a problem ) to 3 ( serious problem ) .
the total maximum score is 179 with a higher score representing higher severity of autistic behaviors and poorer social developmental skills , a decrease in scores indicates progress and improvement in autistic problems .
adi - r which provides a comprehensive assessment of individuals suspected to have autism spectrum disorders , was also used in this project .
adi - r consists of 93 items and focuses mainly on three functional domains : language and communication , reciprocal social interactions , restricted , repetitive and stereotyped behaviors and interests .
the interview also addresses other clinical factors like aggression , self - injury and possible epileptic features . for administrating adi - r an experienced interviewer
data were scored and interpreted by using a diagnostic algorithm or a current behavior algorithm .
construct validity of the instrument was evaluated by demonstrating the correlation between atec and adi - r according to pearson correlation ; the set point for p. value was 0.05 . internal consistency ( reliability ) of the instrument
was confirmed by cronbach 's coefficient alpha and guttman split - half coefficient ; an acceptable internal consistency was defined as a value > 0.7 .
furthermore , the stability of the instrument was evaluated using the test - retest reliability method ; the data obtained in first test session and retest session ( separated by 2 weeks ) were analyzed using the intraclass correlation coefficient to assess the reliability of all the scales measured .
this project used a convenience sample of 134 children and adolescents with autism spectrum disorders ( 111 boys and 23 girls ) aged 6 - 15 years ( mean : 9.6 , sd : 1.97 ) .
all children met criteria for a diagnosis of autism on both the dsm - iv , and adi - r , while the diagnosis was established in a previous assessment by either a child psychiatrist or psychologist .
the child 's parent or caregiver completed written informed consent before they were assigned to the study .
the study was approved by the medical ethics committee of tehran university of medical sciences .
the current study used the essential methodological steps suggested by internationally recognized publications for the procedures involved in the cultural adaption of measurement instruments .
cross - cultural adaption stages were followed as below :
forward translation : in this stage , the questionnaire was translated from original language ( english ) to target language ( persian ) by 2 bilingual translators whose mother tongue was persian .
one of the translators was aware of the concepts examined by the instrument and had translated such medical questionnaires before . the other translator ( also called native translator ) was neither aware nor informed of the concepts and aims of the measurement instrument and had no medical background .
in order to approach to a conclusive data , the results produced by both translators were compared with each other by the translators and a recording observer ( one of the researchers involved in the present study ) .
back translation : the final persian translation was again back translated into english by 2 bilingual , native english - speaking translators who were totally blind to the original version .
they were neither aware of the concepts and aims of the questionnaire nor had academic training in autism .
expert committee : the final persian translation and the back translation were compared and reviewed by a multidisciplinary , expert committee to obtain a final version .
the committee was composed of the translators , a psychologist , a methodologist , and a medical doctor . on the way to guarantee accurate comprehension , the members of the committee evaluated and reviewed the topics of each section while taking into account the semantic , idiomatic and cultural equivalents and the intelligibility of the items .
the committee also reviews all the atec drafts ( i.e. the original , forward and back translation drafts ) and reveals their suggestions about each item ; finally the last version of the draft was produced .
a sample of 20 primary caregivers of autistic children and adolescents was pretested in order to verify the comprehensibility of the statements and questions , to assess the equivalence of the instrument within the iranian culture and to recognize the errors in the final version . in order to assess the psychometric properties of the translated version of the instrument
, the standardized factors were evaluated :
content validity : the content quality of the autism treatment evaluation checklist was reviewed by the expert committee all through the cultural adaptation procedure .
the items or questions would also have been revised if 15% of the participants had difficulty in the comprehension of the items in the pretest stage .
construct validity : the construct quality of the questionnaire was evaluated in order to ascertain that the persian version of the atec really measures what it is expected to measure by comparison of the adapted version of the instrument with similar tests that assess similar factors .
each subscale of atec was examined with its equivalent from adi - r ; for example atec subscale 1 entered the analysis paired with verbal subscale of adi - r . in this way
, there was more assurance that the adapted version is measuring a construct comparable to the original .
reliability : the reliability of the questionnaire was evaluated by measuring the internal consistency of all the items within each subscale of the questionnaire and stability of the instrument as well ( test - retest ) .
measures : autism treatment evaluation checklist atec consists of 4 subscales : 1 : speech / language/ communication ( 14 items ; maximum score : 28 ) ; 2 : sociability ( 20 items ; maximum score : 14 ) ; 3 : sensory / cognitive / awareness ( 18 items ; maximum score : 36 ) , and 4 : health / physical/ behavior ( 25 items , maximum score : 75 ) .
items on subscales 1 - 3 are scored from 0 ( not descriptive ) to 2 ( very descriptive ) .
scoring on subscale 4 ranges from 0 ( not a problem ) to 3 ( serious problem ) .
the total maximum score is 179 with a higher score representing higher severity of autistic behaviors and poorer social developmental skills , a decrease in scores indicates progress and improvement in autistic problems .
adi - r which provides a comprehensive assessment of individuals suspected to have autism spectrum disorders , was also used in this project .
adi - r consists of 93 items and focuses mainly on three functional domains : language and communication , reciprocal social interactions , restricted , repetitive and stereotyped behaviors and interests .
the interview also addresses other clinical factors like aggression , self - injury and possible epileptic features . for administrating adi - r an experienced interviewer
data were scored and interpreted by using a diagnostic algorithm or a current behavior algorithm .
construct validity of the instrument was evaluated by demonstrating the correlation between atec and adi - r according to pearson correlation ; the set point for p. value was 0.05 . internal consistency ( reliability ) of the instrument
was confirmed by cronbach 's coefficient alpha and guttman split - half coefficient ; an acceptable internal consistency was defined as a value > 0.7 .
furthermore , the stability of the instrument was evaluated using the test - retest reliability method ; the data obtained in first test session and retest session ( separated by 2 weeks ) were analyzed using the intraclass correlation coefficient to assess the reliability of all the scales measured .
descriptive data and internal consistency coefficients for each atec subscale and total scores atec : autism treatment evaluation checklist / sd : standard deviation the procedures of translation , back translation and submission of the instrument to the expert committee showed that there was no need for significant changing of the meaning of items or adding and removing the statements . during the pretest stage ,
a direct interview with the participants was performed in order to appraise the difficulties in completing the questionnaires or to identify any misunderstanding in items or statements .
participants who were interviewed in this stage reported no difficulties in comprehending the content of each items ; however two complained that they had difficulties in recognizing the extent to which their child had problems during answering to some items ( in language and communication subscale ) .
following further discussion with the expert committee , authors found no need to significant change in wording and the reported problem seemed to be related to the information reminiscence situation .
however , according to the expert committee discretion , only the statements of two items were refined by adding a word . in the sociability subscale , the word " his / her inside " was added to the statement of the item 12 in parentheses
moreover , in the sensory / cognitive/ awareness subscale an exemplification for the word " tuning in " was added to the statement of the item 17 .
the internal consistency was evaluated by means of cronbach 's alpha and guttman split - half methods .
the results showed a high internal consistency of the instrument for total score in both methods ( cronbach 's coefficient alpha : 0.93 ; guttman split - half : 0.77 ) . internal consistency of the four atec subscales was also excellent in both methods ( table 1 ) .
stability ( test - retest ) test - retest reliability of the atec was calculated using intraclass correlation coefficient .
the stability was excellent for all the subscales and also for total scores ( table 2 ) .
test - retest reliability scores of the atec ( persian version ) atec : autism treatment evaluation checklist / ci : confidence interval data obtained for construct validation were submitted to statistical analysis using pearson correlation .
the achieved values of the atec subscales and related adi - r subscales are shown in table 3 .
results showed significant positive association between each pair variables , language and behavioral subscale indicated highest interrelation ( r=0.7 and 0.79 ) .
construct validity of the atec : correlations between atec subscales and adi - r raw data atec : autism treatment evaluation checklist / adi - r : autism diagnostic interview - revised
the procedures of translation , back translation and submission of the instrument to the expert committee showed that there was no need for significant changing of the meaning of items or adding and removing the statements . during the pretest stage , a direct interview with the participants was performed in order to appraise the difficulties in completing the questionnaires or to identify any misunderstanding in items or statements .
participants who were interviewed in this stage reported no difficulties in comprehending the content of each items ; however two complained that they had difficulties in recognizing the extent to which their child had problems during answering to some items ( in language and communication subscale ) .
following further discussion with the expert committee , authors found no need to significant change in wording and the reported problem seemed to be related to the information reminiscence situation .
however , according to the expert committee discretion , only the statements of two items were refined by adding a word . in the sociability subscale , the word " his / her inside " was added to the statement of the item 12 in parentheses
moreover , in the sensory / cognitive/ awareness subscale an exemplification for the word " tuning in " was added to the statement of the item 17 .
the internal consistency was evaluated by means of cronbach 's alpha and guttman split - half methods .
the results showed a high internal consistency of the instrument for total score in both methods ( cronbach 's coefficient alpha : 0.93 ; guttman split - half : 0.77 ) . internal consistency of the four atec subscales was also excellent in both methods ( table 1 ) .
stability ( test - retest ) test - retest reliability of the atec was calculated using intraclass correlation coefficient .
the stability was excellent for all the subscales and also for total scores ( table 2 ) .
test - retest reliability scores of the atec ( persian version ) atec : autism treatment evaluation checklist / ci : confidence interval data obtained for construct validation were submitted to statistical analysis using pearson correlation .
the achieved values of the atec subscales and related adi - r subscales are shown in table 3 .
results showed significant positive association between each pair variables , language and behavioral subscale indicated highest interrelation ( r=0.7 and 0.79 ) .
construct validity of the atec : correlations between atec subscales and adi - r raw data atec : autism treatment evaluation checklist / adi - r : autism diagnostic interview - revised
the achieved values of the atec subscales and related adi - r subscales are shown in table 3 .
results showed significant positive association between each pair variables , language and behavioral subscale indicated highest interrelation ( r=0.7 and 0.79 ) .
construct validity of the atec : correlations between atec subscales and adi - r raw data atec : autism treatment evaluation checklist / adi - r : autism diagnostic interview - revised
the current study was set out to adapt " autism treatment evaluation checklist " to persian language .
given the complex nature of autism spectrum disorders , there is a subsequent need for a comprehensive battery of diagnostic and monitoring instruments .
hence , cross - cultural adaptation of the asd questionnaires is worthy to be investigated .
in such a way , a wide range of data can be provided using different language versions of a questionnaire for asd in different societies . alongside other formal evaluation tools for autism spectrum disorders ,
however , to our knowledge there were already few published studies investigating cultural adaptation of the atec in languages other than english .
although a few asd scales have been translated into persian and being used in autism schools and clinics ( e.g. autism scaling questionnaire ( asq ) or childhood autism rating scale ( cars ) ) ; we were never informed about their validation procedure through the literature . given together
, the current project provides a reliable and valid translation of atec which remained stable via the cross - cultural and cross - linguistic processes .
small changes made in the questionnaire by the expert committee , were introduced to smooth the progress of items comprehension and the association of the responses .
regarding the psychometric properties of an instrument , the confirmation of its validity in other cultures boosts the validation of the original one . in relation to the construct validity of the persian version of atec
, our results showed that atec measures were significantly correlated with the data obtained in adi - r interview .
results from adi - r have been proven to support a thorough evaluation of core symptoms of autistic disorders listed in diagnostic and statistic manual of mental disorders ( dsm iv - tr ) .
thus the current study indicated that the persian version of the atec had acceptable properties for evaluating autistic symptoms in individuals with asd .
moreover , these results accord with the findings of magiati et al , which showed that atec is a promising instrument for gathering reliable and valid information on autistic individuals functioning .
furthermore , there are several studies in which atec has been used as a tool for measuring severity of asd and the authors reported that this questionnaire was successfully able to do so . despite the popularity of atec to evaluate and monitor progress in autistic individuals over time , to date
few data on the reliability ( internal consistency ) of the questionnaire have been published .
rimland and edelson cite a few data ( reliability : 0.94 for the total scores and 0.8 - 0.9 for subscale scores ) on over 1300 online completed atecs . moreover , recently in a cohort investigation , magiati et al supplemented the previous limited literature on the value of atec and reported a high internal consistency at their two time points of assessment ( when the children were aged about 5.5 years and 5 - 6 years later ) .
our study also confirms the previous findings by showing high values of internal consistency for atec .
all subscales of the questionnaire as well as total scores had similar range of high internal consistency ( cronbach 's alpha > 0.80 ) .
given the primary role of atec which is to measure factors that are expected partially to change over long term period or under treatment conditions , megiati et al reported that atec total scores obtained in the baseline significantly predicted the extent of improvement after 5 - 6 years . on the other hand , providing additional value to megiati findings , current study showed excellent stability ( i.e. , test - retest reliability ) for all the subscales over a short time period .
nevertheless , there are a few limitations and remained questions on atec validation that current study could not address .
, a larger sample study is needed to conduct a factor analysis on atec . to address the discriminant validity of the questionnaire , it should be used to differentiate asd from normally developing children or other developmental disorders .
furthermore , future studies could use other standard measures of autism symptom severity along with atec to examine other possible association among subscales . a few studies which used atec to examine severity and monitor symptoms in individuals with asd indicated the value of atec in autism research .
in conclusion the current study also indicated that the persian version of the atec is a reliable and valid tool for evaluating asd symptoms in an iranian sample with asd .
this finding has important implication for developing effective therapeutic programs as well as ongoing longitudinal research projects in asds . | objectivethe objectives of the current study were to translate and adapt autism treatment evaluation checklist ( atec ) into persian language and to investigate its reliability and validity in an iranian autistic sample.methodsa total sample of 134 children with autism spectrum disorders aged 6 - 15 years were assigned to the study .
the process of cross - cultural adaptation was performed according to international methodological steps as following : translation , back - translation , revision by an expert committee and pretest .
a sample of 20 primary caregivers of autistic children were pretested .
the content validity of the atec was reviewed by the expert committee all through the stages .
the construct quality of the questionnaire was evaluated by comparison of the adapted version of the instrument with similar tests assessed similar factors .
moreover , the reliability of the questionnaire was evaluated through stability and homogeneity assessments.findingsthe results showed good content validity and internal consistency ( cronbach 's alpha : 0.86 - 0.93 ) . in relation to construct validity , there was significant correlation between atec subscales and raw data obtained from autism diagnostic interview - revised ( adi - r ) ( r=0.38 - 0.79 ) .
the intraclass correlation coefficient for the test retest reliability was excellent for all the subscales and also for total scores ( icc : 0.79 - 0.93).conclusioncross - cultural adaptation of atec was successful .
the psychometric properties were verified and indicated that the adapted questionnaire is valid and reliable to use in iranian culture . | Introduction
Subjects and Methods
Participants
Procedure
Data analysis
Findings
Cross-cultural adaptation process
Reliability-Internal consistency (Homogeneity)
Validity
Discussion
Conclusion
Conflict of Interest |
oral squamous cell carcinoma ( oscc ) is the sixth largest group of malignancies globally and represents one of the leading causes of mortality .
it remains a major cancer in the indian subcontinent , comprising more than 40% of all cancer cases .
the most commonly involved sites of tumor development in the indian population are buccal mucosa and tongue . despite the advances in treatment and therapeutic modalities the five year survival rate of oscc
the possible reasons for poor survival rates are late detection and/or local recurrence / regional lymph node metastasis .
several studies have focused on defining tumor - specific molecular markers that can either detect cancer at an early stage or can predict patient 's outcome
. however , clinicopathological factors and molecular biomarkers that could identify patients at early stage or patients at high risk of recurrence / lymph node metastasis are still undefined . keratins ( k ) are epithelia predominant intermediate filament proteins which are expressed in a differentiation dependent and site specific manner . on one hand keratins
are connected to the nuclear envelope while on the other hand , they are connected to the junctional complexes like desmosomes and hemidesmosomes through desmoplakin and plectin-4 integrin respectively .
desmosomes form cell - cell contacts while hemidesmosomes attach the cells to the basal lamina .
previous results from our laboratory have shown deregulation of paired expression of keratins in oral cancer .
changes in keratin and associated proteins like that of the desmosomes ( desmoplakin ) and hemidesmosomes ( 64 integrin ) are also documented in oscc . to our knowledge
there is no report to date about the alterations of keratins and associated proteins together during sequential stages of oral carcinogenesis .
it is important to understand these molecular alterations during oral cancer development , which can help in development of early diagnostic and/or prognostic markers . in patients ,
the difficulty in procuring the normal tissues and tissues of all tumor stages , hampers the analysis of molecular markers
. however , animal models of carcinogenesis allow the reproducible isolation of all tumor stages , including the normal tissues . to this end ,
4nqo induced rat model of carcinogenesis remains the preferred model for studies related to oral carcinogenesis . in the present communication ,
we have studied the alterations in keratins and associated proteins during sequential stages of experimental oral carcinogenesis .
our results have shown alterations in keratins , desmoplakin as well as 64 integrin at different stages of rat oral carcinogenesis , which show a potential to be used as diagnostic / prognostic markers .
fourty five days old male sprague dwaley rats ( weighing150 - 200 g ) were fed with standard diet and water ad libitum .
they were randomly divided into three groups , 4nqo treated group ( n=56 ) , propane diol ( vehicle ) control group ( n=56 ) and untreated control group ( n=56 ) ( 8 animals in each of these groups were treated / untreated for 10 , 20 , 40,80,120,160,200 days ) .
12l of 0.25% 4nqo ( sigma ) was applied on each side of buccal mucosa , thrice a week for induction of tumors in buccal mucosa ( 60g of 4nqo ) .
intramuscular atropine injections ( 0.04mg / kg ) were given prior to 4nqo application to prevent salivation and the animals were also kept inaccessible to drinking water after treatment for 2 hrs .
4nqo was also given in drinking water ( 0.001% 4nqo ) for induction of tumors in tongue .
animals were weighed after every 15 days . after each time point rats were fed with normal drinking water for another 15 days .
2de for keratins was carried out using ipg strips for first dimention ( biorad ) . for second dimention 3.9% stacking and 8 - 10% gradient separating gels
sds page for desmoplakin was performed using 3.9% stacking gel and a combination of 6% top and 10% bottom gel .
the primary antibodies used were ae1 ( zymed , usa , cat no [ x ] 18 - 0153)/ae3 ( zymed , usa , cat no [ x ] 18 - 0154 ) , desmoplakin ( serotec , uk , cat .
a 5316 ) cell lysates were prepared in sds lysis buffer ( 5 mm egta , 5 mm edta , 0.4% sds and protease inhibitor cocktail ( cat no .
protein estimation for total cell lysates was carried out according to modified lowry 's method .
total rna was isolated by using tri reagent ( sigma ) from frozen tongue tissues .
2g of rna was reverse transcribed using mbi fermentas cdna synthesis kit . for rt - pcr
the following pcr primers were used : for 6 , sense 5-gtgaggtgtgtgaacatcag-3 and antisense 5-catggtatcggggaatgct-3 ( gene accession number - xm_001059465 ) ; for 4 , sense 5-gcagccctgggcccaaca-3 and antisense 5-cccaggcaggctttgcag- 3 ( gene accession number - nm_013180 ) ; for 18s sense 5-atggccgttcttagttggtg-3 and antisense 5-aacgccacttgtccctctaa-3 ( gene accession number - v01270.1 ) for immunohistochemistry paraffin embedded sections were deparaffinized , dehydrated and the antigen was retrieved using 0.1 m citrate buffer at ph 6.0 by microwave treatment .
frozen sections were fixed with methanol and immunocytochemistry was performed using k8 ( abcam , uk , cat.no .
sprague dwaley rats were sacrificed after treatment with 4nqo at different time points and dorsal tongue / buccal mucosa were dissected .
figure 1a2 to a4 shows gross changes in the tongue and figure 1a6 shows gross changes in buccal mucosa after 4nqo treatment .
the tumour sizes for papillomas / carcinomas were 38.91 + 3.94/62.43 + 9.11 mm respectively [ figure 1b ] .
it was not possible to decipher the weights of the tumours , as the tumors have different invasive areas in the lingual tissue which makes them difficult to separate .
the histopathological analysis of posterior dorsal tongue epithelium revealed no alterations in vehicle control and untreated control groups , 10 , 20 and 40 days 4nqo treated lingual tissues .
the dysplastic tissues showed increase in basal cell and single cell keratinization with abnormal nuclei [ figure 1c2 ] .
160 days treated animals showed papillary growth of the squamous epithelium with marked parakeratosis[figure 1c3 ] . at the end of 200 days all the animals demonstrated well differentiated scc with disordered and infiltrative growth of squamous cells [ figure 1c4 ] [ table 1 ] .
the analysis of buccal mucosal tissues revealed no histological alterations in vehicle treated tissue and tissues treated with 4nqo upto 160 days [ figure 1c5 ] .
papillomatous lesions were observed at the end of 200 days of 4nqo treatment [ figure 1c6 ] .
the study could not be further extended beyond 200 days because the animals became moribund .
for isolation of earlier stages , the experiment was repeated with higher doses of 4nqo , with 80/100g of oral application , for 120/160 days however , the earlier stages could not be obtained .
a. morphology of ( 1 ) vehicle treated tongue , ( 2 ) tongue treated for 80/120 days , ( 3 ) 160 days and ( 4 ) 200 days with 4nqo .
note white patch in the posterior dorsal tongue after 80/120 days , and exophytic growth in both 160 and 200 days after 4nqo treatment as indicated by the arrow , ( 5 ) control buccal mucosa and ( 6 ) buccal mucosa treated for 200 days showing small papillomatous growth indicated by the arrow .
( c ) h and e sections of ( 1 ) vehicle treated tongue , ( 2 ) tongue treated for 80/120 days ( dysplasia ) , ( 3 ) 160 days ( papillomatous lesion ) and ( 4 ) 200 days ( carcinoma ) with 4nqo ( 5 ) vehicle treated buccal mucosa and ( 6 ) papillomatous growth of buccal mucosa obtained after 200days of 4nqo treatment .
bar = 100m time points and number of animals utilized in the study keratins are identified based on the molecular weight and their isoelectric point which can be separated on a 2-dimensional electrophoretic gel .
hence , in order to establish the pattern of normal rat lingual keratins we performed mass spectrometry of the spots isolated after 2-de of enriched keratins .
the ms analysis showed presence of k5,6a , k14 and k17 [ figure 2a ] . after establishing the keratin pattern of lingual tissues western
dysplastic , papillomatous lesions and carcinoma tissues demonstrated consistent up regulation of k5 and k6a as compared to normal tissue [ figure 2b244 ] respectively ] .
further , there were no major consistent changes in other keratins on the 2-de gel .
( a ) 2de separation and colloidal coomassie staining of enriched keratins from normal lingual epithelium , for identification by mass spectrometry .
( b ) western blotting of keratins separated on 2de at various stages of lingual carcinogenesis .
( 1 ) normal , ( 2 ) dysplastic , ( 3 ) pappiloma and ( 4 ) scc tissue .
note increase in k5/6a in ( 2 ) dysplastic , ( 3 ) papillomatous lesion and ( 4 ) carcinoma tissues .
numbers indicate keratin numbers . c. k8 expression at various stages of oral carcinogenesis using ihc .
note absence of k8 in normal tissue , however , k8 is present in suprabasal layers of ( 2 ) dysplastic tissues as indicated by arrow .
further , very high levels of k8 can be observed in ( 3 ) papillomatous lesion and ( 4 ) carcinoma tissues .
( c ) the upper panel shows k8 staining of normal and various stages of carcinogenesis of lingual mucosa .
bar = 100m k8 is expressed in various malignant tissues and it plays an important role in the process of transformation .
none of the normal tissues of any time points showed k8 expression [ figure 2c1 ] , however , dysplastic tissues demonstrated presence of k8 in the suprabasal layers [ figure 2 c2 ] .
further , papillomatous lesions and carcinomas showed very high levels of k8 [ figure 2c3 and c4 ] .
non reactivity of antibody both in immunohistochemistry and western blotting hindered k18 analysis of rat tissues .
however , it is possible that k18 is expressed in these tissues . to further substantiate our results on aberrant k8 expression we performed immunofluorescence using the same k8 antibody .
as shown in the figure 2c , the normal tissue does not show k8 expression whereas dysplastic , papilloma and scc tissues showed vivid presence of k8 .
keratins on one hand are connected to the nuclear envelope while on the other hand , they are connected to the junctional complexes like desmosomes and hemidesmosomes through desmoplakin and plectin-4 integrin respectively .
it was of our interest to understand the levels and localization of keratin associated proteins .
hence , to study the alterations in desmoplakin levels in these tissues , western blot analysis was performed .
no changes in desmoplakin levels were observed in histologically normal tissues treated upto 40 days with 4nqo [ figure 3b1 ] .
dysplastic tissues showed 4.1 fold increase in desmoplakin levels [ figure 3b2 ] , whereas papillomatous and carcinoma tissues demonstrated 2.8 and 4.6 fold decrease in desmoplakin levels respectively [ figure 3b3 and b4 ] .
-actin was used as a loading control in normal , dysplasia and papillomatous tissues , whereas cooma c blue staining was used for equal loading as the carcinoma tissues demonstrated alterations in -actin levels [ figure 3 b4 ] .
( a ) immunohistochemical analysis of desmoplakin during oral carcinogenesis . in ( 1 ) normal tissue , desmoplakin was detected as diffused cytoplasmic and intense membranous staining in the suprabasal layers .
while , in ( 2 ) dysplasia increase cytoplasmic and membranous staining of desmoplakin is evident in the suprabasal layers ( arrowheads and arrow respectively ) . in ( 3 ) papillomatous lesion , decreased staining of desmoplakin is present in the suprabasal layers and only membranous staining can be seen ( arrow ) . in ( 4 ) scc decreased intensity of desmoplakin was observed .
n1 , n2 , n3 indicate vehicle treated and t1 , t2 , t3 indicate 4nqo treated lingual tissues . ( 1 ) desmoplakin levels in 4nqo treated histologically normal tissues of 40 days , ( 2 ) normal and dysplastic tissues ( 3 ) normal and papillomatous tissues of 160 days ( 4 ) normal and scc tissues of 200 days .
note increase in desmoplakin levels in ( 2 ) dysplastic tissues and decrease in ( 3 ) papillomatous lesion and ( 4 ) scc tissues further , to analyse the alterations in desmoplakin localization at various stages of rat lingual carcinogenesis , immunohistochemical analysis was carried out .
it was found that in histologically normal tissues desmoplakin was detected as diffused cytoplasmic and intense membranous staining in the suprabasal layers [ figure 3a1 ] . while , in dysplastic tissues increase cytoplasmic and membranous staining of desmoplakin was evident in the suprabasal layers [ figure 3 a2 ] . in papillomatous lesion ,
decreased staining of desmoplakin was seen in the suprabasal layers and only membranous staining could be observed [ figure 3a3 ] , whereas in scc , decreased intensity of desmoplakin was observed with diffuse cytoplasmic staining and loss of cell membrane staining [ figure 3a4 ] .
inspite of repeated efforts , and using various commercially available antibodies towards rat 64 integrin none of the antibodies reacted in western blot .
therefore rt - pcr was carried out for both 6 and 4 integrin at different stages of lingual carcinogenesis .
the dysplastic and papillomatous lesions did not show any significant change in the levels of 6 and 4 integrin mrna [ figure 4 a1and a2 ] .
however , scc tissues demonstrated significant increase in 6 and 4 integrin mrna ( p<0.05 , n=4 ) [ figure 4 a3 ] .
( a ) rt - pcr analysis of 6 and 4 integrin . ( 1 ) normal and dysplastic tissues , ( 2 ) normal and papillomatous tissues , ( 3 ) normal and carcinoma tissues .
6 integrin staining in ( 1 ) normal tissues , ( 2 ) dysplasia ( 3 ) papilloma and ( 4 ) scc
. please note suprabasal expression in dysplastic and papillomatous tissues and increased staining intensity in scc . to understand the cellular localization of 6 integrin ,
6 integrin staining was detected only in the basal cells of vehicle treated tissues [ figure 4b1 ] however , in dysplastic tissues 6 integrin was seen in the basal as well as in the suprabasal layers [ figure 4 b2 ] . in papillomatous lesions ,
further , weak staining of integrin 6 was observed in the basal layer as compared to that seen in the control tissues [ figure 4b3 ] . intense but diffused staining of 6 integrin was observed in the cytoplasm and the cell membrane of scc [ figure 4b4 ] .
our rt - pcr analysis of integrin 6 showed no alterations in papillomas however , increase staining intensity of integrin 6 was observed in ihc of papilloma tissues .
, the commercially available antibodies to 4 integrin did not react with rat tissues , we were not able to carry out immunohistochemical analysis for the same . taken together our analysis of keratin expression demonstrated , increase in k5/6a levels , and ectopic k8 expression during various stages of lingual carcinogenesis .
increased desmoplakin levels were observed in dysplastic tissues ( 80 and 120 days ) while its level decreased in papilloma and carcinoma tissues .
further , increase in suprabasal expression of 6 integrin was observed in dysplastic lesions of rat lingual epithelium which persisted in papillomas and scc .
experimental animal models have proved to be an important tool , to study the molecular alterations during the process of oral carcinogenesis , because of difficulties in obtaining sequential stages of carcinogenesis in human system . in the present study , we have isolated different stages of lingual carcinogenesis .
one of the goals of our study was to establish a model for buccal mucosal carcinogenesis , which is a predominant cancer , along with scc of tongue in the indian subcontinent .
inspite of prevention of salivation and higher doses of 4nqo we were unable to obtain all the stages of buccal mucosal carcinogenesis .
one of the possible reasons could be that the papillomatous lesion development is a rapid process and the earlier stages remained undetected .
the probable reason for not obtaining scc in buccal mucosa could be that the buccal mucosa may not have prolonged access to the carcinogen .
hence , the development of a proper model of buccal mucosal carcinogenesis still remains an area of investigation , and all the analysis was carried out only on lingual tissues .
our analysis of keratins expression at various stages of lingual carcinogenesis showed , increased levels of k5/k6a [ figure 2b2b4 ] and aberrant expression of k 8 in dysplastic , papillomatous lesions and carcinoma tissues of lingual epithelium [ figure 2c2c4 ] .
previous reports have demonstrated suprabasal expression of k5/14 and k6/16 in premalignant and malignant lesions of oral cavity .
the presence of k5/14 along with cd44 has also been shown to have cancer stem cell properties in hnscc .
thus , it is possible that the elevated levels of k5 observed in rat lingual carcinogenesis model could be indicative of retention of stem cell like properties of the premalignant and malignant cells .
previous results from our laboratory have shown down regulation of k5 expression in tobacco related oral cancer .
these differences possibly can be explained based on the fact that although 4nqo mimics many molecular changes that occur in human oral carcinogenesis , there could be subtle differences between tumor induced by a pure carcinogen like 4nqo and the tumor induced by tobacco .
further , the keratin gene regulation is not yet well understood and the partial differences observed in keratin expression during murine and human oral carcinogenesis , could be because of the complexity of keratin gene expression and their differential regulation .
keratin 6 is a marker of cell proliferation and its overexpression has been observed in hyperproliferative disorders .
suprabasal expression of k6/16 has been shown in oral cancer . moreover , in mouse epidermal carcinogenesis induction of k6/16 was observed in premalignant as wll as malignant skin tissues .
further , cadmium and arsenite treatment to bladder epithelial cells resulted into their transformation with concomitant induction of k6a .
these results indicate that k6 is closely associated with proliferation of precancerous tissue and may have a role in transformation .
the ectopic expression of k8 has also been shown previously by our laboratory and others .
further , our laboratory has demonstrated that forced expression of k8 in fetal buccal mucosal cells leads to cell transformation .
we have recently shown that downregulation of k8 results in down regulation of 64integrin mediated signaling and decreased cell motility and tumorogenicity .
these reports suggest that k8 is associated with transformation and increased malignant potential of squamous epithelial cells .
we noted increase in desmoplakin levels in dysplastic tissues [ figure 3a2 and figure 3b2 ] while we observed its downregulation in papillomatous lesions and scc [ figure 3a3 , a4 and figure 3b3 , 3b4 ] .
this increase in desmoplakin in dysplastic stages may be required for efficient carcinogenesis , further , intact cell - cell adhesion through desmoplakin may be essential in supporting tumor development .
however , this hypothesis needs to be confirmed in tissue specific knockout animal models of desmoplakin .
further , desmoplakin has been shown to be down regulated in a number of cancers including oral , and pharangeal cancers .
our rt - pcr analysis of integrin 6 showed no alterations in papillomas , however , increase staining intensity of integrin 6 was observed in ihc of papilloma tissues .
we have further shown over expression of 6 integrin using both rt pcr and ihc in scc tissues .
our results of ihc have demonstrated suprabasal expression of 6 integrin in premalignant and malignant lesions .
previous reports have demonstrated that suprabasal localization of 6 integrin in premalignant and malignant tissues of human oral cavity . and
64 integrin protein overexpression has been shown in murine as well as human cancers . in hnscc ,
the analysis of keratins and associated proteins in experimental oral carcinogenesis showed that the alterations predominantly begin after the dysplastic changes in the lingual epithelium .
these changes were observed in inbred animal system where carcinogen treatment results in definite conversion of premalignant lesions to carcinoma .
this is indicative of the fact that the molecular changes observed can prove as useful early biomarkers if similar alterations are observed in human system .
the ongoing work in our laboratory has demonstrated ectopic expression of k8 , increase desmoplakin levels and suprabasal localization of 4 integrin in human premalignant lesions ( data not shown ) .
thus , similar results were obtained in human system and hence , some of these alterations either singly or in combination can prove useful biomarkers for early diagnosis of human oral cancer .
we have also seen alterations in keratins , desmoplakin and 64 integrin in rat lingual scc .
downregulation of desmoplakin and overexpression of 64 integrin separately have been shown to have prognostic value .
studies from our lab and others have suggested that k8/18 can also be used as prognostic markers for human oral cancer .
hence , a correlation of alterations in all these proteins , with the clinical parameters can help in the development of reliable diagnostic / prognostic markers for human oral cancer .
work in this direction is already underway in our laboratory . in summary , the 4nqo model of oral carcinogenesis
, reproduces majority of the changes that are seen in human oral carcinogenesis and it can be exploited for the development of biomarkers for oral cancer .
dr . deepak kanojia , department of biological science , university of south carolina , columbia , sc 29208 dr .
anita m borges , department of histopathology , asian institute of oncology , s.l . raheja hospital , mahim , mumbai - 400 016 , india .
arvind d ingle , laboratory animal facility , advanced centre for treatment , research and education in cancertata memorial centre sector 22 , kharghar , navi mumbai - 410 210 , india .
sharada s sawant , vaidya lab , advanced centre for treatment , research and education in cancer ( actrec ) , tata memorial centre ,
kharghar , navi mumbai- 410210 , maharashtra india dr .
milind m vaidya , vaidya lab , advanced centre for treatment , research and education in cancer ( actrec ) , tata memorial centre , kharghar , navi mumbai- 410210 , maharashtra india | background : oral squamous cell carcinoma ( oscc ) is the sixth largest group of malignancies globally and the single largest group of malignancies in the indian subcontinent . despite the advances in treatment and therapeutic modalities the five year survival rate of oscc has not changed in the last few decades , and remains less than 40% .
several studies have focused on defining molecular markers that can either detect cancer at an early stage or can predict patient 's outcome
. however , such markers are still undefined .
keratins ( k ) are epithelia predominant intermediate filament proteins which are expressed in a differentiation dependent and site specific manner .
keratins are being used as biomarkers in different epithelial disorders including cancer .
they are associated with desmoplakin and 64 integrin which are components of desmosomes and hemidesmosomes respectively.materials and methods:4-nitroquinoline 1-oxide ( 4nqo ) was used as a carcinogen for the development of various stages of oral carcinogenesis in rat lingual mucosa .
two - dimentional gel electrophoresis was performed for the separation of keratins followed by western blotting for their specific identification .
western blotting and rt pcr was carried out for desmoplakin and 64 integrin respectively to understand their levels .
immunohistochemical analysis was carried out to further study the localization of desmoplakin and 6 integrin.results:in this study we have analysed the alterations in keratins and associated proteins during sequential stages of 4nqo induced rat oral carcinogenesis . our results showed that the alterations primarily begin after the dysplastic changes in the lingual epithelium like the elevation of keratins 5/6a , ectopic expression of keratin 8 , increase in suprabasal expression of 6 integrin and increase in desmoplakin levels .
most of these alterations persisted till the development of scc except desmoplakin , the levels of which were downregulated in papillomatous lesions and scc .
many of these alterations have also been documented in human oral carcinogensis.conclusion:thus , 4nqo model of rat lingual carcinogenesis reproduces majority of the changes that are seen in human oral carcinogenesis and it can be exploited for the development of biomarkers . | BACKGROUND
MATERIALS AND METHODS
RESULTS
DISCUSSION
AUTHOR'S PROFILE |
the hippocampal formation , a well - defined region of brain involved in the spatial learning performance , is especially vulnerable to the process of aging and shows early signs of age - related changes in the function and structure ( 1 , 2 ) .
previous studies indicated a decrease in the volume of the hippocampus during normal aging ( 3 , 4 ) .
other investigations showed that the dendritic atrophy occurs in the hippocampus during normal aging ( 5 , 6 ) .
furthermore , the reductions in the cerebral blood flow ( 7 ) and in the cerebral levels of many blood - borne trophic factors ( 8 , 9 ) are also reported in the aged in comparison with young animals .
such changes in the hippocampus are suggested to represent a neurobiological substrate of hippocampal - dependent memory deficits ( 10 , 11 ) .
nowadays , a major focus in research on aging is concentrated on finding drugs to improve declining memory .
the extract of ginkgo biloba ( egb ) leaves is one of the most common phytomedicines in many countries and preparations from the leaf of g. biloba have been therapeutically used to treat decreased cerebral blood flow , memory loss and mental confusion ( 1215 ) .
the egb could also improve performance in cognitive tasks in old animals ( 1618 ) .
the standardized egb , code - named egb 761 , contains 24% flavonoids ( quercetin , kaempferol and isorhamnetin ) and 6% terpenoids ( ginkgolides a , b and c and bilobalides ) proanthocyanidins , and organic acids ( 19 , 20 ) .
egb has a relatively low molecular weight also , and it passes through the blood - brain barrier and induces a wide range of pharmacological actions on the central nervous system ( 21 ) .
the beneficial effects of egb 761 were supported by a variety of in vitro and in vivo studies ( 22 ) .
it improves the local cerebral blood flow by its anti - platelet activating factor ( paf ) activity ( 23 ) , neutralizes oxidative free radicals through antioxidative properties ( 24 , 25 ) , acts as anti - stress agent by inhibiting corticosteroid synthesis ( 26 ) , and stimulates cell growth by growth factor upregulation ( 27 ) . in spite of numerous studies that indicated the positive effects of egb on neurobiological substrate of memory improvement ,
it is well known that the hippocampal dendritic systems play a critical role in spatial learning and memory . on the basis of this background
, the experiments reported here were designed to determine whether long - term administration of egb has a positive impact on the structures of hippocampus in aged rats . in this study ,
cavalieri principle ( 28 ) , was employed to estimate the volumes of constituents layers of cornu ammonis ( ca ) and a quantitative golgi study was used to analysis of dendritic branches of hippocampal pyramidal cells .
male albino wistar rats aged 24 months weighing 570600 g , acquired from the animal house of isfahan medical school , isfahan , iran , were maintained in standard laboratory conditions with food and water ad libitum under a 12:12 light - dark cycle ( lights on at 7:00 am ) .
the animals were randomly divided into experimental and control groups ( n=8 in each group ) .
the animals in experimental group orally received egb leaves ( ginkogol , goldaru phytolaboratory , isfahan , iran ) in the single dose of 100 mg / kg per day for 8 weeks ( 21 , 26 ) .
solution of egb in water was prepared fresh daily and administered orally in a volume of 2 ml / kg body weight .
all animal experiments and housing was performed in accordance with rules approved by the ethical committee of shahid sadoughi medical university of iran . at the end of the experimental period ,
they were transcardially perfused with a phosphate - buffered solution of 4% formaldehyde and 1% glutaraldehyde and decapitated .
each hemisphere was serially sectioned in a coronal plane at 100 m with a calibrated vibratome ( diapath , italy ) and the sections were collected along the entire extent of the hippocampus .
starting at a random position , every 5 section with an interval of 500 m was taken .
the dry sections were stained using hematoxylin : diped in distilled water , 4 min in hematoxylin , and washed in running tap water for 10 min . after rinsing they
were dehydrated in 70% ( 10 min ) , 96% ( 2 5 min ) and 99% ethanol ( 2 8 min ) , cleared 15 min in xylene ; and coverglasses were mounted .
discrimination between the different subdivisions of the hippocampal formation was made according to cell morphology ( figure 1 ) .
the volumes of the constituent layers of ca i.e. oriens , pyramidal and radiatum lacunosum moleculare , were estimated on the basis of the cavalieri principle ( 28 ) .
the cross sectional areas of the layers were estimated by point - counting principle with a projection microscope ( zeiss , germany ) using a 4x objective lens at a final magnification of 64. a grid of systematic uniform test points , 30 mm apart , was randomly superimposed on each image .
each point represented an area , a ( p ) = 0.22 mm , in the section plane .
the number of points hitting the layers , p , was multiplied with the area associated with each point , a ( p ) , to obtain an unbiased estimate of sectional area of each profile . the reference volume , v ( ref ) , was calculated from the following relationship , where t represents the intersection distance ; v ( ref ) = t. p. a(p ) = t. a low magnification micrograph of a hematoxylin stained section through the hippocampus of rat shows its different subregions and the layers of cornu ammonis .
dg ; dentate gyrus ca ; cornu ammonis , or ; oriens , py ; pyramidal , rad ; radiatum lmol ; lacunosum+molecular .
scale bar indicates 400 m no areal shrinkage correction was used in the study because of the insignificant magnitude of the shrinkage and because no difference in shrinkage was found between groups ( mean areal shrinkage of 5% was detected ) .
sections were processed according to a modified version of the single - section golgi impregnation procedure ( 29 ) .
hippocampal sections were incubated in 3% potassium dichromate in distilled water overnight . after rinsing in distilled water ,
the sections were mounted on plain slides and a coverslip was glued over the sections at four corners .
they were incubated in 1.5% silver nitrate in distilled water overnight in darkness . on the following day
, the slide assemblies were dismantled , tissue sections rinsed in distilled water and then dehydrated first in 95% ethanol followed by absolute ethanol .
the sections were then cleared in xylene , mounted onto gelatinized slides and coverslipped . from the hippocampal pyramidal cell layer , 10 pyramids of the ca3 and ca1 regions were selected and pooled per animal in a single group .
the morphological criteria used for selecting the neurons to be measured were as follows ( 30 ) : ( i ) dark and consistent impregnation throughout the extent of dendrites ; ( ii ) cell bodies located in the middle part of the section thickness in order to minimize branch segments cut off at the plan of the section ; and ( iii ) relative isolation from other neighboring impregnated cells , blood vessels and silver deposits . because these criteria were fulfilled solely by apical dendrites , the basal dendritic trees of pyramidal cells were not included in the estimations .
the presence of cut terminal segments on a neuron was not considered as a criterion for its exclusion from the estimations because the elimination of these neurons would have biased the sample towards smaller neurons . since
, we found that in the golgi sections of experimental and control rats there was a similar percentage of cut branches ( 10% ) , the likelihood that these cut branches could have interfered with the final results is negligible .
we observed on average 8% shrinkage of the sections in each group and these values were employed as a correction factor for the length measurements .
the apical dendritic trees of ca3 and ca1 pyramidal cells were traced by hand with the aid of a camera lucida ( leitz orthoplan , wetzlar , germany ) , at a final magnification of 640 .
the centrifugal ordering of dendritic trees was used to estimate the number of dendritic segments per cell ( 31 ) .
the total number of segments per cell was calculated by summing the number of dendritic segments of all orders . for metric analysis
, the dendritic length was measured using a zeiss interactive digitizing analysis system ( zeiss , germany ) .
a grid of concentric was placed over the camera lucida drawing of the dendritic field and the number of dendritic intersections crossing each concentric ring was counted .
the concentric rings were calculated at intervals of 25 m for both ca3 and ca1 pyramidal cells .
whenever the dendrites extended beyond 375 m ( circle 15 ) , they were included in circle 15 .
student s t - test was performed on data from the experimental and control rats .
male albino wistar rats aged 24 months weighing 570600 g , acquired from the animal house of isfahan medical school , isfahan , iran , were maintained in standard laboratory conditions with food and water ad libitum under a 12:12 light - dark cycle ( lights on at 7:00 am ) .
the animals were randomly divided into experimental and control groups ( n=8 in each group ) .
the animals in experimental group orally received egb leaves ( ginkogol , goldaru phytolaboratory , isfahan , iran ) in the single dose of 100 mg / kg per day for 8 weeks ( 21 , 26 ) .
solution of egb in water was prepared fresh daily and administered orally in a volume of 2 ml / kg body weight .
all animal experiments and housing was performed in accordance with rules approved by the ethical committee of shahid sadoughi medical university of iran .
at the end of the experimental period , all rats were deeply anesthetized intraperitoneally with urethan ( merk , germany ) .
they were transcardially perfused with a phosphate - buffered solution of 4% formaldehyde and 1% glutaraldehyde and decapitated .
each hemisphere was serially sectioned in a coronal plane at 100 m with a calibrated vibratome ( diapath , italy ) and the sections were collected along the entire extent of the hippocampus .
starting at a random position , every 5 section with an interval of 500 m was taken .
the dry sections were stained using hematoxylin : diped in distilled water , 4 min in hematoxylin , and washed in running tap water for 10 min . after rinsing they
were dehydrated in 70% ( 10 min ) , 96% ( 2 5 min ) and 99% ethanol ( 2 8 min ) , cleared 15 min in xylene ; and coverglasses were mounted .
discrimination between the different subdivisions of the hippocampal formation was made according to cell morphology ( figure 1 ) .
the volumes of the constituent layers of ca i.e. oriens , pyramidal and radiatum lacunosum moleculare , were estimated on the basis of the cavalieri principle ( 28 ) .
the cross sectional areas of the layers were estimated by point - counting principle with a projection microscope ( zeiss , germany ) using a 4x objective lens at a final magnification of 64. a grid of systematic uniform test points , 30 mm apart , was randomly superimposed on each image .
each point represented an area , a ( p ) = 0.22 mm , in the section plane .
the number of points hitting the layers , p , was multiplied with the area associated with each point , a ( p ) , to obtain an unbiased estimate of sectional area of each profile .
the reference volume , v ( ref ) , was calculated from the following relationship , where t represents the intersection distance ; v ( ref ) = t. p. a(p ) = t. a low magnification micrograph of a hematoxylin stained section through the hippocampus of rat shows its different subregions and the layers of cornu ammonis .
dg ; dentate gyrus ca ; cornu ammonis , or ; oriens , py ; pyramidal , rad ; radiatum lmol ; lacunosum+molecular .
scale bar indicates 400 m no areal shrinkage correction was used in the study because of the insignificant magnitude of the shrinkage and because no difference in shrinkage was found between groups ( mean areal shrinkage of 5% was detected ) .
sections were processed according to a modified version of the single - section golgi impregnation procedure ( 29 ) .
hippocampal sections were incubated in 3% potassium dichromate in distilled water overnight . after rinsing in distilled water ,
the sections were mounted on plain slides and a coverslip was glued over the sections at four corners .
they were incubated in 1.5% silver nitrate in distilled water overnight in darkness . on the following day
, the slide assemblies were dismantled , tissue sections rinsed in distilled water and then dehydrated first in 95% ethanol followed by absolute ethanol .
the sections were then cleared in xylene , mounted onto gelatinized slides and coverslipped . from the hippocampal pyramidal cell layer , 10 pyramids of the ca3 and ca1 regions were selected and pooled per animal in a single group .
the morphological criteria used for selecting the neurons to be measured were as follows ( 30 ) : ( i ) dark and consistent impregnation throughout the extent of dendrites ; ( ii ) cell bodies located in the middle part of the section thickness in order to minimize branch segments cut off at the plan of the section ; and ( iii ) relative isolation from other neighboring impregnated cells , blood vessels and silver deposits . because these criteria were fulfilled solely by apical dendrites , the basal dendritic trees of pyramidal cells were not included in the estimations .
the presence of cut terminal segments on a neuron was not considered as a criterion for its exclusion from the estimations because the elimination of these neurons would have biased the sample towards smaller neurons . since
, we found that in the golgi sections of experimental and control rats there was a similar percentage of cut branches ( 10% ) , the likelihood that these cut branches could have interfered with the final results is negligible .
we observed on average 8% shrinkage of the sections in each group and these values were employed as a correction factor for the length measurements .
the apical dendritic trees of ca3 and ca1 pyramidal cells were traced by hand with the aid of a camera lucida ( leitz orthoplan , wetzlar , germany ) , at a final magnification of 640 .
the centrifugal ordering of dendritic trees was used to estimate the number of dendritic segments per cell ( 31 ) .
the total number of segments per cell was calculated by summing the number of dendritic segments of all orders . for metric analysis
, the dendritic length was measured using a zeiss interactive digitizing analysis system ( zeiss , germany ) .
a grid of concentric was placed over the camera lucida drawing of the dendritic field and the number of dendritic intersections crossing each concentric ring was counted .
the concentric rings were calculated at intervals of 25 m for both ca3 and ca1 pyramidal cells .
whenever the dendrites extended beyond 375 m ( circle 15 ) , they were included in circle 15 .
student s t - test was performed on data from the experimental and control rats .
the results showing the effect of egb on the volumes of the layers of the ca are represented in the table 1 .
statistical analysis revealed significant effect of egb on the volume of the layers of ca except in the oriens layer .
comparisons revealed that egb - treated aged rats had greater volumes than controls in the layers of pyramidal and radiatum lacunosum moleculare in ca3 and ca1 pyramidal fields ( table 1 ) .
this study also showed that the volume of the whole hippocampal formation was significantly larger in egb - treated aged rats than their controls ( table 1 ) .
volumes of the layers ( mm ) of the cornu ammonis ( ca ) in the extract of ginkgo biloba ( egb)-treated rats and respective controls .
all values expressed as mean ( sd ) a significant increase of the dendritic branches of ca3 and ca1 pyramidal cells was present in sections from the egb - treated aged rats as compared to the controls ( figure 2 ) .
student s t - test revealed significant effect of treatment on the total number of segments per cell in both ca3 and ca1 pyramidal cells ( table 2 ) .
the dendritic segment number of ca3 and ca1 pyramidal cells was respectively 15.6% and 15.2% higher in the experimental group than in controls .
results also showed that , in these neurons , the total dendritic length was larger in the egb - treated compared to control animals .
camera lucida drawing of golgi - impregnated ca3 ( a , b ) and ca1 pyramidal cells ( c , d ) .
neurons from control rats are shown in the left column ( a , c ) , from extract of ginkgo biloba ( egb)-treated rats in the right column ( b , d ) .
note an increase in the dendritic arborizations in egb - treated aged rats compared with controls .
scale bar=50 m ( applies to all frames ) comparison of dendritic trees ( meansd ) of extract of ginkgo biloba ( egb)-treated and control rats statistical analyses revealed significant effect of treatment on the dendritic branching density of ca3 pyramidal cells in circles 1015 ( figure 3 ) ; in addition , it indicated a significant difference in the dendritic branching density of ca1 pyramidal cells in circles 59 ( figure 3 ) . in both cases ,
the dendritic intersections were greater in egb - treated than in the control aged rats .
graphic representation of the dendritic branching density of ca3 and ca1 hippocampal neurons of extract of ginkgo biloba ( egb)-administrated aged rats and control ( con ) .
the present study was designed to determine whether chronic administration of egb affects the structure of ca and the morphology of hippocampal pyramidal cells in aged rats .
our study showed that , 8 week treatment with egb increases the volumes of the layers of pyramidal and radiatum lacunosum moleculare in ca3 and ca1 pyramidal fields and the whole hippocampus in aged rats .
quantitative morphological analysis also indicated that there were increases in both the number and the length of dendritic segments associated with an increase in the dendritic branching density of ca3 and ca1 pyramidal cells in egb - treated aged rats .
although in this study we did not investigate the mechanisms underlying the beneficial effects of egb on the morphology of ca structure of aged rats , several lines of evidence could help to explain the neuroprotective effects of egb .
previous studies showed that chronic administration of egb 761 inhibits stress - induced corticosterone hypersecretion ( 26 ) .
it is reported that hippocampal neurons contain high levels of corticosteroid receptors ( 32 ) and it also demonstrated that glucocorticoids are regulators of neurotrophins in the hippocampus ( 33 ) .
therefore , it could be proposed that a decrease in exposure to glucocorticoid concentrations following a chronic treatment with egb has a neuroprotective effect and lowers neurotoxicity and neuronal degeneration particularly in the ca3 subfield ( 34 ) .
in addition , early studies revealed that treatment with egb 761 increased the local cerebral blood flow in nearly all brain regions ( 35 ) , and it may lead to elevated levels of many blood - borne trophic factors in these regions .
it is reported that growth hormone ( gh ) stimulates most target cells to grow in size , and gh receptors are present in the brain ( 36 ) .
thus , it is reasonable to speculate that the observed increase in both the hippocampal size and the extent of dendritic arbors might be the result of availability of neurotrophic factors such as gh .
positive effects of egb on the structure of hippocampal neurons may be related to its antioxidant properties ( 24 , 25 ) , antiapoptotic effect ( 37 , 38 ) and inhibition of beta amyloid production and aggregation ( 39 , 40 ) .
protective effects of egb have been shown after experimentally ischemia ( 41 , 42 ) , for nitric oxide - induced toxicity ( 43 ) and -amyloid - induced cell death in hippocampal cells ( 44 ) . in the present study
, we used the total egb because various chemical constituents of egb , although active in pharmacological models , do not generally reproduce the actions of the total extract ( 21 ) .
while neuroprotective effects of egb and its components have been well documented only a few studies have examined the effect of egb on the structure of central nervous system .
barkats et al ( 45 ) examined the effects of egb 761 on age - related changes in the projection fields of hippocampal mossy fibers in old female mice .
they reported that treatment with egb 761 ( 50 mg / kg / day ) for 7 months led to a significant increase in the projection field of intra- and infrapyramidal mossy fibers in the ca3 field and to a significant decrease in the area of the stratum radiatum .
our findings on old male wistar rats is in agreement with the result of barkat s study ( 45 ) , where they found significant increase in the number of ca3 dendritic arbors following long - term treatment with egb .
however , they found a significant reduction in the area of the stratum radiatum , which is in conflict with our results showing a significant increase in the volume of radiatum layer in the ca3 region of egb - treated aged rats .
this discrepancy could be related to several possible factors particularly the methodology employed to estimate the size of the ca3 layer . although the size of a layer may be estimated in a number of ways , volume measurement , which was used in our study ,
provides a 3-dimensional analysis of structures based on observations made on two - dimensional sections .
other parameters including transsectional area depend not only upon size , but also on assumptions about the structure of the shape and orientation ( 28 ) .
our results showed that long - term administration of egb in the aged wistar rats had neuroprotective effects and enhanced dendritic arbors in ca pyramidal cells of hippocampus .
findings of our study provide a neuroanatomical basis that is useful in explaining improvements in hippocampal - dependent cognitive tasks in both humans and experimental animals treated with egb .
the findings of the present study also support therapeutic potential of egb in age - associated neurodegenerative diseases . | objective(s):growing evidence indicates that extract of ginkgo biloba ( egb ) attenuates hippocampal - dependent memory deficit in aged individuals ; however , very little is known about the effect of egb on the structure of hippocampus .
therefore we examined the egb - induced morphological changes of the cornu ammonis ( ca ) region in aged rats.materials and methods : sixteen aged male wistar rats , 24 months old , were randomly divided into experimental and control groups .
experimental group was orally administered egb ( 100 mg / kg / d for 8 weeks ) , and the control group received a similar volume of water .
the volume estimation of ca hippocampal field was done by cavalieri principle and a quantitative golgi study was also used for analysis of dendritic arborizations of ca3 and ca1 pyramidal cells.results:results revealed that egb - treated aged rats had greater volumes than control animals in the layers of pyramidal and radiatum lacunosum moleculare in both ca3 and ca1 subfields .
the neurons of ca3 and ca1 in experimental rats had more dendritic segments and larger total dendritic length compared to the control .
the results also showed that the aged rats treated by egb had more numerical branching density in the apical dendrites of ca3 and ca1 pyramidal cells.conclusion:the results of the present study show that long - term administration of egb could produce morphometrical changes in hippocampal pyramidal cells in aged rats .
results also provide a neuroanatomical basis for memory improvement due to chronic treatment with egb . | Introduction
Materials and Methods
Animals and treatment
Histological procedure
Volume estimation
Morphometric analysis
Statistical analysis
Results
Discussion
Conclusion |
the essential and highly
conserved snare ( soluble n - ethylmaleimide - sensitive
factor attachment protein receptor ) proteins
are the molecular machines that drive membrane fusion , which represents
the final step in every trafficking pathway .
the neuronal snare complex , consisting
of vamp2 bound to the synaptic vesicle ( v - snare ) and syntaxin1a and
snap25 on the target membrane ( t - snare ) , has been extensively studied
and serves as a model system for understanding complex assembly and
snare - mediated membrane fusion .
snare proteins are characterized
by the presence of the heptad repeat motif that consists of mostly
hydrophobic layer residues at every third or fourth
position ( layers numbered 7 to + 8 , figure 1a ) .
isolated snares are largely unstructured but adopt
an -helical conformation upon interaction with their cognate
binding partners .
a progressive zippering model
was proposed for snare assembly , which suggests that the snare motifs
from vamp2 , syntaxin1a and snap25 , zipper directionally from their
membrane - distal n - terminal domains ( ntds ) to their c - terminal domains
( ctds ) into a four - helical coiled - coil bundle .
interactions extend through the membrane - proximal linker domains
( lds ) and the transmembrane domains ( tmds ) helices of snares .
the
energy from complex formation is thought to be used to overcome the
thermodynamic barrier of membrane fusion .
the zippering reaction has been historically considered to take
place continuously as a single event , but recent biophysical studies
are more consistent with the idea that it occurs in discrete steps .
however , the functional significance of these biophysical observations
has not been tested , which is our goal here . a switch that activates
the t - snare exists in ntd assembly of snare
complex .
( a ) illustration of 4 domains and 16 layers in postfusion
snare complex .
the snare motifs form a four - helix bundle ( syntaxin
1a , red ; snap25 , green ; vamp2 , blue ) .
( b ) vn peptide activates fusion
between flt - liposomes and vc - liposomes .
standard liposome fusion assays
were performed in the absence and presence of prebound vn ( vamp2 residues from layers 7 to 1 )
peptide . to prebind the vn peptide , flt - liposomes and 20 m vn peptide
were incubated together
at 37 c for 60 min prior to mixing with vc - liposomes .
positive
control represents fusion of flt - liposomes ( full length t - snare ) and
flv - liposomes ( full length vamp2 ) , and negative control shows fusion
of flt - liposomes preincubated with cdv ( the cytosolic domain of vamp2 ,
residues 194 ) and flv - liposomes .
( c ) activation of the t - snare
requires snares to assemble at least to layer 1 .
fusion reactions
were performed between vc - liposomes and
flt - liposomes prebound with vn , vn , vn , vn , or vn , respectively .
( d ) layer 1 is required
for vn to bind tightly with the t - snare .
each individually labeled
vn ( 200 nm ) was incubated with cytosolic t - snare at various
concentrations at 37 c for 60 min followed by 24 h on ice .
for each vn ,
the increase in anisotropy was plotted versus t - snare concentration
and fitted using eq 9 in experimental
section to obtain the affinity constants .
neuronal snare assembly is positively regulated by the sm
protein
munc18 and controlled by a clamping system
consisting of complexin and synaptotagmin for ca - dependent
rapid and synchronized fusion .
it is not known how all these regulatory proteins interact with
snares on a molecular level .
the hypothesis we will explore here is
that a partially assembled snare complex represents a folding intermediate
on which regulators might act to accelerate or decelerate snare assembly .
here we demonstrate for the first time that even in the absence
of any regulatory protein , a half - zippered snare complex represents
a functional intermediate in a two - step folding process , and this
intrinsic property of snares provides a molecular basis that supports
the models put forward for the function of complexin .
we show distinct functions for n- and c - terminal snare
zippering , namely , prestructuring the t - snare and driving fusion ,
respectively .
the
abbreviations of constructs used in this study are summarized in supporting table s1 .
the full length t - snare
complex , which includes full length , wild - type mouse his6-snap25 and
rat syn1a , was produced by expression of the polycistronic plasmid
ptw34 in the bl-21 gold ( de3 ) escherichia coli bacterial
strain and purified as described before .
the full
length vamp2 , which
includes full length , wild - type mouse vamp2 , was produced by expression
of the plasmid ptw2 in the bl-21 gold ( de3 ) escherichia coli bacterial strain and purified as described before .
the soluble t - snare
complex , made of the cytoplasmic domain of rat syntaxin 1a ( residues
1265 ) and mouse his6-snap25 ( residues 1206 ) , was produced
by coexpression of pjm57 and pjm72 plasmids in the bl-21 gold ( de3 ) escherichia coli bacterial strain and purified as described
before .
the protein
concentration was typically 510 mgml as determined by bradford protein assay with bsa as the standard .
the cytoplasmic domain of mouse
his6-vamp2 ( residues 194 , for fusion assay ) and his6-sumo - vamp2
( residues 2894 , for circular dichroism assay ) were produced
by expression in the bl-21 gold ( de3 ) escherichia coli bacterial strain and purified as previously described .
the protein concentration was typically 1.53
mgml as determined by bradford protein assay
with bsa as the standard .
the plasmids for the
vn variants were produced by cloning the n - terminus of vamp2 of various
lengths into a pcdfduet-1 vector containing gst - prescission - vn ( containing
mouse vamp2 n - terminal residues ) .
the vn constructs generated were vn ( vamp2 residues 2860 ) , vn ( vamp2 residues 2857 ) , vn ( vamp2 residues 2855 ) , vn ( vamp2 residues 2850 ) , vn ( vamp2 residues 2847 ) ,
and vn ( vamp2 residues 2844 ) .
these constructs were used in liposome liposome fusion assay
and circular dichroism experiments .
the plasmids for the tm - vc
variants were produced by cloning the
c - terminus of vamp2 of various lengths into a pet sumo vector containing
n - terminal his6 tag .
the tm - vc constructs generated were vc ( vamp2 residues 49116 ) , vc ( vamp2 residues 55116 ) , vc ( vamp2 residues 60116 ) , vc ( vamp2 residues 62116 ) , vc ( vamp2 residues 65116 ) , vc ( vamp2
residues 69116 ) , vc ( vamp2 residues
79116 ) , and vc ( vamp2 residues
85116 ) . all tm - vc variants were expressed in bl21 gold
( de3 ) escherichia coli bacterial strain .
the lysate
was centrifuged , and the supernatant was incubated with nickel - nta
beads .
the his6-sumo
tag was cleaved by incubating the protein ( attached to nickel - nta
beads ) with sumo protease .
the protein was eluted with a buffer containing
25 mm hepes ( ph 7.4 ) , 400 mm kcl , 10% glycerol , 1 mm dtt , and 1% ( w / v ) n - octyl--d - glucopyranoside ( og ) .
the full length t - snare
complex was reconstituted with the acceptor lipid mix made of 85 mol
% popc and 15 mol % dops .
full length vamp2 and tm - vc were reconstituted
with the donor lipid mix comprising 82 mol % popc , 15 mol % dops ,
1.5 mol % dppe - rho , and 1.5 mol % dppe - nbd .
the snare - liposome
was prepared using the standard detergent removal method , which was
previously reported .
typically , flt - liposome had 400:1 lipid / protein
ratio and the flv - liposome and vc - liposome had 200:1 lipid / protein
ratio .
for a typical liposome liposome
fusion assay , 45 l of flt - liposome was mixed with 15 l
of buffer or vn peptide ( final concentrations of lipids and vn peptide
were 2 mm and 20 m , respectively ) and incubated
at 37 c for 60 min , then transferred to a 96-well fluoronunc
plates ( nalge nunc , rochester , ny ) and kept at 37 c for 5 min .
the fusion reaction was initiated by adding 5 l of vc - liposome
or flv - liposome .
fusion between flt - liposome and vc - liposome was measured
by monitoring the dequenching of the dppe - nbd fluorescence resulting
from its dilution into the fused liposomes , at 1 min intervals for
120 min , with excitation wavelength at 460 nm and emission wavelength
at 538 nm , by a plate reader ( synergy h1 hybrid microplate reader ,
bio - tek ) .
after 120 min , 10 l of 2.5% ( w / v ) n - dodecylmaltoside ( boehringer , ingelheim , germany ) was added to completely
dissolve the liposomes .
measurement of the dppe - nbd fluorescence was
continued for another 40 min to obtain the dppe - nbd fluorescence at
infinite dilution .
as reported previously , the normalized fluorescence was obtained by using the fluorescence
intensity of dppe - nbd during fusion divided by the average intensity
the dppe - nbd fluorescence at infinite dilution .
the vn - s28c variants and cytosolic vc - cys ( contains vamp2 residues 5894
and a single cysteine at the end of sequence ) were labeled with texas
red c2 maleimide ( invitrogen ) according the protocol recommended by
the manufacturer .
t - format polarization
was used with a 625 nm long - path filter on the left - emission channel
and a monochromator on the right - emission channel .
the temperature
of sample chamber was controlled with 0.1 c accuracy .
for texas red labeled protein , the excitation wavelength was 580 nm
and the emission wavelength at the right - emission channel was 612
nm .
for
steady - state anisotropy measurements , the anisotropy of various
texas red labeled vn - s28c peptides was first measured in the absence
of t - snare .
cytosolic t - snare ( cdt ) of various concentrations was
then added to each labeled vn peptide ( 200 nm ) .
the mixtures
were incubated at 37 c for 60 min , followed by 24 h on ice .
the texas red labeled cytosolic vc peptide ( 72 nm ) solution was introduced to a quartz
cuvette ( hellma ) with continuous and rapid magnetic stirring .
cytosolic t - snare prebound with
vn peptide or t - snare alone , at various concentrations , was injected
into the cuvette and mixed rapidly .
the data were plotted as anisotropy
versus time , and the beginning of mixing was set as time zero . to obtain the kinetics and thermodynamics parameters
, we consider
the following binding reaction : the kinetics equation is1where kon is the
on - rate , koff is the off - rate , and [ v ] ,
[ t ] , and [ vt ] are the concentrations of vamp2 peptide , t - snare , and
snare complex at time t , respectively .
let v0 and t0 be the
initial concentration ( or total concentration ) of vamp2 peptide
and t - snare , respectively .
thenthe measured anisotropy a at time t is an average of anisotropy of the fluorophores
associated with vamp2 peptide and the fluorophores associated with
the snare complex .
let av be the anisotropy
of vamp2 peptide ( all of the fluorophores are associated with vamp2 )
and avt be the anisotropy of complex ( all
of the fluorophores are associated with the complex ) , thenthus,2equation 1 can be written
as3at the initial stage of the binding
reaction ,
[ vt ] is close to zero . hence , eq 3 can be simplified
as4combining eqs 2 and 4 , we obtain5to obtain kon ,
we performed a series of reactions that labeled vamp2 peptide binds
to t - snare at various initial concentrations , t0 , and monitored the variation of a with t. for each t0 , we obtained
the initial rate da / dt from the a versus t curve , then plotted ( da / dt)/(avt av ) versus t0 .
the
resulting data points were fitted with a simple linear regression ,
and the slope gave kon .
let kd be the affinity constant , ap be the measured anisotropy at equilibrium ,
and [ v]p , [ t]p , and [ vt]p be the
concentrations of vamp2 peptide , t - snare , and snare complex at equilibrium ,
respectively .
then67solving eq 6 for [ vt]p , and then entering into
eq 7 , we have8or9by changing the initial concentration
of t - snare , t0 , while keeping v0 constant , one can obtain a curve of ap as a function of t0 .
kd is obtained using eq 8 or eq 9 and applying a nonlinear regression
fit to the ap versus t0 curve .
the model for complexin clamping is that complexin
binds the half - assembled , intermediate snare complex and arrests further
zippering and that upon clamp release , the zippering of the c - terminal
portions provides sufficient energy to drive fusion ( figure 1a ) . to test this directly , we topologically separated
ntd from later zippering reactions , thereby isolating c - terminal assembly
as the only source of energy for bilayer fusion .
we truncated vamp2
at layer + 1 , right after the zeroth layer , generating a protein , vc , containing only ctd , ld , and tmd ( vamp2
residues from 60 to 116 ) .
vc was reconstituted
into liposomes ( vc - liposomes , supporting information figure s1 ) and nanodiscs
( vc - nanodiscs ) .
lipid mixing of vc - liposomes
or vc - nanodiscs with full length t - snare
liposomes ( flt - liposomes ) was monitored by dequenching of membrane
dye . in content release assay , cacl2 that was encapsulated within flt - liposomes was released through
the fusion pores formed between flt - liposomes and vc - nanodiscs and monitored by measuring the fluorescence of
a ca sensor , mag - fluo-4 .
however , fusion was restored when covalently separated n - terminal
portion of the v - snare ( vn ) was added . specifically , we preincubated
flt - liposomes with vn peptide
( the ntd region of vamp2 from layer 7 to 1 , right
before the zeroth layer ) and then added vc - liposomes or vc - nanodiscs to start the
fusion assays ( figure 1b and supporting information figure s2 ) .
the initial fusion rates
of lipid mixing were 12-fold that of the positive control ,
where both flt - liposomes and flv - liposomes ( or flv - nanodiscs ) contain
wild type , full length snares .
interestingly , the magnitude of activation
by prebound vn is very similar to the level of activation by munc18
( 10-fold ) .
these results
show that ( i ) the c - terminal ( ctd - ld - tmd ) assembly of snares provides
sufficient energy needed to drive fusion whereas the energy from the
n - terminal assembly has no direct contribution to fusion and ( ii )
n - terminal assembly with the t - snare is a prerequisite to enable fusion
driven by ctd - ld - tmd assembly .
ntd binding switches the t - snare to
an activated state that must be reached before fusion can occur .
therefore ,
the process of snare - mediated fusion can be functionally divided into
two distinct and sequential steps , and the fusion in the positive
control with full length snares follows the same two - step pattern :
the ntd of snares assembles first and activates the t - snare , after
which the c - termini assemble to drive fusion .
the positive control
is 12 times slower than the fusion between vc - liposomes and preactivated flt - liposomes .
this shows that ( i ) c - terminal
assembly of snares is rapid and not rate - limiting and that ( ii ) the
n - terminal assembly with the t - snare is the rate - limiting factor .
we
further examined the ability of ntd to activate fusion for a potential
length requirement for the sequence of ntd .
we generated a series
of ntd peptides that are truncated after the respective hydrophobic
layer , ranging from vn ( which
contains vamp2 residues from layer 7 to layer 4 ) to vn ( layer 7 to + 1 ) , and tested
whether they are able to activate fusion between vc - liposomes or vc - liposomes
and flt - liposomes ( figure 1c and supporting information figure s3 ) .
we observed
a distinct transition : vn peptides containing layer 1 ( vn and vn ) both enabled fusion at similar rates , while peptides lacking
layer 1 ( vn , vn and vn ) did not activate fusion .
next we used fluorescence
anisotropy to measure the binding between these vn peptides and cytosolic
t - snare .
the binding curves in figure 1d show
a similar transition regarding the sequence of vn : vn , vn , and vn bound tightly to the t - snare , and
the binding constants for these peptides are virtually identical ( 70
to 100 nm ) ; however , vn and vn exhibited a dramatic reduction
in affinity , with affinity constants of 10 m , showing
that truncations of layer 1 of vamp2 lead to a large loss
of binding to the t - snare .
accordingly , we were able to reconstitute
partially assembled snare complexes from syntaxin 1a , snap25 , and vn or longer but not with vn , as assessed by gel filtration
analysis ( supporting information figure s4 ) .
we observe an all - or - nothing transition , revealing a binary switch
on the n - terminus of snares , with the minimum sequence being layer
7 to layer 1 ( figure 1c and
figure 1d ) . only upon
the binding of vn or longer versions is the t - snare switched
on for fusion . to investigate the molecular
basis for the n - terminal activation ,
we compared the crystal structures of a postfusion , fully zippered
snare complex and a partially assembled , half - zippered
complex .
the fully assembled complex
displays a four - helix bundle structure from n- to c - termini , as there
are four helices present on both n- and c - termini .
the partially assembled
snare complex mimicked an intermediate folding state with a vn peptide , vn , which was reconstituted into a complex
with the complete t - snare motifs .
the crystal structure of the resulting
half - zippered snare complex ( snare ) showed that surprisingly the snare motifs of syntaxin and snap25
almost entirely adopt an -helical conformation ( figure 2a ) : even though the c - terminal half of the complex
only consists of three helices , they still display exactly the same
four - helix bundle configuration as in the fully zippered complex .
previous studies have shown that the binary syntaxin / snap25 t - snare
complex is unstructured in its c - terminal portion , implying together with our data that binding
of vamp2 ntd to the t - snare triggers a binary switch that propagates
the four - helix bundle geometry to the t - snare c - terminal domain
( a ) binding of vn prestructures the c - terminus of the t - snare , as seen
in a comparison of the crystal structures of the postfusion snare
complex ( left ) and a partially assembled complex ( right ) .
the postfusion
complex exhibits four - helix structure , as four helices are present
on both its n- and c - termini ( synxin 1a , red ; snap25 , green ; vamp2 ,
blue ) .
the partially assembled snare complex contains a peptide vn binding to the t - snare motif , and
similar to the postfusion complex , it also shows four - helix structure
on both n- and c- termini , even though only three helices are present
on its c - terminus .
t - snare was incubated
with various vn peptides at equimolar ratio , and their structures
were monitored by circular dichroism . after incubating with vn , vn or vn , respectively , the cd spectra of snares
became similar to postfusion snare complex , whereas the cd spectra
of t - snare were not altered after incubating with vn and vn , respectively . to confirm this by an
independent method , we next tested if the
vn peptides that enable fusion mediated by membrane attached vc are
capable of structuring the t - snare in solution .
the transition from
the partially unstructured t - snare to the folded snare core complex
can be monitored using circular dichroism ( cd ) where the higher helical
content of the ternary complex leads to a strong increase in ellipticity
( figure 2b ) .
importantly , the truncated
snare complex adopts a state of intermediate folding / helicity more
similar to the snare core than the t - snare .
this shows that the structure
observed in the crystal is a true representation of the solution structure .
the increase in ellipticity for vn and vn is similar to that of vn , suggesting the formation of a similar
structure .
in contrast , vn and vn , which do not activate
fusion , have no effect on t - snare conformation when they were added
at equimolar ratio or 5-fold molar excess ( figure 2b ) . as a concentration - independent measure of helical content ,
the ratio of ellipticity at 222 and 208 nm can be compared ( supporting information figure s5 ) .
this result
follows the same length requirement as the fusion assay and binding
assay for different lengths of vn peptides .
taken together ,
our observations show that activation of fusion ,
peptide binding , and induction of helicity are all coupled in an all - or - nothing
transition , revealing that the molecular basis of this binary switch
is the structuring of the c - terminal domain of the t - snare .
specifically ,
binding of vn induces the three helices of the t - snare ctd to adopt
the same configuration as in the fully assembled , postfusion complex ,
resulting in a preformed binding site for the fourth helix , the c - terminal
domain of vamp2 .
the n - terminal activation of
the snares profoundly impacts the assembly and fusion on their c - termini .
to accurately quantify this effect , we used fluorescence anisotropy
measurements and monitored the rate of assembly of a soluble vc peptide , vc ( which includes vamp2 residues 5894 ,
layers + 1 to + 8 plus linker domain ) , with soluble , cytosolic portion
of the t - snare in the presence and absence of vn in real time ( figure 3a and
figure 3b , supporting information
figures s6 and s7 ) . in the absence of vn , rate of binding of vc to the t - snare
is slow ( kon = ( 9 1 ) 10 m s ) and thermodynamically less favorable ( kd = 352 60 nm ) , which corresponds to
a free energy of 14.9 0.2 kbt , where kb is the boltzmann
constant . when the t - snare was switched on upon binding vn , the kinetics
of c - terminal domain assembly was increased 70 times ( now kon = ( 6 1 ) 10 m s ) and affinity of vc was increased
by 30-fold to kd = 12 2
nm , corresponding to a free energy 18.3 0.2 kbt . as shown above , the energy
that overcomes the fusion barrier comes from the assembly of c - terminus
( layer + 1 to layer + 8 plus linker domain ) .
this suggests that an extra
free energy of 3.4 kbt is generated when t - snare is in the on state and
that this additional energy is required for rapid fusion to occur .
structuring
of the t - snare facilitates c - terminal assembly both
energetically and kinetically .
fluorescence anisotropy experiments
were performed to monitor the binding process of vc ( vamp2 residues 5894 ) to the cytosolic t - snare at
various concentrations with and without prebound vn peptide in real time .
( a ) vn binding to the t - snare improves binding affinity of vc .
plateau anisotropy values were plotted versus the concentration of
t - snare ( squares ) .
the solid lines were fits using eq 8 in experimental section to obtain
the affinity constants .
( b ) vn binding to the t - snare increases the
on - rate of c - terminal assembly .
the initial binding rate was plotted
versus the concentration of t - snare according to eq 5 in experimental section to obtain
the on - rate .
the on - rate of vc assembling
with preactivated t - snare is also
rapid , with kon = ( 6 1 )
10 m s. considering
the concentration of snares between two docked membranes is 1
mm , the on - rate becomes 10 s ( time constant of 1 ms ) , which
is very close to the rate measured by optical tweezers .
this kinetics is of the same order of magnitude
as the submillisecond scale kinetics of synaptic vesicle measured
by electrophysiology studies .
what we measured was an intermolecular
binding , and this underestimated the real kinetics . under physiological
conditions , vc and vn are located within a single molecule , and after
vn prebinds the t - snare , c - terminal assembly will be an intramolecular
binding , making the local concentration of vc even higher ( probably
0.1 m ) , and thus , the reaction will be even faster than the
kinetics we measured here .
hence the rapid c - terminal assembly of
the snares should be capable of driving fusion at the time scale required
in synaptic vesicle fusion .
therefore , structuring of the t - snare
c - terminal domain accelerates assembly of vc both energetically and
kinetically by lowering the entropy of the t - snare as well the activation
barrier of assembly , which is the mechanism underlying activation
of fusion .
we also examined the length requirements
of the liposome - attached
vc by systematically testing a series of vc - liposomes ( supporting information figure s1 ) in the fusion
assay using flt - liposomes .
when the flt - liposomes were not preincubated
with vn , no specific fusion occurred for all these vc constructs ( supporting information figure s8 ) . when the t - snares
were preassembled with vn ( figure 4a , supporting information figures
s9 ) or with vn ( supporting information figures s10 and s11 ) to
make sure that the t - snare was in the on state , the
fusion capability of these vc - liposomes also exhibited an all - or - nothing
behavior .
all vc - liposomes containing layer + 1 ( vc - liposomes or longer ) fused with prestructured flt - liposomes
with an elevated rate , while all vc - liposomes lacking layer + 1 ( vc - liposomes or shorter ) did not fuse with
prestructured flt - liposomes .
fusion results between flt - liposomes
and vc - nanodiscs showed similar transition between layers + 1 and + 2
( supporting information figure s12 ) .
this
shows that ( i ) the ctd - ld - tmd assembly that triggers fusion also behaves
as a binary switch and ( ii ) layer + 1 has a critical role in fusion ,
without which fusion is completely abolished .
the c - termini of snares
are required to assemble from layer + 1
to their end to drive membrane merging .
( a ) fusion assay between flt - liposomes
with prebound vn and various
vc - liposomes : vc - liposome , vc - liposome , vc - liposome , vc - liposome , vc - liposome , vc - liposome , respectively .
a sharp transition
was observed between layers + 1 and + 2 . in the absence of layer
( b ) vc - liposomes and vc - liposomes
were able to dock to flt - liposomes . in a his - tag pull - down , flt - liposomes
were first incubated with vn or cdv
at 37 c for 1 h , followed by incubation with various vc - liposomes
at 37 c for 2 h , then pulled down by nickel - nta through the
his - tag on snap25 .
( c ) a map of fusion activation
that illustrates the sequence requirements for both n- and c - termini .
two factors may be responsible for fusion incompetency of vc - liposomes or shorter : ( i ) a docking defect
which means that vc - liposomes or shorter
do not bind prestructured flt - liposomes ; ( ii ) fusion defect , where
the energy obtained from zippering layer + 1 to tmd is just enough
to overcome the energy barriers of c - terminal assembly and fusion ,
while zippering from layer + 2 to tmd does not provide enough energy .
to determine which the dominant factor is , we performed a his - tag
pull - down assay ( figure 4b ) .
vc - liposomes contained
no his - tag , while flt - liposomes were his - tagged .
vc - liposomes were
only pulled down when they docked on flt - liposomes .
page
analysis showed that the fusion - potent construct , vc - liposomes , and the fusion - incompetent construct , vc - liposomes , could both dock to flt - liposomes . even
though the pull - down experiment can not prove that docking is quantitatively
the same , this result suggests that fusion incompetency of vc - liposomes or shorter versions was most likely due
to their inability to generate sufficient energy required for c - terminal
assembly and fusion . by systematically testing the sequence
requirements for n - terminal
activation and c - terminal fusion , we are able to generate a comprehensive
map of fusion activation ( figure 4c ) .
the optimal
combination is that flt - liposome is activated by vn and then fuses with vc - liposome .
compared with the standard flv - liposome / flt - liposome fusion
reaction , this pair results in 12-fold activation .
membrane fusion ultimately requires the assembly of t- and v - snares
into a four - helix bundle which brings the membranes into close proximity
and triggers bilayer merging .
formation of cis - snare complex was proposed
to occur through continuous and progressive zippering from n - termini
to c - termini and to culminate in a release of energy to drive membrane
fusion .
our data show that functionally , a two - step sequential
zippering pathway is required in membrane fusion , and each step has
its specific and distinct function ( figure 5 ) . in both steps , zippering exhibits all - or - nothing , binary - switch - like
behavior .
the first step is characterized by docking and t - snare structuring
and requires t- and v - snares to zipper to at least layer 1
( assembly of layer 7 to layer 2 or shorter can barely
dock the v - snare to the t - snare because binding of vn or shorter versions to the t - snare is extremely
weak , with affinities 10 m ) .
the long - range effect
of vn binding on the structure of the t - snare c - terminus can best
be explained by an induced - fit
conformational transition
of the t - snare from a triple - helix to a four - helix bundle configuration .
the second step defines actual fusion , where t- and v - snares assemble
from layer + 1 to the transmembrane domain and energy generated from
this step of zippering is used to overcome the fusion barrier .
these
findings are intrinsic properties of the snares ; in vivo , regulatory
proteins such as synaptotagmin may help stalk formation and pore opening .
whereas the fusion step occurs very rapidly
our data suggest that the
ionic layer , layer 0 , does not have a functional role in either of
the two assembly steps .
however , it is possible that it separates
ntd and ctd - ld - tmd from each other .
first the n - termini of snares assemble to at least
layer 1 and switch the t - snare into fusion - ready conformation
( docking and structuring ) .
then the c - termini of snares assemble ( starting
at least from layer + 1 ) and provide energy to overcome the fusion
barrier .
the docking and structuring step is the rate - limiting step . in the conventional n - to - c zippering
model , the very n - termini
of the snares
we show that n - terminal
assembly has to reach the middles layers ( around layer 1 )
to induce a dramatic transition that ( i ) achieves a much higher binding
affinity than that in the n - terminal layers , ( ii ) introduces a significant
structural change in the t - snare , and ( iii ) facilitates c - terminal
zippering of the snare complex .
these data suggest that the middle
layers are the critical part for assembly of the entire snarepin .
previously , a soluble vc peptide ( vamp2 residues 5792 )
was found to accelerate fusion between flt - liposomes and flv - liposomes .
proposed a molecular mechanism for this finding , suggesting that binding of vc to the t - snare
displaced the n - terminal regulatory domain of syntaxin and opened
up the t - snare .
however , in the current view of the folding pathway
of the snares , because of the topological constraints , the n - termini
zipper first , then followed by c - terminal assembly .
here we use vn
peptides to prebind the t - snare and liposome - reconstituted vc to initiate
fusion .
this design perfectly matches the folding pathway of the snares
because it is completely viable that physiologically full length vamp2
uses its n - terminal portion to bind and prestructure the t - snare and
then further zippers up its c - terminal portion with the t - snare to
drive fusion .
hence , activation of fusion by vn , but probably not
vc , is likely to be relevant under physiological conditions .
other groups reported that vn peptides that contained layers 7
to 0 ( or longer ) inhibited assembly and fusion of full length snares . in our experiments , when flt - liposomes were prebound with vn ( supporting information figure
s10 ) , the rate of fusion with flv - liposomes was about half
the rate of the positive control ( fusion between flt - liposomes and
flv - liposomes in the absence of vn ) , the result was inhibition , which
is consistent with these reports . however , when
flt - liposomes were prebound with vn ( supporting information figure s9 ) , the
rate of fusion with flv - liposomes was about twice the rate of the
positive control , the result was activation .
there are two factors
affecting the fusion rate : ( i ) prestructuring of the t - snare and ( ii )
overlap of residues between vn peptide and flv - liposomes .
such overlap
decreases the efficiency of collision and thus decreases fusion rate
in a systematic manner .
the overall effect is a combination of these
factors . if flt - liposomes were prebound with vn ,
prestructuring was the dominant factor and the result
was activation ; however , if flt - liposomes were prebound with vn or longer , more residues overlapped
and this factor overcame the prestructuring , and the overall result
was inhibition . supporting information table
the significance
of the two - step assembly pathway becomes apparent
in the context of regulatory proteins that influence fusion rates .
complexin has been suggested to promote t- and v - snare interaction
by binding with its central domain to a groove formed by vamp2 and
syntaxin , while its
accessory domain binds the t - snare to block progression of fusion .
the n - terminal switch allows recruiting complexin and creation of
a clamped state , as both interactions occur with the half - zippered
snare complex .
the three aspartic acid residues , which are required
by ca - dependent removal of the clamp , are located on the ctd of vamp2 ( between layers + 2 and
+ 4 ) .
as soon as the snares zipper to around layer + 1 or + 2 , complexin
switches to the closed conformation simultaneously .
a further physiologically
meaningful intermediate pause in the snare folding pathway can not
exist after the action of complexin switch occurs , which indicates
that the c - terminal zippering of the snares may happen as a single
event .
this is consistent with our finding that assembly of vc or shorter versions with the prestructured t - snare
is not capable of driving fusion .
these results suggest that it is
unlikely that there is another relevant intermediate state in the
c - terminal assembly step of the snares .
the two - step assembly becomes
both kinetically and thermodynamically observable in the presence
of complexin .
therefore , this switchlike ,
two - step folding pathway plays a critical role under physiological
conditions and the half - zippered snare complex represents a previously
unrecognized important intermediate stage of the snare assembly . | snare
( soluble n - ethylmaleimide - sensitive factor
attachment protein receptor ) proteins mediate fusion by pulling biological
membranes together via a zippering mechanism .
recent biophysical studies
have shown that t- and v - snares can assemble in multiple stages from
the n - termini toward the c - termini . here
we show that functionally ,
membrane fusion requires a sequential , two - step folding pathway and
assign specific and distinct functions for each step .
first , the n - terminal
domain ( ntd ) of the v - snare docks to the t - snare , which leads to a
conformational rearrangement into an activated half - zippered snare
complex .
this partially assembled snare complex locks the c - terminal
( ctd ) portion of the t - snare into the same structure as in the postfusion
4-helix bundle , thereby creating the binding site for the ctd of the
v - snare and enabling fusion . then zippering of the remaining ctd ,
the membrane - proximal linker ( ld ) , and transmembrane ( tmd ) domains
is required and sufficient to trigger fusion .
this intrinsic property
of the snares fits well with the action of physiologically vital regulators
such as complexin .
we also report that ntd assembly is the rate - limiting
step .
our findings provide a refined framework for delineating the
molecular mechanism of snare - mediated membrane fusion and action of
regulatory proteins . | Introduction
Experimental Section
Results
Discussion |
in recent years , magnesium alloys have attracted much attention as potential biodegradable bone implant materials due to their biodegradability in the bioenvironment as well as their favourable mechanical properties , especially the elastic modulus being close to that of the bone which will effectively decrease the stress shielding effect [ 1 , 2 ] .
most of these studies are focused on the ways to improve corrosion resistance in physiological media , for example , through alloying or coating .
further in vitro and in vivo tests will provide essential data for further material and process optimization before the pre - clinical test stage is reached .
another issue of these potential biomedical materials , being as important as corrosion resistance but not always addressed , concerns their bioactivity , i.e. the ability of the implant to form bonding with the surrounding bone tissue after implantation .
while a number of in vivo studies have shown good bone attachment to magnesium implants after 9 to 18 week implantation and good biocompatibility of magnesium in long - term service [ 5 , 6 ] , some other research on the early bone response to magnesium bone implants has led to inconsistent results .
for example , only 50% of magnesium implants were fixed at 5 weeks post - implantation . in some cases , gaps
could still be observed between the implant and bone tissue after 14-week implantation , even though the material showed a moderate degradation rate .
it is clear that efforts are needed to improve the surface biocompatibility and bioactivity of mg - based materials and speed up the early tissue response to the implant . introducing bioactive particles that have good ability to induce the deposition of ca
p compounds from simulated body fluid into a metal matrix to form a metal matrix composite may be an effective way to elevate the surface biocompatibility and bioactivity of the matrix material , as demonstrated in a recent study .
ning and zhou reported that a ti / hydroxyapatite ( ha ) biocomposite ( with a ti / ha ratio of 1:1 by volume ) indeed had the ability to induce apatite nucleation and growth on its surface in simulated body fluid .
their results showed that the composite with 20% ha by weight was a cytocompatible biomaterial and the distribution and size of ha particles were of major importance for mechanical and corrosive properties .
it is however known that ha has a minimal degradability and its bioactivity still needs to be improved .
a previous study demonstrated a moderate degradation rate and good cytocompatibility of zk30 ( 3 wt% zn , 0.6 wt% zr and balance mg ) that contained no potentially toxic elements such as aluminium in az91 .
the present study was aimed at exploring the feasibility of using commonly acknowledged bioactive and biodegradable glass ( bg , 45s5 ) as the reinforcing phase in the composites with the zk30 magnesium alloy as the matrix and confirming the surface biocompatibility of the composites .
the structures of the composites , including the distribution of bioactive particles in the matrix as well as their mechanical properties were investigated .
the surface biocompatibility of the composites was evaluated by characterizing the corrosion layer on samples soaked in a cell culture medium and comparing it with that of the matrix sample .
45s5 bioglass particles with a composition of 45% sio2 , 24.5% na2o , 24.5% cao and 6% p2o5 by weight were introduced . upon stirring , the mixture was cast into a cylindrical form by using a high pressure casting machine .
the volume fractions of bg particles in the composites were 3.4 , 6.9 and 14.3% , corresponding to 5 , 10 and 20% by weight , respectively .
samples for microstructure observation were cut from the ingots , ground by sic papers up to 2000 grit , and then polished down to 1 m . a leica optical microscope and a scanning electron microscope ( sem , jsm-6500f , jeol ) combined with an energy dispersive x - ray ( edx ) spectrometer ( inca energy , oxford instruments ) were used .
furthermore , a jeol jxa 8900r electron probe microanalyzer ( epma ) was used to determine the distribution of the silicon element in the composites .
the acceleration voltage was set at 15 kev and the probe current at 100 na using a focused electron beam .
the size of the analysis area was 100 100 m with a step size of 1.0 m . for compressive testing , specimens with a length of 15 mm and a diameter of 10 mm were machined in accordance with din en 50106 .
the immersion test was conducted by soaking samples in the cell culture medium ( minimum essential medium with earle s balanced salts , safc bioscience inc .
the minimum essential medium with earle s balanced salts ( e - mem ) was selected , because it represents the ion concentrations of blood plasma and contains some kinds of amino acid that is also present in human plasma .
the concentrations of ions in e - mem in comparison with those in the human blood are listed in table 1 .
the as - fabricated composites as well as the zk30 alloy were cut into disks with a diameter of 10 mm and a thickness of 2 mm .
the surfaces of the samples were ground by sic papers up to 2000 grit , polished down to 1 m and dried , before they soaked in e - mem .
a disk was immersed in the e - mem solution with a volume of 22 ml at 37.0c , thus the ratio of the volume of the solution to the apparent surface area of the disk being 0.1 cm .table 1ion concentrations in human blood and e - mem na ( mmol / l)k ( mmol / l)ca ( mmol / l)mg ( mmol / l)c ( mmol / l)hco3 ( mmol / l)hpo4 ( mmol / l)so4 ( mmol / l)amino acids ( mg / l)dex / glu ( g / l)blood plasma1425.02.51.5103271.00.5ndnde - mem1515.371.800.81112526.20.8970.8110.08601nd not determined ion concentrations in human blood and e - mem nd not determined after soaking in the cell culture medium for 24 h , the samples were taken out and dried .
45s5 bioglass particles with a composition of 45% sio2 , 24.5% na2o , 24.5% cao and 6% p2o5 by weight were introduced . upon stirring , the mixture was cast into a cylindrical form by using a high pressure casting machine .
the volume fractions of bg particles in the composites were 3.4 , 6.9 and 14.3% , corresponding to 5 , 10 and 20% by weight , respectively .
samples for microstructure observation were cut from the ingots , ground by sic papers up to 2000 grit , and then polished down to 1 m . a leica optical microscope and a scanning electron microscope ( sem , jsm-6500f , jeol ) combined with an energy dispersive x - ray ( edx ) spectrometer ( inca energy , oxford instruments ) were used . furthermore ,
a jeol jxa 8900r electron probe microanalyzer ( epma ) was used to determine the distribution of the silicon element in the composites .
the acceleration voltage was set at 15 kev and the probe current at 100 na using a focused electron beam .
the size of the analysis area was 100 100 m with a step size of 1.0 m . for compressive testing , specimens with a length of 15 mm and a diameter of 10 mm were machined in accordance with din en 50106 .
the immersion test was conducted by soaking samples in the cell culture medium ( minimum essential medium with earle s balanced salts , safc bioscience inc . , usa ) . the minimum essential medium with earle s balanced salts ( e - mem ) was selected , because it represents the ion concentrations of blood plasma and contains some kinds of amino acid that is also present in human plasma .
the concentrations of ions in e - mem in comparison with those in the human blood are listed in table 1 .
the as - fabricated composites as well as the zk30 alloy were cut into disks with a diameter of 10 mm and a thickness of 2 mm .
the surfaces of the samples were ground by sic papers up to 2000 grit , polished down to 1 m and dried , before they soaked in e - mem .
a disk was immersed in the e - mem solution with a volume of 22 ml at 37.0c , thus the ratio of the volume of the solution to the apparent surface area of the disk being 0.1 cm .table 1ion concentrations in human blood and e - mem na ( mmol / l)k ( mmol / l)ca ( mmol / l)mg ( mmol / l)c ( mmol / l)hco3 ( mmol / l)hpo4 ( mmol / l)so4 ( mmol / l)amino acids ( mg / l)dex / glu ( g / l)blood plasma1425.02.51.5103271.00.5ndnde - mem1515.371.800.81112526.20.8970.8110.08601nd not determined ion concentrations in human blood and e - mem nd not determined after soaking in the cell culture medium for 24 h , the samples were taken out and dried .
figure 1 shows the microstructures of the zk30-bg composites with different volume fractions of bg particles . as can be seen , black particles are homogeneously dispersed in the matrix and the number density of the black particles indeed increases with increasing volume fraction of bg particles as desired ( fig .
sem revealed that the black particles had angular shapes , as those of the initial bg powder particles , suggesting little reaction took place during material preparation .
the composites with 3.4 and 6.9% bg by volume were slightly porous and most of the pores had sizes below 10 m ( fig .
however , in the composite with 14.3% bg particles by volume , the pore sizes were considerably larger ( fig .
1f ) . in a composite ingot made by the semi - solid casting method , in general
, porosity may arise from ( i ) gas entrapment during mixing , ( ii ) hydrogen evolution , and ( iii ) shrinkage during solidification .
for the present composites , the porosity might result from gas bubbles entering the slurry either independently or as gas envelopes of the reinforcing particles .
indeed , it was observed that the porosity in stir - cast composites increased almost linearly with particle content . such an increase in porosity will have an adverse effect on the mechanical strength of the composite .
the compressive strength of the composite indeed decreased from 330 to 240 mpa as the volume fraction of bg particles increased from 0 to 14.3% .
it is however important to note that the strengths of the composites are still considerably higher than the typical strength of human cortical bone ( 88.3163.8 mpa ) and therefore the sacrifice in strength due to the bg particles and associated porosity is not a matter of serious concern .
the effect of the porosity may be more on the degradation rate than on the compressive strength and , therefore , it is necessary to take measures to eliminate the residual pores in the structure .
vacuum hot pressing , hot isostatic pressing and especially hot extrusion involving strong shearing have been proven to be effective methods capable of consolidating initially porous materials .
1surface morphologies of the zk30-bg composites with 3.4% ( a , b ) , 6.9% ( c , d ) and 14.3% ( e , f ) bg particles by volume under optical microscope ( a , c , e ) and sem ( b , d , f ) . the black arrows point at the reinforcing particles , while the white ones point at the pores in the compositesfig .
2compressive strengths of the zk30-bg composites with different volume fractions of bg particles surface morphologies of the zk30-bg composites with 3.4% ( a , b ) , 6.9% ( c , d ) and 14.3% ( e , f ) bg particles by volume under optical microscope ( a , c , e ) and sem ( b , d , f ) .
the black arrows point at the reinforcing particles , while the white ones point at the pores in the composites compressive strengths of the zk30-bg composites with different volume fractions of bg particles since the biomedical property of a bioactive ceramic material is closely related to its chemical composition , it is of utmost importance to keep the compositional characteristics of bg particles in the composite unchanged . in general , it is rather difficult to ascertain the retention of the chemical composition of bg particles due to their amorphous structure . in the present study ,
edx analysis was performed to confirm the compositional retention of bg particles in the composites . as can be seen from fig .
3a , only mg , zn and a small amount of element o were detected by edx , and the mass ratio of mg and zn was close to that of the designed zk30 composition , which means that the matrix composition was well preserved after the casting procedure .
as to the bg particles in the composites , edx analysis revealed the presence of ca , si , na , o and a small amount of mg ( fig .
the presence of mg could be attributed to the magnesium surrounding the bg particles or to mild reactions at the interfaces between the matrix and bg particles . for a clearer comparison , the weight percents of ca ,
si , na and o of the analyzed particles as determined by edx are listed in table 2 and compared with those of the theoretical elemental composition of bg particles .
it can be seen that the discrepancies between the as - measured and theoretical composition data were not marked , suggesting the retention of bg particles in the composites .
it is of particular importance to note the high si concentration in the bg particles , which is necessary for the excellent bioactivity of a bioactive glass .
epma analysis indeed revealed the silicon element with enhanced intensities scattered all over the matrix , which corresponded to the locations of bg particles ( fig . 4 ) .
it was thus clear that the basic chemical composition of bg particles remained largely intact during semi - solid high pressure casting , which would be essential for the preservation of their bioactivity .
in other words , semi - solid high pressure casting appeared to be a viable method to fabricate zk30-bg composites .
3edx analysis of the matrix ( a ) and particles ( b ) in the zk30-bg compositestable 2edx determined composition of bg particles in the composites in comparison with the designed composition of bg ( wt % ) casinaomgas - designed17.521.018.240.70as - measured22.329.714.230.63.2fig .
the analysis area on a zk30-bg mmc sample is indicated by the square in the backscattered electron image ( bei ) .
the intensity of the si k in the framed area is represented by the gray scale ( or a jet - like colour scheme in the online version ) .
here black represents a low signal and light gray - white higher intensity signals ( pinkish - white the highest intensity in the online version ) edx analysis of the matrix ( a ) and particles ( b ) in the zk30-bg composites edx determined composition of bg particles in the composites in comparison with the designed composition of bg ( wt % ) distribution of si in the composite as determined by epma . the analysis area on a zk30-bg mmc sample is indicated by the square in the backscattered electron image ( bei ) .
the intensity of the si k in the framed area is represented by the gray scale ( or a jet - like colour scheme in the online version ) . here
black represents a low signal and light gray - white higher intensity signals ( pinkish - white the highest intensity in the online version ) the surface morphologies of the composites after immersion in e - mem for 24 h are shown in fig . 5 . during immersion , pitting corrosion indeed occurred on the surface of the zk30 alloy sample without bg reinforcement ( fig .
in contrast , a deposition layer was formed on the surface of the composite samples , and the area of this layer increased with increasing volume fraction of bg particles in the composite ( fig .
edx analysis of the surface layer showed increases in the ca atomic percent and ca / p molar ratio , as the volume fraction of bg particles increased from 0 to 14.3% ( fig .
. the ca / p ratios of the composites in the range of 1.21.35 , being lower than the theoretical value ( 1.67 ) , show that the newly formed apatite layer is a ca - deficient apatite layer , consistent with the properties of bone - like apatite formed on an ha - bioglass composite and on bioglass .
the results indicated that the bg particles present in the composite were indeed able to induce faster and more homogeneous deposition of a ca- and p - rich layer on the magnesium alloy matrix .
the operating mechanism of spontaneous apatite formation on metallic magnesium may be as follows : an ionic exchange between mg from the substrate and h from the soaking medium takes place , leading to an increase in ph ; higher ph values increase the supersaturation degree of the cell culture medium with respect to apatite .
the result is the nucleation and growth of a ca- , p- and mg - rich ceramic layer on the magnesium substrate . with the addition of bg particles ,
apart from the supersaturation caused by the elevated ph environment , the apatite layer formation is accelerated due to the release of ca from the partial dissolution of bg particles .
the silicon dissolved from the bg particles surface may act as a nucleating agent , thereby accelerating the formation of the apatite layer which can significantly improve the surface biocompatibility of the material [ 8 , 9 ] . in combination with the consideration on the compressive strengths of the composites ( fig .
2 ) , the zk30-bg composite with 6.9% bg by volume showed the best balanced properties . further research on the biocompatibility and bioactivity of the composites and other aspects relevant to the biomedical application will be carried out to optimize both material design and processing further .
5sem micrographs of the zk30 alloy ( a ) and the composites with 3.4% ( b ) , 6.9% ( c ) and 14.3% ( d ) bg particles by volume after immersion in e - mem for 24 hfig .
6ca atomic percents and ca / p molar ratios of the surface layer formed on the composite samples with different volume fractions of bg particles after immersion in e - mem for 24 h sem micrographs of the zk30 alloy ( a ) and the composites with 3.4% ( b ) , 6.9% ( c ) and 14.3% ( d ) bg particles by volume after immersion in e - mem for 24 h ca atomic percents and ca / p molar ratios of the surface layer formed on the composite samples with different volume fractions of bg particles after immersion in e - mem for 24 h
for the first time , mg - based metal matrix composites with bioactive glass as reinforcing particles were fabricated by the semi - solid high pressure casting method .
accelerated formation of an apatite layer on the composite surface occurred , indicating an improved surface biocompatibility of the material .
these results demonstrated the feasibility of improving the surface biocompatibility of mg - based implant materials by adding bioactive particles .
further research on material - cell interactions would be of great value to show the potential of the composites as biodegradable , bioactive orthopaedic materials . | in this study , bioactive glass ( bg , 45s5 ) particles were added to a biodegradable magnesium alloy ( zk30 ) through a semi - solid high - pressure casting process in order to improve the surface biocompatibility of the biomaterial and potentially its bioactivity .
the observation of the as - cast microstructures of zk30-bg composites indicated homogeneous dispersion of bg particles in the matrix .
sem , edx and epma showed the retention of the morphological characteristics and composition of bg particles in the as - cast composite materials . in vitro tests in a cell culture medium confirmed that the composites indeed possessed an enhanced ability to induce the deposition of a bone - like apatite layer on the surface , indicating an improved surface biocompatibility as compared with the matrix alloy . | Introduction
Experimental
Material preparation
Observation of microstructure and determination of mechanical properties
Immersion test
Results and discussion
Conclusions |
a patient with incomplete cervical cord injury , taken up for cervical spine decompression and fusion surgery , developed hypertensive crisis in operation theatre which was refractory to routine antihypertensive measures .
anaesthesia and surgery proceeded when she reasonably responded to intravenous ( iv ) dexmedetomidine only to have a rebound hypertension in the post - operative period which finally responded dramatically to rectal evacuation of impacted stool .
autonomic dysreflexia ( ad ) , a potentially dangerous clinical syndrome occurs in spinal cord injury at or above the sixth thoracic vertebral level ( t6 ) resulting in acute uncontrolled hypertension due to over activity of sympathetic nervous system below the level of injury , triggered by an ascending sensory ( noxious ) stimulus usually an over distended bladder in almost 85% of cases and bowel distension due to impacted stools .
a 35 year old female weighing 45 kg was having complaints of pain in the neck and weakness of all 4 limbs for 1 week . there were quadriparesis and a swelling on the left side of the neck along with tenderness in the cervical spine .
neurological examination revealed a power of 3/5 in bilateral upper and lower limbs and a sensory loss below c5 level with no bladder and bowel involvement .
rest of the clinical examination and baseline investigations were within normal limits . based on fine needle aspiration cytology report of a caseating tubercular lesion ,
magnetic resonance imaging of spine showed osseous destruction of c4 , c6 , c7 , t2 vertebral bodies , pre- and para - vertebral abscess and mild tracheal compression at the level of c6c7 [ figures 1 and 2 ] pre- and para - vertebral abscess with extension into b / l paraspinal muscles , anterior and posterior epidural space leading to significant compression of thecal sac and cervical spinal cord osseous destruction of c4 , c6 , c7 , t2 vertebral bodies an awake fiberoptic bronchoscopy ruled out any airway compromise .
she was planned for an elective cervical spine decompression and fusion surgery under the american society of anesthesiologists grade 1 . however , a sudden bladder and bowel involvement called for immediate surgery .
the patient was extremely anxious , agitated , was sweating and complained of headache with pain in the neck even after a premedication of midazolam 1 mg iv .
monitors showed a heart rate ( hr ) of 150/min and a blood pressure ( bp ) of 188/110 mmhg .
after 5 min bp was 196/120 mmhg with hr 158/min and continued to rise to 200/124 mmhg with a hr 156/min .
the progressing neurological deficit , aggressive haemodynamic optimization was attempted with a loading dose of esmolol 1 mg / kg iv was followed by an infusion 0.2 mg / kg / min after securing an arterial line .
remaining parameters such as percentage saturation of oxygen ( spo2 ) remained within normal limits .
a peripheral central catheter was inserted for central venous pressure monitoring . despite continuing esmolol infusion for 15 min
snp was not readily available with us , and a trial of esmolol had already been given .
the persistent anxiety factor prompted us to utilise the 2 agonist dexmedetomidine in a loading dose of 1 g / kg over 10 min followed by infusion of 0.2 g / kg / h .
the hr dropped to 120/min over 10 min , and the bp came down to 140/94 mmhg and patient became anxiety free . having achieved a relatively stable haemodynamics it was decided to proceed with the case .
while maintaining a manual inline stabilisation , mask ventilation was assured and vecuronium bromide 5 mg iv administered .
although a difficult intubation trolley was kept ready , trachea could be easily intubated with a 7.5 mm cuffed endotracheal tube .
extubation was planned in a deeper plane of anaesthesia . to obtund the haemodynamic reflexes at extubation ,
extubation was smooth and uneventful , and the patient shifted to high dependency unit ( hdu ) . in the hdu ,
a per rectal examination revealed impacted hard stools which was then evacuated . in the next 60 - 90 min ,
the patient was observed for the next 48 h with strict instructions of bowel care by enema .
our patient presented with incomplete cervical cord injury without any associated comorbidity but developed rapid neurological deficit with bladder and bowel involvement . on the operation table , she developed hypertensive crisis which was refractory to the conventional treatment , but responded somewhat to the cocktail of 2 agonist dexmedetomidine , opioid , beta blocker , diuretic and inhalation anaesthetic which helped us to tide over the intraoperative period only to have a rebound hypertension in the immediate post - operative period .
since we were dealing with a lesion at the cervical level with relatively intractable hypertension in a young patient with no previous history of hypertension , ad was considered as a possible cause , which led us to search for a focus of stimulation .
the urinary bladder was already catheterised so any stimulus arising from bladder was ruled out .
ad is a potentially dangerous clinical syndrome that develops in spinal cord injury at or above the t6 vertebra , resulting in acute , uncontrolled hypertension due to widespread reflex activity of sympathetic nervous system below the level of injury , triggered by an ascending sensory ( usually noxious ) stimulus either an over distended bladder , in almost 85% of cases , or bowel distension due to impacted stools , due to isolation of spinal cord below the injury from normal regulation by vasomotor centres in the brainstem .
pressure sores , ingrowing toenails , pregnancy and labour are also known to trigger ad .
release of catecholamines causes severe vasoconstriction with skin pallor , piloerection and a sudden rise in bp usually accompanied by a headache . rise in bp
is sensed by baroreceptors in the aortic arch and carotid bodies resulting in parasympathetic activity and compensatory bradycardia ( via the vagus nerve ) . our patient had a unique presentation for several reasons .
firstly , though it is a known occurrence in spinal cord injury , very few cases have been reported in non - traumatic causes .
however , causes like spinal cord tumours or post - neurosurgery above t6 , secondary to medical conditions such as multiple sclerosis are also known . secondly , our patient presented with tachycardia contrary to the much common presentation of bradycardia in these patients .
however , it has been observed that tachycardia is not an uncommon finding especially in patients with cervical lesion as was our patient .
thirdly , only 27% of patients with incomplete lesions present with ad ( in comparison to 91% of complete lesions ) as was in our patient . because of all the above factors , we considered it wise to rule out all other possibilities of such a presentation before concluding on ad as the cause . to rule out common causes of hypertension in a young female ,
a thorough history and examination were followed by a repeat routine laboratory tests along with special tests such as fundoscopy , thyroid profile , renal doppler , ultrasound kidney , ureter , bladder , echocardiography , serum cortisol and vanillylmandelic acid .
since all were within normal range , we zeroed down to a diagnosis of ad .
we want to emphasize that while dealing with a cervical cord injury , traumatic or atraumatic , complete or incomplete , the element of ad should be kept in mind , which should prompt us to eliminate any focus of stimulus below the level of injury .
catheterization of the urinary bladder and bowel evacuation with enema are the pearls of the preoperative preparation of such cases . | a young female having complaints of quadriparesis along with bladder and bowel involvement , diagnosed to have osseous destruction of c4 , c6 , c7 , t2 vertebral bodies with pre- and para - vertebral abscess , was taken up for anterolateral decompression and fusion of cervical spine .
she presented with anxiety , agitation , sweating and headache and was in hypertensive crisis which was refractory to antihypertensives , anxiolytics and analgesics but showed a reasonable response to intravenous dexmedetomidine and finally responded dramatically to rectal evacuation .
autonomic dysreflexia was suspected with stimulus arising from distended rectum as all other causes of hypertension were ruled out . | INTRODUCTION
CASE REPORT
DISCUSSION
CONCLUSION
Financial support and sponsorship
Conflicts of interest |
phrenic nerve damage leading to paralysis of the ipsilateral diaphragm may result from a stretch injury due to lateral hyperextension of the neck at birth .
injury to the nerve is thought to occur at the point where it crosses the brachial plexus .
phrenic nerve injury with diaphragmatic paralysis must be considered when cyanosis and irregular and labored respirations develop .
diaphragmatic paralysis due to phrenic nerve paralysis may result in significant respiratory compromise , pulmonary infection , growth failure , and even death .
this rare cause of respiratory distress of newborn may be missed easily among multiple common etiologies of respiratory distress of newborn if this entity is not kept in mind and thorough examination is not done .
these newborn babies may require continuous positive airway pressure ( cpap ) or mechanical ventilation and if unresponsive , surgical plication of diaphragm should be performed .
herein , we present the case of a female baby who was preterm , weighed 1.75 kg , was appropriate for gestational age , and was born by vaginal delivery with breech presentation .
the baby cried immediately after birth . immediately after birth , the baby developed respiratory distress . upon examination
x - ray of the chest showed elevation of the right hemidiaphragm [ figures 2 and 3 ] .
chest x - ray showing elevated right side of diaphragm another chest x - ray showing elevated right side of diaphragm the baby was started on cpap in view of the severe respiratory distress with grunting and cyanosis on the 1 day .
the baby was weaned to head box oxygen on the 4 day of life and was started on orogastric tube feeds on the 5 day of life .
x - ray of the chest revealed normal position of the right side of diaphragm and ultrasound showed normal movement of the right hemidiaphragm with respiration .
phrenic nerve damage leading to paralysis of the ipsilateral diaphragm may result from a stretch injury due to lateral hyperextension of the neck at birth .
diaphragmatic paralysis alone in the newborn results in significant respiratory sequelae and failure to thrive .
the usual presentation is with respiratory distress , produced largely by over activity of normal hemidiaphragm . in cases of bilateral paralysis ,
there is excessive stretching of c3-c5 nerve roots in the neck . of patients with brachial plexus palsy
majority of the babies with brachial plexus palsy manifested respiratory complications sufficient to warrant diaphragmatic plication ( dp ) .
the severity of brachial plexus palsy failed to correlate with the severity of respiratory consequences .
al - qattan et al . investigated the prognostic value of concurrent phrenic nerve palsy in newborn babies with erb 's palsy .
the records of 191 babies with erb 's palsy were reviewed retrospectively in their study .
poor spontaneous return of the motor function of the limb was found for infants both with and without concurrent phrenic nerve palsy .
concurrent phrenic nerve palsy in newborn babies with erb 's palsy has no prognostic value in predicting spontaneous motor recovery of the limb .
the intercostal muscles are inhibited , because of the supine position of newborn , the diaphragm is pushed upward aggravating respiratory distress . the diagnosis is suggested on chest radiograph if the right hemidiaphragm is two intercostal spaces higher than left or if the left hemidiaphragm is one intercostal space higher than right .
paradoxical motion or limitation of motion of involved diaphragm may be seen on fluoroscopy or ultrasound examination .
ultrasound examination of the diaphragm and phrenic nerve conduction studies are the diagnostic methods of choice .
this is the reason why some newborn babies improve markedly with cpap . according to escande et al .
, non - invasive nasal cpap should be proposed for the treatment of phrenic nerve obstetrical palsy before introducing more invasive ventilation techniques .
these babies improve over a period of 2 - 3 weeks and further improvement is possible over a period of 2 months .
if there is no further improvement and if the newborn can not be weaned from the ventilator , surgical plication of the diaphragm should be performed .
stramrood et al . in his study showed that a minority of infants suffering from diaphragmatic paralysis due to perinatal phrenic nerve injury recover spontaneously .
infants who fail to wean from ventilatory support and undergo early plication have a quick recovery and can be extubated successfully within a few days .
plication of the diaphragm is a safe and useful procedure to improve ventilation in infants with a paralyzed diaphragm .
since this technique does not prevent return of the diaphragmatic function , it should be employed prior to the development of sequelae of prolonged assisted ventilation and sooner if the phrenic nerve is permanently injured . according to de vries et al .
, if after 1 month , no spontaneous recovery of the diaphragmatic paralysis caused by a phrenic nerve injury occurs , plication of the diaphragm is indicated .
this operation proved to be successful for relief of symptomatic phrenic nerve injury in all cases .
if the condition of the patient clinically deteriorates during the 1 month of life , the patient should be operated upon immediately .
traditionally , dp is performed via a thoracotomy that includes incision of the lower intercostal muscles , which are involved in respiratory movement .
this may adversely affect ventilation by causing deterioration of respiratory function and making ventilation less efficient .
these problems do not occur with thoracoscopic dp , since the lower intercostal muscles are left intact . | birth injury is defined as an impairment of a newborn 's body function or structure due to adverse influences that occurred at birth .
phrenic nerve palsy may result from birth trauma during a traumatic neonatal delivery from a stretch injury due to lateral hyperextension of the neck at birth .
this could be a rare cause of respiratory distress in the newborn period with irregular respiration .
respiratory distress due to phrenic nerve damage leading to paralysis of the ipsilateral diaphragm may require continuous positive airway pressure or mechanical ventilation and if unresponsive , surgical plication of diaphragm .
herein , we report a case of phrenic nerve palsy in a newborn presenting with respiratory distress . | Introduction
Case Report
Discussion |
ten subjects with type 2 diabetes and 10 age - matched healthy control subjects participated , all fully informed of the risks and discomforts associated with the experiments . the ethics committee for the copenhagen county approved the study .
patients were recruited from steno diabetes center , an outpatient clinic specialized in treating patients with a history of poor glucose control or diabetes complications ; subject characteristics are provided in table 1 .
the patients continued their usual medication because antidiabetic , antihypertensive , and lipid - lowering drugs exhibit long - term effects without acute affection of cardiovascular regulation . only insulin ( four participants )
patients with nephropathy or history of angina , acute myocardial infarction , or claudication were excluded .
demographic data for diabetic subjects ( n = 10 ) and control subjects ( n = 10 ) data are presented as means se , with the exception of years of diabetes ( median value ) .
p - glucose sampled at the beginning of the first intervention because study participants were not fasting .
all participants with diabetes were treated with lipid - lowering medication ; one participant was only treated with sulfonyl , nine participants were treated with metformin ( in combination with sulfonyl in four of these ) . all male patients received antihypertensive treatment with ace inhibitors or at - ii antagonist ( in combination with thiazide in three of these and with addition of ca - antagonist in one of these ) . none of the control subjects received medication . as a marker of muscle endothelial function ,
ach , acetylcholine ; ado , adenosine ; dm , diabetes mellitus ; ex , exercise ; tyr , tyramine . * different from the previous intervention .
control subjects were recruited through advertising in local newspapers , had no history of impaired glucose tolerance , and received no medications . on the day of the experiment
bmi and leg mass were calculated from whole - body dual energy x - ray absorptiometry scanning ( ge medical systems , fairfield , ct ) . with the participant resting in a supine position ,
three catheters were placed under local anesthesia in the femoral artery and vein of the right leg and in the femoral artery of the left leg using the seldinger technique .
the participants underwent the following protocol : a pretest in which the individual target lbf was determined during 2 min of knee - extensor exercise at 15 w ( 11 ) .
lbf was increased in a dose - response manner by infusion of adenosine or atp until lbf matched that obtained during the pre - exercise test .
adenosine ( 18.7 mol / ml ; item development ab , stockholm , sweden ) was infused at rates of 0.8 in control subjects and 1.1 mol / min in patients ( p = 0.38 ) , whereas atp ( 1 mol / ml , sigma a7699 ; sigma - aldrich co. , st .
louis , mo ) was infused at rates of 0.8 and 0.9 mol / min in control subjects and patients ( p = 0.62 ) , respectively , to increase blood flow to target lbf ( 2.8 l / min ) .
this amount of infused atp , sufficient to increase plasma content by an estimated 500 nmol , is within physiologic range ( 12 ) .
the vasoconstrictor effect of tyramine ( 5.9 mol / ml , sigma t-2879 ; sigma - aldrich co. ) , which evokes endogenous noradrenaline ( na ) release from sympathetic nerve endings and subsequent postjunctional -adrenergic vasoconstriction , was examined during adenosine ( control ) , atp , and exercise - induced hyperemia ; the latter two were randomized ( 13 ) .
tyramine was coinfused during adenosine at rates of 5.4 and 7.4 mol / min in control subjects and patients , respectively ( p = 0.12 ) , to reduce lbf by 50% without affecting arterial blood pressure ( 6 ) .
the individual infusion rate of tyramine , resulting in 50% reduction of lbf during adenosine , was used in the following tyramine trials .
lbf was calculated from measurements of diameter and blood velocity using the doppler ultrasound method : probe 8c ( vivid 7 ; ge healthcare , little chalfont , buckinghamshire , u.k . ) ( 10,14 ) .
lbf represents the average of three measurements obtained at baseline , 4 min after the start of exercise , or 4 min after reaching steady state under infusion of atp , adenosine , or coinfusion of tyramine .
pressure transducers ( pressure monitoring kit ; baxter , deerfield , il ) monitored mean arterial pressure ( map ) ; heart rate was determined from an electrocardiogram , with all data continuously recorded using a powerlab system ( adinstruments , sydney , australia ) .
-values of all hemodynamic variables were calculated as the difference between baselines immediately before the intervention and steady state during the intervention and analyzed by two - way anova repeated measurements with nucleotides as within - subject factors and control / type 2 diabetes as between - subject factors .
the vasodilatory potency of adenosine and atp was similar in control subjects and patients ( 309 54 vs. 250 81 ml/mol atpkg [ p = 0.48 ] and 13.3 1.7 vs. 12.5 4 ml/mol adenosinekg [ p = 0.38 ] ) . during adenosine and atp infusions ,
lbf increased ninefold in both control subjects and patients to similar levels as during the exercise intervention ( 2.7 0.2 l / min , fig .
tyramine infusion reduced lbf during coinfusion with adenosine from 2.6 0.2 to 1.4 0.1 l / min , whereas infusion of the same amount of tyramine during exercise did not reduce lbf in either group ( 2.6 0.25 l / min ) .
coinfusion with tyramine during atp infusion reduced lbf ( from 2.9 0.2 to 2.0 0.2 l / min in control subjects and from 2.7 0.3 to 2.2 0.2 l / min in patients ; p = 0.55 for control subjects vs. patients ) ( fig .
leg vascular conductance ( lvc ) increased similarly from baseline values of 3 0.4 to 27 2 ml / minmmhg during adenosine and 30 4 ml / minmmhg during atp and decreased similarly during coinfusion of tyramine ( 12 2 during adenosine and 22 3 ml / minmmhg during atp ) . during exercise , lvc increased in both groups to 21 4 ml / minmmhg and was not affected by tyramine coinfusion .
map at baseline was slightly higher in the control group , yet not significant and potentially reflecting antihypertensive treatment in the group with diabetes .
map increased from baseline ( 101 4 in control subjects vs. 94 4 mmhg in patients ) to similar values during exercise , 120 4 mmhg in both groups . during adenosine infusion , map was unaltered , but during coinfusion with tyramine , map increased in both groups to 107 3 mmhg .
atp infusion lowered map to 94 3 in control subjects and 86 4 mmhg in patients .
although coinfusion of atp and tyramine did not affect map in control subjects ( 95 4 mmhg ) , map increased ( to 94 4 mmhg ) in patients ( p < 0.05 ) .
the arteriovenous differences of o2 content did not differ at baseline ( 92 7 in control subjects vs. 77 9 ml / l in patients , p = 0.24 ) or during the different interventions . during exercise ,
the arteriovenous difference increased similarly ( 130 6 ml / l ) and coinfusion with tyramine did not alter the values . reflecting the alterations in lbf , with combined infusion of adenosine and tyramine , leg arteriovenous o2 difference increased from 11
2 ml / l with adenosine infusion to 19 3 ml / l with combined adenosine and tyramine and from 14 3 to 18 4 ml / l during atp and atp - tyramine infusion , respectively , with no differences in the groups .
o2 delivery was proportional to lbf , and a small difference in baseline lbf was reflected in a baseline difference of o2 delivery ( p = 0.14 ) . however , there were no differences in o2 delivery or uptake during the infusions of adenosine , atp , exercise , or coinfusion of tyramine .
heart rate at baseline tended to be higher in patients ( 68 4 in control subjects vs. 79 4 bpm in patients , p = 0.06 ) , but during the interventions , values were similar .
in addition , cardiac output differed at baseline ( 4.0 0.4 in control subjects vs. 6.0 0.5 l / min in patients , p = 0.005 ) , but during atp infusion and exercise , values were similar .
in contrast , cardiac output increased more in the group with diabetes during adenosine infusion , both with and without tyramine , p = 0.03 ( control subjects vs. patients , both adenosine and coinfusion of adenosine and tyramine ) . at baseline ,
femoral venous na was different ( 2.6 0.2 in control subjects vs. 1.8 0.2 nmol / l in patients , p = 0.001 ) , but na increased similarly during exercise ( 1.3 0.5 nmol / l , p = 0.98 , fig .
the increases during tyramine coinfusion also were similar in the two groups ( 2.2 0.4 for adenosine , 1.5 0.3 for atp , and 3.2 0.5 nmol / l during exercise p = 0.4 to 0.6 ) , as were the increases in venous na adjusted for the individual infusion rates of tyramine ( 0.38 0.08 during adenosine infusion , 0.25 0.04 during atp infusion , and 0.56 0.11
nmol / l during exercise per micromole of tyramine ) . during adenosine infusions , venous
na did not change in the two groups , whereas during atp infusion , na increased in the control group ( p = 0.003 ) .
this difference was also reflected during combined atp and tyramine infusions , where venous na in the group with diabetes tended to be lower compared with adenosine ( p = 0.053 ) .
the flow reduction per micromole of tyramine was similar in the two groups ( 245 40 ml/mol tyramine ) , whereas during atp infusion , the sensitivity to tyramine in terms of flow reduction was lower in the group with diabetes ( 182 27 vs. 92 34 ml/mol tyramine , p = 0.042 ) .
the vasodilatory potency of adenosine and atp was similar in control subjects and patients ( 309 54 vs. 250 81 ml/mol atpkg [ p = 0.48 ] and 13.3 1.7 vs. 12.5 4 ml/mol adenosinekg [ p = 0.38 ] ) . during adenosine and atp infusions ,
lbf increased ninefold in both control subjects and patients to similar levels as during the exercise intervention ( 2.7 0.2 l / min , fig .
tyramine infusion reduced lbf during coinfusion with adenosine from 2.6 0.2 to 1.4 0.1 l / min , whereas infusion of the same amount of tyramine during exercise did not reduce lbf in either group ( 2.6 0.25 l / min ) .
coinfusion with tyramine during atp infusion reduced lbf ( from 2.9 0.2 to 2.0 0.2 l / min in control subjects and from 2.7 0.3 to 2.2 0.2 l / min in patients ; p = 0.55 for control subjects vs. patients ) ( fig .
leg vascular conductance ( lvc ) increased similarly from baseline values of 3 0.4 to 27 2 ml / minmmhg during adenosine and 30 4 ml / minmmhg during atp and decreased similarly during coinfusion of tyramine ( 12 2 during adenosine and 22 3 ml / minmmhg during atp ) . during exercise , lvc increased in both groups to 21 4 ml / minmmhg and was not affected by tyramine coinfusion .
map at baseline was slightly higher in the control group , yet not significant and potentially reflecting antihypertensive treatment in the group with diabetes .
map increased from baseline ( 101 4 in control subjects vs. 94 4 mmhg in patients ) to similar values during exercise , 120 4 mmhg in both groups . during adenosine infusion , map was unaltered , but during coinfusion with tyramine , map increased in both groups to 107 3 mmhg .
atp infusion lowered map to 94 3 in control subjects and 86 4 mmhg in patients .
although coinfusion of atp and tyramine did not affect map in control subjects ( 95 4 mmhg ) , map increased ( to 94 4 mmhg ) in patients ( p < 0.05 ) .
the arteriovenous differences of o2 content did not differ at baseline ( 92 7 in control subjects vs. 77 9 ml / l in patients , p = 0.24 ) or during the different interventions . during exercise ,
the arteriovenous difference increased similarly ( 130 6 ml / l ) and coinfusion with tyramine did not alter the values . reflecting the alterations in lbf , with combined infusion of adenosine and tyramine , leg arteriovenous o2 difference increased from 11
2 ml / l with adenosine infusion to 19 3 ml / l with combined adenosine and tyramine and from 14 3 to 18 4 ml / l during atp and atp - tyramine infusion , respectively , with no differences in the groups .
o2 delivery was proportional to lbf , and a small difference in baseline lbf was reflected in a baseline difference of o2 delivery ( p = 0.14 ) . however , there were no differences in o2 delivery or uptake during the infusions of adenosine , atp , exercise , or coinfusion of tyramine .
heart rate at baseline tended to be higher in patients ( 68 4 in control subjects vs. 79 4 bpm in patients , p = 0.06 ) , but during the interventions , values were similar .
in addition , cardiac output differed at baseline ( 4.0 0.4 in control subjects vs. 6.0 0.5 l / min in patients , p = 0.005 ) , but during atp infusion and exercise , values were similar .
in contrast , cardiac output increased more in the group with diabetes during adenosine infusion , both with and without tyramine , p = 0.03 ( control subjects vs. patients , both adenosine and coinfusion of adenosine and tyramine ) .
at baseline , femoral venous na was different ( 2.6 0.2 in control subjects vs. 1.8 0.2 nmol / l in patients , p = 0.001 ) , but na increased similarly during exercise ( 1.3 0.5 nmol / l , p = 0.98 , fig .
the increases during tyramine coinfusion also were similar in the two groups ( 2.2 0.4 for adenosine , 1.5 0.3 for atp , and 3.2 0.5 nmol / l during exercise p = 0.4 to 0.6 ) , as were the increases in venous na adjusted for the individual infusion rates of tyramine ( 0.38 0.08 during adenosine infusion , 0.25 0.04 during atp infusion , and 0.56 0.11
nmol / l during exercise per micromole of tyramine ) . during adenosine infusions , venous
na did not change in the two groups , whereas during atp infusion , na increased in the control group ( p = 0.003 ) .
this difference was also reflected during combined atp and tyramine infusions , where venous na in the group with diabetes tended to be lower compared with adenosine ( p = 0.053 ) .
the flow reduction per micromole of tyramine was similar in the two groups ( 245 40 ml/mol tyramine ) , whereas during atp infusion , the sensitivity to tyramine in terms of flow reduction was lower in the group with diabetes ( 182 27 vs. 92 34 ml/mol tyramine , p = 0.042 ) .
the main findings of the current study are that patients with type 2 diabetes and intact endothelial function have a similar capacity to blunt sympathetic vasoconstriction during moderate exercise as healthy age- and bmi - matched control subjects . however , both groups were only partially capable of blunting -adrenergic vasoconstriction during atp - induced hyperemia .
in addition , the vasodilatory potency of adenosine and atp did not differ between patients and control subjects . finally , the subjects with diabetes had a lower venous content of na but a similar elevation of venous na during the adenosine infusions , exercise , and tyramine interventions .
consistent with a study on young healthy subjects ( 6 ) , exercise fully blunted sympathetic vasoconstriction in both groups , indicating that the ability of functional sympatholysis during moderate exercise was not reduced in the group with diabetes .
this may be clinically relevant given that pathology , affecting the vasodilatory function , could be expected to limit skeletal muscle blood flow because of enhanced sympathetic vasoconstriction in the active muscles , thereby potentially reducing exercise capacity .
a study on elderly healthy humans ( > 65 years ) demonstrated that aging is associated with a greater vasoconstrictor tone in active muscles during exercise compared with young adults ( 15 ) .
the magnitude of functional sympatholysis was significantly lower in older persons compared with young persons in the presence of tyramine , leading the authors to conclude that aging is associated with impaired functional sympatholysis in the vascular beds of contracting forearm muscle .
the present finding of intact functional sympatholysis in middle - aged healthy subjects and patients with diabetes could demonstrate that the phenomenon may be age - dependent ; however , limb differences should also be kept in mind ( 16 ) .
moreover , a component of systemic limitation to peripheral blood flow during exercise may explain the observed low blood flows in some studies of patients with type 2 diabetes ; the knee - extensor model eliminates this risk and therefore allows studies of the local microcirculation and may not be translated to all skeletal muscles or applied to high - intensity exercise with a large muscle mass but is likely to represent the leg muscles , which accounts for the largest part of vascular resistance in the body and is of particular interest because insulin resistance is primarily present in leg muscles ( 17 ) . in young subjects ,
luminal atp was shown to abolish tyramine - induced sympathetic vasoconstriction , indicating that atp is contributing to functional sympatholysis via activation of the p2y2 receptor ( 6 ) .
in contrast with this finding , both groups in the current study had a reduction in lbf during combined atp and tyramine infusion .
the sympatholytic effect of atp is graded and dose - dependent ; during very modest atp infusions , atp had no sympatholytic effect ( 18 ) .
however , the present infusion rates of atp increased lbf ninefold , most likely increasing arterial atp to levels sufficient to limit -adrenergic vasoconstriction in young subjects . therefore , the sympatholytic effect of atp may be affected by age .
the amount of tyramine leading to 50% reduction in lvc and lbf during adenosine infusion resulted in a 30% reduction during atp ; thus , atp has a role in functional sympatholysis in the elderly , but other factors must be of importance to offset sympathetic vasoconstriction , because there were no changes in lvc or lbf during exercise with coinfusion of tyramine .
functional sympatholysis in middle - aged persons could gradually be more dependent on factors other than atp , such as katp channel activation , which opposes -adrenergic vasoconstriction during muscle contraction ( 19 ) .
regardless of the compounds responsible for functional sympatholysis , endothelial function also could be of importance .
the present findings do not exclude that endothelial dysfunction affects the ability of sympatholysis during exercise .
the amount of atp and adenosine needed to increase lbf to levels matching exercise was similar in the two groups .
in contrast , in a previous study on patients with diabetes and age - matched control subjects , we found a 50% reduction in the lbf response to atp and adenosine in the group with diabetes ( 10 ) .
the lbf response in control groups was identical , whereas the response in the present group with diabetes was higher in regard to both atp and adenosine .
when comparing the two groups of patients with diabetes , there were no differences in demographic variables or medication . only the lbf response to acetylcholine infusion was significantly different , indicating that the reduction in effect of purinergic agonist may be proportional to the extent of endothelial dysfunction .
a comparison of data from our two studies of middle - aged subjects , both control subjects and patients with diabetes , and previous studies of young subjects ( 20,21 ) demonstrates a decline in lbf response to adenosine in particular , which was reduced fourfold . in regard to atp , there was a clear decline in sensitivity only in the group with more developed endothelial dysfunction .
still , it is a possibility that the response to atp also is diminished in an elderly population , possibly to a minor extent , because the dose - response in young healthy subjects may not be linear for the dose interval under study , hampering data extrapolation and direct comparison ( 6 ) .
the decline in lbf responses to atp and adenosine may reflect age - related changes of the signaling pathways ( 20,21 ) .
however , physical inactivity and obesity also affect endothelial function and cardiovascular regulation and should be of note , because both groups in the current study had moderately elevated bmi and the majority of the subjects had a sedentary lifestyle .
the interpretation of plasma levels of na and its correlation to sympathetic activity is complex ; plasma na elevation may not be a precise measure of the effect on msna but merely a reflection of direction of change .
it should be noted that during infusion with adenosine alone , there was no increase in venous na , despite a ninefold increase in lbf , indicating that the increase in na was indeed due to tyramine infusion and not to hyperemia .
-values of venous na between the two groups were similar during all three tyramine interventions .
furthermore , during moderate exercise , both with and without tyramine , the venous na increase in the groups was similar and additive , indicating that the stimulus of exercise to the sympathetic system also may have been uniform .
these findings are consistent with previous studies in young subjects , showing that na spillover is a function of active muscle mass and exercise intensity ( 22 ) . in young subjects ( 6 ) , plasma na increased from 1.7 nmol l at baseline to 3 nmol l during tyramine infusions with comparable infusion rates , thus lower than in the present middle - aged control subjects .
however , the levels of na in the present group of patients with diabetes were similar to those of young subjects . despite increases in sympathetic nerve activity in patients with diabetes
, plasma na level has been found to be reduced compared with control subjects ( 23 ) . therefore , it is of interest to investigate whether the presented differences are a result of antidiabetic treatment or a physiologic response to elevation in sympathetic nerve activity , leading to enhanced reuptake and thus a reduced spillover .
circulating atp mimics exercise hyperemia by its vasodilatory potency and by increasing msna and circulating na ( 6 ) .
measurements of interstitial na in skeletal muscle during atp infusion with the microdialysis technique showed a dose - dependent increase in interstitial na , whereas interstitial na increased to a larger extent during exercise , despite similar lbf , consistent with the results in the present control group ( 24 )
. the lack of increase in venous na during atp infusion in the group with diabetes may be to the result of an impaired baroreceptor function ( 25 ) or altered function of the atp inducement of na exocytosis because the changes in map during atp infusions were similar in the two groups .
-values of venous na during tyramine infusion and the changes in lvc were proportional and similar in the two groups , suggesting that the subjects with diabetes were equally sensitive to na as the control subjects .
therefore , the present measurements of venous na may reflect interstitial conditions , and the preserved functional sympatholysis in the group with diabetes could be partly attributed to a reduced level of na , perhaps in combination with or attributed to a reduction in atp - induced sympathetic activity .
the primary limitation is that no truly selective human antagonists and ligands of p2 receptors are currently available , which hinders confirmatory studies of the role of the purinergic system .
power calculations ahead were impeded because the current study is the first to investigate this particular area in patients with diabetes . in our previous study on 10 control subjects and 10 patients with diabetes and endothelial dysfunction , we demonstrated clear and significant differences in the relevant variables ( 10 ) .
however , patients with type 2 diabetes are a heterogenic group , and sample size for the current study does not necessarily reflect such heterogeneity .
antidiabetic and antihypertensive treatment has been shown to improve endothelial function through several pathways , and studies of patients with diabetes have been carried out primarily during withdrawal of medications ; however , in most studies analyzing risk profiles of different chronic diseases , the patients are usually taking medication .
it may be more accurate to investigate patients in their normal functional status if the drugs do not affect the measurements directly , because little is known of the time course after withdrawal .
consistent with a study on young healthy subjects ( 6 ) , exercise fully blunted sympathetic vasoconstriction in both groups , indicating that the ability of functional sympatholysis during moderate exercise was not reduced in the group with diabetes .
this may be clinically relevant given that pathology , affecting the vasodilatory function , could be expected to limit skeletal muscle blood flow because of enhanced sympathetic vasoconstriction in the active muscles , thereby potentially reducing exercise capacity .
a study on elderly healthy humans ( > 65 years ) demonstrated that aging is associated with a greater vasoconstrictor tone in active muscles during exercise compared with young adults ( 15 ) .
the magnitude of functional sympatholysis was significantly lower in older persons compared with young persons in the presence of tyramine , leading the authors to conclude that aging is associated with impaired functional sympatholysis in the vascular beds of contracting forearm muscle .
the present finding of intact functional sympatholysis in middle - aged healthy subjects and patients with diabetes could demonstrate that the phenomenon may be age - dependent ; however , limb differences should also be kept in mind ( 16 ) .
moreover , a component of systemic limitation to peripheral blood flow during exercise may explain the observed low blood flows in some studies of patients with type 2 diabetes ; the knee - extensor model eliminates this risk and therefore allows studies of the local microcirculation and may not be translated to all skeletal muscles or applied to high - intensity exercise with a large muscle mass but is likely to represent the leg muscles , which accounts for the largest part of vascular resistance in the body and is of particular interest because insulin resistance is primarily present in leg muscles ( 17 ) . in young subjects ,
luminal atp was shown to abolish tyramine - induced sympathetic vasoconstriction , indicating that atp is contributing to functional sympatholysis via activation of the p2y2 receptor ( 6 ) .
in contrast with this finding , both groups in the current study had a reduction in lbf during combined atp and tyramine infusion .
the sympatholytic effect of atp is graded and dose - dependent ; during very modest atp infusions , atp had no sympatholytic effect ( 18 ) .
however , the present infusion rates of atp increased lbf ninefold , most likely increasing arterial atp to levels sufficient to limit -adrenergic vasoconstriction in young subjects . therefore , the sympatholytic effect of atp may be affected by age .
the amount of tyramine leading to 50% reduction in lvc and lbf during adenosine infusion resulted in a 30% reduction during atp ; thus , atp has a role in functional sympatholysis in the elderly , but other factors must be of importance to offset sympathetic vasoconstriction , because there were no changes in lvc or lbf during exercise with coinfusion of tyramine .
functional sympatholysis in middle - aged persons could gradually be more dependent on factors other than atp , such as katp channel activation , which opposes -adrenergic vasoconstriction during muscle contraction ( 19 ) .
regardless of the compounds responsible for functional sympatholysis , endothelial function also could be of importance .
the present findings do not exclude that endothelial dysfunction affects the ability of sympatholysis during exercise .
the amount of atp and adenosine needed to increase lbf to levels matching exercise was similar in the two groups .
in contrast , in a previous study on patients with diabetes and age - matched control subjects , we found a 50% reduction in the lbf response to atp and adenosine in the group with diabetes ( 10 ) .
the lbf response in control groups was identical , whereas the response in the present group with diabetes was higher in regard to both atp and adenosine . when comparing the two groups of patients with diabetes , there were no differences in demographic variables or medication . only the lbf response to acetylcholine infusion was significantly different , indicating that the reduction in effect of purinergic agonist may be proportional to the extent of endothelial dysfunction .
a comparison of data from our two studies of middle - aged subjects , both control subjects and patients with diabetes , and previous studies of young subjects ( 20,21 ) demonstrates a decline in lbf response to adenosine in particular , which was reduced fourfold . in regard to atp
, there was a clear decline in sensitivity only in the group with more developed endothelial dysfunction .
still , it is a possibility that the response to atp also is diminished in an elderly population , possibly to a minor extent , because the dose - response in young healthy subjects may not be linear for the dose interval under study , hampering data extrapolation and direct comparison ( 6 ) .
the decline in lbf responses to atp and adenosine may reflect age - related changes of the signaling pathways ( 20,21 ) .
however , physical inactivity and obesity also affect endothelial function and cardiovascular regulation and should be of note , because both groups in the current study had moderately elevated bmi and the majority of the subjects had a sedentary lifestyle .
the interpretation of plasma levels of na and its correlation to sympathetic activity is complex ; plasma na elevation may not be a precise measure of the effect on msna but merely a reflection of direction of change .
it should be noted that during infusion with adenosine alone , there was no increase in venous na , despite a ninefold increase in lbf , indicating that the increase in na was indeed due to tyramine infusion and not to hyperemia .
-values of venous na between the two groups were similar during all three tyramine interventions .
furthermore , during moderate exercise , both with and without tyramine , the venous na increase in the groups was similar and additive , indicating that the stimulus of exercise to the sympathetic system also may have been uniform .
these findings are consistent with previous studies in young subjects , showing that na spillover is a function of active muscle mass and exercise intensity ( 22 ) . in young subjects ( 6 ) , plasma na increased from 1.7 nmol l at baseline to 3 nmol l during tyramine infusions with comparable infusion rates , thus lower than in the present middle - aged control subjects .
however , the levels of na in the present group of patients with diabetes were similar to those of young subjects . despite increases in sympathetic nerve activity in patients with diabetes
, plasma na level has been found to be reduced compared with control subjects ( 23 ) .
therefore , it is of interest to investigate whether the presented differences are a result of antidiabetic treatment or a physiologic response to elevation in sympathetic nerve activity , leading to enhanced reuptake and thus a reduced spillover .
circulating atp mimics exercise hyperemia by its vasodilatory potency and by increasing msna and circulating na ( 6 ) .
measurements of interstitial na in skeletal muscle during atp infusion with the microdialysis technique showed a dose - dependent increase in interstitial na , whereas interstitial na increased to a larger extent during exercise , despite similar lbf , consistent with the results in the present control group ( 24 )
. the lack of increase in venous na during atp infusion in the group with diabetes may be to the result of an impaired baroreceptor function ( 25 ) or altered function of the atp inducement of na exocytosis because the changes in map during atp infusions were similar in the two groups .
-values of venous na during tyramine infusion and the changes in lvc were proportional and similar in the two groups , suggesting that the subjects with diabetes were equally sensitive to na as the control subjects .
therefore , the present measurements of venous na may reflect interstitial conditions , and the preserved functional sympatholysis in the group with diabetes could be partly attributed to a reduced level of na , perhaps in combination with or attributed to a reduction in atp - induced sympathetic activity .
the primary limitation is that no truly selective human antagonists and ligands of p2 receptors are currently available , which hinders confirmatory studies of the role of the purinergic system .
power calculations ahead were impeded because the current study is the first to investigate this particular area in patients with diabetes . in our previous study on 10 control subjects and 10 patients with diabetes and endothelial dysfunction , we demonstrated clear and significant differences in the relevant variables ( 10 ) .
however , patients with type 2 diabetes are a heterogenic group , and sample size for the current study does not necessarily reflect such heterogeneity .
antidiabetic and antihypertensive treatment has been shown to improve endothelial function through several pathways , and studies of patients with diabetes have been carried out primarily during withdrawal of medications ; however , in most studies analyzing risk profiles of different chronic diseases , the patients are usually taking medication .
it may be more accurate to investigate patients in their normal functional status if the drugs do not affect the measurements directly , because little is known of the time course after withdrawal .
patients with well - diagnosed type 2 diabetes and only minor or no endothelial affection have an intact capacity of functional sympatholysis during moderate exercise . however
, both the patients and the aging control subjects have a lower sympatholytic effect of atp . because this does not compromise functional sympatholysis , atp is not mandatory for an adequate hyperemic response during exercise .
the lbf response to atp and adenosine was similar in the two groups ; thus , purinergic - induced lbf may not be affected by diabetes per se ; attenuation of purinergic vasodilation in patients with diabetes could be a result of endothelial dysfunction .
when comparing the present findings with those of young subjects , the vasodilatory potency of adenosine in particular may be markedly reduced by aging and further aggravated with diabetes , in correlation to the grade of endothelial affection . | objectivesympathetic vasoconstriction is blunted in contracting human skeletal muscles ( functional sympatholysis ) . in young subjects ,
infusion of adenosine and atp increases blood flow , and the latter compound also attenuates -adrenergic vasoconstriction . in patients with type 2 diabetes and age - matched healthy subjects ,
we tested 1 ) the sympatholytic capacity during one - legged exercise , 2 ) the vasodilatory capacity of adenosine and atp , and 3 ) the ability to blunt -adrenergic vasoconstriction during atp infusion.research design and methodsin 10 control subjects and 10 patients with diabetes and normal endothelial function , determined by leg blood flow ( lbf ) response to acetylcholine infusion , we measured lbf and venous na , with and without tyramine - induced sympathetic vasoconstriction , during adenosine- , atp- , and exercise - induced hyperemia.resultslbf during acetylcholine did not differ significantly .
lbf increased ninefold during exercise and during adenosine- and atp - induced hyperemia .
infusion of tyramine during exercise did not reduce lbf in either the control or the patient group . during combined atp and tyramine infusions ,
lbf decreased by 30% in both groups .
adenosine had no sympatholytic effect.conclusionsin patients with type 2 diabetes and normal endothelial function , functional sympatholysis was intact during moderate exercise .
the vasodilatory response for adenosine and atp did not differ between the patients with diabetes and the control subjects ; however , the vasodilatory effect of adenosine and atp and the sympatholytic effect of atp seem to decline with age . | RESEARCH DESIGN AND METHODS
RESULTS
Hemodynamic variables
Venous NA
CONCLUSIONS
Functional sympatholysis and sympatholytic effect of ATP
Vasodilatory action of adenosine and ATP
Venous NA and sensitivity
Limitations
CONCLUSIONS |
this experiment was conducted at the norwegian university of life sciences . according to the norwegian regulation relating experiments in animals ( 1996 - 01 - 15 no.23 ) , approval was not needed since the normal physiology of the horses was not affected during the experimental execution . however , the permanent caecum cannulation of the horses ( four geldings of norwegian cold - blooded trotter ; age 414 years ; bw 5388 kg ) has previously been approved by norwegian animal research authority ( nara ) according to the norwegian regulation relating experiments in animals ( 1996 - 01 - 15 no.23 ) .
the horses were stabled in individual boxes ( 33 m ) bedded with wood shavings .
water was offered ad libitum from automatic bowls with individual flow meters ( gregen spx axflow ) .
water intake , body weight , and rectal temperatures were recorded each morning . during the adaptation periods ,
all horses were daily exercised in an outdoor rotary exerciser ( kondi - trainer , jnck maschinenbau , borken , germany ) for 40 minutes at speeds varying in intervals from 2 m / s ( walk ) to 6 m / s ( trot ) . during the periods of data collection
, the horses were daily exercised in the evening on a high - speed treadmill ( haico , loimaa , finland ) after having finished the caecal sampling .
the treadmill was inclined to 3% and speed varied in intervals from 1.8 m / s ( walk ) to 4.2 m / s ( fast trot ) .
the geldings were fed either hay or a mixture of hay and whole oats to meet the daily energy requirements in a crossover design of two consecutive 21-day experimental periods that included an adaptation period of 17 days to each diet .
the chemical composition of the timothy hay and whole oats used in the present experiment is presented in table 1 .
the total daily rations were ( h ) : 14.5 kg timothy hay , or ( o ) : 6 kg timothy hay and 4.3 kg whole oats . the horses were fed at 06:00 , 16:00 , and 22:00 hours , and the morning meal consisted of ( h ) : 4.5 kg timothy hay ( equivalent to 0.15 g starch / kg bw ) , and ( o ) : 2 kg timothy hay and 2 kg whole oats ( equivalent to 1.68 g starch / kg bw ) .
thus , the morning meal of the h diet consisted of 81 g starch and 1,607 g neutral detergent fibre ( ndf ) , whereas the morning meal of the o diet provided 904 g starch and 1,204 g ndf . at 16:00
the meals were ( h ) : 5.0 kg timothy hay , and ( o ) : 2.0 kg timothy hay and 1.2 kg whole oats .
similarly , at 22:00 the meals were ( h ) : 5.0 kg timothy hay , and ( o ) : 2.0 kg timothy hay and 1.1 kg whole oats .
chemical composition of the dietary components caecal fluid was collected 0 , 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , and 9 hours after the morning feeding .
each time series ( 10 samples ) were collected from each horse in two repetitions on days 18 and 20 for both the first and second experimental period .
caecal samples for microbiota analyses were immediately conserved in ethanol ( diluted 1:4 in ethanol ) and stored at 20c until extraction of dna . samples for nh3 and vfa analyses ( 9 ml ) were immediately conserved in 1ml 12 m formic acid and stored at 4c until analysis ( fig .
the first time series from horse 1 fed the hay diet is suspected to be biased due to oxygen leakage through the silicone rubber plug that was sealing the caecal cannula ; thus , these results were excluded from statistical analyses and results shown in figs . 2 and 4 .
ph was measured directly in the caecum with a ph meter ( wtw , ph 340i ) attached to the horse with recordings taken every minute for 9 hours post - feeding .
the ph electrode ( hamilton , polyplast din 60 , bonaduz , cr , switzerland ) was inserted into the caecum lumen through the cannula .
chemical composition of hay and oats ( table 1 ) was determined using standard methods for the european community ; dry matter ( 71/393/eec ) , ash ( 71/250/eec ) , and crude protein ( kjeldahl - n x 6.25 ; 93/28/eec ) .
crude lipid was determined by extraction with petroleum ether in an accelerated solvent extractor from dionex ( ase200 ; sunnyvale , ca , usa ) .
all caecal samples were analysed for individual vfas by gas chromatography using the perkinelmer autosystem ( perkinelmer inc . ,
norwalk , ct , usa ) with a restek stabilwax column ( restek , bellefonte , pa , usa ) and nh3n by flow injection - analysis ( 15 ) based on tecator - method no .
template dna was prepared from ethanol - conserved caecal fluid ( 2ml ) followed by centrifugation at 13,000 rpm for 10 minutes at 8c .
the supernatant was removed , and the pellet resuspended in 2ml of solution 1 ( 50 mm glucose , 25 mm tris - hcl ph 8.0 , and 10 mm edta ph 8.0 ) .
next , 200 l of the caecal fluid - suspension was diluted 1:4 in 4 m guanidinium thiocyanate ( gtc ) , and 500 l were transferred to a fastprep tube ( qbiogene inc . ,
carlsbad , ca , usa ) containing 250 mg glass beads ( > 106 microns , sigma - aldrich , steinheim , germany ) .
the samples were homogenised for 40 seconds in the fastprep instrument ( qbiogene inc . ) before automatic dna extraction .
dna isolation and purification were performed using an automated procedure with silica particles ( bioclone inc .
, san diego , ca , usa ) as described earlier by sknseng et al .
primers used in the 16s rna gene amplification reactions were forward primer 5-tcctacgggaggcagcagt-3 ( tm , 59.4c ) and reverse primer 5-ggactaccagggtatctaatcctgtt-3 ( tm , 58,1c ) ( 17 ) . the polymerase chain reaction ( pcr )
mixture contained 0.2 m of each primer , 1 u dynazyme ii hot start dna polymerase , 1x hot start buffer , 200 m dntp mix , and 5.0 l dna in a 25 l pcr reaction .
the amplification profile consisted of an initial step of 94c for 10 minutes , followed by 30 cycles of 94c for 30 seconds , 60c for 30 seconds , and 72c for 30 seconds , and a final extension at 72c for 7 minutes . a universally conserved primer 5-gtgccagcmgccgcggta-3 ( 18 ) with c - tail extension ( u515fc30 ) consisting of 30 bases on the 5-end was used for sequencing of mixed pcr products without prior cloning of samples .
automatic capillary electrophoresis of the sequence products was performed using the instrument abi prism 3100 genetic analyzer according to the manufacturer 's instructions ( applied biosystems , foster city , ca , usa ) .
the mixed sequence spectra were resolved by multivariate curve resolution alternating least squares ( mcr - als ; the unscrambler x software v10.1 , camo software inc . , woodbridge township , nj , usa ) .
signature sequences obtained by direct sequencing and mcr - als were assigned to a hierarchical taxonomy using seq match in the ribosomal database project ii ( www.rdp.cme.msu.edu/ ) .
samples collected 0 , 4 , and 9 hours post - feeding were analysed by flx - pyrosequencing .
pyrosequencing was targeted to a variable region of v4 in 16s rdna ( 18 ) .
the primers used for pcr amplification were 5-actgggcgtaaagcg-3 and 5-ggattagataccctggta-3. their 5-ends were flanked by specific adaptors , 5 ccatctcatccctgcgtgtctccgactcag -3 ( forward ) and 5-cctatcccctgtgtgccttggcagtctcag-3 ( reverse ) .
the pcr products were titrated and pyrosequencing was performed with a genome junior sequencer system ( roche diagnostics , mannheim , germany ) by the microbial laboratory facility of nofima ( s , norway ) .
filtering analysis of sequencing data on each sample was conducted using otupipe available at the homepage of qiime .
otupipe is a pipeline script built using usearch ( high - throughput biological sequence analysis ) ( www.drive5.com/usearch/ ) to perform filtering of noisy sequences , chimera checking ( 19 ) , and otu picking ( qiime.org/tutorials ) .
the resolved mixed sequences for all the time - points were used for the temporal stability analyses .
1).1st=1variance+covariance
for the -diversity analyses , we used the pyrosequencing data due to the higher taxonomic resolution .
2 ) estimated at a 3% phylogenetic distance level.21-d=1-pi2
simpsons indexes were chosen as measurement for diversity , because it takes into account both the number of species present ( richness ) as well as the relative abundance of each species ( evenness ) ( 21 , 22 ) .
this experiment was conducted at the norwegian university of life sciences . according to the norwegian regulation relating experiments in animals ( 1996 - 01 - 15 no.23 ) , approval was not needed since the normal physiology of the horses was not affected during the experimental execution . however , the permanent caecum cannulation of the horses ( four geldings of norwegian cold - blooded trotter ; age 414 years ; bw 5388 kg ) has previously been approved by norwegian animal research authority ( nara ) according to the norwegian regulation relating experiments in animals ( 1996 - 01 - 15 no.23 ) .
the horses were stabled in individual boxes ( 33 m ) bedded with wood shavings .
water was offered ad libitum from automatic bowls with individual flow meters ( gregen spx axflow ) .
water intake , body weight , and rectal temperatures were recorded each morning . during the adaptation periods ,
all horses were daily exercised in an outdoor rotary exerciser ( kondi - trainer , jnck maschinenbau , borken , germany ) for 40 minutes at speeds varying in intervals from 2 m / s ( walk ) to 6 m / s ( trot ) . during the periods of data collection
, the horses were daily exercised in the evening on a high - speed treadmill ( haico , loimaa , finland ) after having finished the caecal sampling .
the treadmill was inclined to 3% and speed varied in intervals from 1.8 m / s ( walk ) to 4.2 m / s ( fast trot ) .
the geldings were fed either hay or a mixture of hay and whole oats to meet the daily energy requirements in a crossover design of two consecutive 21-day experimental periods that included an adaptation period of 17 days to each diet .
the chemical composition of the timothy hay and whole oats used in the present experiment is presented in table 1 .
the total daily rations were ( h ) : 14.5 kg timothy hay , or ( o ) : 6 kg timothy hay and 4.3 kg whole oats . the horses were fed at 06:00 , 16:00 , and 22:00 hours , and the morning meal consisted of ( h ) : 4.5 kg timothy hay ( equivalent to 0.15 g starch / kg bw ) , and ( o ) : 2 kg timothy hay and 2 kg whole oats ( equivalent to 1.68 g starch / kg bw ) .
thus , the morning meal of the h diet consisted of 81 g starch and 1,607 g neutral detergent fibre ( ndf ) , whereas the morning meal of the o diet provided 904 g starch and 1,204 g ndf . at 16:00
the meals were ( h ) : 5.0 kg timothy hay , and ( o ) : 2.0 kg timothy hay and 1.2 kg whole oats .
similarly , at 22:00 the meals were ( h ) : 5.0 kg timothy hay , and ( o ) : 2.0 kg timothy hay and 1.1 kg whole oats .
chemical composition of the dietary components caecal fluid was collected 0 , 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , and 9 hours after the morning feeding .
each time series ( 10 samples ) were collected from each horse in two repetitions on days 18 and 20 for both the first and second experimental period .
caecal samples for microbiota analyses were immediately conserved in ethanol ( diluted 1:4 in ethanol ) and stored at 20c until extraction of dna . samples for nh3 and vfa analyses ( 9 ml ) were immediately conserved in 1ml 12 m formic acid and stored at 4c until analysis ( fig .
the first time series from horse 1 fed the hay diet is suspected to be biased due to oxygen leakage through the silicone rubber plug that was sealing the caecal cannula ; thus , these results were excluded from statistical analyses and results shown in figs . 2 and 4 .
ph was measured directly in the caecum with a ph meter ( wtw , ph 340i ) attached to the horse with recordings taken every minute for 9 hours post - feeding .
the ph electrode ( hamilton , polyplast din 60 , bonaduz , cr , switzerland ) was inserted into the caecum lumen through the cannula .
chemical composition of hay and oats ( table 1 ) was determined using standard methods for the european community ; dry matter ( 71/393/eec ) , ash ( 71/250/eec ) , and crude protein ( kjeldahl - n x 6.25 ; 93/28/eec ) .
crude lipid was determined by extraction with petroleum ether in an accelerated solvent extractor from dionex ( ase200 ; sunnyvale , ca , usa ) .
all caecal samples were analysed for individual vfas by gas chromatography using the perkinelmer autosystem ( perkinelmer inc . ,
norwalk , ct , usa ) with a restek stabilwax column ( restek , bellefonte , pa , usa ) and nh3n by flow injection - analysis ( 15 ) based on tecator - method no .
template dna was prepared from ethanol - conserved caecal fluid ( 2ml ) followed by centrifugation at 13,000 rpm for 10 minutes at 8c . the supernatant was removed , and the pellet resuspended in 2ml of solution 1 ( 50 mm glucose , 25 mm tris - hcl ph 8.0 , and 10 mm edta ph 8.0 ) .
next , 200 l of the caecal fluid - suspension was diluted 1:4 in 4 m guanidinium thiocyanate ( gtc ) , and 500 l were transferred to a fastprep tube ( qbiogene inc . , carlsbad , ca , usa ) containing 250 mg glass beads ( > 106 microns , sigma - aldrich , steinheim , germany ) .
the samples were homogenised for 40 seconds in the fastprep instrument ( qbiogene inc . ) before automatic dna extraction .
dna isolation and purification were performed using an automated procedure with silica particles ( bioclone inc .
, san diego , ca , usa ) as described earlier by sknseng et al .
primers used in the 16s rna gene amplification reactions were forward primer 5-tcctacgggaggcagcagt-3 ( tm , 59.4c ) and reverse primer 5-ggactaccagggtatctaatcctgtt-3 ( tm , 58,1c ) ( 17 ) .
the polymerase chain reaction ( pcr ) mixture contained 0.2 m of each primer , 1 u dynazyme ii hot start dna polymerase , 1x hot start buffer , 200 m dntp mix , and 5.0 l dna in a 25 l pcr reaction .
the amplification profile consisted of an initial step of 94c for 10 minutes , followed by 30 cycles of 94c for 30 seconds , 60c for 30 seconds , and 72c for 30 seconds , and a final extension at 72c for 7 minutes . a universally conserved primer 5-gtgccagcmgccgcggta-3 ( 18 ) with c - tail extension ( u515fc30 ) consisting of 30 bases on the 5-end was used for sequencing of mixed pcr products without prior cloning of samples .
automatic capillary electrophoresis of the sequence products was performed using the instrument abi prism 3100 genetic analyzer according to the manufacturer 's instructions ( applied biosystems , foster city , ca , usa ) .
the mixed sequence spectra were resolved by multivariate curve resolution alternating least squares ( mcr - als ; the unscrambler x software v10.1 , camo software inc . , woodbridge township , nj , usa ) .
signature sequences obtained by direct sequencing and mcr - als were assigned to a hierarchical taxonomy using seq match in the ribosomal database project ii ( www.rdp.cme.msu.edu/ ) .
samples collected 0 , 4 , and 9 hours post - feeding were analysed by flx - pyrosequencing .
pyrosequencing was targeted to a variable region of v4 in 16s rdna ( 18 ) .
the primers used for pcr amplification were 5-actgggcgtaaagcg-3 and 5-ggattagataccctggta-3. their 5-ends were flanked by specific adaptors , 5 ccatctcatccctgcgtgtctccgactcag -3 ( forward ) and 5-cctatcccctgtgtgccttggcagtctcag-3 ( reverse ) .
the pcr products were titrated and pyrosequencing was performed with a genome junior sequencer system ( roche diagnostics , mannheim , germany ) by the microbial laboratory facility of nofima ( s , norway ) .
filtering analysis of sequencing data on each sample was conducted using otupipe available at the homepage of qiime .
otupipe is a pipeline script built using usearch ( high - throughput biological sequence analysis ) ( www.drive5.com/usearch/ ) to perform filtering of noisy sequences , chimera checking ( 19 ) , and otu picking ( qiime.org/tutorials ) .
the resolved mixed sequences for all the time - points were used for the temporal stability analyses .
1).1st=1variance+covariance
for the -diversity analyses , we used the pyrosequencing data due to the higher taxonomic resolution .
2 ) estimated at a 3% phylogenetic distance level.21-d=1-pi2
simpsons indexes were chosen as measurement for diversity , because it takes into account both the number of species present ( richness ) as well as the relative abundance of each species ( evenness ) ( 21 , 22 ) .
on average when horses were fed the oat diet , the caecal nh3n level was lower , the vfa level was higher , the acetate level was lower , and the propionate level was higher than in horses fed the hay diet ( fig .
the barplot is illustrating the mean difference between the two diets in nh3n , vfa , acetate , propionate , and butyrate .
mean difference values above the zero line imply a higher mean value in the hay - fed horses than in whole oats fed horses , whereas mean difference values under the zero line imply a lower mean value in the hay - fed horses than in whole oats
horses fed the oat diet showed a prominent postprandial increase in the caecal vfa concentration 4 hours post - feeding , while in horses fed the hay diet the postprandial caecal vfa profiles showed only minor fluctuations ( fig .
2 ) . the caecal nh3n concentration in horses fed the oat diet showed a decline 3 hours post - feeding , whereas the nh3n profiles in horses fed the hay diet were slightly increasing post - feeding ( fig .
, there was a constant postprandial decrease for the hay diet , while there was an absolute minimum at 3 hours post - feeding for the oat diet ( fig .
caecal measurements related to the oat diet are marked with , and caecal measurements related to a hay diet are marked with . each time point represents mean values .
a total of 79,160 sequences were generated from the pyrosequencing , from which 38,949 were removed , mainly due to short sequence length ( < 200 bp ) and mismatch in primer and barcode sequence .
after filtration , the average sequence length was 218 , and the number of sequences per sample ranged from 583 to 1,453 , with a mean value of 957 .
the main caecal bacterial families were : porphyromonadaceae ( overall mean abundance was 27% ) , prevotellaceae ( 9% ) , lachnospiraceae ( 7% ) , ruminococcaceae ( 7% ) , and verrucomicrobiaceae ( 7% ) .
at the phylum level , the most dominating phylums were bacteroides and firmicutes . overall abundance of bacteroides was 65% , while the average abundance of firmicutes was 20% .
the mean dietary effect on difference in abundances was calculated , and only otus with significant dietary effect are shown in fig .
3 . in horses fed the oat diet , the caecal abundance of several bacterial families in the order of bacteroidetes ( porphyromonadacae , unknown bacteroidetes cluster ii ) , veillonellaceae and several bacterial families in the order of proteobacteria ( alcaligenaceae , oxalobacteraceae , deltaproteobacteria , and succinivibrionaceae ) increased ( fig .
3 ) . in horses on the hay diet , the caecal abundance of several families inside the firmicutes phylum were higher than in horses fed the oat diet ( catabacteriaceae , clostridiaceae , lachnospiraceae , and ruminococcaceae ) .
in addition , the family spirochaceae and several families inside the tenericutes phylum ( spirochataceae , erysipelotrichaceae , anaeroplasmataceae , and unknown tenericutes ) also showed increased abundances in the caecum of horses fed the oat diet .
bar plot illustrating the mean difference between the two diets in abundances of bacterial representatives of the phyla : bacteroidetes , firmicutes , proteobacter , spirochaetes , and tenericutes .
bacterial representatives with mean difference values above the zero line imply that they showed a higher mean abundance in the hay - fed horses than in whole oats fed horses , whereas bacterial representatives with mean difference values under the zero line imply that they had a higher mean abundance in the whole oats
bacterial representatives marked with a star ( * ) means that the otus were not identified down to the family level .
direct sequencing and mcr of the mixed sequences , identified three main caecal bacterial groups at the family level ( porphyromonadaceae , prevotellaceae , and lachnospiraceae ) .
two resolved sequences represented mixed bacterial groups belonging to the phylum proteobacteria ( mixed groups 1 and 2 ) but these could not be identified down to family levels ( supplementary table 1 ; fig .
4 ) . postprandial microbial concentration profiles in caecum of horses fed the hay diet ( black ) and the oat diet ( red ) . estimated multivariate curve resolution ( mcr ) concentration profiles obtained pcr amplification of the variable v3 and v4 regions of 16s rrna gene , direct sequencing , and automatic capillary electrophoresis .
main resolved bacterial groups of the mixed sequences at the family level were porphyromonadaceae , prevotellaceae , and lachnospiraceae .
two of the components ( mixed 1 and 2 ) could not be resolved at a family level , but belong to the phylum proteobacter .
for the stability analyses , we investigated the individual differences for each time point using the mixed sequence data .
the reason why we did not use the pyrosequencing data for stability analyses is that we did not have complete time series .
2 ) . there was a statistically significant difference in the temporal stability index of the microbiota for the two diets , with the stability index being highest for the hay diet ( fig .
( a ) stability index was calculated for each time series including the five resolved mcr components .
mean of community stability in caecum of horses fed a hay diet compared to horses fed an oat diet were significantly different ( p<0.01 ) .
( b ) simpsons index was calculated for each sample and the mean value was calculated for each diet and found to be significantly different ( p<0.01 ) .
the -diversity analyses were based on the pyrosequencing data due to the more complete coverage compared to the direct sequencing .
we found that the hay diet had a statistically significant higher diversity of the microbiota compared to the oat diet ( fig .
on average when horses were fed the oat diet , the caecal nh3n level was lower , the vfa level was higher , the acetate level was lower , and the propionate level was higher than in horses fed the hay diet ( fig .
the barplot is illustrating the mean difference between the two diets in nh3n , vfa , acetate , propionate , and butyrate .
mean difference values above the zero line imply a higher mean value in the hay - fed horses than in whole oats fed horses , whereas mean difference values under the zero line imply a lower mean value in the hay - fed horses than in whole oats
horses fed the oat diet showed a prominent postprandial increase in the caecal vfa concentration 4 hours post - feeding , while in horses fed the hay diet the postprandial caecal vfa profiles showed only minor fluctuations ( fig .
2 ) . the caecal nh3n concentration in horses fed the oat diet showed a decline 3 hours post - feeding , whereas the nh3n profiles in horses fed the hay diet were slightly increasing post - feeding ( fig .
, there was a constant postprandial decrease for the hay diet , while there was an absolute minimum at 3 hours post - feeding for the oat diet ( fig .
caecal measurements related to the oat diet are marked with , and caecal measurements related to a hay diet are marked with . each time point represents mean values .
a total of 79,160 sequences were generated from the pyrosequencing , from which 38,949 were removed , mainly due to short sequence length ( < 200 bp ) and mismatch in primer and barcode sequence .
after filtration , the average sequence length was 218 , and the number of sequences per sample ranged from 583 to 1,453 , with a mean value of 957 .
the main caecal bacterial families were : porphyromonadaceae ( overall mean abundance was 27% ) , prevotellaceae ( 9% ) , lachnospiraceae ( 7% ) , ruminococcaceae ( 7% ) , and verrucomicrobiaceae ( 7% ) . at the phylum level , the most dominating phylums were bacteroides and firmicutes . overall abundance of bacteroides was 65% , while the average abundance of firmicutes was 20% .
the mean dietary effect on difference in abundances was calculated , and only otus with significant dietary effect are shown in fig .
3 . in horses fed the oat diet , the caecal abundance of several bacterial families in the order of bacteroidetes ( porphyromonadacae , unknown bacteroidetes cluster ii ) , veillonellaceae and several bacterial families in the order of proteobacteria ( alcaligenaceae , oxalobacteraceae , deltaproteobacteria , and succinivibrionaceae ) increased ( fig .
3 ) . in horses on the hay diet , the caecal abundance of several families inside the firmicutes phylum were higher than in horses fed the oat diet ( catabacteriaceae , clostridiaceae , lachnospiraceae , and ruminococcaceae ) .
in addition , the family spirochaceae and several families inside the tenericutes phylum ( spirochataceae , erysipelotrichaceae , anaeroplasmataceae , and unknown tenericutes ) also showed increased abundances in the caecum of horses fed the oat diet .
bar plot illustrating the mean difference between the two diets in abundances of bacterial representatives of the phyla : bacteroidetes , firmicutes , proteobacter , spirochaetes , and tenericutes .
bacterial representatives with mean difference values above the zero line imply that they showed a higher mean abundance in the hay - fed horses than in whole oats fed horses , whereas bacterial representatives with mean difference values under the zero line imply that they had a higher mean abundance in the whole oats fed horses .
bacterial representatives marked with a star ( * ) means that the otus were not identified down to the family level .
direct sequencing and mcr of the mixed sequences , identified three main caecal bacterial groups at the family level ( porphyromonadaceae , prevotellaceae , and lachnospiraceae ) .
two resolved sequences represented mixed bacterial groups belonging to the phylum proteobacteria ( mixed groups 1 and 2 ) but these could not be identified down to family levels ( supplementary table 1 ; fig .
4 ) . postprandial microbial concentration profiles in caecum of horses fed the hay diet ( black ) and the oat diet ( red ) . estimated multivariate curve resolution ( mcr ) concentration profiles obtained pcr amplification of the variable v3 and v4 regions of 16s rrna gene , direct sequencing , and automatic capillary electrophoresis .
main resolved bacterial groups of the mixed sequences at the family level were porphyromonadaceae , prevotellaceae , and lachnospiraceae .
two of the components ( mixed 1 and 2 ) could not be resolved at a family level , but belong to the phylum proteobacter .
for the stability analyses , we investigated the individual differences for each time point using the mixed sequence data .
the reason why we did not use the pyrosequencing data for stability analyses is that we did not have complete time series .
2 ) . there was a statistically significant difference in the temporal stability index of the microbiota for the two diets , with the stability index being highest for the hay diet ( fig .
( a ) stability index was calculated for each time series including the five resolved mcr components .
mean of community stability in caecum of horses fed a hay diet compared to horses fed an oat diet were significantly different ( p<0.01 ) .
( b ) simpsons index was calculated for each sample and the mean value was calculated for each diet and found to be significantly different ( p<0.01 ) .
the -diversity analyses were based on the pyrosequencing data due to the more complete coverage compared to the direct sequencing .
we found that the hay diet had a statistically significant higher diversity of the microbiota compared to the oat diet ( fig .
horses rely largely on high intake of fibre that can be fermented to vfas , which in turn can be utilised as energy or for gluconeogenesis ( propionic acid ) by the host . to minimise digestive disturbances ,
it has been suggested that the amount of starch fed per meal should be limited to 11.5 g / kg bw ( 23 ) .
however , considerable amounts of high starch ingredients ( cereal grains ) are often included in diets for high - performing horses .
this can increase the risk of many diseases , including fermentative acidosis , laminitis , and colic ( 24 ) . the morning meal of the oat diet provided 1.68 g starch / kg bw , whereas the total daily oat ration provided 3.67 g starch / kg bw .
our data showed higher microbial fermentation activity in the caecum of horses fed the oat diet as compared to the hay diet ( i.e. increased level of vfa , lower level of ammonia , and a rapid decline in ph post - feeding ) .
these observations were in line with previous studies comparing caecal parameters in horses on a high starch versus a low starch diet ( 8 , 2527 ) .
however , the caecal ph did not go below 6.5 for any of the horses , thus , the temporal postprandial instability in the caecal microbial community structure was induced at a caecal ph far from sub - clinical acidosis ( ph below 6 ) ( 28 ) .
thus the high nutrient availability diet ( whole oats ) in the present study caused only small variations in both microbial structure and functionality that returned to its original state 9 hours post - feeding .
of the five main caecal bacterial families identified in the present study ( porphyromonadaceae , prevotellaceae , lachnospiraceae , ruminococcaceae , and verrucomicrobiaceae ) , four have recently been reported as members of the caecal core bacteria community by dougal et al .
the five most abundant bacteria that could be identified in all animals examined were lachnospiraceae , prevotellaceae , erysipelotrichaceae , ruminococcaceae , and porphyromonadaceae ( 29 ) .
although verrucomicrobiaceae was not identified as a core member of the caecal microbiota , several members of the order of verrucomicrobia are frequently identified in the equine caecum and have also recently been reported to be more abundant in horses with chronic laminitis ( 30 ) .
erysipelotrichaceae and other members of the phylum tenericutes were present in lower numbers in the present study , but with higher abundances in horses fed the hay diet .
the co - occurrence between the overrepresentation of the bacterial family porphyromonadaceae and the high caecal concentration of propionate in horses fed the oats diet ( i.e. high nutrient availability ) , can be explained by the fact that this family often has propionic acid as a main metabolic end product .
corroborating this is that it has recently been shown that members of this family do produce mainly propionic acid upon glucose metabolism ( 31 ) . for the diet
low in available nutrients ( hay diet ) , we found a combined overrepresentation of unclassified clostridiales and acetate .
acetate production , however , is associated with a wide range of bacteria ( 32 ) , so it is difficult to pinpoint the actual producers in the horse caecum . in accordance with general ecological theory
, it has been proposed that increased diversity has a community stabilising effect ( 33 ) .
our observation of a positive relationship between increased diversity and community stability is therefore in accordance with these theories .
in addition , it has been demonstrated within a range of ecological communities that a high level of available nutrients initiates a higher level of inter specific competition favouring rapid growth and metabolic activity ( 34 ) .
this is in contrast to a more complex environment with lower levels of available energy that is favouring microbial specialisation and niche differentiation ( 3537 ) .
the increased fermentation activity , as observed by increased vfa level , decreased nh3h concentration and lower ph , support the hypothesis of a more rapid growth and metabolic activity , and increased inter special competition for the caecal microbiota .
most of these , however , are poorly characterised , and it is thus difficult to deduce their role in the caecum .
interestingly , in sheep rumen the clotridial families catabacteriaceaerum , ruminococcus , and lachnospiraceae have been associated with high methane emission ( 38 ) , suggesting an important role of these families in metabolism of feeds with low digestibility . in conclusion , we found an increased abundance of porphyromonadaceae in the equine caecal microbiota associated with a decreased acetate : propionate ratio in horses fed the oat diet as compared to a hay diet . since horses with hindgut acidosis are more susceptible to laminitis and colic than those with a healthy hindgut environment , it is essential to study both the microbiota and the general hindgut physiology .
here we show that feeding different diets resulted in significant changes in both the caecal fermentation parameters and the bacterial microbiome .
large individual variation was observed , suggesting that bacterial populations may be influenced by other factors such as genetic background , age , and body condition , which were not taken into account in this study .
furthermore , we propose that the increased diversity and stability of the caecal microbiota in horses on the hay diet with low and slower nutrient availability can be explained by general ecological theories .
the authors have not received any funding or benefits from industry or elsewhere to conduct this study . | backgroundit is well known that nutrient availability can alter the gut microbiota composition , while the effect on diversity and temporal stability remains largely unknown.methodshere we address the equine caecal microbiota temporal stability , diversity , and functionality in response to diets with different levels of nutrient availability .
hay ( low and slower nutrient availability ) versus a mixture of hay and whole oats ( high and more rapid nutrient availability ) were used as experimental diets.resultswe found major effects on the microbiota despite that the caecal ph was far from sub - clinical acidosis .
we found that the low nutrient availability diet was associated with a higher level of both diversity and temporal stability of the caecal microbiota than the high nutrient availability diet .
these observations concur with general ecological theories , suggesting a stabilising effect of biological diversity and that high nutrient availability has a destabilising effect through reduced diversity.conclusionnutrient availability does not only change the composition but also the ecology of the caecal microbiota . | Materials and methods
Horses, diets, and sampling
Chemical analyses and pH measurements
DNA extraction
Direct sequencing
Deep microbiota pyrosequencing
Ecological analysis
Results
Caecal physiology
Microbiota composition
Microbiota stability and diversity
Discussion
Supplementary Material
Conflict of interest and funding |
aneurysmal bone cyst ( abc ) is a destructive , vascular pathology of bone , representing 1 - 2% of primary bone tumour.123 abc is characterized by multilocular , sponge like appearance consisting of blood filled cavities separated by thin , fibrous septa .
the core of the tumor consists of soft , fleshy and vascular tissue.4 bleeding appears to come from the soft tissue lining the cysts and may be profuse and difficult to control until all the lining has been removed.4 curettage is one of the treatment modality for abc of spine .
problems encountered during curettage are bleeding due to vascularity , need for reconstruction and risk of recurrence.5 in this paper , we have described two cases with 2 years followup of abc spine treated with vertebral cement augmentation for control of bleeding during curettage and internal stabilization . to the best of our knowledge ,
there are no cases reported presenting this technique to control blood field in a vascular spinal tumor like abc .
a 22-year - old male presented with nonradiating chronic low back pain , since 9 months .
x - ray , computed tomography ( ct ) scan and magnetic resonance imaging ( mri ) findings [ figure 1a ] suggested an expansile , multitrabeculated osteolytic lesions , with thinned out cortex at l3 vertebral body and left pedicle ( probably abc ) .
we did a transpedicular biopsy of l3 vertebra from the left pedicle followed by cement augmentation through the right ( normal ) pedicle was completed for internal stabilization and to control expected bleeding during curettage .
after solidification of cement ( around 12 - 15 min ) , curettage was completed from the left ( involved ) pedicle and a second sample . on histopathological review ,
the diagnosis of abc was confirmed with findings of blood filled cavity , lined wall of fibrous tissue , macrophages , giant cell and island of bone . on followup ,
ct scan done on followup [ figure 1b ] , confirmed good filling of cavity and no any signs of recurrence .
case 1 - a 22 year - old male patient with chronic back pain ( a ) x - ray lumbosacral spine lateral view and ( b ) axial computed tomography scan image showing osteolytic lesion at l3 vertebra ( c and d ) magnetic resonance imaging t2-weighted axial and sagittal showing hyper intense lesion with multilobulated cavity filled with fluid case 1 - ( a and b ) postoperative x - ray lumbosacral spine anteroposterior and lateral views showing well placed cement , ( c ) computed tomography scan on followup showing placement of cement a 15-year - old female , presented with acute onset , nonradiating back pain , aggravated by movement , for last 3 weeks and rapidly progressive lowerlimb weakness with difficulty in walking since 4 days .
neurological examination revealed spastic lower limbs , muscle power in all groups , on right side was 2/5 and left side 3/5 , lower abdominal reflexes were absent , planters on both sides were extensor , both knee and ankle jerks were brisk , spinothalamic sensations were decreased below d10 by about 70% .
radiological investigation showed [ figure 2a ] an osteolytic expansile , septate lesion involving d9 vertebral body , right pedicle and facet with decrease in height of d9 body leading to cord compression .
pedicle screwrod fixation was done from d7 to d11 . at d9 level , through the right pedicle , cavity of the cyst was opened , biopsy was taken .
there was profuse bleeding from the cavity which was not controlled by coagulation and pressure packing .
next , we approached the left pedicle for cement augmentation by a jamshidi needle . we did cement augmentation of the highly vascularized body with care to avoid cement leakage in canal like monitor under fluoroscopy , cement injected slight more viscous state .
after solidification of the cement and completion of exothermic reaction , we started curettage from right pedicle and found that bleeding was stopped and surface of cyst wall was easily visible .
now , we were able to approach cyst wall for second biopsy sample collection and we could complete curettage of the cyst .
followup ct scan had confirmed , good filling of cavity with no sign of recurrence [ figure 2b ] .
case 2 a 15-year - old female with acute back pain ( a and b ) sagittal and axial computed tomography showing osteolytic lesion in d9 magnetic resonance imaging t2-weighted axial ( c ) and sagittal ( d ) showing hyperintense lesion in d9 case 2 ( a ) postoperative x - ray anteroposterior and lateral views showing implant and cement in situ ( b ) followup computed tomography scan sagittal and axial cuts showing implant and cement in situ schematic representation of ( a ) preoperative ( b ) after cement augmentation and curettage showing position of needle , cement and cavity
a 22-year - old male presented with nonradiating chronic low back pain , since 9 months .
x - ray , computed tomography ( ct ) scan and magnetic resonance imaging ( mri ) findings [ figure 1a ] suggested an expansile , multitrabeculated osteolytic lesions , with thinned out cortex at l3 vertebral body and left pedicle ( probably abc ) .
we did a transpedicular biopsy of l3 vertebra from the left pedicle followed by cement augmentation through the right ( normal ) pedicle was completed for internal stabilization and to control expected bleeding during curettage .
after solidification of cement ( around 12 - 15 min ) , curettage was completed from the left ( involved ) pedicle and a second sample . on histopathological review ,
the diagnosis of abc was confirmed with findings of blood filled cavity , lined wall of fibrous tissue , macrophages , giant cell and island of bone . on followup ,
ct scan done on followup [ figure 1b ] , confirmed good filling of cavity and no any signs of recurrence .
case 1 - a 22 year - old male patient with chronic back pain ( a ) x - ray lumbosacral spine lateral view and ( b ) axial computed tomography scan image showing osteolytic lesion at l3 vertebra ( c and d ) magnetic resonance imaging t2-weighted axial and sagittal showing hyper intense lesion with multilobulated cavity filled with fluid case 1 - ( a and b ) postoperative x - ray lumbosacral spine anteroposterior and lateral views showing well placed cement , ( c ) computed tomography scan on followup showing placement of cement
a 15-year - old female , presented with acute onset , nonradiating back pain , aggravated by movement , for last 3 weeks and rapidly progressive lowerlimb weakness with difficulty in walking since 4 days .
neurological examination revealed spastic lower limbs , muscle power in all groups , on right side was 2/5 and left side 3/5 , lower abdominal reflexes were absent , planters on both sides were extensor , both knee and ankle jerks were brisk , spinothalamic sensations were decreased below d10 by about 70% .
radiological investigation showed [ figure 2a ] an osteolytic expansile , septate lesion involving d9 vertebral body , right pedicle and facet with decrease in height of d9 body leading to cord compression .
, pedicle screwrod fixation was done from d7 to d11 . at d9 level , through the right pedicle , cavity of the cyst was opened , biopsy was taken .
there was profuse bleeding from the cavity which was not controlled by coagulation and pressure packing .
next , we approached the left pedicle for cement augmentation by a jamshidi needle . we did cement augmentation of the highly vascularized body with care to avoid cement leakage in canal like monitor under fluoroscopy , cement injected slight more viscous state .
after solidification of the cement and completion of exothermic reaction , we started curettage from right pedicle and found that bleeding was stopped and surface of cyst wall was easily visible .
now , we were able to approach cyst wall for second biopsy sample collection and we could complete curettage of the cyst .
followup ct scan had confirmed , good filling of cavity with no sign of recurrence [ figure 2b ] .
case 2 a 15-year - old female with acute back pain ( a and b ) sagittal and axial computed tomography showing osteolytic lesion in d9 magnetic resonance imaging t2-weighted axial ( c ) and sagittal ( d ) showing hyperintense lesion in d9 case 2 ( a ) postoperative x - ray anteroposterior and lateral views showing implant and cement in situ ( b ) followup computed tomography scan sagittal and axial cuts showing implant and cement in situ schematic representation of ( a ) preoperative ( b ) after cement augmentation and curettage showing position of needle , cement and cavity
management for abc spine is controversial.5 we hereby report an option of cement augmentation in selected cases treated with curettage .
, it is often difficult to visualize the cavity following continuous bleeding from the cavity surface .
increased vascularity occurs as a result of abnormal vessels lining the cavity as describe above .
this bleeding is controlled after removal of cavity wall completely.45 second problem is a need for reconstruction of spine after aggressive vertebral curettage.5 recurrence after curettage is also an important issue to be addressed since recurrent rates are higher than those in complete en bloc vertebral removal.6 the treatment of recurrence remain curettage but it is important to diagnose the recurrence earlier . to solve the above problems , we have done cement augmentation from the uninvolved pedicle , prior to curettage of the abc cavity .
the heat released during this reaction is good enough to potentially heat up the cement by several degrees during setting.7 eriksson et al .
study 8 suggests that the high temperatures thus achieved can give rise to thermal necrosis of the surrounding tissue .
further this may also promote endothelial cell damage.9 the necrosis and endothelial damage promotes coagulation pathway locally .
it results in vascular coagulation of vessels of the vertebral body and therefore control of bleeding during curettage .
this controlled bleeding also allowed good curettage of the remaining cavity after filling with cement in our cases .
in addition to controlled bleeding , local rise in temperature on the inner surface of the cavity produces antitumor effect due to the necrosis of the bony area in contact with cement.10 according to san milln ruz et al .
antitumor effect of polymethylmethacrylate ( pmma ) cement is also attributed to the cytotoxicity of the pmma monomer.11 further , cement bone interface is well defined healing of the lesion on followup images.1213 it is well known that cement augmentation provides filling of defect and stabilization alone or in combination with fixation .
this may obviate complex and morbid reconstruction surgery after extensive curettage and resection . in our first case ,
during surgery there was profuse bleeding from the cavity which limited us from proceeding on with surgery .
we found that after the completion of cement solidification and the exothermic reaction , complete hemostasis was achieved .
part of the cyst lining in contact with the cement is likely to be damaged and necrosed by the exothermic reaction of cement .
evaluating the volume and distribution of cement in the affected vertebral body , it was found to be sufficient for the stabilization of spine .
we have found the same advantage in the second case . as there was collapse of the body ; we have taken extra care to avoid leakage of cement with proper monitoring under image intensifier , cement injection in more viscous consistency and vertebroplasty after decompression laminectomy to provide direct visual monitoring . in both the cases after 2 years
, we had done ct scan and x - ray to see whether there is any further destruction . however
however , due to slow growth in the abc and the young age of the affected population , long term followup ( > 5 years ) is recommended to address recurrences.1415 in our experience of these cases , cement augmentation in addition to curettage is useful in selected cases of abc with single vertebral involvement , single pedicle involvement . | aneurysmal bone cyst ( abc ) is a vascular tumor of the spine .
management of spinal abc still remains controversial because of its location , vascular nature and incidence of recurrence . in this manuscript , we hereby describe two cases of abc spine treated by curettage , vertebral cement augmentation for control of bleeding and internal stabilization with two years followup . to the best of our knowledge ,
this is the first case report in the literature describing the role of cement augmentation in spinal abc in controlling vascular bleeding in curettage of abc of spine .
case 1 : a 22 year old male patient presented with chronic back pain . on radiological investigation ,
there were multiple , osteolytic septite lesions at l3 vertebral body without neural compression or instability .
percutaneous transpedicular biopsy of l3 from involved pedicle was done .
this was followed by cement augmentation through the uninvolved pedicle .
next , transpedicular complete curettage was done through involved pedicle .
case 2 : a 15-year - old female presented with nonradiating back pain and progressive myelopathy . on radiological investigation , there was an osteolytic lesion at d9 . at surgery , decompression , pedicle screw - rod fixation and posterolateral fusion from d7 to d11 was done . at d9 level , through normal pedicle cement augmentation
was added to provide anterior column support and to control the expected bleeding following curettage .
transpedicular complete curettage was done through the involved pedicle with controlled bleeding at the surgical field .
cement augmentation was providing controlled bleeding at surgical field during curettage , internal stabilization and control of pain . on 2 years followup , pain was relieved and there was a stable spinal segment with well filled cement without any sign of recurrence in computed tomography scan
. in selected cases of spinal abc with single vertebral , single pedicle involvement ; cement augmentation of vertebra through normal pedicle has an important role in surgery aimed for curettage of vertebra . | I
C
Case 1
Case 2
D |
real time pcr ( rt - pcr ) can rapidly , reproducibly and quantitatively determine changes in gene expression ( 1 ) . although microarray analysis can measure large scale gene expression levels simultaneously , its hybridization - related variation often demands validation by other methods .
routinely , rt - pcr is used to verify the observation from microarray studies . however
, several artifacts can confound the analysis including : ( i ) amplification of undesired template secondary to mispriming or annealing at inappropriate temperatures ; and ( ii ) susceptibility to rna contamination with genomic dna , especially when collecting samples from tumor tissues ( 2 ) .
though the problem of genomic contamination is partially addressed by dnase treatment this method is often incomplete and its protracted use often diminishes the sensitivity of detection .
this is a costly problem particularly when the detection of rare transcripts in precious tissue samples is desired ( 3 ) .
low cost methods for detecting fluorescent dyes which bind to double stranded dna , such as sybr green , are most widely used and suitable for high throughput screening . since these dyes are not sequence specific , careful consideration should be given to avoid generating extraneous amplicons .
one of the obstacles to high throughput rt - pcr gene expression studies in which multiple unique transcripts are simultaneously measured in 96 or 384 well formats , is the necessity to individually optimize each assay for each target ( 4 ) .
currently , the criteria for successful determination by quantitative rt - pcr require that : ( i ) the optimal amplicon should be located in a non repetitive region without segments of low complexity , ( ii ) the optimal amplicon size should be 100 bp to ensure the efficiency of taq polymerase processivity , ( iii ) if possible , primers should be designed to flank intron
exon borders or primers anneal at a splice junction to distinguish genomic dna from cdna template , and ( iv ) primers have similar melting temperatures with 2070% gc content ( 5,6 ) .
it is a laborious and error - prone chore to design rt - pcr primers that meet these requirements .
rtprimerdb ( ) , an online database , provides experimentally verified primer sets for 2699 human and 487 mouse genes ( 7,8 ) .
primerbank ( ) is a well known resource that covers most known human ( 33 741 ) and mouse ( 27 681 ) genes ( 9 ) .
however , its primer algorithm is not designed to span introns and is therefore more prone to amplify contaminating genomic sequences .
here we describe qprimerdepot , a primer database for rt - pcr analysis of > 99% of human ( 23 400 ) and mouse ( 18 733 ) refseq genes .
these primers sets are designed to be used under uniform annealing temperatures to facilitate their application in large scale high throughput assays .
moreover , to reduce the noise from contaminating genomic dna ( 6 ) , over 90% of the primer sets are designed to produce amplicons bridging exon : exon junctions of intron - bearing genes .
sequences file ( refmrna.zip ) and intron / exon information tables ( refgene.txt.gz ) of 23 463 human and 18 737 mouse refseq genes ( ucsc hg17 and mm6 ) were downloaded from ucsc genome browser ( ) . to assure amplicons free of repetitive elements and sequences of low complexity ( 10 ) , we utilized biowulf , a high - performance linux cluster at the national institutes of health , to mask the repetitive elements using the repeatmasker application with built - in maskeraid ( 11 ) .
primer3 ( 12 ) was used to design primers for each refseq entry , with the following parameters : for intronless genes ( 5.5% of human refseq genes and of 12.4% of mouse refseq genes ) , primers were set to be between 17 and 27 bp with 20 bp as optimum , and melting temperature was set to be between 57 and 63c with 60c as optimum , all other parameters , such as primer_self_any and primer_self_end , were set to default ( 8.0 and 3.0 , respectively ) to assure low self - complementarity .
all cdna amplions were 90150 bp in size to ensure taq polymerase efficiency . for 99% of intron - bearing genes ( 94.5% human genes and 88.6% mouse genes
bear at least one intron ) , primers were designed to flank or cross an exon - intron border in which the intron was one of the top three largest in the gene of interest .
thus , contamination by genomic dna would generate either a longer product , which can be detected by melting curve analysis , or no product if the contamination template length ( intron > 3 kb ) is too long for taq polymerase to traverse during the extension period .
the blast algorithm was used via the nih biowulf linux cluster to evaluate all primers against corresponding refseq databases .
the criteria for possible mis - priming requires that both primers have at least 15 matches in another refseq entry ( i.e. expectation value , e < 1 ) ( 13,14 ) .
the blast result revealed that 891 of human and 420 of mouse primers may mis - prime to other refseq sequences .
sequence alignments of query and hit refseq using the blast2 algorithm ( 15 ) were performed and primer pairs which had < 80% identities were filtered out of the database .
annotations are presented in the user interface for the individual primer sets that could mis - prime another refseq gene with > 80% identity .
the sources of these mis - primed refseq will vary , but may include redundancy within the refseq database , transcript variants and paralogs of high sequence similarity .
each of these possibilities can be assessed by a direct link that is provided to in silico pcr ( ) for all primer pair sets .
this link allows the user to rapidly identify amplicon locations in the mouse and human genomes so that primer specificity can be visually assessed and validated .
qprimerdepot can be accessed at or by querying the database with a refseq i d or a gene name .
batch query service is available upon request if user provides standard gene name or accession number .
flat files and mysql dump file which have all primer information are also available upon request .
reverse transcription was applied with omniscript rt kit following manufacturer 's protocol ( qiagen ) . a 20 l rt reaction included 2 g universal reference rna ( stratagen ) , 1 m oligo - dt primer , 2 l of 10 rt buffer , 0.5 mm each dntp , 10 u of rnase inhibitor , 4 u of omniscript reverse transcriptase , and depc - treated water .
primer sequences were extracted from our database and synthesized by integrated dna technologies ( coralville , ia , usa ) .
quantitative rt - pcr was carried out in a dna engine opticon-2 real time pcr detection system ( mj research ) . in brief , each 20 l reaction mix comprises 0.3 m primers ( both 5 and 3 primers ) , 1 l template from reverse transcription and 10 l 2 quantitect sybr green pcr master mix ( qiagen ) .
each reaction mix was incubated at 95c for 15 min , 40 cycles of 95c for 15 s and 60c for 1 min . a melting curve analysis which read every
0.3c from 65 to 95c was followed to assess the homogeneity of a pcr product .
sequences file ( refmrna.zip ) and intron / exon information tables ( refgene.txt.gz ) of 23 463 human and 18 737 mouse refseq genes ( ucsc hg17 and mm6 ) were downloaded from ucsc genome browser ( ) . to assure amplicons free of repetitive elements and sequences of low complexity ( 10 ) , we utilized biowulf , a high - performance linux cluster at the national institutes of health , to mask the repetitive elements using the repeatmasker application with built - in maskeraid ( 11 ) .
primer3 ( 12 ) was used to design primers for each refseq entry , with the following parameters : for intronless genes ( 5.5% of human refseq genes and of 12.4% of mouse refseq genes ) , primers were set to be between 17 and 27 bp with 20 bp as optimum , and melting temperature was set to be between 57 and 63c with 60c as optimum , all other parameters , such as primer_self_any and primer_self_end , were set to default ( 8.0 and 3.0 , respectively ) to assure low self - complementarity .
all cdna amplions were 90150 bp in size to ensure taq polymerase efficiency . for 99% of intron - bearing genes ( 94.5% human genes and 88.6% mouse genes
bear at least one intron ) , primers were designed to flank or cross an exon - intron border in which the intron was one of the top three largest in the gene of interest .
thus , contamination by genomic dna would generate either a longer product , which can be detected by melting curve analysis , or no product if the contamination template length ( intron > 3 kb ) is too long for taq polymerase to traverse during the extension period .
the blast algorithm was used via the nih biowulf linux cluster to evaluate all primers against corresponding refseq databases .
the criteria for possible mis - priming requires that both primers have at least 15 matches in another refseq entry ( i.e. expectation value , e < 1 ) ( 13,14 ) .
the blast result revealed that 891 of human and 420 of mouse primers may mis - prime to other refseq sequences .
sequence alignments of query and hit refseq using the blast2 algorithm ( 15 ) were performed and primer pairs which had < 80% identities were filtered out of the database .
annotations are presented in the user interface for the individual primer sets that could mis - prime another refseq gene with > 80% identity .
the sources of these mis - primed refseq will vary , but may include redundancy within the refseq database , transcript variants and paralogs of high sequence similarity .
each of these possibilities can be assessed by a direct link that is provided to in silico pcr ( ) for all primer pair sets .
this link allows the user to rapidly identify amplicon locations in the mouse and human genomes so that primer specificity can be visually assessed and validated .
qprimerdepot can be accessed at or by querying the database with a refseq i d or a gene name .
batch query service is available upon request if user provides standard gene name or accession number .
flat files and mysql dump file which have all primer information are also available upon request .
reverse transcription was applied with omniscript rt kit following manufacturer 's protocol ( qiagen ) . a 20 l
rt reaction included 2 g universal reference rna ( stratagen ) , 1 m oligo - dt primer , 2 l of 10 rt buffer , 0.5 mm each dntp , 10 u of rnase inhibitor , 4 u of omniscript reverse transcriptase , and depc - treated water .
primer sequences were extracted from our database and synthesized by integrated dna technologies ( coralville , ia , usa ) .
quantitative rt - pcr was carried out in a dna engine opticon-2 real time pcr detection system ( mj research ) . in brief , each 20 l reaction mix comprises 0.3 m primers ( both 5 and 3 primers ) , 1 l template from reverse transcription and 10 l 2 quantitect sybr green pcr master mix ( qiagen ) .
each reaction mix was incubated at 95c for 15 min , 40 cycles of 95c for 15 s and 60c for 1 min . a melting curve analysis which read every
0.3c from 65 to 95c was followed to assess the homogeneity of a pcr product .
our database comprises pre - designed primers for 42 133 mouse and human refseq genes ( table 1 ) . for most genes
the database provides a simple user interface where the user may enter either the hugo approved gene symbol or the refseq gene identifier ( figure 1 ) .
the database graphic output provides information on the primary transcript location , number of introns , primer sequence , primer length , gc% , amplicon size , and genomic amplicon size .
also a direct link is provided for location of the genomic amplicon by in silico pcr ( figure 2 ) .
summary statistics for qprimerdepot primerdb web input interface for qprimerdepot ( see text ) . web output interface for qprimerdepot ( see text ) .
to experimentally evaluate the primer quality , 288 genes were arbitrarily selected from a list of genes known to function in the immune response .
universal human reference rna was reverse transcribed and used as template in pcr to examine the quality of the primers . given the variation of transcript abundance , melting curve analysis followed by gel electrophoresis has been suggested to verify rt - pcr products ( 6 ) .
visualization by the less sensitive ethidium bromide stain shows that > 70% of the primer sets produce an amplicon of the correct molecular weight that will amplify and be detected as a single species by quantitative pcr ( figure 3 ) .
several of the failures detected by gel electrophoresis are likely due to very low abundance transcripts in the universal rna , imperfect primer design , unanticipated high secondary mrna structure , or erroneous exon annotation in ucsc genome browser .
approximately 88.5% of primer sets produced no product in the absence of reverse transcriptase and the remaining sets produced detectable product only beyond 34 cycles of amplification possibly , due to primer dimers .
validation of pprimerdepot primer sets on 3% ethidium bromide stained agarose / acrylamide ( 3:1 ) gels after 38 cycles of amplification .
the resistance of most qprimerdepot primer sets to contaminating input genomic dna is illustrated in figure 4 . here
the real - time amplification profiles of three intron - bearing genes ( vefg , vegfb and vegfc ) was compared to that of three non intron - bearing genes ( xcr1 , sstr4 and mc1r ) after challenge with increasing concentrations of contaminating genomic dna ( 0.5500 pg/l ) . as demonstrated in figure 4 ,
all three intron - bearing genes show robust resistance to > 500 pg/l of input genomic dna .
this is in stark contrast to the three non intron - bearing genes where as little as 5 pg/l produces a significant false signal .
real - time pcr amplification profiles generated using qprimerdepot primer sets for non intron - bearing ( xcr1 , sstr4 , mc1r ) and intron - bearing ( vefg , vegfb , vegfc ) genes compared after the addition of increasing amounts of contaminating genomic dna .
taking advantage of the intron / exon inventory of refseq genes and primer3 , a paradigm primer design tool , we designed primers which are contamination resistant for 99% of human and mouse refseq genes ( table 1 ) . since the majority of the primer sets will amplify desired templates under unified annealing temperatures , high throughput multiplex analysis is achievable at a reasonable cost .
empirical screening and validation of primer set performance conservatively suggests that 7090% of the primer set designs are likely to perform effectively right out of the box with no need to adjust the conditions of amplification .
therefore , qprimerdepot is a valuable resource for qrt applications , especially in those circumstances requiring high throughput detection of rare transcripts in curated and/or patient - derived samples that often contain unavoidable contamination with genomic dna . | gene expression studies employing high throughput real time pcr methods require finding uniform conditions for optimal amplification of multiple targets , often a daunting task .
we developed a primer database , qprimerdepot , which provides optimized primers for all human and mouse refseq genes .
these primers are designed to amplify desired templates under unified annealing temperature . for most intron - bearing genes ,
primers flank one of the largest introns thus minimizing background noise due to genomic dna contamination .
the qprimerdepot database can be accessed at and . | INTRODUCTION
MATERIALS AND METHODS
Data processing
Experimental validation
RESULTS AND DISCUSSION
CONCLUSION |