Datasets:

LA1512

/

pubmed-val-1K

like 0

ankle sprains are one of the most common injuries caused by physical activity during sports or activities of daily living1,2,3 . they usually occur during dynamic movement , and over 50% of all ankle injuries involve ligament damage4 . chronic ankle instability ( cai ) is defined as a subjective feeling of the ankle giving way , which results from a pattern of instability involving an initial ankle sprain followed by repeated ankle sprains5 . cai can be defined as the state caused by the experience of multiple ankle sprains , with instability resulting from restricted joint range of motion ( rom ) and limited movement6 . in addition , stability of the ankle can have a positive effect on standing balance , and even influence the stability of such movements as walking and jumping7 . cai can occur as a result of inappropriate treatment following an initial injury and pain in the lateral part of the ankle joint is reported to be the most common cause5 , 8 , 9 . due to instability and discomfort during sudden changes of direction or stopping actions , patients with cai report reduced balance control . therefore , when ankle injury occurs , the mechanical receptors in the joint become damaged , leading to functional instability10 . although the precise mechanisms of functional ankle instability have not been elucidated , the condition presents with ligament damage , reduced muscle strength , delayed muscle response time , and proprioceptive deficits in the ankle11,12,13 . ankle injuries can be divided into acute and chronic injuries . in the case of cai , because dynamic movement is restricted and balance and gait abilities are impaired , conservative treatment via rehabilitation exercise is thought to be important5 , 8 , 14 , 15 . the aim of active conservative treatment after an exercise - related injury is to promote functional recovery to a level equivalent to or better than the pre - injury level , through the use of appropriate treatments and exercises , thereby enabling the patient to return to the field or to daily life . hence , this study aimed to construct an integrated rehabilitation exercise program that could improve functional measures , such as muscle strength and dynamic coordination , in order to prevent chronic pain and improve functional impairment caused by ankle injury or re - injury . the study subjects were 26 male soccer players who required functional strength exercises due to repeated ankle injuries . the subjects had a mean age of 23.2 1.4 years , a mean height of 179.8 4.8 cm , and a mean body weight of 75.4 6.0 kg . all the subjects understood the purpose of this study and provided their written informed consent prior to participation in this in the study in accordance with the ethical principles of the declaration of helsinki . rehabilitation exercise was performed for a total of 12 weeks , two sessions per week , 80 minutes per session , with the aim of alleviating cai , strengthening in this by muscles of the ankle and the dynamic coordination of the lower limb . the rehabilitation exercise program consisted of three phases : the initial exercise phase ( weeks 12 ) , the functional improvement phase ( weeks 310 ) , and the functional maintenance phase ( weeks 1112 ) ( table 1table 1.rehabilitation exercise programprogramintensitytimewarm up walking and cycling no pain10main exercise ( 12 weeks)1 ( 12 week)[initial] rom exercise of the ankle joint focused on pf / df & in / ev no pain rpe 1113 circuit ex. increase ex. repetition ex.602 ( 310 week)[improvement] rom exercise of the ankle joint band exercise ( red & green bands) weight ( focused on the lower extremity)3 ( 1112 week)[maintenance] plyometric & pnf training focused on pf / df & in / evcool down static stretching ( mat exercise ) no pain10 ) . the program focused on joint rom for dorsiflexion ( df ) , plantarflexion ( pf ) , internal rotation , and external rotation in order to strengthen the muscles of the ankle . these exercises were combined with band training , weight training , plyometrics , and exercises to improve proprioception in order to develop stable , coordinated , functional ability . measurements were performed before and after participation in the 12-week program in order to evaluate the degree of improvement in muscle strength and dynamic coordination . the humac norm testing & rehabilitation system ( computer sports medicine , inc . , stoughton , ma , usa ) was used to measure the isometric muscle strength of the ankle , considering the functional movements of df , pf , inversion ( in ) , and eversion ( ev ) . the torque of the joint was aligned with the rotation axis of the dynamometer , and the axis of movement was aligned with the anatomical position of the joint . measurements were made of each subject , and were converted into a digital format using a computer program . in order to evaluate ankle muscle strength , peak torque ( nm ) and the ipsilateral muscle strength ratio ( % ) of df , pf , in , and ev were measured 30/s . the y balance test ( functional movement systems , chatham , va , usa ) , which was developed to improve dynamic coordination , was used in this study . this test not only allows subjects to gain stability , but also contributes to gradual improvement in muscle strength and flexibility . the y balance test is a method of testing lower limb muscle strength and coordinated functions in dynamic stability , and was adapted from the star excursion balance test , using three directions instead of eight16 . the subject stands on one leg at the center , and the maximum distance that he / she can stretch the other leg is measured for each of the three directions . here , the three directions corresponded to the anterior , posteromedial , and posterolateral axes . three measurements were made of each leg , and the average of these measurements was used in the analysis . means and sds were calculated for all the measured data . the paired - sample t - test was used to compare isometric muscle strength and dynamic coordination before and after the 12-week program . data were analyzed using spss version 23.0 ( spss inc . , chicago , il , usa ) , and values of p<0.05 were considered statistically significant . following 12 weeks of rehabilitation exercise , there were statistically significant improvements in bilateral pf strength , the ipsilateral muscle strength ratio , isometric in strength , and isometric ev strength ( p<0.05 ) . over 70% of patients who experience ankle sprains report additional symptoms resembling cai , such as re - injury or functional abnormalities17 . moreover , cai has been reported to be associated with several important functional impairments , such as reduced muscle strength and proprioception , as well as loss of both neuromuscular and postural control5 . it is presumed that cai is caused by complex functional deterioration , including reduced proprioception and weakening of the ankle evertors18 . it has also been reported that proprioceptive and muscle strengthening exercises are important for the rehabilitation of ankle instability6 , 9 , 19 , 20 . in this study , isometric muscle strength was compared between before and after participation in the 12-week rehabilitation exercise program aimed at alleviating cai . the results show there were significant improvements in df and pf strength , as well as in the ipsilateral muscle strength ratio , demonstrating an overall improvement in ankle muscle strength ( p<0.001 ) . these results are consistent with those of a previous study , which evaluated eight weeks of strategic resistance training performed by 22 subjects diagnosed with functional ankle injury21 . in another study of the strength , balance , and functional ability of functionally unstable ankles22 , significant differences in pf strength at 30/s , 60/s , and 120/s , and in peak isometric pf force at 30/s were reported ( table 2table 2.isokinetic strength at 30/sec ( nm)pre - testpost - testpeak torque(nm)pfr98.4 25.5107.8 28.1l105.4 25.9114.8 28.1dfr22.2 5.034.5 5.8l37.7 5.046.0 5.9ratio ( % ) r21.7 7.038.1 15.0l34.5 8.946.8 15.9values are mean sd . pf : planterflexion ; df : dorsiflexor , r : right ; l : left . * * * p<0.001 ) . these findings indicate that it is likely that improvement in ankle muscle strength improves functional stability and prevents injury . pf : planterflexion ; df : dorsiflexor , r : right ; l : left . * * * p<0.001 compared with the general population , soccer players show reduced evertor muscle strength and stiff invertor muscles due to repeated training , overuse , and soft tissue damage2 . these differences lead to a tendency of the in angle to be larger than in typical individuals , which has been reported to cause cai due to weakening of the lateral muscles , and development of a supination foot deformity23 . the results of the present study show the exercise program increased in and ev strength , and there were significant increases in right ev ( p<0.05 ) , left ev ( p<0.001 ) , and left in ( p<0.01 ) ( table 3table 3.isokinetic strength at 30/sec ( nm)pre - testpost - testpeak torque(nm)inr42.3 9.743.7 12.4l54.3 9.962.2 12.9evr27.1 4.330.3 7.9l34.6 4.540.8 7.7ratio ( % ) r67.2 18.173.4 21.3l65.8 14.967.9 pf : planterflexion ; df : dorsiflexor , r : right ; l : left . similarly , a meta - analysis of the relationship between ankle instability and balance impairment demonstrated that weakening of the ankle evertors was associated with functional ankle instability24 . it is our opinion the the significant increases in ev and in strength after exercise in this study were due to the active rehabilitation exercise preventing weakening of the evertor muscles . additionally , the significant difference in ev strength is essential for the athletic performance of soccer players . our finding is consistent with previous studies reporting that continual strengthening of the evertors helps to protect against injury by preventing damage to the lateral ankle ligament and reducing tibial slope25 , 26 . generally , when evaluating isometric strength , lower limb muscle strength and the balance ratio are used to evaluate the isometric strength of individual muscles , and to predict the relative risk of certain injuries27 . pf : planterflexion ; df : dorsiflexor , r : right ; l : left . * p<0.05 , * * p<0.01 , * * * p<0.001 when standing erect , ankle stability can have a positive effect on standing balance , and even influence the stability of such movements as walking and jumping7 , 28 . in this study , the y balance test was used as an index of functional balance ability . the y balance test uses three directions of the star excursion balance test and it has been shown in previous studies to have a high reliability ( cronbach s =0.91 ) in assessments of patients with cai29 . in a previous study of functional rom in cai8 , improvements from 75.06 5.19% to 78.71 4.97% in the anterior direction , 93.3 10.37% to 97.47 11.20% in the posteromedial direction , and 85.92 11.97% to 93.09 12.96% in the posterolateral direction were reported , but they were not statistically significant . however , a comparison 1 week later showed results , which were consistent with those of our present study ( table 4table 4.functional ability as measured by the y balance test ( cm)pre - testpost - testa61.8 4.462.0 5.7rightpm95.7 8.797.6 10.9pl106.8 8.9106.9 7.1a63.5 5.863.8 4.2leftpm99.1 8.8100.5 10.9pl110.6 6.9111.3 the results cited above indicate there was improved functional balance ability , including muscle strength , flexibility , and proprioception in the lower limb , after only 1 week of repeated training . therefore , in order to improve function in the major joints of the lower limb , namely , the knee and ankle , participation in an exercise program that can improve muscle strength , flexibility , and proprioception is essential . values are mean sd . a : anterior ; pm : posteromedial ; pl : posterolateral active protocols that can reduce pain , and restore normal joint rom , muscle strength and endurance , and functional ability will need to be developed .

[ purpose ] the aim of the present study was to construct an integrated rehabilitation exercise program to prevent chronic pain and improve motor ability in cases of ankle injury and re - injury . [ subjects and methods ] twenty - six male soccer players who required functional strength exercises due to repeated ankle injury were the subjects . a 12-week rehabilitation exercise program was constructed with the aim of improving muscle strength in the ankle and dynamic coordination of the lower limb . muscle strength and dynamic coordination were evaluated using the y balance test , and isokinetic muscle strength of ankle dorsiflexion , plantarflexion , inversion , and eversion were measured before and after the 12-week program . [ results ] following 12 weeks of rehabilitation exercise , there were statistically significant improvements in the ratios of dorsiflexor strength to plantarflexor strength , eversion strength , and inversion strength on the left side . the other variables showed no significant changes . [ conclusion ] the rehabilitation exercise program for chronic ankle instability helped to reduce pain , and to restore normal joint range of motion , muscle strength and endurance , and functional ability . active protocols to improve complex functions need to be developed to complement these results .

INTRODUCTION SUBJECTS AND METHODS RESULTS DISCUSSION

a wide variety of ethical issues in the biological sciences are continuously debated by both scientists and the public . headlines regarding vaccines , evolution , genetically modified organisms , and many other related topics are frequently found in the media . this underscores the importance of exposing undergraduate science students to bioethics , since these students will become either professionals contributing to the headlines or members of the public responding to them . however , bioethics is not a required course in the biology curriculum for many colleges and universities in the united states , although several publications in the past decade support the importance of including ethics in undergraduate biology education in some form ( 1 , 2 ) . at missouri western state university , there is no formal requirement for students to take an ethics course , although they may opt to take a general studies ethics course as part of their general studies requirements . however , our students are informally exposed to many relevant issues in bioethics in various courses as well as independent research experiences and internships . one topic of particular relevance to the students in our health science concentration , most of whom are interested in professional or graduate school programs and careers involving patient care or health - related research , is the ethical guidelines for the use of human subjects in research . the goal of this project was to guide students through an overview of major events that led to the current united states federal guidelines for human subjects research using a popular nonfiction book , the immortal life of henrietta lacks ( 4 ) . this book describes the woman whose cervical tumor biopsy gave rise to the widely used hela cell line and the lives of her family after her death . it also discusses several infamous events that led to the creation of guidelines for human subjects research . additionally , it introduces the question of what rights a patient has to his or her cells and dna once removed from his or her body . these topics can all be covered in a more traditional lecture - style format or a stand - alone assignment , but the aim of this project was to use the human backstory to pique the students interest and increase their investment in learning about these topics . students were required to purchase the book as part of the requirements for an upper division molecular basis of disease course , which is an elective in our health science concentration . they were given eight weekly reading assignments of 30 to 40 pages and assigned a question related to the reading , with a 150- to 250- minimum word count requirement ( appendix 1 ) . questions were about either a relevant science topic or the student s reactions to events described within the assigned reading . responses to these questions were submitted via the online course management system and graded based on accuracy , length , and any writing issues such as grammatical errors or lack of clarity . in certain assignments , questions also required students to comment briefly on ethical issues relevant to the topics covered in that section of the book . in many chapters , skloot includes a description of the prevalent medical practices and gives the historical context for these practices ( for an example , see chapter 3 , p. 29 , beginning with : like many doctors of his era , telinde often used patients from the public wards for research ) ( 4 ) . these descriptions are usually brief , but serve to introduce students to the concept that determining what is ethical can vary depending on cultural views at the time . in addition , the book frequently mentions patient consent , a cornerstone of ethical treatment of human subjects in research , and notes that it was not commonly viewed as necessary in the 1950s and 1960s , when many of the events in the book take place . after the book was completed , students were assigned a short follow - up writing assignment that required them to summarize the current united states guidelines in place for research on human subjects and human tissues , as well as the major world events that led to the development of these guidelines . students were expected to identify major events referred to in the skloot book , such as the nuremburg trials and tuskegee syphilis study , but also to other events described in more detail by many readily available and reputable sources such as the belmont report ( 3 ) . students were also directed specifically to the afterword of the skloot book , which includes an excellent summary of the ethical issues and status of laws related to human tissues research . the combined total of the weekly assignments plus the short paper was worth 50 points out of 800 to 900 points available for the course . students in three different semester offerings of molecular basis of disease participated in this assignment . in the most recent semester , students were surveyed at the end of the course for their opinions on the usefulness and value of reading this book as part of the class . this study was approved by the missouri western state university institutional research board ( protocol # 783 ) . a total of 19 students completed the survey out of 20 enrolled in the course . student responses to weekly reading assignment questions varied greatly in depth and thoughtfulness , as expected . one unanticipated but positive outcome was that this type of assignment , which is atypical in our department s upper division biology majors courses , gave some quiet students an opportunity to show their writing ability and express surprisingly thoughtful answers . both informal feedback from students over three semesters and formal survey - based feedback from students in the most recent semester offering of this course were quite positive overall . as shown in table 1 , students felt that the book was an enjoyable read , and that they learned new information about ethics and the history of science from reading it . open - ended comments included generally positive statements such as it was not hard to stay focused , and since it was such a good read it did nt feel like homework and i thought it was very insightful because i never put much thought into the ethics of human tissue usage . students from the spring 2014 course offering were surveyed at the end of the semester for their subjective responses to the usefulness of reading this book and completing the assignments using a likert scale - based instrument ( n = 19 ) . in summary , this book has been a useful and well - liked assignment in a rigorous , upper - division biology majors course , and it provides an avenue for discussion of ethics related to this course topic . using this or other relevant popular nonfiction books may be a successful way to add an ethics component to a content - based biology course .

although bioethics is an important topic in modern society , it is not a required part of the curriculum for many biology degree programs in the united states . students in our program are exposed to biologically relevant ethical issues informally in many classes , but we do not have a requirement for a separate bioethics course . the immortal life of henrietta lacks is a recent nonfiction book that describes the life of the woman whose cervical cancer biopsy gave rise to the hela cell line , as well as discussing relevant medical , societal , and ethical issues surrounding human tissue use for research . weekly reading assignments from the book with discussion questions and a final paper were used to engage students in learning about the ethics of human subjects and human tissues research . students were surveyed for qualitative feedback on the usefulness of including this book as part of the course . this book has been a successful platform for increasing student knowledge and interest in ethics related to biomedical and biological research .

INTRODUCTION PROCEDURE CONCLUSION SUPPLEMENTAL MATERIALS

throughout human history we have sought to understand illness as a means of relieving its symptoms , particularly with respect to devising treatment options in the hope of developing cures . in this pursuit of medical knowledge we have shifted the balance of our answers and beliefs from non - evidence based phenomenology to one that is evidenced based . in this regard , it is recognized that placebo and folkloric , or traditional , types of intervention do take place through to today . also present in this multi - layered complex of curing are the understandings that physical resources are required for treatments , new discoveries are ongoing , and old methodologies undergo scrutiny . the technologies available today for improving symptoms and enhancing the chances of finding rapid cures / treatments now offer opportunities for advancing empirical knowledge , especially into the realm of personalized medicine whereby target therapies will provide for more precise outcomes on an individual basis . nonetheless , ethical concerns must be taken into account since denial of determinations / advanced knowledge based treatments associated with novel technologies may be dependent on issues of access , as well as the availability of financial resources . thus , it is evident that our understandings of molecular biology have brought us both medical optimism and significant concerns . understanding the control of gene expression is critical for our understanding of the relationship between genotype and phenotype[14 ] . the need for reliable assessment of transcript abundance in biological samples has driven researchers to develop novel technologies , such as dna microarray and rna - seq . briefly , the differences between the knowledge gained and methods used become apparent once the target sequences go beyond known genomic sequences and , thereby , increasing information . indeed , the depth of this potential information is necessary for the development of personalized medicine . furthermore , due to phenoconversion , giving attention solely to genotype may miss clinical outcomes , signaling the need for caution in data interpretation . the microarray and rna - seq techniques are somewhat different , providing an abundance of information requiring explanation . hybridization - based techniques such as microarray rely on and are limited to the transcripts bound to the array slides . microarrays are only as good as the bioinformatics data available for the model organism s genome and transcriptome . while rna - seq detects annotated transcripts , it will also detect novel sequences and splice variants . rna - seq can use data from the same experiment to detect non - coding rna , single nucleotide polymorphisms , and fusion genes , as well as characterize exon junctions . the utility of rna - seq for other bioinformatics studies aside from gene expression profiling far exceeds that of a microarray . in this light , rna - seq is useful for distinguishing host from parasite transcripts , studying symbioses , and examining transcripts from non - model organisms , including bacteria . analysis of rna - seq data also requires extensive experience and the bioinformatics skills necessary to process the data files . the data analysis techniques not only differ in the type of software used to initially reduce the data sets , but also for each use of rna - seq . for example , the size of an average raw data file from an agilent microarray is 0.7 mb , while the normal size of uncompressed rna - seq raw file is approximately 5 gb . thus , for just one study , these techniques generate an enormous amount of data , parts of which remain to be interpreted , particularly with respect to patterning and clustering of gene expression . this bioinformatics - based technology illustrates the growing need for physician and technician training and greater research into interpretational discoveries . this is especially significant due to the fact that it will eventually enter into the realm of clinical decision - making , once government approvals for such technologies are reached . in recent years today s knowledge of traits associated with genome pathology is made by inference from common traits without taking greater advantage of the knowledge gained in large sample studies , with demonstrate rare variations in the overall pool of populations and individuals . importantly , variants that emerge have not been incorporated in clinical practice , which is noteworthy due to the fact that these genetic variations may be the very foundation of personalized medicine and may also be used in revealing an organism s evolutionary history . as this field grows it increases its potential applicability in a wide array of clinical research . as noted earlier , it will assist physicians in making critical medical decisions . at present , however , these technologies are costly and , therefore , their integration into mainstream medical practice is hampered . nevertheless , as with many technologies , in time the price will decrease so that the information revealed could be readily used to contribute to patient care , including the development of individual databases and their variation , otherwise understood as personalized medicine . as this invaluable technology becomes more economical , it can be argued that there will be better proficiency in understanding genetic phenomena , particularly those involving gene pattern expression , benefiting clinical disciplines and improving the knowledge base of physicians , genetic councilors , and researchers . as such , the use of this broad cache of genome - related information will allow for more effective clinical examination and decision - making , also involving disorder progression and the development of strategic treatment modalities . in this regard , gene expression determinations may find similarities in various tumors previously considered different since they were originally described in one type of tissue / organ , whereas now the revealed expression pattern identifies it as similar . moreover , the genetic composition and information obtained from human , animal , and plant populations will become even more important for the novel design and interpretation of disease mapping processes in living organisms . this knowledge will aid in the further development of the concept and phenomenon of one medicine , which combines information in the veterinary and human medical fields . in support of one medicine , there are many health disorders that demonstrate a coupling of disease transmission and occurrence between animals and humans ( see [ 3,1622 ] ) , demonstrating a common molecular substrate between the two . thus , it is well known and understood that animals can have the same type of disorders found in humans ( e.g. , cancer , diabetes , arthritis , etc . ) , making comparative medicine an old discipline [ 3,1622 ] . given the many genome commonalities , one medicine also becomes important as a means of reducing associated medical costs . this potential can obviously be extended to all living organisms , and the variants can be incorporated into the knowledge base as another critical factor in medicine and evolution . however , we do recognize the fact that between different organisms , variation in the expression of genes will vary just as their biochemistry does as a way to accommodate and adapt to different environments . thus , counter - intuitively , these variations demonstrate the dynamic character of common life processes to survive . in part , this also explains why some medicines designed on the basis of stereospecificity may be ineffective in different organisms . as the fields of personalized and one medicine mature , in part , based on this wealth of molecular data , it will be invaluable to be able to correlate the molecular information with individual case reports . fortunately , what may be emerging is that molecular data can be retro - matched to appropriate patient pathologies . it can be predicted that associations in this analysis will emerge as financial access to the technology improves . in any event , the newness of these technologies and their insights require validation via established methodologies ( rt pcr , chromatography , and electrophoresis separation techniques coupled to ( mass ) spectrometry ) . for example , it is clear that the metabolic energy pathways are nearly the same or have similar components in all living cells . the same can be true for chemical messenger systems , growth , and development processes . in this regard , specific bioactive components / biochemicals are conserved and enhanced during evolution , as well as being used in novel ways [ 2427 ] . retention of specific molecules ( information ) appears to have started before animals and plants split during evolution . the molecular matching identities of these molecules are high , demonstrating that this is not occurring by chance in diverse living organisms . accordingly , this information has tremendous predictive value for biomedicine that can and will be used in one medicine . it comes as no surprise then to find that pharmaceuticals may affect the same target and/or different processes as demonstrated by adverse reactions reported for a particular drug . furthermore , this concept of one medicine aids in the understanding of why plants can and do produce bio - active chemicals , including signaling molecules of use in intracellular and extracellular communication , that influence animals as both nutrition and/or medicine . the force/factor conserving this phenomenon in evolution is stereo - specificity ( lock and key - like process ) , whereby these pathways require multiple conformational - specific enzymes . the enzymes are conformationally linked in specific pathways , constraining new information that may get in the pattern of final product expression . this process preserves information , explaining why similar important molecules are found in all animals and in plants ( common origin ) , and can be used in each other s signaling processes . in addition , conformational matching in a multiple enzyme mediated pathway forces the system to remain the same . in turn , this allows for little novel signal molecule variation across different phyla from single cell organisms to invertebrates and eventually vertebrates , expressing the critical genes in highly developed cellular network , finally allowing for cognition . in this light , given common signal molecules , the latest evolutionary advance occurs in intercellular signaling and the pattern of cellular organization , e.g. , networking . variation in the critical signaling / pathway molecules will only be tolerated if one step exhibits conformational homologies with the existing pattern of processing , producing a related but distinct product ( e.g. , catecholamine synthesis ) . taken together , one medicine becomes very feasible and based on sound molecular / cellular and intercellular networks that are similar across living organisms . this provides for the use of similar strategies , dealing with pathological issues in all animals and , in some instances , plants since they are part of a common core of life . given the advances in genome and gene expression technologies , an enormous amount of information is generated that enable the biomedical community to make strides toward the development of personalized medicine . in this regard , once informational analysis processes mature and , in part , computational biology and the technology becomes increasingly economical , medical costs will decrease as a result of more precise treatment modalities . moreover , these treatment modalities will be developed based on specific target design and at a more rapid pace . this development will be assisted by the realization that common polymorphisms and gene variants reveal their significance and , thereby , this can be incorporated into the medical therapy regime for individuals , thus improving the treatment efficacy . common signaling processes are abundant in living organisms , demonstrating a high level of conservation during evolution . this phenomenon can be exploited , such as though the development of drugs for one organism that can be used in another for the same , or different reason . a single drug may have influences that are regarded as healthy across species lines , making their testing and further development more economical and , thereby , lowering costs .

personalized medicine s foundation rests on the use of molecular technologies , which are being used to identify genetic mutations , polymorphisms , and variants that can be associated with an individual s genetic make up , revealing risk factors and predictive data . needless to say this same analysis can be performed on various types of cancers , including samples stored for many years under the right conditions . for the most part , these technologies employ microarray and rna - seq methodologies , which examine large numbers of gene expressions at a time , providing clustering and patterns of this expression . the methodologies and their evaluative outcomes further demonstrate that more than a single gene is involved with various phenomena . however , given the mass of data emerging from this analysis , and commonalities they reveal between various phenomena / disorders , achieving 100% certainty may not be that easy . another outcome from this massive store of molecular data is the concept of one medicine . this field has been developed by researchers in a variety of disciplines ( e.g. , medical and veterinary science ) that advocate for greater integration of animal and human health . one medicine takes advantage of the fact that molecular commonalities in major biochemical pathways occur because of evolutionary conservation , which is dependent on stereospecificity . in this regard , the foci of personalized medicine and one medicine are quite broad and require trained professionals , as well as a lowering of cost in order to be better integrated into mainstream medical practice .

Background Discussion Conclusions

various lumbar interbody fusion procedures are used to treat lumbar degenerative disc disease and spinal instability . among them , posterior lumbar interbody fusion ( plif ) and transforaminal lumbar interbody fusion ( tlif ) are representative surgical approaches . however , the disadvantages of wide open posterior approaches to the lumbar spine , such as persistent low back pain caused by iatrogenic muscle denervation resulting in atrophy and decreased trunk extensor strength , large amount of blood loss , and long recuperation time , are issues awaiting solutions4,10,11,14,15,27,29,32 ) . additionally , it has prompted the development of minimally invasive ( mis ) spinal surgery techniques such as mis - tlif and mis - alif . however , most of these reports have focused on surgical techniques and clinically significant results , such as reduced intraoperative blood loss , improvement in post - operative back pain , and shorter hospitalization stays , in comparison with conventional open surgery . very few studies based on radiographic results of mis lumbar interbody fusion have been performed . radiographic results , including interbody fusion , the restoration of disc height , foraminal height , and maintenance of normal lumbar lordosis are very important to post - operative clinical outcomes for lumbar interbody fusion surgery over the long term . the purpose of the present study was to evaluate the radiographic results of mis - alif and mis - tlif and also compare those of mis lumbar interbody fusion with conventional lumbar interbody fusion . we assessed 31 patients who were treated with mis lumbar interbody fusion in our hospital from july 2006 to september 2008 . the mean follow - up period was 31.6 months with a minimum 24 months ' follow - up . the patients consisted of 14 men and 17 women , and the mean age was 54 years ( range , 35 - 70 years ) . patients were diagnosed preoperatively with foraminal stenosis in 12 cases , degenerative spondylolisthesis in 7 cases , disc degenerative disorder ( ddd ) in 6 cases , isthmic spondylolisthesis in 4 cases , and recurrent hnp in 2 cases . twelve patients presenting with back pain or bilateral leg pain dominant pathology were treated with mis - alif , and 19 patients with unilateral radiating leg pain dominant pathology were treated with mis - tlif . percutaneous pedicle screw fixations with the sextant or viper system were used in all patients who underwent mis interbody fusions . thirty - four interbody fusion levels were performed in total : 6 on l3 - 4 , 15 on l4 - 5 , and 13 on the l5-s1 level . we selected 18 patients as a comparative group , with corresponding ages , gender ratio , and preoperative clinical symptoms , who underwent single level open tlif in 2007 and were followed up for at least two years . all patients underwent follow - up ct and x - rays at 1 , 6 , 12 , and 24 months postoperatively . in the present study , the following radiographic parameters were determined : interbody fusion , lumbar lordosis angle ( lla ) , fused segment angle ( fsa ) , sacral slope angle ( ssa ) , disc height ( dh ) and foraminal height ( fh ) , and the subsidence rate of interbody fusion . successful bony fusion was determined as follows : presence of bony bridging , absence of radiolucent lines around the cage on final follow - up ct or x - rays , and no motion on flexion / extension lateral x - rays . lla was estimated as the cobb 's angle between the l1 upper endplate and the s1 upper endplate . fsa was estimated as the cobb 's angle between the upper endplate of the upper vertebra and the lower endplate of the lower vertebra at the fusion level . ssa was determined as the angle between the s1 superior endplate and a horizontal reference line . disc height ( dh ) was calculated as the average of anterior disc height ( adh ) and posterior disc height ( pdh ) . foraminal height ( fh ) was estimated as the distance between the inferior pedicle wall above the index disc space and the superior pedicle wall of the lower vertebra ( fig . a subsidence rate of interbody disc height was calculated as a percentage as follows : [ immediate postoperative disc height - final disc height ] / [ immediate postoperative disc height ] 100 . radiographic parameters of mis lumbar interbody fusion were evaluated preoperatively and postoperatively and statistically analyzed . the changes of preoperative and final radiographic parameters were compared statistically between the mis - alif and mis - tlif groups and the mis - tlif and open tlif groups . statistical comparisons utilized the wilcoxon signed - rank test and the mann - whitney u test . the patient was placed in a prone position on a jackson operation table and taken to a lumbar lordosis position with hip extension . a longitudinal skin incision of approximately 3 cm in length was made lateral to the midline on the affected side . to approach the lesion facet joint precisely and minimize the skin incision , the distance from the spinous process line to the multifidus and longissimus muscle plane was measured on the preoperative axial mri ( fig . generally , the intermuscular plane is located at approximately 3 cm from the midline , and muscle dissection precedes 3 cm lateral to the midline ; however , the skin incision was made at 3 to 4 cm lateral to the midline . it is easier to lay the tubular retractor slightly to the lateral side and to facilitate decompression of opposite disc . an intermuscular plane dissection , which exfoliated the multifidus and longissimus muscles after fascial incision , after complete exfoliation of the facet joint lesion and part of the post lamina , the dilator was inserted to dilate the muscle , and a 22 mm quadrant tubular retractor ( medtronic sofamor danek , memphis , tn ) was subsequently inserted . after adjustments were made , it was then fixed on the operation table ( fig . the soft tissue on the lateral side of the facet joint was totally exfoliated , and a partial inferior vertebra transverse process was exposed . a fine high - speed drill was used to hollow out the groove at the inferior articular facet of the superior vertebra in " " shape , and a bayonet - shaped osteotome was used to break the bone . the osteotome was also used to break the exposed superior articular facet of the inferior vertebra . after total facetectomy was completed , the exposed ligamentum flavum was incrementally removed , and then the spinal canal in the medial , the traversing nerve root in the inferior medial , and the exiting nerve root in the superior lateral side were confirmed ( fig . if a central canal stenosis or contralateral side disc herniation was present , the tubular retractor was leaned more . the maximum amount of disc was removed , and meticulous endplate preparation was executed with diverse shaped and diverse angled reamer , distractors , curettes , scarpers , and pituitary punches . then , autologous and allograft bone were sufficiently inserted at the ventral disc space and was tamped down compactly using a bone impactor . a single large interbody cage was inserted as unilaterally as possible as oblique to the contralateral side while protecting the exiting and traversing nerve root with a root retractor ( fig . after completion of the interbody fusion procedure , in the same incision area , percutaneous pedicle screw fixations were performed , and rods were inserted under fluoroscopic guidance . identical procedures were performed on the opposite side . during rod compression and final tightening procedures under general anesthesia , the patient was placed in a prone position on a jackson operation table and taken to a lumbar lordosis position with hip extension . a longitudinal skin incision of approximately 3 cm in length was made lateral to the midline on the affected side . to approach the lesion facet joint precisely and minimize the skin incision , the distance from the spinous process line to the multifidus and longissimus muscle plane was measured on the preoperative axial mri ( fig . generally , the intermuscular plane is located at approximately 3 cm from the midline , and muscle dissection precedes 3 cm lateral to the midline ; however , the skin incision was made at 3 to 4 cm lateral to the midline . it is easier to lay the tubular retractor slightly to the lateral side and to facilitate decompression of opposite disc . an intermuscular plane dissection , which exfoliated the multifidus and longissimus muscles after fascial incision , after complete exfoliation of the facet joint lesion and part of the post lamina , the dilator was inserted to dilate the muscle , and a 22 mm quadrant tubular retractor ( medtronic sofamor danek , memphis , tn ) was subsequently inserted . after adjustments were made , it was then fixed on the operation table ( fig . the soft tissue on the lateral side of the facet joint was totally exfoliated , and a partial inferior vertebra transverse process was exposed . a fine high - speed drill was used to hollow out the groove at the inferior articular facet of the superior vertebra in " " shape , and a bayonet - shaped osteotome was used to break the bone . the osteotome was also used to break the exposed superior articular facet of the inferior vertebra . after total facetectomy was completed , the exposed ligamentum flavum was incrementally removed , and then the spinal canal in the medial , the traversing nerve root in the inferior medial , and the exiting nerve root in the superior lateral side were confirmed ( fig . if a central canal stenosis or contralateral side disc herniation was present , the tubular retractor was leaned more . the maximum amount of disc was removed , and meticulous endplate preparation was executed with diverse shaped and diverse angled reamer , distractors , curettes , scarpers , and pituitary punches . then , autologous and allograft bone were sufficiently inserted at the ventral disc space and was tamped down compactly using a bone impactor . a single large interbody cage was inserted as unilaterally as possible as oblique to the contralateral side while protecting the exiting and traversing nerve root with a root retractor ( fig . after completion of the interbody fusion procedure , in the same incision area , percutaneous pedicle screw fixations were performed , and rods were inserted under fluoroscopic guidance . identical procedures were performed on the opposite side . during rod compression and final tightening procedures under general anesthesia , the patient was placed in a prone position on a jackson operation table and taken to a lumbar lordosis position with hip extension . a longitudinal skin incision of approximately 3 cm in length was made lateral to the midline on the affected side . to approach the lesion facet joint precisely and minimize the skin incision , the distance from the spinous process line to the multifidus and longissimus muscle plane was measured on the preoperative axial mri ( fig . generally , the intermuscular plane is located at approximately 3 cm from the midline , and muscle dissection precedes 3 cm lateral to the midline ; however , the skin incision was made at 3 to 4 cm lateral to the midline . it is easier to lay the tubular retractor slightly to the lateral side and to facilitate decompression of opposite disc . an intermuscular plane dissection , which exfoliated the multifidus and longissimus muscles after fascial incision , after complete exfoliation of the facet joint lesion and part of the post lamina , the dilator was inserted to dilate the muscle , and a 22 mm quadrant tubular retractor ( medtronic sofamor danek , memphis , tn ) was subsequently inserted . after adjustments were made , it was then fixed on the operation table ( fig . the soft tissue on the lateral side of the facet joint was totally exfoliated , and a partial inferior vertebra transverse process was exposed . a fine high - speed drill was used to hollow out the groove at the inferior articular facet of the superior vertebra in " " shape , and a bayonet - shaped osteotome was used to break the bone . the osteotome was also used to break the exposed superior articular facet of the inferior vertebra . after total facetectomy was completed , the exposed ligamentum flavum was incrementally removed , and then the spinal canal in the medial , the traversing nerve root in the inferior medial , and the exiting nerve root in the superior lateral side were confirmed ( fig . if a central canal stenosis or contralateral side disc herniation was present , the tubular retractor was leaned more . the maximum amount of disc was removed , and meticulous endplate preparation was executed with diverse shaped and diverse angled reamer , distractors , curettes , scarpers , and pituitary punches . then , autologous and allograft bone were sufficiently inserted at the ventral disc space and was tamped down compactly using a bone impactor . a single large interbody cage was inserted as unilaterally as possible as oblique to the contralateral side while protecting the exiting and traversing nerve root with a root retractor ( fig . after completion of the interbody fusion procedure , in the same incision area , percutaneous pedicle screw fixations were performed , and rods were inserted under fluoroscopic guidance . identical procedures were performed on the opposite side . during rod compression and final tightening procedures thirty - one patients who were treated with mis lumbar interbody fusion in our hospital were evaluated in this study . twelve patients underwent mis - alif and 19 patients underwent mis - tlif procedures . in the mis interbody fusion cases , pre- and postoperative radiographic parameters were the following : mean lumbar lordosis angle ( lla ) , 32.812.1 and 38.911.1 ; fused segment angle ( fsa ) , 12.16.3 and 14.86.7 ; sacral slope angle ( ssa ) , 30.17.3 and 32.58.6 ; disc height ( dh ) , 10.03.0 mm and 13.92.5 mm ; and foraminal height ( fh ) , 16.74.5 mm and 19.93.9 mm . all radiographic parameters had statistically significant improvements at the postoperative measurement except for ssa ( table 1 ) . the changes ( final value - preoperative value ) of radiographic parameters between mis - alif and mis - tlif were also analyzed . in the mis - alif group , the changes of radiographic parameters were as follows : lla , fsa , ssa , dh , and fh were 12.17.4 , 5.53.5 , 3.55.2 , 6.32.6 mm , and 4.33.3 mm , respectively . in the mis - tlif group , changes in values in the same order were as follows : 2.19.7 , 0.74.9,1.55.2 , 2.31.9 mm , and 2.43.2 mm . no significant differences in ssa and fh were observed between the two groups , although lla , fsa , and dh showed statistically significant increases in the mis - alif group ( table 2 ) . in 2007 , 18 patients who had single level open tlif with a minimum 12 months x - ray follow - up were analyzed for the same parameters . between the open tlif and mis - tlif groups , the changes ( final value - preoperative value ) of radiographic parameters were compared . the changes of lla , fsa , ssa , dh , and fh in the open tlif group were 5.412.1 , 3.64.5 , 1.710.2 , 4.34.0 mm , and 3.03.2 mm , respectively . only the disc height was significantly increased in the open tlif group ; the other parameters were not significantly different ( table 3 ) . additionally , a mean subsidence rate of interbody disc height was 12.04% ( table 4 ) , and the fusion rate was 96% ( one pseudarthrosis in the mis - alif group ) . the mis - tlif technique was reported by foley et al.6 ) in 2003 and has come into wide use . this technique involves partially dissecting and dilating the paraspinal muscle using a 20 - 24 mm - sized small tubular retractor , performing unilateral facetectomy , interbody bone fusion , and percutaneous pedicle screw fixation . therefore , this procedure has the advantages of minimizing paraspinal muscle and soft tissue injury , no need for transfusion by reducing intraoperative bleeding , makes early ambulation possible because postoperative back pain is minimal , and reduces the number of in - hospital days as compared with standard open lumbar interbody fusion techniques24,28 ) . despite these many merits cm operative field of view , the exposure and resection of the targeted facet joint ( inferior and superior articular facet ) , epidural bleeding control , discectomy , sufficient neural decompression , endplate preparation , and appropriate interbody cage insertion without nerve root injury requires a great deal of time and is uncomfortable for the operator22 ) . however , one level lesion can be finished up successfully within 3 hours after a learning curve period of approximately 15 cases . in our study , unilateral leg pain dominant pathologies , such as disc protrusion with instability , recurrent disc herniation , unilateral foraminal stenosis , unilateral foraminal disc herniation , and grade i spondylolisthesis were treated with mis - tlif . the mis - alif technique was developed for minimizing abdominal soft tissue and internal organ injury , which can lead to the early recovery of the patient by reducing post - operative pain and complications such as wound problems . the greatest advantage of the alif approach may be the direct access and visualization of the intervertebral disc space . as a result , it is generally accepted that this approach can achieve a more complete discectomy , secure a wide fusion bed , and perform a more effective restoration of disc and foraminal height . additionally , it is easier to correct a sagittal balance as lumbar lordosis by anterior column support and stabilization directly . furthermore , alif does not violate the posterior spinal musculature or bony elements , and epidural scarring , nerve root retraction , and perineural fibrosis can be avoided . in this study , back pain dominant or bilateral pathologies , such as lumbar disc degenerative disorder ( ddd ) , unilateral or bilateral foraminal stenosis with significant disc space narrowing , and grade ii and more spondylolisthesis were treated with mis - alif . in the present study , evaluated radiographic parameters were shown as lumbar lordosis angle ( lla ) , fused segment angle ( fsa ) , sacral slope angle ( ssa ) , foraminal height ( fh ) , and disc height ( dh ) . radiographic parameters related to sagittal balance , such as lla , fsa , and ssa , are significantly correlated with low back pain ( lbp)17 ) and adjacent segment degeneration ( asd)21 ) , postoperatively . lazennec et al.19 ) reported that lbp developing after fusion surgery was shown to be significantly related to a decreased sacral tilt , increased pelvic tilt , and decreased lumbar lordosis . additionally , postoperative sagittal lumbar malalignment can accelerate adjacent segment deterioration by loading the motion segment in a nonphysiologic fashion30 ) . the optimal sagittal balance obtained with surgical correction of a spinal deformity may also affect the environment for bony fusion , preservation of the adjacent levels , and clinical outcome over the long term1,5,8,18 ) . unlike other studies , our study includes radiographic results of mis - alif as well as mis - tlif . in the mis - alif group , the change ( final value - preoperative value ) of lla , fsa , and ssa was 12.1 , 5.5 , and 3.5 ; it is an obvious improvement of regional sagittal balance . in the mis - tlif group statistical analysis between the two groups showed that mis - alif was more effective in correcting sagittal balance than mis - tlif ( table 2 ) . moreover , the changes of lla , fsa , and ssa after mis - tlif were comparable to those of open tlif in statistical analysis between open tlif and mis - tlif ( table 3 ) . this indicates that mis lumbar interbody fusion surgery is a viable strategy for sagittal balance correction of lumbar degenerative disc disease . in the present study , evaluated foraminal height ( fh ) and disc height ( dh ) are correlated with radiculopathy . in foraminal stenosis , a nerve root is compressed laterally to the intervertebral foramen by bony structures such as a hypertrophied facet and spur developed by disc degeneration7,31 ) . disc degeneration causes disc height and foraminal height to be narrowed , which are checked on lateral x - ray as the parameters of foraminal stenosis . surgical removal of bony structures and restoration of foraminal and disc height can decrease the radiating leg pain of the patient . kim et al.16 ) reported that by mis - tlif , dh was significantly increased at the final follow - up compared with the preoperative value , but fh was not evaluated . in our cases , dh was increased from 10.0 mm prior to surgery to 13.9 mm at the final follow - up , and fh was increased from 16.7 mm to 19.9 mm . both changes were statistically significant differences ( table 1 ) . in the mis - alif group , the changes ( final value - preoperative value ) of dh and fh were obvious , as increases of 6.3 mm and 4.3 mm , respectively , were observed . in the mis - tlif group , mis - alif was more effective in the restoration of disc height than mis - tlif ( table 2 ) . these differences may be explained that mis - alif is performed anterior opening and release by resection of all , and it can be more restored dh as well as fh compared that of mis - tlif . additionally , both the open tlif and mis - tlif groups showed statistically significant increases in fh ; however , this was not the case for dh(table 3 ) . as a result , the restoration of dh and fh are sufficiently possible with mis lumbar interbody fusion , which can resolve the radiating leg pain of patients successful interbody bone fusion is essential to getting a good clinical outcome ; if successful bony fusion is not achieved , back pain occurs in the long term . previously reported fusion rates after plif ranged from 56 to 100%2,13,23 ) , and fusion rates after tlif have ranged from 86 to 100%9,12,22,25 - 28 ) . the limited exposure inherent to mis techniques that requires fusion has the potential to affect adequate bone grafting and endplate preparation to allow for arthrodesis to occur . potter et al.25 ) have reported that for obtaining firm interbody fusion , exposure of more than 30% of the interbody endplate is required , and clinically , by using the unilateral transforaminal approach , an average of 69% of the disc volume ( 56% of the endplate ) could be removed . it is actually very difficult within the narrow operative field of the mis approach . despite this concern , several articles on mis - tlif have demonstrated good bone fusion rates ranging from 92 to 100%16,20,33 ) . on the other hand , deutsch et al.3 ) reported a fusion rate for mis - tlif of 65% . in the present study , the fusion rates of mis - tlif and mis - alif group were 100% and 91.7%(one psuedoarthrodesis in mis - alif group ) , respectively . we made a ceaseless effort for successful bone fusion in as many patients as possible ; meticulous and precise endplate preparation and grafting a large amount of mixed bone chips to the ventral interbody disc space before cage insertion were performed within a narrow operative field . finally , the subsidence of interbody disc height is important to lumbar interbody fusion surgery postoperatively . progress of subsidence can cause a recurrent foraminal stenosis by narrowing foraminal height and destroy a corrected sagittal balance , which may lead to recurrent radiating leg and back pain . in our study , usually , significant subsidence is defined as a decrease in interbody disc height of more than 3 mm . thus , our subsidence rate of interbody disc height seems remarkably low . for minimizing the subsidence rate of interbody disc height , grafting a lot of mixed bone chips compactly at the ventral disc space for anterior column support and inserting a single large interbody cage as unilaterally as possible as oblique to the contralateral side for equal distribution of axial loading to the cage these kinds of operator 's efforts can bring out a high fusion rate and low subsidence rate . mis lumbar interbody fusion ( mis - alif and mis - tlif ) is successful and safe with the advantages of minimally invasive spine surgery ( miss ) . radiographic results , including fusion rate , restoration of disc and foraminal height , and the improvement of lumbar lordosis were comparable to those with conventional open surgery . additionally , mis - alif is more effective in the restoration of lumbar lordosis and disc height than mis - tlif . to determine the effectiveness of mis lumbar interbody fusion , larger , long - term , prospective studies are needed in the future

objectiveto evaluate the radiographic results of minimally invasive ( mis ) anterior lumbar interbody fusion ( alif ) and transforaminal lumbar interbody fusion ( tlif).methodstwelve and nineteen patients who underwent mis - alif , mis - tlif , respectively , from 2006 to 2008 were analyzed with a minimum 24-months ' follow - up . additionally , 18 patients treated with single level open tlif surgery in 2007 were evaluated as a comparative group . x - rays and ct images were evaluated preoperatively , postoperatively , and at the final follow - up . fusion and subsidence rates were determined , and radiographic parameters , including lumbar lordosis angle ( lla ) , fused segment angle ( fsa ) , sacral slope angle ( ssa ) , disc height ( dh ) , and foraminal height ( fh ) , were analyzed . these parameters were also compared between the open and mis - tlif groups.resultsin the mis interbody fusion group , statistically significant increases were observed in lla , fsa , and dh and fh between preoperative and final values . the changes in lla , fsa , and dh were significantly increased in the mis - alif group compared with the mis - tlif group , but ssa and fh were not significantly different . no significant differences were seen between open and mis - tlif except for dh . the interbody subsidence and fusion rates of the mis groups were 12.04% and 96% , respectively.conclusionradiographic results of mis interbody fusion surgery are as favorable as those with conventional surgery regarding fusion , restoration of disc height , foraminal height , and lumbar lordosis . mis - alif is more effective than mis - tlif for intervertebral disc height restoration and lumbar lordosis .

INTRODUCTION MATERIALS AND METHODS Surgical technique Minimally invasive transforaminal lumbar interbody fusion (MIS-TLIF) RESULTS DISCUSSION CONCLUSION

the odontogenic keratocyst ( okc ) is a cystic lesion of odontogenic origin , which is classified as a developmental cyst derived from the dental lamina . okc is known for its rapid growth and its tendency to invade the adjacent tissues including bone . it has a high recurrence rate and is associated with the basal cell nevus syndrome . the distribution between sexes varies from equality to a male to female ratio of 1.6:1 , except in children . okcs may occur in any part of the upper and lower jaw , with the majority occurring in the mandible , most commonly in the angle of the mandible and ramus . the okc involves approximately 11% of all cysts in the jaws and is most often located in the mandibular ramus and angle . this lesion can be associated , although not in all cases , with an impacted third molar . radiographically , okcs demonstrate a well - defined unilocular or multilocular radiolucency with smooth and often corticated margins . okcs tend to grow in an anteroposterior direction within the medullary cavity of the bone without causing obvious bone expansion . okcs of the maxilla are smaller in size compared to those of the mandible . when they are large , they tend to expand bone . these lesions can also present as a small and oval radiolucency between teeth , simulating a lateral periodontal cyst . they can also appear as a radiolucency simulating radiographic presentation of the residual apical periodontal cyst . histologic features of these cysts were subsequently described by shear and by pindborg and hansen . the keratocyts are classified as a developmental epithelial cyst and comprise approximately 11% of all cysts of the jaws . ahlfors . found a mean age of 41 years at the time of diagnosis in 255 patients . there appeared to be two incidence peaks between 25 and 34 years , and 55 and 64 years of age . the histologic features of okcs include a thin epithelial lining , usually consisting of fewer than six cell layers in a corrugated tissue composed of thin , irregular bundles of collagen , and often contain islands of epithelium that may represent daughter cysts . in many cysts , there is a tendency for the epithelium to separate from the underlying cyst wall . histopathologically , they typically show a thin , friable wall , which is often difficult to enucleate from the bone in one piece , and have small satellite cysts within fibrous wall . therefore , okcs often tend to recur after treatment . okcs contain a dirty white , viscoid suspension of keratin , which has an appearance of pus , but without an offensive smell . the following are used to test the presence of keratin . the smear should be stained and examined for keratin cells.electrophoresis reveals low protein content , which is mostly albumin.total protein is found to be below 4 g/100 ml . a 11-year - old female patient reported to the outpatient department of modern dental college and research center , indore , in may 2010 , with a complaint of swelling on the right side of the chin that caused considerable asymmetry of the face [ figure 1 ] . as narrated by her father , the swelling was noted 6 weeks previously , while its size increased gradually , but progressively . intraoral examination was painless and caused no alteration in sensation over the mental nerve distribution . the labio buccal sulcus was obliterated [ figure 2 ] by a bony swelling and fluctuation was elicited in its center . bony expansion extended from 72 to 46 lingually and the overlying mucosa showed normal texture . the adjacent teeth were all mobile and were assigned grade ii to grade iii mobility . the radiographs taken were ( ortho pantomo gram ( opg ) , intra oral peri apical ( iopa),12fnx017fnx016 ) and chest x - ray [ figure 2 ] . ( 71,72,73,74,81,82,83 ) fine needle aspiration cytology ( fnac ) was done and pus was thick in consistency . electrophoresis of the cystic fluid demonstrated low soluble protein content ( < 3.75 g/100 ml ) . tentative diagnosis of okc was made and confirmed later by histologic examination of the surgical specimen . the cross - section showed parakeratinized stratified squamous epithelium with uniform thickness in most areas and with a prominent palisading basal layer , which was consistent with the preoperative diagnosis of okc . the operation was performed under general anesthesia by enucleation of the cyst , according to the principle of partsch ii . facial asymmetry on right side of face large odontogenic keratocyst involving an impacted canine with unilocular and scalloped borders intraoral view showing obliteration of the labio - buccal sulcus under all aseptic precautions in the operation theater , general anesthesia was given to the patient . degloving incision was made 6 - 8 mm below the attached gingiva [ figure 4 ] . mucoperiosteal flap was raised and then small perforation was made for aspiration of cystic contents and impacted canine was exposed [ figure 5 ] . then , the cystic linings was removed and impacted teeth were removed [ figures 6 and 7 ] and curettage was done with carnoy 's solution [ figure 9 ] . the site was closed with betadine soaked gauze pack and their borders are then sutured to create an open cavity that communicates with the oral cavity [ figure 8 ] . degloving incision marked 6 - 8 cm away from attached gingival small perforation with exposure of impacted canine composed of thin , irregular bundles of collagen , contains islands of epithelium that may represent daughter cyst lining was removed intact after curettage , betadine soaked gauze pack placed in the cavity extraction of impacted canine under all aseptic precautions in the operation theater , general anesthesia was given to the patient . degloving incision was made 6 - 8 mm below the attached gingiva [ figure 4 ] . mucoperiosteal flap was raised and then small perforation was made for aspiration of cystic contents and impacted canine was exposed [ figure 5 ] . then , the cystic linings was removed and impacted teeth were removed [ figures 6 and 7 ] and curettage was done with carnoy 's solution [ figure 9 ] . the site was closed with betadine soaked gauze pack and their borders are then sutured to create an open cavity that communicates with the oral cavity [ figure 8 ] . degloving incision marked 6 - 8 cm away from attached gingival small perforation with exposure of impacted canine composed of thin , irregular bundles of collagen , contains islands of epithelium that may represent daughter cyst lining was removed intact after curettage , betadine soaked gauze pack placed in the cavity extraction of impacted canine treatments are generally classified as conservative and aggressive . conservative treatment generally includes simple enucleation , with or without curettage , using spoon curettes of marsupialization . aggressive treatment generally includes peripheral ostectomy , chemical curettage with carnoy 's solution and resection . some surgeons believe that the cyst can be properly treated with enucleation if the lesion is removed intact . however , complete removal of the okc can be difficult because of the thin , friable epithelial lining , limited surgical access , skill and experience of the surgeon , cortical perforation , and the desire to preserve adjacent vital structures . the goals of treatment should involve eliminating the potential for recurrence while also minimizing the surgical morbidity . secondly , it involves growth of a new okc from small satellite cysts of odontogenic epithelial rests left behind by the surgical treatment . the third reason involves the development of an unrelated okc in an adjacent region of the jaws , which is interpreted as a recurrence . marx and stern believe that the two most common reasons for recurrence are incomplete cyst removal and new primary cyst formation . the majority of cases of recurrence occur within the first 5 years after treatment . because of the problematic nature of these cysts , many attempts have been made to reduce the high recurrence rate by improved surgical techniques . this technique is based on the externalization of the cyst through the creation of a surgical window in the buccal mucosa and in the cystic wall . their borders are then sutured to create an open cavity that communicates with the oral cavity . this procedure relieves pressure from the cystic fluid , allowing reduction of the cystic space and facilitating bone apposition to the cystic walls . currently , treatment involving careful and aggressive enucleation with close follow - up has been advocated for the okc . john and james described the use of enucleation in conjunction with a chemical cauterizing agent and excision of overlying mucosa as a means of reducing recurrence . because the lining of the okc is characteristically thin and friable , removal of the cysts in one piece may be difficult . great care must therefore be taken to ensure complete removal of the cyst lining , without leaving behind remnants attached to the adjacent bone or soft tissue . the high recurrence rate associated with okcs is a result of satellite cysts confined to the fibrous walls of the okcs . it should be emphasized that if the fibrous capsule is completely removed , no satellite cysts will be retained to serve as a nidus for recurrence . in view of the possible recurrence of the cysts from basal cell proliferation and because of the fragility of the cyst wall and the presence of satellite cysts , the osseous walls of the defect are abraded with coarse surgical or acrylic burs to ensure that residual peripheral cystic tissue is removed . enucleation is not always easy because the lining may be extremely thin and friable , and access in the depths of the mandible may be limited . multilocular cysts with bony trabeculae present special problems , in as much as it is difficult to remove the lining in one piece . enucleation with excision of the soft tissue overlying the okcs has been proposed in an attempt to reduce the incidence of recurrence . a number of authors advocated the use of tanning with carnoy 's solution ( absolute alcohol , chloroform , glacial acetic acid , and ferric chloride ) before enucleation of the cysts . this procedure is often followed by excision of the overlying mucosa in continuity with the lesion . the okc has been the subject of much debate over the last 50 years with respect to its origin , its growth , and treatment modalities . the obvious advantages of our treatment techniques are as follows : eradication of the pathologic lesion , reduction of the potential for recurrence andpreservation of the continuity of the mandible , thus maintaining jaw function and shape . eradication of the pathologic lesion , reduction of the potential for recurrence and preservation of the continuity of the mandible , thus maintaining jaw function and shape .

although odontogenic keratocysts ( okcs ) are benign , they are often locally destructive and tend to recur after conservative surgical treatment . they must therefore be distinguished from other cysts of the jaw . keratocysts possess outpouchings and microscopic daughter cysts from which recurrences may arise . histologic examination is essential for diagnosis since the appearances on roentgenograms and at operation usually do not reveal the true nature of the lesion . since many non - dental surgeons and pathologists are unaware of okcs , a case is presented in which surgical treatment was by original conservative method . decompression causes a reduction in the cyst volume with new bone formation so that the structures impinged upon ( e.g. , teeth , nerves ) are completely free .

Introduction Cyst Contents (aspirate) Case Report Surgical procedure Discussion Conclusion

recurrent urinary tract infections ( uti ) , renal scarring , and the subsequent end - stage renal disease can be life threatening in these children . the main goal of treatment of vur is to prevent further episodes of uti and to avoid progressive renal scarring . open surgical reimplantation can be attempted intravesical , extravesical , or a combined intra- and extra - vesical approach . various authors have reported an increased incidence of postoperative bladder spasms , hematuria , and prolonged hospital stay with intravesical repairs . the purpose of this article is to assess the outcomes of the extravesical ureteral reimplantation ( evr ) of modified gregoir lich technique and intravesical cohen 's ureteral reimplantation ( cur ) . between 2003 and 2014 , children diagnosed with primary vur and undergoing ureteric reimplantation at our institution were evaluated for inclusion in this study . patients with grade 12 vur , who were conservatively managed with antimicrobial prophylaxis and were not included . those with higher grade of reflux were initially conservatively managed , but those who developed recurrent breakthrough utis / worsening of scars were intervened surgically . those with secondary vur ( posterior urethral valves , neurogenic bladder , or bowel bladder dysfunction ) , associated anomalies such as ureteroceles , duplex systems , and ectopic ureters were excluded from our study . those patients who did not have a follow - up evaluation or who did not turn up for follow - up were also excluded from our study . among the remaining patients with primary vur , evr was performed in group 1 , whereas cur in group 2 modified nerve sparing evr was performed in children younger than 2 years with bilateral vur , as gaining adequate transtrigonal tunnel by a cur would have been difficult in this cohort ( group 1a ) and in those with unilateral vur ( group 1b ; the ureteric orifices would be placed one over the other with cur in unilateral reflux , and this may cause confusion in instrumentation of the ureteric orifices later in life , if needed ) . cur ( n = 67 ) was performed in children older than 2 years with bilateral vur [ figure 1 ] . ( a ) unilateral grade 4 vesicoureteral reflux in a 15-month - old child with a small bladder capacity , a typical case for extravesical reimplantation ; ( b ) bilateral grade 45 vesicoureteral reflux in a child older than 2 years with a good bladder size , a typical case for cohen 's reimplantation the following parameters were compared : length of the surgical procedure , average duration of stay in the hospital , postoperative bladder spasms ( excessive colic immediately before voiding / pericatheter leakage of urine / requirement of anticholinergics in addition to regular painkillers ) , significant postoperative hematuria ( for more than 72 h / required blood transfusions / clot retention ) . long - term complications of the procedure such as persistent reflux and ureteral obstruction were also assessed . postoperative evaluation included ultrasound + voiding cystourethrography ( vcug ) at 3 months and ultrasound + radionuclide imaging at 1 year postoperatively . urodynamic assessment was not performed in the pre / postoperative period as a part of this study . over a period of 11 years , between 2003 and 2014 , 750 children with vur were diagnosed and 188 ureteric reimplants were performed in our institution . after excluding 70 patients as per our exclusion criteria , a total of 118 patients were recruited into the study . evr was performed in 51 patients ( group 1 ) , whereas cur in 67 ( group 2 ) . the mean age at operation was 15 months for group 1 ( range 1024 months ) , whereas in group 2 , it was 36 months ( range 2460 months ) . the median age for the two groups was 16 months and 40 months , respectively . there was a female preponderance ( male : female = 43:75 ) . among group 1 , 32 underwent bilateral evr ( group 1a ) , whereas the remaining underwent unilateral evr ( group 1b ) . the mean duration of bilateral reimplantation was significantly less ( p = 0.0001 ) in group 1a ( n = 32 ; mean 104 min ; standard deviation [ sd ] 18 min ) compared to that in group 2 ( n = 67 ; mean 128 min ; sd 15 min ) . the mean ( sd ) postoperative stay was significantly lower ( p = 0.0001 ) at 4.5 ( 1.5 ) days in group 1a compared to 6.5 ( 0.5 ) days in group 2 . postoperative bladder spasms were significantly lower ( p = 0.03 ) at 10/32 in group 1a compared to 37/67 in group 2 . postoperative hematuria was significantly lower ( p = 0.03 ) at 10/32 in group 1a compared to 31/67 in group 2 . on a repeat vcug at 3 months , persistent vur was noted in 4/51 ( 7.85% ) in group 1 compared to and 5/67 in group 2 ( 7.5% ) . there was no significant difference between the groups and none of these patients developed recurrent febrile uti to warrant further intervention . at 1 year follow , none of them had any evidence of ureteral obstruction on the radionuclide imaging . group 1a ( bilateral extravesical reimplantation ) had significantly less duration of surgery , duration of stay , postoperative hematuria , and bladder spasms compared to group 2 ( bilateral cohen 's reimplantation ) the principal goal of any antireflux procedure is to restore the near normal antirefluxing mechanism of the ureterovesical junction . the fact that there are a plenty of surgical techniques available for correction of vur means there is not a single foolproof technique that would suffice in the management of these patients . the evr has generally been considered to be associated with reduced morbidity in comparison to cur . the overall incidence of hematuria , bladder spasms , convalescence period , and the overall hospital stay have all been less with evr than with cur . in an attempt to further reduce the postoperative complications , zaontz et al . used a modified extravesical technique , where they created a submucosal tunnel , advanced the ureteral meatus and anchored it onto the trigone and closed it with a detrusor buttressing of the ureter , for which they coined the term detrusorrhaphy . they claimed a very minimal postoperative morbidity with such procedure . ellsworth et al . compared the extravesical detrusorrhaphy with cur and claimed that the success rate is the same in both groups . however , patients undergoing evr needed fewer pain medications and lesser anticholinergics to control bladder spasms . they also noted that patients undergoing bilateral extravesical approach were associated with transient urinary retention . wacksman et al . in 1992 performed evr in 132 patients and observed that evr and detrusorrhaphy are associated with a reduced postoperative morbidity and shortened hospital stay . in our study , the evr technique was found to be superior to that of cur , in terms of duration of surgery , postoperative hospital stay , incidence of hematuria and bladder spasms , and overall postoperative complications . the difference in the age distribution between groups could be a pitfall in the current study design . however , a nerve - sparing technique proposed by david reduced these complications , and in our study , none of the patient , who underwent bilateral evr developed retention . in addition , a relatively straight access of ureter makes it easier for upper tract instrumentation , if needed at a later date . with the advent of laparoscopic and robotic techniques further studies should through more light on the superiority of these techniques via a minimally invasive route . it has the advantage of keeping a straight access to the upper tract for future instrumentation .

introduction : there are multiple techniques for surgical correction of vesicoureteral reflux ( vur ) . we compared the outcomes of extravesical versus cohen 's reimplantation for vur in children.methods:records of all children ( n = 118 ) who underwent reimplantation for vur between 2003 and 2014 were analyzed ( male : female = 43:75 ) . children with secondary vur , duplication anomalies , and ectopic ureter were excluded from our study . extravesical reimplantation ( evr ) was performed bilateral in 32 children ( group 1a ) and unilateral in 19 ( group 1b ) , while bilateral cohen 's reimplantation was performed in 67 ( group 2 ) . parameters compared were length of the surgical procedure , average duration of stay in the hospital , postoperative bladder spasms , significant hematuria > 72 h , and long - term complications.results:the mean age at operation was 15 months in group 1 , and 36 months in group 2 . the mean duration of surgery was significantly less ( p = 0.0001 ) in group 1a ( n = 32 ; mean 104 min ; standard deviation [ sd ] 18 min ) compared to group 2 ( n = 67 ; mean 128 min ; sd 15 min ) . the mean ( sd ) postoperative stay was significantly lower ( p = 0.0001 ) at 4.5 ( 1.5 ) days in group 1a compared to 6.5 ( 0.5 ) days in group 2 . postoperative bladder spasms were significantly lower ( p = 0.03 ) at 10/32 in group 1a compared to 37/67 in group 2 . all patients responded well with anticholinergics . postoperative hematuria and bladder spasms were significantly lower ( p = 0.03 ) in group 1a compared to group 2 . there was no significant difference in persistent vur between group 1 and group 2 . at 1 year follow , none of them had any evidence of ureteral obstruction.conclusions:evr has lower operative time , less postoperative discomfort and shorter hospital stay compared to cohen 's reimplantation . both techniques are equally effective in treating reflux .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSIONS None Financial support and sponsorship Conflicts of interest

were asked to participate in a survey describing the menus and serving system in the canteen . worksite information was obtained on number of meals served , occupation ( physically exacting to sedentary work ) , sex distribution , and canteen serving system to make sure that the final distribution would match the country as a whole . two worksites refused to participate because of lack of time and one worksite was excluded to match the desired average distribution . afterwards , the 20 worksites were asked to participate in the present study focusing on individual canteen food intake . five of the 20 worksites refused to participate with the following reasons : lack of time ( three worksites ) or concerns of the employees ' reaction to the study ( two worksites ) . eight of the worksites that agreed to participate mainly served buffet style and seven of the worksites served la carte line . the double portion technique with subsequent chemical analysis was used to quantify actual lunch intakes at the worksite canteens . duplicate portions were collected from a total of 12 customers at each canteen on two different days ( six samples per day ) . employees were asked at random to participate in the study , and in average two persons at each canteen rejected to participate . all items of the meal including bread , spread , fruit , dessert , etc . after the employees finished eating their lunch , they were asked to return the plates to the technicians in order to record / subtract plate waste . the duplicate portions were individually mixed and homogenized in a grindomix type gm200 ( retch ) . fast food was defined as food that can be eaten without the use of knife and fork . before the data collection was carried out , a survey was performed to study the consumption of various kinds of fast food in denmark , and the result of this survey was used to plan the data collection to be representative for the consumption of fast food in denmark . fast food samples were collected from 52 retail places representing both city ( aarhus ) and provincial towns , including pizzerias , major burger chain restaurants , outlets selling fast food , hot - dog stands , kiosks , and petrol stations . a total of 250 samples were collected in the period february 2004 to june 2005 . the samples were subdivided into seven groups of fast food and further divided into 45 different subgroups . the seven main groups were : burgers , sandwiches , pitas , durum rolls , sausages , grilled meals , and pizzas . three items of each of the 250 fast foods were collected , weighed separately , then mixed and homogenized in a grindomixer ( retsch ) and kept in plastic bags at 18c until analysis . moreover , one sample of each fast food was separated and all components were weighted . the chloride ion concentration was determined by potentiometric titration with silver nitrate solution , and salt content was estimated from the chloride content . analyses of the content of protein , fat , and ash were performed according to procedures given by the nordic committee on food analysis ( 1012 ) . dry matter content was determined by drying in a vacuum oven at 70c to constant weight . carbohydrate and energy content were calculated from contents of dry matter , protein , fat , and ash ( 13 ) . canteen meals were categorized into four groups : ( 1 ) hot meals , ( 2 ) sandwiches ( mainly open sandwiches ) , ( 3 ) salad , or ( 4 ) a combination of hot meals / sandwiches and salad / fruit / snack vegetables . as some fast food is eaten as combo menus with a combination of e.g. sausages and bread , ketchup , mustard , burger in combination with chips , etc . , the salt content of typical menus was calculated . the calculations were made by using food composition table values ( 14 ) for the salt content and the analyzed value for the main part of the meal . it was not possible to give standard deviations for the salt contents in meals as these are calculated values . comparisons of salt content in meals between men and women , and between different kinds of meals were done using students t - test . data processing was done with spss version 14.0 ( chicago , il , usa ) . the recruitment took place in two steps . a total of 23 worksites with in - house catering facilities representing both city ( aarhus ) and smaller towns all situated in jutland , were asked to participate in a survey describing the menus and serving system in the canteen . worksite information was obtained on number of meals served , occupation ( physically exacting to sedentary work ) , sex distribution , and canteen serving system to make sure that the final distribution would match the country as a whole . two worksites refused to participate because of lack of time and one worksite was excluded to match the desired average distribution . afterwards , the 20 worksites were asked to participate in the present study focusing on individual canteen food intake . five of the 20 worksites refused to participate with the following reasons : lack of time ( three worksites ) or concerns of the employees ' reaction to the study ( two worksites ) . eight of the worksites that agreed to participate mainly served buffet style and seven of the worksites served la carte line . the double portion technique with subsequent chemical analysis was used to quantify actual lunch intakes at the worksite canteens . duplicate portions were collected from a total of 12 customers at each canteen on two different days ( six samples per day ) . employees were asked at random to participate in the study , and in average two persons at each canteen rejected to participate . all items of the meal including bread , spread , fruit , dessert , etc . after the employees finished eating their lunch , they were asked to return the plates to the technicians in order to record / subtract plate waste . the duplicate portions were individually mixed and homogenized in a grindomix type gm200 ( retch ) . fast food was defined as food that can be eaten without the use of knife and fork . before the data collection was carried out , a survey was performed to study the consumption of various kinds of fast food in denmark , and the result of this survey was used to plan the data collection to be representative for the consumption of fast food in denmark . fast food samples were collected from 52 retail places representing both city ( aarhus ) and provincial towns , including pizzerias , major burger chain restaurants , outlets selling fast food , hot - dog stands , kiosks , and petrol stations . a total of 250 samples were collected in the period february 2004 to june 2005 . the samples were subdivided into seven groups of fast food and further divided into 45 different subgroups . the seven main groups were : burgers , sandwiches , pitas , durum rolls , sausages , grilled meals , and pizzas . three items of each of the 250 fast foods were collected , weighed separately , then mixed and homogenized in a grindomixer ( retsch ) and kept in plastic bags at 18c until analysis . moreover , one sample of each fast food was separated and all components were weighted . chloride content was determined and salt content was estimated by multiplying with 1.648 . the chloride ion concentration was determined by potentiometric titration with silver nitrate solution , and salt content was estimated from the chloride content . analyses of the content of protein , fat , and ash were performed according to procedures given by the nordic committee on food analysis ( 1012 ) . dry matter content was determined by drying in a vacuum oven at 70c to constant weight . carbohydrate and energy content were calculated from contents of dry matter , protein , fat , and ash ( 13 ) . canteen meals were categorized into four groups : ( 1 ) hot meals , ( 2 ) sandwiches ( mainly open sandwiches ) , ( 3 ) salad , or ( 4 ) a combination of hot meals / sandwiches and salad / fruit / snack vegetables . as some fast food is eaten as combo menus with a combination of e.g. sausages and bread , ketchup , mustard , burger in combination with chips , etc . , the salt content of typical menus was calculated . the calculations were made by using food composition table values ( 14 ) for the salt content and the analyzed value for the main part of the meal . it was not possible to give standard deviations for the salt contents in meals as these are calculated values . comparisons of salt content in meals between men and women , and between different kinds of meals were done using students t - test . data processing was done with spss version 14.0 ( chicago , il , usa ) . the intake is higher in men compared with women when given as gram per meal , but there was no gender difference per energy unit . salt intake in meals eaten in worksite canteens ( meansd ) difference between genders . of the 180 meals , 109 ( 61% ) had a salt content at or below 1.0 g per 100 g. eleven ( 6% ) of the meals had a salt content at or below 7 g per 10 mj . five ( 3% ) of the meals had a salt content equal to or more than the recommended daily salt intake of 7 g. the salt content in various canteen meals is given in table 2 , per 100 g , per portion , and per 10 mj . the salt content in salad was significantly lower than the salt content in other meal types when expressed in all three ways , but no significant differences were found between salt content in the other meal types with mean salt content ranging from 13.0 to 16.1 g per 10 mj . salt intake from various meal options eaten in worksite canteens ( meansd ) p<0.05 compared with the other meal options . table 4 shows the salt content in selected subgroups of fast food . in only 17 ( 7% ) of the fast foods salt content in some commonly eaten complete fast food meals were estimated to range from 4.4 to 9.1 g per meal or 7.7 to 21 g per 10 mj ( table 5 ) . salt content in various kinds of fast food ( meansd ) salt content in selected types of fast food ( meansd ) salt content in fast food meals this study shows that the salt content in both worksite canteen meals and fast food is high compared to the recommended daily intake . when expressed as g salt per 10 mj , the mean salt content in canteen meals was generally even higher than the salt content in fast food . the present study shows that a single canteen meal may provide more than half of the daily recommended amount of salt and that some meals even contain more than the daily recommended amount . although only few studies have assessed salt content in canteen meals , a high content of salt seems to be a general finding . a study from france ( 15 ) found a mean content of 3.4 g salt in lunch meals from various catering establishments . likewise , a recent belgian study found a salt content of 3.1 g in lunch meals consumed at ghent university ( 16 ) . if the mean amount of salt in the lunch meal is extrapolated to a daily intake , it would be 14.6 g per day for a person consuming 10 mj . this is a very high value compared to the recommended long - term goal of 56 g per day . the extrapolation assumes that the salt content per mj is similar in all meals consumed during the day . thus , if a hot meal is consumed both as lunch and dinner then the daily salt intake is expected to be even higher than the extrapolated mean intake of 14.6 g per day and the opposite must be true if mainly salad meals are consumed . the salt content in breakfasts have not been investigated , but is expected to vary according to the kind of food eaten ; some breakfast cereals , e.g. corn flakes have a high salt content whereas others , e.g. oat have a very low content ( 13 ) . a limit at 1.0 g salt per 100 g has been set for the use of keyhole labeling ( a label which emphasizes the better choice within a food group ) for ready - prepared dishes in denmark ( 17 ) . more than half ( 61% ) of the worksite canteen meals was at or below this limit . however , the limit seems rather high as one meal with a content of 1.0 g salt per 100 g can provide an amount close to the daily recommended intake . expressed per energy unit , the content of salt is very high in the worksite canteen meals . in order to reach the recommendation of salt intake , salt intake from all sources must be reduced including meals consumed within and outside the homes . to our knowledge , no intervention studies with focus on salt intake has been carried out in worksite canteens . a study that focused on fat and salt content in school cafeterias ( 18 ) found at follow up among the 88 participating schools that none reached the goal of less than 2.5 g salt in a lunch meal , although they have paid attention on several guidelines to lower salt intake ( 18 ) . no data exist for the number of persons eating a meal daily in a worksite canteen in denmark . fast food is eaten frequently in many countries and the frequency of fast food use has increased dramatically since the 1970s ( 7 ) . in denmark , the intake of fast food among 418-year old boys and girls has increased from 1995 to 2004 ( 19 , 20 ) , and the actual intake in the group 1518-year old is a little above 100 g a day . the present study shows , not surprisingly , a high content of salt in fast food meals . thus , a pizza meal , for instance , can provide up to twice the recommended daily intake . in the usa it has been found that the intake of salt was significantly higher among individuals who eat fast food regularly than among individuals who do n't eat fast food ( 20 ) . likewise , a study found that salt intake was significantly higher among young women who were classified as having a fast food eating pattern than among women classified with other eating patterns ( 8) . in contrast , no difference in salt intake was found between a day when fast food was eaten and a day fast food was not eaten in another usa study ( 21 ) . fast food consumption has been related to higher energy intake , overweight , and poor diet quality ( 22 ) , and the risk of hospital admissions for acute coronary heart disease was higher in regions with greater numbers of fast food services than in regions with few ( 23 ) . the reason why fast food is regarded as unhealthy is mainly the high content of fat , trans fatty acids and energy , and the high salt content is another reason why fast food in general is an unhealthy choice . in conclusion , if the recommendation for salt intake should be reached it is necessary to lower the salt content in these meals . the authors have no conflicts of interest and did not receive any funding or benefits from industry to conduct this study .

backgrounda high salt ( = nacl ) intake is associated with high blood pressure , and knowledge of salt content in food and meals is important , if the salt intake has to be decreased in the general population.objectiveto determine the salt content in worksite canteen meals and fast food.designfor the first part of this study , 180 canteen meals were collected from a total of 15 worksites with in - house catering facilities . duplicate portions of a lunch meal were collected from 12 randomly selected employees at each canteen on two non - consecutive days . for the second part of the study , a total of 250 fast food samples were collected from 52 retail places representing both city ( aarhus ) and provincial towns . the canteen meals and fast food samples were analyzed for chloride by potentiometric titration with silver nitrate solution , and the salt content was estimated.resultsthe salt content in lunch meals in worksite canteens were 3.81.8 g per meal and 14.75.1 g per 10 mj for men ( n=109 ) , and 2.81.2 g per meal and 14.46.2 g per 10 mj for women ( n=71 ) . salt content in fast food ranged from 11.82.5 g per 10 mj ( burgers ) to 16.34.4 g per 10 mj ( sausages ) with a mean content of 13.83.8 g per 10 mj.conclusionsalt content in both fast food and in worksite canteen meals is high and should be decreased .

Methods Worksite canteen meals Fast food Analyses Calculations Statistics Results Discussion Conflict of interest and funding

natural killer ( nk ) cells are regulated in part by inhibitory receptors that recognize mhc class i molecules on normal cells . in humans , inhibitory receptors that recognize classical mhc class i molecules ( hla - a , hla - b , and hla - c ) belong to the kir family . kirs are a family of 15 closely linked genes located on chromosome 19q13.4 , which encode both inhibitory and activating receptors that are expressed by nk cells and by subsets of t cells and memory and effector t cells . the reason for kir diversity and the contribution of individual kirs to signaling in nk cells and t cells are not fully understood , but their importance has been underscored by several recent genetic studies , including one in this issue ( 1 ) , which have linked combinations of kir and hla genes with the outcome of various diseases ( table i ) ( 28 ) . associations with different hla kir combinations , involving activating kirs or inhibitory kirs to different extents , have been described . the data suggest that disease can be modified by specific kir ligand interactions , rather than by global responsiveness of nk cells or t cells . disease associations with combinations of kir and hla genes kirs contain either two or three immunoglobulin - like domains with either long ( 2dl , 3dl ) or short ( 2ds , 3ds ) cytoplasmic tails ( table ii ) ( 9 ) . long - tailed receptors carry one or two immunoreceptor tyrosine - based inhibition motifs ( itims ) , which contribute to inhibitory signaling . short - tailed receptors have a lysine residue in their transmembrane domain that is required for pairing with the immunoreceptor tyrosine - based activation motif ( itam)containing adaptor dap12 . several inhibitory kirs have well - defined mhc class i ligands ( table ii ) ( 10 , 11 ) . the ligands for activating kirs , however , have been more elusive . despite high sequence similarity with some of the inhibitory receptors , activating kirs kir molecules and their hla ligands , extracellular immunoglobulin domain ; , transmembrane charge ; , cytoplasmic itim . a striking feature of kir genes is their lack of conservation among species and their rapid evolution , which can not be accounted for solely by divergence in hla class i molecules ( 15 ) . if kir gene evolution were pathogen driven , some of the diversity would be expected to correlate with resistance or sensitivity to certain infectious diseases . indeed , several genetic studies of viral infection have revealed an influence of hla kir gene interactions on disease outcome ( table i ) . an interaction between kir3ds1 and a subset of hla - bw4 alleles those with ile at position 80is associated with delayed progression to aids in hiv - infected individuals ( 2 ) . in the case of hepatitis c virus ( hcv ) infection , homozygosity of both hla - c1 and kir2dl3 the latter finding is that kir2dl3 binds hla - c with lower affinity than kir2dl1 and kir2dl2 receptors , thus reducing nk cell inhibition and favoring resolution of the infection . however , direct affinity measurements have not revealed a difference between kir2dl binding to their respective hla - c ligands ( table ii ) . the report in this issue ( 1 ) reveals a predisposition to human papilloma virus ( hpv)induced cervical cancer with hla kir gene combinations that seem to favor nk cell activation . in contrast to correlations seen with hiv and hcv infections , disease progression toward cervical neoplasia seems enhanced by an increase in activation signals . thus , a combination of kir2ds1 and/or kir2ds2 coupled with homozygosity of an hla - c group favors susceptibility to psoriatic arthritis ( 5 ) . susceptibility could be due to reduced nk cell inhibition , as individuals homozygous for hla - c1 lack a ligand for kir2dl2 and kir2dl3 , and those homozygous for hla - c2 lack a ligand for kir2dl1 . similarly , kir2ds2 combined with hla - c1 in the absence of hla - c2 and hla - bw4 is associated with increased susceptibility to type i diabetes ( 3 ) . likewise , kir2ds1 in combination with hla - cw*06 is a risk factor for psoriasis vulgaris ( 7 ) . kir combinations that favor nk cell or t cell activation may have been selected to improve resistance to viruses and to malignancy ( 8) , despite an associated risk of developing autoimmunity ( table i ) . kir gene combinations that seem to favor nk cell inhibition have also been associated with preeclampsia ( 6 ) , a potentially fatal condition caused by incomplete remodeling of spiral arteries in maternal decidua and by high blood pressure during pregnancy . susceptibility is associated with the combination of hla - c2 on fetal trophoblast cells and kir2dl1 on maternal cells , and is further increased by the absence of activating kir2ds genes ( 6 ) . a potential explanation of these findings is that kir2dl1 confers a strong inhibition , compared with kir2dl2 or kir2dl3 , which prevents activation of nk cells during interaction with fetal trophoblast cells in the decidua . in this context , interactions with dendritic cells , macrophages , and fetal trophoblast cells can regulate nk cell activity by influencing cytokine production , cytotoxicity , and stimulation of t helper-1 responses . stimulation of nk cells can be beneficial during virus infections , malignant transformation , and pregnancy , but deleterious in the context of autoimmunity or neoplastic transformation . the latter may be provoked by chronic inflammation , which is a known risk factor in developing cancer during persistent infections . hpv establishes latency by preventing nk - mediated lysis of infected cells ( 16 ) . it would be interesting to test if hpv infection provokes a proinflammatory cytokine response from nk cells in the absence of cytotoxicity , thereby favoring neoplasia . a simple interpretation of the observed genetic correlations might suggest that kir3ds1 stimulates cytokine production by nk cells , which contributes to inflammation . however , a few key aspects of nk cell biology need to be considered when interpreting such genetic analyses . understanding the basis for the observed genetic associations is complicated by the large repertoire of receptors used by nk cells to interpret their environment . there is extensive polymorphism among kir haplotypes , which differ not only in nucleotide sequence but also in gene content ( 17 ) . different haplotypes carry different numbers of kir genes , some with few or no activating kirs ( a haplotypes ) and others with several activating kirs ( b haplotypes ) . individuals with several activating kir genes simply have a higher probability of expressing activating kirs on any given nk cell than individuals who have fewer activating kirs . therefore , a given disease association with hla kir gene combinations , for instance , an activating kir and its hla ligand , can not be interpreted simply as an overall enhancement in nk cell activation signals . furthermore , a selection process ( the mechanism of which is unknown ) is in place to ensure that each nk cell has at least one inhibitory receptor specific for a self hla class i molecule . if , for instance , an nk cell lacks all of the major inhibitory kirs , it will express the heterodimeric inhibitory receptor cd94nkg2a ( 18 ) , which binds to the nonclassical hla - e . a new inhibitory receptor ligand combination , which is independent of mhc class i , has recently been discovered on mouse nk cells : binding of nkr - p1 receptors to the widely expressed c - type lectin clr - b inhibits nk cell activation ( 19 , 20 ) . therefore , it is not clear that kir haplotypes carrying several activating kirs would necessarily result in nk cells that are more easily activated , as the expression of activating kirs should be compensated by the expression of inhibitory receptors . activating kirs are completely dispensable , as kir haplotypes lacking all functional 2ds and 3ds genes are common ( 21 ) . in addition , all individuals have a subset of nk cells that are completely devoid of activating kirs . as activating and inhibitory kirs are not coordinately expressed , it is unlikely that activating kirs contribute to the function of inhibitory kirs . the ligand specificity of activating kirs is unclear . kir2ds1 and kir2ds2 may bind hla - c with a lower affinity than that of closely related inhibitory kirs ( 12 , 14 ) , but it is also possible that alternate ligands exist , such as the non - hla ligand for kir2ds4 on melanoma cells ( 22 ) . in the mouse ly49 receptor family , which is structurally distinct from but functionally equivalent to human kirs , the activating ly49h and the inhibitory ly49i receptors bind to the m157 protein of mouse cytomegalovirus ( 23 , 24 ) , suggesting that kirs may also have viral protein ligands . it is essential to determine the ligand specificity of activating kirs in order to interpret genetic correlations with diseases . expression of activating kirs on subsets of t cells could contribute to some of the associations seen in the genetic studies . it is conceivable that activating kirs may synergize with tcr - mediated signals to cause aberrant immune activation and autoimmune reactions . kir2ds2 , which is expressed by a large percentage of cd4cd28 t cells in rheumatoid arthritis patients with vascular complications , is also a genetic risk factor for this disease ( 25 ) . even though t cells lack dap12 , expression of kir2ds2 costimulated tcr signals which , although suboptimal , resulted in cytokine secretion ( 26 ) . side chains that extend out of the peptide - binding groove of hla - b and hla - c molecules can interfere with binding of inhibitory kirs ( 10 ) . although peptide - specific recognition by activating kirs has been proposed as a potential mechanism to activate nk cells during infections , it is extremely unlikely that self / nonself discrimination is achieved by kirs , primarily because each kir binds to different hla - b or hla - c molecules , each of which has its own rules for peptide binding . therefore , recognition by kir can only work if the peptide does not contribute to specificity . the extensive polymorphism of hla class i and the very limited repertoire of kir are not compatible with peptide - specific binding to hla class i in the context of diseases or infections . in contrast , cd94 binding to the nonpolymorphic hla - e is governed by peptide specificity ( 9 ) . hla - e normally binds a peptide derived from signal sequences of other hla class i molecules , and recognition by cd94 is lost when hla - e instead binds a peptide derived from the signal sequence of heat shock protein 60 ( 27 ) . situation could induce the killing of cells undergoing a stress response by nk cells that are normally inhibited by hla - e . several of the genetic studies have suggested a model whereby inhibition of nk cells by some kir hla combinations is stronger than others . in this model , the inhibition by kir2dl1hla - c2 is strongest , followed by kir2dl2hla - c1 , and finally kir2dl3hla - c1 ( 1 , 46 , 17 ) . accordingly , weaker inhibitory interactions result in greater nk cell activation and better protection from virus infection , or greater susceptibility to autoimmunity . similarly , in preeclampsia too strong an inhibition by kir2dl1hla - c2 interactions prevents proper nk cell activation ( 6 ) , which may be required to stimulate vascularization . ( 1 ) also support such a connection between strength of kir - mediated inhibition and disease outcome . however , careful affinity measurements by surface plasmon resonance with each of the purified kir2dl molecules and their hla - c ligands have resulted in almost identical values ( table ii ) . on the other hand , binding of kir2dl fc fusion proteins to hla - c followed a pattern consistent with diminishing strength , in the order kir2dl1>kir2dl2>kir2dl3 ( 13 ) . differences in inhibitory strength among kir2dls may also be related to signaling in the cytosol , and not to hla - c binding . an interesting feature of kir2dls is a requirement for zn in their inhibitory function ( 28 ) . kinetic measurements of kir2dl binding to hla - c revealed slower off rates in the presence of zn , particularly in the case of kir2dl1 ( 14 ) . thus , it is possible that differences in sustained engagement of kir due to zn could translate into differences in strength of inhibition . an analysis of receptor ligand interactions in the context of diseases is required to understand how hla kir genotypes contribute to disease . it will be important to determine in what tissue and with what ligand - expressing cells are kir - expressing nk cells and t cells interacting . such questions are difficult to address , as the lack of kir conservation in mice precludes the use of a convenient animal model . a major effort is underway to type kir gene polymorphism and expression in the context of kir - mismatched bone marrow transplantation ( 17 ) . will a precise analysis of kir alleles and kir expression , rather than overall genotypes , result in stronger associations or loss of statistical significance ? it is also possible that the strong linkage disequilibrium within the kir gene complex accounts for disease associations , and that a linked gene is responsible for the observed effect . disease associations were first reported in the 1970s ( 29 ) , a decade before the realization that hla molecules bind peptides , and two decades before the resolution of tcr mhc structures . hopefully a molecular basis for the new disease associations with hla kir gene combinations will be provided before the year 2025 .

combinations of hla and killer cell immunoglobulin like receptor ( kir ) genes have been associated with diseases as diverse as autoimmunity , viral infections , reproductive failure , and now cancer . much as early observations of disease associations with hla polymorphism preceded a detailed knowledge of hla recognition by t cell receptors , the recently reported disease associations with hla kir gene combinations beg for a better understanding of the underlying mechanisms .

KIRs and ligands KIR genotypes and disease Potential mechanisms A complex repertoire of polymorphic KIRs Elusive role of activating KIR Peptide selectivity in recognition of HLA by KIR The strength of inhibition hypothesis Concluding remarks

intracranial dermoid cysts are rare tumors representing < 1% of head and neck tumors . they are believed to arise due to ectopic inclusion of epithelial cells in the course of neural tube closure during embryologic development.1 dermoids tend to be midline lesions and contain dermal and epidermal elements including sebum , hair , and keratin.2 rarely , these tumors have been reported in the middle cranial fossa , usually in the petrous apex or cavernous sinus.2 3 we report a case of a large extradural dermoid cyst arising in the infratemporal fossa ( itf ) and eroding into the middle cranial fossa . a 21-year - old woman presented to our institution following an episode of syncope after a motor vehicle collision . the lesion was originally identified 7 years prior , but the patient was lost to follow - up . the patient reported a long history of frequent debilitating headaches , dizziness , and syncope . her past medical history was significant for surgical treatment of a cholesteatoma of her left mastoid at age 8 . thin - cut computed tomography ( ct ) scan and magnetic resonance imaging ( mri ) identified a heterogeneous mass centered within the left skull base that measured 4.7 2.5 3.4 cm . it extended to the level of the anterior clinoid process and inferiorly between the lateral and medial pterygoid plates into the pterygoid fossa at the level of the pterygomaxillary fissure . the mass demonstrated restricted diffusion with areas of t1 shortening , suppressed on fat saturation images , consistent with a dermoid cyst . the tumor had no associated postcontrast enhancement and no edema in the adjacent brain parenchyma . axial t1 with ( a ) gadolinium , ( b ) diffusion - weighted , ( c ) coronal t1 with gadolinium , and ( d ) coronal computed tomography . a left frontotemporal craniotomy was performed , and an extradural approach was used to mobilize the medial temporal dura off the lateral wall of the cavernous sinus exposing the floor of the middle cranial fossa . a large mass was noted bulging through the defect in the floor of the middle fossa , anterior to v2 and v3 . the tumor was entirely extradural and removed in a piecemeal fashion . sloughed skin and hair were observed as the pieces were removed . the 30- and 70-degree endoscopes were inserted through the defect in the middle fossa floor and used to visualize additional tumor in the itf . the only site of attachment of the tumor was noted in the itf , and the middle fossa component appeared to represent a pushing margin ( fig . 2 ) . histopathology demonstrated lamellar keratin consistent with either an epidermoid or dermoid cyst ( fig . 3 ) . however , visualization of hair during tumor removal confirmed the radiographic findings of dermoid cyst . follow - up imaging studies done 1 month postoperatively demonstrated no evidence of recurrent or residual tumor ( fig . ( a d ) endoscopic views of the tumor and its origin through the bony defect in the middle fossa floor demonstrating progressive resection of the tumor . lamellar keratin , consistent with an epidermoid or dermoid cyst . it was not possible to distinguish between the two histologically because no viable epithelium was present in the specimen submitted for pathology . postoperative axial ( left ) and coronal ( right ) t1 postcontrast magnetic resonance imaging scans demonstrating complete resection of the lesion . epidermoid and dermoid cysts are squamous epithelium - lined inclusion cysts.4 both epidermoid and dermoid cysts contain lamellar keratin and are lined by well - differentiated squamous epithelium . in contrast to epidermoid cysts , the lining of dermoid cysts contains adnexal structures such as hair follicles and apocrine , sebaceous , and sweat glands.5 only 7% of dermoids affect the head and neck , and they are frequently encountered in the lateral eyebrow , orbit , and nose.6 dermoids are most commonly seen in women 20 to 36 years of age.1 5 7 8 cranial dermoid cysts are estimated to occur 3 to 10 times less frequently as epidermoid tumors , and they comprise 0.04 to 0.7% of intracranial tumors.1 2 dermoid cysts are benign and generally become symptomatic secondary to their mass effect on neural structures.5 clinically , they often present with a protracted course rather than an acute decline.9 the presentation of intracranial dermoids varies depending on cyst location , although common symptoms include focal neurologic deficit , headache , or meningitis.10 11 less common presentations include seizures , hydrocephalus , visual field defects , exophthalmos , and oculomotor palsy . sudden death has also been reported in the case of spontaneous rupture.2 12 13 dermoids tend to be midline in location with extradural dermoids reported in the diplo of the anterior fontanelle , posterior fossa , or orbital regions.1 2 10 11 multiple dermoid cysts of the head and neck are uncommon but have been reported.14 the few reported dermoid tumors in the middle cranial fossa have been usually located between layers of the lateral wall of the cavernous sinus.2 10 15 16 the one previously reported case of a dermoid involving the itf presented with rapidly growing facial swelling in a 17-year - old girl.6 tumors arising in the itf can remain asymptomatic until they are quite large , producing symptoms late in the clinical course . when including all intracranial dermoids , the average duration of symptoms prior to diagnosis is 8.5 years.5 6 dermoid cysts grow slowly and expand through glandular secretion or epithelial desquamation.1 as the cyst grows , it follows the path of least intracranial resistance , particularly the subarachnoid space.8 dermoid cysts are typically round or multilobular with a firm capsule . the contents of the cyst generally consist of a soft , oily mass with keratin debris , and they often contain hair.6 dermoids are often more solid than epidermoids and therefore less likely to insinuate between neurovascular structures , but they generally produce greater local mass effect.5 dermoid tumors do frequently adhere to vascular and nervous structures , however.1 imaging studies remain essential in diagnosing these lesions . the differential diagnosis includes epidermoid cysts , arachnoid cysts , cystic gliomas , lipomas , teratomas , and craniopharyngiomas . in contrast to epidermoid cysts that resemble cerebrospinal fluid on mri and ct scan , dermoid cysts have heterogeneous imaging characteristics and contain fat.17 ct scan provides data about the size and extent of the tumor along with its location including relationship to adjacent bone . in our case , the dermoid was extradural and displayed well - defined osseous erosion , reported previously by others.1 2 18 ct reveals a strongly hypodense lesion due to the high fat content , and most do not enhance , although enhancing capsules have been reported.2 10 13 mri is valuable in determining the lesion 's relationship to neighboring neurovascular structures.6 dermoid cysts are nonenhancing with most of them demonstrating hyperintensity on t1-weighted images and heterogeneous signal intensity on t2-weighted sequences determined by the water content , sebum , and hair follicles in the cyst.2 12 17 19 diffusion - weighed imaging frequently demonstrates areas of hyperintensity in the solid keratin - rich portions of the lesion . they also typically contain areas of t1 shortening that suppress on fat - saturated images.12 with cyst rupture , fat droplets can be seen in the subarachnoid space and ventricular system with diffuse meningeal enhancement from chemical meningitis.9 17 20 surgical resection remains the treatment of choice , although tumors involving both the infratemporal fossa and the middle cranial fossa are uncommon and can pose significant challenges for neurosurgeons.21 with improvements in microneurosurgical techniques , total resection is often achieved by many authors and is believed to decrease both postoperative chemical meningitis and tumor recurrence risk.8 11 16 22 the resection of dermoid cysts begins with opening the capsule and then debulking the cyst contents followed by microsurgical dissection of the capsule from adjacent neurovascular structures.7 8 23 when these lesions adhere to neurovascular structures , the benefits of complete capsule removal must be weighed against the risks of new neurologic deficit . because these lesions typically have a benign natural history , subtotal resection is recommended in these situations.2 7 8 19 radiation and chemotherapy have not demonstrated efficacy in the management of dermoid cysts and are therefore not recommended.5 9 the prognosis of dermoids in the head and neck is favorable . malignant transformation is rare and has been reported very few times.19 the three reports have described transformation to squamous cell carcinoma from intracranial dermoid cysts in two separate cases as well as from a sublingual dermoid cyst.19 20 24 25 26 in our patient 's case , it is unclear how the history of cholesteatoma of the left mastoid relates to the itf lesion . it is possible that two separate lesions arose simultaneously secondary to problems during embryologic development . the simplest explanation may be that residual tumor in the petrous apex could have spread to the itf . it is unclear whether the tumor in our case arose in the itf or within the bone of the middle fossa and spread . at the time of surgery , however , the tumor appeared to originate in the itf and did not have any obvious communication with the petrous portion of the temporal bone . we believe this is the first report of a dermoid cyst arising in the itf with extension into the middle cranial fossa . the tumor was successfully removed , and the patient is now 18 months out from surgery without residual or recurrent tumor . we suggest including dermoid tumor in the differential diagnosis of cystic abnormalities in this region .

background intracranial dermoid cysts are rare tumors of congenital origin . we report a case of a large dermoid tumor arising in the infratemporal fossa ( itf ) with erosion into the middle cranial fossa . after reviewing the literature , we believe this represents the first reported dermoid tumor of the itf with extension into the middle cranial fossa . results a 21-year - old women presented with a large cystic mass involving the left infratemporal fossa and middle cranial fossa that was discovered following a motor vehicle collision . neurologic examination was normal . the mass was resected through a frontotemporal extradural approach with endoscopic assistance . imaging studies , gross findings , and histopathology were consistent with a dermoid tumor . conclusion this is the first report of a dermoid cyst arising in the itf with extension into the middle cranial fossa . we suggest including dermoid tumor in the differential diagnosis of cystic abnormalities in this region . complete resection of the cyst remains the preferred treatment with surgical approach guided by preoperative imaging .

Introduction Case Report Discussion Conclusions

a 43-year - old caucasian man with aids presented with progressive confusion , blurring of vision , and personality change for 6 weeks in march 1999 . examination revealed left cerebellar signs , dysphasia , and clear evidence of left posterior - occipital lesion with right homonymous hemianopia . he was unable to identify simple objects such as a pen or coins nor name colors correctly . a magnetic resonance imaging ( mri ) scan on admission showed multiple white matter lesions involving both subcortical cerebral hemispheres and cerebellar regions , with no mass effect or surrounding edema ( figure 1 ) . cerebrospinal fluid ( csf ) was clear in color with a polymorph count of three cells and a lymphocyte count of five cells . gram staining of csf did not show any organism , and bacterial culture of csf was negative . jc virus antibodies in the blood and csf were 1/81,920 and 1/20,489 , respectively.1 the antibody index was 28 , indicating intrathecal production of jc virus antibodies , which was consistent with progressive multifocal leukoencephalopathy ( pml ) . nested pcr for jc virus was positive in the csf . he was treated with nucleoside reverse transcriptase inhibitors , zidovudine ( azt ) , lamivudine , and the non- nucleoside reverse transcriptase inhibitor nevirapine . he was able to walk independently to the local shops and to pay money correctly a year after admission . he became fully independent and able to live on his own nearly 2 years after his admission , though he required frequent visits by a support worker to supervise adherence to his antiretroviral therapy ( art ) . his hiv rna level became undetectable , and his cd4 count rose to 330 cells / mm . he was fully independent and living on his own but still had some residual neurologic signs with homonymous hemianopia . he declined repeat lumbar puncture to look for jc virus in the csf , as he felt that there was no reason to undergo invasive tests whilst he remained well . his most recent hiv rna level was undetectable , and his cd4 count was 574 cells / mm . the initial site of jc virus infection is thought to be the tonsils , and it is then carried via lymphocytes to the kidney and bone marrow , which are the sites of viral latency . reactivation of jc virus occurs due to immunosuppression , and the virus crosses the blood brain barrier within b lymphocytes and infects oligodendrocytes and astrocytes , causing widespread demyelinative lesions.2 pml is an aids - defining illness in approximately 1%3% of hiv - positive patients . it occurs almost exclusively in severely immunocompromised hiv - positive patients with cd4 counts less than 100 cells / mm , as in our case.3 it was invariably fatal in patients with aids before the advent of art , with median survival around 6 months . our patient is still alive 12 years after the diagnosis of aids - related pml . astrom et al4 first described pml in patients with chronic lymphocytic leukemia and hodgkin s lymphoma in 1958 . although the prevalence of pml increased significantly during the hiv epidemic , it has also been widely reported in other non - hiv conditions , such as systemic lupus erythematosus and sarcoidosis , and in patients with organ transplants.5 more recently , pml has also been associated with hiv - negative patients treated with immunomodulatory drugs , especially natalizumab.6,7 the risk of developing pml is 1.47 in 1000 in patients with multiple sclerosis who are treated with natalizumab , which is similar to the risk of developing pml ( one in 1000 ) in patients with systemic lupus erythematosus who are treated with rituximab.8 pml has also been reported in hiv - negative patients who are treated with other monoclonal antibodies such as efalizumab in patients with psoriasis . pml has also been recognized in hiv - negative patients with the use of immunosuppressive agents such as azathioprine , cyclophosphamide , methotrexate , mycophenolate , and fludaramine . fludarabine is the most frequently implicated among immunosuppressive drugs with pml , as it is capable of depleting t lymphocytes.9 new onset of pml has been observed after initiation of art . a rapid recovery of the immune system can trigger immune reconstitution inflammatory syndrome ( pml - iris ) , which is an inflammatory reaction to clinically apparent or subclinical pathogens of jc virus.10 pml - iris has been reported in up to 23% of pml cases diagnosed in hiv- positive patients.11 this inflammatory reaction is often associated with contrast enhancement with edema and possible mass effect on an mri scan . it is often acute in onset , and jc virus pcr in the csf can be negative.12 pml patients present with a slow onset of focal neurologic features without any headaches , fever , or altered consciousness . hemiparesis , hemianopia , aphasia , hemisensory defects , and ataxia are common features . headaches , seizures , and neck stiffness are rare in patients with pml.13 other common causes of focal neurologic features in hiv- positive patients include cerebral toxoplasmosis and primary brain lymphoma . they often present with symptoms of raised intracranial pressure such as headaches or seizures and rapidly progressive focal neurologic features . radiologic imaging often shows multiple cerebral abscesses with surrounding edema in patients with cerebral toxoplasmosis and mass effect with cerebral edema in patients with primary brain lymphoma . ischemic strokes in young aids patients causing focal neurologic signs due to acquired deficiency of protein s and c have also been reported.14 for diagnosing pml , mri is superior to computed tomography and shows multiple white matter lesions without any mass effect or surrounding edema , and lesions are not contrast enhancing . lesions in thalamus , basal ganglia , corpus callosum , and posterior fossa are rare . in our patient , lesions were found in occipito - parietal areas , causing homonymous hemianopia and visual agnosia , and in the cerebellum , causing cerebellar dysfunction.15 csf is usually normal in terms of protein , glucose , and cell counts , which help to rule out other etiology such as cryptococcal meningitis , tuberculous meningitis , or cerebral toxoplasmosis . jc virus pcr of the csf has been shown to have specificity ( 92%99% ) and sensitivity ( 75%).16 however , csf pcr for jc virus can be negative in 25% of patients , especially in those with deep - seated lesions . because jc virus is intermittently shed in the csf , repeated csf analysis may increase the sensitivity . a negative pcr , therefore , will not exclude pml . quantifying jc virus dna level is a useful tool to monitor the disease progression of pml.17 this was not done in our patient , as it was not available at our hospital in 1999 . jc virus antibodies in the csf , in comparison with the blood in our patient , indicate that these antibodies are produced in the csf and are not crossed from the blood . this was confirmed by a high antibody index.18,19 definitive diagnosis is made by brain biopsy , which characteristically shows a triad of demyelination , enlarged nuclei with inclusions of oligodendrocytes , and giant bizarre astrocytes.20 there is no effective therapy for pml . however , cytosine arabinoside , cidofovir , and meflaquine have been tried with various success.2124 the prognosis has been improved with the use of art , which suppresses hiv rna level and improves immune function by raising cd4 counts . regulatory protein tat , which is found in hiv , is known to upregulate jc virus replication.25 the use of art with a high central nervous system penetration effective score might be associated with prolonged survival of patients with hiv - related pml . hence , zidovudine and nevirapine are usually selected in the combination art regimen in treating hiv - positive patients with pml . these agents halt the progression of demyelination by downregulating jc virus replication and improving survival , as in our patient . our patient , who was severely immunocompromised due to hiv infection , had clinical , virologic , and radiologic evidence of pml . the fact that the majority of his neurologic deficits improved with the rise of cd4 count due to the use of art strongly suggests that his pml is in remission clinically following immune reconstitution 12 years after the diagnosis of aids - related pml . in conclusion , slowly progressive focal neurologic features without any headaches or seizures , and multiple subcortical white matter lesions without any mass effect or surrounding edema with positive jc virus dna in the csf in an aids patient , are diagnostic of pml .

a 43-year - old caucasian homosexual man with aids presented with blurring of vision , change of personality , and memory loss in march 1999 . he had first been admitted 2 months previously for treatment of pneumocystis jiroveci pneumonia . a magnetic resonance imaging scan on admission showed multiple white matter lesions involving both subcortical cerebral hemispheres and cerebellar regions , with no mass effect or surrounding edema . jc virus was detected by nested polymerase chain reaction in the cerebrospinal fluid . these findings were diagnostic of progressive multifocal leukoencephalopathy ( pml ) . his cd4 count was 34 cells / ml , and his hiv ribonucleic acid level was 800,789 copies / ml . he was treated with a combination antiretroviral therapy . he was last reviewed in october 2011 . he was fully independent socially and mentally , but he still had some residual neurologic signs with right - sided homonymous hemianopia and visual agnosia . his hiv ribonucleic acid level was undetectable , and his cd4 count was 574 cells / mm3 . although the median survival of patients with pml was poor before the antiretroviral therapy era , our patient , who is now aged 55 years , is still alive 12 years after the diagnosis . the diagnosis of pml and differential diagnosis of focal neurologic signs in hiv - positive patients are discussed in this case report .

Case report Discussion

following the discovery of the lysosome by the nobel prize winner christian de duve in 1955 ( de duve et al . 1955 ) , research into the biochemistry , molecular biology and pathology of the lysosomal system unravelled many of its functions . nowadays , genetic lysosomal storage disorders ( lsds ) represent a group of about 50 disorders ( scriver et al . all of them are characterized by intralysosomal accumulation of compound(s ) , e.g. , enzyme substrates or products , mishandled bioconjugates , or segregated cytoplasmic components , in a variety of cell types and tissues . most lsds result from a deficient enzyme activity caused by a mutation in the gene encoding either the relevant enzyme , protecting protein , protein activators , or the endoplasmic reticulum however , some are caused by dysfunction of the lysosomal system itself due to mutations in genes encoding lysosomal membrane components or components closely associated with the lysosomal system ( saftig 2005 ; jalanko and braulke 2009 ) . the number of lysosomal enzymes and non - catalytic proteins reported in the literature has steadily increased and , therefore , more defects in the lysosomal system are expected to be discovered . the progress in the research into limp-2 deficiency serves as a recent example ( balreira et al . overall frequencies of occurrence of lsds have been reported for several countries ( meikle et al . 2004 ) , while other reports focused on lsd groups ( e.g. , mucopolysaccharidoses , ( mps ) : nelson et al . 2005 ; malm et al . 2008 ; lipidoses : ozkara and topcu 2004 ; neuronal ceroid lipofuscinoses , ncl : claussen et al . 1992 ) , or on particular lsds ( e.g. , mps i : moore et al . the frequency of lsds as a group varies among populations from 7.6 to 25 per 100,000 ( meikle et al . the aim of this study was to calculate the birth prevalence and carrier frequencies of lsds in the czech republic population , and to compare our results with reported epidemiologic data from other populations . we analyzed data from individuals who had been diagnosed with a lsd at the institute of inherited metabolic disorders in prague between 1975 and 2008 . our institute is the only laboratory providing diagnostic testing for lsds , including prenatal testing , in the czech republic . the patients had been referred to , or their blood samples had been sent to , the institute by departments of paediatrics , neurology , haematology , cardiology , nephrology , dermatology , gastroenterology , ophthalmology , pathology , and clinical genetics from hospitals all over the country . the initial diagnosis of most lsds was based on demonstration of accumulated substrates ( e.g. , sphingolipids , oligosaccharides , or glycosaminoglycans ) in tissues and/or body fluids using chromatographic or electrophoretic methods , or on histological proof of storage . the definite diagnosis was made by demonstrating the deficiency of the relevant enzyme and/or presence of pathogenic mutation , and/or by detection of undegraded substrate by loading tests in cell cultures . mucolipidosis ii was confirmed by detecting elevated activities of multiple lysosomal enzymes in serum and by molecular analysis . patients with unspecified types of mps or ncl , who had died before the availability of confirmatory tests , were also included in the birth prevalence calculation . their diagnosis was based on biochemical analyses of storage compound , evaluation of clinical data , and histochemical and/or ultrastructural examinations of samples obtained at biopsy or autopsy . for the calculation of the prevalence the prevalence was calculated as the total number of patients diagnosed with a particular lsd , divided by the total number of live births in the same period , as was the birth period of the diagnosed cases ( i.e. , the birth period is the interval between the year of the birth of the oldest patient and the year of the birth of the youngest patient ) the total number of live births in particular years was calculated using birth rates taken from the czech statistical office web page . to avoid underestimation , some patients were not included into the prevalence calculation ( e.g. , if there was only one patient diagnosed with the disease , the prevalence was calculated using the number of live births ( i.e. , 4,261,897 ) in the examined period ( i.e. , between 1975 and 2008 ) , as used previously by pinto et al . familial cases and 11 affected fetuses [ fabry disease ( 1 ) , niemann - pick disease type c ( 1 ) , mps i ( 3 ) , mps iii a ( 3 ) and mps iv a ( 3 ) ] were also included in the calculation of birth prevalence . for some specific lsds , the patient group consisted of subgroups with distinct clinical phenotypes ( e.g. , mld , gaucher disease ) . using the method mentioned above , we calculated the prevalence of the subgroups separately , and the overall prevalence of the specific lsd was estimated as a sum of the prevalences in the subgroups ( poorthuis et al . calculation of the frequency of fabry disease was done using two approaches , i.e. , excluding and including female heterozygotes . exclusion of heterozygotes ( n = 78 ) enabled us to compare the prevalence to other reported male - specific prevalence data ( meikle et al . 1999 ; poorthuis et al . 1999 ; ozkara and topcu 2004 ; pinto et al . fabry heterozygotes , who can be as severely affected as male patients , are nowadays classified as patients instead of carriers of the defective gene ( dobrovolny et al . 2005 ; wang et al . 2007 ; gibas et al . confidence intervals ( 95% ) for the birth prevalences were estimated from the poisson distribution using sisa ( simple interactive statistical analysis ) software ( uitenbroek 1997 ) . carrier frequency was calculated using the hardy weinberg equation ( strachan and read 2004 ) . in the past three decades , a total of 478 patients have been diagnosed with one of 34 specific types of lsds in the czech republic ( fig . 1 ) . the number of diagnosed patients gradually increased during the study period , from less than 10 cases per year in the 1970s to 2030 new cases diagnosed annually in recent years ( fig . 2 ) . more than half of all lsd patients had a lipidosis , about one - quarter a mucopolysaccharidosis , and the remaining quarter suffered from ncl , gsd ii , mucolipidoses , or glycoproteinoses ( fig . 1 ) . the combined birth prevalence for all lsds is 12.25 ( 95% ci 6.2524.1 ) per 100,000 live births . data on patients with lipidoses , mucopolysaccharidoses , and other lsds detected during the study period , including carrier frequencies in the czech population , are summarized in tables 1 , 2 and 3 , respectively . detailed data on the birth prevalence of specific disorders and their subtypes can be found in tables 4 , 5 and 6 . mps mucopolysaccharidosis , ncl neuronal ceroidlipofuscinosis , gsd ii glycogenosis type ii , ml mucolipidosis , gp glycoproteinosis , npa / b / c niemann - pick a / b / c , mld metachromatic leukodystrophy , cesd cholesterol ester storage disease , msd multiple sulphatase deficiency , gm1 gm1 gangliosidosis , gm2 gm2 gangliosidosis ( tay - sachs and sandhoff diseases ) , -man -mannosidosis , -man -mannosidosis , issd infantile sialic acid storage diseasefig . 2number of live births ( ) and number of lsd diagnoses ( ) in the czech population from 1975 to 2008 . in 1985 , electrophoretic analysis of glycosaminoglycans ( elfo gag ) and thin layer chromatography of oligosaccharides ( tlc ols ) in urine were introduced . from 1990 laboratory diagnostic methods for 45 lsds are available ( enzyme and dna analyses , loading assays)table 1lipidoses : comparison of data in different populationsdiseaseczech republicother countriesno . of patients 10nlportugalaustraliaturkeyprevalence per 100,000 live birthsgaucher ( all types)491.130.611.956.711.161.351.750.45niemann - pick a / b230.330.160.613.650.530.60.4niemann - pick c540.910.671.216.020.352.20.47fabry male490.52 ( 1.0)0.380.690.010.210.120.860.015fabry female780.770.600.98krabbe150.400.210.684.01.351.210.711mld ( all types)250.690.291.385.261.421.851.091.43cesd , wolman180.270.150.453.310.19gm1 gangliosidosis130.260.140.463.250.410.620.260.54gm2 tay - sachs100.300.140.553.450.413.130.50.23gm2 sandhoff30.190.040.552.740.341.490.260.95lipidoses all types259/3375.0/5.772.79 ( 3.39)8.53 ( 9.51)6.212.66.64.6nl netherlands , mld metachromatic leukodystrophy , cesd cholesteryl ester storage diseasetotal number of patients diagnosed between 1975 and 2008data for prevalence calculations are in table 4carrier per 1 live birthmale live births onlyfabry females not includedfabry females includedtable 2mucopolysaccharidoses : comparison of data in different populationsdiseaseczech republicother countriesno . of patients 10nlportugalaustraliagermanyprevalence per 100,000 live birthsmps i200.720.441.115.381.191.331.140.69mps ii220.43 ( 0.83)0.260.650.00850.671.090.740.64mps iii a180.470.270.754.311.1600.88mps iii b10.020.00.130.970.420.720.47mps iii c50.420.140.994.120.210.120.07mps iii d000.10.10mps iii ( all types)240.910.411.871.890.841.421.57mps iv a140.710.381.225.350.220.60.59mps iv b10.020.00.130.970.1400mps iv ( a + b)150.730.381.350.38mps vi20.050.010.181.400.150.420.430.23mps vii10.020.00.130.970.2400.05mps unspecified320.600.390.87msd30.260.050.773.240.050.480.07mps all types1193.721.946.934.54.84.443.53nl netherlands , mps mucopolysaccharidosis , msd multiple sulphatase deficiencytotal number of patients diagnosed between 1975 and 2008data for prevalence calculations are in table 5carrier per 1 live birthmale live births onlyunspecified cases of mps were diagnosed on the basis of analysis of glycosaminoglycan excreted in urine combined with the evaluation of clinical data . no material was available for enzyme and dna analysistable 3glycoproteinoses , mucolipidoses , glycogenosis type ii and neuronal ceroid lipofuscinoses : comparison of data in different populationsdiseaseczech republicother countriesno . of patients 19752008prevalence per 100,000poisson 95% confidence intervalcarrier frequency ii / iii30.220.050.652.980.240.810.31mucolipidosis iv10.020.00.130.97glycogenosis type ii ( all)120.370.130.813.8620.170.69ncl 120.190.020.702.790.17ncl 2280.360.240.523.790.07ncl 320.270.030.963.270.48ncl 410.020.00.130.97ncl 520.210.030.772.92ncl 610.020.00.130.971.43ncl 7180.850.491.365.81ncl unspecified200.370.220.58ncl ( all types)742.291.035.152.14nl netherlands , issd infantile sialic acid storage disease , ncl neuronal ceroid lipofuscinosistotal number of patients diagnosed between 1975 and 2008data for prevalence calculations are in table 6carrier per 1 live birthunspecified ncl were diagnosed on the basis of histochemical and ultrastructural examination of biopsy samples combined with the evaluation of clinical data . no material was available for enzyme and dna analysistable 4lipidoses : data for calculation of birth prevalencediseaseno . of patients 19752008years of birthno . of live birthsno . of patientsprevalence ( 1 per numbers of live births)prevalence per 100,000carrier frequencygaucher type i , early12 ( 10)197419963 090 90212257 5750.39254gaucher type i , late29 ( 28)194519805 956 02824248 1680.40249gaucher type ii and iii8 ( 8)198019982 352 4928294 0620.34271gaucher ( all types)494488 3971.13149niemann - pick a10 ( 8)196320025 480 88510548 0890.18370niemann - pick b + atyp13 ( 11)194819967 362 14611669 2860.15409niemann - pick a / b2321301 3270.33274niemann - pick c54 ( 45)196520035 271 31048109 8190.91166fabry49 ( 24)194520028 518 60144193 6050.5296 803male4 382 0684499 5921.00fabry female78 ( 24)194520058 812 16168129 5910.77krabbe15 ( 15)197720023 249 15013249 9350.40250mld infantile13 ( 11)197019994 195 56413322 7360.31284 juvenile5 ( 4)197020044 661 3245932 2650.11483 adult7 ( 7)196819802 188 0046364 6670.27302mld ( all types)2524144 6470.69190cesd , wolman18 ( 15)196320025 480 88515365 3920.27302gm1 gangliosidosis13 ( 13)197020034 563 66012380 3050.26308gm2 tay - sachs10 ( 10)197119923 362 88910336 2890.30290gm2 sandhoff3 ( 3)199220071 594 9493531 6500.19365lipidoses all types259/337234/30220 0005.0/5.7771mld metachromatic leukodystrophy , cesd cholesteryl ester storage diseasetotal number of patients diagnosed between 1975 and 2008number of families with particular disorder in parenthesesnumber of patients taken for the calculation of birth prevalence . to avoid underestimation , some patients were not included into the prevalence calculation ( e.g. , patients born before 1945 see patients and methodsexpressed as 1 carrier per number of shown live birthsone stillborn casenp type b in 6 slowly progressive visceral cases and atypical protracted neurovisceral phenotype in 7 cases [ pavl - pereira h , et al . j inherit metab dis 2005;28:203227]including one case of np type c2 [ elleder m. et al . virchows arch 2001;439:206211]classical phenotype in 43 male patients and cardiac variant in 6 male patients ( two families ) [ elleder m , et al . cas lek cesk 1990;129:368372]infantile form in 12 patients , late infantile in 2 patients , and adult form in one patient [ kostalova e , et al . ceska slov neurol neurochir 2006;69/102:200210]one infantile patient ( wolman disease ) and 17 juvenile and adult cases [ elleder m , et al . cas lek cesk 1999;138:719724]including two adult patientsfabry females not includedfabry females includedmale live birthscarrier frequency of lipidoses except for fabry diseasetable 5mucopolysaccharidoses : data for calculation of birth prevalencediseaseno . of patients 19752008years of birthno . of live birthsno . of patientsprevalence ( 1 per number of live births)prevalence per 100,000carrier frequencymps i20 ( 17)198420082,772,55920138,6280.72186mps ii22 ( 19)196920054,906,70021233,6520.43116,826male2,520,37321120,0180.83mps iii a18 ( 14)197720063,648,54117214,6200.47232mps iii b1197520084,261,89714,261,8970.021,032mps iii c5 ( 4)198419921,179,7455235,9490.42243mps iii ( all types)2423109,5020.91165mps iv a14 ( 9)198720031,826,47313140,4980.71187mps iv b1197520084,261,89714,261,8970.021,032mps iv ( a + b)1514136,9860.73185mps vi2 ( 2)196819954,115,05722,057,5290.05717mps vii1197520084,261,89714,261,8970.021,032mps i vii848134,9092.8693mps - unspecified32 ( 27)196019894,533,49627167,9070.60205msd3 ( 1)196219691,144,4673381,4890.26309mps all types11911126,8653.7282mps mucopolysaccharidosis , msd multiple sulphatase deficiencytotal number of patients diagnosed between 1975 and 2008number of families with particular disorder in parenthesesnumber of patients taken for the calculation of birth prevalence . to avoid underestimation , some patients were not included into the prevalence calculation ( e.g. , patients born before 1945 were excluded ) . for prevalence definition , see patients and methodsexpressed as 1 carrier per number of shown live birthshurler syndrom in 16 patients , hurler / scheie in 2 patients and scheie syndrom in 2 patientsmale live birthscarrier frequency of mps excluding mps iitable 6glycoproteinoses , mucolipidoses , glycogenosis type ii and neuronal ceroidlipofuscinoses : data for calculation of birth prevalencediseaseno . of patients 19752008years of birthno . ( 1 per numbers of live births)prevalence per 100,000carrier frequency-mannosidosis4 ( 3)198519921,042,8044260,7010.38255-mannosidosis2 ( 1)195019561,223,3862611,6930.16391issd1197520084,261,89714,261,8970.021,032mucolipidosis i3 ( 2)196919994,338,72931,446,2430.07601mucolipidosis ii / iii3 ( 3)199420071,352,2193450,7400.22336mucolipidosis iv1197520084,261,89714,261,8970.021,032gp + ml ( all types)1414112,9950.87170glycogenosis type ii infantile6 ( 5)197919992,614,0756435,6790.23330glycogenosis type ii juvenile6 ( 5)197220024,167,9306694,6550.14417glycogenosis type ii ( all)1212267,7500.37259ncl 12 ( 2)197019751,033,4472516,7240.19359ncl 228 ( 25)194920037,803,06828278,6810.36264ncl 32 ( 2)19791983749,5202374,7600.27306ncl 41197520084,261,89714,261,8970.021,032ncl 52 ( 1)19831989935,5532467,7770.21342ncl 61197520084,261,89714,261,8970.021,032ncl 718 ( 16)198520022,002,02517117,7660.85172ncl - unspecified20 ( 17)196519994,903,21418272,4010.37261ncl ( all types)747143,5512.29104issd infantile sialic acid storage disease , gp glycoproteinosis , ml mucolipidosis , ncl neuronal ceroid lipofuscinosistotal number of patients diagnosed between 1975 and 2008number of families with particular disorder in parenthesesnumber of patients taken for the calculation of birth prevalence . to avoid underestimation , some patients were not included into the prevalence calculation ( e.g. patients born before 1945 were excluded ) . for prevalence definition see patients and methodsexpressed as 1 carrier per number of shown live birthsone infantile patient and two juvenile siblings with cherry - red spot myoclonus syndrome [ ledvinova j , et al . j inherit metab dis 1994;17:118119]atypical case of ml iv with ocular restricted phenotype [ dobrovolny r , et al . am j ophthalmol 2007 ; 143:663671 ] relative rate of lysosomal storage disorders in the czech republic . mps mucopolysaccharidosis , ncl neuronal ceroidlipofuscinosis , gsd ii glycogenosis type ii , ml mucolipidosis , gp glycoproteinosis , npa / b / c niemann - pick a / b / c , mld metachromatic leukodystrophy , cesd cholesterol ester storage disease , msd multiple sulphatase deficiency , gm1 gm1 gangliosidosis , gm2 gm2 gangliosidosis ( tay - sachs and sandhoff diseases ) , -man -mannosidosis , -man -mannosidosis , issd infantile sialic acid storage disease number of live births ( ) and number of lsd diagnoses ( ) in the czech population from 1975 to 2008 . in 1985 , electrophoretic analysis of glycosaminoglycans ( elfo gag ) and thin layer chromatography of oligosaccharides ( tlc ols ) in urine were introduced . from 1990 nowadays , laboratory diagnostic methods for 45 lsds are available ( enzyme and dna analyses , loading assays ) lipidoses : comparison of data in different populations nl netherlands , mld metachromatic leukodystrophy , cesd cholesteryl ester storage disease total number of patients diagnosed between 1975 and 2008 data for prevalence calculations are in table 4 carrier per 1 live birth male live births only fabry females not included fabry females included mucopolysaccharidoses : comparison of data in different populations nl netherlands , mps mucopolysaccharidosis , msd multiple sulphatase deficiency total number of patients diagnosed between 1975 and 2008 data for prevalence calculations are in table 5 carrier per 1 live birth male live births only unspecified cases of mps were diagnosed on the basis of analysis of glycosaminoglycan excreted in urine combined with the evaluation of clinical data . no material was available for enzyme and dna analysis glycoproteinoses , mucolipidoses , glycogenosis type ii and neuronal ceroid lipofuscinoses : comparison of data in different populations nl netherlands , issd infantile sialic acid storage disease , ncl neuronal ceroid lipofuscinosis total number of patients diagnosed between 1975 and 2008 data for prevalence calculations are in table 6 carrier per 1 live birth unspecified ncl were diagnosed on the basis of histochemical and ultrastructural examination of biopsy samples combined with the evaluation of clinical data . no material was available for enzyme and dna analysis lipidoses : data for calculation of birth prevalence mld metachromatic leukodystrophy , cesd cholesteryl ester storage disease total number of patients diagnosed between 1975 and 2008 number of families with particular disorder in parentheses number of patients taken for the calculation of birth prevalence . to avoid underestimation , some patients were not included into the prevalence calculation ( e.g. , patients born before 1945 were excluded ) . for prevalence definition , see patients and methods expressed as 1 carrier per number of shown live births np type b in 6 slowly progressive visceral cases and atypical protracted neurovisceral phenotype in 7 cases [ pavl - pereira h , et al . j inherit metab dis 2005;28:203227 ] including one case of np type c2 [ elleder m. et al . virchows arch 2001;439:206211 ] classical phenotype in 43 male patients and cardiac variant in 6 male patients ( two families ) [ elleder m , et al . cas lek cesk 1990;129:368372 ] infantile form in 12 patients , late infantile in 2 patients , and adult form in one patient [ kostalova e , et al . ceska slov neurol neurochir 2006;69/102:200210 ] one infantile patient ( wolman disease ) and 17 juvenile and adult cases [ elleder m , et al . cas lek cesk 1999;138:719724 ] including two adult patients fabry females not included fabry females included carrier frequency of lipidoses except for fabry disease mucopolysaccharidoses : data for calculation of birth prevalence mps mucopolysaccharidosis , msd multiple sulphatase deficiency total number of patients diagnosed between 1975 and 2008 number of families with particular disorder in parentheses number of patients taken for the calculation of birth prevalence . to avoid underestimation , some patients were not included into the prevalence calculation ( e.g. , patients born before 1945 were excluded ) . for prevalence definition , see patients and methods expressed as 1 carrier per number of shown live births hurler syndrom in 16 patients , hurler / scheie in 2 patients and scheie syndrom in 2 patients carrier frequency of mps excluding mps ii glycoproteinoses , mucolipidoses , glycogenosis type ii and neuronal ceroidlipofuscinoses : data for calculation of birth prevalence issd infantile sialic acid storage disease , gp glycoproteinosis , ml mucolipidosis , ncl neuronal ceroid lipofuscinosis total number of patients diagnosed between 1975 and 2008 number of families with particular disorder in parentheses number of patients taken for the calculation of birth prevalence . to avoid underestimation , some patients were not included into the prevalence calculation ( e.g. patients born before 1945 were excluded ) . for prevalence definition see patients and methods expressed as 1 carrier per number of shown live births one infantile patient and two juvenile siblings with cherry - red spot myoclonus syndrome [ ledvinova j , et al . j inherit metab dis 1994;17:118119 ] atypical case of ml iv with ocular restricted phenotype [ dobrovolny r , et al . am j ophthalmol 2007 ; 143:663671 ] to date , no individuals in the czech population have been conclusively diagnosed with farber disease , schindler disease , danon disease , sanfilippo d disease , galactosialidosis , fucosidosis , aspartylglucosaminuria , or prosaposin , saposins , or gm2 activator protein deficiencies . the overall prevalence of lsds in the czech population ( 12.25 per 100,000 ) , which represents a typical central european population , is comparable to prevalences reported for australia ( 12.9 per 100,000 ) , the netherlands ( 14 per 100,000 ) and italy ( 12.1 per 100,000 ) ( meikle et al . . the higher prevalence of lsds reported for the northern portuguese population ( 25 per 100,000 ) might reflect the relative geographic isolation and more extensive studying of that particular population of this region ( pinto et al . the most frequent single lsd is gaucher disease in the czech republic , italy and australia , gm2 gangliosidosis in portugal , and pompe disease in the netherlands . in the czech population , lipidoses were most frequently diagnosed ( 5.0 per 100,000 live births ) , followed by mps ( 3.72 ) and ncl ( 2.29 ) . in addition to the lsd diagnoses in czech patients , 96 cases from slovakia were confirmed at our institute during the studied period ; 41% with lipidoses , 39% with mps , and 20% with gsd ii or ncls . these slovakian patients have not been included in our prevalence calculations as former czechoslovakia was divided into two independent states , the czech republic and the slovak republic , in 1993 . interestingly , the four cases of prosaposin deficiency so far diagnosed at our institute came from neighboring populations ( slovak , german ) ( hulkova et al . 2001 ; elleder et al . the birth prevalence of the most frequent lsd in the czech republic , gaucher disease , is 1.13 per 100,000 live births , followed by niemann - pick c ( 0.91 ) , mps iii ( 0.91 ) , mps iv ( 0.73 ) , and mps i ( 0.72 ) . comparison of these prevalences to those in selected foreign populations ( tables 1 , 2 and 3 ) is complicated by the differences in methods used for calculation . when we compared the calculations of prevalence in the czech population based on the method of poorthuis et al . ( 1999 ) used in this study ( see patients and methods ) to the method reported by meikle et al . ( 1999 ) ( the prevalence calculated as the number of patients divided by the total number of live births during the study period ) , the calculations resulted in underestimation or overestimations of some individual disorders . this is the case for disorders with delayed onset ( e.g. , frequencies of fabry disease were 0.52 and 1.14 per 100,000 , and frequencies of cholesterol ester storage disease were 0.27 and 0.42 , if calculated using the methods of poorthuis et al . also , unavailability of some diagnostic methods during the study period ( some methods were introduced as late as the 1990s ) may explain some discrepancies found in our calculations using the two methods . although prevalence values for some disorders calculated using either of the methods were within the confidence intervals ( data not shown ) , for other disorders prevalence values fell outside this interval ( e.g. , the frequencies differed for mps iii c ( 0.42 and 0.11 per 100,000 ) , mps iva ( 0.71 and 0.32 ) , ncl 2 ( 0.36 and 0.65 ) and ncl 7 ( 0.85 and 0.42 ) , if calculated according to the methods used by poorthuis et al . thus , establishment of standard rules for calculation of birth prevalence - a defined term in clinical epidemiology - is highly recommended . based on our experience , the calculation of the ratio of the number of patients to the number of live births during the patients births period ( poorthuis et al . underestimation of the birth prevalence may result from lack of recognition of early clinical signs and symptoms or phenotypic diversity , including adult forms of the disease ( e.g. , fabry disease , adult krabbe disease , adult mld , cholesteryl ester storage disease , and adult gsd ii ) . thus , the calculated birth prevalence is probably the lowest estimate as the diagnosis is commonly delayed for years . screening studies have shown that certain groups of patients , for example individuals with renal failure on haemodialysis , may harbor missed fabry patients ( nakao et al . the nationwide screening study among 3,370 chronic haemodialysis patients in the czech republic disclosed four previously unrecognized fabry males and one female from five unrelated families . subsequent family screening ascertained fabry disease in another 12 individuals , including 8 females ( merta et al . patients with unexplained cardiomyopathy represent another group at risk of having fabry disease where screening is justified ( monserrat et al . 2007 ) . such lsd screening initiatives for selected lsds will contribute to the identification of the true prevalence of these disorders ( spada et al . fabry heterozygotes have not been included in the calculation of birth prevalence in previous reports ( meikle et al . however , they commonly develop clinical symptoms and severe complications , generally a few years later , as in affected men ( deegan et al . 2006 ; wilcox et al . 2008 ) . when we included fabry heterozygotes in the calculations , the prevalence of fabry disease increased by 2.5 times to 1.29 per 100,000 live births , that of lipidoses from 5.0 to 5.77 per 100,000 and the overall prevalence of lsds reached 13.02 per 100,000 ( table 4 ) therefore , we propose that fabry heterozygotes ought to be included in the calculation of the birth prevalence of fabry disease . reliable calculation of the birth prevalence is dependant on a correctly defined pathogenic cause underlying the condition . recent molecular studies have provided evidence for at least ten separate genetic loci ( cln1cln10 ) for ncl ( peltonen et al . these new findings necessitated reclassification of our 37 cases that had formerly been provisionally classified as ncl6 into ncl5 , ncl6 , and ncl7 subgroups . the latter turned out to be of high prevalence in the roma gypsy population ( kousi et al . 2009 ) . about a quarter of the ncl cases remain unspecified due to the lack of material suitable for mutation analysis . athough specific lsds are generally reckoned to be rare disorders , as a group of inherited metabolic disorders they are quite common , as seen from published and our data . the information on birth prevalencies of lsds is available from countries with a long tradition of diagnosis of lsds ; however , for most populations , these date are missing . epidemiological data on these disorders are important in genetic counselling for calculation of the risk for the disorders in the other members of affected families and subsequently for the public health care systems . importantly , awareness of the clinical aspects of these life - threatening and progressively disabling genetic diseases among the medical community should increase , allowing earlier diagnosis . dependant on the diagnosed disorder , such intervention may include enzyme replacement therapy , bone marrow transplantation , or other current or future therapies . last but not least , it should be borne in mind that genetic counselling and prenatal diagnosis in families affected by a genetic metabolic disorder still form the basic strategy for lowering the number of patients with these severe disorders .

the aim of this retrospective study was to determine the prevalence of lysosomal storage disorders ( lsds ) in the czech republic . the data on cases diagnosed between 1975 and 2008 were collected and analyzed . the overall prevalence of lsds in the czech population ( 12.25 per 100,000 ) is comparable to that reported for the countries with well - established and advanced diagnostics of lsds such as the netherlands ( 14 per 100,000 ) , australia ( 12.9 per 100,000 ) and italy ( 12.1 per 100,000 ) . relatively higher prevalence of lsds was reported in the north of portugal ( 25 per 100,000 ) . thirty - four different lsds were diagnosed in a total of 478 individuals . gaucher disease was the most frequent lsd with a birth prevalence of 1.13 per 100,000 births . the most frequent lsd groups were lipidoses , mucopolysaccharidoses , and neuronal ceroid lipofuscinoses , with combined prevalences of 5.0 , 3.72 , and 2.29 per 100,000 live births , respectively . glycoproteinoses ( 0.57 per 100,000 live births ) , glycogenosis type ii ( 0.37 ) , and mucolipidoses ( 0.31 ) rarely occur in the czech population , and a range of other lsds have not been detected at all over the past three decades . knowledge of the birth prevalence and carrier frequency of particular disorders is important in genetic counselling for calculation of the risk for the disorder in the other members of affected families . earlier diagnosis of these disorders will permit timely intervention and may also result in lowering of the number of newborns with lsds .

Introduction Patients and methods Results Discussion

health spending in the united states reached $ 425 billion in 1985 , up 8.9 percent from the previous year . this growth was the slowest in two decades , but the slowdown was attributable almost entirely to lower growth of prices . person , but rather a commitment of resources on a national level . of the funding for health expenditures , 59 percent came directly from the private sector , mostly through private health insurance and from consumers and their families . the remaining 41 percent was funded through government programs , principally the medicare and medicaid programs . the medical care component of the consumer price index ( cpi ) was 6.2 percent higher in 1985 than it had been in 1984 . equally encouraging , at least to purchasers of health care , was a marked trend toward price competition in the health care market . the rapid spread of competition among providers of care for market share may have served to moderate the rise of health care prices even beyond the extent indicated by the list prices measured in the cpi . although a slowdown in the growth of prices was welcome news to consumers and insurers alike , there were at least two troubling signs to be seen . first , despite that slowdown , medical prices still outpaced prices of other goods and services . to a great extent , this type of price behavior is expected . health care is largely a service , and in a mature economy , service prices tend to rise more rapidly than do commodity prices . however , the inevitability of an economic phenomenon does little to ease the burden it imposes . the burden that relatively high medical care price inflation imposes is that , unless the combined growth of relative prices and of the quantity of goods and services consumed per capita is less than the growth of real income per capita ( currently about 2 or 3 percent per year ) , a larger and larger share of income will be consumed for health care . this clearly has been the case in the united states , as health spending reached 10.7 percent of the gross national product ( gnp ) , a measure of our nation 's income . the second troubling observation about medical care price inflation is that it seems to be heating up again . starting in mid-1985 , monthly cpi figures began to show more and more growth , suggesting that the deceleration of price inflation experienced in 1985 will not be repeated in 1986 . the amount spent for health in 1985 increased over 1984 levels even after adjustment for the effects of price growth . this can be seen in either of two ways . first , growth of real spending for personal health care expenditure change excluding the effects of health care price inflation was very much along historical trends . second , the opportunity cost of health care spending spending deflated by the general price level to measure the amount of other goods and services u.s . consumers had to forgo in order to purchase health care increased 5.4 percent in 1985 . both measures point to an increase in the share of our nation 's physical consumption devoted to health . spending for health has been cutting more and more deeply into the nation 's pocketbook . from about 6 percent of gnp in 1965 , national health expenditures grew to equal 10.7 percent of gnp in 1985 , nearly doubling the claim on resources in two decades . the relatively rapid change from 1984 to 1985 in the share of gnp going to health can be attributed to two phenomena . in 1984 , gnp grew very strongly after a 2-year recession but health spending , and hospital spending in particular , decelerated as providers and consumers accustomed themselves to changes in the financing of such care . in addition , gnp growth in 1985 was one - half of the 1984 growth . prices and real growth decelerated , but health care price inflation did not decelerate nearly as much , and real growth increased a little . the decline in the share of gnp going to health in 1984 appears to be a one - time blip in the historic trend rather than the start of a new trend . it is perhaps some consolation that the united states is not alone in its struggle to determine the proper level and mix of health care consumption . most other industrial countries in the world are facing the same issue , adopting different approaches in attempting to find a solution . from great britain 's nationalized health industry , through the reliance of france and west germany on the social security system , to u.s . dependence on the private sector , a variety of health delivery and financing models have been developed . that real growth of health spending has followed a fairly even path does not alter the fact that the health care industry has undergone change in the recent past . although minor in comparison with the structural upheaval of other industries in the united states , such as that faced by the steel and air travel industries , the changes seen in the health industry are remarkable in light of the strong traditional attitudes of health care providers and consumers . driven by cost considerations , insurers and other third parties have banished , perhaps forever , an unflinching reliance on providers of care to determine not only the correct treatment but the correct cost of that treatment as well . the new wave of health care can be seen through changes in the delivery of care ( notably , the deemphasis of hospital care ) and in the financing of care ( a heightened concern with the bottom line ) . following years of unrelenting increases in hospital use , the financial pinch felt by employers and government health program managers early in the 1980 's resulted in sharp reversals of historic trends . growth of expenditures for hospital services , which comprise almost one - half of all spending for personal health care and which had been growing more rapidly than other forms of health spending , slowed dramatically . preadmission testing in outpatient departments and physicians ' offices replaced early admission to the hospital , and the length of hospital stays was reduced . procedures that had been performed on an inpatient basis were moved to outpatient and office settings . in some cases , financial pressures to move to lower cost settings were coupled with the diffusion of affordable technology that permitted such moves . in december 1985 , the u.s . department of commerce announced the results of their periodic revision of the gross national product ( gnp ) estimates . the new estimates are substantially higher than previous figures because of three types of changes : definitional changes ( none related to health ) , new methods of adjusting tax return information , and the inclusion of new or revised data . for example , of the $ 111 billion upward revision to gnp for 1984 , $ 30 billion are attributable to changes in definitions , $ 44 billion to adjusted tax information , and the remainder to revised data ( bureau of economic analysis , 1985 ) . the effect of these revisions , not yet incorporated in the national health expenditures series , is to lower the share of gnp accounted for by health in the past as well as present . as we undertake our own benchmark of national health expenditures estimates , we may well revise spending levels upward for some of the same reasons that the gross national product was increased , returning health 's share of gnp to somewhere near its previous levels . industry statistics indicate the remarkable turnaround in use of hospital facilities over the last 5 years . after an average growth rate of 2.5 percent from 1967 to 1979 , the number of admissions to community hospitals dropped an average of 1.0 percent per year from 1979 to 1985 ( hospital data center , 1986 ) . a reversal in the growth trend for inpatient days was just as pronounced , from a pre-1980 average growth of 1.5 percent to a post-1980 average of 2.3 percent . further , it was the population under 65 years of age for whom admissions and days first began to drop . use of hospital care by the population 65 years of age or over did not begin to fall until 1984 , but admissions and inpatient days for the population under 65 years of age had begun to drop as early as 1982 . what became of the care that would have been provided to those lost admissions ? to some extent , it never was provided . other care was provided through nonhospital providers : nursing homes , home health agencies , ambulatory care centers , and traditional practitioner offices . it is clear from the growth of price - deflated spending for personal health care that the u.s . population is not consuming less health care goods and services than before , either in total or per capita . during the last few years , hospitals have benefited from a slowdown in the growth of prices they paid for inputs . these benefits have been shared with consumers in the form of slower price growth for hospital services . the consumer price index component for hospital care , one measure of output prices , rose 6.4 percent from 1984 to 1985 , the smallest change recorded for that component since its creation in 1977 . increasing competition in the health care industry has led both distributors and hospitals to engage in price discounting , a phenomenon that is not captured in the cpi or the producer price index . paying something other than list prices is not new : blue cross and other insurers ( and , until the advent of the prospective payment system , medicare ) based reimbursement on the cost of the service rather than its price . still , the recent proliferation of preferred provider organizations has extended price discounting to many smaller insurers , including self - insured businesses . further , heightened competition for customers among product distributors has combined with hospitals ' exercise of purchasing power to create widespread discounting of prices paid by hospitals . thus , even the official estimates of price inflation may overstate the growth of hospital prices . despite a drop in the number of admissions and inpatient days during the last few years industry statistics for 1985 show that community hospital income was 5.9 percent greater than expenses , part of a 10-year upward trend ( hospital data center , 1986 ) . first , the health industry in general has recently become more businesslike in management and decisionmaking in response to cost - containment pressures from insurers and employers alike . at least one hospital , for example , has begun a commercial flat laundry service to use slack time in its own laundry . third , large profits have reportedly been made by some types of community hospitals in the first years of medicare 's prospective payment system . the same pressures that are forcing hospitals to become more businesslike in their operation are also fostering development of alternatives to traditional health care centered around hospitals and family physicians . a new subindustry , the walk - in clinic , has arisen in just a few years . from 150 establishments in 1979 , the number of walk - in clinics has grown to 1,850 in 1984 , with an annual business of $ 800 million ( henderson , 1985 ) . prepaid health care , usually in the form of a health maintenance organization ( hmo ) , traces its roots back to the great depression but did not experience rapid growth until the last decade . in december 1985 , 21 million people were enrolled in 480 hmo 's across the nation ( interstudy , 1986 ) . record - setting enrollment growth , up 25.7 percent from december 1984 , laid the groundwork for strong growth in the 1990 's , when projections indicate that 25 - 30 percent of the u.s . the appeal of hmo 's stems from their ability to manage total patient care by directing patients to and treating them in the appropriate setting ( thus reducing hospitalizations ) , by emphasizing preventive care , and by keeping costs low . the average monthly premium per family for hmo enrollees increased only 4 percent in 1985 , to $ 196 ( interstudy , 1986 ) . as demonstrated in a study ( schieber , 1985 ) conducted under the auspices of the organization for economic cooperation and development ( oecd ) , rising levels of per capita national income are associated with higher proportions of that income being spent on health : a 10-percent increase in gross domestic product ( gdp ) per capita is associated with a 4.4-percent increase in the share of gdp going for health . the author found both a fairly consistent pattern of real growth in health spending relative to gdp within countries and greater than proportional spending differentials in countries with higher gdp 's . he also stated , health care price inflation in excess of overall economic inflation continues to be a problem , albeit not the major one , in many , although not all , of the countries . increases in utilization / intensity of services due to both coverage changes and technological progress , population aging , and large increases in the number of physicians could pose significant new expenditure pressures in most oecd countries in the near future . home health care is another response to cost - containment pressures . although the exact size indeed , the exact definition of the industry is the subject of debate , the rapidity of its growth is not . medicare and medicaid benefits alone rose from less than $ 100 million per year in 1972 to $ 3 billion per year in 1985 . like other insurers of health care , the medicare program has been grappling with the rising cost of health care . it has been seeking ways to protect the access to care not only of current beneficiaries , but also of future retirees . medicare 's hospital insurance ( hi ) , or part a , trust fund is still in jeopardy despite the implementation of the hospital prospective payment system . in 1985 , 30.6 million people 65 years of age or over , disabled , or suffering from end stage renal disease were covered by the hospital portion of medicare . the average couple enrolled in hi can expect to receive more in benefits than they paid into the program ( for example , from 7 to 26 times as much for a couple retiring in 1985 ) . therefore , the program depends on taxes paid by future beneficiaries ( current workers ) to finance care for current beneficiaries . however , changing demographic conditions will create problems . as stated in the most recent trustee 's report : there are currently over four covered workers supporting each hi enrollee . this ratio will begin to decline rapidly early in the next century . by the middle of that century not only are the anticipated reserves and financing of the hi program inadequate to offset this demographic change , but under all but the most optimistic assumptions , the hi trust fund is projected to become exhausted even before the major demographic shift begins to occur . exhaustion is projected to occur during the late 1990 's and could occur as early as 1993 if the pessimistic assumptions are realized ( health care financing administration , 1986 ) . in an effort to extend the life of the hi trust fund , medicare implemented its prospective payment system ( pps ) in stages , beginning in 1983 . a primary objective of pps is to encourage the efficient and effective provision of hospital care by changing the economic incentives of the payment system . hospitals and is based on an average cost per case for each of 467 diagnosis related groups . the year - to - year growth in the payment rates is a composite of price inflation and measures of hospital production . medicare 's supplementary medical insurance ( smi ) , or part b currently , premiums cover about one - quarter of program costs , so considerable tax revenue , $ 18 billion in 1985 , is needed to provide benefits . in 1985 , 30.0 million people , most of whom were 65 years of age or over , were enrolled in medicare part b ; by 1993 , that number should reach 34.3 million . however , research is under way to determine methods of introducing cost consciousness into the way in which part b care is delivered . one proposed solution to these problems is to enroll medicare beneficiaries in hmo 's and competitive medical plans ( cmp 's ) on a risk basis . ( an hmo or cmp that operates on a risk basis assumes the financial risk of the enrollee 's medical care in return for a premium . ) changes in federal laws regarding reimbursement to hmo 's and cmp 's , effective february 1985 , substantially increased participation in hmo risk enrollment , both by providers and by medicare enrollees . as of june 1986 , 630,000 beneficiaries were enrolled on a risk basis in 132 hmo 's and cmp 's , 5.8 percent more than in the previous month . ( another 220,000 enrollees were in hmo 's reimbursed on a cost basis . ) from march 1985 to june 1986 , enrollment of medicare beneficiaries in hmo 's operated on a risk basis more than doubled . the tax equity and fiscal responsibility act of february 1985 allowed hmo 's to accept medicare enrollees on a risk basis . this provided incentives for the government , the industry , and enrollees to participate in such prepaid arrangements . the attraction for the government lies in the ability to control expenditures using the forces of the marketplace competition and consumer choice . contracting is more attractive to the industry because of the opportunity for profit and the prospective nature of medicare payments . the attractiveness of hmo risk contracts to medicare beneficiaries stems from the additional benefits available . the medicare program pays a risk hmo 95 percent of the adjusted average per capita cost ( aapcc ) of regular medicare benefits for enrollees in the hmo 's geographic area . however , if the commercial rate charged by the hmo ( adjusted for medicare ) is less than the aapcc , the hmo must do one of four things . it may use the difference to reduce premiums , to provide additional benefits , to offset future premium increases , or it may return the difference to the government . the enrollee continues to pay the medicare part b premium , but the reduced hmo premium ( as low as zero in some hmo 's ) and additional benefits , such as prescription drug coverage or unlimited hospitalization , can be an attractive alternative to regular fee - for - service medicare . after increases of more than 15 percent per year from 1978 to 1981 , medicaid expenditure growth has slowed considerably because of changes initiated by state and federal governments in the areas of services , reimbursement , and eligibility . according to an intergovernmental health policy project report ( 1986 ) : how much of the recent slowdown in the growth of medicaid expenditures can be attributed to new state initiatives and experimentation in the organization , financing , and reimbursement of services , as opposed to reduced federal financial participation , or federal and state policies constricting eligibility and benefits , can not easily be determined . nevertheless , several state officials have singled out increased program flexibility , especially with respect to institutional reimbursement and new waiver opportunities , as contributing significantly to their ability to constrain the growth in their programs . among the newest initiatives are competitive bidding programs for inpatient hospital services , which have been implemented in california , arizona , and illinois . in states with low hospital occupancy rates , hospitals are willing to bid competitively for the delivery of medicaid services . in exchange for reduced rates charged to the medicaid program , hospitals ensure a larger market share and increased patient flow through their facilities . despite implementation of the prospective payment system ( pps ) , medicare 's share of the nation 's hospital bill continues to rise , from 26 percent in 1981 to 29 percent in 1985 . in 1985 alone , medicare expenditures for hospital services rose 10.1 percent , 60 percent faster than the growth in all remaining non - medicare hospital revenues , which increased 6.2 percent . the rise in medicare 's share of hospital costs over the past 2 years appears to be inconsistent with the cost - containment aims of pps . at the same time , persistent claims that pps had thrust some hospitals into severe financial positions prompted the office of the inspector general of the department of health and human services to investigate the early impact of pps . the study results indicate that the 2,099 hospitals included in the study earned a net profit margin of about 15 percent on medicare revenues and a return on investment of 25 percent the study highlighted the larger profits recorded by teaching hospitals ( 47 percent higher than their nonteaching counterparts ) , by investor - owned facilities ( 21 percent higher than nonprofit facilities ) , by urban hospitals ( 74 percent higher than rural facilities ) , and by hospitals with greater numbers of medicare - certified beds . based on this evidence of high profit margins earned by pps hospitals , the office of the inspector general 's report cited the proposed freeze on pps rates in 1986 as a positive step . these medicare profits resulted , in part , because established pps rates were based on overstated hospital inpatient operating costs the chief actuary of the health care financing administration has a different perspective ( king , 1986 ) . during the first year of pps , total expenditures under medicare for inpatient hospital services were required by law to remain at the same level under pps as they would have been under the cost - based reimbursement system . when hospitals responded to the incentives of prospective payment by becoming dramatically more cost efficient , profit rates soared . following are highlights of 1985 estimates on national health expenditures : $ 425 billion was spent for health in the united states in 1985 , an amount equal to 10.7 percent of the gross national product . almost one - half of the money spent for health in 1985 was used to purchase hospital and nursing home services . hospital expenditures , $ 167 billion in 1985 , grew less during the last 2 years than at any other time in the last two decades . $ 83 billion , 22 percent of personal health care expenditures , were spent for the services of physicians . this proportion has remained almost unchanged over the last decade despite substantial changes in the size and focus of individual government programs . medicare , the federal program of health insurance for the aged and disabled , spent $ 71 billion for health care benefits in 1985 , 19 percent of all personal health care expenditures . the proportion of spending attributable to medicare has increased slowly but steadily since the program 's inception in 1966 . medicaid , a joint federal and state program of health care for certain categories of low - income people , paid $ 40 billion for health care in 1985 . the growth of medicaid spending since 1981 has been much lower than historical growth rates as state governments have grappled with rising health costs and reduced growth of revenues . about one - third of health spending was channeled through private health insurance plans . since 1980 , that proportion has remained steady or even fallen a little after years of increase . the direct pay percentage declined during the 1960 's and 1970 's with the growth of government programs and private health insurance coverage , but it appears to have leveled off since 1980 . enrollment of medicaid recipients increased substantially over the past year , reaching 561,000 in december 1985 , up from 349,000 in june 1984 . there are indications , however , that hmo 's and medicaid recipients may not find each other attractive . hmo 's find that recipients tend to be high users of services and to have high disenrollment rates ( glenn , 1985b ) , confounding risk assessment and actuarial ratesetting . for their part , low - income hmo enrollees may need assistance in learning how to use hmo 's effectively . they may have trouble dealing with the queuing system for appointments and with limitations on emergency room visits . they may lack continuity in care by the same physician or group of physicians and are less likely than others to know how to deal with a medical system that is predisposed to underserve ( reichard , 1986 ) . employers in the private sector are becoming increasingly aggressive in the pursuit of health care cost containment and are trying a number of paths to this goal ( washington business group on health , 1984 ) . an increasing number are turning to self - insurance in an effort to exert more pressure on providers of care , to benefit from the cash flow advantages of not having to pay premiums , and , in some instances , to avoid state regulation of benefit packages . we estimate that more than one - half of all employees in 1984 were covered by some form of self - insurance , compared with about 10 percent in 1977 . the incidence of use review is increasing also as employers , directly or through their insurers , are demanding that uncontrolled use of health care benefits be curtailed . one development in the area of private sector initiatives is the rise of preferred provider organization ( ppo ) arrangements . these agreements between providers ( groups of physicians , hospitals , and other practitioners ) and insurers were originally designed to provide price breaks for the insurer and guaranteed patient loads for the provider . competition among ppo 's , however , has led to variations on that theme : ppo 's now offer use review , prepayment options , and other financial and service arrangements ( rice et al . , 1985 ; cassack , 1985 ) . the national association of employers on health care recently honored two companies for contributions to health care cost containment . it now covers more than 38,000 employees and dependents . in 1978 , the company introduced a dental care plan through which employees receive preventive care , endodontia , orthodontia , and oral surgery services . the company also has implemented other cost - containment measures such as preadmission certification , a preadmission testing requirement , on - site concurrent review in the hospital , and a mandatory second surgical opinion program the xerox corporation , which moved from a first - dollar medical benefits plan to a comprehensive plan with copayments and deductibles in 1984 , has been able to reduce hospital utilization by about 20 percent as a result of cost - containment efforts xerox also offers employees a comprehensive wellness program , which was established in 1978 . the company has fitness facilities at 11 of its major offices , and employee - volunteers who coordinate health seminars , contests , and distribution of wellness materials . xerox is now in the first stages of developing a managed - care system in which the company will negotiate provider contracts with physicians and hospitals ( business insurance , 1986 ) . all of the forces working on the health care industry have a direct effect on consumers of care as well as providers of care . congressional hearings have been held to determine whether medicare 's prospective payment system , by creating an incentive for hospitals to discharge patients quicker and sicker , has caused a deterioration in the health status of the aged population . the full cost of health care eventually is borne by consumers as a whole in direct costs , higher insurance premiums , higher taxes , or lower wage increases . however , increased coinsurance and deductible requirements present an immediate demand on the individual consumer 's pocketbook , a demand that may be difficult to meet if the same illness that requires treatment also reduces income . perhaps the most sensitive issue surrounding the effects of current initiatives in health care cost containment is that of indigent care assuring access to health care for the medically indigent ( people with little or no public or private health insurance and without resources to pay for essential services ) and assuring the viability of hospitals providing that care . high unemployment has increased the number of people without health insurance coverage . at the same time , public and private health care cost - containment efforts and cutbacks in government spending to aid the indigent have reduced the resources available to finance care for the poor . hospitals , affected by these pressures , are seeking ways to control costs and are reluctant to provide care for which they will not be reimbursed . some hospitals have resorted to economic transfers , dumping , in which indigent patients , on arrival , are transferred to public or charity hospitals without first receiving emergency treatment or being stabilized . in some cases , the receiving hospital is not aware of the transfer until the ambulance arrives at the door , often without any medical records or test results on the patients . dumping has become so prevalent in some areas that state lawmakers are legislating against it . in addition , recently enacted federal legislation will require medicare - certified hospitals to provide treatment to or stabilize all emergency patients before transferring them . violators risk termination or suspension of the hospital 's agreement with medicare , fines of up to $ 25,000 per violation on both the hospital and the responsible physician , and civil actions . dumping adds to the already heavy workloads in hospitals that provide substantial charity care , and patients are faced with long waits in overcrowded clinics and emergency rooms . transferred patients in emergency rooms tend to be sicker than nontransferred patients because , in some cases , they delay seeking the preventive medical care they can not afford . death rates are higher for transferred patients than for nontransferred patients . in the past , hospitals paid for charity care by charging private patients more . today , the robin hood approach to charity care has started to crumble as some hospitals attempt to shift the cost of indigent care by expanding nonpatient services or establishing luxury hospital suites . the provision of designer health care for the wealthy may enable some hospitals to serve more poor , said a report by the catholic health association 's task force on health care for the poor not all uncompensated care goes to the poor : about 70 percent is attributable to bad debts . in 1982 , investor - owned hospitals classified 97 percent of all uncompensated care as bad debt ( fackelmann , 1986 ) . the health care marketplace in 1985 was a scene of struggle , both among groups and within groups . although growth of spending slowed , in some cases to 20-year lows , that slowdown was the result of a deceleration of price inflation rather than a fundamental reduction in health care use . the struggle for market share among and between classes of health care providers , the struggle by government to balance social needs with limited resources , and the struggles of providers to resolve the conflict between the ethical and financial aspects of health care all affected the care received by individuals . the industry is in transition , and although transition is healthy , it is not always painless . problems associated with financing indigent care in large , inner - city public hospitals are well publicized , but similar problems permeated america 's heartlands in the mid-1980 's as hard economic times hit farm communities in the plains states ( baldwin , 1986 ) . farmers , unable to make a profit on their crops , moved to cut expenses . they canceled health insurance policies , reduced their coverage , or opted for higher deductibles . as a result , hospital uncompensated care in farm states increased , up 55 percent in kansas from 1982 to 1984 and up almost 14 percent in iowa from 1982 to 1985 . the des moines charter community hospital established a fund to finance free care to indigent farmers and convinced area physicians to donate their services at the same time . the marshalltown medical and surgical center , in conjunction with independent professionals ( physicians , dentists , and podiatrists who receive substantially reduced compensation from a church - sponsored fund ) created a similar program for farmers in north - central iowa . both hospitals ' programs avoid the label of charity care . in neither facility are collections of bills from indigent farmers attempted : one hospital indicates that bills can be paid whenever finances permit ; the other simply provides a bill , but does not pursue collection . although much uncompensated care is provided in urban areas of farm states , the severity of the problem is felt more acutely in rural hospitals . small rural facilities with few beds and falling admissions find it difficult to absorb an increase in uncompensated care . the impact of the changing structure of the health care industry is vividly illustrated in the physician sector . increased competition for patients has forced many physicians , especially new graduates , to consider employment rather than independent practice ( sorian , 1986 ) . high costs of medical education leave most new physicians with substantial debt and little ability to finance the creation of an independent practice . more are turning to employment in hospitals , health maintenance organizations , and other health care groups and institutions . as employees , some physicians feel they are losing control over the quality of care that they deliver . pressured by employers and insurers to contain costs , physicians are increasingly concerned that reductions in diagnostic testing and limits on hospitalization may lower the quality of service provided . in addition , the oversupply of physicians in some areas permits employers to hire physicians at relatively low salaries . as a result of these factors , unionization of physicians , although small in numbers , appears to be on the rise . home health care , as defined in the national health accounts , includes preventive , supportive , therapeutic , or rehabilitative medical care provided in a home setting . regardless of definition , home health care has been an area of rapid growth that shows little indication of slowing . for patients and their families home care services allow patients to remain in their own homes , which may add to the psychological well - being of the patient and involve less cost . they also avoid the stress and physical drain caused by repeated visits to an institution that may be some distance away . home health care is a small but rapidly growing segment of the health care delivery system , increasing at an estimated average annual rate of 20 - 25 percent in recent years . according to projections of total industry spending , the cost of home health products and services will grow from $ 9 billion in 1985 to $ 16 billion in 1990 , with 70 percent of the total going for services ( frost and sullivan , 1983 ) . from delivery of nursing care by family and friends , through visiting nurse associations , the industry has evolved into a complex health delivery system that involves government ; visiting nurse associations ; private nonprofit , proprietary , and facility - based providers ; and a variety of services . the most significant change in the home health industry has been the emergence of proprietary agencies , particularly chains , as the largest single form of organization . studies indicate that home health agency ( hha ) chains , perceiving home health to be a lucrative market , have been growing rapidly . corporations controlling the large hha chains appear to be closely related to other primary health industries , such as pharmaceutical businesses , nursing care facilities , and freelance medical staffing agencies ( williams , gaumer , and cella , 1984 ) . hospitals are moving into home health care in increasing numbers . in 1984 , 42 percent of the nation 's hospitals offered home health services ; that fraction was expected to reach 65 percent in 1985 ( glenn , 1985a ) . the hospital home health department 's most important function is to serve as a feeder for the hospital , identifying potential patients and directing them to the hospital . hospital - based home health care also allows the hospital , under pressure from the prospective payment system to reduce inpatient cost , to discharge patients yet continue to generate revenue from their care . home health departments offer a wider base over which to spread overhead costs , and they serve as a marketing tool as well . further , home health care reduces the hospital 's exposure to malpractice suits ( cassak , 1984 ; ginzberg , balinsky , and ostow , 1984 ) . a legislative change in 1980 that eased medicare certification requirements for proprietary hha 's in states without licensure laws opened the way for the rapid growth of proprietary hha 's . the number of certified proprietary hha 's increased fourfold from 1982 to 1985 , reaching 1,943 ( 32 percent of all hha 's ) . despite its rapid growth , there are indications that the home health industry is not keeping up with demand for home health services . patients are being discharged quicker and sicker as a result of hospitals ' cost - containment efforts , and home health agencies are scrambling to take care of these new patients . meanwhile , other patients , those requiring the social - type home health care , are being cut off from services they had come to depend on , such as nutrition and day - care programs ( grady , 1986 ) . it has been estimated that people 65 years of age or over receive 8590 percent of the home health care furnished ( ginzberg , balinsky , and ostow , 1984 ; frost and sullivan , 1983 ; cassak , 1984 ) . the population 65 years of age or over is projected to increase from 29 million people ( or 11.7 percent of the population ) in 1985 to 32 million ( or 12.4 percent of the population ) in 1990 ( social security administration , 1986 ) . the average annual rate of growth of the aged population is expected to be 2 1/3 times faster than the rate of growth of the overall population from 1985 to 1990 . medicare spending for home health care has grown from $ 60 million in fiscal year 1968 ( 1.2 percent of total payments for benefits ) to $ 2.3 billion in 1985 ( 3.3 percent of benefit payments ) , an annual growth rate of 24 percent . in 1984 , 1.5 million medicare beneficiaries used 40 million home health visits . visiting nurse associations served the largest number of people , 31 percent , and had the largest number of visits , 12 million . however , proprietary and hospital - based agencies ranked first and second in the percent of total charges billed to medicare ( 27 percent and 16 percent , respectively ) . the share of total hha charges billed by proprietary agencies almost doubled from 1982 to 1984 . a recent analysis of cost reports for 1982 submitted by home health agencies that were not part of a hospital or nursing home indicates that agency costs for services , medical equipment , and supplies provided to medicare patients represent approximately 50 percent of total agency costs . the rapidly rising cost of health care affects government as well as the private sector . facing future budget reductions and continuing declines in real per capita expenditures , the indian health service ( ihs ) is finding ways to meet the needs of its growing constituency . american indians and alaskan natives living on or near reservations rely predominately on ihs for the health services they require . unemployment rates are high on many reservations , and one out of every three indians lives at or below the poverty level . associated with high unemployment and poverty are death and disease rates that are among the highest in the nation . the death rate for indians under 65 years of age is 2 1/2 times as great as that in the general population . lack of sanitation facilities and safe drinking water make infectious disease a persistent problem , especially in newborns . despite federal appropriations of only $ 800 million in 1985 , ihs maintains a network of 45 hospitals and 137 outpatient facilities . these , along with tribally operated facilities and contract care , provide medical care to 980,000 indians in the ihs service population . a small budget has not deterred ihs from striving for and achieving substantial success in upgrading the health status of indians . among ihs accomplishments recorded in states with reservations are a substantial increase from 1970 to 1980 in life expectancy at birth ; a 93-percent decrease in the gastrointestinal death rate from 1955 to 1982 ; and achievement of a mortality rate for indian infants during the first 28 days of life that is lower than the u.s . rate . as both provider and financer of medical care , ihs works to identify prevalent health problems and their causes and to design a cost - effective method for implementing a solution . lifestyle changes have been promoted . in 1986 , most ihs facilities are smoke free . the zuni diabetes project succeeded in introducing a fitness program for diabetics in that tribe , resulting in weight reduction and removal from medication of some of the participants . a patient care information system has been implemented that permits more efficient patient processing and retrieval of patient histories . studies on ambulatory care delivery allowed ihs to develop a method for optimally allocating health practitioners to outpatient care centers , a method adopted by other federal agencies . sometimes , less traditional methods have been developed for dealing with specific indian health problems : a joint tribal - ihs program has substantially reduced gastroenteritis , a summertime killer of indian babies . in 1971 , the papago tribal health organization and ihs devised a program that identified infants at high risk and prepared tribal workers to train mothers and to screen infants for the disease . tribal workers made a presentation in english and o'odham throughout the reservation that wove local settings and legends with the causes and prevention of gastroenteritis . the outreach workers assessed the stage and severity of the problem in the children whom they saw and , as appropriate , gave mothers dietary advice , administered electrolytes , or made referrals . at summer 's end , no papago baby had died from gastroenteritis , and evaluation of the program revealed that the children whom it had reached had 26 percent fewer outpatient visits and 56 percent fewer hospital days related to that condition . gastroenteritis control has subsequently become an annual campaign of the papago tribe , and the program 's design has been applied to upper respiratory infections , unwanted pregnancies , and other health problems ( indian health service , 1986 ) .

slower price inflation in 1985 translated into slower growth of national health expenditures , but underlying growth in the use of goods and services continued along historic trends . coupled with somewhat sluggish growth of the gross national product , this adherence to trends pushed the share of our nation 's output accounted for by health spending to 10.7 percent . some aspects of health spending changed : falling use of hospital services was offset by rising hospital profits and increased use of other health care services . other aspects remained the same : both the public sector and the private sector continued efforts to contain costs , efforts that have affected and will continue to affect not only the providers of care but the users of care as well .

Overview Changes in delivery of care Changes in financing of care Summary

viruses and cells : the 766 bvdv isolates were kindly provided from 14 livestock hygiene service centers in hokkaido prefecture , japan , from 2006 to 2014 . these viruses were isolated from serum , buffy coat , nasal discharge , pleural effusion , fecal specimen or emulsion of an organ ( lung , liver , kidney , spleen , heart or brain ) of cattle or aborted fetuses infected with bvdvs . seventeen of the 766 isolates were cp bvdvs , and the other 749 isolates were ncp bvdvs . for example , bvdv / nakashibetsu/881/10 strain was isolated in 2010 at nakashibetsu , hokkaido , japan . bvdvs isolated from 2001 to 2006 in hokkaido were described in our previous report and also analyzed genetically and antigenically in the present study . nose strain ( bvdv-1a ) , is27cp/01 strain ( bvdv-1b ) and kz-91-ncp strain ( bvdv-2a ) were selected as reference strains . hokudai - lab/09 strain ( bvdv-2b ) was isolated from a commercial fetal bovine serum batch derived from north america . gbk_e strain ( bvdv-2a ) was kindly provided from takashi kozasa ( national veterinary assay laboratory , kokubunji , japan ) . the bovine kidney cell line mdbk - hs was propagated in eagle s minimum essential medium ( nissui pharmaceutical , tokyo , japan ) supplemented with 0.295% tryptose phosphate broth ( becton dickinson , san jose , ca , u.s.a . ) , 10 mm n , n - bis ( 2-hydroxyethyl)-2-aminoethanesulfonic acid ( sigma - aldrich , st . louis , mo , u.s.a . ) , 0.3 mg / ml l - glutamine ( mem - bes ) and 10% horse serum ( life technologies , carlsbad , ca , u.s.a . ) . bovine fetal muscle ( bfm ) cell cultures within 20 passages were propagated in mem - bes with 5% horse serum and 5% fetal bovine serum which is free from both bvdv antigens and antibodies ( japan bio serum , hiroshima , japan ) . mdbk - hs cells were used for virus preparation , and bfm cells were used for cross - neutralization tests . virus genome sequencing and phylogenetic analysis : viral rna was extracted by trizol ls reagent ( life technologies ) from the supernatants of mdbk - hs cells inoculated with viruses . the part of 5-utr genome was amplified by reverse transcription ( rt ) and pcr using the superscript iii one - step rt - pcr system with platinum taq high fidelity ( life technologies ) and the primer set , 324 and 326 . for amplification of the entire e2 gene , extracted rna was reverse - transcribed with the random primer ( n)9 ( takara bio , otsu , japan ) using the m - mlv reverse transcriptase ( life technologies ) . the entire e2 gene of bvdvs was amplified using primers in supplementary table 1 and ex - taq dna polymerase ( takara bio ) . nucleotide sequences of pcr fragments were determined using the bigdye terminator v3.1 cycle sequencing kit ( life technologies ) and the 3500 genetic analyzer ( life technologies ) according to the manufacturer s protocol . sequencing data were analyzed using the genetyx network version 12.0.1 software ( genetyx , tokyo , japan ) . the entire e2 sequences of field isolates used for antigenic analysis were deposited in the ddbj / embl / genbank databases under accession numbers described in supplementary table 2 . for phylogenetic analysis , phylogenetic trees based on nucleotide sequences of the 5-utr and the e2 gene were constructed by the maximum - likelihood method and bootstrap analysis ( n=1,000 ) using the mega 6.0 software with default parameters . the sequence data of reference strains were obtained from the ddbj / embl / genbank databases . statistical analysis : pearson s chi - square test was performed in order to estimate association between viral genotypes and incidences of clinical signs in cattle infected with bvdvs . fisher s exact test was performed in order to identify the categories responsible for a significant chi - square statistic . antisera : antisera against is27cp/01 , bvdv / nakashibetsu/881/10 , bvdv / nakasatsunai/719/09-cp , bvdv / setana/1103/13 , bvdv / hamanaka/646/08 , gbk_e , hokudai - lab/09 and bvdv / hamanaka/843/10 strains were prepared using slc : jw / csk rabbits ( japan slc , hamamatsu , japan ) . these viruses were injected four times intravenously and intramuscularly with each virus suspension containing approximately 10 tcid50 at 3 , 5 and 7 weeks after the first injection . eight weeks later , sera were obtained and inactivated for 30 min at 56c to be used for cross - neutralization tests . rabbit antisera against the nose strain ( bvdv-1a ) and the kz-91-ncp strain ( bvdv-2a ) were also produced by four times injection and kindly provided from dr . cross - neutralization tests : cross - neutralization tests were performed in bfm cell cultures grown in 96-well microplates as described previously . briefly , serial twofold dilutions of sera were prepared in a volume of 25 l in a microplate with cell culture media , mixed with an equal volume of virus suspension containing 200 tcid50 and incubated at 37c for 1 . then , 100 l of bfm cell suspension ( approximately 2 10 cells ) were added into all the wells of the microplate and incubated at 37c under 5% co2 for 5 days . the fixed cells were stained using an immunoperoxidase method with anti - ns3 mabs . each assay was performed in quadruplicate , and neutralization titers were expressed as the reciprocal of the highest dilution that inhibited 50% viral growth . antigenic similarity ( r ) values were calculated according to the following formula of archetti and horsfall . genotyping of the isolates based on the 5-utr nucleotide sequences : the 766 bvdvs were isolated from 2006 to 2014 from pi cattle in hokkaido , japan . phylogenetic analysis of the 5-utr nucleotide sequences revealed that these isolates were classified as bvdv-1 ( 544 isolates ) and bvdv-2 ( 222 ) . bvdv-1 were further divided into bvdv-1a ( 93 isolates ) , 1b ( 371 ) and 1c ( 80 ) , and all bvdv-2 isolates were grouped into bvdv-2a ( 222 ) ( table 1table 1.genotyping of bvdvs isolated in hokkaido from 2006 to 2014year of isolationno . of isolategenotypebvdv-1bvdv-21a1b1c2a2006662431922007123148212152008851740424200978744101720108311351522201113310501162201210217424392013611319227201435216413total7669337180222a ) from april to december . proportion of subgenotypes 1a , 1b , 1c and 2a was 12.1% , 48.4% , 10.5% and 29.0% , respectively . the sequence identity of the 5-utr was 7275% between bvdv-1 and bvdv-2 isolates , and almost equal to those of the previous report . the sequence identities among bvdv-1 and bvdv-2 isolates were 87100% and 93100% , respectively . b ) from january to july . association between viral subgenotypes and their pathogenicity in cattle : to investigate association between viral subgenotypes and their pathogenicity in cattle , the present isolates were classified according to viral subgenotypes and clinical signs of cattle . between 43.065.0% of cattle infected with each subgenotype virus showed no clinical signs , and the others showed typical clinical signs of bvd except for no information ( fig . ( a ) the pie charts show percentage incidence of clinical signs in cattle infected with each subgenotype virus . statistical analysis using pearson s chi - square test and fisher s exact test showed that cattle infected with bvdv-1b viruses showed significantly less clinical signs compared with other subgenotypes ( p<0.01 ) . ( b ) clinical signs frequently observed in cattle infected with bvdvs of each subgenotype . complications of clinical signs in the same cattle were dually counted for each sign . ) . in statistical analyses , pearson s chi - squared test was performed in order to estimate association between viral genotypes and incidences of clinical signs in cattle infected with bvdvs . difference of viral genotypes significantly relates to incidence of clinical signs in cattle ( p<0.01 ) . the percentages of clinical sings of bvdv-1b vs. other subgenotypes were compared with fisher s exact test . this analysis revealed that cattle infected with bvdv-1b viruses significantly showed less clinical signs compared with other subgenotypes ( p<0.01 ) . clinical signs frequently observed in cattle were poor development , diarrhea , respiratory symptoms , reproductive failure , fever , mucosal disease and death ( fig . ( a ) the pie charts show percentage incidence of clinical signs in cattle infected with each subgenotype virus . statistical analysis using pearson s chi - square test and fisher s exact test showed that cattle infected with bvdv-1b viruses showed significantly less clinical signs compared with other subgenotypes ( p<0.01 ) . ( b ) clinical signs frequently observed in cattle infected with bvdvs of each subgenotype . complications of clinical signs in the same cattle were dually counted for each sign . phylogenetic analysis on the basis of nucleotide sequences of the viral glycoprotein e2 gene : the entire e2 genes of bvdv-1a , 1b and 2a isolates were analyzed for more comparative genetic investigation . thirty - eight isolates of bvdv-1a , 70 isolates of bvdv-1b and 24 isolates of bvdv-2a from 2001 to 2014 in hokkaido were randomly selected for phylogenetic analysis on the basis of the entire e2 array , avoiding biases by year and geographical localization of viral isolation . the bvdv-1a , 1b and 2a isolates in hokkaido were blanched into 5 , 5 and 2 clusters by phylogenetic analysis supported with bootstrap values more than 50 , respectively ( figs . 2.phylogenetic tree of bvdv-1a field isolates based on nucleotide sequences of the entire e2 gene . nucleotides 1,122 bp of the entire e2 gene were used for phylogenic analysis . the phylogenetic tree of bvdv-1a field isolates was constructed using the maximum - likelihood method and bootstrap analysis ( n=1,000 ) by the mega 6.0 software with 31 sequences obtained from the ddbj / embl / genbank databases and through personal communication . the 38 field isolates in hokkaido were classified as 5 clusters ( i v ) followed by bootstrap values of phylogenetic analysis . 3.phylogenetic tree of bvdv-1b field isolates based on nucleotide sequences of the entire e2 gene : nucleotides 1,122 bp of the entire e2 gene were used for phylogenic analysis . the phylogenetic tree of bvdv-1b field isolates was constructed using the maximum - likelihood method and bootstrap analysis ( n=1,000 ) by the mega 6.0 software with 33 sequences obtained from the ddbj / embl / genbank databases and through personal communication . the 70 field isolates in hokkaido were classified as 5 clusters ( i v ) followed by bootstrap values of phylogenetic analysis . 4.phylogenetic tree of bvdv-2a field isolates based on nucleotide sequences of the entire e2 gene : nucleotides 1,116 bp of the entire e2 gene were used for phylogenic analysis . the phylogenetic tree of bvdv-2a field isolates was constructed using the maximum - likelihood method and bootstrap analysis ( n=1,000 ) by the mega 6.0 software with 38 sequences obtained from the ddbj / embl / genbank databases and through personal communication . the 24 field isolates in hokkaido were classified as 2 clusters ( i ii ) followed by bootstrap values of the phylogenetic analysis . on phylogenetic analysis of the e2 gene , all isolates were classified as the same subgenotypes based on the 5-utr . the classification of each e2 cluster of bvdv-1a and 1b was not biased by year and geographical localization of viral isolation . only isolates of 2009 and 2010 years were classified as bvdv-2a cluster ii . phylogenetic tree of bvdv-1a field isolates based on nucleotide sequences of the entire e2 gene . the phylogenetic tree of bvdv-1a field isolates was constructed using the maximum - likelihood method and bootstrap analysis ( n=1,000 ) by the mega 6.0 software with 31 sequences obtained from the ddbj / embl / genbank databases and through personal communication . the 38 field isolates in hokkaido were classified as 5 clusters ( i v ) followed by bootstrap values of phylogenetic analysis . phylogenetic tree of bvdv-1b field isolates based on nucleotide sequences of the entire e2 gene : nucleotides 1,122 bp of the entire e2 gene were used for phylogenic analysis . the phylogenetic tree of bvdv-1b field isolates was constructed using the maximum - likelihood method and bootstrap analysis ( n=1,000 ) by the mega 6.0 software with 33 sequences obtained from the ddbj / embl / genbank databases and through personal communication . the 70 field isolates in hokkaido were classified as 5 clusters ( i v ) followed by bootstrap values of phylogenetic analysis . phylogenetic tree of bvdv-2a field isolates based on nucleotide sequences of the entire e2 gene : nucleotides 1,116 bp of the entire e2 gene were used for phylogenic analysis . the phylogenetic tree of bvdv-2a field isolates was constructed using the maximum - likelihood method and bootstrap analysis ( n=1,000 ) by the mega 6.0 software with 38 sequences obtained from the ddbj / embl / genbank databases and through personal communication . the 24 field isolates in hokkaido were classified as 2 clusters ( i ii ) followed by bootstrap values of the phylogenetic analysis . antigenic analysis of bvdv-1a and 1b field isolates by cross - neutralization tests : to compare the phylogenetic e2 classification and the antigenicity , 8 isolates of bvdv-1a and 10 isolates of bvdv-1b were randomly selected from each e2 cluster for cross - neutralization tests , avoiding biases by year and geographical localization of viral isolation . nose ( bvdv-1a ) and is27cp/01 ( bvdv-1b ) strains were also analyzed as representative strains of each subgenotype . rabbit antisera against bvdv-1b field isolates , bvdv / nakashibetsu/881/10 , bvdv / nakasatsunai/719/09-cp , bvdv / setana/1103/13 and bvdv / hamanaka/646/08 strains were prepared to analyze antigenic property of each bvdv-1b e2 cluster . the cross - neutralization tests showed 4 to 64-fold antigenic differences between bvdv-1a and 1b isolates in japan ( table 2table 2.cross-neutralization titers of antisera raised against different strains of bvdv-1a and 1bsubgenotypecluster of e2 genevirusantisera against bvdvs1a1bnosecluster icluster iicluster iiicluster ivcluster vis27cp/01nakashibetsu /881/10nakasatsunai /719/09-cpsetana/1103/12hamanaka /646/081acluster inose2,04864643212864betsukai/503/072,04864643212832monbetsu/205/041,0246432326432cluster iimonbetsu/03/01-cp1,0246464163232betsukai/669/081,0246432326464cluster iiioketo/277/042,04864643212864kamiyuubetsu/08/022,04864323212864cluster ivakkeshi/710/091,0246432163232cluster vhamatonbetsu/1191/131,02412816161281281bcluster iis27cp/01256512256256128128yuubetsu/10/01256512256256512256okoppe/89/01256256256256256128betsukai/884/10128512256128512256cluster iisaroma/23/022562561,024256512256nakashibetsu/856/102565121,024512256256nakashibetsu/881/101285121,0241,024256128cluster iiinakasatsunai/583/07256128256512256256nakasatsunai/719/09-cp256128128512256128cluster ivsetana/1103/1225612825625651264cluster vhamanaka/646/08641286464128512a ) neutralization titers are expressed as the reciprocal of the highest dilution that inhibits 50% viral growth , and homologous titers are described in bold . b ) bvdv/ is omitted from the name of field isolates . ) . antigenic similarity ( r ) values of bvdv-1a and 1b strains were 6.3 to 17.7 , which suggested significant antigenic differences between bvdv-1a and 1b subgenotypes . the cross - neutralization tests of bvdv-1a field isolates showed 1 to 2-fold antigenic differences against bvdv-1a nose strain , and this result indicated that antigenicity of bvdv-1a isolates was similar regardless of further classification by e2 array . bvdv-1b field isolates of clusters i , ii , iii and iv showed 8-fold or less antigenic differences , and r values were 25.0 to 50.0 . these results indicated that antigenicity of these bvdv-1b isolates was almost similar among e2 clusters . the bvdv / hamanaka/646/08 strain of bvdv-1b cluster v showed lowest neutralization titers compared with other bvdv-1b isolates , and r values compared with other e2 clusters were 12.5 to 25.0 . these results indicated that the antigenicity of this isolate was slightly different from other bvdv-1b isolates . a ) neutralization titers are expressed as the reciprocal of the highest dilution that inhibits 50% viral growth , and homologous titers are described in bold . antigenic analysis of bvdv-2a field isolates by cross - neutralization tests : the 6 isolates of bvdv-2a were also selected for antigenic analysis by cross - neutralization tests based on the same criteria . kz-91-ncp ( bvdv-2a ) , gbk_e ( bvdv-2a ) and hokudai - lab/09 ( bvdv-2b ) strains were also analyzed as representative strains of each subgenotype . rabbit antisera against the bvdv / hamanaka/843/10 strain were prepared to analyze antigenic property of bvdv-2a cluster ii . the cross - neutralization tests showed 2 to 16-fold antigenic differences , comparing with bvdv-2a and 2b ( table 3table 3.cross-neutralization titers of antisera raised against different strains of bvdv-2subgenotypecluster of e2 genevirusantisera against bvdvs2a2bkz-91-ncphamanaka /843/10gbk_ehokudai - lab/092acluster ikz-91-ncp512641632yuubetsu/71/015121286464okoppe/458/052561283264honbetsu/597/07256641664akkeshi/1170/13256641632cluster iihamanaka/843/101281281616shikaoi/909/10128128816gbk_e12812812882bhokudai - lab/092566432128a ) neutralization titers are expressed as the reciprocal of the highest dilution that inhibits 50% viral growth , and homologous titers are described in bold . b ) bvdv/ is omitted from the name of field isolates . ) . the r values among subgenotypes were 12.5 to 35.4 , and significant antigenic differences were not observed among bvdv-2 subgenotypes . the cross - neutralization tests of bvdv-2a field isolates showed 1 to 4-fold antigenic differences , and antigenicity of bvdv-2a field isolates was almost similar among e2 clusters . a ) neutralization titers are expressed as the reciprocal of the highest dilution that inhibits 50% viral growth , and homologous titers are described in bold . bvdvs have been detected since 1969 in japan , and bvd has not been eradicated as yet . approximately 60% of dairy cattle and 20% of beef cattle in a total of japan are raised in the hokkaido prefecture , and thus , it is important to control bvd in this area . the 766 bvdvs were isolated from cattle or aborted fetuses by the 14 livestock hygiene service centers of hokkaido prefecture from 2006 to 2014 , and now , we have a total of 1,155 field isolates since 2001 . to confirm a diagnosis of persistent infection with bvdvs , cattle should be retested after an interval of at least 3 weeks . in japan , most of cattle were not retested , because of economic losses by detention of viral pollutant in herds . these infected cattle were sporadically identified in herds , not in a group , and thus , almost of these cattle can be considered as pi cattle . to investigate recent epidemics in hokkaido for the control of bvd phylogenetic analysis on the basis of the 5-utr revealed that field isolates were divided into bvdv-1a , 1b , 1c and 2a . these subgenotype viruses have been circulating at least since 2001 in hokkaido , japan , but hobi - like viruses ( bvdv-3 ) were not detected from field isolates by the present phylogenetic analysis . on classification of bvdv-2 subgenotypes , some criteria were reported in the previous studies [ 19 , 34 , 41 ] . in the present study , the classification of bvdv-2 isolates was followed using that of peterhans et al . , and all japanese bvdv-2 strains were classified as bvdv-2a . in japan , no epidemic has been reported , that was caused by highly pathogenic bvdv-2 viruses , such as the 890 strain isolated in north america or the nrw 19 - 13 - 8 strain recently isolated in germany . taken together , bvdv-1b viruses are still predominant , and bvdv-2a has increased since 2011 in hokkaido , japan . interestingly , statistical analysis showed that bvdv-1b isolates in hokkaido tended to result in less clinical signs in cattle . this result may indicate that the predominance of bvdv-1b is due to difficulty of diagnosis by clinical signs . inactivated vaccines containing bvdv-1a and 2a antigens and live - attenuated vaccines containing bvdv-1a antigen had been used widely in japan until 2014 , whereas bvdv-1b and 2a viruses were predominant recently in hokkaido . therefore , we analyzed nucleotide sequences of the e2 of bvdv-1a , 1b and 2a field isolates from 2001 to 2014 , since the e2 is a main target of immune responses in hosts and important for viral antigenicity [ 12 , 13 ] . these field isolates were further classified , supported with bootstrap values in the phylogenetic trees . regardless of the classification of e2 clusters , all bvdv-1a and 2a field isolates were antigenically similar . antigenicity of bvdv-1b isolates was almost similar among e2 clusters , while only one isolate of bvdv-1b cluster v , bvdv / hamanaka/646/08 strain , showed antigenic difference . the bvdv / hamanaka/646/08 strain was blanched into the most distant cluster from other bvdv-1b clusters and showed the lowest identity of the e2 gene ( 8488% ) with other bvdv-1b isolates . these results indicate that genetic differences on the e2 gene correlate with differences in viral antigenicity , and thus , phylogenetic analysis on the e2 array improves understanding of viral antigenicity in detail . additionally , the isolates of bvdv-1b clusters iv and v were blanched into the same cluster with osloss strain , which was classified as bvdv-1b2 , and it is the first report of isolation of bvdv-1b1 viruses in japan . bvdv / setana/1103/13 strain of bvdv-1b cluster iv was antigenically similar with bvdv-1b2 viruses , and antigenicity could not be clearly distinguished between bvdv-1b1 and 1b2 viruses . taken together , it has been confirmed that the bvdv-1a , 1b and 2a isolates are likely to be antigenically conserved among each subgenotype during the last 14 years in hokkaido , japan . antigenic diversity among subgenotypes of bvdv-1 has been well demonstrated [ 1 , 3 , 28 , 31 , 36 ] . japanese bvdv-1a and 1b viruses showed significant antigenic differences in the previous studies [ 28 , 31 ] , and the present study also showed antigenic differences between bvdv-1a and 1b isolates in hokkaido , supported by r values ( 6.3 to 17.7 ) lower than 25.0 . in contrast , bvdv-1a and 1b isolates in other countries , such as switzerland , u.s.a . and argentina , showed higher r values ( 24.2 to 50.0 ) [ 1 , 3 , 36 ] . in such countries , the several reports also showed that bvdv-1a vaccines can induce only lower antibody titers against bvdv-1b viruses [ 14 , 32 , 36 ] , and some authors discussed that this antigenic difference may lead to predominance of bvdv-1b viruses over the other subgenotypes [ 14 , 36 ] . in japan , there are no complete data of the frequency of vaccination in cattle , and thus , it is still unclear whether the predominant situation of bvdv-1b viruses was due to bvdv-1a vaccine pressure or not . recently , a commercial inactivated vaccine containing bvdv-1b and 2a strains and a live attenuated vaccine containing bvdv-1a and 2a strains have become available in japan , and further studies are needed to consider the epidemiological impact of these vaccines on the predominant bvdvs . in summary , we revealed that bvdv-1b and 2a viruses were recently predominant in hokkaido , japan . bvdv-1a , 1b and 2a isolates show genetic diversity on the e2 gene with antigenic conservation among each subgenotype during the last 14 years . based on the present study , it is required to use effective vaccine against predominant field isolates for the control of bvd in japan . vaccination as a stand - alone control measure is not adequate in preventing viral circulation [ 18 , 23 ] , and thus , it is important to both stamp out pi cattle and to use effective vaccines for reduction of pi cattle to control bvd .

in our previous study , we genetically analyzed bovine viral diarrhea viruses ( bvdvs ) isolated from 2000 to 2006 in japan and reported that subgenotype 1b viruses were predominant . in the present study , 766 bvdvs isolated from 2006 to 2014 in hokkaido , japan , were genetically analyzed to understand recent epidemics . phylogenetic analysis based on nucleotide sequences of the 5-untranslated region of viral genome revealed that 766 isolates were classified as genotype 1 ( bvdv-1 ; 544 isolates ) and genotype 2 ( bvdv-2 ; 222 ) . bvdv-1 isolates were further divided into bvdv-1a ( 93 ) , 1b ( 371 ) and 1c ( 80 ) subgenotypes , and all bvdv-2 isolates were grouped into bvdv-2a subgenotype ( 222 ) . further comparative analysis was performed with bvdv-1a , 1b and 2a viruses isolated from 2001 to 2014 . phylogenetic analysis based on nucleotide sequences of the viral glycoprotein e2 gene , a major target of neutralizing antibodies , revealed that bvdv-1a , 1b and 2a isolates were further classified into several clusters . cross - neutralization tests showed that bvdv-1b isolates were antigenically different from bvdv-1a isolates , and almost bvdv-1a , 1b and 2a isolates were antigenically similar among each subgenotype and each e2 cluster . taken together , bvdv-1b viruses are still predominant , and bvdv-2a viruses have increased recently in hokkaido , japan . field isolates of bvdv-1a , 1b and 2a show genetic diversity on the e2 gene with antigenic conservation among each subgenotype during the last 14 years .

MATERIALS AND METHODS RESULTS DISCUSSION Supplementary Material

intussusception is not a rare disease in children , however in adults it accounts for only 1% of bowel obstructions , and 5% of all intussusceptions . we herein report a preoperatively diagnosed case of adult intussusception caused by a small bowel lipoma . a 33-year - old man was admitted to our hospital with three weeks history of colicky epigastric pain . before admission the patient had been hospitalized at another hospital , but the cause of the repeated colicky epigastric pain had not been identified . the patient had no significant past medical history of illnesses nor any hospitalization otherwise . on physical examination , the abdomen was flat and no tumor was palpable . 1 ) . colonoscopy revealed ileocolic intussusception , but no obvious cause was identified ( fig . barium enema for reduction of the ileocolic intussusception showed a small bowel tumor in the ileum 15 cm proximal to the ileocecal valve ( fig . reduction of the intussusception under barium enema was succeesful , and the patient underwent laparotomy the next day . however , recurrent ileocolic intussusception was found , for which a manual reduction and a partial resection of the ileum encompassing the small bowel tumor in the ileum 15 cm proximal to the ileocecal valve was performed . the resected specimen showed a soft and yellowish - white submucosal tumor with a diameter of 40 25 mm . histological findings revealed fat cells proliferating in the submucosal layer and confirmed the diagnosis of lipoma of the small bowel . adult intussusception is rare and usually caused by a tumor acting as the apex of the intussusception . therefore , such a condition should indicate the possibility of the presence of malignancy in the bowel . however , it has been reported that 52 - 80% of cases of adult small bowel intussusception are caused by benign entities , such as lipoma , hamartomatous polyp , inflammatory polyp , hyperplastic polyp , meckel 's diverticulum or surgery - related lesions . because benign tumors of the small bowel are commonly polypoid - shaped , the intussusception usually develops before the tumor has grown to a size sufficient to obstruct the passage of the small intestinal contents . small intestinal tumors are rare , accounting for 1 - 2% of all gastrointestinal tract tumors . moreover , preoperative diagnosis is often difficult because of the lack of specific clinical symptoms and difficulty with the examination of the small intestine . computed tomography and ultrasonography of the abdomen . however , further examinations such as barium enema or endoscopic ultrasonography are useful in cases of difficult diagnosis . it is accepted that gentle preoperative or operative reduction can be attempted safely to avoid unnecessary operation . laparoscopic surgery for intussusception is increasing , and successful reduction of intussusception recently has been reported . although more technically difficult than laparotomy , with an increased risk of perforation and dissemination and metastasis in cases of malignancies or with intestinal dilatation , laparoscopic surgery seems to become a procedure of choice for intussusception caused by benign intestinal tumors in the future .

adult intussusception is rare , accounting for only 5% of all intussusceptions , for which preoperative diagnosis is difficult . we herein report a preoperatively diagnosed case of adult intussusception caused by a small bowel lipoma . a 33-year - old man was admitted to our hospital with three weeks history of colicky epigastric pain . computed tomography revealed thickening of the ileal wall suggestive of intussusception . colonoscopy revealed an ileocolic intussusception . barium enema for reduction of ileocolic intussusception demonstrated a small bowel tumor in the ileum 15 cm proximal to the ileocecal valve . the intussusception was reduced , and the patient underwent partial resection of the ileum encompassing the small bowel tumor . histological findings confirmed the diagnosis of lipoma of the small bowel . the patient made a satisfactory recovery and remains well .

Introduction Case Report Discussion

measles is a highly contagious acute viral disease characterized by high fever , malaise , coryza , conjunctivitis , cough , and a maculopapular rash ( griffin , 2007 ) . patients with measles develop a severe and temporary immunosuppression , which is often accompanied by secondary bacterial infections ( griffin , 2007 ) . despite the availability of highly effective vaccines , measles - related deaths were estimated to be 164,000 worldwide in 2008 ( who , 2009 ) . the causative agent is measles virus ( mv ) , which belongs to the genus morbillivirus in the family paramyxoviridae . the virus particle is enveloped and contains a non - segmented negative - strand rna genome encoding six tandem linked genes , n , p / v / c , m , f , h , and l. the genome is encapsidated by the nucleocapsid ( n ) protein and associated with viral rna - dependent rna polymerases , forming a helical ribonucleoprotein complex ( rnp ) . on the envelope , the viral particle possesses two types of viral glycoprotein spikes , the hemagglutinin ( h ) and fusion ( f ) proteins ( griffin , 2007 ) . the h protein is responsible for binding to cellular receptors on the target host cells , and plays a key role in the determination of host cell specificity ( tropism ) of mv ( yanagi et al . , 2009 ) . binding of the h protein to a receptor triggers f protein - mediated membrane fusion between the virus envelope and the host cell plasma membrane , releasing the rnp into the cytoplasm . in cells infected with mv , the h and f proteins are expressed on the cell surface and cause cell - to - cell fusion , producing syncytia . therefore , the distribution pattern of its receptors is a key determinant of which cells become infected with mv ( yanagi et al . , 2009 ) . the initial discovery of an mv receptor came in 1993 ( dorig et al . , 1993 ; naniche et al . , two independent studies indicated that the receptor molecule for mv is the human membrane cofactor protein ( mcp / cd46 ) , a central component of the complement system , which is expressed ubiquitously on all organs and tissues throughout the human body ( dorig et al . these findings were highly welcomed from the viewpoint that mv causes a systemic infection . meanwhile , kobune et al . ( 1990 ) reported the isolation of lymphotropic mv strains , and subsequent studies indicated that these lymphotropic mv strains do not use mcp / cd46 as a receptor ( yanagi et al . , 2009 ) . importantly , kobune s isolates exhibited a high virulence in experimentally infected monkeys , whereas mcp / cd46-using classical mv isolates caused no or mild disease in monkeys ( kobune et al . , 1990 , 1996 ; takeda et al . , 1998 ) . hence , new two questions have arisen for mv researchers . what is the receptor for these lymphotropic strains ? which strains are the real wild - type ( wt ) mv strains ? in 2000 , using kobune s isolates , another receptor was identified ( tatsuo et al . , 2000 ) . this receptor is signaling lymphocyte activation molecule , also known as cd150 ( slam / cd150 ) , which is expressed on cells of the immune system ( tatsuo et al . , 2000 ) . subsequent studies clarified that slam / cd150 is a receptor for wt mv strains circulating in patients , and that mcp / cd46 does not act as a receptor for wt mv strains ( yanagi et al . , 2009 ) . mcp / cd46 acts as a receptor only for vaccine and some laboratory mv strains ( yanagi et al . , 2009 ) . currently , it is clear that these mv strains have acquired the ability to use mcp / cd46 as an alternative receptor to grow in laboratory cell lines lacking slam / cd150 expression ( yanagi et al . , 2009 ) . hence , it has become generally accepted that wt mv is a lymphotropic virus that specifically targets immune cells , similar to the case of human immunodeficiency virus ( hiv ) and human t cell lymphotropic virus type 1 ( htlv1 ) . in 2000 , a recombinant mv , ic323 , was generated based on kobune s first isolate ( takeda et al . , 2000 ) , and has greatly contributed to our understanding of the molecular bases for the pathogenesis of wt mv strains ( takeuchi et al . , 2005 ; de swart et al . , 2007 ; devaux et al . , 2008 , 2011 ; leonard et al . , 2008 ; nakatsu et al . , 2008 ; de vries et al . , 2010 ; ludlow et al . , 2010 ; mhlebach et al . , 2011 ; 2011 ) . at that time , only slam / cd150-positive cells were found to be susceptible to wt mv infections . however , it remained difficult to make a final conclusion that slam / cd150 is the sole receptor for wt mv , because histopathological examinations of measles patients and monkeys infected with mv have revealed considerable levels of mv protein expression in the epithelia of various organs , and histopathological changes are also evident in these epithelia ( nii et al . , 1964 ; lightwood and nolan , 1970 ; olding - stenkvist and bjorvatn , 1976 ; moench et al . , 1988 ; craighead , 2000 ; figure 1 ) . in 2003 , primary cultures of human small airway epithelial cells ( saecs ) were shown to be susceptible to wt mv infection ( takeuchi et al . , 2003 ) . upon mv infection , large syncytia developed in saecs via a slam - independent mechanism ( takeuchi et al . , 2003 ) . after searching many cell lines , several epithelial cell lines with high susceptibility to mv infection ( 2008 ) clearly demonstrated that wt mv infects epithelial cell lines that form tight junctions ( tjs ) using an unidentified receptor ( leonard et al . , 2008 ; tahara et al . , 2008 ) . using these cells and recombinant ic323 expressing green fluorescent protein ( ic323-egfp ; takeda et al . , 2000 ; hashimoto et al . , 2002 ) , a final answer was obtained for the receptor on epithelial cells . two groups independently demonstrated that nectin4 , which is expressed at adherens junctions ( ajs ) , acts as a receptor for mv ( mhlebach et al . interestingly , mv loses the ability to use either slam / cd150 or nectin4 when it possesses specific mutations in the h protein ( leonard et al . , 2008 ; tahara et al . , 2008 ; nectin4-blind mv still infects slam / cd150-positive immune cells efficiently ( slam / cd150-tropic ) , and conversely , slam / cd150-blind mv infects nectin4-positive epithelial cells efficiently ( nectin4-tropic ; leonard et al . , 2008 ; tahara et al . , 2008 ; figure 2 ) . in this regard , mv is intrinsically dual - tropic to immune cells and epithelial cells ( figure 2 ) . measles virus antigen and histopathological changes in bronchiolar epithelial cells . at 11 days post - infection , a cynomolgus monkey experimentally infected with wt mv ic323 strain was subjected to the histopathological examination . multinucleated cell were seen in the epithelial layer of the bronchiole with inflammatory infiltration of eosinophils and lymphocytes . ( b ) immunohistochemical double staining for the n protein of mv ( left , green ) and keratin ( center , red ) . multinucleated epithelial giant cells showing positive staining for the n protein are present in the bronchiole ( right , yellow in merged images ) . wt mv ( ic323 ) infects and produces syncytia in both slam - positive lymphoblastoid b95a and nectin4-positive epithelial ii-18 cells ( dual - tropic ) . ic323 with an r533a mutation in the h protein fails to spread in b95a cells ( slam - blind ) , but replicates well in ii-18 cells ( nectin4-tropic ) . on the contrary , ic323 with a y543s mutation in the h protein spreads in b95a cells ( slam - tropic ) , but fails to spread in ii-18 cells ( nectin4-blind ) . there is now no doubt that slam / cd150 and nectin4 are the major receptors for mv . however , other molecules may further support mv infection in vivo , being involved in the development of measles and its neurological sequela . for example , the mechanism that the c - type lectin dc - specific intercellular adhesion molecule 3-grabbing non - integrin ( dc - sign ) acts as an attachment receptor for mv , thereby promoting mv infection of dcs , may be ideal to understand the extraordinarily high transmissibility of measles ( de witte et al . it is well known that mv causes subacute sclerosing panencephalitis ( sspe ) , a persistent infection of the central nervous system ( cns ) with mv . this occurs with a mean latency period of 710 years after suffering from acute measles at a frequency of 1/5,0001/100,000 reported cases of acute measles ( takasu et al . , 2003 ; bellini et al . , although nectin4 is a possible candidate for an mv receptor in the cns , no ( or undetectable ) nectin4 expression was observed in the cns in humans ( reymond et al . , 2001 ; brancati et al . , 2010 ) , and some mv strains derived from sspe patients are likely to use nectin4 inefficiently ( seki et al . , 2011 ) . ( 2007 ) suggest that neurokinin-1 , a substance p receptor , supports trans - synaptic transmission of mv by acting as a receptor for the f protein . measles virus infection causes immunosuppression in patients and is often accompanied by secondary bacterial infections . typically , mv - induced immunosuppression is characterized by a marked lymphopenia , and an early th1 response followed by predominant and prolonged th2 response in patients , with suppression of mitogen - induced lymphocyte proliferation ex vivo ( griffin and ward , 1993 ; schneider - schaulies and schneider - schaulies , 2009 ) . some , if not all , of these immunological observations must be attributed either directly or indirectly to the fact that mv uses slam / cd150 as a receptor . slam / cd150 is a member of the slam - family receptors , which belong to the immunoglobulin ( ig ) superfamily ( veillette , 2010 ; ma and deenick , 2011 ) . the slam - family consists of nine members ( cannons et al . , 2011 ; ma and deenick , 2011 ) . the slam - family receptors are type i transmembrane proteins that typically possess an extracellular region with two ig - like domains ( an amino - terminal variable ( v)-like domain and a carboxy - terminal constant-2 ( c2)-like domain ) , a transmembrane region , and a cytoplasmic region that harbors multiple tyrosine - based motifs ( detre et al . , 2010 ; veillette , 2010 ; cannons et al . , 2011 ; ma and deenick , 2011 ) . these motifs are referred to as immunoreceptor tyrosine - based switch motifs ( itsms ; cannons et al . , 2011 ) . the slam - family receptors are expressed in a broad range of immune cells and play critical roles in immunity . in general , the receptors act as self - ligands and their homophilic trans - interactions occur between either heterotypic or homotypic immune cells ( veillette , 2010 ; ma and deenick , 2011 ) . slam / cd150 is expressed on thymocytes , subsets of b and t lymphocytes , mature dendritic cells ( dcs ) , macrophages , and platelets , and their expression is upregulated or induced in lymphocytes and monocytes upon activation ( detre et al . signaling lymphocyte activation molecule - associated protein ( sap)-family adaptors [ sap , ewing s sarcoma - associated transcript ( eat)-2 , and eat-2-related transducer ( ert ) ] play important roles for the signal transductions mediated by the slam - family receptors ( veillette , 2010 ; ma and deenick , 2011 ) . they are small proteins that consist of a single src homology 2 ( sh2 ) domain and a short carboxy - terminal region . sap associates intracellularly with the itsms in the cytoplasmic region of the slam - family receptors via the sh2 domain ( dong and veillette , 2010 ; veillette , 2010 ; ma and deenick , 2011 ) . sap has the ability to bind concomitantly to the src - family protein tyrosine kinase , fyn , thereby coupling the slam - family receptors with fyn ( dong and veillette , 2010 ; veillette , 2010 ; cannons et al . , 2011 ) . thereafter , fyn phosphorylates tyrosine residues at the cytoplasmic region of slam - family receptors and other intracellular effector molecules , activating the downstream signals ( detre et al . , 2010 ; dong and veillette , 2010 ; cannons et al . sap binding to the sh2 domain of slam - family receptors competes with the binding of other sh2 domain - containing molecules , thus modulating the slam - mediated signaling ( dong and veillette , 2010 ; veillette , 2010 ; cannons et al . via slam / cd150-sap fyn interactions play important roles in regulating t cell receptor - mediated induction of th2 cytokines , such as interleukin ( il)-4 and il-13 ( detre et al . , 2010 ; cannons et al . , 2011 ; ma and deenick , 2011 ) . eat-2 also mediates the signal transduction cascades of the slam - family receptors via a similar but distinct mechanism to that of sap ( cannons et al . , 2011 ) . similar to sap , eat-2 also associates with the itsms of slam - family receptors through its sh2 domain , but mediates the subsequent signal cascades via its own phosphorylated tyrosine in the short carboxy - terminal region ( veillette , 2010 ) . in general , the signals mediated by the sap - family adaptors induce the activation and differentiation of immune cells ( veillette , 2010 ) . however , if the sap - family adaptors are absent , the slam - family receptors mediate inhibitory signals to immune cells ( a switch - of - function effect ; dong and veillette , 2010 ; veillette , 2010 ) . roles for slam / cd150 in macrophage functions , cell adhesion , and nkt cell development have also been demonstrated , although many data were obtained in mice ( dong and veillette , 2010 ; veillette , 2010 ; cannons et al . , 2011 ; ma and deenick , 2011 ) . x - linked lymphoproliferative syndrome is a rare immunodeficiency disease typically caused by mutations in the sap - encoding gene , sh2d1a ( veillette , 2010 ; ma and deenick , 2011 ) . patients with this syndrome have various functional defects and impaired differentiation of immune cells , indicating crucial roles for sap in normal immunity ( dong and veillette , 2010 ) . barr virus infection are characteristics of the disease ( veillette , 2010 ; ma and deenick , 2011 ) . although slam - family receptors have some functional redundancy , each receptor plays specific roles in a variety of immune responses ( dong and veillette , 2010 ; veillette , 2010 ) . in general , lymphotropic viruses , such as hiv and htlv1 , can never be airborne , and are transmitted inefficiently even through direct contact with patients . in sharp contrast , mv transmits via aerosols , and has a highly contagious nature . therefore , this transmission style of mv can not be easily explained by the fact that the virus uses a lymphocytic molecule , slam / cd150 , as a receptor . the recent findings showing that mv uses nectin4 , a cell adhesion molecule ( cam ) expressed at the ajs of epithelia , may partly but nicely explain how and why mv transmits efficiently from a patient to other individuals . epithelial cells are connected with one another through the formation of several specialized cell cell junctions , such as tjs , ajs , desmosomes , and gap junctions . tjs function as a physical barrier that prevents the passage of soluble molecules through the intercellular gaps , and also blocks the lateral movement of lipids and membrane proteins across the tj barrier , thereby acting as the border of the apical and basolateral membranes . nectin4 is a member of the nectin family , which consists of four members ( nectin1 , 2 , 3 , and 4 ; takai et al . , nectin1 and nectin2 were originally identified as poliovirus receptor - related protein ( prr)-1 and prr-2 , respectively , and subsequently shown to support the entry of some herpes viruses ( takai et al . are also type i transmembrane proteins that belong to the ig superfamily ( takai et al . , they possess an extracellular region with three ig - like domains ( an amino - terminal v - like domain and two c - like domains ) , a transmembrane region , and a cytoplasmic region with a short afadin - binding motif ( takai et al . the consensus motif was reported to be e / a - x - y - v for nectin1 , 2 , and 3 , while nectin4 does not have this motif but still binds to afadin ( reymond et al . , 2001 ; ( 2001 ) proposed a new consensus motif , k / r - x - x - y / l - v , for all four nectins . afadin is an actin filament ( f - actin)-binding protein , and supports nectins to interact and co - operate with cadherins , other cams , and intracellular signaling molecules ( takai et al . , nectins are expressed as dimers , and interact in trans with other nectin dimers expressed on neighboring cells ( takai et al . all nectins show homophilic interactions , while heterophilic interactions are also observed between specific nectins , such as those between nectin1/nectin3 and nectin 2/nectin3 ( takai et al . nectin4 shows homophilic interactions as well as heterophilic interactions with nectin1 ( reymond et al . , 2001 ; the ig v - like domain is used for the trans - interaction ( reymond et al . , 2001 ; fabre et al . , 2002 ) . nectins play key roles in the initiation of aj formation , and regulate various physiological functions of epithelial cells , such as contact inhibition of cell movement and proliferation , survival , differentiation , and cell polarization ( takai et al . , 2008a , b ) . although nectin1 and nectin2 are expressed in a broad range of tissues , the expression of nectin3 and nectin4 is more specific ( reymond et al . , 2001 ) . ( 2010 ) showed that human nectin4 is expressed mainly in the placenta and to lesser extents in the trachea , prostate , lung , and stomach . ( 2010 ) demonstrated nectin4 expression in human keratinocytes , suprabasal nucleated layers of the epidermis , and non - keratinized structures of hair . some levels of expression in epithelial cells of the tonsil , oral mucosa , esophagus , and nasopharynx have also been reported ( www.proteinatlas.org ) . although , in many cases , nectin4 is expressed in low or undetectable levels in normal human tissues , many cancer cells are highly positive for nectin4 . thus , it has been proposed that nectin4 is a new tumor - associated marker ( fabre - lafay et al . these observations may provide a rationale for the use of mv as an oncolytic agent ( mhlebach et al . , 2011 ) . in humans , mutations in the pvrl4 gene encoding nectin4 cause ectodermal - dysplasia - syndactyly syndrome ( edss ) , in which patients have affected skin and skin appendages , such as hair , teeth , and nails ( brancati et al . , 2010 ; jelani et al . , 2011 ) . the pathology of measles can now be drawn with these two receptors ( figure 3 ) . although nectin4-expressing epithelial cells can be the initial targets of mv , no or very limited infection of epithelia was observed in monkeys experimentally infected with mv at the early days after infection ( ludlow et al . , 2010 ; lemon et al . , 2011 instead , mv initiates its infection via slam - mediated entry into alveolar macrophages and dcs in the lung or respiratory tracts ( de witte et al . , 2008 ; de vries et al . , 2010 . these infections may allow mv to penetrate into the human body and reach the lymphoid organs or tissues , where slam / cd150-expressing cells are abundant ( corry et al . after initial replication in these lymphoid organs or tissues , mv or mv - infected lymphocytes can easily enter the bloodstream . subsequently , a dramatic mv infection is observed in all lymphoid organs , such as the spleen , thymus , appendix , tonsil , and lymph nodes , throughout the body ( moench et al . , 1988 ; kobune et al . , 1996 ; de swart et al . , 2007 ; de vries et al . , 2010 ) . at the time when the mv infection of lymphoid organs reaches its peak , mv infection of epithelia , such as squamous stratified epithelia of the tongue and buccal mucosa and ciliated epithelia of the trachea , becomes evident ( nii et al . , 1964 ; olding - stenkvist and bjorvatn , 1976 ; moench et al . , 1988 ; this epithelial infection is probably led by mv - infected immune cells and initiated through the basolateral side , since monkeys infected with mv often show infectious foci in the epithelia with mv - infected lymphoid or myeloid cells in the subepithelial cell layers of the trachea , bronchus , and tongue ( de vries et al . , 2010 ; ludlow et al . , the h protein expressed on mv - infected immune cells that migrate through the epithelial cell layer likely recognizes nectin4 expressed at ajs , triggering f protein - mediated membrane fusion between the mv - infected immune cells and the target epithelial cells . ( 2011 ) demonstrated a correlation between nectin4 expression and mv infection in epithelia in vivo . importantly , mv has a mechanism that further facilitates virus shedding in the airway . in epithelia , mv selectively releases progeny virus particles from the apical membrane to the luminal side of the respiratory tract ( leonard et al . , 2008 ; leonard et al . ( 2008 ) showed that mv genetically engineered to use slam / cd150 , but not nectin4 ( nectin4-blind or slam / cd150-tropic ) , does not shed progeny viruses into the respiratory tract , although it does show systemic infection of lymphoid organs , similar to the case for wt mv . mv initiates its infection via slam - mediated entry into alveolar macrophages and dcs in the lung . after initial replication in regional lymph nodes , mv enters the bloodstream and subsequently spreads to all lymphoid organs , such as the spleen , thymus , appendix , tonsil , and lymph nodes , throughout the body . when the mv infection of the lymphoid organs reaches its peak , mv - infected immune cells transfer mv to epithelial cells through the basolateral side . at this step , mv uses nectin4 expressed at ajs as a receptor . in the epithelia , mv selectively releases its progeny virus particles from the apical membrane to the luminal side of the respiratory tract . membrane cofactor protein / cd46 was first identified as a receptor for mv ( dorig et al . , however , our current knowledge of mv receptors has been totally transformed . in 2000 , it was shown that slam / cd150 expressed on cells of the immune system , but not mcp / cd46 , is a real receptor for wt mv . however , recent studies further showed that slam / cd150 is not the sole receptor for mv . mv has an intrinsic ability to enter not only immune cells but also epithelial cells . in 2011 , a clear answer was obtained through the identification of the epithelial mv receptor nectin4 , which is expressed at ajs , thereby partly explaining why mv exhibits its highly contagious nature ( mhlebach et al . , 2011 ; noyce et al . , however , many aspects and molecular mechanisms underlying immunosuppressive effects and a highly contagious nature of mv still remain to be elucidated . analyses of physiological roles of mv receptors , slam / cd150 , and nectin4 , would provide deep insights into mv pathogenesis . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

measles is a highly contagious disease that causes temporary and severe immunosuppression in patients . signaling lymphocyte activation molecule ( slam ) expressed on cells of the immune system functions as a receptor for measles virus ( mv ) . in addition to slam , vaccine strains of mv also use a ubiquitously expressed complement regulatory protein , cd46 , as a receptor , whereas wild - type ( wt ) mv strains do not use this receptor . however , recent studies have indicated that slam is not the sole receptor for wt mv strains . these strains have an intrinsic ability to enter both immune and epithelial cells using distinct receptor binding sites in their hemagglutinin ( h ) protein . recently , a clear answer was obtained through the identification of an epithelial mv receptor , nectin4 , expressed at adherens junctions , thereby greatly improving our knowledge of mv receptors . it is now clear that mv specifically targets two cell types , immune cells and epithelial cells , using slam and nectin4 , respectively . mv loses the ability to use either slam or nectin4 when it possesses specific mutations in the h protein . however , nectin4-blind mv still infects slam - positive immune cells efficiently ( slam - tropic ) , and conversely , slam - blind mv infects nectin4-positive epithelial cells efficiently ( nectin4-tropic ) . in this regard , mv is intrinsically dual - tropic to immune cells and epithelial cells . although many aspects and molecular mechanisms underlying immunosuppressive effects and a highly contagious nature of mv still remain to be elucidated , analyses of physiological functions of these two receptors would provide deep insights into mv pathogenesis .

Measles Virus Discoveries of Cellular Receptors for MV SLAM/CD150 Nectin4 Relevance of SLAM/CD150 and Nectin4 to MV Pathogenesis Concluding Remarks Conflict of Interest Statement

emotional intelligence , in recent decades , has been considered as an achievement elixir in the various comprehensive aspects of life and include perception capacity , expression , understanding , cognition , application , and self - management of the emotions of self and others . emotional intelligence will help an individual to apply his skills in the best way , in social relations , and in particular circumstances , will help him / her recognize an inappropriate action from an appropriate action , be hopeful , empathize with others , listen to the others emotions , ignore smaller rewards to achieve much larger rewards , persist against the problems and maintain the motivation in all circumstances , attract others trust , be accountable , convinced , lively , be a novelty seeker , be in balance emotionally , and be optimistic and goal - oriented in life . having an emotional intelligence quotient rate causes one to spend less psychological energy in negative incidents and to achieve more benefits from the positive incidents . with regard to these features , some of the references pointed out that people 's destiny to obtain many achievements is dependent on their emotional intelligence . in this regard , emotional intelligence is a decisive determinant , for example , the unsuccessfulness of some people with high iq ( intelligence quotient ) or unexpected success of some others with average and normal iq . thus , emotional intelligence is the predictor of individuals success in life , education , and so on . dewey correlated this issue to the education system ; in this system , only academic ability is emphasized and ei is disregarded . therefore , austin et al . , believe that social and emotional competence is considered as a determinant for academic achievement . hence , emotions have consistently been seen as essential components of learning , along with the emphasized cognitive capacity of the psychologists and instructors of educational sciences . however , considering the importance and impact of emotional intelligence on different aspects of life , such as the educational life , the mentioned survey tried to predict the academic performance of medical students in the basic sciences comprehensive examination , based on ei indicators and their educational status in this period ; especially medical students who required a higher commitment level , a more complete performance , and more accountability , of the service providing type . in the following section , relevant domestic and foreign researches in this regard , in separate researches on students reported that there was a significant and positive correlation between some of the components of ei and academic achievement . haddadi et al . in a study on shahed and non - shahed students of tehran university concluded that there was no correlation between ei and academic achievement . it has been reported that emotional skills have a long - term effect on success . the american psychiatrists association , studied the educational experiences of 21 women and came to a conclusion that those with higher ei had higher academic achievement . gumora and arsenio , diguseppe , robert , parker , petrides et al . , abdollah et al . , parker et al . , wraight , rice , and bradshow , in separate researches , reported that there was a positive and negative correlation between ei and academic achievement . moreover , woitasze and alsama , drago , and bastian et al . , illustrated an inconsistent result in different researches based on the fact that there was no correlation between emotional intelligence and academic achievement . stratton et al . , in a study that had reviewed ei in medical students , had come to realize that with increase in the academic semester of the students , they showed considerable reduction in emotions , mood modification , sympathy , and increased distress on account of the ei indicators . lazaguirre , when studying freshmen , had concluded that the variables of problem solving and social accountability of ei indicators were in association with academic achievement . studies conducted in different countries have emphasized the impact of various emotional intelligence indicators on students academic performances . the present study aims to investigate this subject in medical students , based on their biomedical examination , and show that this examination plays a decisive role in a student 's ability to continue his / her education in this major , and then it answers the research question of whether the educational function of medical students , according to excitable intelligence indices , is a predictable method . this study was a survey that was performed on the medical students of the isfahan , tehran , and mashhad universities of medical sciences , iran , in 2008 . the mentioned students had participated in a comprehensive basic sciences examination , in september 2008 . the universities were randomly selected and the students underwent census ( n = 182 ) . following coordination with the dean of the colleges and universities and contact with student representatives , the standardized emotional intelligence questionnaires were distributed , after explaining the study objective . on the other hand , accurate accessibility of the students average scores was conducted by obtaining the user i d and code through the sama software affiliated to the research deputy of the university . thereafter , the score of comprehensive basic sciences examination of each of the students was received with the coordination of the research chancellor of the universities from the educational section of the schools ( colleges ) . the emotional intelligence questionnaire had 90 questions with 15 likert scales of , problem - solving , happiness , using stress tolerance , self - actualization , emotional self - awareness , realism , interpersonal relationships , optimism , self - esteem , impulse control , flexibility , social responsibility , empathy , and self - expression by responding . reliability was reported to be 0.93 through the cronbach 's alpha coefficient and 0.87 by the split - half method . after collecting the data , they were analyzed by the spss software version 15 and stepwise regression test . the results showed that the predicted coefficients of the three independent variables including average scores of the third semester , the first semester , and the independence score ( one of the 15 scales of the ei questionnaire ) were significant toward the academic performance of the students in the comprehensive basic sciences examination [ tables 1 and 2 ] . multiple correlation coefficients of the emotional intelligence subscale and average score of the five semesters of basic sciences in predicting the academic performance of medical students in comprehensive basic sciences examination reviewing significant coefficient predictors of the academic performance of medical students according to the results of the statistical test , the three predictive academic performance variables were , average scores of the third semester , the first semester , and independence scale , from the ei questionnaire . with the aim to widen the varied effects of emotional intelligence on different dimensions of the individual , social , academic , occupational , family life and so on , the present study predicted the academic performance of the medical students in a comprehensive examination of the basic sciences , according to the indices of emotional intelligence and educational status . according to the results of the regression coefficient , among the independent variables ( a mean of the five semesters of basic sciences and 15 ei scales ) , three predictive academic performance variables of the students included average scores of the third semester , the first semester , and the independence scale from the ei questionnaire . the correlation between ei and academic performance also was indicated in many researches , like those of : zare , mansouri , yousefi and kheir , haddad kouhsari , et al . samari and tahmasbi , lalifaz and asgari , elias , apa , gumora and arsenio , digiuseppe , rice , holt , bradshaw , and lizagairre . however , bastin et al . , and haddad kouhsar et al . , in their studies , found no correlation between emotional intelligence and academic achievement . in this study , out of 15 components of ei , only the independence scale was a significant predictor for academic performance of medical students in the comprehensive basic sciences examination . the finding of this study was compatible with the study findings of dehshiri , and supported it ; while in the rice 's study , out of 11 ei components , 10 components showed a significant correlation with academic performance and in the study by lisa cuir , responsibility and problem - solving had the highest correlation with academic performance . one of the major causes of difference in results and in the type of scales associated with the predictor of academic performance of the students could be the difference between the individual characteristics of the study samples in iran and other countries . on the other hand , with regard to the independence component ( that was a significant predictor in this study ) , the ability to recognize the inner capacity , talent , and the capability for doing the things someone is able to do , wants to do , and enjoys doing , will be reviewed . the prerequisite for being accepted in the medicine course also is to try and work hard . therefore , individuals must use their own capacity , talent , effort , and abilities independently , to achieve success . taking into consideration the influence of emotional intelligence on individual , social , occupational , and educational life aspects , as well as the fact that emotional intelligence is a skill that can be learned , it is imperative to provide students with the related training during the academic semesters , which will help improve their academic performance and enhance their occupational skills and abilities .

background : considering the increasing importance of emotional intelligence ( ei ) in different aspects of life , such as academic achievement , the present survey is aimed to predict academic performance of medical students in the comprehensive examination of the basic sciences , according to the indices of emotional intelligence and educational status.materials and methods : the present survey is a descriptive , analytical , and cross - sectional study performed on the medical students of isfahan , tehran , and mashhad universities of medical sciences . sampling the universities was performed randomly after which selecting the students was done , taking into consideration the limitation in their numbers . based on the inclusion criteria , all the medical students , entrance of 2005 , who had attended the comprehensive basic sciences examination in 2008 , entered the study . the data collection tools included an emotional intelligence questionnaire ( standardized in isfahan ) , the average score of the first to fifth semesters , total average of each of the five semesters , and the grade of the comprehensive basic sciences examination . the data were analyzed through stepwise regression coefficient by spss software version 15.results:the results indicated that the indicators of independence from an emotional intelligence test and average scores of the first and third academic semesters were significant in predicting the students academic performance in the comprehensive basic sciences examination.conclusion:according to the obtained results , the average scores of students , especially in the earlier semesters , as well as the indicators of independence and the self - esteem rate of students can influence their success in the comprehensive basic sciences examination .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION Financial support and sponsorship Conflict of interest

gout is a form of inflammatory arthritis characterized by the formation of monosodium urate crystals in the joints , synovial liquid , and other tissues [ 14 ] . it is one of the most prevalent causes of arthritis [ 47 ] and recent studies suggest that the prevalence and incidence of gout has increased in the last decades [ 2 , 8 , 9 ] . in the usa , the cumulative incidence of gout is 8.6% in men and its prevalence in the general population is approximately 0.5% [ 1 , 2 ] . the disease affects approximately 1 - 2% of adult males in occidental countries [ 1 , 4 , 7 ] , with a male : female ratio of 35 : 1 . according to the framingham study , 9.2% of men and 0.4% of women had hyperuricemia and 19% of them developed gout . persistent elevation of serum urate levels is the essential condition leading to the development of gout . about 10% of people with hyperuricemia develop gout and 90% of patients with gout are hyperuricaemic . risk factors include family history , excessive consumption of alcohol , use of diuretics , kidney disease [ 1 , 2 , 6 , 9 ] , dietary factors such as elevated consumption of seafood , meat , and vegetables rich in purines [ 1 , 2 , 4 , 6 , 9 ] , elevated body mass index ( bmi ) [ 1 , 4 , 6 , 9 ] , age , and gender . initial clinical presentation is commonly an acute inflammatory monoarthritis affecting the first metatarsophalangeal joint , known as podagra [ 1 , 2 , 4 ] . the presence of urate crystals in the synovial fluid is considered the gold standard in diagnosing gout . the treatment of an acute gout crisis focuses on controlling pain and inflammation [ 4 , 6 ] . drugs such as colchicine , anti - inflammatories , and analgesics are part of the therapeutic regime for gout . once the acute crisis is controlled , drugs that reduce uric acid such as allopurinol are widely prescribed [ 4 , 6 ] . benzbromarone is an uricosuric agent that has been used for more than 25 years to control hyperuricemia . it inhibits the main renal urate transporter , urat-1 , an exchanger located in the luminal face of the proximal tubule of the kidney . in doing so benzbromarone is metabolised in the liver by the cytochrome p450 system , and as a result should be used with caution in patients with hepatobiliary diseases . however , benzbromarone is no longer commercially available in usa , and in 2003 it was withdrawn from the european market due to the risk of severe hepatotoxicity . there are case reports of fulminant hepatitis associated with the usage of standard doses of benzbromarone ( 100 mg / day ) during short periods ( three months ) . nevertheless , only three cases have been described since the early 1970s and it is debated whether banning benzbromarone was appropriate or if it was done too hastily . in brazil , sales are permitted by the brazilian health surveillance agency ( anvisa ) and benzbromarone seems to have a safety profile identical to sulfinpyrazone . besides hepatotoxicity , at times of the intense uric acid excretion benzbromarone causes may lead to the formation of uric acid kidney stones . patients should be advised to stop benzbromarone and seek urgent medical attention if they develop nausea , vomiting , abdominal pain , or jaundice . benzbromarone also increases the metabolism of warfarin increasing the risk of bleeding in patients using both medications at the same time . there are few studies in the medical literature evaluating the metabolism of benzbromarone , its side effects , and also its risks and benefits . the objective of this study is to describe the profile of a sample of gouty patients treated with allopurinol , benzbromarone , or a combination of these two drugs , as well as to describe the impact of this therapy on lowering uric acid levels . we evaluated 48 patients diagnosed with gout who were seen at the outpatient rheumatology clinic at the federal university of paran between january 2009 and november 2010 . the study was approved by the teaching hospital 's ethics committee and informed consent was obtained from all patients . an observational the following data were collected : age ; gender ; profession ; personal history of alcohol , tobacco , or drug use ; comorbidities such as obesity , high blood pressure ( hbp ) , diabetes mellitus ( dm ) , hypertriglyceridemia , nephrolithiasis , and osteoarthritis ; family history of gout ; year of onset ( first attack ) , total number of attacks , average duration of attacks ( days ) , triggering factors , joint affected in the first attack , and other joints involved as the disease evolved ; presence or absence of tophi ; daily dosage ; and how long each medication had been used . serum creatinine , basal and posttreatment serum levels of uric acid , transaminase , and bilirubin were measured . the patients were divided into three groups : patients using only allopurinol ( a ) , only benzbromarone ( b ) , and both in combination ( a + b ) . treatment for each patient was selected on a case - by - case basis by attending physicians and the head of the clinic . allopurinol was started in doses from 100 to 300 mg / day , with progressive increases according to therapeutic response . benzbromarone was started at a dose of 50 mg / day during the first month and was increased later , if necessary , to 100 mg / day . uric acid levels were checked every three months . the treatment period with uricosurics ranged from 12 to 18 months . the results were analysed by variance analysis , t - test , paired t - test , and nonparametric tests ( wilcoxon and mann - whitney ) , when necessary . the average age of these patients was 56.6 11.4 years , with variation from 35 to 81 years . more than 70% of the individuals had acute monoarthritis in the first metatarsophalangeal joint at some point in the evolution of the disease and approximately 40% of them experienced their first gout attack in this joint . almost half of the patients had chronic tophaceous gout ( table 1 ) . approximately half of the patients identified factors that triggered acute attacks , and the majority of acute attacks were triggered by dietary factors ( 31.2% ) and alcohol consumption ( 29.1% ) . other triggers in our sample included local trauma , cold , physical exercise , and the use of diuretics . about 80% of the patients had high blood pressure , 20% had diabetes mellitus , 40% had hypertriglyceridemia , and 20% were obese . serum creatinine levels were 1.4 0.8 mg / dl ( a variation of 0.65.4 mg / dl ) and uric acid levels in the urine were 555 356 mg / day ( variation of 1382132 mg / day ) . 58.3% of the patients were considered to be uric acid hypoexcretors ( excretion below 400 mg / day ) . no patient experienced alteration of bilirubin or transaminases . with regard to the medications used , 31 ( 64.5% ) patients used colchicine , with daily doses between 0.5 and 1 mg . approximately 40% of the patients were using nonsteroidal anti - inflammatories ( nsaids ) and 18.75% used corticosteroids . the entire patient group experienced a significant drop in uric acid levels , from 8.5 1.8 to 6.7 2.1 mg / dl ( p < 0.001 ) , regardless of the prescribed medication class ( figure 1 ) . thirty - eight patients used hypouricemics : allopurinol was prescribed to 27 patients and benzbromarone to four patients , and these two drugs were combined in seven cases . there were no significant differences in age , uric acid levels in urine , or serum urate levels at the beginning of the treatment ( table 2 ) . when comparing the base serum urate levels with the final serum urate levels obtained in this study , there was a significant difference between patients taking only allopurinol and patients taking benzbromarone alone or both drugs together ( table 2 and figure 2 ) . the number of patients taking both drugs whose serum urate values were within normal range ( men < 7 mg / dl and women < 6 mg / dl ) was 85.7% ( 6/7 ) , while for the group taking benzbromarone alone this value was 75% ( 3/4 ) , and in the group taking allopurinol alone it was 51.8% ( 14/27 ) . at a time when new synthetic and biological medications to treat gout are being considered , we revisited a molecule that is already known and used in the therapeutic control of this ancient disease . eighty percent ( 38/48 ) received hypouricemics . in most cases , allopurinol was the drug of choice to reduce hyperuricemia ( 27/38 , 71% ) . we observed that , in patients taking allopurinol alone , serum urate levels were higher than in those taking benzbromarone alone or taking a combination of both drugs ( table 2 ) . there is evidence that standard doses of benzbromarone ( 100 mg / day ) produce stronger hypouricemic effects than standard doses of allopurinol ( 300 mg / day ) [ 11 , 15 , 16 ] . in two series , benzbromarone reduced uric acid concentration by 54% to 63% and uric acid levels were inferior to 5 mg / dl [ 15 , 17 ] . in a study conducted by perez - ruiz et al . , 53% of patients who received allopurinol and 100% of patients who received benzbromarone achieved plasma urate levels considered optimal for disease control . in another study in which only patients intolerant to allopurinol were analysed , 92% of patients who received benzbromarone were successfully treated , maintaining serum urate levels at around 5 mg / dl [ 4 , 11 , 17 ] . in our study , allopurinol brought serum urate levels to within normal range in 51.8% of the patients , benzbromarone alone reduced urates to normal levels in 75% of patients , and combination therapy normalized uricaemia in 85.7% of patients . compared efficacy and tolerability between allopurinol 300600 mg / day and benzbromarone 100200 mg / day . when doses considered to be lower than the standard were used , uric acid levels were brought to normal levels in 26% of cases using allopurinol and 52% of cases using benzbromarone . with higher doses , benzbromarone can be considered for patients with low urate excretion , except if there is a previous history of nephrolithiasis . patients intolerant to allopurinol or who experience unsatisfactory reduction of urate levels or even primary hyperuricemia with deficiency in kidney urate excretion ( < 400 mg/24 h ) but normal kidney function can be treated with benzbromarone . in our study , the majority of patients using benzbromarone were hypoexcretors of uric acid . benzbromarone has limited effectiveness in patients with kidney insufficiency but can be effective in patients with moderate kidney insufficiency . although this drug is less effective in patients with lower creatinine clearance , an important reduction in uric acid levels was observed in these patients . the serum creatinine levels of patients using benzbromarone varied greatly , with values between 0.8 and 2.3 mg / dl . we did not measure the patients ' 24-hour creatinine clearance . in the patient group taking both allopurinol and benzbromarone simultaneously , initial serum urate levels of 8.2 1.4 mg / dl decreased about 47.25% to 4.6 2.3 ( p < this result can be considered superior when compared with the patient group taking allopurinol alone ( figure 2 ) and similar to the result obtained from the group taking benzbromarone alone . in a study performed by yamamoto and collaborators , the authors concluded that the interaction did not affect the plasmatic concentration of oxipurinol ( the main allopurinol metabolite ) but caused an increase in oxipurinol clearance . oxipurinol levels were not measured in our patients . according to perez - ruiz et al . , benzbromarone , used alone or combined with allopurinol , is superior to therapy with allopurinol in reducing gouty tophi . this study has limitations : first of all , the choice of therapy was not randomized but was chosen by the attending physician according to each patient 's profile . similarly , patient followup was not blind ; that is , doctors and patients were aware of which medication was being used in each case . moreover , although 11 patients received benzbromarone , the number of patients taking this drug alone ( n = 4 ) was very small . however , we believe that benzbromarone , alone or in combination with allopurinol , has an important clinical role in controlling uricaemia of patients with gout . patients should be selected carefully to take benzbromarone , and those with liver disease or advanced chronic kidney disease should be excluded . of course , a prospective , randomized double - blind clinical trial involving multiple centres is still needed . as stated by lee and collaborators in a recent revision , availability of benzbromarone to treat selected cases of gout would be especially interesting , particularly to patients in whom allopurinol produces insufficient response or toxicity . the therapeutic combination of benzbromarone and allopurinol significantly decreased serum urate levels in patients with gout when compared to the individual use of each of these agents . this finding is especially important in treating patients who can not control hyperuricemia with monotherapy . the lack of serious adverse effects associated with benzbromarone in our study is probably related to the selection of suitable patients . we believe that benzbromarone plays an important role in controlling hyperuricemia and clinical remission of patients with refractory gout .

objective . to profile a sample of gouty patients treated with allopurinol , benzbromarone , or a combination of these two drugs and to describe the impact of this therapy in reducing uric acid levels . methods . an observational , transversal study was performed . we evaluated 48 patients diagnosed with gout who were seen at the outpatient rheumatology clinic of the federal university of paran between january 2009 and november 2010 . clinical data , creatinine serum levels , and basal and posttreatment levels of serum urates , transaminases , and bilirubins were recorded . uric acid levels were measured in a 24-hour urine sample . patients were divided into three groups : patients given only allopurinol ( a ) , only benzbromarone ( b ) , and both in combined therapy ( a + b ) . results . the average age of these patients was 56.6 11.4 years , varying from 35 to 81 years . the entire patient group experienced a significant drop in serum urate levels , from 8.5 1.8 mg / dl ( 0.472 0.1 mmol / l ) to 6.7 2.1 mg / dl ( 0.372 0.116 mmol / l ) ( p < 0.001 ) , regardless of the prescribed medication . the number of patients taking both drugs whose serum uric acid values fell within normal range ( men < 7 mg / dl ( 0.38 mmol / l ) and women < 6 mg / dl ( 0.33 mmol / l ) ) was 85.7% ( 6/7 ) while this value for the group taking benzbromarone alone was 75% ( 3/4 ) and for the group taking allopurinol alone this number was 51.8% ( 14/27 ) . conclusions . the therapeutic combination of benzbromarone and allopurinol significantly decreased serum urate levels in patients with gout when compared to individual use of each of these agents . this finding is especially important in treating patients who can not control hyperuricemia with monotherapy . benzbromarone alone or in combination with allopurinol has an important clinical role in controlling hyperuricemia in patients with gout .

1. Introduction 2. Patients and Methods 3. Results 4. Discussion 5. Conclusion

pneumocystis jirovecii pneumonia ( pjp ) is one of the most life - threatening infections in immunocompromised patients . typical computed tomography ( ct ) findings of pjp include diffuse ground glass opacity in both lungs , but cystic formation or pneumothorax can also be seen , and nodules are found on rare occasion ( 1 , 2 , 3 ) . nodular opacities in pneumocystis jirovecii ( p. jirovecii ) infection are related with granulomatous response to pjp infection on histopathologic examination that is an uncommon form of pneumocystis infection . solitary pulmonary nodule in patients with pjp infection is very rare and only 3 cases have been reported in the english literature ( 4 , 5 , 6 ) . in addition , imaging findings of single nodular opacities in lymphoma patients can mimic lymphoma involvement of the lung or other infectious lesions . the diagnosis of granulomatous pjp infection is only possible by biopsy rather than traditional procedures like bronchoalveolar lavage ( bal ) , because the organisms are not infiltrated in the alveolar lumen ( 7 ) . we reported a patient with diffuse large b cell lymphoma ( dlbl ) who presented with an unusual manifestation of pjp infection after chemotherapy to stress the diagnostic importance of biopsy rather than bal . the case was approved by the institutional review board of kyung hee university hospital that waived the requirement of patient informed consent for the retrospective investigation . a 69-year - old woman was diagnosed with stage ii dlbl involving the left gastric and paraaortic lymph nodes . she had received treatment with the r - chop regimen that consists of rituximab ( 375 mg / m ) , cyclophosphamide ( 750 mg / m ) , adriamycin ( 50 mg / m ) , vincristine ( 2 mg on day 1 ) , and prednisolone ( 100 mg / day for 5 days ) every 3 weeks . after her sixth cycle of r - chop chemotherapy , she was admitted to the hospital for management of neutropenia . her absolute neutrophil count ( anc ) was 81 , but she had no fever ( 36 ) or any other symptoms . the c - reactive protein ( crp ) and the erythrocyte sedimentation rate ( esr ) levels were in the normal range . she underwent a routine chest ct 2 weeks later for evaluation of response to chemotherapy . there was a 1.3-cm subpleural solitary pulmonary nodule in the right lower lobe ( fig . her body temperature was normal ( 36.2 ) and she was asymptomatic . physical examination including lung sounds was normal . laboratory examination revealed a hemoglobin level of 10.7 g / dl , a white blood cell count of 3240/l ( 57.1% neutrophils , 20.7% lymphocytes , 10.4% monocytes , 6.2% eosinophils , 1.3% basophils ) and a platelet count of 184000/l . the patient underwent positron emission tomography - computed tomography for further evaluation of the nodule , and the nodule showed high uptake ( standardized uptake values maximum 5.4 ) ( fig . short - term follow - up with chest ct was conducted under suspicion of an inflammatory lesion or lymphoma involvement of the lung . the subpleural nodule grew rapidly to 2.5 cm after 10 days with peripheral ground glass opacity showing a halo sign ( fig . interval growth during the short term period was suggestive of an infectious lesion and a nodule with a halo sign suggested the possibility of fungal infection such as angioinvasive pulmonary aspergillosis . however , neutrophil count was in the normal range and the aspergillosis antigen test was negative . finally , video - assisted thoracoscopic surgery biopsy and pathology results showed foamy eosinophilic exudates with the granuloma ( fig . 1d ) and demonstrated p. jirovecii organisms on gomori 's methenamine silver nitrate stain ( fig . she received trimethoprim - sulfamethoxazol for 2 weeks and no additional infections developed during the follow - up period . the most common manifestation of pjp is diffuse alveolar pneumonia with classical pathologic findings of foamy intra - alveolar eosinophilic exudates that contains pjp organisms ( 8 , 9 ) . granulomatous reaction to pjp organisms is an unusual pathologic finding comprising 3 - 5% cases , predominantly in human immunodeficiency virus ( hiv ) patients ( 10 ) . until now , granulomatous pjp infection was reported less frequently in non - hiv than in hiv patients . the pathogenesis of granulomatous reaction in pjp infection is related to host states such as prophylaxis with pentamidine , active malignancy , recent corticosteroid use , or immune reconstitution diseases rather than pjp genotypes ( 9 ) . withdrawal from steroids can affect cd4 count and function and can cause immune reconstitution - like syndrome that is a phenomenon similar to immune reconstitution syndrome in hiv patients on anti - retroviral therapy ( 11 ) . insidious presentation with minimal symptoms of mild cough and dyspnea is common in granulomatous pjp infection ; however , we experienced a very rare asymptomatic pjp infection with granulomatous reaction , the second case reported to date ( 12 ) . there are few reports on detailed imaging findings of granulomatous pjp infection , but granulomatous pjp infection shows variable radiological findings of mostly diffuse infiltrations , multiple nodules , and rarely a solitary pulmonary nodule ( 5 , 13 ) . this was the first report of granulomatous pjp presenting as a solitary pulmonary nodule with peripheral ground glass opacity , also called the halo sign . the halo sign on chest ct was first described in angioinvasive pulmonary aspergillosis , indicative of hemorrhagic infarction ( 14 , 15 ) . in addition , although it is less common , the ct halo sign may be observed in hemorrhagic nodules of infectious origin ( mucormycosis , candidiasis , tuberculosis , viral pneumonia ) ; hemorrhagic nodules of non - infectious origin ( wegener granulomatosis , kaposi sarcoma , hemorrhagic metastases ) ; tumor cell infiltration ( lymphoma , adenocarcinoma with lepidic growth pattern ) ; and non - hemorrhagic lesions ( sarcoidosis and organizing pneumonia ) ( 16 , 17 ) . the ct halo sign was associated with inflammatory cell infiltrates on histopathologic examination , in our case . in case of granulomatous pjp infection , unlike pjp pneumonia that shows alveolar infiltration , organisms rarely exist in the alveoli lumen and therefore bal specimens show high false negative rates ( 7 ) . furthermore , biopsy is needed for a definite diagnosis since pjp radiologically needs differentiation from other infections and malignancies like lymphoma . physician awareness of atypical radiologic manifestation of granulomatous pjp infection will help in the diagnostic approach . in conclusion , our experience suggests that granulomatous pjp infection should be considered a possible diagnosis when non - hiv immunocompromised patients present with a solitary pulmonary nodule with halo sign and when suspected , biopsy , rather than bal should be performed promptly to prevent delay in diagnosis and effective treatment .

the radiologic findings of a single nodule from pneumocystis jirovecii pneumonia ( pjp ) have been rarely reported . we described a case of granulomatous pjp manifesting as a solitary pulmonary nodule with a halo sign in a 69-year - old woman with diffuse large b cell lymphoma during chemotherapy . the radiologic appearance of the patient suggested an infectious lesion such as angioinvasive pulmonary aspergillosis or lymphoma involvement of the lung ; however , clinical manifestations were not compatible with the diseases . the nodule was confirmed as granulomatous pjp by video - assisted thoracoscopic surgery biopsy .

INTRODUCTION CASE REPORT DISCUSSION

the major pathophysiological feature of glaucoma is optic nerve damage , with progressive apoptosis of the retinal ganglion cells ( rgcs ) being the final pathway . this apoptosis can be blocked ; the damaged rgcs can regenerate ; and their functions can be restored by neuroprotective molecules . nerve growth factor ( ngf ) has the ability to promote development , differentiation , and regeneration of central or peripheral neurons [ 25 ] . therapeutic neuroprotective compounds are commonly administered orally , intravenously , or intramuscularly and reach ocular tissue via the systemic circulation . however , blood - eye barrier brings about a low concentration of the drugs in retina and optic nerve , leading to low efficacy and limited application of neuroprotective drugs . therefore , the development of an efficient drug - delivery system is essential to make neuroprotective drugs more effective . the recent study in microbubble ( ultrasound contrast agent ) inspires us to use it as a tool for topical drug - delivery . microbubbles are blasted using ultrasound with specific energy , so that the drugs can be directly released at the target cells [ 7 , 8 ] . we hypothesized that combined usage of ultrasound microbubble could increase the protective effect of mngf against optic nerve damage due to intraocular hypertension . to verify the availability of this administration , we firstly establish an optic nerve damage model due to intraocular hypertension in rabbits and then treat the rabbits with a combination of ultrasound microbubble and mngf . the animal studies were conducted in compliance with the arvo statement for the use of animals , and all animal experiments were performed under protocols approved by the institutional animal care of shenzhen eye hospital . forty healthy new zealand 's rabbits ( 1.5 kg in body weight ) were purchased from medical experimental animal center of guangdong province and maintained in shenzhen university . china ) , carbomer-940 ( beijing guoren yikang technology co. ltd . , china ) , electrophysiological system ( roland consult , germany ) , optical microscope ( olympus , japan ) , transmission electron microscope ( fei , usa ) , and ultrasonic instrument ( chongqing medical university , china ) . the ultrasonic instrument has a center frequency of 1 mhz , with probe diameter of 1 cm . its intensity ranges from 0 to 3.0 w / cm , with continuous or pulse transmission ( figure 1(a ) ) . we slowly injected 5 ml sonovue into 0.9% saline and shook it to generate foams . then the microbubble was formed with concentration of 2 10/ml , diameter of 2.5 microns , and osmotic pressure of 290 osm / kg ( the same as human plasma ) ( figure 1(b ) ) . mouse nerve growth factors ( mngf ) were purchased from xiamen beida biological engineering company ( beida , china ) . a bottle of dried powder of mngf ( 18 g ) was mixed with 0.1 ml of 0.9% sodium chloride ( 18 g/0.1 ml ) before use . a total of 40 new zealand 's rabbits were randomly divided into 5 groups ( 8 rabbits per group ) : group a ( control group ; 0.1 ml microbubble injected into the vitreous ) , group b ( intraocular hypertension control ) , group c ( 0.1 ml mngf injected into the vitreous ) ( figure 1(c ) ) , group d ( 0.1 ml mngf injected into the vitreous with ultrasound irradiation ) ( figure 1(d ) ) , and group e ( 0.1 ml microbubble and mngf injected into the vitreous with ultrasound irradiation ) . ultrasound irradiation was performed for 60 s at a frequency of 1 mhz and intensity of 0.5 w / cm . animals were anesthetized by injection of pentobarbital sodium ( 3% , 1 ml / kg ) . 0.2 ml aqueous humor was extracted from anterior chamber ; 0.2 ml compound carbomer solution ( 0.3% ) was then transfused in . if iop < 22 mmhg , then the carbomer solution injection was repeated once more . the model should be considered as success if iop > 22 mmhg , maintained for 4 weeks . tono - pen ( a pen type tonometer ) was used to measure iop every day . the animals were anesthetized with 2% pentobarbital sodium ( 20 mg / kg ) . reference electrode was inserted subcutaneously at midpoint between two eyes , recording electrode at midpoint between two ears , grounding electrode behind the right ear . we use roland electrophysiological system to record flash visual evoked potential ( f - vep ) . according to iscev standard for clinical visual evoked potentials , we used white flash stimulation as colorless background with pass - band of 1~300 hz , using gray flip checkerboard as stimulus signal . the latency and amplitude of p100 in each animal were recorded every 10 minutes , so in half an hour we obtain three values , and the average of the values was chosen as statistics data . after 4 weeks , the rabbits were sacrificed and the retina and optic nerve were collected for hematoxylin and eosin ( he ) staining , retinal thickness measurement , retinal ganglion cell ( rgc ) counting , and transmission electron microscopy ( tem ) . after 4 weeks , the rabbits were sacrificed and the retina was collected . with 1% toluidine blue stained retina 10~15 min , which was observed under optical microscope . the retina was divided into four quadrants , namely , the supratemporal , the infratemporal , the superior nasal , and the inferior nasal quadrants . each quadrant was also divided into three parts , namely , the central , the middle , and the surrounding area . in each partition the comparison of iop was conducted by t - test , comparison of latency , amplitude of p100 , and retinal thickness and rgc counting was conducted by one - way anova , using spss16.0 software . the value of p < 0.05 was considered as statistical significance . iop of group b at 1 , 2 , and 4 weeks was significantly higher than that of group a ( table 1 ) . compared to group b , the f - vep showed a statistically significant decrease in latency and increase in amplitude of p100 in groups c and d , and in group e there was more significant difference ( p < 0.05 ) ( table 2 ) . group a. each layer of retina was clear and arranged orderly . from top to bottom it was as follows : retinal ganglion cell layer , inner plexiform layer , inner nuclear layer , the outer plexiform layer , outer nuclear layer , photoreceptor cell layer , and retinal pigment epithelium . retinal ganglion cells presented single permutation with large , round , or oval nucleus but without vacuolar degeneration . inner plexiform layer was thick with net - like structure ( muller cells inside ) . groups c and d. in these two groups , we observed similar manifestation in cellular morphology . each layer of retina was distinct and arranged orderly , relatively . number of retinal ganglion cells was higher than that in group b. sporadic vacuolar degeneration could still be seen in retinal ganglion cells . in inner and outer nuclear layer , nuclei were less dyeing , loosely arranged . number of retinal ganglion cells was higher than that in groups c and d. few vacuolar degeneration could be seen in retinal ganglion cells . the thickness of inner plexiform layer and outer plexiform layer was nearly in normal range . in inner and outer nuclear layer , nuclei were less dyeing , loosely arranged . compared to groups c and d , group e had significantly thicker retina and higher retinal rgcs counts ( p < 0.05 ) ( table 3 ) . group a. structure of photoreceptor cells was clear ; rod and cone cells were arranged in alignment . inside they were full of organelles as mitochondria , rough endoplasmic reticulum , golgi apparatus , and so forth . group b. part of photoreceptor cells was rupture , with tumid and vacuolar degenerative mitochondria . organelles such as mitochondria , rough endoplasmic reticulum , or golgi apparatus almost disappeared . groups c and d. similar manifestation in cellular morphology was also observed in groups c and d. arrangement of photoreceptor cells was mildly disordered . organelles such as mitochondria , rough endoplasmic reticulum , or golgi apparatus could be seen with mild degeneration . group e. structure of photoreceptor cells was distinct ; rod and cone cells arranged in alignment , without obvious degeneration . inside there were clear organelles as mitochondria , rough endoplasmic reticulum , golgi apparatus , and so forth . , microtubules , microfilaments , and organelles such as mitochondria could be seen explicitly . groups c and d. part of myelin sheath was attenuation . in the axoplasm , microtubules and microfilaments became mildly swallowing . in the axoplasm , microtubules , microfilaments , and organelles such as mitochondria could be seen without degeneration . microbubble as new drug carriers can produce a variety of biological effects after ultrasonic irradiation . its cavitation and sonoporation effect mean that it can generate reversible holes on cell membranes . therefore drugs can easily enter into cells so as to increase the permeability . the technique of ultrasound microbubbles is safe , controllable , nonimmunogenic , repeatable , and well targeted . . however , ultrasound microbubble can also generate certain harmful biological results , including fracture of tissue , bleeding , intravascular hemolysis , and even cell death , which relates to its cavitation effect . recognizing that a high ultrasonic energy or long irradiation time might cause tissue damage , we have optimized suitable ultrasound parameters for rabbits in pilot study , that is , the frequency of 1 mhz , intensity of 0.5 w / cm , and duration of 60 s . iop of carbomer group at 1 , 2 , and 4 weeks was significantly higher than that of normal group . visual evoked potential ( vep ) is a sensitive method for evaluating nerve damage , primarily reflecting lesions between retina and visual cortex . the latency and amplitude of flash visual evoked potential ( f - vep ) mainly reflect the function of optic nerve myelin and axons . our results showed that , due to intraocular hypertension , there was an increase in latency and decrease in amplitude of p100 , meaning an impairment of signal transduction . there was no significant difference in latency and amplitude of p100 between mngf+ultrasonic irradiation group and mngf group ( p > 0.05 ) , which indicates that ultrasonic irradiation alone does not enhance effect of mngf . compared to mngf treatment only , a more significant decrease in latency and increase in amplitude of p100 were seen in mngf+ultrasound microbubbles group . it proved the importance of cavitation effect made by microbubbles . in the test of retinal thickness and rgcs counting , compared to mngf treatment only , the treatment with addition of ultrasound microbubbles gave rise to less retina damage . light microscope observation showed that intraocular hypertension could lead to disordered phenomenon and cellular vacuolar degeneration of retina . electron microscope observation provided us with a more visual result ; it revealed that intraocular hypertension could lead to various degrees of cell edema , rgcs loss , optic nerve myelin sheath damage , and decreases in mitochondria , microtubules , and microfilaments . with treatment of mngf , there was less tissue damage . adding ultrasound irradiation can not increase the protective effect , but , adding microbubbles , ultrasound microbubbles have achieved great progress in the experimental study of genes or drugs carriers [ 1620 ] . li et al . investigated the expression levels of green fluorescence protein ( gfp ) into retinal ganglion cells ( rgcs ) in vitro by ultrasound - mediated microbubble destruction ( ummd ) and assess the effect of bcl - xl gene on n - methyl - d - aspartate- ( nmda- ) induced apoptosis in the cultured rgcs by ummd . their results showed that ultrasound combined with microbubbles enhanced gene transfection to the cultured cells in some conditions . the expression of bcl - xl protein in transfected and nontransfected rgcs was significantly different . reported that ummd can effectively and safely enhance recombinant adenoassociated virus delivery to rgcs in rats , and it may serve as a novel gene delivery method in gene therapy for glaucomatous optic neuroprotection . investigated the protective effect of ultrasound microbubbles mediated transfection of brain - derived neurotrophic factor ( bdnf ) into the retina and visual cortex on rgcs after optic nerve injury in rats . they found that survival rate of rgcs was higher in the study group that underwent ultrasound microbubble - mediated transfection of bdnf . liu et al . investigated the effects of ciliary neurotrophic factor ( cntf ) gene mediated by ultrasound microbubbles intraocular transfer on visual function and rgcs after optic nerve injury . their results showed that the latency of p1 was significantly shorter in the ultrasound microbubble group compared with the plasmid group and plasmid combined with ultrasound group ; and the amplitude of p1 was significantly increased in the ultrasound microbubbles group . they also found that the average counts of rgcs and the expression level of cntf mrna were significantly higher in the ultrasound microbubble group than in the plasmid group and plasmid combined with ultrasound group . their findings indicated that ultrasound microbubbles can enhance the transfection and expression of the cntf gene in the eye , protect against early damage of rgcs in rats , and effectively promote the recovery of visual function . yang et al . evaluated the protection effects of ultrasonic microbubbles combined with memantine on rat rgcs after optic nerve injury and found that the rgc count was significantly higher in the group treated with ultrasound microbubbles combined with intravitreal injection of memantine , indicating that the protective effect of ultrasound microbubbles combined with memantine was greater compared to intravitreal injection of memantine alone . in conclusion , mngf can decrease optic nerve damage due to intraocular hypertension . combined usage of microbubble with ultrasound irradiation can strengthen its protective effect .

ultrasound microbubble combined optic protection drugs have obvious protective effect on optic nerve damage . this way of targeting drug delivery is becoming more simple , not through the whole body metabolism , avoiding drug via blood circulation when facing the decomposition and the environment in the interference and destruction process of drugs , to maximize the guarantee to reach target organs of drug concentration and to reache the maximum therapeutic effect . the technique of ultrasound microbubbles is safe , controllable , nonimmunogenic , and repeatable . it provides us with a novel idea in the administration of neuroprotective drugs .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

the precise identification of some fungal species is often very difficult when using only biochemical or phenotypic methods ( dooley et al . , 1994 ; fenn et al . , 1994 however , the advent of dna - based methods largely overcame the limitations of traditional methods and studies using molecular approaches revealed a greater diversity in fungi ( odds et al . , 1998 ; chen et al . , 2000 ) . some closely related species are often misidentified because of the great similarity in their biochemical and morphological characteristics . ( 2008 ) reported the misidentification of pichia guilliermondii ( teleomorph candida guilliermondii ) , debaryomyces hansenii ( teleomorph candida famata ) and candida palmioleophila . their results showed that only 23 of 36 isolates identified as p. guilliermondii and three of 26 identified as d. hansenii were confirmed by sequencing the its1 - 5.8s - its2 and d1/d2 regions of the ribosomal cistron . 2001 ) and candida parapsilosis ( lasker et al . , 2006 ) show the same problem . in our laboratory , we have had problems differentiating ( 1 ) p. guilliermondii , c. palmioleophila and d. hansenii , ( 2 ) candida krusei and candida inconspicua , and ( 3 ) candida pelliculosa and candida subpelliculosa when using the commercial kit api 20 c aux ( biomrieux , france ) ( table s1 ) . the vitek yeast biochemical card and the i d 32c , two widely used methods for yeast identification , were tested by different groups ( dooley et al . , 1994 ; lo et al . , 2001 ; burton et al . , 2010 ) and their findings confirmed the problem of incorrect or inconsistent identification . lo et al . ( 2001 ) suggested that the laboratory routine should include at least two methods for yeast identification . misidentification of the fungal species can compromise epidemiological or antibiotic susceptibility studies and over- or underestimate the species abundance . precise identification is therefore necessary and molecular approaches can provide the tools for a fast method . in this study , we developed a real - time pcr method that can differentiate / identify p. guilliermondii , d. hansenii and c. palmioleophila , and sequencing the its 1 region of these species confirmed our results . dna was quantified with a qubit fluorometer and a quant - it picogreen dsdna br assay kit ( invitrogen , life technologies , eugene , or , usa ) according to the manufacturers recommendations . a go taq flexi dna polymerase kit ( promega , madison , wi , usa ) was used to amplify the its 1 region with its1/its2 primers ( white and lee , 1990 ) and a topota cloning kit ( invitrogen ) was used for the constructions . the sequences were obtained using a big dye terminator v3.1 cycle sequencing kit followed by automatic sequencing in an abi 3100 ( applied biosystems , life technologies , foster city , ca , usa ) . the sequences obtained from the three american tissue culture collection ( atcc ) species , d. hansenii atcc 36239 , c. famata atcc 62894 and p. guilliermondii atcc 6260 , were compared by the blastn program ( zhang et al . , 2000 ) against the genbank non - redundant database ( nr ) , embl , ddbj and pdb nucleotide collections . the sequences obtained were aligned with clustalw software ( larkin et al . , 2007 ) and then used to create a consensus sequence for each species and to choose target regions ( data not shown ) . the primers and taqman minor groove binder ( mgb ) probes were designed using the software primer express v. 2.0 and default parameters ( applied biosystems ) . a real - time pcr was done using the taqman universal pcr master mix ( applied biosystems ) in the following singleplex reaction mixture : 10 ng of sample dna , 1x taqman universal pcr master mix , 200 nm of each primer , 300 nm of taqman mgb probe ( table 1 ) and water to a total volume of 25 l . the cycling conditions were set in an abi 7300 real - time pcr cycler fitted with sds software v. 1.2.3 ( applied biosystems ) as follows : 10 min at 95 c followed by 35 cycles of 95 c for 30 s and 60 c for 1 min . the efficiency of multiplex reactions was tested by mixing all of the probes together in the same concentrations as shown above . the sequences obtained from the atcc strains ( data not shown ) were matched in a search against the ( nr ) nucleotide bank using the blast program ( the alignment files are provided in supplementary material figure s2 ) in order to choose the potential target region for genotyping by real - time pcr ( figure 1 ) . comparison of the two methods of identification ( api 20c aux and ribotyping by sequencing ) revealed the difficulty in differentiating p. guilliermondii and d. hansenii , in the correct identification of c. parapsilosis versus d. hansenii ( burton et al . , 2010 and table s1 ) and the impossibility of differentiating c. krusei and c. insconspicua . initially , three polymorphic domains ( its 1 , its 2 and d1/d2 ) of the ribosomal cistron from these species were aligned using clustalw ( larkin et al . , 2007 ) . of these three regions , only the its 1 region provided suitable discrimination ( figure 1 ) . this region is ideal because it is flanked by two conserved domains : the end of 18s rrna and the beginning of 5.8s rrna . the amplicon is short ( about 300 bp ) and the sequence is variable among different species but conserved among strains of the same species . figure 2 shows the amplification plot of the real - time pcr genotyping done using species - specific probes . the region indicated as ntc ( no template control ) confirmed the specificity of each probe since only in the presence of the specific target was there amplification . to confirm this finding , we analyzed the real - time pcr products in a 2% agarose gel stained with ethidium bromide and detected the expected amplicons ( data not shown ) . the multiplex reaction worked as well as the singleplex test ( figure s1 ) and can be used for fungus identification , thereby reducing the costs of the assay . the close relationship between c. palmioleophila and d. hansenii has previously been shown by a phylogenetic analysis using data from the d1/d2 and its regions ( desnos - ollivier et al . , 2008 ) . in our study , the strain c. famata atcc 62894 , used as a positive control , was identified as c. palmioleophila by sequence analysis of the d1/d2 region of rrna ( table s1 ) and by the real - time pcr assay described here ( figure 2 ) . in conclusion , ribosomal rna sequencing is the gold standard for identification but is generally expensive and time consuming . the real - time pcr assay described here is a very effective , rapid , low - cost alternative . the method can unambiguously identify isolates and confirm the identification of strains analyzed by traditional methods , with the advantage of measuring species abundance if necessary . the following online material is available for this article : comparison of results obtained dna sequencing .

traditional phenotypic methods and commercial kits based on carbohydrate assimilation patterns are unable to consistently distinguish among isolates of pichia guilliermondii , debaryomyces hansenii and candida palmioleophila . as result , these species are often misidentified . in this work , we established a reliable method for the identification / differentiation of these species . our assay was validated by dna sequencing of the polymorphic region used in a real - time pcr assay driven by species - specific probes targeted to the fungal its 1 region . this assay provides a new tool for pathogen identification and for epidemiological , drug resistance and virulence studies of these organisms .

Introduction Materials and Methods Results and Discussion Supplementary Material

cloning of a codon - optimized variant of the homo sapiens traak gene ( uniprot q9nyg8 - 2 ) and heterologous expression in pichia pastoris was previously described . the construct used in this study is c - terminally truncated by an additional ten amino acids compared to our previous reports and similarly incorporates two mutations to remove n - linked glycosylation sites ( n104q / n108q ) and is expressed as a c - terminal precission protease - cleavable egfp-10xhis fusion protein . traak1290(n104q , n108q)-sns - levlfq / gp - egfp - h10 is referred to as traak in the text for simplicity . frozen pichia cells expressing traak were disrupted by milling ( retsch model mm301 ) 5 times for 3 minutes at 25 hz . all subsequent purification steps were carried out at 4 c. for crystallization in k , cell powder was added to lysis buffer ( 50 mm tris ph 8.0 , 150 mm kcl , 60 mm decyl--d - maltoside ( dm , affymetrix ) , 0.1 mg / ml dnase 1 , 1 g / ml pepstatin , 1 g / ml leupeptin , 1 g / ml aprotinin , 10 g / ml soy trypsin inhibitor , 1 mm benzamidine , and 1 mm phenylmethysulfonyl fluoride added immediately before use ) at a ratio of 1 g cell pellet/4 ml lysis buffer . membranes were extracted for 3 hours with stirring followed by centrifugation at 35000g for 45 minutes . cobalt resin ( clontech ) was added to the supernatant ( 1 ml resin/5 g cell pellet ) and stirred gently for 3 hours . resin was collected on a column and serially washed and eluted in buffer ( 50 mm tris ph 8.0 , 150 mm kcl , 6 mm dm ) with 10 mm , 30 mm , and 300 mm imidazole ph 8.0 . edta ph 8.0 ( 1 mm final ) and prescission protease ( ~1:50 wt : wt ) were added to the elution before incubation with gentle rocking overnight . cleaved protein was concentrated ( 50 kda mwco ) and applied to a superdex 200 column ( ge healthcare ) equilibrated in sec buffer ( 20 mm tris ph 8.0 , 150 mm kcl , 1 mm edta , 4 mm n - decyl--d - maltopyranoside ( dm ) ) . fab was prepared from monoclonal antibody 13e9 against traak as described and buffer exchanged on a hitrap desalting column ( ge healthcare ) into 20 mm tris 150 mm kcl ph 8.0 for crystallization in kcl or 20 mm tris 150 mm kno3 ph 8.0 for crystallization in tlno3 . traak - fab complexes were prepared by incubating purified channel concentrated ( 50 kda mwco ) to ~10 mg / ml with purified fab concentrated ( 10 kda mwco ) to ~30 mg / ml at a 1:2.5 molar ratio in sec buffer for 10 min at 4c . traak - fab complex was separated from excess free fab on a superdex 200 column ( ge healthcare ) equilibrated in sec buffer . traak - fab complexes were concentrated ( 10 kda mwco ) to 30 mg / ml for crystallization . for crystallization in tl , traak - fab complexes were purified identically except that 150 mm kno3 replaced the 150 mm kcl in all buffers except for the final sec buffer in which 150 mm tlno3 replaced the 150 mm kcl . crystals were grown in drops of 0.250.35 l protein added to an equal volume of reservoir in hanging drops over 100 l reservoir at 4c . reservoir for the nonconductive conformation in k was 50 mm tris ph 8.8 , 200 mm cacl2 , 2730% ( vol / vol ) peg400 . reservoir for the nonconductive conformation in tl was 50 mm tris ph 8.8 , 200 mm ca(no3)2 , 2730% ( vol / vol ) peg400 . reservoir for the conductive conformation in k was 50 mm tris ph 8.8 , 200 mm cacl2 , 2730% ( vol / vol ) peg400 , 4% ( vol / vol ) polypropylene glycol 400 . reservoir for the conductive conformation in tl was 50 mm tris ph 8.8 , 200 mm ca(no3)2 , 2730% ( vol / vol ) peg400 , 52 mm trichloroethanol . crystals grew to ~ 100 m 100 m 200 m in 46 weeks . for cryoprotection , an approximately equal volume of mother liquor supplemented to be 30% ( vol / vol ) peg 400 was added to one side of the drop and crystals were moved through this solution with a cryoloop before being plunged into liquid nitrogen . thallium - containing crystals were collected at the energy giving a maximum imaginary scattering component f determined by a fluorescent scan . data were processed with hkl2000 and structures were solved by molecular replacement with phaser using the previously solved traak - fab structure with ligands , tm2-tm3 and tm4 regions removed as the search model . consistent with recent analysis , incorporation of weak data at high resolution ( to cc1/2=3560% ) improved map quality . two - fold local ncs and jelly body restraints were used throughout refinement and three tls groups per protein chain were incorporated during the final rounds of refinement . 1350 of 1454 total amino acids ( 93% ) are modeled in the structures : the termini ( amino acids 126 and 285290 plus a nine amino acid linker ) and a loop connecting the helical cap to pore helix 1 ( amino acids a104-a109 and b106-b109 ) in each traak protomer and a loop in each fab heavy chain ( amino acids 130135 ) were not visible in the electron density . in the nonconductive structure in tl , residues 275284 from traak subunit the positions of seven tl ions in the nonconductive conformation ( two bound to the extracellular surface of traak , one above the cytoplasmic mouth of the filter , and four in the selectivity filter ) and eight tl ions in the conductive conformation ( with an additional tl in the cavity ) were identified in model phased anomalous difference fourier maps as the highest peaks above background . the presence of an acyl chain in the channel cavity was evaluated based on the shape of the electron density ( in omit maps ) and statistics after crystallographic refinement . the mean b - factor and real space correlation coefficient of the acyl chain ( 101 / 0.76 in the k structure and 132 / 0.74 in the tl structure ) are comparable to the values of nearby residues in tm2 and tm4 that project into the cavity ( amino acids 154,155,158,161,269,272,273 , and 276 have an average b - factor / real space correlation coefficient of 125 / 0.78 in the k structure and 142 / 0.83 in the tl structure ) . phases for omit maps were calculated from a ligand - free model with every atom randomly shifted by a maximum of 0.5 prior to 20 cycles of refinement in refmac to remove model bias . omit density in these maps was essentially indistinguishable from maps generated with nave models that never had ligands modeled or simulated annealing omit maps calculated with phenix . structures were compared after alignment of pore helices and selectivity filters ( 119133 and 228242 from chain a and b ) using lsqkab in ccp4 . the area calculation used a surface calculated with 1.4 added to van der waals radii of protein atoms and a probe radius of 3.5 to approximate the lipid accessible surface area . a water cylinder with a 6 radius was used to fill the cavity of the traak channels to exclude its contribution from the calculation . 3 and 4 were made with symmetric traak channels ( i.e. both subunits had the same conformation ) generated by rotation of a copy of one subunit onto the other . structure figures were made with pymol ( version 1.7.2 schrdinger , llc ) or the ucsf chimera package . chimera is developed by the resource for biocomputing , visualization , and informatics at the university of california , san francisco ( supported by nigms p41-gm103311 ) . for cellular recording , cho - k1 cells ( atcc ) ( which do not express endogenous mechanosensitive channels ) were cultured in dmem - f12 ( gibco ) with 10% fbs , 0.2 mm l - alanyl - l - glutamine ( glutamax , gibco ) , 100 u / ml penicillin , and 100 ug / ml streptomycin . cells were plated in 35 mm polystyrene dishes ( bd biosciences ) or on polyester thermanox coverslips ( thermo scientific ) ~24 hrs before transfection with fugenehd ( promega ) following manufacturers protocol . after 48 hrs , dishes or coverslips dna encoding amino acids 1290 of homo sapiens traak was cloned into a pir es2-acgfp vector ( clontech ) to generate untagged traak1290 used in experiments shown in fig . dna encoding amino acids 1300 of homo sapiens traak was cloned into the ecor1/xho1 sites of a modified pceh vector to generate a c - terminally egfp tagged construct ( traak1300 - snsavdaglvprgsaaa - egfp - h10 ) . this construct and mutants generated with inverse pcr were used in experiments presented in fig . reconstitution of traak1290(n104q , n108q)-sns - levlfq / gp - egfp - h10 and recording from proteoliposome blisters was performed as described for traak1300(n104q , n108q)-sns - levlfq / gp - egfp - h10 . azolectin ( egg l--phosphatidylcholine , 840051 ) and dphpc ( 1,2-diphytanoyl - sn - glycero-3-phosphocholine , 850356 ) lipids were from avanti polar lipids , inc . pipettes were pulled from borosilicate glass ( sutter instruments bf150 - 86 - 10 ) to 34 m resistance . recordings were made with an axopatch 200b amplifier ( molecular devices ) , filtered at 1 khz and digitized at 10100 khz ( digidata 1440a , molecular devices ) . pressure application through the patch pipette was accomplished with a high - speed pressure clamp ( hspc , ala scientific ) controlled through the clampex software . all recordings were performed in a ten - fold concentration gradient of k. for cellular recordings , pipette solution was 10 mm hepes , 150 mm kcl , 3 mm mgcl2 , 5 mm egta , ph 7.2 ( adjusted with koh ) and bath solution was 10 mm hepes , 15 mm kcl , 135 mm nacl , 3 mm mgcl2 , 1 mm cacl2 , ph 7.3 ( adjusted with naoh ) . for experiments in fig . 2 and extended data fig . 3 , reducing bath solution additionally contained 10 mm dtt added from a freshly thawed 1 m stock of dtt in water . reducing solution pipette solution was 5 mm hepes , 180 mm nacl , 20 mm kcl , ph 7.2 ( adjusted with naoh ) and bath solution was 5 mm hepes , 200 mm kcl , 40 mm mgcl2 , ph 7.2 ( adjusted with koh ) . perfusion was accomplished with a nitrogen pressurized micro - perfusion system ( vc-8xp , ala scientific ) . all recordings in the manuscript are presented such that positive currents indicate k flux from the high [ k ] to low [ k ] side . cloning of a codon - optimized variant of the homo sapiens traak gene ( uniprot q9nyg8 - 2 ) and heterologous expression in pichia pastoris was previously described . the construct used in this study is c - terminally truncated by an additional ten amino acids compared to our previous reports and similarly incorporates two mutations to remove n - linked glycosylation sites ( n104q / n108q ) and is expressed as a c - terminal precission protease - cleavable egfp-10xhis fusion protein . traak1290(n104q , n108q)-sns - levlfq / gp - egfp - h10 is referred to as traak in the text for simplicity . frozen pichia cells expressing traak were disrupted by milling ( retsch model mm301 ) 5 times for 3 minutes at 25 hz . all subsequent purification steps were carried out at 4 c. for crystallization in k , cell powder was added to lysis buffer ( 50 mm tris ph 8.0 , 150 mm kcl , 60 mm decyl--d - maltoside ( dm , affymetrix ) , 0.1 mg / ml dnase 1 , 1 g / ml pepstatin , 1 g / ml leupeptin , 1 g / ml aprotinin , 10 g / ml soy trypsin inhibitor , 1 mm benzamidine , and 1 mm phenylmethysulfonyl fluoride added immediately before use ) at a ratio of 1 g cell pellet/4 ml lysis buffer . membranes were extracted for 3 hours with stirring followed by centrifugation at 35000g for 45 minutes . cobalt resin ( clontech ) was added to the supernatant ( 1 ml resin/5 g cell pellet ) and stirred gently for 3 hours . resin was collected on a column and serially washed and eluted in buffer ( 50 mm tris ph 8.0 , 150 mm kcl , 6 mm dm ) with 10 mm , 30 mm , and 300 mm imidazole ph 8.0 . edta ph 8.0 ( 1 mm final ) and prescission protease ( ~1:50 wt : wt ) were added to the elution before incubation with gentle rocking overnight . cleaved protein was concentrated ( 50 kda mwco ) and applied to a superdex 200 column ( ge healthcare ) equilibrated in sec buffer ( 20 mm tris ph 8.0 , 150 mm kcl , 1 mm edta , 4 mm n - decyl--d - maltopyranoside ( dm ) ) . fab was prepared from monoclonal antibody 13e9 against traak as described and buffer exchanged on a hitrap desalting column ( ge healthcare ) into 20 mm tris 150 mm kcl ph 8.0 for crystallization in kcl or 20 mm tris 150 mm kno3 ph 8.0 for crystallization in tlno3 . traak - fab complexes were prepared by incubating purified channel concentrated ( 50 kda mwco ) to ~10 mg / ml with purified fab concentrated ( 10 kda mwco ) to ~30 mg / ml at a 1:2.5 molar ratio in sec buffer for 10 min at 4c . traak - fab complex was separated from excess free fab on a superdex 200 column ( ge healthcare ) equilibrated in sec buffer . traak - fab complexes were concentrated ( 10 kda mwco ) to 30 mg / ml for crystallization . for crystallization in tl , traak - fab complexes were purified identically except that 150 mm kno3 replaced the 150 mm kcl in all buffers except for the final sec buffer in which 150 mm tlno3 replaced the 150 mm kcl . crystals were grown in drops of 0.250.35 l protein added to an equal volume of reservoir in hanging drops over 100 l reservoir at 4c . reservoir for the nonconductive conformation in k was 50 mm tris ph 8.8 , 200 mm cacl2 , 2730% ( vol / vol ) peg400 . reservoir for the nonconductive conformation in tl was 50 mm tris ph 8.8 , 200 mm ca(no3)2 , 2730% ( vol / vol ) peg400 . reservoir for the conductive conformation in k was 50 mm tris ph 8.8 , 200 mm cacl2 , 2730% ( vol / vol ) peg400 , 4% ( vol / vol ) polypropylene glycol 400 . reservoir for the conductive conformation in tl was 50 mm tris ph 8.8 , 200 mm ca(no3)2 , 2730% ( vol / vol ) peg400 , 52 mm trichloroethanol . crystals grew to ~ 100 m 100 m 200 m in 46 weeks . for cryoprotection , an approximately equal volume of mother liquor supplemented to be 30% ( vol / vol ) peg 400 was added to one side of the drop and crystals were moved through this solution with a cryoloop before being plunged into liquid nitrogen . thallium - containing crystals were collected at the energy giving a maximum imaginary scattering component f determined by a fluorescent scan . data were processed with hkl2000 and structures were solved by molecular replacement with phaser using the previously solved traak - fab structure with ligands , tm2-tm3 and tm4 regions removed as the search model . consistent with recent analysis , incorporation of weak data at high resolution ( to cc1/2=3560% ) improved map quality . two - fold local ncs and jelly body restraints were used throughout refinement and three tls groups per protein chain were incorporated during the final rounds of refinement . 1350 of 1454 total amino acids ( 93% ) are modeled in the structures : the termini ( amino acids 126 and 285290 plus a nine amino acid linker ) and a loop connecting the helical cap to pore helix 1 ( amino acids a104-a109 and b106-b109 ) in each traak protomer and a loop in each fab heavy chain ( amino acids 130135 ) were not visible in the electron density . in the nonconductive structure in tl , residues 275284 from traak subunit b were additionally not modeled . the positions of seven tl ions in the nonconductive conformation ( two bound to the extracellular surface of traak , one above the cytoplasmic mouth of the filter , and four in the selectivity filter ) and eight tl ions in the conductive conformation ( with an additional tl in the cavity ) were identified in model phased anomalous difference fourier maps as the highest peaks above background . the presence of an acyl chain in the channel cavity was evaluated based on the shape of the electron density ( in omit maps ) and statistics after crystallographic refinement . the mean b - factor and real space correlation coefficient of the acyl chain ( 101 / 0.76 in the k structure and 132 / 0.74 in the tl structure ) are comparable to the values of nearby residues in tm2 and tm4 that project into the cavity ( amino acids 154,155,158,161,269,272,273 , and 276 have an average b - factor / real space correlation coefficient of 125 / 0.78 in the k structure and 142 / 0.83 in the tl structure ) . phases for omit maps were calculated from a ligand - free model with every atom randomly shifted by a maximum of 0.5 prior to 20 cycles of refinement in refmac to remove model bias . omit density in these maps was essentially indistinguishable from maps generated with nave models that never had ligands modeled or simulated annealing omit maps calculated with phenix . structures were compared after alignment of pore helices and selectivity filters ( 119133 and 228242 from chain a and b ) using lsqkab in ccp4 . the area calculation used a surface calculated with 1.4 added to van der waals radii of protein atoms and a probe radius of 3.5 to approximate the lipid accessible surface area . a water cylinder with a 6 radius was used to fill the cavity of the traak channels to exclude its contribution from the calculation . all area calculations and structures in figs . 3 and 4 were made with symmetric traak channels ( i.e. both subunits had the same conformation ) generated by rotation of a copy of one subunit onto the other . structure figures were made with pymol ( version 1.7.2 schrdinger , llc ) or the ucsf chimera package . chimera is developed by the resource for biocomputing , visualization , and informatics at the university of california , san francisco ( supported by nigms p41-gm103311 ) . for cellular recording , cho - k1 cells ( atcc ) ( which do not express endogenous mechanosensitive channels ) were cultured in dmem - f12 ( gibco ) with 10% fbs , 0.2 mm l - alanyl - l - glutamine ( glutamax , gibco ) , 100 u / ml penicillin , and 100 ug / ml streptomycin . cells were plated in 35 mm polystyrene dishes ( bd biosciences ) or on polyester thermanox coverslips ( thermo scientific ) ~24 hrs before transfection with fugenehd ( promega ) following manufacturers protocol . after 48 hrs , dishes or coverslips dna encoding amino acids 1290 of homo sapiens traak was cloned into a pir es2-acgfp vector ( clontech ) to generate untagged traak1290 used in experiments shown in fig . dna encoding amino acids 1300 of homo sapiens traak was cloned into the ecor1/xho1 sites of a modified pceh vector to generate a c - terminally egfp tagged construct ( traak1300 - snsavdaglvprgsaaa - egfp - h10 ) . this construct and mutants generated with inverse pcr were used in experiments presented in fig . reconstitution of traak1290(n104q , n108q)-sns - levlfq / gp - egfp - h10 and recording from proteoliposome blisters was performed as described for traak1300(n104q , n108q)-sns - levlfq / gp - egfp - h10 . azolectin ( egg l--phosphatidylcholine , 840051 ) and dphpc ( 1,2-diphytanoyl - sn - glycero-3-phosphocholine , 850356 ) lipids were from avanti polar lipids , inc . pipettes were pulled from borosilicate glass ( sutter instruments bf150 - 86 - 10 ) to 34 m resistance . recordings were made with an axopatch 200b amplifier ( molecular devices ) , filtered at 1 khz and digitized at 10100 khz ( digidata 1440a , molecular devices ) . pressure application through the patch pipette was accomplished with a high - speed pressure clamp ( hspc , ala scientific ) controlled through the clampex software . pressure application velocity was set to the maximum rate of 8.3 mmhg / msec . all recordings were performed in a ten - fold concentration gradient of k. for cellular recordings , pipette solution was 10 mm hepes , 150 mm kcl , 3 mm mgcl2 , 5 mm egta , ph 7.2 ( adjusted with koh ) and bath solution was 10 mm hepes , 15 mm kcl , 135 mm nacl , 3 mm mgcl2 , 1 mm cacl2 , ph 7.3 ( adjusted with naoh ) . for experiments in fig . 2 and extended data fig . 3 , reducing bath solution additionally contained 10 mm dtt added from a freshly thawed 1 m stock of dtt in water . reducing solution pipette solution was 5 mm hepes , 180 mm nacl , 20 mm kcl , ph 7.2 ( adjusted with naoh ) and bath solution was 5 mm hepes , 200 mm kcl , 40 mm mgcl2 , ph 7.2 ( adjusted with koh ) . perfusion was accomplished with a nitrogen pressurized micro - perfusion system ( vc-8xp , ala scientific ) . all recordings in the manuscript are presented such that positive currents indicate k flux from the high [ k ] to low [ k ] side . ( a , b ) view from the membrane plane of the traak central cavity in the ( a ) nonconductive and ( b ) conductive conformations . the exposed surface of hydrophobic amino acids are colored white , arginine and lysine are blue , glutamate and aspartate are red , and polar residues are green . the positions of k ions in the filter are outlined and residue t277 in tm4 is indicated with an asterisk . ( c ) diameter of the ion conduction pathway as a function of distance through the membrane for nonconductive traak ( red ) , conductive traak ( blue ) and twik1 ( gray , pdb:3ukm ) . the green box indicates the position of the selectivity filter and dashed gray lines are the approximate boundaries of the lipid membrane . the pore diameter is larger in traak than in twik1 and expands below t277 in the conductive conformation . ( a ) current recorded from traak proteoliposome patches as a function of holding voltage ( mean sem , n=9 patches each ) . current through traak reconstituted in phosphatidylcholine lipids with branched acyl chains ( 1,2-diphytanoyl - sn - glycero-3-phosphocholine , dphpc ) was significantly higher than in non - branched acyl chains ( egg l--phosphatidylcholine , pc ) at each voltage measured ( 5.0 fold higher at 0 mv , p < 0.0001 , student s t - test ) . ( b , c ) representative recording of pressure ( lower trace ) activation of traak current ( upper trace ) in ( b ) pc or ( c ) dphpc lipids . ( d ) quantification of pressure activation of traak in pc and dphpc ( mean fold pressure activation at 0 mv sem , n=9 patches each , * * * p < 0.0001 , student s t - test ) . in these experiments and those in fig . 2 , inside - out patches from cells expressing wild - type or mutant traak channels were excised and perfused with reducing bath solution ( with 10 mm dtt ) . after stabilization of the patch ( traak channels exhibit a gradual run - up of current following excision to an equilibrium value , e.g. extended data fig . 4 ) , the perfusion solution was switched to oxidizing bath solution ( no dtt ) . ( a , b ) representative voltage family from a i159c r284c traak patch during perfusion of ( a ) reducing and ( b ) oxidizing solution . the voltage family protocol is illustrated . ( c , d ) same as ( a , b ) but from a wild - type traak patch . ( e , f ) current response ( upper ) to pressure application ( lower ) at 0 mv from the same i159c r284c traak patch during perfusion of ( e ) reducing or ( f ) oxidizing bath solution . ( g , h ) same as ( e , f ) , but from a wild - type traak patch . ( a ) whole cell current from a traak - expressing cell during a voltage step protocol in a ten - fold gradient of [ k ] ( ek+ = 59 mv , holding voltage = 80 mv , v = 10 mv , indicated steps shown ) . ( c ) currents ( upper traces ) recorded from an outside - out patch excised from the same cell as in ( a , b ) . the voltage protocol in ( a ) was used with an additional pressure step ( lower trace ) during each voltage step . ( d ) current - voltage relationship from data in ( b ) ( mean current 5 min after patch excision before pressure ( red ) and peak current during pressure step ( gray ) ) and a recording immediately after pulling the patch ( red dashes ) . the excised patch contains < 1% of the whole cell membrane area , but gives ~25% of the whole cell current before and similar current during a pressure step . this is explained by very low basal activity of traak with near - zero membrane tension ( whole cell ) and channel activation by increasing membrane tension over a broad range ( intermediate tension in an excised patch to high tension in a pressurized patch ) . stereo view from the cytoplasm of an overlay of nonconductive ( red ) and conductive tm2-tm3 rotated ( blue ) conformations . amino acids that sterically prevent tm2-tm3 rotation when tm4 is down are shown as sticks . this rotation can only occur if tm4 is up because amino acids l172 , f201 and g205 on tm2-tm3 shift ( 0.75 2.1 ) to a position that would sterically clash with amino acids y271 and v275 on tm4 in a down conformation . translation of y271 and v275 3.14.1 in tm4 up conformations creates space for the tm2-tm3 rotation . data collection and refinement statistics data from 1 , 1 , 3 and 2 crystals were merged for the conductive k , conductive tl , nonconductive k and nonconductive tl structures , respectively . pairwise root mean square deviation ( ) between conformationally static regions between traak structures conformationally static regions of the traak channel in these structures include the entire a chain and residues 1155 of chain b. summary of traak channel conformations in crystal structures structures shown in figure 3 are highlighted with the color used in the figure .

summaryactivation of mechanosensitive ion channels by physical force underlies many physiological processes including the sensation of touch , hearing and pain15 . traak ion channels are neuronally expressed members of the two - pore domain k+ ( k2p ) channel family and are mechanosensitive6 . they are involved in controlling mechanical and temperature nociception in mice7 . mechanosensitivity of traak is mediated directly through the lipid bilayer : it is a membrane tension gated channel8 . however , the molecular mechanism of traak channel gating and mechanosensitivity is unknown . here we present crystal structures of traak in conductive and nonconductive conformations defined by the presence of permeant ions along the conduction pathway . in the nonconductive state , a lipid acyl chain accesses the channel cavity through a 5 - wide lateral opening in the membrane inner leaflet and physically blocks ion passage . in the conductive state , rotation of a transmembrane helix ( tm4 ) about a central hinge seals the intramembrane opening , preventing lipid block of the cavity and permitting ion entry . additional rotation of a membrane interacting tm2-tm3 segment , unique to mechanosensitive k2ps , against tm4 may further stabilize the conductive conformation . comparison of the structures reveals a biophysical explanation for traak mechanosensitivity : an expansion in cross sectional area up to 2.7 nm2 in the conductive state is expected to create a membrane tension - dependent energy difference between conformations that promotes force activation . our results show how tension of the lipid bilayer can be harnessed to control gating and mechanosensitivity of a eukaryotic ion channel .

Methods Protein expression and purification Crystallization, data collection, and structure determination Electrophysiology Extended Data

endocrine changes in the form of thyroid , adrenal , gonadal , bone , and metabolic dysfunction , have all been reported in both early and late stages of hiv infection . there may be primary endocrine dysfunction as a result of direct effect of hiv as well as secondary endocrine dysfunction due to indirect effects of cytokines , opportunistic infections and rarely infiltration by a neoplasm . these endocrinopathies can have significant clinical impact , affecting growth and development , preservation of muscle mass , sexual function , fat distribution and quality of life in hiv - infected patients . wide accessibility of highly active antiretroviral therapy ( haart ) gave rise to increase life expectancy and hence high incidence of endocrinopathies in hiv - infected patients in the last two decades . the paucity of data makes it difficult to make general recommendation about hormone replacement therapy in all hiv - infected patient with diminished circulating levels of a particular hormone to reduce morbidity and mortality in hiv - infected patients . to the best of our knowledge there were only few studies correlating endocrine dysfunction in hiv - infected patient with cd4 count , this pilot cross sectional study was undertaken to evaluate the frequency of thyroid , adrenal and gonadal dysfunction in newly diagnosed hiv - infected patients and to correlate them at different levels of cd4 cell counts . this observational cross - sectional study was conducted in department of general medicine and department of endocrinology , s.c.b . the study group included 43 newly diagnosed hiv - positive patients admitted in medicine ward of s.c.b . medical college , cuttack . patients with previous history of any endocrine disorders , taking drugs known to interfere with hormone metabolism or anti - retroviral therapy or hormone replacement therapy , having abnormal liver function or renal function tests , diabetics and alcoholics were excluded from the study group . hiv - positive patients were divided into three groups based on the cd4 cell counts . group a : cd4 count < 200/mm , group b : cd4 count 200 - 350/mm and group c : cd4 count > 350/mm . hiv - positive status was confirmed by a series of three elisa tests as per naco guidelines [ comb aids , retro check and micro elisa ] . cd4 cells count was done by the becton dickinson facs flow cytometer . for hormone assay blood serums free t3 , free t4 , tsh , 8 a.m serum cortisol , fsh , lh , testosterone , estradiol were estimated by the radioimmunoassay using pc - ria . normal reference range for the hormonal values was taken as cutoff from our laboratory reference range . definition : various diagnosis was made as , primary hypogonadism : low sex steroids with high gonadotrophin ; secondary hypogonadism : both sex steroids and gonadotrophin levels were low ; isolated low t3 : low t3 with normal t4 and tsh ; secondary hypothyroid : low t3 , low t4 , normal or low tsh ; subclinical hypothyroid : normal t3 and t4 with tsh between 5 and 10 iu / l ; adrenal insufficiency : 8 a.m serum cortisol less than the lower reference cutoff value ; adrenal excess : 8 a.m serum cortisol more than the lower reference cutoff value [ table 1 ] . in this study out of 43 patients male outnumbered female with 29 ( 67.4% ) and 14 ( 32.6% ) , respectively . the mean age and bmi ( body mass index ) of hiv - infected patients was 37.88 7.8 year 17.84 2.12 most of the patients ( 55.8% ) had cd4 cell count < 200/mm with mean cd4 count 201.5 159.9/mm . overall the prevalence of gonadal , thyroid and adrenal dysfunction were 88.3% , 60.4% and 27.9% , respectively . the prevalence of thyroid dysfunction among the hiv - infected patients in the decreasing order of frequency was isolated low free t3 ( 25.6% ) , secondary hypothyroidism ( 16.2% ) and subclinical hypothyroidism ( 11.6% ) with other thyroid dysfunction reported in our study was isolated high free t4 , overt hypothyroidism and subclinical hyperthyroidism each of them accounting 3.45% of case group . thyroid dysfunction was more common in males ( 65.5% ) than females ( 50% ) [ figure 1 ] . adrenal insufficiency was more common in females ( 21.45% ) than males ( 6.9% ) , whereas adrenal excess was more common in males ( 24.1% ) than females . the difference in hormonal dysfunction between male and female was statistically insignificant ( p > 0.05 ) . types of thyroid dysfunction in hiv - infected patients when compared between the hiv positive groups on the basis of cd4 count , male hypogonadism was 90% in group a , 83.3% in group b , 100% cases in group c and female hypogonadism was 100% in group a , 83.3% in group b , 75% in group c [ table 2 ] . the thyroid dysfunction was 66.7% in group a , 58.3% in group b and 42.9% in group c. isolated low free t3 ( low t3 syndrome ) was found in 37.5% in group a , 8.33% in group b , 14.3% in group c [ table 3 ] . adrenal insufficiency was 8.3% in group a , 16.7% in group b , 14.2% in group c and adrenal excess was 16.7% in group a , 25% in group b [ table 4 ] . test of strength of linear dependence between cd4 count and various hormone levels was done using pearson 's correlation coefficient . for all the hormone the coefficient of correlation(r ) was nearer to zero ( r= + 0.13 , 0.16 , 0.03 , 0.16 , 0.08 , 0.07 , + 0.21 , + 0.03 for free t3 , free t4 , tsh , cortisol , fsh , lh , testosterone and estradiol , respectively ) and p value for each hormone > 0.05 [ table 5 ] . this indicates that there was negligible or no correlation between cd4 count and serum hormone level . distribution of gonadal dysfunction among cd4 groups distribution of types of thyroid dysfunction among cd4 groups distribution of adrenal dysfunction among cd4 groups correlations of hormone level with cd4 count hiv infection and aids is a global pandemic , with cases reported from virtually every country . globally , an estimated 35.3 ( 32.238.8 ) million people were living with hiv in 2012 . according to the hiv estimations 2012 , the estimated number of people living with hiv / aids in india was 20.89 lakhs in 2011 . but still , india is estimated to have the third highest number of people living with hiv / aids , after south africa and nigeria . endocrine dysfunction is common in hiv - infected patients and in patients with aids and this dysfunction now came to attention because of the success of antiretroviral medication leads to patients lived longer . hypogonadism was the most common endocrine dysfunction found in our study followed by thyroid and adrenal dysfunction [ table 6 ] . this was similar to the study by katz et al . who reported that hypogonadism is probably the most common endocrinological abnormality in hiv - infected men . according to dobs et al . hypogonadism was found in 6% , 40% and 50% of asymptomatic hiv positive , symptomatic hiv positive and in aids patients , respectively . secondary hypogonadism was more common than primary hypogonadism in our study correlating with the finding of mandal sk et al . the cause of secondary hypogonadism was might be a decrease in gonadotropin secretion during acute or chronic severe illness and involvement of hypothalamic or pituitary tissue by opportunistic infections or malignancies in both sexes . primary gonadal failure may be due to opportunistic infections ( e.g. cytomegalo virus , mycobacterium avium complex , cryptococcus neoformans , etc ) infiltration by a neoplasm like kaposi 's sarcoma , il1 and tumor necrosis factor ( tnf ) that decrease leydig cell steroidogenesis . comparison of prevalence of endocrine dysfunction in previous studies isolated low free t3 was the most common thyroid dysfunction in our study found in both male and female cases . , madge et al . , and hoffman et al . who also observed that non - thyroidal illness was most common thyroid dysfunction in hiv - infected patients . low t 3 syndrome in severe illness may be due to release of cytokines such as il-6 , and impaired deiodination from t4 to t3 . secondary hypothyroidism in our study might be due to the stress of the illness as found in 6% of cases in ketsamathi et al . in the present study the prevalence of sub - clinical hypothyroidism was 11.6% and higher in female as compared to male patients . , 6.6% by beltran et al . , 6% by ketsamathi et al . , 4% by madge et al . , 10.6% by bongiovani et al . this was also similar to the observation made by other authors like 2.6% by beltran et al . , 1.5% by ketsamathi et al . , 2.5% by madge et al . , 10.66% by meena et al . , and 2% by jain et al . , and it may be due to increased risk of opportunistic infection which is an independent risk factor for decrease thyroid function . isolated high free t 4 levels were seen in 3.45% of cases in the present study . it was less than 1% in a study by madge et al . and ketsamathi reporting it to be at 0.5% . in our study 11.6% had adrenal insufficiency and 16.3% had adrenal excess . according to study by meena et al . , 2.66% had adrenal insufficiency and 26% had adrenal excess ; and by jain et al . the elevated cortisol level may be to the stress of hiv infection as well as associated opportunistic infection , which the patient was suffering from . adrenal insufficiency may be due to tuberculosis of adrenal gland which is very common in india . when compared between the hiv - positive groups on the basis of cd4 count , the thyroid dysfunction and hypogonadism were negatively correlated with cd4 count as found by meena et al . isolated low free t3 ( low t3 syndrome ) was profound in group a cd4 count group but adrenal insufficiency was noted more prevalent in group b cd4 count group . in this study by using pearson 's correlation coefficient we found negligible or no correlation between cd4 count and serum thyroid level which was similar to the findings of mandal et al . ( tsh , free t3 , and free t4 achieved a poor correlation when matched with cd4 counts ( r = 0.14 , 0.15 , 0.15 respectively ; p value in each case > 0.05 ) ) but contradicts jain et al . where they found a direct correlation between cd4 count and free t3 and free t4 values ( r = 0.357 with p < 0.05 ; r = 0.650 with p < 0.05 , respectively ) and there was an inverse correlation of cd4 counts with serum tsh levels ( r = 0.470 with p < 0.050 ) . in our study the correlation coefficient between serum cortisol and cd4 count was negligible as observed by mandal et al . and jain et al . in 2011 found a significant correlation coefficient between serum cortisol and cd4 count ( r = 0.301 with p < 0.0001 ) . in our study , there was negligible or no correlation of cd4 count with gonadotropin , serum testosterone and estradiol but according to mandal et al . the gonadotropin and total testosterone ere all found to be decreased proportionately with the cd4 count ( r = 0.43 ; p = 0.07 , r = 0.51 ; p = 0.32 r = 0.39 ; p = 0.03 , respectively ) . in our study dyanamic testing was not done to look for adrenal axis and less number of patients found to conclude for adrenal disorders . dyanamic testing was not done to look for adrenal axis and less number of patients found to conclude for adrenal disorders . low t3 syndrome ( isolated low free t3 ) was the most common thyroid dysfunction . there was no significant difference in endocrine dysfunction between hiv - infected males and females . however , it could be a chance finding due to small sample size , and endocrine dysfunctions and role of hormone replacement therapy in hiv - infected patient needs to be substantiated by a large longitudinal study , so that it will help to reduce morbidity and improve quality of life .

aims and objectives : to study the frequency of thyroid , adrenal and gonadal dysfunction in newly diagnosed hiv - infected patients and to correlate them at different levels of cd4 cell counts.materials and methods : forty - three hiv - positive cases were included in the study group . cases were divided into three groups on the basis of cd4 cell count . serum free t3 , free t4 , tsh , cortisol , fsh , lh , testosterone and estradiol were estimated by the radioimmunoassay method . hormone levels between cases were compared and their correlation with cd4 count was analyzed.results:prevalence of gonadal dysfunction ( 88.3% ) was the most common endocrine dysfunction followed by thyroid ( 60.4% ) and adrenal dysfunction ( 27.9% ) . secondary hypogonadism ( 68.4% ) was more common than primary ( 31.6% ) . low t3 syndrome , that is , isolated low free t3 , was the most common ( 25.6% ) thyroid dysfunction followed by secondary hypothyroidism ( 16.2% ) and subclinical hypothyroidism ( 11.6% ) . adrenal excess ( 16.3% ) was more common than adrenal insufficiency ( 11.6% ) . the difference in hormonal dysfunction between male and female was statistically insignificant ( p > 0.05 ) . 27.9% of patients had multiple hormone deficiency . there was negligible or no correlation between cd4 count and serum hormone level.conclusion:in our study , endocrine dysfunction was quite common among hiv - infected patients but there was no correlation between hormone levels and cd4 count . endocrine dysfunctions and role of hormone replacement therapy in hiv - infected patient needs to be substantiated by large longitudinal study , so that it will help to reduce morbidity , improve quality of life .

I M Statistical analysis R D Limitation C

chronic obstructive pulmonary disease ( copd ) is a major cause of chronic morbidity and mortality throughout world . it is the fourth leading cause of death in the world and further increases its prevalence and mortality can be predicted in the coming decades 1 , 2 . pulmonary hypertension ( ph ) is a common and well established complication of copd 3 . tobacco smoking ( ts ) is responsible for more than 80 % of the incidence of copd 6 . copd is also observed in rural areas of developing countries , affecting predominantly non - smoking women with exposure to biomass smoke ( bs ) during cooking . it is predicted that half of the world population and more than 90 % of the rural population in developing countries uses biological fuels 7 . approximately 3 billion people worldwide are exposed to smoke from biomass fuel compared with 1.01 billion people who smoke tobacco , suggesting that exposure to bs might be the most important global risk factor for copd . however , to date whether or not different between biomass exposed women and smoker men the prevalence of ph was not examined . therefore this study was designed to investigate the ph frequency of hospitalized copd patients with the pft parameters , demographic aspects , smoking status , and history of use of biomass . subjects were chosen from the patients hospitalized in the ward of the pulmonary department of university hospital . the department gives service to both economically deprived and developed population . a retrospective review was conducted on copd patients who had undergone echocardiographic investigation for evaluation of pulmonary hypertension between the years of 2000 and 2010 . the subjects consisted of females and males who required hospitalization in the department of pulmonary department due to copd during the period . patients with conditions including left heart failure , pulmonary embolus , lung cancer , sleep apnea , obesity ( bmi > 35 ) and exposed to both of tobacco and biomass smoke were excluded . cumulative exposure of biomass smoke was expressed as hour - years ( h - yr ) , the product of the number of years cooking with biomass fire multiplied by the average number of hours spent daily in the traditional underground oven . diagnosis of copd was performed by assessment of functional criteria of chronic and irreversible airflow obstruction ( forced expiratory volume in one second ( fev1)/(forced vital capacity ) < 70 % , fev1 < 80 % predicted ) and without asthma as assessed by clinical history and response to bronchodilators ( change , 12% in fev1 following 400 g of inhaled salbutamol ) . pulmonary function tests : post - bronchodilator spirometry was performed with a flow sensitive spirometer ( vitalograph , vitalograph alpha , maids moreton , buckingham , uk ) , which meets to the european respiratory society and american thoracic society standards . at least three reproducible maximal expiratory efforts starting from complete inspiration were obtained ; the best fev1 was used to calculate fev1 as percent predicted . fvc and fev1 were expressed as percentage of predicted ( fvc % , fev1 % ) . echocardiographic measurement : echocardiography was performed by the same cardiologist ( 7 years of experience ) using a vivid 3 instrument ( general electric , us ) and by utilizing a 2 mhz probe . the gradient between the right ventricular peak systolic pressure and right atrium pressure was measured by doppler echocardiography at rest in cases with tricuspid insufficiency . the modified bernoulli equation was used to calculate pulmonary artery pressure ( pap ) pressure : pap = 4 ( tricuspid systolic jet ) . the estimated systolic pap ( spap ) was obtained by adding the right atrium mean pressure . right atrial pressure is estimated to be 5 mm - hg when the diameter of inferior vena cava ( ivc ) is less than 1.7 cm and a 50 % decrease in the diameter with inspiration , 10 mm - hg when ivc is more than 1.7 cm and with normal inspiratory collapse ( 50 % ) , and 15 mm - hg when ivc is more than 1.7 cm and inspiratory collapse is less than 50 % 8 . when spap is more than 35 mm - hg , the presence of ph is established accordingly the newly recommendations of the working group on diagnosis and assessment of pulmonary arterial hypertension in the 4th world symposium on pulmonary hypertension 9 . statistical analysis : patients were compared according to exposure using a t test for independent groups for normally distributed variables or a mann - whitney test or chi - squared test ( for qualitative variables ) . the kolmogorov - smirnov test was used to assess normality . results are presented as mean standard deviation ( sd ) , and frequency expressed as a percent . a multiple logistic regression analysis was used to identify factors independently associated ph in copd . multiple logistic regressions were performed with the dependent variable of the presence versus the absence of ph and age , gender , paco2 , pao2 , fev1 % , fvc % independent variables . associations were expressed as odds ratios ( or ) with 95 % confidence intervals ( ci ) . to analyze whether risk factors for ph differ with copd severity multiple logistic regressions were performed for moderate , severe and very severe copd groups separately . initially , 694 patients were reviewed the retrospective data analysis by our service . of this number , 94 were excluded due to comorbidities such as obesity 14 , sleep apnea 10 , bronchiectasis 18 , left heart failure 15 tobacco and biomass smoke exposure 21 , and incomplete documentation 16 . the remaining 600 patients , all with copd with varying degrees of severity were accepted for our study and evaluated . patients were 336 ( 56 % ) males , and 264 ( 44 % ) females . the mean cumulative exposure was 233 101 h - yr for the biomass group and 51 32 pack - years for smokers . it was more prominent in moderate copd cases ( 56,2 % and 37,5 % , p < 0,002 ) ( figure 1 ) . however there was no difference between the frequency of ph in severe and in very severe copd cases . both groups had airflow limitation , hypercapnia and hypoxemia , but no differences were found in terms of paco2 and pao2 . however , fev1 % was lower in males than females ( p<0,005 ) . on the other hand , fvc % was significantly lower in the bs group compared with the ts group ( p < 0.02 ) . mean age of females was found to be higher than males ( 69 + 10 , 65 + 10 p=0,001 ) . males had higher levels of fvc % and fev1 % than females ( p=0 , 01 ) . females had more higher level of pao2 than males ( 42 + 11 , 45 + 7 p=0,01 ) . ph was more frequent in females than males ( 63,6% , 37,5% p=0,005 ) ( table 2 ) . females had higher levels of fvc % and fev1 % than males ( p = 0,000 , p=0,000 ) . the frequency of ph was not different between males and females ( table 3 ) . males had higher levels of fvc % and fev1 % than females ( p=0,004 , p=0,000 ) . the frequency of ph was not different between males and females ( table 4 ) . to analyze whether risk factors for ph differ with copd level , multiple logistic regressions were performed for each copd severity group separately . the influence of fvc % on the risk of a person having ph increased with increasing copd level . variables except age were significant in the development of ph in patients with moderate copd . blood gas parameters of paco2 and pao2 were significant in the development of ph in patients with severe copd . fvc % , fev1 % and sex variables were significant in the development of ph in patients with very severe copd ( table 5 ) . to our knowledge , this is the first study compares frequency of ph in the subjects exposed to biomass and tobacco smoke , and describes the possible causes of ph in these patients groups . in the present study , the most relevant findings were that patients exposed to bs had more frequent ph presence and less fvc % , whereas ts group had less frequent ph presence and fev1 % . finally , biomass smoke exposed group had more frequent ph especially in the moderate level copd cases . bs is composed of a relatively equal mixture of gases and particles and can penetrate deeply into the lung , producing a variety of morphologic and biochemical changes 10 , 11 . a recent meta - analysis , which reviewed risk of copd from exposure to bs , concluded that bs exposure is a clear risk factor for copd 12 . it has reported that bs related copd cases ' clinical characteristics , quality of life , and mortality rate were similar in degree to that of tobacco smokers 13 . to date , the frequency of ph was not compared in these risk groups . in the current study , we found that the biomass related copd cases had more frequent ph than cigarette smoking related copd cases . the relationship between bs exposure , and ph and cor pulmonale ( cp ) has long been established 14 - 16 . an autopsy study conducted in females with cp with ages ranging from 20 to 60 years in delhi , india . they concluded that ph and cp development might have a correlation with biomass smoke exposure 14 . a mexican study reported a clinical picture with a chronic pulmonary disease and a significantly high ph that they have observed frequently among women exposed to wood smoke 17 . it reported that vascular changes were prominent in both groups , but were more severe in the biomass smoke exposed group which could explain why ph and cp in women exposed to biomass smoke is common and high 18 . also we previously reported that prevalence of ph was higher among bs exposed females than non - exposed females in a healthy cohort ( 48 % vs 12 % , p<0.05 ) . the odds ratio ( or ) for ph development with bs exposure was established as 6 ( p<0.001 ) 19 . independent predictors of ph were found in moderate level , severe level , and very severe level copd cases as follow ; gender , fev1 % , fvc % , pao2 , paco2 , and pao2 , paco2 and gender , fev1% , fvc % respectively . some previous studies examining the relationship between spirometry and ph reported similar results 20 - 22 . however some studies reported weak or no associations between fev1 and spap 23 , 24 . sandoval et al reported a correlation between pulmonary artery pressure ( pap ) and pao2 in wood smoke exposed women , but there was not any correlation regarding other factors such as fev1 % , fvc % , and paco2 17 . sim et al . found that a correlation between spap and fev1 % , fvc % , higher paco2 and lower pao2 25 . a study investigated the relation between ph and inflammation in copd , and found that pao2 and c - reactive protein were independent variables for ph in copd cases 26 . this mismatch results may be due to the differences in the severity of copd between cohorts . our finding that sex had highest value of or for ph in moderate and very severe copd cases . it is suggest that this increasing may be relating to decreasing of fev1 % and fvc % . in our study , however , age was not an independent factor in any copd level although prevalence of ph was increased accordingly copd level . the pathophysiology of the development of ph in copd is poorly understood and is likely multifactorial . the central stimulus to these processes remains chronic exposure of airways to noxious stimuli like tobacco and biomass smoke . hypoxia has been classically considered to be the major pathogenic mechanism of pulmonary hypertension in copd 21 , 27 . chronic hypoxia induces predominant medial hypertrophy and is associated with complete reversal of pulmonary hypertension a few weeks after return to sea level 28 , 29 . pathologic studies of lung specimens from patients with copd have shown all vessel wall layers to be involved extensive pulmonary vascular remodeling with prominent intimal thickening , medial hypertrophy , and muscularization of small arterioles 30 . also pulmonary vascular remodeling has been observed in lung specimens from patients with mild to- moderate copd without chronic hypoxemia and in smokers with normal lung function 31 , 32 . these very early histopathologic findings suggest that the morphologic changes in the pulmonary arteries are initiated by the toxic effects of tobacco and biomass smoke and progress in parallel with the parenchymal changes of copd 33 . there are new advances about of pathogenesis of pulmonary hypertension in copd supporting an endothelium - derived vasoconstrictor - dilator imbalance , mainly from a decreased endothelial nitric oxide expression , increased vascular endothelial growth factor and serotonin transporter expressions 32 , 34 - 36 . the routine investigation of ph is difficult in all copd patients due to request of right heart catheterization . the literature on the prevalence of ph in copd is confounded by several limiting factors . studies were different each other from definition of ph to study condition ( ie rest , exercise ) , severity of diseases and the methods used to determine pulmonary pressures . the true prevalence of ph in patients with mild or moderate copd is not known because of the absence of large - scale epidemiologic studies . direct measurements of pap obtained at right - heart catheterization have been conducted only in small series of patients with mostly severe copd . most studies have reported a prevalence of ph in copd to be between 30 % and 70 % 27,37,38 . severe ph is uncommon in copd and typically is associated with less severe respiratory function compromise 39 . patients with this condition are important to identify because they may be expected to have significant clinical compromise from the ph . a recent small cohort reported that the frequencies of ph in mild , moderate , severe , and very severe copd were 16.67 % , 54.55 % , 60.00 % , and 83.33 % , respectively 40 . in another study , the frequency of ph was also found to be 25 % , 43 % , and 68 % in mild , moderate , and severe copd , respectively 22 . we found that frequencies of ph were 44 % , 56 % and 59 % , in moderate , severe , and very severe copd , respectively . we also observed different frequency of ph between the female and male moderate copd cases ( 56,2 % and 37,5 % p < 0,00 ) while not observed in severe and high severe copd cases ( 60 % , 53,8 % , p>0,05 , 62,5 % , 57,1 % p > 0,05 ) . we concluded that biomass smoke induced ph in females earlier than tobacco smoker . in summary , our study demonstrated that ph frequency is higher in female copd cases due to biomass smoke than in male copd cases due to tobacco smoke , and this difference is prominent in moderate copd level .

objectives ; pulmonary hypertension ( ph ) is a common and well established complication of chronic obstructive pulmonary disease ( copd ) . its presence is associated with decreased survival . this study was designed to investigate the ph frequency and its relations in hospitalized tobacco and biomass related copd patients . methods and results ; the study was a retrospective review of inpatients with copd defined as a history of tobacco or biomass smoking , pulmonary function tests ( pft ) within stable status , an echocardiogram within stable status . ph was defined as systolic pulmonary artery pressure ( spap ) > 35 mmhg . of the 694 individuals , 600 had suitable aspects for inclusion of study . all females were biomass exposer and males were tobacco smoker . the prevalence of ph was found more frequent in females than males . it was more prominent in moderate level copd cases ( 56,2% and 37,5% , p<0,002 ) . both groups had airflow limitation , hypercapnia and hypoxemia , but no differences were found in terms of paco2 and pao2 . however , fev1 % was lower in males than females ( p<0,005 ) . on the other hand , fvc % was lower in the females compared with the males ( p < 0.02 ) . when analyzing the influence of pft and demographic parameters on ph in separate copd level groups , the results a bit varied among the groups . conclusion ; our study demonstrated that ph frequency is higher in female copd cases due to biomass smoke than in male copd cases due to tobacco smoke . the influence of fvc % on the risk of a person having ph increased with increasing copd level .

Introduction Materials and Methods Results Discussion

over several decades , the pharmaceutical industry has become heavily reliant on demonstrating functionality in animal models , especially mouse models , as a way to characterize and select vaccine formulations . however , it is becoming increasingly clear that animal testing may not always accurately reflect the response in humans and may not necessarily provide the most meaningful data . the issues surrounding animal use and human immunofunctionality are well - known and have been highlighted in several recent publications . the difference in immune function is hardly surprising given the vast evolutionary distance between mouse and human , thought to be in the order of 65 million years . there are many examples where differences between animals and humans may have profound implications for formulation development . one example is toll - like receptor ( tlr ) usage , relevant to the development of new generation adjuvants . currently , the response initiated by a tlr may not be fully known until clinical testing is initiated . another example was highlighted in a clinical trial for an immunomodulatory anti - cd28 monoclonal antibody ( mab ) ( tgn1412 ) . during the trial , delivery of the antibody triggered an immediate systemic inflammatory response and a serious adverse event ( sae ) referred to as a cytokine storm . this life - threatening event was unexpected since standard non - clinical safety studies in animal models raised no alarm . during pharmaceutical development of vaccines , it is crucial to identify optimal conditions for long - term storage and for boosting immunogenicity through , for example , the addition of adjuvants . to this end , a large number of variables must be examined during pre - formulation development to identify optimal ph , buffer ingredients , ionic strength , stabilizer excipients , as well as optimal adjuvant - antigen composition . multiwell - based assays are readily available to monitor biophysical and biochemical properties of macromolecules as a function of different formulation parameters under normal or stressed conditions . however , there is a lack of simple and cost efficient in vitro high throughput screening methods to evaluate the biological activity of complete adjuvanted formulations . the hwb approach aims to emulate this . in order to begin addressing some of the issues mentioned above and to bridge preclinical testing in animal models , sanofi pasteur has looked into strategies that focus on in vitro testing using human cells . compatible with these initiatives and as a way to further bridge formulation development to vaccine functionality and to human clinical studies , we now describe a new way to evaluate the immune response to adjuvanted formulations using a fresh human whole blood ( hwb ) approach ( fig . 1 ) . the approach may be particularly useful in an early clinical phase when a formal in vitro potency assay may not be available . innate immunity is an immediate response to a stimulus or danger signal typically triggered through ancient receptors inherited at birth , which sense conserved pathogen - associated molecular patterns ( pamps ) found on a variety of bacteria , fungi , and other pathogens . one of the best characterized of these innate signaling pathways is that for the bacterial endotoxin , lipopolysaccharide ( lps ) , which triggers a pro - inflammatory response through toll - like receptor 4 ( tlr4 ) . derivatives of lps that mimic innate immunity are now key components of a new generation of vaccine adjuvants that use a tlr4 agonist ( tlr4a ) . studies were initially conducted using tlr4a combined with an aluminum salt adjuvant ( asa ) , hereafter referred to as tlr4-adjuvant . several of these adjuvant formulations stimulated a pro - inflammatory cytokine ( tnf ) response in fresh human whole blood ( hwb ) . the response was initiated after as little as 6 h of incubation and more optimally between 1824 h. to further characterize the adjuvant response , individual components of the adjuvant were used in a follow - up study to stimulate hwb over a broad range of concentrations . the data indicated a consistent trend in response across 3 different subjects ( fig . 2 ) . although there was a lack of response to the asa alone ( not shown ) , the response to tlr4a was significantly augmented in the presence of asa . indeed , there were responses to the tlr4-adjuvant at concentrations of the tlr4a alone that would otherwise have failed to induce a detectable response . tnf is released from human whole blood of three different subjects after 24h stimulation with lps , tlr4-adjuvant , tlr4a , and asa ( asa alone was consistently negative and is not shown ) . while there is expected variability between subjects , there may be ways to normalize the data against a standard reference such as lps or other tlr4as . evaluating adjuvant responses in this way is inexpensive , relatively quick , and technically easy to perform . depending on the technology used it may be possible to generate functional data comfortably within a single working day . typically , the memory t cell population is rapidly activated and proliferates upon re - encounter with a specific antigen , with immediate cytokine - secreting cells being described as effector memory , and with proliferating t cells being described as central memory . a methodology developed by scientists at the london school of hygiene and tropical medicine and based on earlier studies in leishmania has been in use for approximately two decades as a way to monitor antigen specific , vaccine - induced memory after bacillus calmette - gurin ( bcg ) vaccination . the response is monitored by stimulating hwb with antigens from m. tuberculosis and detection of t cell cytokines such as ifn after 67 d of culture by elisa , or by multiplex bead array assays . to investigate antigen specific responses to complete vaccine formulations , an advanced tb vaccine candidate referred to as h4 was formulated with the tlr4-adjuvant and tested using fresh hwb recovered from 3 healthy bcg vaccinated volunteers ( fig . the data demonstrated that an antigen - specific ifn memory response can be monitored in a simple 6 d assay when blood is incubated with the complete formulation . in all cases the optimum concentration of h4 was relatively broad ( 2.0 g and 0.02 g ) and was dependent on the concentration of tlr4-adjuvant . while responses were variable between subjects , the expectation is that loss of potency , between different formulations , would be apparent in any subject tested . the ability to demonstrate profound immunomodulation in terms of quantitative ( measurable ) and qualitative ( cytokine profile ) responses by adjuvant on the t cell response through this in vitro approach is of particular interest . the use of hwb may provide a new way to monitor complete vaccine formulations in terms of both the antigen and the adjuvant response . the ability to demonstrate and understand modulation in vitro in this manner is relatively novel . since a tlr4-adjuvant is expected to drive th1-like immunity , it is thus important to show and quantify this effect for any formulation being developed . the example chosen here uses a tb vaccine to boost the memory response primed by bcg or prior mycobacterial exposure . however , the approach is likely to be applicable to any other t cell inducing vaccine that aims to boost existing memory . once the functionality of a formulation can be demonstrated , the ability to detect changes to the stability of the formulation is then possible . to this end , tlr4-adjuvant formulations under different conditions of accelerated temperature storage were monitored using hwb and chemical integrity by reversed phase high - performance liquid chromatography ( rp - hplc ) . the fresh blood from a single subject was tested on multiple weeks using different adjuvant preparations in an overnight tnf assay . the data revealed a loss of functional activity ( ability to stimulate tnf ) when formulations were stored at 45 c and 60 c for 3 , 5 , and 12 wk ( fig . interestingly , the loss of functional activity agreed with changes in the rp - hplc profile . the ability to link specific chemical or structural changes to an immunofunctionality will be particularly useful . effect of temperature on chemical degradation and functionality of a tlr4 agonist as measured by rp - hplc ( green ) and in hwb ( purple ) . since the approach identifies both innate signaling and the modulated adaptive response , the use of cells from healthy humans may be a quick way to confirm absence of unwanted or unexpected immunity in any formulation at any time during development . such testing might also identify contamination with endotoxin or any other toxins that might not be recognized in other standard tests ( i.e. , limulus amebocyte lysate lal and rabbit pyrogenicity ) . indeed , a commercial kit using hwb is already being marketed for this purpose ( biotest pyrodetect system ) . application of the approach may also be helpful to a non - clinical safety assessment . certainly , innovative approaches to address safety are of major interest to the industry ( e.g. , biovacsafe ) . the hwb approach enables the determination of the functionality of a complete formulation ( adjuvant and antigen ) within 6 d. multiple formulations can be monitored simultaneously and responses compared for several subjects . the approach presents an opportunity for a broad formulation screen and to select optimal , possibly safer , formulations based on a functional response on fresh human cells . the functional response can be used in conjunction with standard biochemical and biophysical tests . the ability to re - stimulate antigen - specific memory b cells moreover , the ability to correlate a memory t helper cell response with antibody elicited in vivo would make the approach especially attractive for screening other vaccine targets . these technologies and other assays such as qpcr or proteomics could be readily applied to the hwb approach . a convincing argument for the advantages of using fresh hwb is already reported and discussed . provided that drawn blood is returned to culture within a few hours , there is no need for cellular enrichment or centrifugation . in addition , hwb contains components essential to stimulate both innate and memory t cell immunity . such factors may include neutrophils and eosinophils , as well as platelets and other cells and plasma constituents , that have been shown to play a role in cellular function and cytokine production . since hwb is used for immunomonitoring clinical trials , there may be a direct link between formulation screening in vitro and actual clinical trial monitoring . indeed , the approach may be compatible with a trial - in - a - test tube , where an in vitro response may be predictive of the clinical response . the use of point - of - care devices ( pcd ) to screen whole blood for an array of markers is becoming a reality . such variability allows for a more realistic understanding of vaccine performance . in terms of formulation screening , multiple formulations can be monitored relative to a reference formulation within a single subject . in summary , the hwb approach is a relatively inexpensive , fast hts methodology that can monitor complete vaccine formulation functionality in terms of the adjuvant response , the antigen response , and the modulation of the antigen response by the adjuvant . in addition , the approach can detect a loss of functionality thus supporting structure - function characterization of vaccine antigens and optimization of antigen - adjuvant interactions . finally , the application of a formulation to human cells can be a sensitive indicator of unwanted or unexpected immunological response . the approach would considerably de - risk progression of vaccine formulations through early clinical trials ( fig .

understanding the relevant biological activity of any pharmaceutical formulation destined for human use is crucial . for vaccine - based formulations , activity must reflect the expected immune response , while for non - vaccine therapeutic agents , such as monoclonal antibodies , a lack of immune response to the formulation is desired . during early formulation development , various biochemical and biophysical characteristics can be monitored in a high - throughput screening ( hts ) format . however , it remains impractical and arguably unethical to screen samples in this way for immunological functionality in animal models . furthermore , data for immunological functionality lag formulation design by months , making it cumbersome to relate back to formulations in real - time . it is also likely that animal testing may not accurately reflect the response in humans . for a more effective formulation screen , a human whole blood ( hwb ) approach can be used to assess immunological functionality . the functional activity relates directly to the human immune response to a complete formulation ( adjuvant / antigen ) and includes adjuvant response , antigen response , adjuvant - modulated antigen response , stability , and potentially safety . the following commentary discusses the hwb approach as a valuable new tool to de - risk manufacture , formulation design , and clinical progression .

Introduction Monitoring an Adjuvant Response Monitoring an Antigen Specific Memory Response Adjuvant Immunomodulation Formulation Stability Formulation Safety Concluding Remarks Disclosure of Potential Conflicts of Interest

a 44-year - old male patient was admitted to the hospital for surgical removal of a duodenal submucosal tumor found incidentally on duodenoscopy . an abdominal ct scan showed a well - defined heterogeneous retroperitoneal enhancing mass measuring 3.6 4.5 3.1 cm in the paraaortic space ( fig . he had a 20-year history of smoking and was on medication for hyperlipidemia , but had no other significant past medical or family history . prior to anesthetic induction , the patient 's blood pressure ( bp ) was 130/75 mmhg and his heart rate ( hr ) was 74/min . the modified allen test was positive and a 20-gauge catheter was placed into the radial artery for continuous bp monitoring . desflurane 8 vol% and remifentanil 0.2 g / kg / min were continued for 3 minutes prior to endotracheal intubation . desflurane 4 vol% , n2o 50% , and remifentanil 0.06 g / kg / min were used for maintenance of anesthesia . bispectral index was maintained at 35 - 50 . during the initial manipulation of the tumor , at the beginning of the surgery , the patient became hypertensive , with a bp of 250/120 mmhg , and tachycardic , with a hr of 100/min . the hypertension was treated with a combination of sodium nitroprusside infusion ( 0.5 g / kg / min ) , labetalol hydrochloride ( 10 mg of labetalol in two doses of 5 mg each ) , remifentanil infusion ( 0.3 g / kg / min ) , and increased desflurane concentration up to 9 vol% . although the bp decreased to 155/100 mmhg following the infusion , there was an increase in the systolic bp ( above 180 mmhg ) and the hr ( 95 - 105/min ) each time the surgeon manipulated the tumor . despite the adequate depth of anesthesia and anti - hypertensive therapy , subsequently , an additional dose of nicardipine hydrochloride 300 g was administered , and isosorbide dinitrate 0.2 g / kg / min infusion was maintained . after the administration of nicardipine , the bp initially decreased to 130/80 mmhg , and systolic bp was maintained at 140 - 150 mmhg thereafter . an arterial blood gas analysis performed at this point showed ph 7.35 , paco2 40 mmhg , pao2 168 mmhg , and oxygen saturation 99% on fio2 0.5 . desflurane 9 vol% , remifentanil 0.3 g / kg / min , sodium nitroprusside ( 0.1 - 0.3 g / kg / min ) and isosorbide dinitrate 0.2 g / kg / min were administered continuously , and the bp remained stable at around 130 - 160 mmhg systolic . there were no changes in the ecg after the resumption of surgery , and the troponin i levels checked afterwards remained below 0.20 ng / ml . as the bp gradually decreased with ligation of the tumor , desflurane and remifentanil were tapered . one hundred and fifty minutes after the start of the surgery , the tumor was completely removed . following tumor removal , estimated blood loss during the surgical procedure was about 500 ml . in order to improve the patient 's hemodynamic parameters , volume expanders ( 500 ml ) and crystalloid fluids ( 1,000 ml ) were given , and 8 mg of ephedrine was administered intravenously . after these procedures , the bp returned to 140/87 mmhg and the hr returned to 88/min . the patient 's vital signs were maintained with desflurane 4 vol% and remifentanil 0.03 g / kg / min until the surgery was completed . an undiagnosed extra - adrenal pheo was suspected based on the hypertensive crisis caused by tumor manipulation during the surgery . a biopsy showed that the tumor was a well - encapsulated , solid mass measuring 5.5 4.0 3.7 cm . immunohistochemical staining revealed the neuroendocrine markers synaptophysin and chromogranin , and a positive cd56 confirmed the diagnosis of pgl . the patient was transferred to the general ward on postoperative day ( pod ) 2 and was discharged on pod 11 without any complications . a follow - up appointment was scheduled for six months after the surgery , to investigate any evidence of recurrence and to monitor signs of lymph node metastasis . the most common catecholamine secreted is norepinephrine , and the classic triad of symptoms of catecholamine excess is headache , palpitations , and sweating . sustained or paroxysmal hypertension has been reported in 80 - 100% of patients . the main manifestation of sympathetic pgl is hypertension , and this type of tumor is usually localized in the thorax or the abdomen . while parasympathetic pgls are mostly localized around the head and neck , these tumors are nonfunctional , and biochemically silent . there are cases , therefore , in which the classic triad of symptoms does not occur . in addition , some cases are either asymptomatic or ambiguous , with confounding factors including psychiatric disorders , anxiety , facial pallor , weight loss , polyuria , hyperglycemia , secondary erythrocytosis , stroke , and cardiomyopathy , making a proper diagnosis difficult . in such cases , the patient may be unaware that he or she has pgl until it is discovered incidentally from an imaging study such as a ct or mri . however , specific patient interviewing could help trigger the suspicion of pgl . there is also a special need for a physical examination to determine the presence of cardiovascular side effects from such a tumor . in hindsight , the patient described here showed a borderline bp elevation before surgery ; therefore , a physician should not overlook borderline elevation of the bp in patients . also , pgl or pheo should be considered in patients with a history of resolved takotsubo cardiomyopathy and abdominal mass . in 2009 , choi et al . reported a case in which a severe catecholamine - induced cardiomyopathy barely responded to high vasopressin and epinephrine . therefore , to evaluate the possibilities of such cardiac abnormalities , an echocardiogram must also be performed . pheo / pgl are associated with genetic syndromes such as neurofibromatosis 1 , von hippel - lindau ( vhl ) disease , multiple endocrine neoplasia type 1 ( men 1 ) and type 2 ( men 2 ) . abdominal pgls are also associated with succinate dehydrogenase subunit d ( sdhd ) b mutation . thus , medical information obtained through preoperative genetic counseling can aid in diagnosing pheo / pgl . in the case described here , the patient was admitted to the hospital for surgical treatment of an incidental duodenal mass . the case was uneventful not only prior to the surgery , but also during endotracheal intubation and the surgical incision . however , direct manipulation of the tumor led to hypertensive crisis in this patient . this finding is believed to be due to the sudden excessive secretion of catecholamines from the tumor ( extra - adrenal or retroperitoneal pgl ) , which was misdiagnosed as gist . gists are large - sized tumors ( > 5 cm ) , arising from the stomach , with heterogeneous enhancement ( 84% ) and central necrosis ( 37% ) . large - sized pgls adjacent to the stomach , accompanied by no specific signs of catecholamine secretion , are therefore often misdiagnosed as tumors of neural or mesodermal origin , such as gist or other soft tissue sarcomas . furthermore , when there are neither symptoms of catecholamine excess nor histologic diagnosis , gist has a similar radiographic appearance to pgl . the genetic association of nonfamilial pgl , gist , and pulmonary chondroma ( carney triad ) has been described in a very small number of patients , but the underlying genetic factor has not yet been revealed . what was initially perceived by physicians to be gist turned out , after biopsy , to be pgl . in a case described in 2009 , lowenthal et al . believed that a patient with anxiety symptoms and a perigastric mass had gist . while undergoing a surgical resection , the patient experienced a hypertensive crisis during the initial tumor manipulation . from the pathologic examination , yoo et al . discovered an incidental duodenal polypoid mass that they thought was an adenoma . there are reports of pgl occurring not only in the duodenum but also in the liver , urethra , cerebellopontine angle , cauda equina , and larynx , among other sites . therefore , the surgeon must be aware of the fact that one could encounter pgl in unexpected parts of the body during surgery . imaging studies for localizing the tumor and staging the disease are important , and the conventional work - up with ct or mri is recommended . since i - metaiodobenzylguanidine ( mibg ) shows higher specificity in confirming catecholamine - secreting adrenergic tissue , this is the method of choice for diagnosis . however , finding the correlation between the symptoms and laboratory values is considered the most important , even if pgl is seen on a ct . in cases where pgl is suspected due to a sudden hypertensive crisis during surgery , one must decide whether to proceed with the surgical procedure or to stop the surgery and restart it after proper management of the crisis . in the case discussed here , the surgeon continued with the surgical procedure because the patient 's vital signs were stable after the infusion of short - acting sodium nitroprusside and nicardipine hydrochloride . sodium nitroprusside is effective in arteriolar dilatation and in suppressing the hypertensive response due to circulating catecholamines . there have been recent reports that nicardipine hydrochloride suppresses the secretion of norepinephrine in pheo / pgl , and its use has therefore increased . surgical procedures involving an unexpected pgl without proper preoperative management , however , lead to an increase in morbidity and mortality . elective surgical procedures should be canceled or delayed until the origin of the hypertensive episode can be clarified ; furthermore , a differential diagnosis must be made and proper preoperative medication with 1-blockers must be administered to the patient . when proper preoperative management is done , perioperative mortality can be reduced from 45% to 0 - 3% . once the diagnosis of pgl has been confirmed , complete surgical resection of the tumor is the treatment of choice . to minimize the chances of cerebrovascular catastrophes and/or cardiovascular complications such as arrythmias , hemodynamic instability , and even hypertensive crisis during the perioperative period , at least 1 - 2 weeks of preoperative medical treatment with a nonselective 1-adrenergic blocker ( phenoxybenzamine ) or a selective post - synaptic 1-adrenergic blocker ( doxazosin , prazosin , or terazocin ) is recommended . after adequate -blockers have been administered , -blockers can be added to prevent catecholamine - induced arrhythmias or reflex tachycardia , which are the side effects of -blockers . although the majority of pgl are benign tumors , they may also be malignant , especially in children . several imaging studies , as well as cytologic and histologic studies by biopsy , are useful in suggesting malignancy . the combination of large size , heterogeneous density , irregular margins , and distant metastasis increases the possibility of malignancy , but the presence of distant metastasis is the most important factor . chromogranin a is a valuable tumor marker that correlates with size and malignancy , and is useful for detecting sdhb - related pgl , which is biochemically silent . this marker may improve the sensitivity of diagnosis , and it can be used effectively to monitor for recurrence during long - term follow - up . although the initial therapy recommended for pgl is surgical resection , in cases of metastatic or unresectable disease , i - mibg therapy is the standard alternative therapy option . careful follow - up is needed in these situations . in conclusion , pgl is very difficult to diagnose during preoperative patient evaluation , as it has either no symptoms or atypical symptoms . therefore , if acute hemodynamic instability , such as malignant hypertension and tachycardia , occurs during induction of anesthesia or surgical manipulation , particularly in the case of gist surgery , one should suspect pgl . being aware of the lesion and the potential for hypertensive crisis may prevent intraoperative cardiac disaster . in order to minimize the risk of pgl removal , anticipation by the anesthesiologist and guarded manipulation by the surgeon are essential .

although paraganglioma ( pgl ) , an extra - adrenal retroperitoneal pheochromocytoma ( pheo ) , is a rare catecholamine - secreting neuroendocrine tumor , it can cause severe hypertensive crisis during anesthesia or surgery if undiagnosed preoperatively . extraluminal perigastric masses may be presumed to be gastrointestinal stromal tumors ( gists ) or soft tissue sarcomas even when histologic confirmation is not possible . therefore , without a histologic diagnosis or symptoms of excessive catecholamine secretion , pgl may be mistaken for gist . we report a case of preoperatively undiagnosed pgl which caused hypertensive crisis during anesthesia for retroperitoneal mass excision .

Case Report Discussion

disasters are either man - made or natural events ( 1 , 2 ) whose general consequences include disruption of social and psychological order of communities , destruction of infrastructure and residential houses , deaths and injuries , destruction of assets and properties and disruption of social life of communities ( 3 ) . major disasters require a different form of management . in the case of a major disaster , management process may be very complex and full of problems because disasters have very chaotic situations ( 4 ) . iran is subject to a broad range of natural and man - made disasters ( 5 ) and has historically been damaged a lot by natural disasters ( 6 ) . over the past century , hundreds of thousands of people have died due to disasters like war , earthquake , flood and drought . bam deadly earthquake in 2003 , in south eastern iran , is claimed to have taken the lives of more than 30,000 people ( 7 ) . zarand earthquake in 2005 in central iran , silakhor earthquake in 2006 in western iran ( 8) , eastern azerbaijan earthquake in 2002 , bushehr earthquake and southern khorasan earthquake in 2003 are some of the natural disasters occurred in iran in the recent decade . management in natural disasters has various and different aspects , one of which is related to mental issues at individual and social levels . mental health programs during and after a disaster have recently been very controversial ( 9 ) . natural disasters are situations that need high social and psychosocial support ( 10 ) . every year , millions of people are affected by natural disasters . research has shown that exposure to disasters exacerbates traumas ( 2 ) . among the effects of disasters , consequences which damage the health and lives of people are of great importance ( 11 ) . since some countries , including iran , are disaster - stricken , having comprehensive and dynamic disaster management structures is essential in coping with disasters . in times of disaster , an approach that addresses physical , mental and social needs of individuals is very crucial ( 12 ) . psychological needs of victims and taking measures to deal with the psychological effects of disasters are among the needs mentioned above . psychological responses must not be limited to disaster period but rather must continue long after disaster due to long - term effects disaster has on victims . although number of studies related to psychological support in natural disasters is growing , there is still a shortage of these studies ( 13 ) . the breadth and severity of medical problems among patients with mental illnesses are not well known ( 14 ) . people s mental and physical health and behavior are closely linked together ( 15 ) . psychological support in disasters focuses on identification of individuals who are at risk of long - term psychological effects and on development of effective strategies to cope with stress after disaster ( 17 ) . psychological intervention is one of the important aspects in the comprehensive chain of mental health cares after disasters and is considered an important factor in preventing mental health problems after disasters and in creating suitable social support ( 13 ) . new research focuses on transforming mental health systems in order to recognize the long - term psychological effects of a disaster ( 19 ) . integrating mental response and mental health programs with humanitarian assistance programs can bring about an opportunity to present a model to centralize mental health in public health structures of a country ( 20 ) . ( 2012 ) considered psychological consequences a priority for preparing for and responding to disasters and presented a conceptual framework for managing the consequences of disasters in order to guide hospitals and clinics . this model consists of structural components ( internal organizational structure and a chain of command , resources and infrastructures and knowledge and skills ) and process components ( coordination with external organizations , assessing and monitoring risk , psychological support and sharing information and communication ) ( 21 ) . a systematic intervention includes three stages : preparation before the disaster , psychological first aid , monitoring and evaluation . training is required , in all three phases , before assessing the disaster , verbal intervention , individual and group social support , providing sufficient information and sensitivity to cultural and situational diversity ( 13 ) . successful disaster management requires a holistic view on the effects and aspects of the disaster . therefore , success of disaster management depends on analyzing conditions correctly and reviewing consequences comprehensively in the light of social areas . the aim of the present study was to identify the most important shortcomings of dealing with the psychological effects of natural disasters and the problems related to this field . this study is of qualitative type ; statistical universe consists of 26 disaster managers who have had experience in managing natural disasters over the last decade . information was gathered using in - depth interviews with semi - structured open - ended questions . interview questions were designed to identify the most important shortcomings and problems related to dealing with psychological effects of previous natural disasters in iran . these face - to - face interviews lasted for approximately 30 minutes . qualitative and quantitative content analysis was used to analyze the results . for qualitative analysis , , the interviews were studied several times to obtain an overall understanding and determine codes and meaning units . then , the codes , that were semantically similar , were matched and the most important concepts were extracted . contingency analysis was used for quantitative content analysis . thereby , the frequency of each concept was determined . in the next step , to obtain guidelines and solutions , focus group meetings were held with six scientific and practical experts in disaster management and the solutions were extracted . analyses showed that interviewees pointed to nine main problems in this regard ; they are shown in table 1 . frequency distribution of managers viewpoints regarding shortcomings of dealing with psychological effects in disasters as shown in table most of the interviewees expressed three other shortcomings that had nearly the same frequency were : insufficient training , shortage of experts and ignoring needs of specific groups with 92.3% frequency . lack of suitable communications of organizations in the field of providing mental services and discontinuation of psychological support after disaster also gained the same frequency ( 76.9% ) . unfamiliarity with native language and culture of the area , little attention of media to psychological principles in broadcasting news and people s long - term dependence on governmental aid were noted as the three least common weaknesses that has lowest frequency in content analysis of interviewees viewpoints ( 69.2% , 57.6% , 38.4% respectively ) . the results of this study identified nine problems that had most effect on the psychological consequences management of disasters . in continued , these problems are analyzed , some experiences are mentioned , and some guidelines are presented . when a terrible natural disaster occurs , all relevant organizations and authorities try to save the victims and to provide their basic welfare needs . viewpoints of disaster managers reveal that psychological support has been taken into less consideration than other factors including houses and meeting physical needs . unfamiliarity with principles of psychological support results in increased mental problems of people and even rescuers . meeting mental needs after disasters requires familiarity with principles of psychological support in disasters . the way rescuers and authorities treat victims , look at them and speak to them and the way words are selected are all important keys which must be taught and taken into account . it is not enough for people who are in charge of preparing profile of the injured and dead people to only know how to work with computer and to search information ; they must also be familiar with principles of emotional support in treating survivors who are looking for some information about their relatives , especially when they are going to be informed of their relatives deaths . knowing the basic principles of psychological support is also emphasized by other researchers ( 2224 ) . specialized responses to the mental needs , shortage of experts or ignoring the presence of mental health specialists in disaster management teams have worsen the situation . the most important measure in preventing the injured people s illogical and irrational decisions and behaviors in disasters is to support them mentally and psychologically ; if it is done correctly by experts , it will help victims , rescuers and the related authorities . education and training about immediate responses are important for all mental health providers of immediate and continuing services to assist victims in the aftermath of disasters ( 25 ) . not employing experts to teach these principles to rescuers and to supervise psychological supports will also worsen mental problems in disasters . a part of this training is specialized and is used to train psychologists , while other part must cover public education for victims and rescuers . in this case , interviewees mentioned the way physicians and nurses treat patients and the way rescuers treat the injured . psychological support is not limited to the victims in a disaster area and in the disaster time . in disaster conditions , it is necessary to pay attention to the psychological needs of different groups ( 13 ) . survivors need the most attention and support , but other groups should not be ignored . identifying needs of different groups such as women , children , adolescents , the elderly , the disabled and patients is crucial . thus , in selecting rescuers , their emotional personalities must be taken into huge consideration . obviously , sensitive and emotional people will find it difficult to respond to painful tragedies . numerous studies have emphasized specific groups in disasters , especially children ( 26 ) , women ( 27 ) and the elderly ( 28 ) . rabiee & pourhosseini ( 2014 ) , have added addicts to this groups and have stated that attention to their needs is necessary ( 23 ) . kohn et al . ( 2012 ) , have stated some people have different needs and vulnerability to disasters ; they must be taken into huge consideration in national policymaking and programming ( 29 ) . lack of proper coordination is a main problem and challenge for natural disaster management which is caused by undefined disaster activities ( 30 ) . different organizations like the red crescent , welfare organization , charities and international organizations such as unicef play an important role in presenting counseling and psychological support to the victims of disasters ; however , experience has shown that there is no certain rela tionship among these organizations and they perform some isolated services . establishing effective inter - organizational communications and holding regular meetings between organizations that provide psychological supports in disasters in order to share information and to coordinate with each other must be considered during disaster . 2012 ) , pointed to the lack of central cooperation and psychological intervention programs in responding to disasters in east europe and regarded programming and presenting post - disaster mental cares as key needs in this regard ( 31 ) . although post - disaster traumas decline over time , they will be still visible ( 32 ) . when it comes to psychosocial support in disaster situations , the first thing that comes to mind is to comfort and console the survivors . it is done and thus can be beneficial until there are different groups in the disaster area . however , mental problems are not short - term and temporary conditions which can be healed as soon as the disaster finishes . losing family members , seeing painful events and scenes and many other problems can cause lifelong problems for people . if the psychological support programs are limited to disaster times , the feelings of fear , anxiety , isolationism , and other mental illnesses will remain long after the disaster . a common issue in all disasters is that basic needs are provided and finished in a certain time , while psychological and mental needs will remain for years and will hurt the survivors . continuing psychological support until victims return to their mental and emotional equilibrium through establishing psychological support centers and letting them work long after disaster can be effective . another problem found in some areas was unfamiliarity of rescuers with the native language of people of that region . absence of a common language will not lead to understanding the real needs . considering the customs , religious beliefs of people and employing rescuers who are familiar with the disaster area and with the language , culture and customs of that area is very important . although there is a plethora of literature associated with psychosocial aspects of disaster , very little of it specifically relates to culture ( 33 ) . ( 2008 ) , one of the principles of psychological intervention have stated attention to cultural differences ( 13 ) . observing principles of psychological support media also plays an important role in causing or preventing the disturbance in the public , and can affect victims and people s morale . showing harrowing scenes does not help control disaster ; dissemination of essential information , announcing real needs of people , asking for suitable aid and spreading health , safety and comforting messages can be useful activities of media in disaster times . ( 2014 ) , also believes that if the social media play their role properly , they will have more psychological benefits ( 34 ) . previous disasters have shown that although much time has passed since some disasters , people still have not returned to their equilibrium condition of life . one of the most important consequences of disasters is people s dependent on government assistance . government s support should make people return to their previous daily lives in a short period of time . providing employment and financial independence in a shortest possible time can eliminate most of people s mental disturbances and can help them gain their mental and psychological equilibrium . concerning the issues and problems introduced in this research , some measures and planning must be started to deal with psychological effects of disasters . although some measures were taken after bam earthquake , they were not sufficient . planning must be considered prior to disaster so as to have fewer problems in the time of disaster . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or fal sification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .

abstractbackgroundnatural disasters result in numerous economic , social , psychological and cultural consequences . of them , psychological consequences of disasters will affect the lives of people long after the critical conditions finish . thus , concerning the importance of psychological support in disasters , this study has identified problems and weaknesses in dealing with the psychological effects of the disasters occurred in iran.methodsthis qualitative study was carried out using semi - structured in - depth interviews and focus groups . sample volume consisted of 26 experts in the field of disaster management . content analysis was used to analyze data.resultsnine major problems were identified as weaknesses in handling the psychological effects of the disaster . these weaknesses include : rescuers unfamiliarity with the basic principles of psychosocial support , shortage of relevant experts and inadequate training , paying no attention to the needs of specific groups , weaknesses in organizational communications , discontinuation of psychological support after disaster , unfamiliarity with native language and culture of the disaster area , little attention paid by media to psychological principles in broadcasting news , people s long - term dependence on governmental aid.conclusionsdisaster management has various aspects ; in iran , less attention has been paid to psychological support in disasters . increasing education at all levels , establishing responsible structures and programming seem necessary in dealing with the psychological effects of disasters .

Introduction Materials and Methods Results Discussion Conclusions Ethical considerations

primary hyperparathyroidism ( phpt ) is a disease characterized by elevated or inappropriately normal parathyroid hormone ( pth ) levels due to excessive secretion by one or more parathyroid glands . the classical form of the disease is characterized by hypercalcemia , kidney stones , and severe bone disease . the routine measurement of serum calcium as a screening tool has led to a sharp increase in the incidence of a new presentation of the disease , namely , asymptomatic phpt , whose demonstration of bone involvement depends exclusively on the bone densitometry data [ 24 ] . the association with kidney disease , nephrocalcinosis , and nephrolithiasis is well established in the hptp and has been reported in several studies . found a prevalence of 7% in 271 individuals with the disorder and 1.6% in 500 healthy patients evaluated by sonography . the risk of hospitalization due to urolithiasis is increased for patients with hptp even ten years after parathyroidectomy [ 5 , 6 ] . currently a new phenotype has arisen , in which normocalcemia is observed , despite persistently high levels of pth . in this situation , a thorough search for causes of secondary hyperparathyroidism , particularly vitamin d deficiency , is imperative [ 79 ] . the demonstration of normocalcemic phpt is even more difficult as there are no guidelines for routine pth measurement , as hptp is most frequently identified during the investigation of reduced bone density [ 9 , 10 ] . we retrospectively reviewed the medical records of 70 patients with phpt from our institution , who were divided into two groups : 33 patients with normal serum calcium levels and 37 with hypercalcemia ( serum calcium 10.2 mg / dl ) . the following clinical data were obtained : gender , age , weight , height , and bmi . the diagnostic criteria for nphpt were as follows : apart from normal serum calcium and high pth levels , serum 25ohd levels above 30 ng / ml , absence of bisphosphonates , thiazide diuretics , anticonvulsants or lithium use , glomerular filtration rate greater than 60 ml / min , using the formula modification of diet in renal disease ( mdrd ) , and the absence of other metabolic bone diseases or gastrointestinal diseases associated with malabsorption or liver disease . all patients had a urinary ca / cr ratio of less than 240 mg / g cr , demonstrating the absence of hypercalciuria . serum calcium was determined using the johnson and johnson vitros 950 system ( rochester , ny , usa ) with reference value 8.4 to 10.2 mg / dl , serum 25-hydroxyvitamin d using the diasorin liaison competitive chemiluminescent immunoassay ( stillwater , mn , usa ) 10% coefficient of variation , with the following reference values : normal : 30 to 60 ng / ml ) , serum pth using the chemiluminescence method , immulite 2000 ( siemens , llanberis , gwynedd , uk ) , with intra- and interassay coefficients of variation of 4.2 to 5.7% and 6.3 to 6.8% , respectively , and serum c - telopeptide when using the electrochemiluminescence assay , elecsys systems , roche diagnostics , mannheim , germany , reference value 50450 pg / ml . bone mineral density ( bmd ) and t - score were evaluated at the lumbar spine ( l1l4 ) , femoral neck , and distal radius ( lunar corporation madison , wisconsin , usa ) . the correction of serum calcium levels in relation to albumin was performed using the following formula : corrected calcium = calcium found + ( 4-serum albumin ) 0.8 . patients who had clinical manifestations of nephrolithiasis were evaluated by ultrasound , and the results of the examinations were obtained from the medical records . pearson 's chi - square test or fisher 's exact test and the student 's t - test with equal or unequal variances were used for comparisons . verification of the hypothesis of equal variances was performed using levene 's f test , and the level of significance used in interpreting the statistical test was 5% . the prevalence of nephrolithiasis in the normocalcemic group was 18.2% and 18.9% in the hypercalcemic group ( p = 0.937 ) . fifteen percent of normocalcemic patients had a previous history of fractures compared to 10.8% of hypercalcemic patients , although there was no statistically significant difference ( p = 0.726 ) table 2 . in both groups , the bone mineral density in the lumbar spine was 0.95 0.24 g / cm ( t score : 1.3 ) , femoral neck 0.76 0.15 g / cm ( t score : 1.75 ) , and distal radius 0.54 0.15 g / cm ls bmd was normocalcemic 0.95 0.22 g / cm versus hypercalcemic 0.95 0.26 g / cm , p = 0.885 and fn bmd : normocalcemic 0.73 0.15 g / cm versus hypercalcemic 0.79 0.19 g / cm , p = 0.123 . patients with normocalcemia had bmd values in the distal radius significantly higher than the hypercalcemic patients ( p = 0.046 ) , as shown in table 3 . in the present study we found a high prevalence of kidney stones in nphpt , suggesting that the normocalcemia condition does not mean that the patient is without clinical manifestations . in relation to a history of fractures , we found a similar occurrence in the two groups with 15.2% in the normocalcemic and 10.8% in the hypercalcemic . we also observed that the bone mineral density in the distal radius was more preserved in the normocalcemic group than in the hypercalcemic group , although there were no significant differences in the lumbar spine and femoral neck . lundgren et al . , in a sample of 109 patients , found that 17 ( 16% ) had normal levels of calcium with elevated pth characterizing nphpt . in our institution , marques et al . found a prevalence of nphpt of 8.9% in a population of 156 postmenopausal women with osteoporosis . these data suggest that it is not a rare condition and therefore needs to be investigated in all patients with reduced bone mineral density . in contrast , in a population - based survey conducted in sweden , the prevalence of nphpt , in postmenopausal women was 0.6% . lowe et al . , in a series of 37 normocalcemic patients , found a frequency of nephrolithiasis of 14% , which is comparable with our findings , and a history of fracture of 11% . marques et al . showed an occurrence of kidney stones of 28.6% in osteoporotic women with nphpt in contrast to 0.7% in noncarriers . for clinical fractures they found a 21.4% prevalence in nphpt compared with 16.2% in those not affected . our study showed a preservation of cortical bone in patients with the normocalcemic form of the disease , and this is in agreement with the findings of lowe et al . , who showed a deterioration , particularly in ls bmd . one study showed that after an oral calcium load , normocalcemic subjects had an inadequate suppression of pth compared with hypercalcemic subjects . the high frequency of kidney stones and fractures in normocalcemic primary hyperparathyroidism could be explained by the possible lower renal and bone sensitivity to the biological effects of pth , although this hypothesis needs further investigation . gomes et al . stated that another possibility could be the presence of non-184 pth circulating molecules , such as a 784 pth fragment , blocking the calcemic effect of 184 pth and preventing hypercalcemia . our data suggests that nphpt may not be an idle condition as it may progress to complication regardless of the development of hypercalcemia . controversies regarding the suggestion that nphpt should be treated , since the disease can lead to a deterioration in bone mineral density , fractures , and kidney stones . thus , the routine determination of pth could detect these individuals early on in an attempt to prevent an unfavorable clinical course . there is no consensus about when to treat patients with hptpn , but if there is progression to clinical complications such as urolithiasis , bone mass loss , or fractures , surgery is indicated . finally , a new phenotype of nphpt was recently described in a population - based survey mros ( osteoporosis fractures in men ) . using less rigid criteria for the diagnosis of nphpt ( gfr > 40 ml / min and serum 25ohd < 20 mg / ml ) , the authors found a 0.7% prevalence of the disease that was associated with a significantly higher ls bmd in comparison with the elderly men without nphpt . our findings revealed a high prevalence of urolithiasis in normocalcemic primary hyperparathyroidism , but with preservation of the cortical bone , corroborating the belief that the disease is not an indolent condition and needs to be not only investigated but also treated when complications are diagnosed .

introduction . normocalcemic primary hyperparathyroidism ( nphpt ) is considered a variant of the more frequent form of the disease characterized by normal serum calcium levels with high pth . the higher prevalence of renal stones in patients with hptp and the well established association with bone disorders show the importance of studies on how to manage asymptomatic patients . objective . to compare the clinical and laboratory data between the normocalcemic and mild hypercalcemic forms of phpt . methods . we retrospectively evaluated 70 patients with phpt , 33 normocalcemic and 37 mild hypercalcemic . results . the frequency of nephrolithiasis was 18.2% in normocalcemic patients and 18.9% in the hypercalcemic ones ( p = 0.937 ) . fifteen percent of normocalcemic patients had a previous history of fractures compared to 10.8% of hypercalcemic patients , although there was no statistically significant difference ( p = 0.726 ) . conclusion . our data confirms a high prevalence of urolithiasis in normocalcemic primary hyperparathyroidism , but with the preservation of cortical bone . this finding supports the hypothesis that this disease is not an idle condition and needs treatment .

1. Introduction 2. Patients and Methods 3. Statistical Analysis 4. Results 5. Discussion 6. Conclusion

the osteoporotic vertebral compression fractures ( ovcf ) have attracted more and more attention due to increase in life span globally and aging population.12345 vertebroplasty has gained popularity during the past few years for the treatment of osteoporotic compression fractures.6789 several reports document its usefulness in addressing pain and prevention of further collapse and preservation of posture.6789 meanwhile , osteoporotic spinal fractures have shown an increasing trend in incidence . the decrease in bone mass density ( bmd ) always leads to an internal fixation failure for older people . these compression fractures or senile burst fractures are important part of ovcfs on health care systems which can not be ignored . what 's more important is that spinal fracture treatment for older people has special requirements : the surgical injury should be as little as possible , and the patients can get out of bed as early as possible . for these requirements , percutaneous vertebroplasty ( pvp ) and percutaneous kyphoplasty ( pkp ) have been popularized rapidly by virtue of their unique advantage in minimal invasiveness.26789 although pvp and pkp have similar analgetic mechanisms , the possible mechanisms are 1 ) the mechanical action after bone cement infusion causes local vascular occlusion ; 2 ) bone cement monomers have cytotoxicity , which injure the pain nerve endings ; 3 ) the thermal effect of bone cement damages the sensory nerve endings in the diseased vertebra ; 4 ) bone cement shoulders a quite portion of the axial stress , which reduces the stimuli on the intrapyramidal nerves ; and 5 ) bone cement infusion gets the vertebral body microfractures fixed and increases the spinal stability . however , bone cement has the drawback of seepage , which further leads to damage to surround vital structures . the posterior wall ruptures of the injured vertebral is a contraindication to the application of bone cement . when such ruptures happen to the old patients with spinal fractures , things will become worse and more complicated . we analysed our results in osteoporotic thoracolumbar fractures using percutaneous kyphoplasty and posterior screw rod system . 26 cases of ovcf treated with pkp combined with the posterior screwrod system between august 2006 and january 2011 were included in study . this study was conducted with approval from the ethics committee of kunming general hospital of chengdu military command ( protocol record d5395l00006 ) . so it was important to restore the spine normal force line , which was key to relieve pain . the mode of trauma was bicycle fall ( n=20 ) and road traffic accident ( n=6 ) . dual energy x - ray absorptiometry scanning before surgery showed that the t values of their bmds were no more than 2.5 , indicating all of them suffered from osteoporosis . the routine , x - ray and/or ct scanning showed that posterior vertebral walls were injured . the patient was taken in prone position under general anesthesia and image intensifier . according to the presence or absence of the neurological symptom , open decompression and reduction pkp or percutaneous reduction pkp were decided . for patients with the neurological symptom , midline posterior incision centered on injured vertebra was made and the injured vertebra and the superior and inferior vertebral articular processes exposed . four pedicle screws were inserted , laminectomy and decompression was done , indirect reduction and pkp was performed according to the standard pkp procedures . if there was an accompanied vertebral arch pedicle injury , the nerve roots were decompressed at the injured pedicle , and only unilateral puncture was performed ( on the integral side of the pedicle if possible ) . a 1 cm incision was , respectively , made at the superior and inferior vertebral arch pedicles of the injured vertebra . four screws were screwed in with the help of pkp tools , and subcutaneous rod threading was then performed for reduction . if the vertebral arch pedicle of the injured vertebra was spared , the rods would be withdrawn . after bilateral pkp on the injured vertebra was performed , the incisions were closed in 11 patients , the screws and rods were taken out directly after reduction , and pkp was then performed . , the bone cement pushrod was pushed to the 1/3 site of the anterior vertebral body . the infusion was terminated when the cement arrived at the 1/5 site to the posterior wall of the vertebral body . all the percutaneous reduction pkp patients got out of bed 24 h later after surgery the open decompression and reduction pkp patients had to stay in bed for 2 months . the x - ray ( anteroposterior and lateral view ) comparisons before and after surgery were made using the cobb angle and visual analogue scale ( 0 - 10 , vas ) . the patient was taken in prone position under general anesthesia and image intensifier . according to the presence or absence of the neurological symptom , open decompression and reduction pkp or percutaneous reduction pkp were decided . for patients with the neurological symptom , midline posterior incision centered on injured vertebra was made and the injured vertebra and the superior and inferior vertebral articular processes exposed . four pedicle screws were inserted , laminectomy and decompression was done , indirect reduction and pkp was performed according to the standard pkp procedures . if there was an accompanied vertebral arch pedicle injury , the nerve roots were decompressed at the injured pedicle , and only unilateral puncture was performed ( on the integral side of the pedicle if possible ) . a 1 cm incision was , respectively , made at the superior and inferior vertebral arch pedicles of the injured vertebra . four screws were screwed in with the help of pkp tools , and subcutaneous rod threading was then performed for reduction . if the vertebral arch pedicle of the injured vertebra was spared , the rods would be withdrawn . after bilateral pkp on the injured vertebra was performed , the incisions were closed in 11 patients , the screws and rods were taken out directly after reduction , and pkp was then performed . , the bone cement pushrod was pushed to the 1/3 site of the anterior vertebral body . the infusion was terminated when the cement arrived at the 1/5 site to the posterior wall of the vertebral body . all the percutaneous reduction pkp patients got out of bed 24 h later after surgery the open decompression and reduction pkp patients had to stay in bed for 2 months . the x - ray ( anteroposterior and lateral view ) comparisons before and after surgery were made using the cobb angle and visual analogue scale ( 0 - 10 , vas ) . cement seepage occurred in five cases , including one at the superior vertebral lamina , one at the inferior vertebral lamina , two at the anterior border , and one at the para vertebra . no clinical symptoms were found . as shown in table 1 , at day 2 after surgery , lumbago in all the patients ( rather than those open decompression patients ) was obviously relieved or even disappeared . the vas score was decreased to 3.77 0.44 from the preoperative 8.23 0.17 . the cobb angle was corrected to 3.8 0.2 from the preoperative 28.7 0.33. at 2 months after the surgery , lumbago gradually reappeared in 4 patients out of 12 who received treatment comparatively earlier . although such a symptom could be slightly relieved after rest , it progressively aggravated at 6 months . after the screws and rods were taken out , the symptom of the active pain disappeared . therefore , considering that this symptom might be caused by osteoporotic aggravation and higher relative rigidity of the screws , and after closed reduction the screws and rods were not left behind in the following 11 patients without the neurological symptom . not a similar symptom was found any more among them [ figures 1 and 2 ] . vas score and cobb angle ( n=26 , xs ) x - ray lateral views of a 72 years old male patient showing ( a ) l2 compression fracture before surgery ( b ) after surgery pedicle screw rod system with kyphoplasty ( c ) 6 months after surgery screws and rods have been removed x - ray images ( lateral view ) in a 68 years old male patient ( a ) preoperative x - ray showing compression fracture l1 vertebra ( b ) postoperative x - ray after kyphoplasty ovcf is a common disease among older people , and most of the cases are subjected to low energy injuries.2 previously , the common treatment method for ovcf was either conservative treatment or posterior screw - rod internal fixation . the conservative treatment in form of long bed rest may lead to more risky complications , like aggravation of the osteoporotic severity , increased nursing burden and cost . therefore , conservative treatment is not preferred in clinic nowadays.10 meanwhile , traditional open surgery always causes great trauma and hemorrhage to which most aged patients are intolerant . since the first successful application in c2 vertebral hemangioma treatment in the 1980s,11 pvp has been widely applied for in vertebral osteoporosis and tumor treatment . the potential of the technique also offers the possibility to apply localized pressure in the bone and push fragments in a well - controlled manner . however , pvp has a high bone cement seepage rate,12 which can lead to a fatal complication , i.e. , pulmonary embolism ( pe ) . for this it takes the advantage of the balloon catheter technique to reposition part of the collapsed vertebral body directly and promote the formation of the intrapyramidal air cavity , which can obviously decrease the risks of bone cement seepage13 and pe . therefore , the application of pkp in ovcf treatment has shown an increasing trend in recent years.14 but , posterior vertebral wall ruptures are still a generally accepted contraindication to pkp clinical application . the possible consequences caused by the use of pkp alone for ovcf patients with posterior vertebral wall ruptures may be : 1 ) the broken posterior vertebral wall causes bone cement to infuse into the spinal canal along the ruptures , which ultimately leads to disastrous effect on the contiguous spinal cord and nerves due to the heat produced during cement solidification ; and 2 ) the stress produced during balloon inflation forces the bone fragments into the spinal canal to compress the nerves . therefore , pkp must be carefully performed under the condition of an broken posterior vertebral wall.15 the benefit from screw - rod reduction before bone cement infusion lies in that the posterior longitudinal ligament can be propped open to enhance the strength of the posterior wall by letting the retro pulsed bony fragment fall in its place.16 a short - segment fixation was performed in these cases in order to reset the factures which was easy to cause active pain . therefore , for ovcf patients with posterior vertebral wall ruptures , screw - rod reduction before pkp is a better option . in the current study , in order to prevent too fast flow speed of liquid bone cement under a high pressure and to better control the penetration speed , cement in the doughy phase was infused rather than that in the drawing - off phase . furthermore , for the sake of safety from the bone cement delayed effect , the infusion was terminated when the cement arrived at the 1/5 site in the vertebral body to the posterior wall . bone cement infusion can achieve the goals of analgesia as well as internal fixation at the same time . however , as the sclerotin of older osteoporotic patients can not hold the internally fixated screws tightly , the screws are apt to cut the sclerotin leading to screw loosening and shedding - off this can be used to explain the active pain cases at 2 months after surgery in the current study . as the purpose of screw used in the current study was for intraoperative reposition , of retro pulsed fragment by indirect reduction the screws could be taken out when such purpose was achieved . however , whether delayed fractures will happen to the vertebral body due to sclerotin injuries after screw withdrawing and whether there is a need to infuse a small amount of bone cement to prevent such an injury , still remains to be explored . as this technique is a mature one , it has been confirmed that some biomechanical / cadaveric studies were conducted before the clinical use of the technique . meanwhile , although the balloon involved in the pkp technique has a certain role in reduction , more and more scholars and clinical experts point out that pkp can not achieve a satisfactory reduction effect on a compression of more than 80% , based on which some physicians adopt pkp combined with postural reduction.1718 in the current study , the results show that pkp combined with the screw - rod system can achieve a better effect than pkp alone . even for osteoporotic fractured vertebral bodies with an integral posterior wall , pkp combined with minimally invasive screw - rod reduction will be safer and more effective in treating osteoporotic fractures with a vertebral compression of above 2/3 than pkp combined with postural reduction . as long as experienced doctors control the needle position better and grasp the bone cement viscosity , pkp combined with the posterior screw - rod system would be applicated more and more widely .

background : the osteoporotic vertebral compression fractures ( ovcf ) have attracted more and more attention due to increase in life span globally and aging population . percutaneous vertebroplasty ( pvp ) and percutaneous kyphoplasty ( pkp ) have been popularized rapidly by virtue of their unique advantage in minimal invasiveness . we analysed our results in osteoporotic thoracolumbar fractures using percutaneous kyphoplasty and posterior screw rod system . to investigate the possibility of treatment of rupture of the posterior vertebral osteoporotic fractures by means of kyphoplasty combined with the posterior screw - rod system.materials and methods : twenty six patients ( 65 years of age or older ) with the single spine fractures included in study . the preoperative bone mineral density was measured by dual - energy x - ray . the pkp was done in all the cases . decompression was done if neurological symptoms were present.results:the results demonstrated osteoporosis with bmd t value 2.5 ; injured posterior vertebral body ( 3 cases ) had shown the whole damage accompanied by neurological symptoms through x - ray or ct . after 2 days , the remaining patients of back pain symptoms were relieved or disappeared except for three cases of patients with decompression incision . vas score and cobb angle changed from preoperative 8.23 0.17 and 28.7 0.33 respectively to postoperative 3.77 0.44 and 3.8 0.2 respectively.conclusion:treatment of rupture of the posterior vertebral osteoporotic thoracolumbar fractures by means of kyphoplasty combined with posterior screw - rod system is a safe , effective procedure .

I M Operative procedure R D

the malaria parasite , plasmodium , is a major public health burden in the developing world , and despite the existence of antimalarial treatment active in blood stages of infection , there is a continual need for novel drug design as the parasite develops resistance to current treatments . additionally , treatment for the hypnozoite - causing species , plasmodium vivax , requires primaquine , which has severe side effects and causes hemolysis in patients with glucose-6-phosphate dehydrogenase deficiency . discovery of novel compounds in antimalarial drug development is essential for future intervention strategies . atg8 is the ubiquitin - like ( ubl ) protein necessary for formation and maturation of autophagosomes in autophagy in eukarya . in yeast and mammals , atg8 is lipidated to the autophagosome membrane , but in plasmodium , atg8 is partially conjugated to the membrane of the apicoplast under nonstarvation conditions . the apicoplast is a nonphotosynthetic chloroplast - like organelle present in apicomplexans and is essential for isoprenoid synthesis . under starvation conditions , atg8 relocates to acidic vesicles with rab7 in and near the food vacuole . atg8 is essential to the plasmodium parasite and has been proposed as a target for antimalarial drug design . in most eukaryotes , lipidation of atg8 to phosphatidylethanolamine ( pe ) in membranes normally requires proteolytic processing of the c - terminus of atg8 by atg4 and activation via adenosine 5-triphosphate ( atp ) followed by intermediate thioester bond formation with the e1-activating enzyme atg7 . atg8 is then transferred to its e2-like conjugating enzyme atg3 , forming a second thioester intermediate before being conjugated to the nitrogen of pe ( figure 1 ) . this process also requires noncovalent interaction between atg8 and atg3 through a well - characterized atg8-interacting motif ( aim ) in atg3 and two hydrophobic pockets , termed the w and l - site , in atg8 . notably , in plasmodium , atg8 is synthesized with a c - terminal glycine and therefore does not require activation by atg4 . recently published studies showed a drastic growth defect in plasmodium falciparum when levels of pfatg7 were reduced . this along with the essentiality of plasmodium atg8 suggests that targeting pfatg8 lipidation is a good strategy for drug intervention . we previously elucidated the protein crystal structure of p. falciparum atg8 bound to a peptide corresponding to pfatg3 s aim ( pdb code 4eoy ) . regions of diversity exist between the human and plasmodium system that may be exploitable through small molecule inhibition . our mutational and interaction studies suggest that the plasmodium atg8-atg3 interaction requires atg8 s w / l site as well as the apicomplexan loop on atg8 ( residues 6776 ) , termed the a - loop . here , we report the identification of a class of compounds that inhibit the plasmodium atg8-atg3 interaction and that inhibit in vitro growth of p. falciparum in blood- and liver - stage assays , presumably through prevention of pfatg8 lipidation . previously , we developed a surface plasmon resonance ( spr)-based competition assay to identify compounds that disrupt the pfatg8-pfatg3 noncovalent interaction.pfatg3 is immobilized onto an spr chip , and pfatg8 is injected in the presence of dimethyl sulfoxide ( dmso , control ) or a compound ( dissolved in dmso ) , and binding is measured by the spr response . the medicines for malaria venture ( mmv ) malaria box of 200 druglike and 200 probelike molecules was screened at 5 m in a primary spr screen ( figure 2a ) . six compounds met the cutoff for at least 25% inhibition of the pfatg8-pfatg3 interaction : ( n-(4-methylphenyl)-4-pyridin-2-yl-1,3-thiazol-2-amine ) ( 1 ) , ( 2-methylsulfanyl - n-(4-pyridin-2-yl-1,3-thiazol-2-yl)benzamide ) ( 2 ) , ( 2-bromo - n-(4-pyridin-2-yl-1,3-thiazol-2-yl)benzamide ) ( 3 ) , n-[2-chloro-5-(trifluoromethyl)phenyl]-2-[2-(4-methylphenyl)pyrazolo[1,5-a]pyrazin-4-yl]sulfanylacetamide ( 4 ) , 1-[4-(dimethylamino)phenyl]-6,6-dimethyl-1,3,5-triazine-2,4-diamine ( 5 ) , and 2-n,3-n - bis(4-bromophenyl)quinoxaline-2,3-diamine ( 6 ) ( figure 2a,2b , table 1 ) . in subsequent dose - dependent studies , 46 demonstrated a constant level of inhibition independent of concentration of the small molecule and were not further investigated . compounds 13 led to dose - dependent inhibition with an spr inhibitory concentration ( ic50 spr ) ranging from 6 to 18 m ( figure 2c ) . interestingly , these compounds shared a common scaffold : 4-pyridin-2-yl-1,3-thiazol-2-amine ( pta ) incorporated as the n - substituent in various anilines or benzamides . 13 were tested for their effect on the stability of pfatg8 using fluorescence - based thermal shift assays ( tsas ) . none of the compounds significantly affected the melting temperature ( tm ) indicating that they most likely did not disturb the tertiary structure of pfatg8 ( figure 2d ) . pfatg8 was immobilized onto an spr ni - nitrilotriacetic acid ( nta ) chip via a 12 histidine n - terminal tag . 1 , chosen for its better solubility , was injected over the chip , and binding was measured . compound 1 led to a dose - dependent increase in spr response , indicating binding to pfatg8 ( figure 3a ) . we next sought to determine the binding site for the pta compounds with in silico docking . the openeye software package ( www.eyesopen.com ) was used to dock conformers of the compounds against the x - ray structure of pfatg8 ( pdb code 4eoy ) . all three compounds docked to the w - site of pfatg8 ( figure 3b ) . 2 and 3 bound with the pyridine ring in the w - site , whereas 1 was predicted to bind with the pyridine ring in the l - site , the thiazole ring positioned between the pockets , and the methylbenzene group in the w - site . an alternate pose was enriched within the top 10 poses output by the docking study in which 1 binds solely within the w - site in a more compact conformation . 1 is missing a donor oxygen compared to 2 and 3 and , therefore , may adopt a different mode of binding to the w- and l - sites of pfatg8 . 2 docked with the pyridine ring in the w - site , and the methylsulfanylbenzene group bound to the l - site of pfatg8 . docking was repeated using a version of the receptor for which the carbonyl of lys47 was input as a hydrogen bond acceptor constraint ( figure 3b inset ) . 1 had a similar binding pose to the highest ranked pose from the unconstrained docking , while 2 was slightly different with the pyridine ring rotated 90 in the w - site and the benzene ring positioned just below and to the left of the l - site pocket with the methylsulfanyl group reaching into the mostly hydrophobic l - site . the half maximal inhibitory concentrations ( ic50 ) for these compounds in p. falciparum 3d7 blood stages were previously reported and are located on the ncbi pubchem database ( http://pubchem.ncbi.nlm.nih.gov ) . 1 has a reported ic50 of 350400 nm ( pubchem bioassay i d ( aid ) : 660866 and 449703 ) . the reported ic50 for 2 ranged from 0.20 to 6.8 m , while 3 ranged from 1.36 to 4.52 m ( pubchem aid : 660866 and 449707 ) . we focused on compound 1 for further studies because the reported cytoxicity in human cell lines is much lower than that of compounds 2 or 3 ( pubchem aid : 660872 , 685525 , and 449705 ) . pfatg8 is expressed and lipidated during the liver stage where it partially localizes to the apicoplast . treatment of early liver stage parasites with the autophagy inhibitor 3-methyladenine is reported to delay conversion of the parasite into its trophozoite form . 1 was previously tested in plasmodium yoelii liver stage cultures and did not display > 50% inhibition at the screening concentration of 10 m ; an ic50 was not reported ( pubchem aid : 602118 and 602156).p . yoelii and plasmodium berghei are often used to test drugs for liver stage inhibition as they are easier to culture . however , these are rodent malaria models and may not be indicative of activity in p. falciparum . analysis of the w / l - site in these three species revealed differences in the amino acid composition that could affect drugs predicted to bind in that region ( figure 4 ) . we utilized a recently established p. falciparum liver stage in vitro model in which sporozoites isolated from infected mosquitos salivary glands invade hc-04 hepatocytes . hc-04 is a unique immortalized cell line that exhibits the expression of biochemical markers characteristic for normal hepatocytes and allows for the full development of the human malaria parasite , p. falciparum.(2022 ) using this system , we assessed the effect of 1 on the development of p. falciparum 3d7-green fluorescent protein ( gfp ) parasites in human hepatocytes in vitro . no change in the viability of hc-04 cells was detected in response to treatment with 3 m or 30 m of 1 for 96 h ( figure 5a ) . using flow cytometry , we observed about a 50% decrease in the proportion of hepatocytes infected with p. falciparum 3d7-gfp sporozoites ( gfp+/propidium iodide ( pi)- cells ) in response to treatment with 30 m , but not with 3 m of 1 ( figure 5b , c ) . additionally , there was a dose - dependent reduction in the intensity of gfp fluorescence at both concentrations of 1 , indicating inhibition of parasite development within hepatocytes , at least in vitro ( figure 5d ) . because 1 did not affect cell survival or cell growth of hc-04 cells ( figure 5a ) , the compound s effect on the parasite is unlikely to result from host cell cytotoxicity . we next sought to determine whether 1 had an effect on pfatg8 in p. falciparum blood stage cultures . in immunoblot assays , very low levels of endogenous pfatg8 were detected in dmso - treated control cells . incubation of cells in minimal media lacking human serum for 5 h led to a very slight increase in pfatg8 . in contrast , treatment with 50 m cytocidal levels of compound 1 led to a drastic increase in pfatg8 protein levels as well as to a shift in mobility , likely corresponding to the unlipidated form of pfatg8 . overall protein levels were unchanged , indicating an up - regulation or accumulation of pfatg8 in the presence of 1 under conditions that are likely leading to cell death ( figure s1 of the supporting information ) . after treating the parasites for 6 hours , a dose - dependent increase in delipidation of pfatg8 is already observed at 12.5 m of 1 , and at 25 m , unlipidated pfatg8 is the predominant species ( figure 6a , figures s2s4 of the supporting information ) . when investigating the soluble versus insoluble membrane fraction , pfatg8 could only be detected in the soluble fraction with the number of parasites used per lane . we attribute this to the low amount of pfatg8 present in the untreated control and to reaching the detection limit of our assay ( data not shown ) . at the treatment concentration and duration used in the study , our studies indicated that the pta scaffold is a good platform for hit - optimization . we synthesized a pta - benzaldehyde derivative , 4-formyl - n-(4-pyridin-2-yl-1,3-thiazol-2-yl)benzamide ( 7 ) , with a functional handle extending off the common hydrophobic ring system ( table 1 , scheme 1 ) . 7 was prepared from commercially available pta and 4-formyl benzoic acid through a dicyclohexylcarbodiimide ( dcc)-promoted amide coupling . compound 7 can be tethered through a dialkoxyamine linker to a library of aldehydes and can be screened using our primary spr competition assay against the pfatg8-pfatg3 interaction . in docking studies , 7 bound the w- and l - site of pfatg8 in a fashion similar to compound 2 with the functional handle positioned toward the a - loop pocket ( figure 7a ) . a gain in parasite selectivity for such bifunctional analogues is expected as the a - loop is missing in the human atg8 homologues . to confirm binding to pfatg8 , we tethered 7 to ( + ) -biotinamidohexanoic acid hydrazide ( bach ) through its reactive aldehyde group and tested binding with spr . his12-pfatg8 injected at various concentrations led to a dose - dependent increase in spr response indicating pfatg8 directly binds 8 with a kd of 540 nm . in contrast , the human atg8 homologue , microtubule - associated protein light chain 3 ( hlc3 ) showed much lower affinity for 8 with a kd of 18 m , indicating specificity of the pta scaffold for p. falciparum ( figure 7b ) . additionally , recombinant pfatg3 did not bind immobilized 8 ( data not shown ) in agreement with our docking studies suggesting binding to the w - site of pfatg8 . compound 7 was converted to the hydrochloride salt and was subjected to acid - catalyzed acetal formation with methanol and trimethyl orthoformate under microwave irradiation to provide the dimethyl acetal compound 9 , an unreactive derivative , to confirm the inhibitory activity of the starting platform ( table 1 , scheme 1 ) . 4-(dimethoxymethyl)-n-(4-pyridin-2-yl-1,3-thiazol-2-yl)benzamide 9 has a similar shape and distribution of the acceptor and donor pairs as the original pta compounds ( figure 7c ) and docked onto pfatg8 in a fashion similar to 7 ( figure 7a ) . spr studies confirmed that 9 inhibited the pfatg8-pfatg3 interaction with an ic50 of 2.86 m in spr ( figure 8a ) . we next measured growth inhibition of p. falciparum 3d7 by 1 using the sybr green i assay . this assay exploits the absence of nuclei in erythrocytes with a fluorescent dye that is unquenched upon binding to nucleic acids , preferentially double - stranded dna . in two of three independent experiments , the ic50 of 1 was 768 nm , similar to previously published results , while in a third experiment , the ic50 was 3.3 m , resulting in an average ic50 of 1.61 1.47 m . using this assay , 9 had a potency similar to that of compound 1 against the blood stage of p. falciparum with an average ic50 of 1.48 0.6 m ( figure 8b ) . we identified compound 1 through a screen for inhibitors against the plasmodium atg8-atg3 protein protein interaction ( ppi ) . targeting protein protein interactions has long been overlooked in the drug development field . it was thought to be difficult because of the shallower nature of many pockets and the more extensive network of residues involved in the interaction compared to an enzymatic site . however , ppis also offer the opportunity for more selectivity , an important concept when targeting a eukaryotic parasitic protein within a eukaryotic host . great methodological and technological advances have been made recently using this approach with promising leads in cancer drug development . in the case of our inhibitor , in addition to its potential as a therapeutic drug , any 1-derived inhibitor could serve as a tool to elucidate the function of pfatg8 during different stages of the malaria life cycle as its function is currently unclear . treatment of p. falciparum with high levels of 1 led to a drastic increase in pfatg8 protein levels , presumably the unlipidated form as judged by its migration in sodium dodecyl sulfate - polyacrylamide gel electrophoresis ( sds - page ) . this increase could be due to an up - regulation of pfatg8 synthesis to compensate for inhibition or due to a buildup of existing protein levels because of a blockade in autophagic degradation . in yeast , nitrogen starvation leads to induction of atg8 expression while inhibition of later stages of autophagy leads to accumulation and even greater protein levels of atg8 . further studies are necessary to determine if pfatg8 is up - regulated at the transcriptional , translational , or degradation level in response to treatment with 1 . this could be due to an accumulation of the drug inside the parasite or could be because even slight inhibition of pfatg8 lipidation has drastic effects on parasite growth , similar to reaching the tipping point on a balance . an alternative explanation is the result of off - target effects ; however , the observed delipidation of pfatg8 could not be attributed to an off - target effect . 1 was previously reported to have low cytotoxicity with an ld50 ( lethal dose ) of 18.2 m in hepg2 cells and half maximal cytotoxicity concentration ( cc50 ) and ic50 of 32 m in huh7 cells ( pubchem aid : 685525 , 660872 , 449705 ) . in our study together , this indicates 1 may be a good starting scaffold for antimalarial drug design . compound 1 had lower activity in the liver stage than in the blood stage , which could either indicate that pfatg8 is less important in the liver stage or that less compound is delivered to the parasite in liver cells . there is precedence for this variability in the efficacy of antimalarials between the liver and blood stages . compound 1 showed 50% inhibition of liver stage parasites at 30 m , which is within the range for cytotoxicity in human cells . we suggest the use of 1 and the pta scaffold for further probe development to increase specificity and potency in both the liver and blood stages . all pta - containing mmv compounds had a ligand efficiency by atom number ( lean ) score greater than 0.3 in the blood stage assay , indicative of good ligand efficiency and good potential for future drug optimization . this combined with the higher affinity of 8 for pfatg8 compared to human lc3 makes the pta scaffold a promising starting point for expansion . we are currently pursuing optimization through a combinatorial oxime library approach using 7 with the goal to extend the inhibitor into the a - loop pocket and to gain selectivity toward pfatg8 . our spr data confirm that 1 directly binds to pfatg8 , while our docking studies suggest that the pta scaffolds of compounds 13 , 7 , and 9 bind the w - site . the w - sites of atg8 homologues in mammals and yeast participate in numerous protein protein interactions through binding to the aromatic residue of an aim , including nonautophagic proteins . therefore , our inhibitor and its derivatives could be used to identify novel plasmodium atg8 interactions as well as to confirm paralogous interactions known to occur in yeast and mammalian cells . taken together , our bioinformatics analysis of the pta - binding site and the spr binding studies strongly suggest that the amino acid differences near the l- and w - site may have contributed to the failure of 1 in the p. yoelii liver stage drug - screening assay . two residue differences ( i8v , p9s ) adjacent to the w - site may lead to a widening of the w - site in p. yoelli because of their shorter side chains , and one residue ( v62i ) participating directly in the l - site results in an extended side chain and therefore may decrease the volume of the l - site pocket . additionally , l115 m just below the l - site binding pocket may also contribute to a decreased volume as a secondary shell residue . care and emphasis on choice of model system should be taken into account when studying protein ligand interactions , as single amino acid substitutions may have drastic effects on binding . his12-pfatg8 variants were expressed and purified with cobalt - nta affinity columns similar to his6-pfatg8 , as previously published with the exception that proteins were eluted from cobalt - charged talon resin ( clonetech ) in buffer containing 50 mm ethylenediaminetetraacetic acid ( edta ) rather than imidazole . spr runs were conducted on a biacore 3000 instrument ( ge healthcare ) at 25 c with a flow rate of 50 l / min , unless otherwise specified . running buffer ( rb ) consisted of 1 phosphate - buffered saline ( pbs ) ( 1 mm kh2po4 , 5.6 mm na2hpo4 , 154.5 mm nacl , ph 7.4 ) , 0.01% v / v p20 , and varying amounts of dmso ( quality biologicals ) . a double referencing method was applied to correct for nonspecific binding to the chip with interspersed blank injections correcting for baseline drifts . changes in refractive index because of dmso were accounted for with a dmso calibration curve . mbp - pfatg3 was immobilized onto a cm5 chip ( biacore ) as described previously with mbp immobilized on a reference flowcell . compounds were added to 300 nm his6-pfatg8 in rb at a final concentration of 5 m , and 40 l was injected , followed by a 12.5 l injection of 2 m mgcl2 for dissociation and regeneration of the spr chip surface . thirty microliters of pfatg8 at 200 nm was injected in the presence of a 2-fold dilution series of compound ( highest concentration of 50 m ) or equivalent volume of dmso ( final dmso concentration was 1% ) . his12-pfatg8 was injected over an nta - chip ( ge healthcare ) preconditioned with nickel , leading to capture of 3000 response units ( rus ) . running a 2-fold - dilution series of compounds , highest concentration of 75 m , was injected over pfatg8 variants at 40 l / min . 8 was injected over a neutravidin - coated spr chip ( ge healthcare ) on one flowcell , with 130 rus immobilized , while bach was injected over a reference flowcell ( 150 rus immobilized ) . his6-pfatg8 , human lc3 , or his6-pfatg3 was injected in duplicate in running buffer containing 10 mm hepes ph 7.5 , 150 mm nacl , 0.05% p20 . protein was dissociated from the chip after each cycle with 10 l injection of 20 mm hepes ph 7.4 , 1% w / v sds regeneration solution . all reagents were obtained from commercial suppliers and were used without further purification . acetonitrile was distilled after drying on cah2 and then was stored over 3 molecular sieves . dynamic adsorbents 3263 m silica gel was used for flash column chromatography , and 250 m f254 plates were used for thin layer chromatography ( tlc ) . microwave - assisted reactions were carried out using a biotage initiator microwave synthesizer ( 300 w ) . h and c nmr spectra were acquired on a bruker avance iii 500 spectrometer operating at 500 mhz for h and 125 mhz for c. chemical shift values are reported as ( ppm ) relative to chcl3 at 7.27 ppm and dmso at 2.50 ppm for h nmr and chcl3 at 77.0 ppm and dmso at 39.51 ppm for c nmr . mass spectrometry analysis was carried out at university of illinois at urbana - champagne , school of chemical sciences , mass spectrometry laboratory . the purity of synthesized compounds was 95% as analyzed by high - performance liquid chromatography ( hplc , beckman gold nouveau system gold ) on a c18 column ( grace alltima 3 m c18 analytical rocket column , 53 mm 7 mm ) using triethylammonium acetate buffer ( 50 mm , ph 7 ) and acetonitrile ( acn ) as eluent , flow rate 3 ml / min , and detection at 300 nm . to a solution of 4-(pyridin-2-yl)-1,3-thiazol-2-amine ( 0.059 g , 0.33 mmol ) in acetonitrile ( 2.0 ml ) was added sequentially dicyclohexylcarbodiimide ( 0.076 g , 0.37 mmol ) , 4-formylbenzoic acid ( 0.050 g , 0.33 mmol ) , and n , n - dimethylamino pyridine ( 0.012 g , 0.10 mmol ) . the mixture was heated at 50 c for 17 h and then was allowed to cool to ambient temperature . solids were removed by vacuum filtration , and the resulting filtrate was condensed under reduced pressure . the resulting yellow solid was redissolved in chcl3 ( 5 ml ) , and 1 m hcl ( 5 ml ) was added to give a yellow - tan emulsion at the liquid this solid was collected by centrifugation at 4000 rpm for 5 min followed by manual collection of the resulting cake ( this acid precipitation was necessary to remove closely eluting impurities ) . the solid was then purified by silica flash column chromatography ( dichloromethane(dcm):meoh : triethylamine 94:5:1 ) rf = 0.32 . the product was obtained as a yellow powder ( 23 mg , 22% yield ) . h nmr ( 500 mhz , dmso - d6 ) ( ppm ) = 12.95 ( br . s. , 1h ) , 10.13 ( s , 1h ) , 8.63 ( d , j = 3.93 hz , 1h ) , 8.31 ( d , j = 8.17 hz , 2h ) , 8.07 ( d , j = 8.33 hz , 2h ) , 8.03 ( d , j = 7.86 hz , 1h ) , 7.92 ( s , 1h ) 7.91 ( td , j = 2.00 hz , 8.75 hz , 1h ) , 7.35 ( ddd , j = 1.10 , 4.79 , 7.47 hz , 1h ) c nmr ( 500 mhz , dmso - d6 ) ( ppm ) = 192.90 , 164.74 , 158.91 , 152.03 , 149.54 , 149.38 , 138.50 , 137.30 , 137.15 , 129.41 , 128.94 , 122.88 , 120.06 , 112.30 . high - resolution mass spectrometry ( hrms , electrospray ionization , esi ) m / z : calcd 310.0650 ( m h ) ; found 310.0651 ( m h ) . twenty - five microliters 50 mm 7 dissolved in dmso was incubated with 20 l 50 mm bach ( 5-[(3as,4s,6ar)-2-oxo-1,3,3a,4,6,6a - hexahydrothieno[3,4-d]imidazol-4-yl]-n-(6-hydrazinyl-6-oxohexyl)pentanamide ) ( sigma - aldrich ) dissolved in dmso and 10 l sodium acetate ( ph 4.5 ) with 0.02% sodium azide at 37 c overnight . 7 dissolved in chcl3 was treated with 1 m hcl as described above to form the hydrochloride salt . 7 hcl ( 0.040 g , 0.12 mmol ) was suspended in meoh ( 0.5 ml ) , and trimethylorthoformate ( 0.010 ml , 0.91 mmol ) was added followed by p - toulene sulfonic acid monohydrate ( 0.003 g , 0.012 mmol ) . this solution was heated by microwave irradiation at 130 c in a sealed vial for 5 min and then was stirred at ambient temperature for 36 h at which time a precipitate formed . the solvent was removed under reduced pressure , and the residue was dissolved in dcm ( 10 ml ) and was washed with saturated nahco3 ( 10 ml ) and brine ( 10 ml ) and was dried with na2so4 . condensation under reduced pressure yielded the product as a yellow powder ( 26 mg , 61% yield ) . h nmr ( 500 mhz , cdcl3 ) ( ppm ) = 9.81 ( br s , 1h ) , 8.64 ( d , j = 4.24 hz , 1h ) , 7.96 ( d , j = 8.17 hz , 2h ) , 7.91 ( d , j = 7.86 hz , 1h ) , 7.74 ( s , 1h ) , 7.74 ( td , j = 1.73 , 7.70 hz , 1h ) , 7.62 ( d , j = 8.17 hz , 2h ) , 7.22 ( dd , j = 4.95 , 6.84 hz , 1h ) , 5.47 ( s , 1h ) , 3.35 ( s , 6h ) c nmr ( 500 mhz , cdcl3 ) ( ppm ) = 164.24 , 158.12 , 152.24 , 149.85 , 149.62 , 143.32 , 136.84 , 131.80 , 127.51 , 127.29 , 122.69 , 120.50 , 112.21 , 102.08 , 52.71 . hrms ( esi ) m / z : calcd 356.1069 ( m h ) ; found 356.1070 ( m h ) . assays were conducted in 1 pbs with 1:1800 final dilution of sypro orange dye ( invitrogen ) . fluorescence was measured from 20 to 80 c in a biorad c1000 thermal cycler . one hundred microliters of pta compounds or equivalent volume of dmso was added to his6-pfatg8 . the hc-04 cell line ( atcc , manassas , va , u.s . ) was maintained in complete medium ( imdm containing 2.5% fcs , 100 units / ml penicillin , 100 g / ml streptomycin , and 2 mm l - glutamine , all from gibco , life technologies , grand island , ny ) . p. falciparum 3d7-gfp parasite strain was propagated in the parasitology core facility , the johns hopkins malaria research institute . in vitro infection of human hepatocytes briefly , salivary glands were sequestered from infected anopheles gambiae mosquitoes at day 17 after exposure to infective blood meal , and homogenates were separated on an optiprep density gradient ( sigma - aldrich , st . sporozoites were collected from the gradient interface , were washed in complete medium , were counted using a hemocytometer , and were incubated with hc-04 cells at 3:1 sporozoite to hepatocyte ratio for 2 h at 37 c . infected cultures were further propagated in complete medium alone or in medium supplemented with 3 m or 30 m of 1 . flow cytometry based detection of infected cells was done 72 h post infection using facscalibur flow cytometer ( bd biosciences ) and was analyzed using flowjo software ( tree star , inc . , effect of 1 on the viability of in vitro propagated hc-04 cells was monitored as follows : 0.3 10 cells per well were seeded into the 24-well plate and were treated with 3 m or 30 m of 1 in complete medium for 96 h , and a relevant amount of dmso was used as a vehicle control . detection of annexin - v positive and pi - positive cells in hepatocyte cultures was done by flow cytometry according to the manufacturer s instruction ( invitrogen , life technologies , grand island , ny , u.s . ) . p. falciparum 3d7 and fcr3 cultures were maintained using modified , previously published methods at 37 c , 2% hematocrit of human red blood cells . complete culture media consisted of sterile rpmi 1640 media ( life technologies ) supplemented with 10% human serum and 0.005% hypoxanthine and buffered with final concentrations of 0.6% hepes and 0.26% nahco3 . the fcr3 strain was maintained at 3% co2 and 5% o2 , 92% n2 atmosphere , while the 3d7 strain was maintained at 5% co2 , 5% o2 , and 90% n2 atmosphere . j. smith , seattle biomed ) asynchronous culture , 25% parasitemia , was washed in starvation media lacking human serum and was resuspended in complete media with 50 m compound 1 or equivalent dmso or in starvation media with equivalent dmso for 5 h. rbcs were harvested with centrifugation and were lysed with 0.2% saponin , and rbc lysate was removed through three 1 pbs washes . parasites were harvested by centrifugation and were washed in 1 pbs with complete edta - free protease inhibitors ( roche ) and were lysed by repeated vortexing and boiling in sds reducing sample buffer . lysates were separated with sds - page on a 420% polyacrylamide gel and were subjected to western blotting with 1:400 -tgatg8 , demonstrated to be cross - reactive with pfatg8 ( generously provided by dr . hrp - conjugated secondary antibodies ( southern biotech ) were detected by supersignal west femto ( thermo scientific ) or amersham ecl prime ( ge healthcare ) chemiluminescent substrate . ap - conjugated secondary antibodies ( emd millipore ) were detected using nbt / bcip ( promega ) colorimetric stain . total protein levels were visualized with proact membrane stain ( amresco ) and were quantified with imagej . parasite morphology at time of harvesting was visualized with light microscopy at 100 magnification on olympus bx53 system microscope ( olympus america , inc . ) . ten microliters of 10 compound diluted in rpmi 1640 media ( gibco ) with a constant concentration of 1% dmso was added to a 96 well plate ( costar ) , 90 l of 1.5% ring stage , synchronized with 5% w / v sorbitol p. falciparum 3d7 parasites , 1% hematocrit , in culture media with 10% v / v human serum with 10 g / ml gentamycin . each compound concentration and 1% v / v dmso controls were run in triplicate . plates were incubated at 37 c in 5% o2 , 5% co2 , and 90% n2 for 72 h. plates were frozen , thawed , and incubated with 100 l 2 sybr green in lysis buffer ( 20 mm tris ph 7.5 , 5 mm edta , 0.008% saponin , 0.08% tritonx-100 ) in the dark for at least 1 h. fluorescence was measured with a plate reader ( hts 7000 , perkinelmer ) at excitation / emission wavelengths of 485/535 nm . docking was conducted using the openeye software package using standard parameters if not specified otherwise ( www.eyesopen.com ) . a receptor for pfatg8 was made with make_receptor from oedocking toolkit without constraints covering the whole molecule to detect potential binding pockets on the surface . three main pockets ( w - site , l - site , a - site ) were detected with 377 , 271 , and 513 volumes , used in first docking studies . a second receptor was generated with specific constraints to the carbonyl of lys47 as hydrogen bond donor . a maximum of 2000 conformers for each compound from the mmv malaria box was prepared with omega2 . fred was used to dock these conformers onto both the constrained and unconstrained receptor . docking results were visualized using the openeye visualization software , vida . using itasser , models of p. yoelii and p. berghei atg8 were generated with pdb code 4eoy as the parent molecule . default values as suggested by the web server were used to generate these models . sequences for p. yoelii ( pyym_0504500 ) and p. berghei ( pbanka_050410 ) were obtained from plasmodb . atg8 , represented by the rectangle , is essential to the elongation of the autophagosomal membrane . ( b ) generic conjugation pathway shown for yeast system . in plasmodium , atg8 is synthesized with a c - terminal glycine that does not require proteolytic processing for activation . identification of a common scaffold that inhibits atg8-atg3 from the mmv malaria box screen . ( b ) bar graph showing inhibition of hits in primary screen , denoted by compound number . inhibition was measured with increasing amount of compound in spr competition screen . mean and standard deviation ( sd ) of three injections are shown . error bars show sd of three measurements . identification of 1 binding site on pfatg8 . 1 was injected over immobilized pfatg8-variants in two separate runs at four concentrations . ( b ) in silico docking of pta compounds to pfatg8 ( pdb code 4eoy ) . overall structure of pfatg8 with w- and l - site and a - loop demarcated . docking was also performed with a hydrogen bond constraint to the carbonyl of lys47 , located between the w- and l - site . predicted pose for constrained docking is shown in green . for 1 , an alternate pose , it is highly ranked in the unconstrained docking and is enriched in the top 10 poses as shown in magenta . amino acid changes between the species are shown in red with p. falciparum letter and numbering followed by p. yoelii . w - site , l - site , and a - loop pockets are shown in mesh in cyan , purple , and green , respectively . falciparum atg8 pocket sizes were calculated with openeye vida visualization software ( www.eyesopen.com ) . effect of 1 treatment on the development of p. falciparum 3d7 gfp parasite in hc-04 cells in vitro . ( a ) flow cytometry based detection of annexin - v positive and pi - positive cells in hepatocyte cultures treated with 1 ( as described in experimental section ) . dot plot graphs demonstrate representative pattern of staining , and bar graphs show summary ( mean sd ) of viable cell detection obtained in three independent hepatocyte cultures . ( b ) viable infected hepatocytes ( gfp+/pi ) were detected by flow cytometry in hc-04 cultures 72 h post infection with p. falciparum . dot plot graphs demonstrate representative pattern of staining , and numbers reflect percentages of gfp positive cells in total pi negative cell populations . ( c ) summary ( mean sd ) of viable infected cell detection obtained in three independent hepatocyte cultures . ( d ) gfp - specific fluorescence was assessed in infected cultures exposed to 1 or dmso for 72 h. histograms demonstrate one representative staining pattern , and numbers reflect mean fluorescence intensity ( mfi ) in gfp - positive populations . bar graphs reflect gfp - specific mfi ( mean sd ) in viable cell population detected in three independent hepatocyte cultures . ( a ) dose - dependent immunoblot analysis of p. falciparum treated with dmso or 3.375 , 6.75 , 12.5 , or 25 m 1 for 6 h. chloroquine ( cq ) at 50 nm was used as a positive control of autophagy inhibition . the blot was probed with antibody against tgatg8 , demonstrated to be cross reactive against pfatg8 . ( b ) blood smears of p. falciparum after treatment with dmso or 50 m 1 for 5 h , observed at 100 magnification . representative images for different stages are shown , progressing from ring stage on the left to late schizont on the right . 7 ( yellow ) and 9 ( green ) were docked onto the constrained receptor of pfatg8 ( pdb code 4eoy ) with openeye docking suite . pfatg8 and hlc3 were injected over immobilized 8 , and binding was measured with spr . ( c ) superposition of small molecule hits derived from mmv malaria box with 9 . the individual molecular surfaces with their corresponding electrostatic potential are depicted in side and top view . all four molecules share the pta moiety and were superimposed using rocs via shape complementarity and tanimoto color scoring function . the figure was prepared with vida and was rendered in povray ( www.povray.org ) . ( a ) inhibition of pfatg8-pfatg3 interaction by 9 . spr response of pfatg8 injected over immobilized pfatg3 was measured in the presence of increasing concentration of 9 . sybr green i assays were used to measure inhibition by chloroquine ( cq ) , 1 , and 9 . growth inhibition curves are shown for one experiment with ic50 values from two to three experiments in table inset . pta - containing compounds used in studies listed with pubchem compound identification ( cid ) , mmv i d , chemical structure , molecular weight ( g / mol ) , ic50 in spr and blood stage assays , and lean score , calculated as log ( ic50)/number of heavy atoms . the organisms are maintained in licensed bsl2 facilities , and approvals are obtained annually for all consortia laboratories . human erythrocytes are obtained either commercially or from healthy volunteers under johns hopkins irb - approved protocols . because these cells are provided to the lab without identifiers

atg8 is a ubiquitin - like autophagy protein in eukaryotes that is covalently attached ( lipidated ) to the elongating autophagosomal membrane . autophagy is increasingly appreciated as a target in diverse diseases from cancer to eukaryotic parasitic infections . some of the autophagy machinery is conserved in the malaria parasite , plasmodium . although atg8 s function in the parasite is not well understood , it is essential for plasmodium growth and survival and partially localizes to the apicoplast , an indispensable organelle in apicomplexans . here , we describe the identification of inhibitors from the malaria medicine venture malaria box against the interaction of pfatg8 with its e2-conjugating enzyme , pfatg3 , by surface plasmon resonance . inhibition of this protein protein interaction prevents pfatg8 lipidation with phosphatidylethanolamine . these small molecule inhibitors share a common scaffold and have activity against both blood and liver stages of infection by plasmodium falciparum . we have derivatized this scaffold into a functional platform for further optimization .

Introduction Results Discussion Experimental Section

epilepsy is one of the chronic non - communicable diseases among the major causes of morbidity and mortality worldwide . it is also one of the public health problems and is a particular importance in developing countries where its incidence is found to be higher . epilepsy is a widely recognized health condition , but one that is poorly understood , even among people who know someone with the disorder . lack of knowledge about the causes of epilepsy has been associated with negative attitudes and beliefs . lack of understanding about epilepsy is a leading cause of stigma in the workplace and in schools . studies done to determine knowledge , attitude , and practice about epilepsy have shown that people living in different parts of the world and even those suffering from the disease have poor knowledge regarding the cause , nature , and treatment of epilepsy . epilepsy is traditionally looked upon as caused by ancestral spirits or attributed to possession by evil spirits . it is also thought to be due to witchcraft and poisoning and often thought to be contagious . in some communities , it is thought to be brought up on one as punishment for ones sins . in many parts of africa , the international league against epilepsy ( ilae ) , which represents medical practitioners and scientists and the international bureau for epilepsy ( ibe ) , which acts on behalf of patients and their families , have joined world health organization ( who ) in launching the global campaign to improve the treatment and social acceptance of epileptic patients . reducing the burden of epilepsy in low- and middle - income countries requires understanding of the cultural aspects of epilepsy but studies still demonstrated that there is poor knowledge about methods of dealing with seizures . the rational for conducting this research is to provide baseline information and document the extent of the problem . it will also help for planning future research in the area and will also , hopefully , stimulate concerned officials and organizations for interventions that include not only the extension of services , but also the training of the staff and educating the patients , and the public at large . this cross - sectional prospective study was conducted at jimma university specialized hospital ( jush ) from june 28 , 2013 to july 13 , 2013 using structured questionnaire . a formal ethical letter was obtained from jomma university college of public health and medical sciences ethical review board and allowance was given to the hospital before starting data collection . it provides clinical services for approximately 9,000 inpatient and 80,000 outpatient attendances per year coming to the hospital out of catchment population of about 15 million people . there are many clinics for follow - up of patients with chronic illness at the hospital among which the epilepsy clinic is one . there are 680 people currently on follow - up at the adult epilepsy clinic and is run by seniors physicians , residents , health officers ( ho ) , medical interns , clinical pharmacists , and nurses . all patients with epilepsy attending follow - up clinic at jush were considered as source population . patients less than 10 years who are on seizure attack at the time of data collection and patients with severe intellectual disability were excluded from the study . data collectors were trained about the objectives of the study and how to fill the questionnaires . the data collection was supervized daily and filled checklists were collected daily so as to check whether data was filled correctly or not . data was cleared , coded , and entered into the computer and analyzed by spss 16.0 statistical software . p - values and chi - square tests were calculated by using online chi - square calculator . a p - value of less than 0.5 was considered as a statistically significant association between variables in all tests . data was cleared , coded , and entered into the computer and analyzed by spss 16.0 statistical software . p - values and chi - square tests were calculated by using online chi - square calculator . a p - value of less than 0.5 was considered as a statistically significant association between variables in all tests . regarding the knowledge of the cause of epilepsy , 58 ( 32.2% ) of the respondents said , we do n't know the cause of epilepsy , 46 ( 25.5% ) respondents correctly said that epilepsy was caused by a brain damage or disease . and also , 44 ( 24.4% ) of the respondents said that the cause of epilepsy was from the others : like from god , 8 ( 4.4% ) of the respondents said that it was hereditary , 4 ( 2.2% ) of them believe that it is a punishment of sins , and 4 ( 2.2% ) said that epilepsy is transmitted through contacts with epileptic patients . regarding the aim of treatment of epilepsy , 108 ( 60% ) of respondents said that medications decrease the frequency of seizures , 66 ( 36.6% ) of them said that epilepsy is entirely cured by medications while 6 ( 3.3% ) said that medications do nothing [ tables 1 and 2 ] . socio - demographic characters and knowledge of epileptic patients in jimma university specialized hospital , june - july 2013 epileptic patients knowledge towards their illness , jimma university specialized hospital , june - july 2013 concerning attitude , 126 ( 70% ) of the respondents have a positive attitude , 29 ( 16.1% ) of the respondents have a negative attitude while the remaining 25 ( 13.8% ) were uncertain . 46 ( 25.5% ) of respondents with positive attitude are illiterate and 39 ( 21.6% ) of respondents with positive attitude are grade 1 - 8 . moreover , 63 ( 35% ) of single respondents have positive attitude and 57 ( 31.6% ) of married respondents have negative attitude . furthermore , 96 ( 53.3% ) of the respondents with positive attitude have income less than 100 birr per month . the association between attitude and duration of follow - up at jush epilepsy clinic is statistically significant [ tables 35 ] . attitude of epileptic patients towards their illness , jimma university specialized hospital , june - july 2013 attitude of epileptic patients by their socio - demographic factors jimma university specialized hospital , june - july 2013 knowledge of epileptic patients about cause and nature of epilepsy , jimma university specialized hospital , june - july 2013 regarding the measure taken during seizure attack , about 11.111% of respondents use method of lighting the match on the patient and putting the clothes in the mouth and positioning the patient accounts 6.67% and 53.33% , respectively [ table 6 ] . practice of epileptic patients during seizure attack , jimma university specialized hospital , june - july 2013 regarding the knowledge of the cause of epilepsy , 58 ( 32.2% ) of the respondents said , we do n't know the cause of epilepsy , 46 ( 25.5% ) respondents correctly said that epilepsy was caused by a brain damage or disease . and also , 44 ( 24.4% ) of the respondents said that the cause of epilepsy was from the others : like from god , 8 ( 4.4% ) of the respondents said that it was hereditary , 4 ( 2.2% ) of them believe that it is a punishment of sins , and 4 ( 2.2% ) said that epilepsy is transmitted through contacts with epileptic patients . regarding the aim of treatment of epilepsy , 108 ( 60% ) of respondents said that medications decrease the frequency of seizures , 66 ( 36.6% ) of them said that epilepsy is entirely cured by medications while 6 ( 3.3% ) said that medications do nothing [ tables 1 and 2 ] . socio - demographic characters and knowledge of epileptic patients in jimma university specialized hospital , june - july 2013 epileptic patients knowledge towards their illness , jimma university specialized hospital , june - july 2013 concerning attitude , 126 ( 70% ) of the respondents have a positive attitude , 29 ( 16.1% ) of the respondents have a negative attitude while the remaining 25 ( 13.8% ) were uncertain . 46 ( 25.5% ) of respondents with positive attitude are illiterate and 39 ( 21.6% ) of respondents with positive attitude are grade 1 - 8 . moreover , 63 ( 35% ) of single respondents have positive attitude and 57 ( 31.6% ) of married respondents have negative attitude . furthermore , 96 ( 53.3% ) of the respondents with positive attitude have income less than 100 birr per month . the association between attitude and duration of follow - up at jush epilepsy clinic is statistically significant [ tables 35 ] . attitude of epileptic patients towards their illness , jimma university specialized hospital , june - july 2013 attitude of epileptic patients by their socio - demographic factors jimma university specialized hospital , june - july 2013 knowledge of epileptic patients about cause and nature of epilepsy , jimma university specialized hospital , june - july 2013 regarding the measure taken during seizure attack , about 11.111% of respondents use method of lighting the match on the patient and putting the clothes in the mouth and positioning the patient accounts 6.67% and 53.33% , respectively [ table 6 ] . practice of epileptic patients during seizure attack , jimma university specialized hospital , june - july 2013 knowledge , attitude , and practice of patients towards a certain disease they conducted are important as they greatly determine the outcome especially for those diseases requiring lifelong therapy . the knowledge about epilepsy was found to be significantly associated to the duration of with epilepsy and months on follow - up . this might indicate that lack of adequate education by the health professionals concerning the disease before the commencement of therapy . various studies done to determine the knowledge of epilepsy have shown that people living with in different parts of the world and even those sufferers have poor knowledge regarding the cause , nature , and treatment of epilepsy . but in this study , majority of the sufferers were able to demonstrate a good knowledge regarding cause 46 ( 21.5% ) and treatment 108 ( 60% ) of epilepsy . the figure is nearly the same to similar studies done in usa , ohio where only 30% of the respondents know the cause of the disease . but in much lower as compared with the study in zambia which is high as 75% after an intervention from the initial 23.5% . though the figure of the study took the upper hand , the figure are very small with regard to zambia ; ideally almost all the patients are expected to have a good knowledge concerning the treatment of the disease but less regarding with the cause disease they are suffering from . so , the numbers more or less go with the trend of many countries where poor knowledge predominate . attitude plays an important role in the well - being of the patients as well as the overall of success of therapy . regarding attitude , 126 ( 70% ) of the respondents have a positive attitude , 29 ( 16.11% ) of the respondents have a negative attitude while the remaining 25 ( 13.8% ) were uncertain . the number of patients with positive attitude is extremely greater than the of negative and uncertain 's in combination . as epilepsy imposes serious burden on its sufferers which there was a statically significant association between attitude and age , occupation , marital status , monthly income , ethnicity of epileptic patients . these aged 20 - 35 ( 53.33% ) , single ( 51.11% ) , with monthly income less than 100 birr ( 72.2% ) , oromo ( 75.5% ) were found to good attitude towards epilepsy . the way in which one copes with epilepsy is an important determinant besides the knowledge and attitude , the practice of patient is as much important . in this study , majority of the patients , 170 ( 94.4% ) , were with good compliance as they strictly adhere to the instructions given by the health professionals . the in accessibility of health facilities with epileptic clinics poses a major threat to the adherence level . on the contrary to the above good practice 3.3% of the respondents used other modes of treatment , i.e. , spiritual treatment , prayers , and holy water in addition to modern medication . this study figure showed very lower than the study from urban centers in nigeria where only 33% of the patients preferred to combine medical treatment with traditional modes of treatment . this figure showed that the respondents have much more knowledgeable than that urban centers of nigeria concerning modern medication used . regarding first aid measure to be taken for seizing patients , 53.3% of the respondents suggested correctly positioning the patients to prevent aspiration . this finding is comparable with the study conducted in ohio , usa where 41% of the study subjects believed it is appropriate to place an object in the patient 's mouth during seizure to prevent injury . strengthen the communication between physicians and hospital pharmacy coordinator , and pharmacist who dispense drugs for epileptic patients must be necessary . if the gap between the above concerned bodies developed , the problem of medication discontinue can not be reduced as well , moreover , they have worked for the benefit of the patients when the patients are not properly hospitalized , their attitude towards have taken the medication changed . on the long run , this condition made them to take traditional medication rather than the modern one . from the study undertaken , it was found that the majority of the respondents have fair knowledge about the cause and nature of epilepsy and its treatment and about the first aid measures to be given to seizing patients . traditional and religious treatment , i.e. , spiritual treatment , prayers , and holy water are still practiced . a statistically significant association was found between knowledge and literacy status which implies that with an increasing level of formal educations , a knowledgeable society with a more positive attitude towards epilepsy can be expected .

background : epilepsy is a major public health problem and specially in developing countries where its incidence is found to be higher . in countries like ethiopia , epilepsy is thought as a supernatural happening and patients usually suffer from social discrimination and prejudice.aims:the objective of this study was to assess the knowledge , attitude , and practice of people with epilepsy regarding their illness and its treatment at jimma university specialized hospital ( jush).materials and methods : a cross - sectional hospital - based study was conducted among patients with epilepsy on follow - up at epilepsy clinic . the study was done between june and july 2013 and data was analyzed by using spss version 16.0.results:a total of 180 epileptic patients , on follow - up clinic , were interviewed out . a total of 25.5% and 60% of the respondents have knowledge about the cause and treatment of epilepsy , respectively . and , 70% of the respondents have positive attitude towards their treatment . about 53.3% of the respondents suggested correct positioning of the patients during seizure to prevent aspiration.conclusion:the study has showed that the majority of the respondents have medium knowledge and better attitude towards epilepsy and its treatments . they also have medium knowledge about the first aid measures to be taken for seizing patients .

Introduction Materials and Methods Statistical analysis Results Knowledge about epilepsy and its treatment Attitude towards epilepsy and its treatment Patients practice Discussion Conclusion

a 13-month - old , female , mixed breed , 4.0 kg cat was referred with a 6 month history of decreased appetite , loss of vigour and intermittent vomiting . physical examination revealed no cyanosis or wasting , and no audible heart murmur was auscultated . blood profile revealed mild anaemia and mildly elevated postprandial serum ammonia ( 109 g / dl ) . abdominal ultrasonography revealed dilation of an intrahepatic portal vein branch and an intrahepatic aneurysm , with splenomegaly and ascites . medical control was achieved using antibiotics , liver - protecting agents , a low - protein diet and blood transfusions . however , because medical treatment proved ineffective , coil embolisation was performed on day 11 , using a hybrid approach via the mesenteric vein . subsequent follow - up showed good appetite , with no signs of diarrhoea or ascites . abdominal ultrasonography revealed that the mosaic pattern around the site of coil placement in the portal vein branch had improved and pulsatility had disappeared . intrahepatic arterioportal fistula involves a circulatory shunt between the hepatic artery and the hepatic or portal vein within the liver , and may be congenital or acquired . both forms have been reported in humans , but most cases in cats have been congenital . we report here that coil embolisation using a hybrid approach is a procedure offering easy , effective treatment by blocking hepatofugal blood flow . intrahepatic arterioportal fistula ( ihapf ) is a congenital or acquired condition in which a circulatory shunt forms between the hepatic artery and a hepatic or portal vein within the liver . only three cases of ihapf have previously been described in cats , whereas congenital ihapf has been reported in 18 human cases . both congenital and acquired cases have been reported in people , but almost all reported cases in dogs and cats have been congenital . ihapf in dogs has been treated by hepatic lobectomy , feeding artery ligation and feeding artery glue embolisation . comparing results from these procedures , glue embolisation has been found to offer the best long - term prognosis . in people , ihapf has been treated by liver transplantation , feeding artery surgical ligation , feeding artery embolisation and end - to - side portocaval shunt . a previous study in cats only reported diagnosis , and treatment and prognosis have not been described . a cat with ihapf and multiple concomitant acquired portosystemic shunts was treated by coil embolisation via the mesenteric vein . coil embolisation using a hybrid approach was effective in blocking the direct flow of arterial blood into the intrahepatic portal vein branch . a 13-month - old , female , mixed - breed cat weighing 4.0 kg was referred to the animal medical center at the tokyo university of agriculture and technology with chronic decreased appetite , loss of vigour and intermittent vomiting from 7 months of age . physical examination revealed no cyanosis or wasting , and no heart murmur was auscultated . arterial blood pressure was within the normal range ( 139/98 mmhg [ mean arterial pressure 113 mmhg ] ) . complete blood count revealed mild anaemia with haematocrit ( hct ) 22.5% , and serum biochem - istry revealed elevated levels of aspartate aminotrans - ferase ( 114 u / l ) , alanine aminotransferase ( 366 u / l ) and preprandial serum ammonia ( 109 g / dl ) . levels of albumin ( 3.1 g / dl ) and total bile acid ( tba ) ( preprandial , 3.3 mol / l ; postprandial , 3.6 mol / l levels ) were within normal limits . abdominal ultrasonography revealed dilation of an intrahepatic portal vein branch and an intrahepatic saccular dilation ( maximum diameter 10.3 mm ) showing pulsatile mosaic perfusion . contrast - enhanced ( 4 ml iodine contrast agent ; iopamidol injection [ konica minolta health care ] ) ct confirmed dilation of a portal vein branch ( diameter 6.7 mm ) in the left lateral hepatic lobe with several tortuous vessels that appeared continuous with the hepatic artery and a nidus visible around the associated portal vein branch ( figure 1 ) . portal venous phase contrast - enhanced ct of the abdomen shows dilation and curvature of the portal vein branch ( ) in the left lateral hepatic lobe , with several tortuous vessels that appeared continuous with the hepatic artery and a nidus visible around the associated portal vein branch ( ) . multiple shunt vessels are seen in the abdominal cavity ( ) moderate splenomegaly and ascites were also present . based on these findings , hepatic arteriovenous fistula / hepatic artery the cat was medically controlled using antibiotics ( ampicillin sodium , 15 mg / kg q12h ) , liver - protecting agent ( ursodeoxycholic acid , 50 mg q12h ) and a low - protein diet with blood transfusions . however , because medical treatment proved ineffective , coil embolisation was performed on day 11 using a hybrid approach via the mesenteric vein . intravenous ( iv ) ampicillin sodium was administered at 30 mg / kg ( ampicillin na injection ; kyoritsu seiyaku ) to prevent infection , with iv buprenorphine hydro - chloride at 0.01 mg / kg ( lepetan 0.2 mg ; otsuka pharmaceutical ) as pain relief . following preadministration of a subcutaneous injection of atropine sulfate at 0.02 mg / kg , general anaesthesia was induced using 5% isoflurane ( isoflurane for animal use ; intervet ) . coil embolisation was performed via a transperitoneal approach under general anaesthesia maintained with isoflurane inhalation ( 3.54.0% ) . for the midline transperitoneal approach , the mesenteric vein was cannulated with an iv catheter , and portal venous pressure was 26/24 mmhg ( mean pressure 24 mmhg ) ( portal venous pressure in anaesthetised cats is 8.9 0.35 mmhg , with a mean of 7.38 2.7 mmhg ) . a wide area of greater omentum was pale and the colour of the intestines suggested congestion . anterograde angiography with iodine contrast agent ( 4 ml ) showed that the contrast medium injected into the portal vein branch immediately diverted into the mesenteric vein , and multiple shunts were visible in the abdominal cavity . congestion , dark - red colouration and varicose projections were apparent in part of the right medial hepatic lobe , which presented an extremely irregular texture . however , no abnormalities in external appearance were observed in the quadrate or left medial lobes . a small amount of pale - yellow ascites fluid was accumulated in the abdominal cavity . the splenic head was enlarged and dark red , and splenectomy to improve anaemia was performed using a vessel - sealing system ( ligasure ; covidien ) . after splenectomy , a 3 fr sheath was inserted in the proximal mesenteric vein and a 0.018 inch guidewire was introduced . a microcatheter ( virtus 2marker microcatheter ; boston scientific japan ) was then inserted under fluoroscopic guidance as far as the region of the arterioportal fistula . a detachable coil ( interlocking detachable coil , 12 mm , 20 cm 1 coil ; boston scientific japan ) was deployed inside the portal vein branch under fluoroscopic guidance . portal venous pressure was measured and peristaltic movements and colour of the intestines were checked , then five push - up coils ( cook push - up coils : 10 mm , 14.2 cm ; cook japan ) were added in order to embolise the intrahepatic portal vein ( figures 2 and 3 ) . portal venous pressure after coil embolisation was 27/23 mmhg ( mean pressure 25mmhg ) . postoperative condition was improved , with no diarrhoea or vomiting . the day after the operation ( day 12 ) , pulsatile mosaic perfusion on abdominal ultrasonography was decreased in the intrahepatic branches of the portal vein . on day 92 , the animal was vigorous and showed a good appetite , with no sign of diarrhoea or ascites . postprandial serum ammonia ( 197 g / dl ) showed no decrease and remained medically controlled using ursodeoxycholic acid , but no sign of hepatic encephalopathy was identified and the cat exhibited good levels of activity and a stable condition . , abdominal ultrasonography revealed that the mosaic pattern around the site of coil placement was nearly undetectable . contrast medium injected into the portal vein branch immediately diverts into the mesenteric vein and multiple thick shunts are also evident . portal venous pressure is 26/24 mmhg ( mean pressure 24 mmhg ) angiography after coil placement . the contrast medium injected reaches the proximal portal vein because the retrograde hepatofugal flow is blocked by the coils , but the right hepatic parenchyma is not clearly visualised . portal venous pressure after coil embolisation is 27/23 mmhg ( mean pressure 25 mmhg ) ihapf is extremely rare in cats , and our search of the literature suggests that this represents the first report of surgical treatment . clinical signs in this case were loss of vigour , decreased appetite , vomiting and ascites , similar to previous reports of this condition in dogs and cats . however , signs of hypoalbuminaemia and high tba were not observed in previous reports of canine cases , and no cases with vascular murmurs in the anterior abdomen have been reported . unlike the situation in dogs colour doppler ultrasonography has been reported as a useful tool for the diagnosis of ihapf in both cats and dogs . in the present case , ultrasonography revealed a dilation of an intrahepatic portal vein branch and an intrahepatic saccular dilation with pulsatile mosaic perfusion in the portal vein branch . contrast - enhanced ct also revealed a dilated portal vein branch , tortuous vessels and a nidus in the liver . these diagnostic tools are therefore very useful for the diagnosis of ihapf . in surgery , anterograde angiography from the mesenteric vein produced a stain only on a small part of the portal vein , suggesting that retrograde blood flow was entering from the hepatic artery via the fistula . ihapf in dogs has been treated surgically by hepatic lobectomy , arterial ligation or arterial glue embolisation . of these , glue embolisation has been found to offer the best long - term prognosis . hepatic lobectomy enables the removal of the lesion , as the origin of this disorder itself , and is useful if the ihapf has developed within a single hepatic lobe . however , this entails a risk of major haemorrhage , and the large amount of hepatic parenchyma removed may cause liver dysfunction . a study comparing outcomes between the various treatments found that lobectomy does not always provide favourable prognosis . coil embolisation reduces the risk of haemorrhage compared with lobectomy , although a recurrence of portal hypertension often occurs with congenital ihaph in people . vessel ligation at the site of the arteriovenous fistula can treat the shunt directly , but these procedures also require dissection of the hepatic parenchyma , resulting in a risk of major haemorrhage and extending surgical time . in the present case , the arteriovenous fistula was localised to the left lateral hepatic lobe , so anatomical lobectomy was possible . however , considering the anaemia and other conditions , intrahepatic portal vein branch embolisation was selected as a means of reducing the volume of haemorrhage and produced good outcomes . coils were chosen rather than glue embolisation , to enable accurate embolisation at the target position under conditions in which the iodine contrast agent was being pushed back by the strong blood flow from the artery via the fistula . performing coil embolisation using a hybrid approach , rather than percutaneously , reduces the distance to the target position compared with an approach via the neck . consequently , this makes the operation easier to perform , and enables additional coils to be placed while the state of the intestines is confirmed by visual inspection at the same time as measurements of portal venous pressure before and after coil placement . in this cat , high - pressure arterial blood flowing into the left intrahepatic portal vein branch from the hepatic artery branch created retrograde hepatofugal flow to the right hepatic lobe and the distal part of the portal vein , causing portal hypertension . this high - pressure hepato - fugal flow interferes with the natural flow of blood into the liver from the portal vein . the presence of splenomegaly also suggested an increase in the volume of blood flowing from the spleen to the liver . the portal vein hypertension generated by the inflow of hepatofugal arterial blood and its interference with the flow of portal venous blood into the liver was the underlying cause of the condition prior to coil placement . after coil placement , the inflow of hepatofugal arterial blood was stopped and portal venous blood could flow into the hepatic lobes . in the present case , no great change in portal venous pressure was observed before ( 26/24 mmhg [ mean pressure 24 mmhg ] ) and after coil placement ( 27/23 mmhg [ mean pressure 25 mmhg ] ) . this is similar to cases in dogs that have undergone hepatic lobectomy that have not exhibited major reductions in portal venous pressure immediately after lobectomy . this suggests that closure of the ihapf , the origin of the disease itself , does not immediately lead to a drop in portal venous pressure . increased retrograde hepatofugal flow may be related to histological findings , including fibrosis of the hepatic parenchyma at the ihapf and hypoplasia of the intrahepatic portal vein . even after closure of the ihapf , these hepatic changes remained and the increased portal venous pressure was maintained . the disappearance of retrograde hepatofugal flow may lead to the regeneration of hepatic tissue and decreases in portal venous pressure in the future . alternatively , the disappearance of hepatofugal flow may have been related to suppression of the intrahepatic arteriovenous fistula by the coils preventing flow from the high - pressure system of the hepatic artery to the low - pressure system of the portal vein . a previous study evaluated the prognosis for surgical treatment of intrahepatic arteriovenous fistula based on clinical signs . in that investigation , prognoses were divided into four types : excellent ( clinical signs resolved and no medical treatment required ) , good ( clinical signs resolved but some sort of medical treatment required ) , poor ( clinical signs continued or surgery - related death occurred ) and overall poor ( clinical signs exacerbated or intraoperative death ) . under this classification , good ( clinical signs resolved but administration of ursodeoxycholic acid continued ) , suggesting that the therapeutic outcome of this method was at least equivalent to those of previously applied surgical methods . the present case suggests that coil embolisation using a hybrid approach is a procedure that offers an easy and effective treatment by blocking hepatofugal blood flow . this procedure may therefore constitute an effective method of surgical treatment for feline ihapf .

case summarya 13-month - old , female , mixed breed , 4.0 kg cat was referred with a 6 month history of decreased appetite , loss of vigour and intermittent vomiting . physical examination revealed no cyanosis or wasting , and no audible heart murmur was auscultated . blood profile revealed mild anaemia and mildly elevated postprandial serum ammonia ( 109 g / dl ) . abdominal ultrasonography revealed dilation of an intrahepatic portal vein branch and an intrahepatic aneurysm , with splenomegaly and ascites . hepatic arteriovenous fistula / hepatic artery portal vein fistula with multiple acquired portosystemic shunts was strongly suspected . medical control was achieved using antibiotics , liver - protecting agents , a low - protein diet and blood transfusions . however , because medical treatment proved ineffective , coil embolisation was performed on day 11 , using a hybrid approach via the mesenteric vein . subsequent follow - up showed good appetite , with no signs of diarrhoea or ascites . abdominal ultrasonography revealed that the mosaic pattern around the site of coil placement in the portal vein branch had improved and pulsatility had disappeared.relevance and novel informationintrahepatic arterioportal fistula involves a circulatory shunt between the hepatic artery and the hepatic or portal vein within the liver , and may be congenital or acquired . both forms have been reported in humans , but most cases in cats have been congenital . few reports have described treatment methods or prognosis in cats . we report here that coil embolisation using a hybrid approach is a procedure offering easy , effective treatment by blocking hepatofugal blood flow .

Case summary Relevance and novel information Introduction Case description Discussion Conclusions

study design : the study was performed from july 2011 to september 2011 at a commercial pig farm located in jitian village , shuangliu county , chengdu , sichuan province , china . there had been no mass outbreaks of disease and less antimicrobial use at the farm in the past year . a total of 26 finishing pigs were selected and divided into the following 2 groups : the experimental ( ep ) group and the control ( cp ) group . each group of pigs was placed in different pens , and the 2 groups were managed by a single stockman . landrace , duroc and yorkshire crossbred pigs ( mixed males and females ) , 2 . same ages ( 90 days old ) with an average weight of 30 kg , 3 . antimicrobial administration and sampling : pigs were fed a control diet for 2 weeks before sampling . pigs in the ep group were orally fed ciprofloxacin ( 150 mg per pig ) once per day at noon for 30 days . we performed the feeding procedure in 2 steps : 1 ) half the fodder ( by weight ) was taken out , and an antimicrobial solution was sprayed onto it by mixing ; the mixture was then added into the corresponding feeder . 2 ) after the pigs ate all the mixture , the other half of the fodder without the antimicrobial was added in so that all the antimicrobials were eaten by pigs . no antimicrobials were used for the pigs in the cp group . the feeder would clean the floor of each pen after feeding the pigs . fresh feces ( > 5 g ) were picked from 5 different locations in each pen and mixed immediately . fecal samples were collected at noon on each sampling day within 1 hr post feeding . they were collected on days 0 , 1 , 2 , 4 , 6 , 11 , 16 , 21 , 26 , 31 , 36 , 41 , 46 , 51 , 56 and 61 . the fecal samples were placed into an ice box and transported to laboratory within 2 hr . counting of drug - resistant e. coli and total e. coli in fecal samples : one gram of each fecal sample was suspended in 10 ml pbs buffer ( 0.05 m ) , and the supernatant was collected after the sample was mixed fully . the supernatant was serially diluted 10-fold by using pbs buffer ( 0.05 m ) , and then 0.1 ml of each dilution , including the original dilution , was spread onto 2 types of culture medium : emb agar ( becton , dickinson and co. , sparks , md , u.s.a . ) containing no ciprofloxacin and ciprofloxacin - plus emb ( cip+emb ) agar containing 4 g / ml ciprofloxacin . after 24 hr of incubation at 37c , the numbers of qrec and total e. coli in feces were calculated according to the countable isolates on agar plates , and 10 e. coli clones were randomly picked from emb agar for further analysis . bacterial isolates and susceptibility testing : all the e. coli clones were identified by classical biochemical methods and confirmed with an api 20e system ( biomrieux , france ) . the susceptibility to quinolones of the e. coli clones was tested by determining the minimal inhibitory concentration ( mic , 0.0078125256 g / ml ) . the agar dilution method described by the clinical and laboratory standards institute ( clsi ) was used to test the mic of the antimicrobials , ciprofloxacin , nalidixic acid , norfloxacin and levofloxacin . e. coli clones were considered resistant or susceptible according to a standard introduced by the clsi . the reference e. coli strain atcc 25922 was used as an internal control in this study . statistical analysis for the mics of e. coli clones in the ep and cp groups : after the mics of e. coli clones from both the ep and cp groups were determined , we used the t - test in spss ( statistical product and service solutions ) 13.0 software to analyze the salient differences in the mics of e. coli clones between different points of time in the ep group and between the ep and cp groups . the e. coli clones were from the fecal samples collected on day 0 , 1 , 4 , 6 , 11 , 31 , 41 , 51 and 61 . dna sequence analysis and genotypic comparison of e. coli clones : by using the boiling method , dna of e. coli clones was extracted and reserved at 80c until use . the quinolone resistance - determining region ( qrdr ) genes ( gyra , parc ) were found to have point mutations with primers described previously [ 13 , 23 ] . four plasmid - mediated quinolone resistance ( pmqr ) genes ( qnrb , qnrs , aac ( 6)-ib - cr , and oqxab ) were detected by pcr with the primers shown in table 1table 1.primers used in this studytarget geneprimerssequence ( 5-3)size ( bp)annealing temperature ( c)accession no.qnrbqnrb -fcgacctgagcggcactgaat51557.5dq351241qnrb -rtgagcaacgatgcctggtagqnrsqnrs -fcatacatatcggcaccacaac63756ef683584qnrs -rcaggataaacaacaatacccagtaac ( 6 ) ib - craac -fttgcgatgctctatgagtggcta48255ef465463aac -rctcgaatgcctggcgtgtttoqxaboqxab -fgatcagtcagtgggatagttt62755hq674771oqxab -rtactcggcgttaactgatta . all the reactions were carried out in a final volume of 25 l containing 2.5 l of 10ex taq buffer , 2 l of mgcl2 ( 25 mm ) , 2 l of dntp ( 2.5 mm ) , 0.25 l of takara ex taq ( 5 u/l ) , 0.5 l of each primer ( 25 m ) and 1 l of dna samples . homologous analysis of e. coli clones was performed through enterobacterial repetitive intergenic consensus ( eric ) pcr amplication as described previously . the quantity one 4.6.2 software was used to analyze genetic relationships among different isolates . cluster analysis was performed using the unweighted pair - group method with average linkages . monitoring of bacterial growth : the growth rates of e. coli clones from 3 stages ( before ciprofloxacin administration , after ciprofloxacin administration and after ciprofloxacin withdrawal ) were determined by the method described previously . for each of the 3 stages , 5 e. coli clones were selected to measure the optical density at 600 nm ( od600 ) in luria - bertani ( lb ) medium . all the clones were initially cultured in lb medium at 37c for 16 hr , and then , the bacterial suspension was diluted to a determined density ( 10 cfu ) ; finally , 0.1 ml of the diluted culture was transferred into 3 ml lb medium for measuring the od600 . the number of qrec and total e. coli isolates : fecal samples contained a certain amount ( 10 cfu per gram of feces ) of qrec isolates before ciprofloxacin administration , and the amount of total e. coli isolates was 10 cfu per gram of feces . after ciprofloxacin administration , the number of qrec isolates increased from 10 cfu to 10 cfu , and on day 6 , the amount was stable ( 10 cfu ) . the number of total e. coli isolates decreased obviously from 10 cfu to 10 cfu after ciprofloxacin administration , but returned to a stable level on day 6 ( 10 cfu ) . after withdrawal , the numbers of qrec isolates and total e. coli isolates gradually decreased , and on day 56 , they finally decreased to the initial level seen before ciprofloxacin administration ( fig . 1.the number of qrec and total e. coli strains in fecal samples collected from experimentally treated pigs at 16 time points . ) . the number of qrec and total e. coli strains in fecal samples collected from experimentally treated pigs at 16 time points . antimicrobial resistance testing and statistical analysis : a total of 240 e. coli clones ( 160 clones from the ep group and 80 clones from the cp group ) were examined with the api 20e system . the results concerning the dynamics of the mics for the 240 e. coli clones are shown in fig . 2.the average mic of e. coli clones ( n=10 ) from fecal samples at 16 time points in the experimental group of pigs and at 8 time points in the control group of pigs . after 3 days of ciprofloxacin administration , the mic for ciprofloxacin increased from 0.5 to 8 g / ml ( 16-fold ) ; after 26 days of ciprofloxacin withdrawal , the mic decreased from 128 to 0.5 g / ml in the ep group . the mics for the 80 e. coli clones in the cp group maintained a stable value ( < 1 g / ml ) . according to the statistical analysis , the mics for the e. coli clones showed no significant difference between the ep and cp groups , in which the fecal samples were collected on days 0 , 51 and 61 ( p>0.05 ) , but there were significant differences between the 2 groups in which the fecal samples were collected on days 1 , 6 , 11 , 31 and 41 ( p<0.05 ) . in the ep group , after 3 days of ciprofloxacin administration , the mics for the e. coli clones showed significant differences compared with the e. coli clones from before ciprofloxacin administration ( day 0 ) . the average mic of e. coli clones ( n=10 ) from fecal samples at 16 time points in the experimental group of pigs and at 8 time points in the control group of pigs . detection of pmqr genes and mutations in qrdr genes : the pmqr genes ( qnrb , qnrs , aac ( 6)-ib - cr and oqxab ) were not detected in both the ep and cp groups . only the position 83 mutation of gyra was detected in some of the e. coli clones in the cp group during the whole study . in the ep group , after ciprofloxacin administration , the position 83 and 87 mutations of gyra and the position 80 mutation of parc were detected in e. coli clones with an mic 8 g / ml . after 26 days of ciprofloxacin withdrawal , only the position 83 mutation of gyra was detected ( table 2table 2.characteristics of e. coli isolates isolated from the fecal samples of pigs fed ciprofloxacin from days 1 to 30cip useday of fecescollectionmax mic ( g / ml)gyraparccipnalnorlvxmut 83 ( n)mut 87 ( n)mut 80 ( n)before ciprofloxacin administration016411s83l ( 4) ...... after cip administration1165121616s83l ( 6)d87n ( 4)s80i ( 4)2165121616s83l ( 6)d87n ( 4)s80i ( 6)4165121632s83l ( 10)d87n ( 10)s80i ( 10)632>10243232s83l ( 10)d87n ( 10)s80i ( 10)1132>10243232s83l ( 10)d87n ( 4)s80i ( 6)16128>10243232s83l ( 10)d87n ( 4 ) d87y ( 6)s80i ( 10)21128>10243232s83l ( 10)d87n ( 10)s80i ( 10)26128>10243232s83l ( 10)d87n ( 10)s80i ( 10)after cip withdrawal31128>10243232s83l ( 10)d87n ( 10)s80i ( 10)3632>10243232s83l ( 10)d87n ( 2 ) d87y ( 8)s80i ( 10)4164>10241616s83l ( 10)d87n ( 10)s80i ( 10)46325121632s83l ( 10)d87n ( 10)s80i ( 10)5185121616s83l ( 10)d87n ( 4)s80i ( 4)560.56422s83l ( 10) ...... 6116422s83l ( 10) ...... cip : ciprofloxacin , nal : nalidixic acid , nor : norfloxacin , lvx : levofloxacin , mic : minimal inhibitory concentration , n : number of e. coli with a point mutation . ) . cip : ciprofloxacin , nal : nalidixic acid , nor : norfloxacin , lvx : levofloxacin , mic : minimal inhibitory concentration , n : number of e. coli with a point mutation . homology of e. coli clones : cluster analysis of eric - pcr profiles of the e. coli clones from the 3 stages ( before ciprofloxacin administration , after ciprofloxacin administration and after ciprofloxacin withdrawal ) revealed a low level of similarity among the strains ( 6179% ) . growth rates of e. coli clones : the e. coli clones we used to measure growth rates were quinolones susceptible e. coli ( qsec ) from feces before ciprofloxacin administration ( day 0 ) and after ciprofloxacin withdrawal ( day 61 ) ; and the e. coli clones after ciprofloxacin administration ( day 26 ) were qrec clones . 3.growth profiles of e. coli clones ( n=5 ) from before ciprofloxacin administration ( bs - e . growth profiles of e. coli clones ( n=5 ) from before ciprofloxacin administration ( bs - e . this study was specifically designed to analyze the time - effect relationship between ciprofloxacin administration and quinolones resistance in fecal e. coli of finishing pigs and to test the hypothesis that the emergence of resistance in pigs requires drug accumulation for 7 days or more . a certain amount of qrec isolates was present in the intestine of pigs before ciprofloxacin administration , suggesting that resistant isolates could colonize the swine intestine , which is consistent with previous research . the use of antimicrobials can influence the number of intestinal microbiota in swine immediately , but the influence becomes smaller as time goes on , as the swine intestinal ecosystem was previously shown to remain stable with or without antimicrobial pressure . the dynamic changes in the number of qrec and total e. coli isolates suggest this . we found that a low - level dose ( 5 mg / kg ) of ciprofloxacin alone could alter the number of qrec isolates , but not the total number of e. coli isolates from feces of pigs . a recent study also showed that chlortetracycline alone at a low - level dose ( 50 g / ton ) had little effect on the microbial population of swine feces . but , in another study that investigated the intestinal microbiota after feeding a performance - enhancing mixture of 3 antimicrobials ( chlortetracycline 100 g / ton , sulfamethazine 100 g / ton and penicillin 50 g / ton ) to pigs , an increase was found in the e. coli population . the correlation between emergence of ciprofloxacin - resistant bacteria and ciprofloxacin treatment in humans or swine has been well characterized in recent years [ 11 , 22 ] . however , how medication time influences the emergence of resistance has not been revealed . according to the dynamics of the mic , we found that just 3 days were needed to develop quinolone resistance to fecal e. coli of pigs , which proves that our hypothesis that the emergence of resistance in pigs requires drug accumulation for 7 days or more is invalid . removing antimicrobial pressure can reduce the number of resistant bacteria , but the seeds of resistance could colonize in the animal farm environment for a long time . , quinolones have been used as therapy or feed additives in animals for many years , which has resulted in high quinolone resistance in bacteria [ 6 , 18 , 33 ] . the mechanism of quinolone resistance is mainly mediated by the mutation of gyra and parc genes . in this study , when the max mic of qsec to cip was 1 g / ml or less , only the gyra mutation was detected ; but , when the max mic was 16 g / ml or more , mutations of gyra and parc were both detected . these results suggest that mutations of the gyra gene could not mediate high - level quinolone resistance , but are necessary for high - level resistance , which is in agreement with previous reports [ 25 , 29 ] . low - level quinolone resistance can also be mediated by pmqr genes . however , we detected none of the described pmqr genes , suggesting that the emergency of qrec has little relation to the pmqr genes in this study . there was no similarity between e. coli clones that were separated from feces before ciprofloxacin administration , during ciprofloxacin administration and after ciprofloxacin withdrawal , illustrating that de novo selection of resistance mutants from the initial microbiota was not the cause of emergence of qrec . moreover , no plasmid - mediated resistance genes were detected in qsec and qrec clones . thus , the emergence of qrec may be caused by 2 possibilities : ( 1 ) enrichment of qrec in the initial gut microbiota and ( 2 ) exogenously acquired resistant bacteria . in both the ep and cp groups , we found a certain number of qrec isolates ( 10 cfu ) in feces from pigs before ciprofloxacin administration . therefore , we are inclined to believe that the more likely cause of qrec emergence was the enrichment of qrec in the initial gut microbiota . , we found that the qrec had a selective advantage from day 31 to day 56 , suggesting that the antimicrobial pressure did not disappear immediately after ciprofloxacin withdrawal , which is in agreement with a previous report . qrec with mutations in gyra and parc may have a fitness cost without antimicrobial pressure [ 1 , 26 ] . however , our findings indicate that without antimicrobial pressure , qrec lost its selective advantage after 26 days of ciprofloxacin treatment first , fecal samples were picked from just 5 different locations in the pens , but there were 13 pigs in each pen . second , qrec isolates , which were present in feces at a low concentration before ciprofloxacin administration , may have been missed when we selected only 10 clones for further research . this may have led to a lack of information about the relationship between e. coli resistance and antimicrobial residues . it has been shown that exogenous acquisition of resistant isolates is the cause for the emergence of qrec from an individual s feces . however , our results suggest that the enrichment of qrec in the initial gut microbiota is the more probable cause for the emergence of fecal qrec after feeding ciprofloxacin to pigs .

abstractescherichia coli resistance to quinolones has now become a serious issue in large - scale pig farms of china . it is necessary to study the dynamics of quinolone resistance in fecal escherichia coli of pigs after antimicrobial administration . here , we present the hypothesis that the emergence of resistance in pigs requires drug accumulation for 7 days or more . to test this hypothesis , 26 pigs ( 90 days old , about 30 kg ) not fed any antimicrobial after weaning were selected and divided into 2 equal groups : the experimental ( ep ) group and control ( cp ) group . pigs in the ep group were orally treated daily with 5 mg ciprofloxacin / kg of body weight for 30 days , and pigs in the cp group were fed a normal diet . fresh feces were collected at 16 time points from day 0 to day 61 . at each time point , ten e. coli clones were tested for susceptibility to quinolones and mutations of gyra and parc . the results showed that the minimal inhibitory concentration ( mic ) for ciprofloxacin increased 16-fold compared with the initial mic ( 0.5 g / ml ) after ciprofloxacin administration for 3 days and decreased 256-fold compared with the initial mic ( 0.5 g / ml ) after ciprofloxacin withdrawal for 26 days . gyra ( s83l , d87n/ d87y ) and parc ( s80i ) substitutions were observed in all quinolone - resistant e. coli ( qrec ) clones with an mic 8 g / ml . this study provides scientific theoretical guidance for the rational use of antimicrobials and the control of bacterial resistance .

MATERIALS AND METHODS RESULTS DISCUSSION

subjects are mexican american ( both parents and 3 grandparents mexican or of mexican descent ) who are either probands with gdm diagnosed within the previous 5 years and diagnosed in their family members or non - gdm probands with normal glucose levels in pregnancy in the past 5 years . the institutional review boards of participating institutions approved all protocols for betagene , and all participants provided written informed consent before participation . phenotyping was performed on two separate visits to the university of southern california general clinical research center . the first visit consisted of a physical examination , dna collection , and an oral glucose tolerance test ( ogtt ; 75 g ) as previously described ( 3335 ) . participants with fasting glucose < 126 mg / dl were invited back for a second visit , which consisted of a dual - energy x - ray absorptiometry scan for body composition ( percent of body fat ) and an insulin - modified intravenous glucose tolerance test ( ivgtt ) performed as previously described ( 37 ) . plasma glucose is measured on an autoanalyzer using the glucose oxidase method ( ysi model 2300 ; yellow springs instruments , yellow springs , oh ) . insulin is measured by two - site immunoenzymometric assay that has < 0.1% crossreactivity with proinsulin and intermediate split products . we attempted to replicate our findings in subjects participating in the ongoing metsim study ( 36 ) . the primary goal of the metsim study was to investigate the effect of genetic variation on risk for type 2 diabetes and cardiovascular disease in a random sample of finnish men ( aged 5070 years ) living in the town of kuopio , eastern finland ( population 95,000 ) . there were 5,327 men from this ongoing population - based study included in this report . the ethics committee of the university of kuopio and in accordance with the helsinki declaration approved the metsim study . phenotyping for metsim was performed in a single visit to the clinical research unit of the university of kuopio . in addition to fasting blood samples for dna , glucose , and insulin , all subjects underwent an ogtt with samples obtained at 30 and 120 min postload . in betagene , gkc 30ga polymorphism ( rs1799884 ) and g6pc2 rs560887 were genotyped using the taqman system ( applied biosystems ) ( 38,39 ) . genotyping discrepancy rate based on blinded duplicates was < 0.1% , and overall genotyping success rates were > 97% for rs1799884 and > 99% for rs560887 . in metsim , gck rs4607517 and g6pc2 rs560887 were genotyped by the homogeneous massextend reaction using the massarray system ( sequenom ) ( 9 ) . in the hapmap ceu data ( 40 ) , which provide a good representation of linkage disequilibrium in finns ( 41 ) , rs4607517 is a perfect proxy for rs1799884 ( d ' = 1.0 , r = 1.0 ) . there were no genotype discrepancies based on > 220 blinded duplicates , and overall genotyping success rates were > 96% for rs4607517 and > 94% for rs560887 . genotype data were tested for deviation from hardy - weinberg equilibrium and for non - mendelian inheritance using pedstats version 0.6.4 ( 42 ) . allele frequencies for betagene samples were estimated using all available data taking into account relatedness using solar version 2.1.4 ( 43,44 ) , whereas metsim frequencies were estimated by gene counting . we calculated two measures of insulin response to glucose : the difference between the 30 and fasting plasma insulin concentration from ogtt ( 30 insulin ) and the incremental area under the insulin curve for the first 10 min of the ivgtt ( air ) . ivgtt glucose and insulin data were analyzed using the minimal model ( minmod millennium version 5.18 ) to derive measures of glucose effectiveness and si ( 45 ) . disposition index , a measure of -cell compensation for insulin resistance , was computed as the product of si and air . we also computed an ogtt - derived measure of -cell compensation as the product of si and 30 insulin ( di30 ) . we initially examined the association between the two single nucleotide polymorphisms ( snps ) and fasting glucose , fasting insulin , 30 insulin , and air given our primary hypothesis that these variants may underlie variation in these specific quantitative traits . we recognized that these variants could also underlie variation in other type 2 diabetes related quantitative traits . we tested these snps for association with 2-h glucose , 2-h insulin , si , sg , bmi , and percent of body fat as a series of secondary analyses . we first tested each snp for association with type 2 diabetes related quantitative traits using likelihood ratio testing under a variance components framework as implemented in solar ( 43,44 ) . because families were ascertained through probands based on previous gdm status , we corrected for ascertainment bias by conditioning each model on the proband 's phenotype . each snp was tested for association with quantitative traits assuming a dominant genetic model because of the relatively low minor allele frequencies observed for both snps . all models were adjusted for age , sex , and , where appropriate , percent body fat . p values were corrected for multiple testing to account for the number of traits tested ( four traits in the primary analysis , six traits in the secondary analysis ) . we used pact to control for the number of tests performed and to account for the correlation among the quantitative traits tested for association ( 46 ) . pact compares the observed test statistic with their asymptotic distribution using numeric integration and directly accounts for correlation among both dependent and independent variables . next , we performed a test of the association between type 2 diabetes related quantitative traits and the interaction between gck and g6pc2 . we compared a model with age , sex , rs1799884 , and rs560887 as main effects with a second model that included the multiplicative interaction between the two snps . test and performed a bonferroni correction to account for the number of traits tested because pact is not valid for multi - d.f . tests ( 46 ) . however , because many of the quantitative traits examined are correlated and bonferroni assumes independence , the corrected p values we report should be overly conservative . given that gck and g6pc2 work in opposite directions on the glucose cycle , we hypothesized that additivity may best characterize their interaction . test to test the joint effect of rs1799884 and rs560887 for association with type 2 diabetes related quantitative traits . standard regression methods were used to test for association between genetic variants and type 2 diabetes related traits as metsim participants are unrelated individuals . given that only specific a priori hypotheses were tested in the metsim data , we did not apply a correction for multiple testing . all data for betagene are reported as age- and sex - adjusted means and sd , whereas metsim data are reported as age - adjusted means and sd unless noted otherwise . subjects are mexican american ( both parents and 3 grandparents mexican or of mexican descent ) who are either probands with gdm diagnosed within the previous 5 years and diagnosed in their family members or non - gdm probands with normal glucose levels in pregnancy in the past 5 years . the institutional review boards of participating institutions approved all protocols for betagene , and all participants provided written informed consent before participation . phenotyping was performed on two separate visits to the university of southern california general clinical research center . the first visit consisted of a physical examination , dna collection , and an oral glucose tolerance test ( ogtt ; 75 g ) as previously described ( 3335 ) . participants with fasting glucose < 126 mg / dl were invited back for a second visit , which consisted of a dual - energy x - ray absorptiometry scan for body composition ( percent of body fat ) and an insulin - modified intravenous glucose tolerance test ( ivgtt ) performed as previously described ( 37 ) . subjects are mexican american ( both parents and 3 grandparents mexican or of mexican descent ) who are either probands with gdm diagnosed within the previous 5 years and diagnosed in their family members or non - gdm probands with normal glucose levels in pregnancy in the past 5 years . the institutional review boards of participating institutions approved all protocols for betagene , and all participants provided written informed consent before participation . phenotyping was performed on two separate visits to the university of southern california general clinical research center . the first visit consisted of a physical examination , dna collection , and an oral glucose tolerance test ( ogtt ; 75 g ) as previously described ( 3335 ) . participants with fasting glucose < 126 mg / dl were invited back for a second visit , which consisted of a dual - energy x - ray absorptiometry scan for body composition ( percent of body fat ) and an insulin - modified intravenous glucose tolerance test ( ivgtt ) performed as previously described ( 37 ) . plasma glucose is measured on an autoanalyzer using the glucose oxidase method ( ysi model 2300 ; yellow springs instruments , yellow springs , oh ) . insulin is measured by two - site immunoenzymometric assay that has < 0.1% crossreactivity with proinsulin and intermediate split products . we attempted to replicate our findings in subjects participating in the ongoing metsim study ( 36 ) . the primary goal of the metsim study was to investigate the effect of genetic variation on risk for type 2 diabetes and cardiovascular disease in a random sample of finnish men ( aged 5070 years ) living in the town of kuopio , eastern finland ( population 95,000 ) . there were 5,327 men from this ongoing population - based study included in this report . the ethics committee of the university of kuopio and in accordance with the helsinki declaration approved the metsim study . phenotyping for metsim was performed in a single visit to the clinical research unit of the university of kuopio . in addition to fasting blood samples for dna , glucose , and insulin , all subjects underwent an ogtt with samples obtained at 30 and 120 min postload . in betagene , gkc 30ga polymorphism ( rs1799884 ) and g6pc2 rs560887 were genotyped using the taqman system ( applied biosystems ) ( 38,39 ) . genotyping discrepancy rate based on blinded duplicates was < 0.1% , and overall genotyping success rates were > 97% for rs1799884 and > 99% for rs560887 . in metsim , gck rs4607517 and g6pc2 rs560887 were genotyped by the homogeneous massextend reaction using the massarray system ( sequenom ) ( 9 ) . in the hapmap ceu data ( 40 ) , which provide a good representation of linkage disequilibrium in finns ( 41 ) , rs4607517 is a perfect proxy for rs1799884 ( d ' = 1.0 , r = 1.0 ) . there were no genotype discrepancies based on > 220 blinded duplicates , and overall genotyping success rates were > 96% for rs4607517 and > 94% for rs560887 . genotype data were tested for deviation from hardy - weinberg equilibrium and for non - mendelian inheritance using pedstats version 0.6.4 ( 42 ) . allele frequencies for betagene samples were estimated using all available data taking into account relatedness using solar version 2.1.4 ( 43,44 ) , whereas metsim frequencies were estimated by gene counting . we calculated two measures of insulin response to glucose : the difference between the 30 and fasting plasma insulin concentration from ogtt ( 30 insulin ) and the incremental area under the insulin curve for the first 10 min of the ivgtt ( air ) . ivgtt glucose and insulin data were analyzed using the minimal model ( minmod millennium version 5.18 ) to derive measures of glucose effectiveness and si ( 45 ) . disposition index , a measure of -cell compensation for insulin resistance , was computed as the product of si and air . we also computed an ogtt - derived measure of -cell compensation as the product of si and 30 insulin ( di30 ) . we initially examined the association between the two single nucleotide polymorphisms ( snps ) and fasting glucose , fasting insulin , 30 insulin , and air given our primary hypothesis that these variants may underlie variation in these specific quantitative traits . we recognized that these variants could also underlie variation in other type 2 diabetes related quantitative traits . we tested these snps for association with 2-h glucose , 2-h insulin , si , sg , bmi , and percent of body fat as a series of secondary analyses . we first tested each snp for association with type 2 diabetes related quantitative traits using likelihood ratio testing under a variance components framework as implemented in solar ( 43,44 ) . because families were ascertained through probands based on previous gdm status , we corrected for ascertainment bias by conditioning each model on the proband 's phenotype . each snp was tested for association with quantitative traits assuming a dominant genetic model because of the relatively low minor allele frequencies observed for both snps . all models were adjusted for age , sex , and , where appropriate , percent body fat . p values were corrected for multiple testing to account for the number of traits tested ( four traits in the primary analysis , six traits in the secondary analysis ) . we used pact to control for the number of tests performed and to account for the correlation among the quantitative traits tested for association ( 46 ) . pact compares the observed test statistic with their asymptotic distribution using numeric integration and directly accounts for correlation among both dependent and independent variables . next , we performed a test of the association between type 2 diabetes related quantitative traits and the interaction between gck and g6pc2 . we compared a model with age , sex , rs1799884 , and rs560887 as main effects with a second model that included the multiplicative interaction between the two snps . test and performed a bonferroni correction to account for the number of traits tested because pact is not valid for multi - d.f . however , because many of the quantitative traits examined are correlated and bonferroni assumes independence , the corrected p values we report should be overly conservative . given that gck and g6pc2 work in opposite directions on the glucose cycle , we hypothesized that additivity may best characterize their interaction . test to test the joint effect of rs1799884 and rs560887 for association with type 2 diabetes related quantitative traits . we attempted to replicate our findings in subjects participating in the ongoing metsim study ( 36 ) . the primary goal of the metsim study was to investigate the effect of genetic variation on risk for type 2 diabetes and cardiovascular disease in a random sample of finnish men ( aged 5070 years ) living in the town of kuopio , eastern finland ( population 95,000 ) . there were 5,327 men from this ongoing population - based study included in this report . the ethics committee of the university of kuopio and in accordance with the helsinki declaration approved the metsim study . phenotyping for metsim was performed in a single visit to the clinical research unit of the university of kuopio . in addition to fasting blood samples for dna , glucose , and insulin , all subjects underwent an ogtt with samples obtained at 30 and 120 min postload . in betagene , gkc 30ga polymorphism ( rs1799884 ) and g6pc2 rs560887 were genotyped using the taqman system ( applied biosystems ) ( 38,39 ) . genotyping discrepancy rate based on blinded duplicates was < 0.1% , and overall genotyping success rates were > 97% for rs1799884 and > 99% for rs560887 . in metsim , gck rs4607517 and g6pc2 rs560887 were genotyped by the homogeneous massextend reaction using the massarray system ( sequenom ) ( 9 ) . in the hapmap ceu data ( 40 ) , which provide a good representation of linkage disequilibrium in finns ( 41 ) , rs4607517 is a perfect proxy for rs1799884 ( d ' = 1.0 , r = 1.0 ) . there were no genotype discrepancies based on > 220 blinded duplicates , and overall genotyping success rates were > 96% for rs4607517 and > 94% for rs560887 . genotype data were tested for deviation from hardy - weinberg equilibrium and for non - mendelian inheritance using pedstats version 0.6.4 ( 42 ) . allele frequencies for betagene samples were estimated using all available data taking into account relatedness using solar version 2.1.4 ( 43,44 ) , whereas metsim frequencies were estimated by gene counting . we calculated two measures of insulin response to glucose : the difference between the 30 and fasting plasma insulin concentration from ogtt ( 30 insulin ) and the incremental area under the insulin curve for the first 10 min of the ivgtt ( air ) . ivgtt glucose and insulin data were analyzed using the minimal model ( minmod millennium version 5.18 ) to derive measures of glucose effectiveness and si ( 45 ) . disposition index , a measure of -cell compensation for insulin resistance , was computed as the product of si and air . we also computed an ogtt - derived measure of -cell compensation as the product of si and 30 insulin ( di30 ) . we initially examined the association between the two single nucleotide polymorphisms ( snps ) and fasting glucose , fasting insulin , 30 insulin , and air given our primary hypothesis that these variants may underlie variation in these specific quantitative traits . we recognized that these variants could also underlie variation in other type 2 diabetes related quantitative traits . we tested these snps for association with 2-h glucose , 2-h insulin , si , sg , bmi , and percent of body fat as a series of secondary analyses . we first tested each snp for association with type 2 diabetes related quantitative traits using likelihood ratio testing under a variance components framework as implemented in solar ( 43,44 ) . because families were ascertained through probands based on previous gdm status , we corrected for ascertainment bias by conditioning each model on the proband 's phenotype . each snp was tested for association with quantitative traits assuming a dominant genetic model because of the relatively low minor allele frequencies observed for both snps . all models were adjusted for age , sex , and , where appropriate , percent body fat . p values were corrected for multiple testing to account for the number of traits tested ( four traits in the primary analysis , six traits in the secondary analysis ) . we used pact to control for the number of tests performed and to account for the correlation among the quantitative traits tested for association ( 46 ) . pact compares the observed test statistic with their asymptotic distribution using numeric integration and directly accounts for correlation among both dependent and independent variables . next , we performed a test of the association between type 2 diabetes related quantitative traits and the interaction between gck and g6pc2 . we compared a model with age , sex , rs1799884 , and rs560887 as main effects with a second model that included the multiplicative interaction between the two snps . test and performed a bonferroni correction to account for the number of traits tested because pact is not valid for multi - d.f . however , because many of the quantitative traits examined are correlated and bonferroni assumes independence , the corrected p values we report should be overly conservative . given that gck and g6pc2 work in opposite directions on the glucose cycle , we hypothesized that additivity may best characterize their interaction . test to test the joint effect of rs1799884 and rs560887 for association with type 2 diabetes related quantitative traits . standard regression methods were used to test for association between genetic variants and type 2 diabetes related traits as metsim participants are unrelated individuals . given that only specific a priori hypotheses were tested in the metsim data , we did not apply a correction for multiple testing . all data for betagene are reported as age- and sex - adjusted means and sd , whereas metsim data are reported as age - adjusted means and sd unless noted otherwise . we report results from 861 betagene individuals in 251 families with available phenotype and genotype data ( table 1 ) . probands , siblings , and cousins were similar in median age , bmi , and percent of body fat , although these characteristics tended to be highest in the gdm probands and lowest in cousins . non - gdm probands were slightly younger and less obese compared with gdm probands , reflecting the fact that betagene participant accrual was ongoing and recruitment of non - gdm probands was slightly lagging to allow for matching as previously described ( 3335 ) . parameters of glucose metabolism tended to be best in the non - gdm probands and worst in the gdm probands . ( g > a ) had a minor allele frequency of 18.0% and was marginally associated with fasting glucose ( table 2 , p = 0.052 ) that modestly increased ( p = 0.021 ) after adjustment for body fat . individuals homozygous for the g allele had a lower average fasting glucose compared with those with at least one a allele ( 5.13 0.52 vs. 5.22 0.59 . however , the association between gck rs1799884 and fasting glucose did not remain significant when corrected for multiple testing . in addition , we did not observe any evidence for association between this snp and measures of insulin secretion ( table 2 ) or other type 2 diabetes related quantitative traits ( table 3 ) , although there was a tendency for mean fasting insulin , 30 insulin , and air to be lower in individuals with at least one rs1799884 a allele ( table 2 ) . univariate tests of associations between genetic variants and fasting glucose and measures of insulin secretion data are unadjusted means sd unless otherwise indicated . univariate tests of associations between genetic variants and additional type 2 diabetes related quantitative traits data are unadjusted means sd unless otherwise indicated . * age- and sex - adjusted p value not corrected for multiple testing . g6pc2 rs560887 ( g > a ) had a minor allele frequency of 14.5% and was nominally associated with fasting glucose ( table 2 , p = 0.015 ) and 30 insulin ( p = 0.0038 ) and marginally associated with air ( p = 0.088 ) . these associations became weaker when body fat was included in the model ( p = 0.059 , p = 0.014 , and p = 0.222 , respectively ) . individuals homozygous for the rs560887 g allele had an average fasting glucose higher than those with at least one a allele ( 5.19 0.52 vs. 5.08 0.61 both 30 insulin and air were , on average , higher in individuals homozygous for the g allele ( table 2 ) . only the association with 30 insulin remained significant after correction for multiple testing ( pact = 0.021 ) . although g6pc2 rs560887 was not associated with most type 2 diabetes related quantitative traits , we did observe an association between this snp and percent body fat ( pact = 0.035 ) , where individuals homozygous for the g allele had higher trait values ( table 3 ) . we found no evidence for association between the multiplicative interaction between gck rs1799884 and g6pc2 rs560887 and type 2 diabetes related quantitative traits ( uncorrected p > 0.26 ) , and additional adjustment for body fat did not change the overall results . in contrast , when we tested whether the additive effects of gck rs1799884 and g6cp2 rs560887 were associated with type 2 diabetes related quantitative traits , we observed association with fasting glucose ( bonferroni p = 0.03 ) and 30 insulin ( bonferroni p = 0.027 ) . bouatia - naji et al . reported a linear relationship between number of glucose - lowering alleles for gck , g6pc2 , and gckr and fasting glucose , which suggested additive effects of these alleles on fasting glucose ( 10 ) . we observed a similar linear relationship ( data not shown ) when we stratified gck and g6pc2 genotypes , consistent with the results of our statistical analysis and the observations of bouatia - naji et al . ( 10 ) . however , given the specificity of these two gene products in regulating the glucose - sensing step in pancreatic -cells , we hypothesized the primary effect of variation in gck and g6pc2 to be at the level of insulin secretion , not directly upon glucose . the presence of an a allele in the gck rs1799884 promoter variant is hypothesized to reduce gck gene expression and result in decreased gck protein ( 23 ) . this should result in modest reductions in glycolytic flux and atp production , resulting in modest reductions in insulin secretion for any level of circulating glucose . g6pc2 rs560887 is located in intron 3 , just 26 bp proximal to exon 4 ( 9,10 ) . the presence of an a allele may result in a g6pc2 isoform with differential activity that favors increased conversion of glucose-6-phosphate to glucose , significantly reducing glycolytic flux and atp generation , resulting in larger reductions in insulin secretion for any glucose level . the balance between the effects of gck and g6pc2 should differentially modulate insulin secretion , depending upon genotype combination as detailed in fig . 1 . hypothesized effect of gck rs1799884 and g6pc2 rs560887 genotype combinations on atp production and insulin secretion in pancreatic -cells . upper portion of the figure shows the glucose - cycling step and the effect of specific alleles in gck and g6pc2 on activity of each enzyme : thick arrow depicts increased activity , thin arrow depicts reduced activity . lower portion shows the specific genotype combinations and the hypothesized effect on atp production and subsequent insulin secretion . when we stratified individuals by gck and g6pc2 genotypes as depicted in fig . 2 , top ; p = 0.0016 ) is observed where on average , 30 insulin decreased 5.6 pmol / l among genotype groups . we do not see a clear linear relationship when the same stratification is used to examine the relationship with fasting glucose ( fig . thus , the linearity between gck and g6pc2 genotype combinations and insulin secretion does not directly translate into linear changes in fasting glucose . we observed a similar dichotomy when we examined fasting glucose and 30 insulin stratified by total number of glucose - raising alleles , as previously performed by bouatia - naji et al . ( 10 ) ; fasting glucose is linear with total number of glucose - raising alleles , whereas 30 insulin is not ( data not shown ) . a : age- and sex - adjusted 30 insulin ( means se ) stratified by gck rs1799884 and g6pc2 rs560887 genotype combination . genotype groups are ordered by hypothesized effect on glucose cycling in the pancreatic -cell ( see text for details ) . b : age- and sex - adjusted fasting plasma glucose ( means se ) stratified by genotype . therefore , we plotted fasting glucose against 30 insulin from betagene stratified by gck and g6pc2 genotypes ( fig . 3 , top ) to better characterize the relationship between 30 insulin and fasting glucose . we noted a different pattern of coordinate changes in fasting glucose and 30 insulin associated with variation in gck as compared with variation in g6pc2 . 3 , circles ) had lower fasting glucose and higher 30 insulin than individuals with at least one a allele ( fig . 3 , squares ) . for g6pc2 rs560887 , individuals homozygous for the g allele ( fig . 3 , open symbols ) had higher fasting glucose and higher 30 insulin than individuals with at least one a allele ( fig . variation in gck led to inverse changes in fasting glucose and 30 insulin , whereas variation in g6pc2 led to parallel changes in these two traits . the 30 insulin vs. fasting plasma glucose stratified by gck rs1799884 and g6pc2 rs560887 genotype . a : shows results from the betagene study . model - predicted age- and sex - adjusted 30 insulin ( means sd ) stratified by genotype is plotted against model- predicted age- and sex - adjusted fasting plasma glucose ( means sd ) . solid symbols represent g6pc2 rs560887 g / a or a / a genotypes and open symbols represent g6pc2 rs560887 g / g genotype . circles represent gck rs1799884 g / g genotype and squares represent gck rs1799884 g / a and a / a genotypes . b : shows results from the metsim study . details are identical to that described for the top panel except that circles and squares represent gck rs4607517 genotypes . given the observation of additivity between gck rs1799884 and g6pc2 rs560887 on fasting glucose and 30 insulin in betagene , we attempted to replicate these findings in the metsim sample , in which gck rs4607517 is in perfect linkage disequilibrium with rs1799884 . gck rs4607517 was associated with fasting glucose but not associated with 30 insulin ( table 4 ) . g6pc2 rs560887 was associated with fasting glucose and marginally associated with 30 insulin ( table 4 ) . the multiplicative interaction between gck rs4607517 and g6pc2 rs560887 was weakly associated with fasting glucose ( p = 0.038 ) and marginally associated with 30 insulin ( p = 0.049 ) . test of the joint additive effect of the two snps was significant for both fasting glucose ( p = 3.5 10 ) and 30 insulin ( p = 0.028 ) . the evidence for association between the joint additive effect of both snps and fasting glucose was not affected when bmi was included as an additional covariate ( p = 3.3 10 ) ; the association with 30 insulin became stronger when bmi was included as a covariate ( p = 0.0028 ) . when we examined the relationship between fasting glucose and 30 insulin stratified by gck rs4607517 and g6pc2 rs560887 genotype groupings , an identical pattern of relationship to that seen in betagene was observed ( fig . individuals homozygous for the g allele had lower fasting glucose and higher 30 insulin than individuals with at least one a allele . for g6pc2 rs560887 , individuals homozygous for the g allele had higher fasting glucose and higher 30 insulin than individuals with at least one a allele . univariate tests of associations between genetic variants and fasting glucose and 30 insulin in metsim data are unadjusted means sd unless otherwise indicated . we report results from 861 betagene individuals in 251 families with available phenotype and genotype data ( table 1 ) . probands , siblings , and cousins were similar in median age , bmi , and percent of body fat , although these characteristics tended to be highest in the gdm probands and lowest in cousins . non - gdm probands were slightly younger and less obese compared with gdm probands , reflecting the fact that betagene participant accrual was ongoing and recruitment of non - gdm probands was slightly lagging to allow for matching as previously described ( 3335 ) . parameters of glucose metabolism tended to be best in the non - gdm probands and worst in the gdm probands . ( g > a ) had a minor allele frequency of 18.0% and was marginally associated with fasting glucose ( table 2 , p = 0.052 ) that modestly increased ( p = 0.021 ) after adjustment for body fat . individuals homozygous for the g allele had a lower average fasting glucose compared with those with at least one a allele ( 5.13 0.52 vs. 5.22 0.59 . however , the association between gck rs1799884 and fasting glucose did not remain significant when corrected for multiple testing . in addition , we did not observe any evidence for association between this snp and measures of insulin secretion ( table 2 ) or other type 2 diabetes related quantitative traits ( table 3 ) , although there was a tendency for mean fasting insulin , 30 insulin , and air to be lower in individuals with at least one rs1799884 a allele ( table 2 ) . univariate tests of associations between genetic variants and fasting glucose and measures of insulin secretion data are unadjusted means sd unless otherwise indicated . univariate tests of associations between genetic variants and additional type 2 diabetes related quantitative traits data are unadjusted means sd unless otherwise indicated . * age- and sex - adjusted p value not corrected for multiple testing . g6pc2 rs560887 ( g > a ) had a minor allele frequency of 14.5% and was nominally associated with fasting glucose ( table 2 , p = 0.015 ) and 30 insulin ( p = 0.0038 ) and marginally associated with air ( p = 0.088 ) . these associations became weaker when body fat was included in the model ( p = 0.059 , p = 0.014 , and p = 0.222 , respectively ) . individuals homozygous for the rs560887 g allele had an average fasting glucose higher than those with at least one a allele ( 5.19 0.52 vs. 5.08 0.61 both 30 insulin and air were , on average , higher in individuals homozygous for the g allele ( table 2 ) . only the association with 30 insulin remained significant after correction for multiple testing ( pact = 0.021 ) . although g6pc2 rs560887 was not associated with most type 2 diabetes related quantitative traits , we did observe an association between this snp and percent body fat ( pact = 0.035 ) , where individuals homozygous for the g allele had higher trait values ( table 3 ) . we found no evidence for association between the multiplicative interaction between gck rs1799884 and g6pc2 rs560887 and type 2 diabetes related quantitative traits ( uncorrected p > 0.26 ) , and additional adjustment for body fat did not change the overall results . in contrast , when we tested whether the additive effects of gck rs1799884 and g6cp2 rs560887 were associated with type 2 diabetes related quantitative traits , we observed association with fasting glucose ( bonferroni p = 0.03 ) and 30 insulin ( bonferroni p = 0.027 ) . bouatia - naji et al . reported a linear relationship between number of glucose - lowering alleles for gck , g6pc2 , and gckr and fasting glucose , which suggested additive effects of these alleles on fasting glucose ( 10 ) . we observed a similar linear relationship ( data not shown ) when we stratified gck and g6pc2 genotypes , consistent with the results of our statistical analysis and the observations of bouatia - naji et al . ( 10 ) . however , given the specificity of these two gene products in regulating the glucose - sensing step in pancreatic -cells , we hypothesized the primary effect of variation in gck and g6pc2 to be at the level of insulin secretion , not directly upon glucose . the presence of an a allele in the gck rs1799884 promoter variant is hypothesized to reduce gck gene expression and result in decreased gck protein ( 23 ) . this should result in modest reductions in glycolytic flux and atp production , resulting in modest reductions in insulin secretion for any level of circulating glucose . g6pc2 rs560887 is located in intron 3 , just 26 bp proximal to exon 4 ( 9,10 ) . the presence of an a allele may result in a g6pc2 isoform with differential activity that favors increased conversion of glucose-6-phosphate to glucose , significantly reducing glycolytic flux and atp generation , resulting in larger reductions in insulin secretion for any glucose level . the balance between the effects of gck and g6pc2 should differentially modulate insulin secretion , depending upon genotype combination as detailed in fig . 1 . hypothesized effect of gck rs1799884 and g6pc2 rs560887 genotype combinations on atp production and insulin secretion in pancreatic -cells . upper portion of the figure shows the glucose - cycling step and the effect of specific alleles in gck and g6pc2 on activity of each enzyme : thick arrow depicts increased activity , thin arrow depicts reduced activity . lower portion shows the specific genotype combinations and the hypothesized effect on atp production and subsequent insulin secretion . when we stratified individuals by gck and g6pc2 genotypes as depicted in fig . 2 , top ; p = 0.0016 ) is observed where on average , 30 insulin decreased 5.6 pmol / l among genotype groups . we do not see a clear linear relationship when the same stratification is used to examine the relationship with fasting glucose ( fig . thus , the linearity between gck and g6pc2 genotype combinations and insulin secretion does not directly translate into linear changes in fasting glucose . we observed a similar dichotomy when we examined fasting glucose and 30 insulin stratified by total number of glucose - raising alleles , as previously performed by bouatia - naji et al . ( 10 ) ; fasting glucose is linear with total number of glucose - raising alleles , whereas 30 insulin is not ( data not shown ) . a : age- and sex - adjusted 30 insulin ( means se ) stratified by gck rs1799884 and g6pc2 rs560887 genotype combination . genotype groups are ordered by hypothesized effect on glucose cycling in the pancreatic -cell ( see text for details ) . b : age- and sex - adjusted fasting plasma glucose ( means se ) stratified by genotype . therefore , we plotted fasting glucose against 30 insulin from betagene stratified by gck and g6pc2 genotypes ( fig . 3 , top ) to better characterize the relationship between 30 insulin and fasting glucose . we noted a different pattern of coordinate changes in fasting glucose and 30 insulin associated with variation in gck as compared with variation in g6pc2 . 3 , circles ) had lower fasting glucose and higher 30 insulin than individuals with at least one a allele ( fig . 3 , squares ) . for g6pc2 rs560887 , individuals homozygous for the g allele ( fig . 3 , open symbols ) had higher fasting glucose and higher 30 insulin than individuals with at least one a allele ( fig . variation in gck led to inverse changes in fasting glucose and 30 insulin , whereas variation in g6pc2 led to parallel changes in these two traits . the 30 insulin vs. fasting plasma glucose stratified by gck rs1799884 and g6pc2 rs560887 genotype . a : shows results from the betagene study . model - predicted age- and sex - adjusted 30 insulin ( means sd ) stratified by genotype is plotted against model- predicted age- and sex - adjusted fasting plasma glucose ( means sd ) . solid symbols represent g6pc2 rs560887 g / a or a / a genotypes and open symbols represent g6pc2 rs560887 g / g genotype . circles represent gck rs1799884 g / g genotype and squares represent gck rs1799884 g / a and a / a genotypes . b : shows results from the metsim study . details are identical to that described for the top panel except that circles and squares represent gck rs4607517 genotypes . given the observation of additivity between gck rs1799884 and g6pc2 rs560887 on fasting glucose and 30 insulin in betagene , we attempted to replicate these findings in the metsim sample , in which gck rs4607517 is in perfect linkage disequilibrium with rs1799884 . gck rs4607517 was associated with fasting glucose but not associated with 30 insulin ( table 4 ) . g6pc2 rs560887 was associated with fasting glucose and marginally associated with 30 insulin ( table 4 ) . the multiplicative interaction between gck rs4607517 and g6pc2 rs560887 was weakly associated with fasting glucose ( p = 0.038 ) and marginally associated with 30 insulin ( p = 0.049 ) . test of the joint additive effect of the two snps was significant for both fasting glucose ( p = 3.5 10 ) and 30 insulin ( p = 0.028 ) . the evidence for association between the joint additive effect of both snps and fasting glucose was not affected when bmi was included as an additional covariate ( p = 3.3 10 ) ; the association with 30 insulin became stronger when bmi was included as a covariate ( p = 0.0028 ) . when we examined the relationship between fasting glucose and 30 insulin stratified by gck rs4607517 and g6pc2 rs560887 genotype groupings , an identical pattern of relationship to that seen in betagene was observed ( fig . individuals homozygous for the g allele had lower fasting glucose and higher 30 insulin than individuals with at least one a allele . for g6pc2 rs560887 , individuals homozygous for the g allele had higher fasting glucose and higher 30 insulin than individuals with at least one a allele . univariate tests of associations between genetic variants and fasting glucose and 30 insulin in metsim data are unadjusted means sd unless otherwise indicated . our results from mexican americans , replicated in a sample of finnish men , show that variation in both gck and g6pc2 have additive effects on both fasting glucose and insulin secretion . our examination of the relationship between 30 insulin and fasting glucose stratified by gck and g6pc2 genotype reveals that the joint effect of genetic variation in these two genes may be through distinct mechanisms . variation in gck leads to inverse changes in fasting glucose and insulin secretion , consistent with a primary effect on insulin secretion . variation in g6pc2 leads to parallel changes in fasting glucose and insulin secretion , suggesting a primary effect on glucose , with secondary changes in insulin secretion . table 5 summarizes our examination of the effects of gck rs1799884 and g6pc2 rs560887 on fasting glucose and 30 insulin . although it is possible that our conclusion of these variants having an additive effect could be driven mainly by g6pc2 rs560887 , the summary in table 5 suggests otherwise . it is clear that in both betagene and metsim , the model testing the joint effect of gck and g6pc2 shows greater significance than the effect of each individual gene variant alone , which suggests both genes are contributing to the effect on fasting glucose and 30 insulin . in support of this observation , when we tested for the additional effect of gck in the presence of g6pc2 we observed marginal or significant effects for fasting glucose ( p = 0.058 for betagene ; p = 0.0009 for metsim ) and 30 insulin ( p = 0.148 for betagene ; p = 0.723 for metsim ) . our a priori hypothesis tested whether the multiplicative interaction between rs1799884 and rs560887 was associated with type 2 diabetes related quantitative traits . in betagene we observed no evidence for a multiplicative interaction ; our analysis favored a joint additive effect of these two loci . however , our relatively small size may limit our ability to exclude a multiplicative interaction . a priori power estimates indicated that a sample size of 600 should have provided 80% power to detect a multiplicative interaction effect that accounted for 1.8% of the variability in fasting glucose or 30 insulin , assuming = 0.01 , minor allele frequencies of 15% for both loci , and dominant genetic models for both loci . thus , betagene can not discount the possibility that a very weak multiplicative interaction exists between these two loci . in fact , the metsim sample , which is 6 times larger than betagene , showed modest evidence for a multiplicative interaction ( table 5 ) suggesting that a weak multiplicative interaction between gck and g6pc2 could be contributing to variation in fasting glucose and 30 insulin . this interaction would need to be replicated in a sample of similar or larger size . summary of modeling analysis data are uncorrected p values for the genetic effect being tested . our initial examination of the additive effect of these two genes was motivated by the fact that when we plotted 30 insulin against gck rs1799884 and g6pc2 rs560887 genotype combinations sorted by the hypothesized biologic effect on insulin secretion , we observed a linear relationship with 30 insulin . recently , pirot et al . ( 47 ) showed in mouse and human islets that g6pc2 protein levels and enzymatic activity increased when islets were incubated in high - glucose media , whereas those for gck did not change , suggesting that g6pc2 activity may adapt to changes in glucose to alter insulin secretion . because insulin secretion was not measured , it is unclear whether the changes observed translated into altered rates of insulin secretion . however , previous studies have demonstrated that manipulation of glucose cycling in insulin - secreting cell lines does result in changes in insulin secretion ( 31,32 ) . for example , iizuka et al . ( 32 ) showed that altering glucose cycling by varying the g6pc2-to - gck ratio leads to reductions in atp production and reduced glucose - stimulated insulin secretion in min-6 cells . taken together , these studies examining the balance between gck and g6pc2 support our hypothesized effects of variation in gck and g6pc2 on insulin secretion ( compared with fig . however , they do not account for the differences we observed in the relationship between fasting glucose and insulin secretion when stratified by these two loci . primary enhancement of -cell sensitivity to glucose should result in increased systemic insulin concentrations in relation to glucose levels . the fact that the linearity in 30 insulin we observed between gck rs1799884 and g6pc2 rs560887 genotype combinations did not extend to fasting glucose ( compared with fig . we confirmed this initial observation by examining the relationship between fasting glucose and 30 insulin , stratifying on gck and g6pc2 genotype ( compared with fig . the presence of the gck rs1799884 a allele resulted in lower 30 insulin and higher fasting glucose , regardless of g6pc2 genotype . the results suggest that variation in gck may alter insulin secretion and fasting glucose in the traditionally envisioned manner where changes in insulin secretion result in reciprocal changes in glucose concentration . however , the presence of a g6pc2 a allele resulted in both lower 30 insulin and fasting glucose , regardless of gck genotype . first , variation in g6pc2 could have a direct and independent effect to regulate hepatic glucose production . this effect is unlikely because the hepatic isoform of glucose-6-phosphatase is encoded by an independent gene . second , variation in g6pc2 could alter a characteristic of insulin secretion that disrupts the normal signaling between the pancreas and other tissues , resulting in both insulin secretion and glucose changing in tandem . specifically , their studies show that in canines with partial pancreas resection or in rats transgenic for human islet amyloid polypeptide , disruption of pulsatile insulin secretion results in hepatic insulin resistance and impaired fasting glucose ( a. matveyenko , personal communication ) . they conclude that the loss of pulsatile insulin secretion results in a loss of efficiency in insulin action at the liver , leading to hepatic insulin resistance and increased glucose output , which subsequently leads to a gradual rise in glucose levels . variation in g6pc2 may disrupt pulsatility in insulin secretion , thereby reducing insulin - signaling efficiency between the pancreas and liver . the small increase in glucose because of hepatic insulin resistance may result in modest increases in absolute insulin secretion . additional studies will be required to test this hypothesis . finally , we observed association between g6pc2 rs560887 and measures of adiposity that have not been previously reported . bmi and body fat were both lower in the presence of the a allele ( compared with table 3 ) , but the biologic mechanism underlying this association is unclear . one possibility is that if variation in g6pc2 results in decreased insulin - signaling efficiency because of the loss of pulsatility and leads to hepatic insulin resistance , then a similar loss of insulin signaling may occur in other tissues , such as adipose . our observed association between variation in g6pc2 and adiposity will require replication in other populations and further study to elucidate the mechanism underlying the association . in conclusion , we observed evidence for an additive effect of variation in gck ( rs1799884 ) and g6pc2 ( rs560887 ) on insulin secretion and fasting glucose . when stratified by genotype , the effect of gck rs1799884 follows an expected pattern of reduced insulin secretion and reciprocal increase in fasting glucose . by contrast , glucose levels and insulin secretion change in parallel with g6pc2 rs560887 , suggesting a primary effect on insulin signaling to regulate hepatic glucose production . our analyses highlight the importance of considering biologic effects in assessing relationships between genotype and quantitative traits . like previous studies , our analyses show that these variants account for only a small fraction of the variability in insulin secretion or glucose . the remaining variability is likely because of the effects of other common genetic variants of both modest and moderate effect and a variety of additional gene - gene and gene - environment interactions . thus , additional studies of samples with detailed phenotyping will be necessary to fully unravel the genetic architecture underlying glucose regulation and diabetes .

objectiveglucokinase ( gck ) and glucose-6-phosphatase catalytic subunit 2 ( g6pc2 ) regulate the glucose - cycling step in pancreatic -cells and may regulate insulin secretion . gck rs1799884 and g6pc2 rs560887 have been independently associated with fasting glucose , but their interaction on glucose - insulin relationships is not well characterized.research design and methodswe tested whether these variants are associated with diabetes - related quantitative traits in mexican americans from the betagene study and attempted to replicate our findings in finnish men from the metabolic syndrome in men ( metsim ) study.resultsrs1799884 was not associated with any quantitative trait ( corrected p > 0.1 ) , whereas rs560887 was significantly associated with the oral glucose tolerance test 30-min incremental insulin response ( 30 insulin , corrected p = 0.021 ) . we found no association between quantitative traits and the multiplicative interaction between rs1799884 and rs560887 ( p > 0.26 ) . however , the additive effect of these single nucleotide polymorphisms was associated with fasting glucose ( corrected p = 0.03 ) and 30 insulin ( corrected p = 0.027 ) . this additive association was replicated in metsim ( fasting glucose , p = 3.5 1010 30 insulin , p = 0.028 ) . when we examined the relationship between fasting glucose and 30 insulin stratified by gck and g6pc2 , we noted divergent changes in these quantitative traits for gck but parallel changes for g6pc2 . we observed a similar pattern in metsim.conclusionsour data suggest that variation in gck and g6pc2 have additive effects on both fasting glucose and insulin secretion .

RESEARCH DESIGN AND METHODS The BetaGene Study Subject recruitment. Clinical protocols. Assays. The METSIM Study Subject recruitment. Clinical protocols. Molecular analysis. Data analysis. METSIM Study. RESULTS The BetaGene Study. Replication in the METSIM Study. DISCUSSION

electronic digital technology innovates the production and transport of clinical information with unprecedented speed and quantity . we may feel overwhelmed with the massive wealth of clinical information in journals . statistically trained eyes and minds to see the major points of data and judge the validity of data quickly and accurately are mandatory survival skills in the digital information age . in this article , five key statistical concepts for busy clinicians without formal statistical training are succinctly and clearly reviewed to help them keep up with the times . the evolution of human society has been generally accomplished owing to civilization based on science . knowledge through scientific method was fundamentally different from knowledge from other sources such as authority , superstition , mystery , and personal experiences . in science , any idea ( hypothesis ) should be crucially tested to verify whether the idea fits the facts . as to the status of being provisional , the old knowledge is on the brink of continuous challenge of revision with new facts . every problem of civilization has been solved successfully because the scientific test confirmed the prediction of phenomenon in reality . this makes science the most powerful tool we have for getting to the truth of things1 . thus , the recurrence of the phenomenon is the core difference from knowledge from other sources , called extrapolation or inference . human beings can expect the outcome of phenomenon with certain probability with knowledge from science . technology developed from scientific knowledge brings about civilization , which is a production of man - made artificial environments . disease has been one of the infamously fearful , irritating nature , encroaching the quantity and quality of human happiness . health care professionals intervene in the progress of disease to enhance the quantity and quality of life of patients . such professional intervention should be based on rational scientific evidences to verify that there is real benefit and no iatrogenic harm . empirical evidences from the accumulation of mere personal experiences are not acceptable , since the probability of recurrence of the beneficial outcome could not be quantified . if the beneficial outcome observed by man would not occur again before his eyes , none of the health care professionals and patients would accept any therapeutic intervention . objective impersonal data providing high probability of occurrence of the favorable outcome in repetition are required for the justification of routine therapeutic intervention . owing to the specific knowledge of the conditions for the therapeutic outcome , the health care professional is able to master the therapeutics ' outcome and to expand the scope of considerable power over the diseases . nonetheless , powerful recurrent evidences result from rigorous scientific investigation . the two major scientific activities of human beings -- observations and experimentations of therapeutic phenomenon under varying conditions of interventions including surgery and medication -- have supplied objective , recurrent , predictable data to clinicians . clinicians who acquire clinical knowledge from journal articles should carefully scrutinize the probability of recurrence of data with the help of variation statistics such as standard deviation.(table 1 ) standard deviation provides information on the possibility of recurrence of mean ; the smaller the standard deviation is , the higher the probability of expected recurrence of the same mean in other patients . proof that a condition always accompanies a phenomenon does not warrant conclusions with certainty that the condition is the immediate cause of such phenomenon . it must still be established that , when this condition is removed , the phenomenon will no longer occur . if we limit ourselves to proof of presence alone , we might fall into error at any moment and believe in the relations of cause and effect when there was nothing but simple coincidence . the human brain is equipped with the ability to sense the presence of immediate change . unfortunately , the general inability to think about absence is a potent source of error . thus , co - occurrence ( how many people who have bruxism have temporomandibular dysfunction ? ) and non - co - occurrence ( how many people who have bruxism do not have temporomandibular dysfunction , and how many people who do not have bruxism have temporomandibular dysfunction ? ) and co - absence ( how many people who do not have bruxism do not have temporomandibular dysfunction ? ) occur . all these numerical statistics are necessary to evaluate accurately the likelihood that the two things have a real causal relationship . as long as the phenomenon of causal relationship is real , we can anticipate the same or similar clinical outcome when we apply the knowledge to our clinical practice . thus , the distinction of pattern is one of the major contributions of statistics to the community of health care professionals . it has increased the confidence of clinicians in providing clinical intervention to patients expecting a favorable outcome without being afraid of any iatrogenic harm . observation or experimentation should be performed on a sufficiently large number of human or animal subjects to make sure that a certain same phenomenon occurs on a large number of subjects . the mounting evidence concretizes the therapeutic patterns as more internationally collaborating scientific activities confirms the same phenomenon across gender , age , race , and region . relations of clinical intervention with positive outcome tend to become a pattern as the number of phenomena accumulates due to the law of large numbers . therefore , patterning with the repletion of observation of a large number of objects is referred to as pattern statistics . most clinicians with inadequate statistical concepts tend to focus their attention to representative numerical pattern statistics such as mean only . once the pattern is ascertained numerically , pattern statistics can be compared to describe the pattern of relation between clinical modality and outcome . representative statistical instruments comparing the proof and counterproof of connections between the clinical intervention and the clinical outcome are relation statistics , e.g. , odds ratio , relative risk ratio , and survival ratio . clinical statistics are concerned about relation statistics because of the impossibility of knowing the essence of clinical interventions . instead , we are able to estimate the relations of things . for example , dental clinicians are not aware of the essence of osseointegration of dental implants with human bones . nonetheless , they know the relations of osseointegration with the longevity of dental implants under the ordinary masticatory function . thus , health care professionals should be familiar with the correct interpretation of relation statistics . in addition , the comparison of magnitude of relation statistics sheds light on the major definite conditions . due to limited time and resources , health care professionals and patients the ascertainment of the most determining factor for the best prognosis obviously assists in the most cost - effective treatment planning . unlike physical or chemical science , clinical science is where finding the truth of relation is hardest because of the complexity of human phenomenon5 . first , effects can result from a combination of causes because human beings are creatures inhabiting physical , mental , and social environments6 . effects are rarely associated with a single causal factor . in clinical domains , it is very commonplace to see a list of many possible causal factors for the therapeutic effect . for example , cigarette smoking causes lung cancer in a certain proportion of people . in other words , causation is not an all - or - nothing matter . two statistical devices have been developed : other things being equal control group and multivariate statistical methods . the control group whose conditions are the same as those of the test group except the conditions under observation is required to single out the definite conditions to produce the phenomenon . without the control group , thus , a case report without a comparative group can not provide determinant evidence of cause - effect relation between clinical intervention and therapeutic outcomes . that is why a case report must be regarded as a mere suggestion of further rigorous scientific investigations . clinicians should not apply what they have read in a case report to their patients immediately . depending on the type of effect variables such as interval , binary ( nominal ) , and censored , the statistical analysis of multiple causal factors includes multiple statistical models such as linear regression , logistic regression , and cox hazard regression . statistically - minded clinical scientists think that the task of finding the truth of relation is not that simple . the pattern of strong relations supported by large relation statistics from a sufficiently large number of objects might be due to chance . wide variations of clinical objects or events arise from the variety of genes , complex inner and outer environments , and diverse past experiences . if you toss a coin with two sides , the correct probability of observing the front side is 50% . in reality , however , such is not warranted . a group of study subjects chosen for a clinical study might always come from a group of population with wide variation . by a clinical study including observation or experiment , we have a chance to look at part of a wide variation of phenomenon , but we do not know where the part is placed in the entire population7 . statisticians developed the method of calculating the probability of chance intervention into relation statistics , called error statistics . the concept of error in statistics is somewhat different from ordinary terms , which imply mainly human mistakes . the abstract concept of chance is not something clinicians working with concrete subjects are familiar with . confidence intervals and p - value are representative error statistics estimating the probability of chance intervention . p - value=0.07 , for example , means that the probability of chance intervention into the observed relation is estimated to be as much as 7% . when we set the acceptable cut - off level to 0.05 ( in other words , 5% of chance intervention into the observed phenomenon ) , we should consider the observed relation statistics to be unacceptable because of the higher probability of chance than expected ( p - value=0.07 ) . in the same context , when 95% confidence intervals of relation statistics include 1 - -which means that the relation pattern of clinical intervention with the therapeutic outcome of the test group is equal to that of the control group -- we consider the relation statistics to be highly accidental and the relation to be non - replicable in other subjects . in any scientific activity testing a hypothesis ( idea ) , measurement is mandatory . since human beings ' sense and instruments are imperfect , errors in measurement are inevitable . in addition , scientific reasoning with regard to the collected data is prone to error because the preconceived idea ( working hypothesis ) guiding the research activities is biased toward the investigator 's expected outcome . no data could be 100% free from any error . unfortunately , human mistakes and bias owing to the investigator 's subconscious favored hypothesis are impossible to enumerate . the only concern is how much the error contaminates the data . if the level of contamination does not erode the direction or magnitude of the cause - effect link too much , it is acceptable . note , however , that skepticism on the hypothesis is not desirable because all knowledge is provisionally proven hypothesis , and nobody knows the validity of hypothesis . only a crucial test , not man , can judge the validity of the hypothesis . criticism on the hidden errors in the evidence and investigating method of any research article is the process of uncovering errors8 . investigators should not regard any criticism on their works as an assault on their dignity . otherwise , too defensive attitude and avoidance of criticism may hinder the progress of science . if a clinical scientist understands that the falsification of hypothesis is a core part of the scientific method , critical comments on any research could be accepted without any mental resistance . in particular , we tend to resist ideas competing with our own automatically . nothing could be more damaging than abandoning the critical mind and replacing it by too quick acceptance of hypothesis based on weak evidence . these mental attitudes may subconsciously influence a person toward acceptance of claims on plausibility . hastily jumping to a conclusion to escape from mental pain thus , scrutinizing erroneous data thoroughly , discarding opinions that are not based on valid data , and looking for the right explanation for a long time instead of jumping to a conclusion hastily make for the essence of critical and reflective mind for capable clinicians . the critical faculty of a clinician 's mind should be developed and trained continuously such that critical attitude becomes an automatic response . by looking at -- and looking for -- the key concepts of clinical statistics , clinicians can continue the lifelong journey to completion . as goethe said , " we see only what we know."8

statistics is the science of data . as the foundation of scientific knowledge , data refers to evidentiary facts from the nature of reality by human action , observation , or experiment . clinicians should be aware of the conditions of good data to support the validity of clinical modalities in reading scientific articles , one of the resources to revise or update their clinical knowledge and skills . the cause - effect link between clinical modality and outcome is ascertained as pattern statistic . the uniformity of nature guarantees the recurrence of data as the basic scientific evidence . variation statistics are examined for patterns of recurrence . this provides information on the probability of recurrence of the cause - effect phenomenon . multiple causal factors of natural phenomenon need a counterproof of absence in terms of the control group . a pattern of relation between a causal factor and an effect becomes recognizable , and thus , should be estimated as relation statistic . the type and meaning of each relation statistic should be well - understood . a study regarding a sample from the population of wide variations require clinicians to be aware of error statistics due to random chance . incomplete human sense , coarse measurement instrument , and preconceived idea as a hypothesis that tends to bias the research , which gives rise to the necessity of keen critical independent mind with regard to the reported data .

I. Introduction II. Variation Statistics III. Counterproof of Absence IV. Pattern Statistics V. Relation Statistics VI. Control Group VII. Error Statistics VIII. Critical Mind

lung cancer now ranks as the leading cause of cancer related death in the world , both in men and women . the cancer is usually diagnosed in the advanced stages of the disease and screening for the disease has proven difficult.1 if discovered in the early stages , lung cancer may undergo curative resection . the aim has hence been to develop appropriate screening strategies to diagnose this disease earlier . in the recent national lung screening trial2 , patients underwent screening with either regular chest radiographs or low - dose computed tomography ( ct ) . the regular screening with the aid of low dose ct was able to show a reduction in mortality of 20.6% by means of detecting lung cancer in the earlier stages . it became apparent however that extensive screening reveals pulmonary lesions that require further investigation , despite the majority of these being benign . if screening is to be widely accepted and adopted , these lesions will pose a diagnostic dilemma with regards to the management of these patients . solitary pulmonary lesions are defined as parenchymal lesions of less than 3 cm in diameter , not associated with atelectasis or adenopathy , surrounded by normal lung parenchyma . lesions below 8 mm in size have a low likelihood of malignancy and ct follow - up is recommended in the initial stages . the larger the size of the lesion , the higher the probability of malignancy . surgical resection may be the treatment of choice for a solitary nodule ; however , patients are often elderly or have several comorbidities rendering them unsuitable for a surgical approach . the incidence of solitary pulmonary nodules ( spn ) is increasing particularly with the increasing use of screening methods . in order to obtain a histological diagnosis , transthoracic needle aspiration ( ttna ) of these lesions can be attempted when they are located within the periphery of the lung . the procedure is well established and a sensitivity of between 74% and up to 96% has been quoted . but transthoracic needle biopsy carries a high risk of periprocedural pneumothorax , quoted to be between 15% and 44%.345 bronchoscopy has been used for many years to evaluate spn as well as peripheral tumors of the lung . transbronchial forceps biopsy ( tbb ) under fluoroscopy is the standard approach to obtain tissue samples of the spn ( fig . , the diagnostic yield is dependent on the size of the lesion , and increases with increasing lesion size as well as visibility under fluoroscopy . for lesions between 2.5 cm and 4.0 cm the sensitivity is described at 62% , whereas for lesions under 2.5 cm it drops to 40%.16 pulmonary lesion under fluoroscopy with biopsy forceps . complications are rare and pneumothoraces are much less frequent after tbb than after ttna . the use of fluoroscopy for transbronchial biopsy results in radiation exposure for the patients as well as the staff . the size and location of the lesion influence the diagnostic accuracy of tbb under fluoroscopy.67 in order to reach peripheral lung nodules more easily and improve the diagnostic yield , different guidance techniques have been developed over the last few years . in the early 1990s , a miniaturized ultrasound probe was developed for the use within the airways . ultrasound probes , so - called miniprobes , with a diameter of 1.4 mm and 1.7 mm are available for the use in the periphery of the lung . these can be advanced via the working channel of a bronchoscope and offer a 360 degree view of surrounding structures . most commonly a frequency of 20 mhz is used within the lung . the difference in impedance between normal lung tissue and pulmonary lesions ultrasound is completely reflected by surrounding air within the lung , giving the impression of a snowstorm picture ( fig . once the miniprobe is within a pulmonary lesion , the picture changes and allows for detailed imaging of the lung lesions . solid tumors tend to appear darker and have a bright border differentiating them from the surrounding lung tissue ( fig . ultrasound images of inflammatory tissue or atelectasis have a more inhomogeneous pattern caused by the different structures within the lung , and fluid appears dark . once the lesion has been reached by the ultrasound probe , the probe is retracted prior to inserting a biopsy forceps through the working channel . ultrasound images when a miniprobe is used . a : in the lesion ; b : adjacent to the lesion . herth et al8 used the radial ebus probe initially in 2002 for the detection of lung nodules in the periphery and to guide transbronchial biopsies . this prospective trial compared fluoroscopy - guided versus ebus - guided transbronchial biopsies showing a non - significant trend for ebus to be better than fluoroscopy . the position of the radial ebus probe in relation to the lesion can be determined as central ( within the target ) and adjacent ( see pictures ) to the lesion . diagnostic sensitivities of using radial ebus for peripheral nodules have been reported to be in the region of 61%-80% independent of lesion size . if fluoroscopy is used in combination with the miniprobe , the yield can be further improved . eighty percent of lesions less than 22 mm in diameter could be localized with ebus , and in 70% a diagnosis was established with transbronchial biopsy.9 hence , ebus allows for image guidance as an alternative to fluoroscopy . in order to improve the yield of ebus - guided biopsies further , the use of the guide sheath for the radial probe was first introduced by kurimoto in 2004.10 the procedure is similar to that with the naked radial probe , the probe however is advanced within the guide sheath through the working channel of the flexible bronchoscope ( fig . 4 ) . a standard bronchoscope with a working channel of 2.0 mm can be used together with a guide sheath of 1.9 mm and a 1.4 mm ultrasound probe . if the larger radial probe of 1.7 mm is used , a bronchoscope with a working channel of 2.8 mm needs to be employed . the picture obtained with the radial ebus probe confirms the position within the lesion and can then be retracted . if the lesion can not be located in this fashion , a double hinged curette can be inserted into the guide sheath . in this way the appropriate bronchus can now be selected under fluoroscopy and once it has been determined , the curette is removed and the ultrasound reinserted into the guide sheath to confirm the correct position . the guide sheath remains within the lesion and now acts as an extended working channel and samples can be taken with forceps , brush or curette . ideally five biopsies should be taken from the site to obtain a high sensitivity as quoted in a retrospective analysis.11 use of a guide sheath avoids the need for concurrent fluoroscopy if the lesion can be detected with radial ebus . yoshikawa et al.12 found that ebus could be used as guidance for transbronchial biopsies with a guide sheath relinquishing the need for fluoroscopy . the diagnostic yield in this study was significantly higher for lesions of > 20 mm than for those < 20 mm . the lesion size is certainly a determining factor in being able to visualize them by ebus as shown in previous studies.13 even for lesions of less than 20 mm in diameter a definitive diagnosis can be established in 46% patients as shown in a recent study by eberhardt et al.14 biopsy with the guidance of a radial ultrasound probe has the limitation of not being real time as the ultrasound probe has to be removed prior to inserting the forceps via the working channel . the biopsy instrument can sometimes not be reinserted into the same subsegment as the radial ebus probe and hence biopsies might be from a different area . a guide sheath can overcome this problem by remaining at the position where the lesion was identified with the radial ebus probe . it limits the size of the biopsy forceps due to the limitations of the working channel . the guide sheath bends easily and can prevent the insertion of the biopsy forceps or brush . a meta - analysis performed by steinfort et al.15 in 2011 found a pooled sensitivity of 73% and a specificity of 100% for the use of radial ebus with or without a guide sheath in transbronchial biopsies . they further pointed out , however , that a non - diagnostic result in ebus - guided tbb should strongly be considered for further investigation to rule out malignancy . in most of the studies examined in this metaanalysis radiological findings on ct can aid to predict the sensitivity of ebus - guided tbb , e.g. , the presence of a bronchus sign that may predict the probability of malignancy of the lesion . a retrospective trial by yamada et al11 showed that the diagnostic yield is higher if the miniprobe is central in the lesion than if it is adjacent to the lesion . recently , thin bronchoscopes were developed in order to be passed into the periphery more easily , hence negating the need for a guide sheath . oki et al.16 published a randomized trial comparing the use of an ebus probe via a thin bronchoscope to using it within a guide sheath . an olympus prototype videobronchoscope was used with an external diameter of 3.4 mm and a 1.7-mm working channel . two hundred and three patients were randomized to receiving biopsy of their lesion either with the ebus guide sheath or via the thin bronchoscope . the diagnostic yield of the thin bronchoscope was non - inferior to the guide sheath method and the procedure time was significantly shorter in the thin- bronchoscope group . the use of ultrathin bronchoscopes has also meant a further reduction of the size of the working channel . other navigation techniques such as virtual bronchoscopy and electromagnetic navigation bronchoscopy are additional tools to guide the biopsy of peripheral lesions . virtual bronchoscopy is a ct - based imaging technique allowing for noninvasive evaluation of the bronchial tree . it creates a 3-dimensional image of the bronchial tree and a generated map can lead the way to the peripheral lesion , indicating where the bronchoscope should be inserted at each subdivision . the combination of virtual bronchoscopy with ebus guidance has been demonstrated to be safe , feasible and effective by asahina et al.17 the diagnostic sensitivity reached 44.4% for lesions < 20 mm and 91.7% for lesions of 20 - 30 mm.17 electromagnetic navigation - guided diagnostic bronchoscopy ( enb ) allows for guidance of the bronchoscope to the peripheral lesion via a reconstructed ct image in 3-dimension . it is possible to navigate the bronchoscope with this system to invisible lesions but is based on a virtual environment . the lesion can not be visualized in itself prior to biopsy . the diagnostic sensitivity with this technique was shown to be 67%.18 enb can also be used in combination with ebus and the diagnostic sensitivity can be further increased to 88%,19 greater than ebus or enb alone . the set - up however is expensive and may not be as readily available in bronchoscopy suites as an ultrasound processor . overall , the ebus guide sheath for transbronchial biopsies and brushings is useful to confirm the precise location of the lesion even if the lesion is not visible under fluoroscopy . a guide sheath aids to obtain the samples from the most adequate position closest to real - time procedure by leaving the guide sheath in place , and bleeding is reduced by trapping the guide sheath in the relevant bronchus . the combination of several guidance techniques together with the improvement in biopsy tools has improved the diagnostic yield to be closer to the sensitivity achieved with ct - guided ( 92%)20 or surgical biopsies .

lung cancer is one of the most common tumors worldwide . pulmonary lesions detected during screening for lung cancer need to be evaluated further and tissue should be obtained . bronchoscopy is often the first step to secure a histological diagnosis . differ - ent guidance techniques are available to increase the diagnostic yield . over the last few years endobronchial ultrasound ( ebus ) has been used increasingly to direct the sampling tools , often in combination with a guide sheath . this article offers a review of the literature of the use of ebus in diagnosis of pulmonary peripheral lesions .

INTRODUCTION SOLITARY PULMONARY LESIONS ENDOBRONCHIAL ULTRASOUND (EBUS) FOR PERIPHERAL LESIONS GUIDE SHEATH DISCUSSION

it is now evident that adipose tissue not only stores excess triacylglycerols , but functions as an endocrine organ by releasing adipokines , which have important roles in the regulation of appetite , glucose and lipid metabolism , inflammation , and insulin resistance.1,2 such adipokines include adiponectin , leptin , resistin , tumor necrosis factor ( tnf)- , plasminogen activator inhibitor-1 ( pai-1 ) , and interleukin ( il)-6 . tnf- , pai-1 , and il-6 are all proinflammatory cytokines , although il-6 can further exert an anti - inflammatory action.1 it has also been observed that leptin , resistin , and tnf- impair insulin sensitivity and trigger atherogenesis.1 these adipokines usually increase with adiposity and can have a detrimental role on an individual s health . however , adiponectin , unlike other adipokines produced by adipose tissue , possesses antiatherogenic properties and is found to decrease with increased adiposity.1,2 several studies provide evidence of improvement in adipokine profiles with weight loss.36 however , it remains unclear as to whether changes in the circulating adipokines investigated to date contribute significantly to the beneficial effects on health associated with weight loss.7 the extent of weight loss required to elicit such changes in adipokine levels remains unclear . in addition , the method by which the weight loss is achieved may also influence the adipokine response . varady et al8 suggest that a minimum weight loss of 5% is required to have an effect on levels of key adipokines ( adiponectin , leptin , and resistin ) , but this differs from other studies which report the need for a 10% weight loss for modification in levels of some adipokines ( eg , adiponectin ) and that this varies with the degree of obesity.9 further studies are needed to clarify the relationship between changes in adipokine levels and the health benefits of weight loss , and whether specific dietary manipulations have differential effects on such changes . we hypothesized that the extent of weight loss rather than the macronutrient intake will determine the degree of change in adipokine levels . we aimed to investigate the effect of weight loss on adipokine levels in individuals receiving a low carbohydrate / high protein ( lchp ) diet compared with a very low calorie diet ( lighterlife [ ll ] ) diet . the present analysis is an ancillary study to that previously presented by rolland et al10 where the methods were described . dropouts were not included in this analysis because the goal was to evaluate the effect of diet on adipokine levels and not an intention - to - treat clinical trial . in brief , patients referred to a specialist obesity clinic were entered into a randomized controlled clinical trial of differing dietary interventions in the management of obesity . men and women older than 18 years of age and a body mass index ( bmi ) 35 kg / m were included . patients with a history of hepatic or renal disease , cancer , current pregnancy / lactation , on antidepressant or antiobesity medication , or eating disorders were excluded . the study included a three - month screening period where patients were assigned to a 600 calorie - deficient diet ( cdd ) aiming to achieve a 5% weight loss . this was done to select patients who would not respond to a low - fat , reduced - energy approach and randomly assign them to a lchp or a ll diet in the form of a continuous method approach . those who lost > 5% of their body weight were maintained on this approach for an additional three months . if weight loss was > 10% at this time , the cdd was continued for an additional six months . completer data for this group were limited ( n = 4 ) and therefore were not included in this paper . those patients who failed to achieve the weight loss targets were randomly allocated to either a lchp or ll diet , and continued on the assigned diet for an additional nine months ( figure 1 ) . patients on cdd who achieved a 5% weight loss at screening but did not achieve the 10% weight loss three months following screening were randomized to the ll or the lchp diet but their data were omitted from this analysis . the study was approved by the north of scotland research ethics service . using the schofield and the harris benedict equations , the amount of energy allowed was broken down into portions from the different food groups.10 portion sizes were explained to the patients and written information was also provided . patients were reviewed at weeks 2 , 4 , 8 , and 12 when they were weighed , their weight loss progress was discussed , and they were provided with dietary advice . patients randomized to the low lchp diet were restricted to 40 g of carbohydrate per day . the energy intake was 8001500 kcal where an 800 kcal diet was composed of 20% carbohydrate , 40% protein , and 40% fat . patients were given a booklet with information about which foods to eat and which to avoid . the diet was supplemented with multivitamins and minerals ( forceval , alliance pharmaceuticals , chippenham , uk ) . the ll diet used in this study is administered in the form of soups , shakes , and bars to replace conventional food and provides a daily average of 550 kcal ( 36% carbohydrate , 36% protein , 28% fat , and at least 100% of the recommended daily allowance for all micronutrients ) . ll has two distinctive stages , ie , weight loss and food reintroduction . during each stage , patients attend weekly single - sex group meetings of 712 people for behavior change therapy based on cognitive behavior therapy and transactional analysis methodology delivered by a trained ll advisor . patients were required to remain on the weight loss phase for a minimum of three months , after which they were given a choice to continue for up to another six months or were assigned to the food reintroduction phase . on average , patients who completed the study remained on the diet for 6.9 ( range 49 ) months . for the food reintroduction phase , solid foods were reintroduced over a 12-week period where patients were slowly weaned off food packs while still receiving advice and support . all patients came monthly to the trial center to be weighed for the first three months and then every alternate month after screening , resulting in six visits in nine months . fat mass and fat free mass was estimated using bioelectrical impedance ( tanita bc-418 ma , [ tanita corporation , arlington heights , il ] ) . body composition and waist circumference were measured prescreening , at screening , and at months 3 and 9 after screening . blood samples were obtained after an overnight fast prescreening , at screening , and at months 3 and 9 after screening to measure fasting plasma glucose , insulin , and adipokines , including leptin , resistin , adiponectin , pai-1 ( active ) , il-6 , and tnf-. serum samples for adipokines and insulin were measured in duplicate with commercially available immunoassay kits from millipore using the lincoplex system ( st charles , mo ) . the protocol for measurement of insulin and all the adipokines was carried out as described by the manufacturer . high - density lipoprotein cholesterol ( hdl ) , triacylglycerol , and fasting glucose were analyzed in the department of clinical biochemistry at nhs grampian . insulin resistance using fasting glucose and insulin values was calculated using the homeostasis model of assessment of insulin resistance ( homa - ir ) where homa - ir = [ insulin ] [ glucose]/22.5 . any skewed data were log - transformed and subsequently assessed using parametric tests . for within group analysis , a paired t - test was used . for between - group analysis of changes , the pearson correlation was used to assess the relationship between changes in adipokines and changes in other continuous measurements . statistical tests were carried out using the spss 15.0 for windows software program ( spss inc , chicago , il ) . because this is an ancillary analysis following on from a previously published study,10 the power for this analysis a p value of < 0.05 ( two - tailed ) was considered statistically significant . based on the mean change ( 31.0 kg ) and standard deviation ( 16.4 kg ) for weight loss observed at nine months,10 14 patients in each group resulted in a > 99% power for weight change . using the schofield and the harris benedict equations , 600 kcal were removed from the patients estimated daily energy intake . the amount of energy allowed was broken down into portions from the different food groups.10 portion sizes were explained to the patients and written information was also provided . patients were reviewed at weeks 2 , 4 , 8 , and 12 when they were weighed , their weight loss progress was discussed , and they were provided with dietary advice . patients randomized to the low lchp diet were restricted to 40 g of carbohydrate per day . the energy intake was 8001500 kcal where an 800 kcal diet was composed of 20% carbohydrate , 40% protein , and 40% fat . patients were given a booklet with information about which foods to eat and which to avoid . the diet was supplemented with multivitamins and minerals ( forceval , alliance pharmaceuticals , chippenham , uk ) . the ll diet used in this study is administered in the form of soups , shakes , and bars to replace conventional food and provides a daily average of 550 kcal ( 36% carbohydrate , 36% protein , 28% fat , and at least 100% of the recommended daily allowance for all micronutrients ) . ll has two distinctive stages , ie , weight loss and food reintroduction . during each stage , patients attend weekly single - sex group meetings of 712 people for behavior change therapy based on cognitive behavior therapy and transactional analysis methodology delivered by a trained ll advisor . patients were required to remain on the weight loss phase for a minimum of three months , after which they were given a choice to continue for up to another six months or were assigned to the food reintroduction phase . on average , patients who completed the study remained on the diet for 6.9 ( range 49 ) months . for the food reintroduction phase , solid foods were reintroduced over a 12-week period where patients were slowly weaned off food packs while still receiving advice and support . all patients came monthly to the trial center to be weighed for the first three months and then every alternate month after screening , resulting in six visits in nine months . fat mass and fat free mass was estimated using bioelectrical impedance ( tanita bc-418 ma , [ tanita corporation , arlington heights , il ] ) . body composition and waist circumference were measured prescreening , at screening , and at months 3 and 9 after screening . blood samples were obtained after an overnight fast prescreening , at screening , and at months 3 and 9 after screening to measure fasting plasma glucose , insulin , and adipokines , including leptin , resistin , adiponectin , pai-1 ( active ) , il-6 , and tnf-. serum samples for adipokines and insulin were measured in duplicate with commercially available immunoassay kits from millipore using the lincoplex system ( st charles , mo ) . the protocol for measurement of insulin and all the adipokines high - density lipoprotein cholesterol ( hdl ) , triacylglycerol , and fasting glucose were analyzed in the department of clinical biochemistry at nhs grampian . insulin resistance using fasting glucose and insulin values was calculated using the homeostasis model of assessment of insulin resistance ( homa - ir ) where homa - ir = [ insulin ] [ glucose]/22.5 . all variables were assessed for normality using the kolmogorov - smirnov test . any skewed data were log - transformed and subsequently assessed using parametric tests . for within group analysis , a paired t - test was used . for between - group analysis of changes , the pearson correlation was used to assess the relationship between changes in adipokines and changes in other continuous measurements . statistical tests were carried out using the spss 15.0 for windows software program ( spss inc , chicago , il ) . because this is an ancillary analysis following on from a previously published study,10 the power for this analysis was carried out based on weight loss . a p value of < 0.05 ( two - tailed ) was considered statistically significant . based on the mean change ( 31.0 kg ) and standard deviation ( 16.4 kg ) for weight loss observed at nine months,10 14 patients in each group resulted in a > 99% power for weight change . data are presented as means standard deviation , and changes are expressed as the mean difference changes from baseline standard deviation . baseline characteristics are listed in table 2 . a total of 31 ( 14 in ll , 17 in lchp ) patients completed the study . there were significantly more men in the ll than the lchp group ( n = 5 and n = 1 , respectively ) . weight , bmi , and fat free mass were significantly greater in the ll group than in the lchp group ( table 2 ) . when investigating the whole group , significant associations were observed between adiponectin , hdl , and pai-1 . leptin was significantly associated with percentage body fat and tnf- , while il-6 was inversely associated with hdl ( table 3 ) . there were no significant gender differences for the adipokines with the exception of leptin , for which the levels were significantly greater in women than in men ( 46.7 15.5 ng / ml versus 28.2 14.6 ng / ml , p = 0.014 ) . however , this was no longer significant after adjusting for percentage body fat ( p = 0.089 ) . at three months , percentage weight loss for the lchp group was 2.9% 4.2% and for ll was 18.4% 5.4% ( p < 0.0001 ) . weight , waist circumference , percentage body fat , fat mass , leptin , pai-1 , fasting glucose , homa - ir , and triacylglycerols had improved significantly in the ll group ( table 4 ) . however , hdl and fat free mass decreased significantly from baseline in the ll group ( table 4 ) . a significant improvement from baseline to three months was observed for weight , percentage body fat , fat mass , insulin , and homa - ir in the lchp group ( table 4 ) . at nine months , the percentage weight change for the lchp group was 1.4% 1.0% and for ll was 23.8% 4.0% ( p in the ll group , weight loss , waist circumference , percentage body fat , fat mass , fat free mass , leptin , pai-1 , fasting glucose , and triacylglycerols were still significantly improved compared with baseline ( table 4 ) . in addition , significant improvements in circulating levels of adiponectin and hdl were observed , but homa - ir was no longer significant ( table 4 ) . changes in adiponectin were inversely associated with changes in weight , bmi , fat mass , percentage body fat , waist circumference , il-6 , and tnf-. changes in leptin were associated with changes in weight , bmi , fat mass , waist circumference , fat free mass , and percentage body fat . changes in tnf- were associated with changes in il-6 , and inversely associated with changes in adiponectin . there were no significant changes from baseline at nine months for the lchp group ( table 4 ) . however , changes in leptin were inversely associated with changes in hdl ( r = 0.573 , p = 0.032 ) . overall , changes at nine months for weight , waist circumference , fat mass , adiponectin , leptin , fasting glucose , and hdl were significantly greater for the ll group than for the lchp group ( table 4 ) . at three months , percentage weight loss for the lchp group was 2.9% 4.2% and for ll was 18.4% 5.4% ( p < 0.0001 ) . weight , waist circumference , percentage body fat , fat mass , leptin , pai-1 , fasting glucose , homa - ir , and triacylglycerols had improved significantly in the ll group ( table 4 ) . however , hdl and fat free mass decreased significantly from baseline in the ll group ( table 4 ) . a significant improvement from baseline to three months was observed for weight , percentage body fat , fat mass , insulin , and homa - ir in the lchp group ( table 4 ) . at nine months , the percentage weight change for the lchp group was 1.4% 1.0% and for ll was 23.8% 4.0% ( p < 0.0001 ) . in the ll group , weight loss , waist circumference , percentage body fat , fat mass , fat free mass , leptin , pai-1 , fasting glucose , and triacylglycerols were , significant improvements in circulating levels of adiponectin and hdl were observed , but homa - ir was no longer significant ( table 4 ) . changes in adiponectin were inversely associated with changes in weight , bmi , fat mass , percentage body fat , waist circumference , il-6 , and tnf-. changes in leptin were associated with changes in weight , bmi , fat mass , waist circumference , fat free mass , and percentage body fat . changes in tnf- were associated with changes in il-6 , and inversely associated with changes in adiponectin . there were no significant changes from baseline at nine months for the lchp group ( table 4 ) . however , changes in leptin were inversely associated with changes in hdl ( r = 0.573 , p = 0.032 ) . overall , changes at nine months for weight , waist circumference , fat mass , adiponectin , leptin , fasting glucose , and hdl were significantly greater for the ll group than for the lchp group ( table 4 ) . in the present study , there was a significant weight loss at three months for patients on both ll and lchp . however , significant weight loss at nine months was only maintained in the ll group . changes in adiponectin and leptin were significantly greater in the ll group than in the lchp group which may be due to greater weight loss and decrease in fat mass . however , changes in tnf- , il-6 , pai-1 , and resistin did not differ significantly between the dietary groups at nine months . at baseline , we observed a trend for adiponectin to be inversely correlated with weight and bmi , but this did not reach statistical significance , possibly due to the small sample size . surprisingly , there was no significant inverse correlation between adiponectin and waist circumference , which was unexpected because other studies have demonstrated that waist circumference is a good correlate for adiponectemia.12,13 although the sample size was small , this may not be the reason for the lack of correlation between adiponectin , bmi , and waist circumference . . there is evidence to suggest that the incidence of metabolic syndrome decreases beyond a bmi of 37.5 kg / m.14 interestingly , our findings support the evidence presented by plaisance et al,15 who reported that baseline adiponectin levels were strongly correlated with mean hdl cholesterol . association of moderately decreased risk of cvd with increased adiponectin is thought to be mediated in part by the effects of adiponectin on hdl , through parallel increases in both . however , how adiponectin affects hdl remains unknown.16 in the ll group , changes in adiponectin were significant at nine months but not at three months . weight loss increased significantly from three to nine months in this group , which would suggest that a weight loss greater than 18.4% is required for statistically significant improvements in circulating adiponectin levels . changes in adiponectin were inversely associated with fat mass , waist circumference , il-6 , and tnf- at nine months , suggesting an improvement in inflammatory status with weight loss and the associated increase in adiponectin . in the present study , leptin was significantly associated with percentage body fat at baseline , which is consistent with previous findings.17 there was no significant correlation found between leptin and waist circumference in the present study at baseline . this suggests that there may be a greater release of leptin from peripheral subcutaneous adipose tissue compared with visceral adipose tissue . studies have shown that there are variations in leptin gene expression in adipose tissue depending on the site where it is deposited , where expression is greater in subcutaneous compared with visceral adipose tissue.18,19 alternatively , the lack of association between leptin and waist circumference may have been due to issues in the measurement of waist circumference in grade iii obese patients , a difficulty which is well recognized . in addition , different protocols yield different results.20 leptin was significantly decreased at three and nine months in the ll group . the changes in leptin were significantly associated with fat mass , percentage body fat , and waist circumference . this is consistent with a number of studies in which leptin is shown to decrease in response to weight loss.2124 there was also an association between leptin change and waist circumference change at nine months , reflecting an overall loss of fat mass . in addition , despite the minimal weight loss for the lchp group , changes in leptin were inversely associated with hdl at nine months . this may suggest that even a small reduction in weight results in a beneficial trend of improvement in leptin levels which is likely to improve cardiovascular risk . levels of pai-1 at baseline were associated with waist circumference , homa - ir , and insulin , suggesting that pai-1 is involved in insulin resistance as previously reported.25 weight loss has been found to reduce the levels of pai-1,2628 indicating the influence of adipose tissue on the levels of this protein . our study data are in support of this evidence , where changes in pai-1 were associated with changes in fat mass for the ll group at nine months . there was no evidence from the present study to support a strong link between resistin levels and weight . of all the adipokines examined in this study , resistin appears to be the most controversial because the evidence appears to be equivocal and inconclusive.2931 further human studies are required to confirm whether there is a relationship between resistin and obesity , including insulin resistance and type 2 diabetes mellitus . similarly , despite the fact that il-6 has been found to be increased in obesity32,33 and reduced in response to weight loss,34 no significant differences at baseline or in response to diet were observed here . subcutaneous adipose tissue is thought to release approximately 30% of systemic il-6 , and visceral adipose tissue is thought to release even more . however , the lack of change may be explained by the fact that only about 10% of total il-6 is produced by fat cells.35 in addition , mean levels of tnf- did not correlate significantly with weight , waist circumference , or percentage body fat at baseline . these results were unexpected , because it is widely reported that tnf- is linked with obesity.36 also , tnf- did not show any significant decrease in response to weight loss or diet . however , in a study by arvidsson et al,37 circulating levels of tnf- did not show a significant difference after a mean weight loss of 7.5% at 10 weeks . these authors concluded that adipose tissue has only a minor effect on the regulation of circulating tnf- levels . thus , tnf- seems to be produced and acts locally in human fat tissue,38 and there is no in situ release from adipose tissue into the blood.35 a number of studies have observed no changes in il-6 or tnf- after significant reductions in weight ( 59 kg ) with dietary and exercise interventions.39,40 however , it was interesting to observe that changes in il-6 and tnf- were significantly correlated at nine months in the ll group . this could be explained by the relationship between il-6 and tnf- whereby il-6 exerts proinflammatory activity itself and increases tnf-.1 this would suggest that , despite weight loss not resulting in significant improvements in circulating levels of il-6 and tnf- , there appears to be an underlying clinically significant response whereby reduction in weight results in a decrease in inflammation . there is evidence that weight loss achieved using a very low calorie diet results in changes in adipokine levels similar to those observed in response to bariatric surgery . mitterberger et al41 compared a group of patients for whom weight loss was achieved by dietary caloric restriction only with a group of patients in whom caloric restriction was induced by bariatric surgery ( three gastric bypasses and eight gastric bands ) . they reported that despite the fact that only a 26% 7% weight loss was achieved in the dietary caloric restriction as compared with 43% 10% in the bariatric surgery group , changes in adipokines were not significantly different between the two groups . this may suggest an important role for the use of a weight loss approach , such as the very low calorie diet instead of bariatric surgery , which is highly invasive , expensive , and can lead to long - term vitamin and mineral deficiencies.42 although it remains unclear as to whether the adipokines investigated to date are responsible for the beneficial effects on health associated with weight loss , it is clear from this study and several others that there are important associations between weight loss , certain adipokines ( such as adiponectin ) , leptin levels , and cardiovascular disease risk . in addition , the extent of weight loss required to elicit the benefits as well as the effects of the method by which weight loss is obtained remains unknown . however , it can be argued that there does seem to be a minimal weight loss required which was not achieved here in the lchp group and a maximal weight loss beyond which further improvements in circulating adipokine levels are no longer observed , as demonstrated in the study by mitterberg et al.41 further research would include determining if there is a ceiling effect for adipokine change in response to weight loss . this would involve directly comparing adipokine changes in response to weight loss achieved using a very low calorie diet as compared with weight loss achieved using surgical approaches . there were significantly more men on ll than on lchp , but this may not have been too limiting because there were no significant gender effects on adipokine when all patients were combined at baseline , except for leptin , but this discrepancy may have resulted in the significant differences between the two groups at baseline for weight , waist circumference , and fat free mass . in addition , although the sample size provided a > 99% power for weight loss , the sample sizes may have been too small to observe associations and changes in adipokines , which would have been expected based on the literature . moreover , use of the multiplexed assay has been criticized in the scientific literature.43 the multiplexed bead immunoassay allows the simultaneous detection of adipokines in small blood samples which may be particularly useful when samples are difficult to obtain . the use of this approach has been validated and found to be useful for leptin , adiponectin , and insulin in the evaluation of changes in obesity markers following weight reduction.43 the relationship between the multiplexed bead immunoassay when compared with the radioimmunoassay or enzyme - linked immunoassay for other adipokines such as resistin , il-6 , and tnf- , were reported to be quite weak . these differences could be explained by differences in antibody pairs and sample diluents , as well as the low effects of low concentrations of these adipokines . in addition , assay sensitivity remains an issue when compared with ultrasensitive enzyme - linked immunoassay methods.43 however , the ability of multiplexed assays to detect adipokines of a broader dynamic range than enzyme - linked immunoassays , as well as its greater cost - effectiveness , time efficiency , requirement of smaller sample volumes , and the removal of interassay variability suggest that this approach is still to be considered a powerful tool , albeit with the above limitations . it would appear that the significant weight loss of 23.8% observed on ll resulted in significant improvements in circulating levels of leptin , pai-1 , and adiponectin . changes in these adipokines possibly resulted in improvements in fasting glucose , triacylglycerols , and hdl . this is most likely due to the overall weight loss achieved rather than macronutrient intake . further research examining the adipokine response to weight loss using a very low calorie diet in comparison with surgical interventions would be beneficial to determine if the adipokine response to weight loss has a ceiling effect .

background : adipose tissue functions as an endocrine organ by releasing adipokines which have important roles in the regulation of inflammation and insulin sensitivity . although there is evidence of improvement in circulating levels of adipokines with weight loss , few studies relate such changes to specific diets . we investigated the effects of weight loss achieved by two different diets on circulating adipokine levels in obese individuals.methods:a total of 120 obese patients ( body mass index 35 kg / m2 ) underwent a three - month screening period on a low - fat , reduced - calorie diet . patients failing to achieve a 5% weight loss using this approach were randomly allocated to either a low carbohydrate / high protein diet ( n = 17 ) or to a commercial very low calorie diet ( lighterlife , n = 14 ) for a period of nine months.results:at nine months , a significant weight loss was only maintained for lighter - life ( 32.3 22.7 kg , p < 0.0001 ) but not on the low carbohydrate / high protein diet . changes in adiponectin ( 15.8 17.1 ng / ml versus 0.8 6.2 ng / ml , p = 0.003 ) and leptin ( 17.6 24.3 ng / ml versus 3.0 9.2 ng / ml , p = 0.049 ) at nine months were significantly greater for lighterlife than for the low carbohydrate / high protein diet , which may reflect greater weight loss and decrease in fat mass . changes in tumor necrosis factor - alpha , interleukin-6 , and plasminogen activator inhibitor type 1 did not differ significantly between the dietary interventions at nine months.conclusion:a significant weight loss of 23.8% from baseline weight was observed using a very low calorie diet and resulted in significant improvements in circulating levels of leptin , plasminogen activator inhibitor type 1 , and adiponectin , which are likely to be due to weight loss and not macronutrient intake .

Introduction Methods Dietary intervention Randomization and diet allocation Data collection Statistical analysis Results Three-month data Nine-month data Discussion Conclusion

dr . bawaskar was born in a small village with a population of 500 in rural maharashtra to a poor farmer in the early 1950s . one who is courageous ; it was years later that he proved that no other name would have suited him better . his father recognized that education was the only tool that would liberate the family from their sufferings . the determination to educate his children earned his illiterate father the nickname barrister . he had to take up all kinds of jobs from working in the fields , hotels , temples , bookshops , chemist 's shop , brick kiln , and many such odd places to support his education . adversity taught him that he would have to fight for everything in life and nothing would come easy . misfit in college and with lack of guidance , hard work was the only asset he possessed . he still recounts how he knew complete gray 's anatomy by heart and emphasizes his deep study of pathology which has proven useful for his research . however , certain circumstances made him depressed and disillusioned during his college days . he lost his confidence and it was only after the completion of his mbbs degree and a prolonged treatment that he came out of the mental trauma . his strong roots with rural parts prompted him to opt for the position of a medical officer at a primary health centre ( phc ) rather than a housejob at a medical college . fighting the red tape he managed to get posting at a small phc in the costal district of raigad . yet he decided to work there with a great personal interest and slowly reformed the phc . in a short time , he established himself as a dedicated , honest , and a skilled doctor . it was here that he was introduced to the problem of scorpion stings for the first time . he had not heard of deaths due to scorpion stings till then and was surprised to know that such deaths were common in his area of clinical practice . added to the problems were the superstitions which denied such cases medical care or worsened them even further . this stimulated the scientist within him and he started to collect data on such cases from past records , other doctors , and lay people in general . however , he found this information inadequate and unreliable , so he decided to admit all the cases and study them on his own . the need of the people to have a sure , scientific , and a safe cure for this menace formed the base of his work thereafter . in such a resource poor setting , his only tools were a stethoscope and a modest sphygmomanometer [ figure 2 ] . however , his keen observation , thorough knowledge , and meticulous record keeping compensated for the lack of resources . he spent sleepless nights sitting beside the patients , monitoring them and noting the subtle changes . he found common symptoms of vomiting , hypertension , profuse sweating , cold extremities , priapism , and mild tolerable pain followed by ropy salivation , arrhythmias , hypotension , frothy expectoration and peripheral circulatory failure . thus , he observed that the immediate cause of death in these cases was pulmonary edema . he tried traditional methods of symptomatic treatments with atropine , beta - blockers , chlorpromazine , aminophylline , etc . , but these methods did not yield the desired results . tools of research a humble stethoscope and a bp apparatus in the meantime , he realized that his education was inadequate for the needs of his quest . to further his skills and knowledge , he applied for md in medicine at b.j . he mastered advanced techniques and intensive care . in the light of his new found knowledge , he prepared a paper on data of 51 cases of scorpion stings and sent it to an indian journal . he sent the same paper to lancet and received a response within 8 days that the report was accepted with minor changes . thus , his first individual paper titled diagnostic cardiac premonitory signs and symptoms of red scorpion sting was published in the lancet in 1982 . he recounts how a case of scorpion sting succumbed in the tertiary care hospital where he was working . thus he wondered , if a person could not be saved in such well - equipped settings , what could a clinician do in a phc like setup ? [ figure 3 ] also , he was successful in understanding that heart failure due to the sting was similar to a refractory heart failure like condition . he decided to use sodium nitroprusside for sting - related heart failure and was successful in managing many cases ! a makeshift the couple returned to konkan only to find that the problem was the same as he had left it . in oct 1983 , a 8-year - old child was admitted with all the symptoms of severe scorpion envenomation . as he developed pulmonary edema his chances of survival started declining . bawaskar asked for his father 's consent to use nitroprusside explaining the dangers of this drug . he postulated that it would decrease both the preload and afterload on the victim 's heart with increased cardiac emptying . with the faith and trust invested by the victim'sfather , he administered nitroprusside drop by drop monitoring the child minute by minute . after 4 h , the victim gradually started showing signs of recovery , the blood pressure started rising , pulmonary edema subsided , pulse rate dropped and started oral feeds . 24 h later and almost on the verge of crying , he declared that the boy was saved ! when he was monitoring the child , he received a telegram informing the death of his father . he was in a dilemma to choose between his family obligations and his duty as a doctor . he chose the latter and stayed with the child as he believed that there were people who could take care of the funeral , but the child needed him more . the news spread far and wide and patients from all over konkan started pouring in for the cure . where death was considered a norm after a poisonous sting , in a short span of one month he cured 65 patients of pulmonary edema . sodium nitroprusside is a dangerous drug which has to be rigorously monitored , and even in icus it is used with apprehension . therefore , the next challenge was to find a safer alternative which could be easily administered even in peripheral settings . again dr . bawaskar was back to the library and started an extensive search in journals . here , he chanced upon a new drug prazosin , an alpha blocker . it was advocated for refractory heart failure and was used in pheochromocytoma to control the hypertension caused by catecholamine excess . he had already discovered that the pathophysiology in scorpion sting was the pouring of catecholamines in the blood due to the venom 's action on the human adrenal gland . thus , he decided to use this drug . in 1984 , he treated 126 patients with prazosin ; all of them survived . in 1986 , in his paper titled prazosin in the management of cardiovascular manifestations of scorpion sting was published in the lancet he put forward for the first time prazosin as a physiological antidote for scorpion stings . his work started getting recognition internationally as prazosin 's success was duplicated all over the world . for this , he arranged various seminars , regularly communicated with other doctors and regularly sent them academic materials on the same issue . the case fatality rate dropped down from 40% to less than 1% with this treatment . he also kept on improvising and standardizing the regimes with regular publications in international journals such as japi , bmj , lancet , and the british heart journal , etc . another important facet of his research is that all this work was done with out of pocket funding without any funding from government or external agencies . it makes us think , do we need all types of resources and facilities or pure passion to pursue research that could benefit mankind ? dr . bawaskar is an exemplar for the fact that research truly related to upliftment of human life needs a higher level of dedication ! he is considered an international authority on scorpion sting and has even authored two chapters in the api textbook of medicine . prazosin as a treatment for scorpion sting has been incorporated in satoskar 's textbook of pharmacology . the january 2011 issue of the british medical journal includes a full paper of his randomized trial conducted to compare the efficacy of scorpion antivenom + prazosin and prazosin alone . the same issue carries an editorial highlighting the importance of research in resource poor settings and how dr . bawaskar had overcome the subjectivity and some shortcomings in his study by his dedication and time tested methods of clinical observation . dr . bawaskar currently has a private practice in mahad ( maharashtra ) assisted by his wife . his hospital is well equipped for primary intensive care and the couple attends to all the patients without any nursing staff . his other areas of study are the problems he has encountered first hand in the rural area . following are some of his areas of studies which have been translated into various publications : what prompted him to study this was the fact that chronic diseases and chds have a high prevalence in this area due to excessive salt consumption , usage of coconut oil for cooking , and other lifestyle - related risk factors.alarmed with the rising cases of chronic renal failure in his native place , he studied the problem and found out that heavy metals in drinking water were an important risk factor for the same.in a small village near mahad , girls left college due to yellowish discoloration of teeth . it was diagnosed as dental fluorosis the source traced to high content of fluoride in the drinking water.based on his experience with thyroid disorders and having himself been a victim of a thyroid ailment , he developed a premonitory score to suspect hypothyroidism in a rural setting.a serendipitous observation during the treatment of scorpion envenomation prompted him to suggest that the venom might prove useful for the treatment of brugada syndrome.another common animal bite discussed in detail by dr . the absence of local reaction in krait bite masks the underlying severity and delays treatment . thus , he observed that a victim waking up from sleep from floor bed at midnight due to abdominal pain with early ptosis should be diagnosed with krait bite . in villages , women going to toilet in the open early in the morning were seen as a risk factor for russels viper bite in which in 30 - 40% of the cases death was due to acute renal failure ( arf ) . early administration of asv , mannitol , frusemide , and acetylcysteine prevent arf due to the russels viper bite . also , he suggested simple remedies as sleeping on a cot and the use of mosquito net as protection against any kind of bites.at present the bawaskar couple is investigating and has found increased levels of lead in petrol pump workers , ganpati idol makers , women using lipstick and surma . he has published a manuscript on thrombolytic therapy in ami in rural settings . what prompted him to study this was the fact that chronic diseases and chds have a high prevalence in this area due to excessive salt consumption , usage of coconut oil for cooking , and other lifestyle - related risk factors . alarmed with the rising cases of chronic renal failure in his native place , he studied the problem and found out that heavy metals in drinking water were an important risk factor for the same . in a small village near mahad , girls left college due to yellowish discoloration of teeth . it was diagnosed as dental fluorosis the source traced to high content of fluoride in the drinking water . based on his experience with thyroid disorders and having himself been a victim of a thyroid ailment a serendipitous observation during the treatment of scorpion envenomation prompted him to suggest that the venom might prove useful for the treatment of brugada syndrome . the absence of local reaction in krait bite masks the underlying severity and delays treatment . thus , he observed that a victim waking up from sleep from floor bed at midnight due to abdominal pain with early ptosis should be diagnosed with krait bite . in villages , women going to toilet in the open early in the morning were seen as a risk factor for russels viper bite in which in 30 - 40% of the cases death was due to acute renal failure ( arf ) . early administration of asv , mannitol , frusemide , and acetylcysteine prevent arf due to the russels viper bite . also , he suggested simple remedies as sleeping on a cot and the use of mosquito net as protection against any kind of bites . at present the bawaskar couple is investigating and has found increased levels of lead in petrol pump workers , ganpati idol makers , women using lipstick and surma . bawaskar remains close to reality and his research is driven by day to day experience from his surroundings for betterment of human life , rather than from lucrative offers from private companies that have made medical research a commercial profession that often renders fewer outcomes for improving human health . through many of his correspondences in various journals and books , he has voiced the concerns for ethics and principles in medical practice , hiv - related issues and practice and research in rural areas . he is an ardent advocate of importance of clinical skills in practice and community and need based research . he has over 60 publications in international and national journals to his credit including seventeen letters , one manuscript , and three case reports in the lancet . the techniques used by him may not be sophisticated yet the dedication , efforts and knowledge he has put in to sharpen those techniques have turned them into powerful weapons of his work . he proves the golden adage that the most important part of a stethoscope is between the ear pieces ! he underlines the fact that research should derive its roots from the real problems of people in the community and it should be directed to solve those problems . an overview of his life finds him demanding do not judge me from where i stand , judge me from where i have come . a message from dr . we owe our learning , earning , and satisfaction to our ancestors ( scientists ) who blessed us with their research which gave us direction . it is our moral duty to repay them by engaging ourselves in , contributing to and publishing the research for the benefit of our future generations . this can be done only by performing our honest , sincere , and dedicated duty every single day . never neglect what the patient or his relatives have to say since they are the sole reason of your existence as a doctor .

in the times of rapid advancement of science and technology , advance medical equipment and hi tech hospitals represent the face of medical science . the aspirations and ambitions of medical professionals are also shifting , with growing concerns of deterioration of doctor patient relationship as well as disconnect between services and the community needs . the life of dr himmatrao bawaskar defies several conventions of today 's medical practice . his outstanding dedication towards patients and commitment to provide high quality care in resource poor setting makes him an ideal role model for younger generation of physicians in india .

Early Days Necessity is the Mother of Invention The Eureka Moment Other Areas of Work Some Reflections

paraneoplastic retinopathy ( pr ) is a progressive retinal disease caused by antibodies generated from neoplasms distant from the eye.13 the retinopathy can develop either before or after the diagnosis of the neoplasm . patients with pr usually have night blindness , photopsia , ring scotoma , attenuated retinal arteriole , and abnomal electroretinograms ( ergs ) . pr is thought to be mediated by an autoimmune mechanism , and is associated with the presence of antiretinal autoantibodies in the serum . various types of neoplasms are known to cause pr , including malignancies of the lung , breast , cervix , colon , prostate / bladder , uterus / endometrium , and blood cells . only two cases of pr associated with a sarcoma , a malignant tumor arising from mesenchymal cells , have been reported.4,5 we report a case of pr associated with a retroperitoneal liposarcoma . a 42-year - old man was referred to our hospital with complaints of night blindness and blurred vision in the peripheral field . he did not have any systemic or eye diseases including a malignant tumor , and the family history revealed no other members to have any eye diseases . at the initial examination , his best - corrected visual acuity was 1.0 in both eyes , but goldmann perimetry showed defects in the mid - peripheral visual fields in both eyes ( figure 1a ) . ophthalmoscopy showed that the fundus was nearly normal , but fluorescein angiography demonstrated mottled hyperfluorescence along the vascular arcades ( figure 1b and 1c ) . the erg amplitudes of both the rod and cone components were reduced ( figure 1d , middle column ) . based on these findings , we diagnosed him as having a rod - cone dystrophy . however , his symptoms progressively worsened , and the amplitudes of the ergs were further reduced six months after the initial examination ( figure 1d , right column ) . the abdominal mri showed a large retroperitoneal mass ( figure 2a , arrow ) which compressed the left kidney . we also performed western blot analysis using bovine retinal proteins to determine whether there were any antiretinal antibodies in the serum of our patient . a retinal protein of approximately 83 kd ( figure 2b , arrow ) was detected in the serum of this patient . we also confirmed that the serum reacted with the photoreceptors of a bovine retina ( figure 2c ) . we then diagnosed our patient as having pr associated with retroperitoneal tumor , and the tumor as well as the left kidney was removed ( figure 2d ) . pathologic examination revealed a dedifferentiated liposarcoma that contained the characteristic two patterns of a well differentiated liposarcoma ( figure 2e , asterisk ) and dedifferentiated fibrotic sarcomatoid tissue ( figure 2e , arrow ) . after the tumor was resected , he received chemotherapy but he had a recurrence with metastasis . a pubmed search for cases of pr associated with a sarcoma yielded two cases.4,5 one case involved a uterine sarcoma , and the other a rhabdomyosarcoma of the thorax . to the best of our knowledge , a liposarcoma is a malignancy of fat cells that occurs in deep soft tissue and is mostly seen in the limbs and retroperitoneum.6 it is the most common soft tissue sarcoma and accounts for approximately 20% of all mesenchymal tumors . most of the patients with liposarcoma have no symptoms until the tumor becomes large and causes pain or functional disturbances in neighboring organs . we detected an antiretinal antibody in the serum of our patient , and found that the serum reacted with the photoreceptors of a bovine retina , suggesting that this antibody caused the retinopathy of our patient . however , we did not confirm that this antibody actually reacted to the tumor proteins of our patient . thus , additional experiments are needed because it is known that the antiretinal antibody can be produced not only in pr , but also in other retinal degenerative diseases as a secondary complication of retinal cell death.7 our experience with this case demonstrated that it is important for ophthalmologists to be aware that liposarcoma can be the cause of pr . in these cases , the visual symptoms may precede the discovery of this tumor , because liposarcoma usually grows silently in deep soft tissues without any local symptoms .

we report a case of paraneoplastic retinopathy associated with a retroperitoneal liposarcoma . a 42-year - old man was referred to our hospital with complaints of night blindness and blurred vision in the peripheral field . electroretinograms showed a progressive amplitude reduction in his both eyes . abdominal magnetic resonance imaging showed a large retroperitoneal mass , and pathologic examination revealed a dedifferentiated liposarcoma . western blot analysis showed an antiretinal antibody in the serum of our patient , and his serum reacted with the photoreceptors of a bovine retina . to the best of our knowledge , this is the first case of paraneoplastic retinopathy associated with a liposarcoma .

Introduction Case report Comments

the medial entorhinal cortex is critically involved in spatial navigation and memory . among other functionally specialized cell types 2008 ) , it contains grid cells ( hafting et al . , 2005 ) , spatially modulated neurons which show periodic , hexagonally arranged spatial firing fields . given the striking regularity and invariance of the grid representation , these cells are thought to be part of the brain s coordinate system supporting spatial navigation ( see moser and moser , 2013 for review ) . pure grid cells are primarily found in layer 2 ( boccara et al . , 2010 ) , which differs from other cortical laminae in its unique cell biology . here the two types of principal cells , stellate and pyramidal neurons , have been described ( alonso and klink , 1993 ; germroth et al . , 1989 ) . specifically , stellate and pyramidal neurons differ in conductances and projection patterns ( alonso and llins , 1989 ; lingenhhl and finch , 1991 ; klink and alonso , 1997 ; canto and witter , 2012 ) . recent work indicates that stellate and pyramidal neurons can be reliably differentiated by calbindin immunoreactivity ( ray et al . , 2014 ; kitamura et al . , 2014 ) , and that these cells also differ in their inhibitory inputs ( varga et al . , 2010 ) . calbindin - positive ( calbindin ) cells , which are clustered and arranged in a hexagonal grid ( ray et al . , 2014 ) , have been recently shown to project to the ca1 ( kitamura et al . , 2014 ) , while calbindin - negative ( calbindin ) neurons are homogeneously distributed and project primarily to the dentate gyrus ( varga et al . , 2010 ; ray et al . , few studies have so far explored structure - function relationships in entorhinal circuits ( schmidt - hieber and husser , 2013 ; domnisoru et al . , 2013 ; zhang et al . , 2013 ; see rowland and moser , 2014 and burgalossi and brecht , 2014 for reviews ) . thus , the functional implications of the remarkable cellular diversity of layer 2 have remained largely unresolved . resolving how differential spatial firing relates to principal cell types will clarify the cellular mechanisms of grid discharges and spatial input patterns to distinct subfields of the hippocampus . in the present work we aim at resolving layer 2 circuits by taking advantage of improved methodologies for identifying individual neurons recorded in freely moving animals . by cell identification and theta - locking - based classification of unidentified recordings , we provide evidence that grid and border responses are preferentially contributed by pyramidal and stellate cells , respectively . to explore the cellular basis of grid cell activity in medial entorhinal cortex , we juxtacellularly recorded and labeled neurons in layer 2 ( which contains the largest percentage of pure grid cells ; boccara et al . , 2010 ) in awake rats trained to explore 2d environments ( tang et al . , 2014 ) . the clearest grid - like firing pattern in our sample of 31 identified cells ( 17 of which met the criteria for spatial analysis ; see experimental procedures ) was observed in the calbindin cell shown in figure 1a . this neuron had pyramidal morphology , with simple dendritic arborization and a single large apical dendrite targeting a calbindin patch ( figure 1b ; see also ray et al . , 2014 ) . during exploratory behavior , calbindin neurons fired with strong theta rhythmicity and phase locked near the trough of the local field potential theta rhythm ( figure 1c ; ray et al . , 2014 ) . spatial autocorrelation analysis of the firing pattern in the 2d environment revealed a hexagonal periodicity of firing fields ( grid score = 1.07 ; figure 1d ) , indicative of grid cell activity ( hafting et al . , 2005 ) . because of its relatively low firing rate ( 0.5 hz ) this cell was not included in the grid cell sample ( see experimental procedures ) . most other identified calbindin neurons had no clear spatial firing patterns . the clearest border discharge in our sample of identified cells was observed in the calbindin cell shown in figure 1e . this cell was a stellate neuron , which did not have a single apical dendrite , but instead extended multiple and widely diverging ascending dendrites ; this dendritic tree spanned a vast field , which encompassed multiple calbindin patches ( figure 1f ; see also ray et al . , 2014 ) . on average , spikes from calbindin neurons were weakly modulated by the local theta rhythm ( figure 1 g ) . in 3 out of 11 calbindin cells from recordings with sufficient spatial coverage , we observed clear border firing patterns as in figure 1h . while we did not observe grid cells , nonspatial firing patterns also dominated in calbindin neurons . while the small size of the data set of identified neurons prevented us from establishing firm structure - function relationships , four preliminary observations can be drawn : ( i ) grid cells are less abundant in layer 2 than previously assumed ( sargolini et al . , 2006 ; boccara et al . , 2010 ; but see mizuseki et al . , 2009 ; gupta et al . , 2012 ; bjerknes et al . , 2014 ) , and there is no one - to - one relationship between spatial discharge characteristics and cell type , ( ii ) calbindin neurons probably include grid cells , ( iii ) the absence of grid cells in the 22 identified calbindin stellate neurons suggests that grid cells are rare in this cell population , and ( iv ) calbindin neurons include border cells . currently available evidence points to a correspondence between cytochemical ( calbindin versus calbindin ) and morphological ( pyramidal versus stellate ) classification of principal neurons in layer 2 ( varga et al . , 2010 ; , we determined the percentage of calbindin cells in layer 2 and compared these data with related measurements in the literature ( figure s1a available online ) . in agreement with previous studies ( peterson et al . , 1996 ; kumar and buckmaster , 2006 ; varga et al . , 2010 ) , we found that layer 2 neurons consist of 34% calbindin and 53% calbindin ( and reelin ) principal cells , and 13% interneurons ( figure s1b ) . ( 2014 ) found about 30% of calbindin cells , most of which were shown to have pyramidal morphology ( see also varga et al . , 2010 ; calbindin and calbindin cells showed large quantitative differences in their morphology , but without a clear bimodality in individual morphological parameters ( figures s1c and s1d ) . calbindin cells had significantly ( on average 2.5-fold ) smaller dendritic trees ( figure s1e ) . calbindin cells had a single long ( always apical ) dendrite , which accounted on average for 63% of the total dendritic length ( figure s1e ) and which was polarized toward the center of pyramidal cell patches as shown previously ( ray et al . , 2014 ) . calbindin expression matched well , but not perfectly , with pyramidal cell morphology ( figures s1c and s1d ) . calbindin cells featured similar - length dendrites with the longest dendrite contributing on average for 33% of the total dendritic length ( figure s1e ) . these results are in line with published data and indicate that calbindin and calbindin cells largely correspond to pyramidal and stellate neurons , respectively . however , the lack of clear morphological bimodality in layer 2 ( see also canto and witter , 2012 ) implies that the correspondence between pyramidal / calbindin and stellate / calbindin might not be perfect . interestingly , the spine density in calbindin cells decreased as a function of distance from the soma , whereas the reverse was true for calbindin cells ( figure s1f ) . these morphological differences , together with clustering of calbindin cells in patches and the polarization of their apical dendrites toward the center of calbindin patches ( ray et al . , 2014 ) , likely result in a local and overlapping sampling of inputs in neighboring calbindin cells , whereas neighboring calbindin stellate cells sample large and nonoverlapping input territories . calbindin stellate and calbindin pyramidal cells differ strongly in their temporal discharge properties ( figures 1c and 1 g ; ray et al . , 2014 ) . we therefore wondered if temporal discharge properties could be used to classify layer 2 cells as putative pyramidal or stellate neurons . we used a support vector machine to classify neurons based on both the spike phase and strength of phase locking to local field potential theta oscillations , which indeed clearly segregated calbindin and calbindin cells with a large distance to the separating hyperplane ( figure 2a ; see supplemental information ) . to further improve the purity of assigned cells , we added a guard zone around the hyperplane separating the gaussian kernels classifying calbindin ( light green background ) and calbindin ( gray background ) cells ( omitting the guard zone and classifying all cells did not qualitatively affect the results ; data not shown ) . we tested our classifier by a bootstrapping approach ( figures s2a and s2b ) and found that a large fraction of calbindin and calbindin cells could be correctly assigned ( figure s2c ) . more importantly , the specificity of classification procedure reflected in the purity of the resulting cell samples was excellent , i.e. , 89% for putative calbindin cells and 83% for putative calbindin cells ( figure s2d ) , and even higher values for combination of identified and putatively assigned cells ( figure s2e ) . we further evaluated the robustness of the classifier by testing it on a larger data set of identified layer 2 neurons ( ray et al . , 2014 ) recorded under urethane / ketamine anesthesia ( klausberger et al . , 2003 ) . we consider this a challenging test of the classifier , as theta phase and strength of locking might differ between the awake and anesthetized state . similarly to the awake situation , however , the large majority of neurons recorded under anesthesia were also correctly classified ( 92% of calbindin cells , 65% of calbindin cells , p < 0.001 , bootstrap ; figure 2b , bottom ) , suggesting that our classification criteria work robustly and can effectively generalize across very different recording conditions ( figure 2b ) . encouraged by these results , we classified the larger data set of our hitherto unidentified layer 2 juxtacellular and tetrode recordings ( classified + identified n = 193 cells ) . to assess the relationship between cell identity and spatial firing properties , we pooled the nonidentified recordings , assigned to putative calbindin and calbindin cells , with the recordings from histologically identified neurons . the pooled data sets included n = 99 calbindin and n = 94 calbindin cells , respectively . in our first assessment of spatial discharge patterns , we attempted to classify grid and border cells solely using scores ( grid score > 0.3 , border score > 0.5 ; solstad et al . according to visual inspection of individual rate maps , however , these criteria were not sufficiently stringent and returned a majority of weakly to nonmodulated neurons , i.e. , possibly a majority of false - positive grid and border cells . to resolve this issue ( 2014 ) , in which spatial discharge properties were only quantified in those cells that carried significant amounts of spatial information ( as assessed by a spike - shuffling procedure , see skaggs et al . , 1993 ; supplemental experimental procedures ) . this approach identified grid and border responses , which in a majority of cases were convincing according to visual inspection . boccara et al . , 2010 ; burgalossi et al . , 2011 ; domnisoru et al . , 2013 ) , a fraction of layer 2 neurons ( 33% ; n = 63 cells ) were significantly spatially modulated . weak hexagonal symmetry of spatial firing patterns was observed in both the calbindin and calbindin data set , in line with previous observations ( burgalossi et al . , 2011 ; domnisoru et al . , 2013 however , grid scores in the calbindin population were significantly higher than those in the calbindin population ( p = 0.000046 , mann - whitney u test ; figures 2d and 2e ) , consistent with observations from the identified data set ( figure 1 ) . on the other hand , in line with observations from the identified data set ( figure 1 ) , calbindin cells had significantly higher border scores than calbindin cells ( figure 2 g ; p = 0.0012 , mann - whitney u test ) . border discharges in calbindin cells are shown in figure 2f , which also includes an example where border firing was confirmed by a border test ( solstad et al . , 2008 ; lever et al . , 2009 ) . thus , according to the grid and border scores shown in figures 2d and 2 g , putative pyramidal and stellate cells have significantly different , but overlapping , spatial properties . figure 2h gives an overview of the spatial response properties of our pooled calbindin and calbindin data sets , respectively ( see also figure s3 ) . grid patterns were significantly more common in the calbindin population , where 19% ( 19/99 ) of the cells passed our grid cell criteria , compared to only 3% ( 3/94 ) in the calbindin population ( p = 0.00046 , fisher s exact test ) . a higher fraction of calbindin cells passed the border cell criterion ( 11% calbindin , 10/94 cells ; versus 1% calbindin , 1/99 cells ) , and this difference was statistically significant ( p = 0.0042 , fisher s exact test ) . these data confirm and extend the conclusion from our recordings of identified cells and indicate that grid cells are preferentially recruited from the calbindin population , while border responses preferentially occur in calbindin cells . unlike many studies based on tetrode recordings ( sargolini et al . , 2006 ; , 2010 ; but see zhang et al . , 2013 ) , a substantial fraction of cells showed head - direction selectivity both in identified and theta - assigned calbindin and calbindin cells ( figure s4 ) . head - direction selectivity was more common in calbindin ( 19% , 19 out of 99 cells ) than in calbindin cells ( 12% , 11 out of 94 cells ) , but this difference was not significant ( p = 0.17 , fisher s exact test ) , and both classes contained pure as well as conjunctive responses ( sargolini et al . , 2006 ) . the grid and border cells recorded here showed systematic differences in spike locking to local field potential theta oscillations ( figure 3a ) . spikes from most grid cells were strongly entrained by the theta rhythm , with strong phase locking ( figure 3b ) and a phase preference near the theta trough ( figure 3c ; p = 0.000000027 , rayleigh s test for nonuniformity ) . the modulation of spiking activity of border cells by the theta rhythm was significantly weaker than in grid cells ( figure 3b ; p = 0.0013 , mann - whitney u test ) and showed on average only a weak , nonsignificant phase preference for the theta peak ( figure 3c ; p = 0.21 , rayleigh s test for nonuniformity ) , which differed significantly from the phase preference of grid cells ( figures 3b and 3c ; p = 0.0000088 , parametric watson - williams multisample test ) . thus , in layer 2 grid and border signals mirrored the temporal differences between calbindin pyramidal and calbindin stellate cells reported earlier ( ray et al . relating functionally defined discharge patterns to principal cell diversity is an unresolved issue in cortical physiology . in layer 2 of medial entorhinal cortex , most studies suggested that spatially modulated responses are common , and that grid firing patterns are contributed by both stellate and pyramidal neurons ( burgalossi et al . , 2011 ; schmidt - hieber and husser , 2013 ; domnisoru et al . , 2013 ; zhang et al . , 2013 ) . in line with such evidence , we observed a consistent fraction of spatially modulated neurons in layer 2 , and weakly hexagonal firing patterns in both stellate and pyramidal neurons . at the same time , however , most grid patterns that met our grid score and spatial information criteria ( see supplemental experimental procedures ) were classified as putative calbindin pyramidal cells ( see figure s3a ) . border responses , on the other hand , were predominantly observed in the calbindin stellate population ( figure s3b ) . our data indicate a strong interdependence between cell type and spatial discharge pattern in layer 2 , where a calbindin cell is about six times more likely to be a grid cell and ten times less likely to be a border cell than a calbindin neuron . our confidence in classification is based on the striking differences between calbindin and calbindin cells in their temporal discharge properties ( ray et al . , 2014 ) , the assessment of classification quality by our bootstrapping approach , and the robustness of classification across widely differing recording conditions . it is important , however , to note that our conclusions rest on the validity and accuracy of our classification procedure . a key finding from our work is that layer 2 principal cells can be classified with high accuracy by their distinct temporal discharge properties . such classification can be extended to a large number of unidentified layer 2 recordings from other laboratories , provided that the required histology and local field potential data have been collected . to this end we provide our classification training data set ( table s1 ) and a custom - written matlab function ( supplemental information , note s1 ) . supplying identity to formerly blind extracellular recordings could be instrumental for understanding principal cell diversity and cortical microcircuitry . calbindin pyramidal cells might be predetermined for grid cell function as they receive cholinergic inputs , are strongly theta modulated , and are arranged in a hexagonal grid ( ray et al . , 2014 ) . we suggested an isomorphic mapping hypothesis , according to which an anatomical grid of pyramidal cells ( ray et al . , 2014 ) generates grid cell activity ( brecht et al . , 2014 ) and is an embodiment of the brain s representation of space in hexagonal grids . representing grid discharge by a cortical grid might offer similar advantages as isomorphic representations of body parts , as barrel fields ( woolsey and van der loos , 1970 ) , or nose stripes ( catania et al . , 1993 ) , in somatosensory cortices of tactile specialists . notably , the local similarity of grid cell discharges is high , as neighboring grid cells share the same grid orientation and scaling and are phase coupled even across distinct environments ( hafting et al . , 2005 ; we speculate that calbindin pyramidal neuron clustering and apical dendrite bundling in patches ( ray et al . , 2014 ) a surprising implication of our data is that the spatial input to the dentate gyrus is provided mainly by stellate border cells , whereas pyramidal grid cells do not feed into this pathway ( kitamura et al . , 2014 ; ray et al . , border responses arise in stellate neurons , with long and widely diverging dendritic trees , i.e. , such discharge patterns may result from a relatively global sampling of incoming inputs in medial entorhinal cortex and help generate place cell activity ( bjerknes et al . the functional dichotomy of pyramidal and stellate cells in layer 2 will help elucidate how spatial discharge patterns arise in cortical microcircuits . all experimental procedures were performed according to the german guidelines on animal welfare under the supervision of local ethics committees . juxtacellular recordings and tetrode recordings in freely moving animals were obtained in male wistar and long - evans rats ( 150250 g ) , which were habituated to the behavioral arena and trained for 37 days . experimental procedures were performed as previously described ( burgalossi et al . , 2011 ; herfst et al . , 2012 ) with the exception that methodological developments allowed us to identify neurons in drug - free animals ( tang et al . , 2014 ; see also supplemental experimental procedures ) . some of the data have been published in a previous report ( ray et al . , 2014 ) . recordings in anesthetized animals were performed under urethane / ketamine / xylazine ( klausberger et al . , 2003 ) . a hilbert transform was used for assigning instantaneous theta phase of each spike based on theta in the local field potential in the spike - theta phase analysis . grid scores were calculated as previously described ( barry et al . , 2012 ) by taking a circular sample of the spatial autocorrelogram , centered on , but excluding the central peak . to determine the modulation of a cell firing along a border , we determined border scores as previously described or performed border tests ( solstad et al . , 2008 ; lever et al . , 2009 ) . head - direction tuning was measured as the eccentricity of the circular distribution of firing rates . classification based on strength of locking to theta phase ( s ) and preferred theta phase angle ( ) was done by building a support vector machine , trained on the vectors ( cos()s , sin()s ) using a gaussian radial basis function kernel . classification of nonidentified cells into putative calbindin and calbindin cells was performed by applying a conservative classification threshold , where we did not classify cells close to the separating hyperplane .

summaryin medial entorhinal cortex , layer 2 principal cells divide into pyramidal neurons ( mostly calbindin positive ) and dentate gyrus - projecting stellate cells ( mostly calbindin negative ) . we juxtacellularly labeled layer 2 neurons in freely moving animals , but small sample size prevented establishing unequivocal structure - function relationships . we show , however , that spike locking to theta oscillations allows assigning unidentified extracellular recordings to pyramidal and stellate cells with 83% and 89% specificity , respectively . in pooled anatomically identified and theta - locking - assigned recordings , nonspatial discharges dominated , and weakly hexagonal spatial discharges and head - direction selectivity were observed in both cell types . clear grid discharges were rare and mostly classified as pyramids ( 19% , 19/99 putative pyramids versus 3% , 3/94 putative stellates ) . most border cells were classified as stellate ( 11% , 10/94 putative stellates versus 1% , 1/99 putative pyramids ) . our data suggest weakly theta - locked stellate border cells provide spatial input to dentate gyrus , whereas strongly theta - locked grid discharges occur mainly in hexagonally arranged pyramidal cell patches and do not feed into dentate gyrus .

Introduction Results Discussion Experimental Procedures Author Contributions

trauma is no more considered accidental but a preventable epidemic with a unique pattern of host , agent , and environment working in unison to produce injury . traumatic injuries are associated with significant morbidity and mortality and are of particular relevance currently with technological sophistication in all spheres of life and upsurge in armed conflicts globally . an injury is said to be a bodily lesion at organic level resulting from acute exposure to energy in amounts that exceeds the threshold of physiologic tolerance or the absence of such essentials as heat or oxygen . injuries accounted for 16% of the global burden of disease and an estimated 5.8 million deaths in 1998 with injury - related mortality predicted to increase by 40% between 2002 and 2030 . mortality statistics , in isolation , do not adequately depict the magnitude of injury as for each death there are many more injuries that resulted in hospitalization , treatment in emergency departments , treatment by practitioners outside the formal health sector , or never received treatment at all . to accurately characterize the burden of injury , nonfatal outcomes are also measured by using disability - adjusted life years ( dalys ) which combine the number of years of life lost from premature death with the loss of health from disability among persons with nonfatal injuries . road traffic accidents , falls , assaults , firearm injuries , burns , sports injuries , animal bites , and industrial accidents are some causes of of trauma . deaths from road traffic accidents are predicted to increase from 1.2 million in 2002 to 1.9 million in 2020 globally , to become the third leading cause of dalys losses . increasing waves of terrorism and civil conflicts are expected to lead to a surge in violence - related injuries . trauma care in most developing nations is at infancy level despite the fact that about 90% of injury deaths occur in these nations . dearth of trauma centers , nonexistent ambulance services and prehospital care , and unavailability of data on trauma are some of the impediments to trauma management in nigeria . trauma has been recognized to be preventable over the past few decades and methods for the scientific study of injury prevention have been established . however , the development of effective trauma prevention measures depends on reliable and detailed information on the characteristics and pattern of injury . the aim of this study is to elucidate the pattern and characteristics of trauma at benue state university teaching hospital ( bsuth ) , makurdi , nigeria . this was a hospital - based study of trauma patients of all age groups and gender who presented to the accident and emergency ( a and e ) department of bsuth , makurdi , nigeria from january to december 2013 . bsuth is a tertiary care and teaching hospital for the benue state university and is located along the shores of river benue . there is no trauma center in the city as such most seriously injured patients are referred to the facility . it provides trauma care for inhabitants of the city and surrounding areas of north central nigeria . the case records of all patients seen with injuries at the a and e department during the study period were retrieved . demographic data , types of injuries sustained , causes and circumstances of injuries , as well as outcome of treatment were extracted from the case files and entered onto a computerized questionnaire . data were analyzed using the software statistical package for social sciences for windows version 15.0 ( spss inc ; chicago , illinois ) . descriptive statistics were used to display single variable quantities using means and standard deviations ( sd ) for continuous variables or proportions for categorical variables unless otherwise stated . this was a hospital - based study of trauma patients of all age groups and gender who presented to the accident and emergency ( a and e ) department of bsuth , makurdi , nigeria from january to december 2013 . bsuth is a tertiary care and teaching hospital for the benue state university and is located along the shores of river benue . there is no trauma center in the city as such most seriously injured patients are referred to the facility . it provides trauma care for inhabitants of the city and surrounding areas of north central nigeria . the case records of all patients seen with injuries at the a and e department during the study period were retrieved . demographic data , types of injuries sustained , causes and circumstances of injuries , as well as outcome of treatment were extracted from the case files and entered onto a computerized questionnaire . data were analyzed using the software statistical package for social sciences for windows version 15.0 ( spss inc ; chicago , illinois ) . descriptive statistics were used to display single variable quantities using means and standard deviations ( sd ) for continuous variables or proportions for categorical variables unless otherwise stated . there were 203 ( 81.2% ) males and 47 ( 18.8% ) females with a male to female ratio of 4.3:1 . their ages ranged from 3 to 74 years with a mean of 32 13.1 years . sex distribution of patients with respect to age groups unintentional injuries were the predominant form of trauma ( n = 209 , 83.6% ) . road traffic accidents were the most common cause ( n = 180 , 72.0% ) . this was followed by gunshot injuries ( n = 21 , 8.4% ) and assault ( n = 20 , 8.0% ) . etiologies of trauma with respect to age groups the extremities were the most commonly injured body region ( n = 148 , 43.5% ) . this was followed by the head ( n = 112 , 32.9% ) , chest ( n = 46 , 13.5% ) , abdomen ( n = 16 , 4.7% ) , spine ( n = 10 , 2.9% ) , and pelvis ( n = 8 , 2.4% ) . open wounds ( abrasions and lacerations ) were the most common injury type sustained ( n = 95 , 28.2% ) . isolated injuries occurred in 166 ( 66.4% ) patients , while 84 ( 33.6% ) patients were multiply - injured . one hundred and twenty - one patients ( 48.8% ) sustained severe / profound injuries . distribution of injuries sustained by patients the majority of patients ( n = 138 , 55.2% ) were admitted and treated in the a and e , 110 ( 44.0% ) in the general / pediatric surgical and orthopedic wards and two ( 0.8% ) in the intensive care unit . of the 250 patients , 142 were treated surgically of which surgical wound debridement ( n = 90 , 63.3% ) was the most common procedure carried out . length of hospital stay ranged between 1 and 160 days with a mean duration of about 8 days . mortality pattern of traumatized patients majority of patients ( n = 133 , 53.2% ) were treated and discharged without permanent disability . eleven ( 4.4% ) were discharged with permanent disability ( paraplegia , limb loss , etc . ) , 56 ( 22.4% ) opted for discharge against medical advice , while 12 ( 4.8% ) were referred . there were 203 ( 81.2% ) males and 47 ( 18.8% ) females with a male to female ratio of 4.3:1 . their ages ranged from 3 to 74 years with a mean of 32 13.1 years . unintentional injuries were the predominant form of trauma ( n = 209 , 83.6% ) . road traffic accidents were the most common cause ( n = 180 , 72.0% ) . this was followed by gunshot injuries ( n = 21 , 8.4% ) and assault ( n = 20 , 8.0% ) . etiologies of trauma with respect to age groups the extremities were the most commonly injured body region ( n = 148 , 43.5% ) . this was followed by the head ( n = 112 , 32.9% ) , chest ( n = 46 , 13.5% ) , abdomen ( n = 16 , 4.7% ) , spine ( n = 10 , 2.9% ) , and pelvis ( n = 8 , 2.4% ) . open wounds ( abrasions and lacerations ) were the most common injury type sustained ( n = 95 , 28.2% ) . isolated injuries occurred in 166 ( 66.4% ) patients , while 84 ( 33.6% ) patients were multiply - injured . one hundred and twenty - one patients ( 48.8% ) sustained severe / profound injuries . distribution of injuries sustained by patients the majority of patients ( n = 138 , 55.2% ) were admitted and treated in the a and e , 110 ( 44.0% ) in the general / pediatric surgical and orthopedic wards and two ( 0.8% ) in the intensive care unit . of the 250 patients , 142 were treated surgically of which surgical wound debridement ( n = 90 , 63.3% ) was the most common procedure carried out . length of hospital stay ranged between 1 and 160 days with a mean duration of about 8 days . majority of patients ( n = 133 , 53.2% ) were treated and discharged without permanent disability . eleven ( 4.4% ) were discharged with permanent disability ( paraplegia , limb loss , etc . ) , 56 ( 22.4% ) opted for discharge against medical advice , while 12 ( 4.8% ) were referred . the burden of trauma in this study is mostly borne by young males , a finding similar to those from other studies . male predominance is likely to be due to the fact that males are more involved in risk - taking activities and more exposed to the elements being the main revenue - earners in families . involvement of the active and productive segment of the society suggests huge losses to the economy . the impact of trauma on this group may be reduced by incorporating preventive measures into children 's school curriculum so as to particularly target boys in their formative years . road traffic injuries are a major cause of death and disability globally , with a disproportionate number occurring in developing countries . they were the leading cause of injury in this study in a similar manner to a number of studies and accounted for over 70% of the mortality . developing countries accounted for more than 85% of all deaths due to road traffic crashes globally in 1998 . reasons put forward for this high burden of road traffic accidents in developing countries include growth in motor vehicle numbers , poor enforcement of traffic safety regulations , and poor access to health services . passengers and pedestrians constituted the majority of road traffic injured patients in this study in keeping with studies from other developing countries . this is in contradistinction to findings from the united states where drivers are the majority of the injured . this may be because of frequent crashes involving multi - passenger vehicles like buses and trucks as well as nonexistent pedestrian walkways on most roads in low - income countries . firearms are the most destructive of readily available weapons in modern society and injuries resulting from them are associated with a high morbidity and mortality . firearm injuries were the second leading cause of trauma in this study constituting over 20% of overall causes . the high rate of gunshot injuries in this study is likely to be due to an armed conflict between nomadic herdsmen and local farmers over rights to grazing land in the study area . designating special grazing zones along the seasonal migration route of the herdsmen and establishing open channels for conflict resolution may go a long way to help mitigate future occurrences . snake bites constituted the most fatal of all the causes of trauma in this study with about 40% mortality rate . most patients got bitten while working on farms in remote areas and late presentation to hospital prevented early institution of treatment . provision of personnel and facilities to administer anti - snake venom at primary healthcare centers in the countryside before referral to tertiary centers may help improve the outcome of treatment . use of approved safety helmets by at - risk individuals like construction workers and motorcyclists is known to reduce the incidence traumatic head injury . in fact , severe head injury among motorcyclists is said to be a reflection of low usage of helmets . the high mortality from head injuries in this study may be due to the culture of poor usage of safety helmets that is prevalent in developing countries . trauma in makurdi is a predominantly young adult male occurrence with road traffic accidents being the leading etiological factor .

background : trauma leads to considerable morbidity and mortality . the aim of this study is to elucidate the pattern and characteristics of trauma at benue state university teaching hospital ( bsuth ) , makurdi , nigeria.materials and methods : case records of all patients who presented to the accident and emergency ( a and e ) department with trauma between january and december 2013 were analyzed for demographic data , types of injuries sustained , causes and circumstances of injuries , as well as outcome of treatment were extracted from the case files and entered onto a computerized questionnaire . data were analyzed using the software statistical package for social sciences for windows version 15.0 ( spss inc ; chicago , illinois).results : a total of 250 traumatized patients were studied consisting of 203 ( 81.2% ) males and 47 ( 18.8% ) females with a modal age group of 2130 years . unintentional injuries were the most predominant form of trauma ( n = 209 , 83.6% ) with road traffic accidents being the leading cause ( n = 180 , 72.0% ) . open wounds ( n = 95 , 28.2% ) were the most common form of injury sustained and the extremities ( n = 148 , 43.5% ) , the most frequently injured body region . most patients ( n = 133 , 53.2% ) were treated and discharged home without permanent disabilities , while death occurred in 15.2%.conclusion : trauma in makurdi is a predominantly young adult male occurrence with road traffic accidents being the leading etiological factor . reducing road traffic accidents will likely reduce mortality and morbidity due to trauma .

INTRODUCTION MATERIALS AND METHODS Study design and setting Study population Statistical analysis RESULTS Demographic data Circumstances of injury Outcome DISCUSSION CONCLUSION

chlamydophila pneumoniae is a common etiological factor of the respiratory tract infections , including pharyngitis , bronchitis , and pneumonia . it is estimated that c. pneumoniae is responsible for pneumonia in approximately 10% of cases , and for bronchitis and sinusitis in approximately 5% of cases . the main symptoms of infection include cough , pharyngitis and , hoarseness , often accompanied by sinusitis pharyngitis occurs in the first phase , followed by bronchitis or pneumonia in the second phase of a disease . prolonging cough ( for more than 3 weeks ) is a basic symptom indicating c. pneumoniae infection [ 4 - 6 ] . respiratory tract infections of c. pneumoniae etiology are characterized by a long incubation period , usually lasting 14 - 21 days . untreated infections can lead to many complications , such as exacerbations of bronchial asthma , endocarditis , coronary heart disease , endothelitis , and abortions [ 7 - 9 ] . the aim of this study was to assess the incidence of chlamydial respiratory tract infections in children and adolescents in the lower silesia region of poland in the year 2009 . the study was performed in accordance with the declaration of helsinki for human research and the study protocol was accepted by institutional ethics committee . in 2009 , children treated for various , non - specific respiratory illnesses in different hospital wards , in clinical departments , or as outpatients ( mainly from family practices ) in the lower silesia region were investigated for c. pneumoniae infections . the study materials were 641 throat swabs obtained from 326 girls and 315 boys , aged 11 months to 18 years . past medical history of these patients was indicative of recurrent respiratory tract infections , long - lasting paroxysmal dry cough , rhinitis , and hoarseness . throat swabs from the posterior wall of the pharynx were made before the start of any treatment , with the use of thin , sterile disposable swabs . tests for the presence of c. pneumoniae antigens in throat swabs were performed by an indirect immunofluorescence antibody ( ifa ) technique , using the chlamydia cel pn testing kits ( cellabs pty ltd . , sydney , australia ) . table 1 presents the results of throat swabs examination for c. pneumoniae in 641 children . the positive ifa test results were shown in 276 patients ( 43.1% of the study group ) , including 41.4% of girls and 44.8% of boys . the proportion of positive results was strikingly large , and it should be taken into consideration regarding epidemiologic assessment , differential diagnosis , and therapeutic management . the presence of c. pneumoniae antigens in children depending on the diagnosis and the clinical symptoms is shown in table 2 . in the group of children with features of infection which manifested itself in the form of dry cough , the proportion of positive results for c. pneumoniae was 41.4% , and in the children with cough , rhinitis , and discharge from the throat - 47.2% . an assumption can be made that these are the dominant clinical symptoms of infection , since other symptoms like hoarseness occurred only in 22.9% of the examined subjects . in the group of children with symptoms of infection and having contact with sick people around them , the proportion of positive findings for c. pneumoniae was 48.3% , whereas in the children without infection in their environment this proportion was as low as 29.3% . that shows that there was a high probability of transmitting infection with cough or as droplet infection . in the group of children followed up for 14 days after the end of treatment , the presence of c. pneumoniae antigens was revealed in 54.2% . the latter observation is of a substantial interest to us , since it could have a bearing on further patients ' management . the significance of this observation is , however , hampered by a relatively small number of patients , 48 ( 17.3% ) out of the group of 276 with positive tests for the presence of c. pneumoniae antigens , who were followed up . the following conclusions can be drawn from the findings of this study : in the group of children and adolescents from the lower silesia region a large number of c. pneumoniae airborne and droplet infections were revealed ; the most common clinical symptoms were dry cough lasting for more than 3 weeks and rhinitis ; the diagnosis of the respiratory tract infection in a child caused by chlamydia should be the signal for a thorough examination of people from its closest circle ; patients treated with antibiotics should always be followed up , because in nearly 50% of them the presence of chlamydia pneumoniae can still be detected .

objectiveto assess the incidence of chlamydia pneumoniae respiratory tract infection in children and adolescents in the lower silesia region in poland in 2009.materials and methods641 throat swabs obtained from 326 girls and 315 boys , aged 11 months to 18 years , were assessed diagnostically . the patients enrolled into the study were treated on an outpatient basis due to various , non - specific respiratory ailments . the most common presenting clinical symptom of a respiratory problem was dry cough , which occurred in 295 studied subjects , followed by runny nose and cough with discharge in 176 subjects , and other minor symptoms in 35 subjects . the assessment was conducted by an indirect immunofluorescence antibody ( ifa ) chlamydia testing kit ( cellabs , sydney , australia).resultsoverall , chlamydia infection was detected in the respiratory tract in 43.1% ( 276/641 ) of the children , with no clear gender differences . of the 295 subjects presenting with dry cough , 122 ( 41.4% ) had positive tests for chlamydia . of the 176 subjects with runny nose and cough and the 35 subjects with other symptoms , 83 ( 47.2% ) and 8 ( 22.9% ) had positive tests for chlamydia , respectively . in the asymptomatic children who had direct contact with a chlamydia infected person , there were 29.6% ( 8/27 ) positively tested cases , whereas in the children presenting symptoms , the percentage of positive tests was 48.3% ( 29/60).conclusionsin children living in the lower silesia region of poland , there is a substantial ~50% rate of chlamydia infection , transmitted via airborne droplets . the finding of chlamydia infection should be the signal for testing other subjects from the child 's closest environment .

Introduction Materials and methods Results and Discussion Conclusions Conflicts of interest

a 15-day - old male baby was brought from an orphanage with his right testes extruding from the scrotum . care givers at the orphanage noticed sudden extrusion of the right testes from the scrotal defect without any redness or swelling prior to this event . the baby had a transverse wound at the base of the scrotum with his testis prolapsing through it [ figure 1 ] . there was no bleeding and the testis appeared edematous and firm in consistency , suggestive of orchitis . a newborn baby was noticed to have transverse breech at the base of the left scrotal wall with protrusion of the testis . there was no history of any birth injury or injury to the scrotum after birth . the left testes was seen to be protruding from the scrotum , normal in size and appeared viable [ figure 2 ] . repositioning of the testis and repair of the scrotum was performed with biopsy of the edges . the post - operative period was uneventful in both babies with excellent healing of the wounds . edge biopsy of the skin showed early inflammatory signs with no features of presence of meconium or aplasia cutis . both babies were followed at regular intervals and recent follow - up at 1 year showed good healing of the wounds with normal - sized testis in the scrotum . a 15-day - old male baby was brought from an orphanage with his right testes extruding from the scrotum . care givers at the orphanage noticed sudden extrusion of the right testes from the scrotal defect without any redness or swelling prior to this event . the baby had a transverse wound at the base of the scrotum with his testis prolapsing through it [ figure 1 ] . there was no bleeding and the testis appeared edematous and firm in consistency , suggestive of orchitis . a newborn baby was noticed to have transverse breech at the base of the left scrotal wall with protrusion of the testis . there was no history of any birth injury or injury to the scrotum after birth . the left testes was seen to be protruding from the scrotum , normal in size and appeared viable [ figure 2 ] . repositioning of the testis and repair of the scrotum was performed with biopsy of the edges . the post - operative period was uneventful in both babies with excellent healing of the wounds . edge biopsy of the skin showed early inflammatory signs with no features of presence of meconium or aplasia cutis . both babies were followed at regular intervals and recent follow - up at 1 year showed good healing of the wounds with normal - sized testis in the scrotum . scrotoschisis , the extrusion of the testis through the scrotal wall in neonates , is very rare . the testicular descent is in the normal pathway but extrusion occurs due to a defect in the scrotal skin wall , the cause of which is not fully understood yet . many theories have been proposed for the development of this condition , but none is proved . the proposed pathophysiology is the late rupture of the scrotal skin secondary to an inflammatory reaction caused by exposure to meconium extruded from an intestinal segment and delivered to the scrotum during fetal life through the patent processus - vaginalis , but other reports have failed to demonstrate evidence of meconium peritonitis like in our cases . the site of defect described in meconium - associated evisceration is anteromedial in the scrotum , but in both the cases the defect was at the base of the scrotum suggesting other etiology for its development . external mechanical compression due to arthrogryposis obstetric trauma proposed as cause is less likely as the testes and scrotum being mobile structures will escape from injury . shukla et al . called it as extracorporeal ectopic occurring due to scrotal defect during descent of the testes . suggested the failure of differentiation of scrotal mesenchyme leaving a defect where gubernaculum was covered only by a thin layer of epithelium causing rupture or avascular necrosis of the scrotum due to a lack of a sufficient supporting structure within it . early amnion rupture or the adhesion / band spectrum is often cited as a probable factor in scrotoschisis . aberrant amnion bands , strands or sheets can cause disruption of morphogenesis in the abdominal wall . the different techniques described for scrotal fixation as in orchiopexy can be utilized . as the number is very small , browne trans - scrotal orchiopexy ( eversion of tunica vaginalis with fixation in subdartos pouch ) is associated with good results . the first neonate in our series was 15 days old and no abnormality of the scrotum was noted . however , the testis appeared bigger and firm in consistency , indicating orchitis . all these theories are not accepted and no uniform findings were described in all reports ; hence , the cause still remains unclear . in conclusion , scrotoschisis seems to affect otherwise healthy newborn males with no associated illness requiring repositioning of eviscerated testis with scrotal repair . the immediate prognosis is good , but long - term results need to be studied .

spontaneous extrusion of the testis from the scrotum is a very rare cause of acute scrotum in neonates . it has been described as scrotoschisis in few case reports . the exact etiology of this condition is not known . replacing the testes and repair of scrotum is needed and associated with good prognosis . we report two cases that presented in a short interval to us with a review of the literature .

INTRODUCTION CASE REPORTS Case 1 Case 2 DISCUSSION

the discovery of x - rays by roentgen in the year 1895 and radioactivity by becquerel in the year 1896 can be considered as the turning point in human health care as the x - rays allowed to peep inside the human body [ 1 , 2 ] . although harmful effects of ionizing radiations were reported within a few months of discovery of x - rays , the real magnitude was not known . study of occupational workers like physicians and scientists handling radioactivity gave a clear picture of the harmful effects of ionizing radiations , which was further strengthened after the study of japanese atomic bomb survivors of 1945 . it is now fairly well established that radiation produces deleterious effects on the organisms and widespread use of radiation in diagnosis therapy , industry , energy sector and inadvertent exposure during air and space travel , nuclear accidents and nuclear terror attacks requires safeguard against human exposures . lead shielding and other physical measures are cumbersome to use in such situations , therefore pharmacological intervention could be the most prudent strategy to protect humans against the harmful effect of ionizing radiations . the use of chemicals to protect against the harmful effects of radiation was attempted after world war ii with the realization of the need to safeguard humans against the military use of atomic weapons . patt and his co - workers ( 1949 ) were the first to investigate the effect of amino - acid cysteine in rats exposed to lethal doses of x - rays . thereafter , several chemical compounds and their analogues have been screened for their radioprotective ability however , their high toxicity at optimum protective doses precluded their clinical use [ 4 , 5 ] . the other major drawback of these compounds was that they were unable to provide post - irradiation protection . with the recognition that normal tissue protection during radiotherapy is as important as the destruction of cancer cells , recent terror attacks throughout the world has strengthened the idea that it its necessary to devise appropriate measures against the nuclear terror attacks by using pharmacological agents that can protect against the ill effects of radiation . the high toxicity of thiol compounds necessitated search for alternative agents , which could be less toxic and highly effective at non - toxic dose levels . it was also thought that products / compounds isolated from natural sources could be of substantial use as non - toxic radioprotectors . therefore , investigators diverted their attention towards the plant and natural products during the last two decades . plants have been reported to play an important role in the discovery of new drugs for the treatment of human diseases , which indicated that natural products play a highly significant role in the drug discovery and development process . this was particularly evident in the areas of cancer and infectious diseases , where over 60% and 75% of these drugs , respectively , were shown to be of natural origin . a good chemical protector should be able to protect against the deleterious effect of ionizing radiation during therapeutic procedures as well as during nuclear accidents , space flight and background irradiation etc . an ideal radioprotector should be cheap , does not have toxic implications in a wide dose range , orally administered , rapidly absorbed , possesses a reasonably good dose reduction factor and can act through multiple mechanisms . they are usually non - toxic , relatively cheap , can be orally administered and could act through multiple mechanisms due to the presence of many chemicals . the advantage of plants and natural products is that they are used in several traditional systems of medicines . once this is done their use , as radioprotectors could be more successful than synthetic chemicals . the most pragmatic approach to select the possible candidate to evaluate radioprotective effect is to look into the available properties of the substance . whether a substance has anti - inflammatory , antioxidant , antimicrobial , immunomodulatory , free radical scavenging or anti - stress properties , if so , it may act as a potential radioprotector and could be the right candidate for evaluation of its radioprotective activity . short - term in vitro tests can provide a basis for detailed evaluation of radioprotective activity . assay of free radicals and antioxidant status of a pharmacological agent can also provide some leads regarding the radioprotective potential of such agents . if a plant or a natural product is found to inhibit lipid peroxidation and scavenge free radicals , it may act as a possible radioprotector . the next step is to evaluate its radioprotective potential in vitro using cell survival and micronuclei assays . if it is found to elevate cell survival and reduce radiation - induced micronuclei formation , it certainly has a potential as a radioprotector . there are other short - term tests like dna strand breaks , apoptosis and estimation of glutathione ( gsh ) and enzymes like catalase , glutathione peroxidase etc . that can also provide an inkling of the radioprotective activity of any pharmacological agent . however , the gold standard for radioprotective activity is the evaluation of 30-day survival in rodents , since the animal studies with death as the end point are the most confirmatory , because the 30-day survival after lethal whole body irradiation clearly indicates the capacity of the pharmacological agent in test to modulate the recovery and regeneration of the gastrointestinal epithelium and the hemopoietic progenitor cells in the bone marrow , the two most radiosensitive organs that are essential for sustenance of the life . the most reliable procedures involve determination of a dose reduction factor ( drf ) . in animal studies , drfs are typically determined by irradiating mice with or without administering radioprotective agent at a range of radiation doses and then comparing the endpoint of interest . for example , the drf for 30-day survival ( ld50/30 drug - treated divided by ld50/30 vehicle - treated ) quantifies protection of the hemopoietic system [ 8 , 9 ] . with sufficient loss of hemopoietic stem cells the gi syndrome in mice can be assessed by determining survival up to ten days ( measure of gi death ) after exposure to comparatively high doses of whole - body radiation , whereas hemopoeitic syndrome can be assessed by monitoring the survival of irradiated animals up to 30 days post - irradiation [ 711 ] . the intestinal crypt cell assay or functional changes also serve as indicators of gi damage . the most informative and useful preclinical studies relate protective effects to the drug s toxicity in the same animal model . the efficacy of radioprotectors in clinical practice requires different end points . among other endpoints amenable to the determination of beneficial effects of radioprotectors , the most readily evaluable is protection against mucositis and xerostomia resulting from head and neck radiotherapy and various side effects when the gi tract is in the radiation field . an intravenous infusion of an ethanol extract of gingko biloba leaves , at a dose of 100 mg / person was found to be effective in patients with vasogenic edema observed after irradiation of the brain . it has been reported to protect against the clastogenic factors from plasma of human subjects exposed to irradiation . treatment of recovery workers from the chernobyl accident site was found to be effective when an oral dose of 40 mg / day of g. biloba was given 3 times daily for 2 months . aqueous extract of centella asiatica reduced the adverse effect of low dose irradiation in sprague dawley rats by inhibiting radiation - induced body weight loss and conditioned taste aversion . similarly , it has been found to protect against the radiation - induced weight loss in mice exposed to 8 gy -radiation . oral administration of a hippophae rhamnoides fruit juice concentrate to rats before or after irradiation increased life span , restored the 11-oxycorticosteroid level in the blood and weight of isolated adrenals , and also normalized their basal activity and response to ( acth ) ( corticotropin ) under in vitro conditions . hydroalcoholic extract of berries of h. rhamnoides also protected mice against -radiation - induced mortality , decline in endogenous colony forming unit ( cfu ) , micronuclei formation and various other hematological parameters [ 2022 ] . the radioprotective property of osimum sanctum was first reported by jagetia et al . against the radiation - induced mortality , thereafter studies by uma devi and her coworkers established its radioprotective efficacy by evaluating mouse survival , spleen colony assay , and chromosome aberrations in mouse bone marrow cells . apart from these osmium has been reported to protect against radiation - induced lipid peroxidation and reduction in glutathione concentration [ 24 , 25 ] . the radioprotective efficacy of ginseng ( panax ginseng ) has been reported by several workers [ 2630 ] . the whole extract of ginseng and the relative protective effects of various fractions ( carbohydrate , protein and saponins ) have been evaluated . the results showed that the water - soluble whole extract of ginseng provided best protection against radiation induced damage in c3h mice , whereas isolated protein and carbohydrate fractions were less effective , the saponin fraction was ineffective . similar results were obtained by kim and coworkers , who found that whole ginseng extract and its fractions increased endogenous spleen colony formation in irradiated mice and also reduced apoptosis in jejunal crypt cells . the radioprotective effect of ginseng root extract on testicular enzymes ( acid and alkaline phosphatases and lipid peroxidation ) has also been reported . hexandrum has been reported to protect against radiation - induced mortality , gastrointestinal damage and embryonic nervous system of developing mice [ 20 , 3335 ] . it has also been reported to protect against radiation - induced decline in glutathione - s - transferase , superoxide dismutase in the liver and intestine of irradiated mice . oral administration of an aqueous extract of guduchi , tinospora cordifolia has been reported to increase the survival of mice exposed to radiation . treatment of mice with hydroalcoholic extract of tinospora cordifolia has been found to protect against the radiation - induced micronuclei formation and oxidative stress and decline in the mouse survival , spleen cfu and hematological parameters . the fruit pulp of amala , emblica officinalis ( eo ) has been reported to increase the survival and inhibit radiation - induced weight loss in mice . phyllanthus amarus has been reported to protect against the radiation - induced decline in white blood cells ( wbc ) , superoxide dismutase , catalase , glutathione - s - transferase , glutathione peroxidase , and glutathione reductase . daily oral administration of 800 mg / kg body weight ( b. wt . ) of rajgira ( amaranthus paniculatus ) leaf extract for 15 consecutive days before whole body exposure to -radiation protected mice against the radiation - induced lethality with a dose reduction factor of 1.36 . it increased endogenous spleen colony forming units and spleen weight without any side effects or toxicity . rajgara extract also arrested radiation - induced lipid peroxidation and the decline in reduced glutathione in the liver and blood of mice . the ethanolic extract of piper longum ( pippali ) fruits was found to protect mice against the radiation - induced decline in wbc , bone marrow cells -esterase positive cells and gsh . pippali extract also reduced the elevated levels of glutathione pyruvate transaminase ( gpt ) , alkaline phosphatase ( alp ) , lipid peroxidation ( lpo ) in liver and serum of irradiated animals . the dietary supplements , if found radioprotective may be of crucial importance , as they are in daily human use , nontoxic and have wide acceptability . skeels also known as eugenia cumini ( family myrtaceae ) , and has been reported to posses several medicinal properties in the folklore system of medicine . the micronucleus study of radioprotective effect of dichloromethane and methanol ( 1:1 ) extract of jamun ( sce ) in human peripheral blood lymphocytes ( hpbls ) ascertained its radioprotective potential , where 12.5 g / ml sce was found to reduce the micronuclei up to a maximum extent . in vivo evaluation further established its radioprotective activity where it was found to reduce radiation - induced sickness , gastrointestinal and bone marrow deaths [ 7 , 44 ] . not only leaf but the hydroalcoholic extract of jamun seeds ( jse ) also exhibited a greatest protective effect at 80 mg / kg jse . the jse was more effective when administered through the intraperitoneal route at equimolar doses than the oral . the jse treatment protected mice against the gastrointestinal as well as bone marrow deaths with a drf of 1.24 . , family lamiaceae ) , a plant , native of japan , is used as a food seasoner , household remedy , and for industrial purposes . extract of mint ( mentha arvensis linn ) protected against the radiation - induced sickness , gastrointestinal and bone marrow deaths with a drf of 1.2 . further it was non - toxic up to a dose of 1000 mg / kg b. wt . pre - treatment of mice with leaf extract of another species of pudina , i.e. mentha piperita has been reported to protect mice against the radiation - induced decline in hematological constituents , serum phosphatase , endogenous spleen colonies formation , spleen weight , goblet cells / villus section and chromosomal damage [ 4850 ] . the rhizome of zingiber officinale , commonly known as ginger , is consumed daily worldwide as a spice and flavoring agent . the rhizome of ginger has been reported to possess diverse medicinal properties in the traditional indian system of medicine , the ayurveda , and it is widely used in several medicinal preparations . administration of 10 mg / kg ( i.p ) or 250 mg / kg ( orally ) hydroalcoholic extract once daily , consecutively for 5 days was found to protect mice against the radiation - sickness , gastrointestinal as well as bone marrow deaths with a drf of 1.15 . ginger has been reported to increase glutathione , reduce lipid peroxidation in vivo and scavenging of various free radicals in vitro [ 52 , 53 ] . ageratum conyzoides , ( family : asteraceae ) is commonly known as billy goat weed . it has been used in various parts of africa , asia and south america for curing various diseases . the study of various doses of alcoholic extract of ageratum conyzoides , linn . revealed that the best protective dose was 75 mg / kg and it reduced radiation - induced , sickness gastrointestinal as well as bone marrow deaths . the radioprotective effect was due to scavenging of dpph ( 1,1-diphenyl-2-picrylhydrazyl ) , free radical . aegle marmelos correa , commonly known as bael , is a spinous tree belonging to family rutaceae . it is grown throughout the sub - continents as well as bangladesh , burma and srilanka . the hydroalcoholic extract of aegle marmelos ( ame ) protected cultured hpbls against the radiation - induced micronuclei at a concentration of 5 g / ml . it was also reported to scavenge oh , o2 , dpph , abts and no ( nitric oxide ) radicals in vitro in a concentration dependent manner . the radioprotective efficacy of 15 or 250 mg / kg ame was further confirmed in animal studies where its intraperitoneal as well as oral administration has been found to protect mice against the radiation - induced sickness , gastrointestinal and bone marrow deaths and mortality giving a drf of 1.2 . it also protected mice against the radiation - induced lipid peroxidation and elevated gsh concentration in the liver , kidney , stomach and intestine at 31 days post - irradiation . oral administration also protected mice against the gamma radiation - induced decline in erythrocytes , leukocytes , lymphocytes and clonogenicity of hemopoietic progenitor cells assessed by exogenous spleen colony forming assay . pretreatment of mice with ame elevated the villus height and the crypt number accompanied by a decline in goblet and dead cell number [ 57 , 58 ] . not only leaf but also the hydroalcoholic extract of aegle marmelos fruit administered intraperitoneally at a dose of 20 mg / kg once daily , consecutively for five days found to protect mice against the radiation - induced sickness , gastrointestinal as well as bone marrow deaths with a drf of 1.1 . parker [ amoora rohituka , amoora aphanamixis ( roxb . ) wight & arn . ] is a member of the family meliaceae . the ethyl acetate fraction of aphanamixis polystachya at a dose of 7.5 mg / kg b. wt . before exposure to 15 gy of whole body gamma - radiation significantly reduced the frequencies of aberrant cells and chromosomal aberrations like acentric fragments , chromatid and chromosome breaks , centric rings , dicentrics , exchanges and total aberrations at all post - irradiation scoring times . it also showed a concentration dependent scavenging of hydroxyl , superoxide , 2,2'-diphenyl-1-picryl hydrazyl ( dpph ) radicals and the 2,2-azino - bis-3-ethyl benzothiazoline-6-sulphonic acid ( abts ) cation radicals in vitro . eap treatment also reduced lipid peroxidation in bone marrow cells in a concentration dependent manner . ionizing radiations induce reactive oxygen species in the form of oh , h , singlet oxygen and peroxyl radicals that follows a cascade of events leading to dna damage such as single- or double - strand breaks ( dsb ) , base damage , and dna - dna or dna - protein cross - links , and these lesions cluster as complex local multiply damaged sites . the dna - dsbs are considered the most lethal events following ionizing radiation and has been found to be the main target of cell killing by radiation . the putative mechanisms of radioprotection by plant and herbal radioprotectors are shown in fig . 1 . the radioprotective activity of plant and herbs may be mediated through several mechanisms , since they are complex mixtures of many chemicals . the majority of plants and herbs contain polyphenols , scavenging of radiation - induced free radicals and elevation of cellular antioxidants by plants and herbs in irradiated systems could be leading mechanisms for radioprotection . the polyphenols present in the plants and herbs may upregulate mrnas of antioxidant enzymes such as catalase , glutathione transferase , glutathione peroxidase , superoxide dismutase and thus may counteract the oxidative stress - induced by ionizing radiations . upregulation of dna repair genes may also protect against radiation - induced damage by bringing error free repair of dna damage . reduction in lipid peroxidation and elevation in non - protein sulphydryl groups may also contribute to some extent to their radioprotective activity . the plants and herb may also inhibit activation of protein kinase c ( pkc ) , mitogen activated protein kinase ( mapk ) , cytochrome p-450 , nitric oxide and several other genes that may be responsible for inducing damage after irradiation . the discovery of x - rays by roentgen in the year 1895 and radioactivity by becquerel in the year 1896 can be considered as the turning point in human health care as the x - rays allowed to peep inside the human body [ 1 , 2 ] . although harmful effects of ionizing radiations were reported within a few months of discovery of x - rays , the real magnitude was not known . study of occupational workers like physicians and scientists handling radioactivity gave a clear picture of the harmful effects of ionizing radiations , which was further strengthened after the study of japanese atomic bomb survivors of 1945 . it is now fairly well established that radiation produces deleterious effects on the organisms and widespread use of radiation in diagnosis therapy , industry , energy sector and inadvertent exposure during air and space travel , nuclear accidents and nuclear terror attacks requires safeguard against human exposures . lead shielding and other physical measures are cumbersome to use in such situations , therefore pharmacological intervention could be the most prudent strategy to protect humans against the harmful effect of ionizing radiations . the use of chemicals to protect against the harmful effects of radiation was attempted after world war ii with the realization of the need to safeguard humans against the military use of atomic weapons . patt and his co - workers ( 1949 ) were the first to investigate the effect of amino - acid cysteine in rats exposed to lethal doses of x - rays . thereafter , several chemical compounds and their analogues have been screened for their radioprotective ability however , their high toxicity at optimum protective doses precluded their clinical use [ 4 , 5 ] . the other major drawback of these compounds was that they were unable to provide post - irradiation protection . with the recognition that normal tissue protection during radiotherapy is as important as the destruction of cancer cells , recent terror attacks throughout the world has strengthened the idea that it its necessary to devise appropriate measures against the nuclear terror attacks by using pharmacological agents that can protect against the ill effects of radiation . the high toxicity of thiol compounds necessitated search for alternative agents , which could be less toxic and highly effective at non - toxic dose levels . it was also thought that products / compounds isolated from natural sources could be of substantial use as non - toxic radioprotectors . therefore , investigators diverted their attention towards the plant and natural products during the last two decades . plants have been reported to play an important role in the discovery of new drugs for the treatment of human diseases , which indicated that natural products play a highly significant role in the drug discovery and development process . this was particularly evident in the areas of cancer and infectious diseases , where over 60% and 75% of these drugs , respectively , were shown to be of natural origin . a good chemical protector should be able to protect against the deleterious effect of ionizing radiation during therapeutic procedures as well as during nuclear accidents , space flight and background irradiation etc . an ideal radioprotector should be cheap , does not have toxic implications in a wide dose range , orally administered , rapidly absorbed , possesses a reasonably good dose reduction factor and can act through multiple mechanisms . they are usually non - toxic , relatively cheap , can be orally administered and could act through multiple mechanisms due to the presence of many chemicals . therefore , screening of plants and natural products is a useful paradigm for radioprotection . the advantage of plants and natural products is that they are used in several traditional systems of medicines . once this is done their use , as radioprotectors could be more successful than synthetic chemicals . the most pragmatic approach to select the possible candidate to evaluate radioprotective effect is to look into the available properties of the substance . whether a substance has anti - inflammatory , antioxidant , antimicrobial , immunomodulatory , free radical scavenging or anti - stress properties , if so , it may act as a potential radioprotector and could be the right candidate for evaluation of its radioprotective activity . short - term in vitro tests can provide a basis for detailed evaluation of radioprotective activity . assay of free radicals and antioxidant status of a pharmacological agent can also provide some leads regarding the radioprotective potential of such agents . if a plant or a natural product is found to inhibit lipid peroxidation and scavenge free radicals , it may act as a possible radioprotector . the next step is to evaluate its radioprotective potential in vitro using cell survival and micronuclei assays . if it is found to elevate cell survival and reduce radiation - induced micronuclei formation , it certainly has a potential as a radioprotector . there are other short - term tests like dna strand breaks , apoptosis and estimation of glutathione ( gsh ) and enzymes like catalase , glutathione peroxidase etc . that can also provide an inkling of the radioprotective activity of any pharmacological agent . however , the gold standard for radioprotective activity is the evaluation of 30-day survival in rodents , since the animal studies with death as the end point are the most confirmatory , because the 30-day survival after lethal whole body irradiation clearly indicates the capacity of the pharmacological agent in test to modulate the recovery and regeneration of the gastrointestinal epithelium and the hemopoietic progenitor cells in the bone marrow , the two most radiosensitive organs that are essential for sustenance of the life . the most reliable procedures involve determination of a dose reduction factor ( drf ) . in animal studies , drfs are typically determined by irradiating mice with or without administering radioprotective agent at a range of radiation doses and then comparing the endpoint of interest . for example , the drf for 30-day survival ( ld50/30 drug - treated divided by ld50/30 vehicle - treated ) quantifies protection of the hemopoietic system [ 8 , 9 ] . with sufficient loss of hemopoietic stem cells the gi syndrome in mice can be assessed by determining survival up to ten days ( measure of gi death ) after exposure to comparatively high doses of whole - body radiation , whereas hemopoeitic syndrome can be assessed by monitoring the survival of irradiated animals up to 30 days post - irradiation [ 711 ] . the intestinal crypt cell assay or functional changes also serve as indicators of gi damage . the most informative and useful preclinical studies relate protective effects to the drug s toxicity in the same animal model . the efficacy of radioprotectors in clinical practice requires different end points . among other endpoints amenable to the determination of beneficial effects of radioprotectors , the most readily evaluable is protection against mucositis and xerostomia resulting from head and neck radiotherapy and various side effects when the gi tract is in the radiation field . an intravenous infusion of an ethanol extract of gingko biloba leaves , at a dose of 100 mg / person was found to be effective in patients with vasogenic edema observed after irradiation of the brain . it has been reported to protect against the clastogenic factors from plasma of human subjects exposed to irradiation . treatment of recovery workers from the chernobyl accident site was found to be effective when an oral dose of 40 mg / day of g. biloba was given 3 times daily for 2 months . aqueous extract of centella asiatica reduced the adverse effect of low dose irradiation in sprague dawley rats by inhibiting radiation - induced body weight loss and conditioned taste aversion . similarly , it has been found to protect against the radiation - induced weight loss in mice exposed to 8 gy -radiation . oral administration of a hippophae rhamnoides fruit juice concentrate to rats before or after irradiation increased life span , restored the 11-oxycorticosteroid level in the blood and weight of isolated adrenals , and also normalized their basal activity and response to ( acth ) ( corticotropin ) under in vitro conditions . hydroalcoholic extract of berries of h. rhamnoides also protected mice against -radiation - induced mortality , decline in endogenous colony forming unit ( cfu ) , micronuclei formation and various other hematological parameters [ 2022 ] . the radioprotective property of osimum sanctum was first reported by jagetia et al . against the radiation - induced mortality , thereafter studies by uma devi and her coworkers established its radioprotective efficacy by evaluating mouse survival , spleen colony assay , and chromosome aberrations in mouse bone marrow cells . apart from these osmium has been reported to protect against radiation - induced lipid peroxidation and reduction in glutathione concentration [ 24 , 25 ] . the radioprotective efficacy of ginseng ( panax ginseng ) has been reported by several workers [ 2630 ] . the whole extract of ginseng and the relative protective effects of various fractions ( carbohydrate , protein and saponins ) have been evaluated . the results showed that the water - soluble whole extract of ginseng provided best protection against radiation induced damage in c3h mice , whereas isolated protein and carbohydrate fractions were less effective , the saponin fraction was ineffective . similar results were obtained by kim and coworkers , who found that whole ginseng extract and its fractions increased endogenous spleen colony formation in irradiated mice and also reduced apoptosis in jejunal crypt cells . the radioprotective effect of ginseng root extract on testicular enzymes ( acid and alkaline phosphatases and lipid peroxidation ) has also been reported . hexandrum has been reported to protect against radiation - induced mortality , gastrointestinal damage and embryonic nervous system of developing mice [ 20 , 3335 ] . it has also been reported to protect against radiation - induced decline in glutathione - s - transferase , superoxide dismutase in the liver and intestine of irradiated mice . oral administration of an aqueous extract of guduchi , tinospora cordifolia has been reported to increase the survival of mice exposed to radiation . treatment of mice with hydroalcoholic extract of tinospora cordifolia has been found to protect against the radiation - induced micronuclei formation and oxidative stress and decline in the mouse survival , spleen cfu and hematological parameters . the fruit pulp of amala , emblica officinalis ( eo ) has been reported to increase the survival and inhibit radiation - induced weight loss in mice . phyllanthus amarus has been reported to protect against the radiation - induced decline in white blood cells ( wbc ) , superoxide dismutase , catalase , glutathione - s - transferase , glutathione peroxidase , and glutathione reductase . daily oral administration of 800 mg / kg body weight ( b. wt . ) of rajgira ( amaranthus paniculatus ) leaf extract for 15 consecutive days before whole body exposure to -radiation protected mice against the radiation - induced lethality with a dose reduction factor of 1.36 . it increased endogenous spleen colony forming units and spleen weight without any side effects or toxicity . rajgara extract also arrested radiation - induced lipid peroxidation and the decline in reduced glutathione in the liver and blood of mice . the ethanolic extract of piper longum ( pippali ) fruits was found to protect mice against the radiation - induced decline in wbc , bone marrow cells -esterase positive cells and gsh . pippali extract also reduced the elevated levels of glutathione pyruvate transaminase ( gpt ) , alkaline phosphatase ( alp ) , lipid peroxidation ( lpo ) in liver and serum of irradiated animals . the dietary supplements , if found radioprotective may be of crucial importance , as they are in daily human use , nontoxic and have wide acceptability . skeels also known as eugenia cumini ( family myrtaceae ) , and has been reported to posses several medicinal properties in the folklore system of medicine . the micronucleus study of radioprotective effect of dichloromethane and methanol ( 1:1 ) extract of jamun ( sce ) in human peripheral blood lymphocytes ( hpbls ) ascertained its radioprotective potential , where 12.5 g / ml sce was found to reduce the micronuclei up to a maximum extent . in vivo evaluation further established its radioprotective activity where it was found to reduce radiation - induced sickness , gastrointestinal and bone marrow deaths [ 7 , 44 ] . not only leaf but the hydroalcoholic extract of jamun seeds ( jse ) also exhibited a greatest protective effect at 80 mg / kg jse . the jse was more effective when administered through the intraperitoneal route at equimolar doses than the oral . the jse treatment protected mice against the gastrointestinal as well as bone marrow deaths with a drf of 1.24 . , family lamiaceae ) , a plant , native of japan , is used as a food seasoner , household remedy , and for industrial purposes . extract of mint ( mentha arvensis linn ) protected against the radiation - induced sickness , gastrointestinal and bone marrow deaths with a drf of 1.2 . further it was non - toxic up to a dose of 1000 mg / kg b. wt . , the highest drug dose that could be tested for acute toxicity . pre - treatment of mice with leaf extract of another species of pudina , i.e. mentha piperita has been reported to protect mice against the radiation - induced decline in hematological constituents , serum phosphatase , endogenous spleen colonies formation , spleen weight , goblet cells / villus section and chromosomal damage [ 4850 ] . the rhizome of zingiber officinale , commonly known as ginger , is consumed daily worldwide as a spice and flavoring agent . the rhizome of ginger has been reported to possess diverse medicinal properties in the traditional indian system of medicine , the ayurveda , and it is widely used in several medicinal preparations . administration of 10 mg / kg ( i.p ) or 250 mg / kg ( orally ) hydroalcoholic extract once daily , consecutively for 5 days was found to protect mice against the radiation - sickness , gastrointestinal as well as bone marrow deaths with a drf of 1.15 . ginger has been reported to increase glutathione , reduce lipid peroxidation in vivo and scavenging of various free radicals in vitro [ 52 , 53 ] . ageratum conyzoides , ( family : asteraceae ) is commonly known as billy goat weed . it has been used in various parts of africa , asia and south america for curing various diseases . the study of various doses of alcoholic extract of ageratum conyzoides , linn . revealed that the best protective dose was 75 mg / kg and it reduced radiation - induced , sickness gastrointestinal as well as bone marrow deaths . the radioprotective effect was due to scavenging of dpph ( 1,1-diphenyl-2-picrylhydrazyl ) , free radical . aegle marmelos correa , commonly known as bael , is a spinous tree belonging to family rutaceae . it is grown throughout the sub - continents as well as bangladesh , burma and srilanka . the hydroalcoholic extract of aegle marmelos ( ame ) protected cultured hpbls against the radiation - induced micronuclei at a concentration of 5 g / ml . it was also reported to scavenge oh , o2 , dpph , abts and no ( nitric oxide ) radicals in vitro in a concentration dependent manner . the radioprotective efficacy of 15 or 250 mg / kg ame was further confirmed in animal studies where its intraperitoneal as well as oral administration has been found to protect mice against the radiation - induced sickness , gastrointestinal and bone marrow deaths and mortality giving a drf of 1.2 . it also protected mice against the radiation - induced lipid peroxidation and elevated gsh concentration in the liver , kidney , stomach and intestine at 31 days post - irradiation . oral administration also protected mice against the gamma radiation - induced decline in erythrocytes , leukocytes , lymphocytes and clonogenicity of hemopoietic progenitor cells assessed by exogenous spleen colony forming assay . pretreatment of mice with ame elevated the villus height and the crypt number accompanied by a decline in goblet and dead cell number [ 57 , 58 ] . not only leaf but also the hydroalcoholic extract of aegle marmelos fruit administered intraperitoneally at a dose of 20 mg / kg once daily , consecutively for five days found to protect mice against the radiation - induced sickness , gastrointestinal as well as bone marrow deaths with a drf of 1.1 . parker [ amoora rohituka , amoora aphanamixis ( roxb . ) wight & arn . ] is a member of the family meliaceae . the ethyl acetate fraction of aphanamixis polystachya at a dose of 7.5 mg / kg b. wt . before exposure to 15 gy of whole body gamma - radiation significantly reduced the frequencies of aberrant cells and chromosomal aberrations like acentric fragments , chromatid and chromosome breaks , centric rings , dicentrics , exchanges and total aberrations at all post - irradiation scoring times . it also showed a concentration dependent scavenging of hydroxyl , superoxide , 2,2'-diphenyl-1-picryl hydrazyl ( dpph ) radicals and the 2,2-azino - bis-3-ethyl benzothiazoline-6-sulphonic acid ( abts ) cation radicals in vitro . eap treatment also reduced lipid peroxidation in bone marrow cells in a concentration dependent manner . ionizing radiations induce reactive oxygen species in the form of oh , h , singlet oxygen and peroxyl radicals that follows a cascade of events leading to dna damage such as single- or double - strand breaks ( dsb ) , base damage , and dna - dna or dna - protein cross - links , and these lesions cluster as complex local multiply damaged sites . the dna - dsbs are considered the most lethal events following ionizing radiation and has been found to be the main target of cell killing by radiation . the putative mechanisms of radioprotection by plant and herbal radioprotectors are shown in fig . 1 . the radioprotective activity of plant and herbs may be mediated through several mechanisms , since they are complex mixtures of many chemicals . the majority of plants and herbs contain polyphenols , scavenging of radiation - induced free radicals and elevation of cellular antioxidants by plants and herbs in irradiated systems could be leading mechanisms for radioprotection . the polyphenols present in the plants and herbs may upregulate mrnas of antioxidant enzymes such as catalase , glutathione transferase , glutathione peroxidase , superoxide dismutase and thus may counteract the oxidative stress - induced by ionizing radiations . upregulation of dna repair genes may also protect against radiation - induced damage by bringing error free repair of dna damage . reduction in lipid peroxidation and elevation in non - protein sulphydryl groups may also contribute to some extent to their radioprotective activity . the plants and herb may also inhibit activation of protein kinase c ( pkc ) , mitogen activated protein kinase ( mapk ) , cytochrome p-450 , nitric oxide and several other genes that may be responsible for inducing damage after irradiation . apart from these humans also get exposed to ionizing radiations during air and space travel , background radiation nuclear accidents , and use of electronic devices . nuclear terror attacks are not distant possibility , therefore it is essential to protect humans from ionizing radiations by pharmacological intervention . recently , focus of radiation protection has shifted to test the radioprotective potential of plants and herbs in the hope that one day it will be possible to find a suitable pharmacological agent / s that could protect humans against the deleterious effects of ionizing radiation in clinical and other conditions as well as during nuclear terror attack . majority of plant and herbs described in this review have medicinal properties and are being used in traditional ayurvedic or chinese systems of medicine to treat various ailments in humans . they protect against the radiation - induced damage by scavenging of free radicals and increasing antioxidant status . fractionation guided evaluation may result in the development of ideal radioprotector / s in the near future .

ionizing radiations produce deleterious effects in the living organisms and the rapid technological advancement has increased human exposure to ionizing radiations enormously . there is a need to protect humans against such effects of ionizing radiation . attempts to protect against the deleterious effects of ionizing radiations by pharmacological intervention were made as early as 1949 and efforts are continued to search radioprotectors , which may be of great help for human application . this review mainly dwells on the radioprotective potential of plant and herbal extracts . the results obtained from in vitro and in vivo studies indicate that several botanicals such as gingko biloba , centella asiatica , hippophae rhamnoides , ocimum sanctum , panax ginseng , podophyllum hexandrum , amaranthus paniculatus , emblica officinalis , phyllanthus amarus , piper longum , tinospora cordifoila , mentha arvensis , mentha piperita , syzygium cumini , zingiber officinale , ageratum conyzoides , aegle marmelos and aphanamixis polystachya protect against radiation - induced lethality , lipid peroxidation and dna damage . the fractionation - guided evaluation may help to develop new radioprotectors of desired activities .

Introduction Need for chemical radioprotection Chemical radioprotection Assessment of radioprotective potential of plants and herbs Plants and herbs as radioprotectors Mechanism of action Conclusions

to develop methods for mapping a qtl to a phylogenetic tree , we begin with several simplifying assumptions : the taxa are represented by inbred lines , the tree relating the taxa is known without error , the quantitative trait of interest is affected by a single diallelic qtl , and there are no background effects ( i.e. , the effect of the qtl is the same in the different crosses in which it is segregating ) . we consider the case of intercrosses among pairs of taxa , consider only autosomal loci , and assume a common genetic map . the basic idea , illustrated in figure 1 , is that each possible location for the origin of a diallelic qtl on the tree corresponds to a different partition of the taxa into two groups , with the two groups corresponding to the two qtl alleles . for different partitions , the qtl will segregate in different sets of crosses . in the case of very large crosses , with each having high power to detect the qtl , if present , we could simply consider the crosses individually and use the pattern of presence / absence of qtl to identify the correct partition of the taxa . note that one does not need data on all possible crosses . for the case illustrated in figure 1 , with four taxa , it would be sufficient to consider the crosses a b , a c , and b d , as with just these three crosses , the five possible partitions have distinct patterns of presence / absence of the qtl . in the following , we focus on partitions of the taxa into two groups , in place of locations of the qtl on the tree . illustration of the basic concepts behind the mapping of a qtl to a phylogenetic tree . on the left the locations of possible origins of a diallelic qtl are indicated by the numbers 15 . in the table on the right , we indicate the presence or absence of a qtl in each of the six possible crosses among pairs of taxa , according to the location of the qtl on the tree . each possible qtl location on the tree corresponds to a partition of the taxa into two groups . given limited resources and crosses of limited size , there will be incomplete power to detect the qtl in a given cross , and so the naive approach based on the presence or absence of the qtl in the different crosses will likely be misleading . a more formal approach , in which the likelihoods for the different possible partitions are evaluated and compared , will provide a clear assessment of the evidence for the different locations for the qtl on the tree . consider a particular location in the genome as the site of a putative qtl , and consider a particular partition of the taxa into two qtl alleles . we assume a linear model with normally distributed errorsyij=i+aij+dij+ij , where yij is the phenotype for individual j in cross i , i the average phenotype in cross i , and are the additive and dominance effects of the qtl , respectively , and the ij are independent and identically distributed normal ( 0 , ) . the aij and dij denote encodings of the qtl genotypes , with aij = dij = 0 if the qtl is not segregating in cross i. for convenience , we call the two qtl alleles defined by the partition as the high allele ( h ) and the low allele ( l ) , although we wo nt actually constrain the high allele to increase the phenotype . if the qtl is segregating in cross i , then we take aij = 1 , 0 , or + 1 , if individual j has qtl genotype gij = ll , hl , or hh , respectively , and dij = 1 if individual j has qtl genotype hl and dij = 0 otherwise . for most putative qtl locations , the qtl genotypes are not be observed , but we may calculate ( e.g. , by a hidden markov model ) the conditional probabilities of the qtl genotypes given the available multipoint marker genotype data , pijk = pr(gij = k|mij ) . it is critical that we have a common map for the set of crosses , so that a putative qtl location is clearly defined in all crosses . it is not necessary , however , that the same markers be used in all crosses or that they be informative in all crosses . we may then use standard interval mapping ( lander and botstein 1989 ) or an approximation such as haley knott regression ( haley and knott 1992 ) to fit the model , estimate the parameters i , , , and , and calculate a lod score , lod( ) , where denotes the partition of the taxa and denotes the location of the putative qtl . the lod score is the log10 likelihood comparing the hypothesis of a single qtl at that location to the null hypothesis of no qtl but with the multiple crosses allowed to have separate phenotypic means , that is , yij normal ( i , ) . ( 2005 ) , in that one recodes the genotypes in the crosses in which the qtl is segregating , stacks them on top of one another , as if they were a single intercross , and performs interval mapping with cross indicators as additive covariates . the only difference is that we are considering all possible partitions of the taxa , while li et al . there is one technicality : the crosses in which the qtl does not segregate also need to be included in the likelihood , and they contribute to the estimate of the residual variance . we thus consider each possible partition , , one at a time , and scan the genome to obtain a set of lod curves , lod( ) . we summarize these at the chromosome level , calculating the maximum lod score for partition on chromosome i , mi = maxi lod( ) . the maximum on chromosome i , maxmi , indicates the evidence for a qtl on chromosome i. to evaluate the relative support of the different partitions , we use an approximate bayes procedure . assuming the presence of a single diallelic qtl on chromosome i , we assign equal prior probabilities to the different possible partitions , , treat the profile log likelihoods mi ( in which we have maximized over all nuisance parameters , including the location of the qtl on the chromosome ) as if they were true log likelihoods , and obtain posterior probabilities by taking 10mi and rescaling so that they sum to 1 . that is , we further use these approximate posterior probabilities to form a 95% bayesian credible set of partitions . one could assign unequal prior probabilities to the partitions , for example , based on the branch lengths in the assumed phylogenetic tree , giving more weight to longer branches . one might also use a prior on partitions that assigns greater weight to partitions induced by the tree and lesser ( but nonzero ) weight to the other ( possibly more numerous ) partitions . the 95% credible set of partitions is relevant only if there is sufficient evidence for a qtl on that chromosome . to evaluate the evidence for a qtl , we consider the maximum of the mi on chromosome i and derive a significance threshold , adjusting for the genome scan , by a stratified permutation test ( churchill and doerge 1994 ) . the permutation test is stratified in that we permute the phenotype data , relative to the genotype data , separately in each cross . for each permutation replicate , we calculate the lod curve for each possible partition and then take the maximum lod score across the genome and across partitions . the 95th percentile of these permutation results may be used as a significance threshold , or we may calculate a p - value that accounts for the search across partitions and across the genome . one may restrict the analyses to the set of partitions induced by the assumed phylogenetic tree , or one may consider all possible partitions of the taxa into two groups . for example , for the four - taxon tree in figure 1 , one may consider only the five partitions that correspond to qtl locations on the tree , as in the accompanying table , or one may also consider the two additional partitions , ac|bd and ad|bc . the consideration of all possible partitions will be accompanied by some loss of power , particularly if there is a large number of taxa . however , the correct phylogenetic tree will seldom be known with certainty and will likely vary along the genome , particularly if the taxa are closely related . moreover , if there is strong support for one of the partitions that is not associated with a qtl location on the assumed phylogenetic tree , one would certainly want to know this . thus , we are inclined to always consider all possible partitions and not focus on those induced by an assumed phylogenetic tree . in this section , we address a theoretical question of considerable interest : which subsets of crosses are sufficient to identify the location of a qtl on the phylogenetic tree ? with very large crosses , we can exactly determine which crosses are segregating a qtl and which are not . as discussed in the introduction for example , for the case in figure 1 , if one performs only the crosses a b , a c , and a d , the ideal results perfectly discriminate among the possible locations of the qtl on the tree . however , if one performs only the crosses a b , a c , and b c , several of the possible partitions of strains exhibit the same pattern of presence / absence of qtl and so are confounded . it is useful , in considering this problem , to represent a set of crosses by a graph , with nodes corresponding to taxa and edges indicating a cross between two taxa . three possible choices of a subset of five crosses among the six taxa are displayed in figure 2 , b d . a phylogenetic tree with six taxa ( a ) and three possible choices of five crosses among the six taxa , with nodes denoting taxa and edges denoting crosses ( b d ) . a sufficient condition for identifying the true partition of the strains is the use of a set of crosses that connect all of the taxa , as in figure 2b . choose an arbitrary taxon ( e.g. , a ) and assign it an arbitrary qtl allele . with sufficient numbers of individuals in each cross , we may determine whether the qtl is segregating in a cross , which indicates that the two taxa have different qtl alleles , or is not segregating , which indicates that the two strains have the same qtl allele . thus , one may move between taxa connected by a cross and assign qtl alleles , and so if the set of crosses connect all of the taxa , one can assign qtl alleles to all taxa and so identify the correct partition of taxa . if the set of crosses are not connected ( as in figure 2 , c and d ) , then some partitions of taxa will be confounded . for example , for the crosses in figure 2c , the partition abc|def will give the same set of qtl results as under the null hypothesis of no qtl . other pairs of partitions are confounded in this example , such as ab|cdef and abdef|c . if one is considering all possible partitions of the taxa ( and not just those induced by the tree ) , then graph connectivity is also a necessary condition for identifying the true partition : if the crosses do not connect all taxa there will always be some partitions that are confounded . however , if one focuses solely on those partitions induced by the tree ( that is , partitions that result from a split on an edge in the tree ) , then it is not necessary that the crosses connect all taxa . for the pairs of partitions that are confounded with this choice of crosses , no more than one of each pair corresponds to a split on the tree in figure 2a ; each possible partition induced by the tree gives a distinct set of qtl results for these crosses . moreover , in this case one may omit any one of the three crosses , b c , b e , c e : only four crosses are necessary to distinguish among the nine partitions induced by the tree in figure 2a . that the crosses connect all taxa is a necessary and sufficient criterion to distinguish among all possible partitions , but it is not a necessary condition to distinguish among the partitions induced by the tree . note that a cross between two taxa corresponds to a path along the tree from one leaf to another . further , the qtl will be segregating in crosses whose paths go through the edge with the qtl , but it will not be segregating in crosses whose paths do not go through that edge . a necessary and sufficient criterion for a set of crosses to distinguish the partitions induced by the tree ( i.e. , to distinguish the possible locations of the qtl on the tree ) is that each edge is covered by at least one cross and that no two edges appear only together . if an edge was not covered by a cross , then a qtl on that edge could not be distinguished from the null model , of no qtl . if two edges only appear together in crosses , then those two qtl locations can not be distinguished . note that a cross in which the qtl is segregating will limit the possible qtl locations to the edges on the corresponding path through the tree . as every pair of edges along such a path will appear separately in different crosses , we see that the specific edge containing the qtl may be identified . for n taxa ( with n3 ) , the minimal number of crosses to distinguish among all possible partitions is n1 . to distinguish among the partitions induced by the tree , the minimal number of crosses is 2n/3 ( the smallest integer that is greater than 2n/3 ; a proof appears in the appendix ) . for n5 , these are the same ; for n6 , fewer crosses are needed to distinguish among the tree partitions . as discussed in the previous section , we recommend that one not restrict oneself to the partitions induced by the tree but rather always consider all possible partitions , possibly with different prior weights . as a result , we recommend that one use , at a minimum , a set of crosses that connect all taxa . however , this is based on the assumption of a small number of taxa . if the number of taxa , n , is large , the total number of non - null partitions ( 2 1 ) will vastly exceed the number of partitions induced by the tree ( 2n 3 ) , and so there is great potential advantage in focusing on the tree partitions . of course , in practice crosses are of finite size and so one can not identify the true partition of the taxa without some degree of uncertainty . in the next section we explore , via computer simulation , the relative performance of the proposed method with different possible choices of crosses . we begin by comparing our proposed method to the naive approach of considering the crosses individually and comparing the pattern of presence / absence of a qtl in the crosses to what is expected for different possible partitions . we then compare the performance of our approach with all possible crosses to different choices of a minimal set of crosses . we consider the case of four taxa and use of all six possible intercrosses among pairs of taxa , with 75 individuals per cross ( a total sample size of 450 ) . we consider a single autosome of length 127 cm , with markers at an approximately 10-cm spacing , and with a single diallelic qtl placed in the center of an interval between two markers , near the middle of the chromosome . the qtl alleles were assumed to act additively ( that is , no dominance ) , and the percentage phenotypic variance explained by the qtl , in the crosses in which it was segregating , was 10% . we assumed either the partition a|bcd or ab|cd ; other possible partitions are equivalent to one of these . to reduce computation time , we used haley knott regression ( haley and knott 1992 ) for all simulation studies , with lod score calculations performed on a 1-cm grid . for the naive approach , we applied a given significance threshold and inferred the presence or absence of a qtl in a cross if the maximum lod score on the chromosome was above or below the threshold , respectively . if the presence / absence pattern matched that for a possible partition , that partition was inferred . for the proposed approach , we applied a given significance threshold on maxm and then formed a 95% bayesian credible set of partitions , using equal prior probabilities on all seven possible partitions . if maxm was greater than the threshold but the 95% credible set did not contain the truth , the result was considered a false positive . the results , based on 10,000 simulations , are displayed in figure 3 as receiver operating characteristic ( roc ) curves : the power ( the rate of true positives ) vs. the false positive rate , for varying significance thresholds . we display two sets of curves for the proposed method : for the dashed curves , the power indicates that maxm exceeded the threshold and the true partition was contained within the 95% credible set ; the dotted curves are more stringent and require that the credible set contained only the true partition . points are plotted at the results with a nominal 5% significance threshold , adjusting for an autosomal genome scan , with the genome modeled after the mouse and the thresholds estimated by 10,000 simulations under the null hypothesis of no qtl . ( the estimated thresholds are displayed in supporting information , table s1 and table s2 . ) estimated receiver operating characteristic ( roc ) curves for the naive method ( solid curves ) , the proposed method , with power indicating that the true partition is contained within the 95% credible set ( dashed curves ) , and the proposed method , with power indicating that the 95% credible set contains only the true partition ( dotted curves ) , in the case of four taxa , with each of the six possible intercrosses having a sample size of 75 , and a qtl responsible for 10% of the phenotypic variance in the crosses in which it is segregating . the red and blue curves correspond to the case that the true partition is a|bcd and ab|cd , respectively . the roc curves for the naive method form interesting shapes , with the lower part of each corresponding to low thresholds and the upper part corresponding to high thresholds , and indicate terrible performance : the false positive rate is well controlled , but power is low . the problem is that , with only moderate power to detect the qtl in a given cross , one has low power to detect the qtl in all of the crosses in which it is segregating , which is necessary to identify the correct partition of the taxa . lowering the significance threshold below the 5% level helps somewhat , but the power to detect the true partition is no higher than 21% . the naive approach might actually perform better if one considered a smaller set of crosses , but we have not explored this further . the proposed method performs reasonably well , and the false positive rate is well controlled at the nominal 5% significance threshold ( the points in figure 3 ) . lowering the threshold could give some improvement in power while maintaining the false - positive rate below the target level , at least in the simulated situations . in the previous section , we noted that it is not necessary to use all possible crosses among taxa . to distinguish among all possible partitions , one need sets of crosses that connect all taxa and are of minimal size ( i.e. , n1 crosses for n taxa ) are called minimal sets . we now turn to the question of whether it is better to use all crosses , with a smaller number of individuals per cross , or a minimal set of crosses , with a larger number of individuals per cross . we use the same general settings as for the simulations comparing the proposed method to the naive approach , with four taxa and the true partition being either a|bcd or ab|cd , but here we vary the total sample size among 300 , 450 , and 600 individuals , and we vary the percentage phenotype variance explained by the qtl from 2.5 to 15% . we consider either all six crosses or a minimal set of three crosses , and we consider all 16 choices of three crosses that include all four taxa . we also compared the consideration of all seven possible partitions , or just the five partitions induced by the tree in figure 1 . we estimated 5% genome - wide significance thresholds by simulations under the null hypothesis of no qtl ( see table s2 ) . figure 4 displays the simulation results , as a function of the effect of the qtl , for the case that the total sample size was 450 ( i.e. , 75 individuals per cross when considering all crosses and 150 individuals per cross when considering a minimal set of three crosses ) and when all possible partitions were considered . the results with other sample sizes and with analysis restricted to the five partitions induced by the tree in figure 1 are shown in figure s1 , figure s2 , figure s3 , figure s4 , figure s5 , and figure s6 . the top of each figure indicates the power ( the chance that maxm exceeded its threshold and the true partition was contained in the 95% credible set ) ; the middle indicates the exact power ( the chance that maxm exceeded its threshold and that the credible set contained only the true partition ) ; the bottom indicates the false positive rate . the left and right correspond to the true partition being a|bcd or ab|cd , respectively . the black dashed curves correspond to the use of all six possible crosses ; the solid curves correspond to the different choices of a minimal set of three crosses , with blue , red , and green corresponding to cases in which 3 , 2 , or 1 of the crosses are segregating a qtl . estimated power ( top ) , exact power ( middle ) , and false - positive rates ( bottom ) in the case of four taxa with a total sample size of 450 , as a function of the percentage phenotypic variance explained by the qtl . the other curves are for the various choices of a minimal set of three crosses , with the curves in blue , red , and green corresponding to cases in which three , two , and one of the crosses are segregating the qtl , respectively . the results are based on 10,000 simulation replicates , with analyses considering all possible partitions of the taxa . in choosing among the possible minimal sets of crosses , power is highest when a larger number of crosses are segregating the qtl . for a fixed total sample size , the use of all possible crosses ( with fewer individuals per cross ) has better performance than the worst of the possible minimal sets of crosses , but is not as good as the best of the possible minimal sets of crosses . the use of all possible crosses has greater power when the true partition is ab|cd ( in which case four of the six crosses are segregating the qtl ) than when the true partition is a|bcd ( in which case three of the six crosses are segregating the qtl ) . the false - positive rate ( figure 4 , bottom ) is well controlled throughout . the use of a total sample size of 300 or 600 gives qualitatively similar results ( see figure s1 , figure s2 , figure s3 , figure s4 , figure s5 , and figure s6 ; figure s7 and figure s8 contain the false negative rates ) , although we note that while a larger sample size results in a great improvement in power , it gives only a slight improvement in the chance that the credible set includes only the true partition . restricting the analysis to the five partitions induced by the tree has little effect on power ( compare figure s1 and figure s2 ) , but improves the chance that the credible set includes only the true partition ( compare figure s3 and figure s4 ) , and results in a somewhat lower false - positive rate ( compare figure s5 and figure s6 ) . the performance of the proposed method with different possible choices of minimal crosses is largely predicted by the number of crosses that are segregating a qtl : the solid curves of a given color ( which indicates the number of crosses segregating a qtl ) are largely coincident , but there are some differences ( red curves in figure 4 , middle right ) . to explore this further , the results for the individual choices of crosses , when the percentage phenotypic variance explained by the qtl is 10% and the total sample size is 450 , are displayed in figure 5 . ( for other sample sizes and for the analyses restricted to the partitions induced by the tree in figure 1 , see figure s9 , figure s10 , figure s11 , figure s12 , figure s13 , figure s14 , figure s15 , and figure s16 . ) detailed results on the estimated power ( top ) , exact power ( middle ) , and false positive rates ( bottom ) , for individual choices of crosses , in the case of four taxa with a total sample size of 450 , and with the qtl being responsible for 10% of the phenotypic variance in crosses in which it is segregating . blue , red , and green correspond to cases in which three , two , and one of the crosses are segregating the qtl , respectively . the results are based on 10,000 simulation replicates , with analyses considering all possible partitions of the taxa . the black vertical line segments indicate 95% confidence intervals . in the case that the true partition is ab|cd , there are some differences among the choices of three crosses when two of the three are segregating the qtl , in terms of the chance that the 95% credible set contains only the true partition ( figure 5 , middle ) . for example , the use of the crosses a b , a c , and b d gives exact power of 50% , while the use of a b , a c , and a d gives , we need to consider the sign of the qtl effect in different crosses for the true partition and the best alternative partition ; these are shown in table 1 . if the true partition is ab|cd , with c and d having an allele that results in an increase in the phenotype , the a b cross does not segregate a qtl , while each of a c , b d , and a d have a segregating qtl with the latter taxon in each cross increasing the phenotype . with the crosses a b , a c , and a d , the best alternative partition after ab|cd would be a|bcd , in which a c and a d are also segregating the qtl , but a b should also be segregating the qtl , and note that for both partitions ab|cd and a|bcd , the qtl has effect in the same direction in the a c and a d crosses . on the other hand , with the crosses a b , a c , and b d ( which was seen to have better performance ) , in the only alternative partition with two crosses segregating a qtl , ad|bc , the two crosses should have qtl effects in opposite directions ( the a and d alleles both result in a decrease in phenotype ) , and so this should be easy to distinguish from the ab|cd partition . for this choice of three crosses , all other partitions have a qtl segregating in just one of a c or b d but not both . as a result , the chance that the credible set contains only the true partition is slightly higher . for each partition , the taxa to the right of the vertical bar have the high allele . for each cross , the sign of the effect is for the right vs. the left taxon . while no such differences among the choices of minimal crosses are seen when the true partition is a|bcd and all possible partitions are considered in the analysis , these sorts of differences do arise when the analysis is restricted to the five partitions induced by the tree in figure 1 . we consider the case of four taxa and use of all six possible intercrosses among pairs of taxa , with 75 individuals per cross ( a total sample size of 450 ) . we consider a single autosome of length 127 cm , with markers at an approximately 10-cm spacing , and with a single diallelic qtl placed in the center of an interval between two markers , near the middle of the chromosome . the qtl alleles were assumed to act additively ( that is , no dominance ) , and the percentage phenotypic variance explained by the qtl , in the crosses in which it was segregating , was 10% . we assumed either the partition a|bcd or ab|cd ; other possible partitions are equivalent to one of these . to reduce computation time , we used haley knott regression ( haley and knott 1992 ) for all simulation studies , with lod score calculations performed on a 1-cm grid . recombination was simulated assuming no crossover interference . for the naive approach , we applied a given significance threshold and inferred the presence or absence of a qtl in a cross if the maximum lod score on the chromosome was above or below the threshold , respectively . if the presence / absence pattern matched that for a possible partition , that partition was inferred . for the proposed approach , we applied a given significance threshold on maxm and then formed a 95% bayesian credible set of partitions , using equal prior probabilities on all seven possible partitions . if maxm was greater than the threshold but the 95% credible set did not contain the truth , the result was considered a false positive . the results , based on 10,000 simulations , are displayed in figure 3 as receiver operating characteristic ( roc ) curves : the power ( the rate of true positives ) vs. the false positive rate , for varying significance thresholds . we display two sets of curves for the proposed method : for the dashed curves , the power indicates that maxm exceeded the threshold and the true partition was contained within the 95% credible set ; the dotted curves are more stringent and require that the credible set contained only the true partition . points are plotted at the results with a nominal 5% significance threshold , adjusting for an autosomal genome scan , with the genome modeled after the mouse and the thresholds estimated by 10,000 simulations under the null hypothesis of no qtl . ( the estimated thresholds are displayed in supporting information , table s1 and table s2 . ) estimated receiver operating characteristic ( roc ) curves for the naive method ( solid curves ) , the proposed method , with power indicating that the true partition is contained within the 95% credible set ( dashed curves ) , and the proposed method , with power indicating that the 95% credible set contains only the true partition ( dotted curves ) , in the case of four taxa , with each of the six possible intercrosses having a sample size of 75 , and a qtl responsible for 10% of the phenotypic variance in the crosses in which it is segregating . the red and blue curves correspond to the case that the true partition is a|bcd and ab|cd , respectively . the roc curves for the naive method form interesting shapes , with the lower part of each corresponding to low thresholds and the upper part corresponding to high thresholds , and indicate terrible performance : the false positive rate is well controlled , but power is low . the problem is that , with only moderate power to detect the qtl in a given cross , one has low power to detect the qtl in all of the crosses in which it is segregating , which is necessary to identify the correct partition of the taxa . lowering the significance threshold below the 5% level helps somewhat , but the power to detect the true partition is no higher than 21% . the naive approach might actually perform better if one considered a smaller set of crosses , but we have not explored this further . the proposed method performs reasonably well , and the false positive rate is well controlled at the nominal 5% significance threshold ( the points in figure 3 ) . lowering the threshold could give some improvement in power while maintaining the false - positive rate below the target level , at least in the simulated situations . in the previous section , we noted that it is not necessary to use all possible crosses among taxa . to distinguish among all possible partitions , one need sets of crosses that connect all taxa and are of minimal size ( i.e. , n1 crosses for n taxa ) are called minimal sets . we now turn to the question of whether it is better to use all crosses , with a smaller number of individuals per cross , or a minimal set of crosses , with a larger number of individuals per cross . we use the same general settings as for the simulations comparing the proposed method to the naive approach , with four taxa and the true partition being either a|bcd or ab|cd , but here we vary the total sample size among 300 , 450 , and 600 individuals , and we vary the percentage phenotype variance explained by the qtl from 2.5 to 15% . we consider either all six crosses or a minimal set of three crosses , and we consider all 16 choices of three crosses that include all four taxa . we also compared the consideration of all seven possible partitions , or just the five partitions induced by the tree in figure 1 . we estimated 5% genome - wide significance thresholds by simulations under the null hypothesis of no qtl ( see table s2 ) . figure 4 displays the simulation results , as a function of the effect of the qtl , for the case that the total sample size was 450 ( i.e. , 75 individuals per cross when considering all crosses and 150 individuals per cross when considering a minimal set of three crosses ) and when all possible partitions were considered . the results with other sample sizes and with analysis restricted to the five partitions induced by the tree in figure 1 are shown in figure s1 , figure s2 , figure s3 , figure s4 , figure s5 , and figure s6 . the top of each figure indicates the power ( the chance that maxm exceeded its threshold and the true partition was contained in the 95% credible set ) ; the middle indicates the exact power ( the chance that maxm exceeded its threshold and that the credible set contained only the true partition ) ; the bottom indicates the false positive rate . the left and right correspond to the true partition being a|bcd or ab|cd , respectively . the black dashed curves correspond to the use of all six possible crosses ; the solid curves correspond to the different choices of a minimal set of three crosses , with blue , red , and green corresponding to cases in which 3 , 2 , or 1 of the crosses are segregating a qtl . estimated power ( top ) , exact power ( middle ) , and false - positive rates ( bottom ) in the case of four taxa with a total sample size of 450 , as a function of the percentage phenotypic variance explained by the qtl . the other curves are for the various choices of a minimal set of three crosses , with the curves in blue , red , and green corresponding to cases in which three , two , and one of the crosses are segregating the qtl , respectively . the results are based on 10,000 simulation replicates , with analyses considering all possible partitions of the taxa . in choosing among the possible minimal sets of crosses , power is highest when a larger number of crosses are segregating the qtl . for a fixed total sample size , the use of all possible crosses ( with fewer individuals per cross ) has better performance than the worst of the possible minimal sets of crosses , but is not as good as the best of the possible minimal sets of crosses . the use of all possible crosses has greater power when the true partition is ab|cd ( in which case four of the six crosses are segregating the qtl ) than when the true partition is a|bcd ( in which case three of the six crosses are segregating the qtl ) . the false - positive rate ( figure 4 , bottom ) is well controlled throughout . the use of a total sample size of 300 or 600 gives qualitatively similar results ( see figure s1 , figure s2 , figure s3 , figure s4 , figure s5 , and figure s6 ; figure s7 and figure s8 contain the false negative rates ) , although we note that while a larger sample size results in a great improvement in power , it gives only a slight improvement in the chance that the credible set includes only the true partition . restricting the analysis to the five partitions induced by the tree has little effect on power ( compare figure s1 and figure s2 ) , but improves the chance that the credible set includes only the true partition ( compare figure s3 and figure s4 ) , and results in a somewhat lower false - positive rate ( compare figure s5 and figure s6 ) . the performance of the proposed method with different possible choices of minimal crosses is largely predicted by the number of crosses that are segregating a qtl : the solid curves of a given color ( which indicates the number of crosses segregating a qtl ) are largely coincident , but there are some differences ( red curves in figure 4 , middle right ) . to explore this further , the results for the individual choices of crosses , when the percentage phenotypic variance explained by the qtl is 10% and the total sample size is 450 , are displayed in figure 5 . ( for other sample sizes and for the analyses restricted to the partitions induced by the tree in figure 1 , see figure s9 , figure s10 , figure s11 , figure s12 , figure s13 , figure s14 , figure s15 , and figure s16 . ) detailed results on the estimated power ( top ) , exact power ( middle ) , and false positive rates ( bottom ) , for individual choices of crosses , in the case of four taxa with a total sample size of 450 , and with the qtl being responsible for 10% of the phenotypic variance in crosses in which it is segregating . blue , red , and green correspond to cases in which three , two , and one of the crosses are segregating the qtl , respectively . the results are based on 10,000 simulation replicates , with analyses considering all possible partitions of the taxa . the black vertical line segments indicate 95% confidence intervals . in the case that the true partition is ab|cd , there are some differences among the choices of three crosses when two of the three are segregating the qtl , in terms of the chance that the 95% credible set contains only the true partition ( figure 5 , middle ) . for example , the use of the crosses a b , a c , and b d gives exact power of 50% , while the use of a b , a c , and a d gives , we need to consider the sign of the qtl effect in different crosses for the true partition and the best alternative partition ; these are shown in table 1 . if the true partition is ab|cd , with c and d having an allele that results in an increase in the phenotype , the a b cross does not segregate a qtl , while each of a c , b d , and a d have a segregating qtl with the latter taxon in each cross increasing the phenotype . with the crosses a b , a c , and a d , the best alternative partition after ab|cd would be a|bcd , in which a c and a d are also segregating the qtl , but a b should also be segregating the qtl , and note that for both partitions ab|cd and a|bcd , the qtl has effect in the same direction in the a c and a d crosses . on the other hand , with the crosses a b , a c , and b d ( which was seen to have better performance ) , in the only alternative partition with two crosses segregating a qtl , ad|bc , the two crosses should have qtl effects in opposite directions ( the a and d alleles both result in a decrease in phenotype ) , and so this should be easy to distinguish from the ab|cd partition . for this choice of three crosses , all other partitions have a qtl segregating in just one of a c or b d but not both . as a result , the chance that the credible set contains only the true partition is slightly higher . for each partition , the taxa to the right of the vertical bar have the high allele . for each cross , the sign of the effect is for the right vs. the left taxon . while no such differences among the choices of minimal crosses are seen when the true partition is a|bcd and all possible partitions are considered in the analysis , these sorts of differences do arise when the analysis is restricted to the five partitions induced by the tree in figure 1 . these data concern four intercrosses among five inbred mouse strains , cast / ei ( c ) , dba/2 ( d ) , i / lnj ( i ) , pera / ei ( p ) , and 129s1/svimj ( s ) . the four intercrosses performed were c d , c s , d p , and i p. the c d and c s crosses were all males and had 277 and 275 mice , respectively . the d p and i p crosses had approximately equal numbers of males and females and had a total of 282 and 322 mice , respectively . as in li et al . ( 2005 ) , we focus on a single phenotype , the square root of plasma hdl cholesterol . note that the four intercrosses form a daisy chain , s c d p i , and so satisfy the connectedness condition necessary for inference of the correct partition of the strains at a diallelic qtl . ( 2009 ) , with marker locations obtained using the mouse map converter at the jackson laboratory ( http://cgd.jax.org/mousemapconverter ) . we used standard interval mapping ( lander and botstein 1989 ) and considered all 15 possible partitions of the five strains , without attempting to infer a phylogenetic tree relating the strains . to handle the two sexes , we included sex as an additive covariate ( that is , we allowed for a shift in the average phenotype between the sexes and assumed no qtl sex interaction ) . we used permutation tests with 10,000 replicates to obtain 5% significance thresholds for the individual crosses and for maxmi . the estimated significance thresholds for the individual crosses were approximately 3.44 for all four crosses ; the estimated threshold on maxmi was 5.39 . ( 2005 ) , we focused on chromosomes 1 , 2 , 4 , 5 , 6 , and 11 . the lod curves for the top five partitions on each chromosome are in figure 6 , middle . the posterior probabilities of the different partitions , assuming the presence of a single diallelic qtl , are on the right . in all cases , ( 2005 ) : lod curves for individual crosses ( left ) , lod curves for the top five partitions ( middle ) , and approximate posterior probabilities for each partition ( right ) . the partitions corresponding to the five lod curves in the middle are indicated on the right . the labeled points on the right indicate the partitions included in the 95% bayesian credible sets . on the left and in the middle , dashed horizontal lines are plotted at the 5% significance thresholds . for chromosome 1 , significant evidence for a qtl is seen in the crosses c s and d p but not in c d or i p. by the naive approach , we would infer the partition cd|ips , and this is the partition that li et al . our proposed method does give this partition the highest posterior probability ( 57% ) , but also gives reasonable weight to the alternative ps|cdi ( posterior probability 39% ) , in which case the qtl would also be segregating in the i p cross . for chromosome 2 , we see a qtl just in cross c d. by the naive approach ( given the set of crosses performed ) , we would infer the partition cs|dip , which is the partition that li et al . however , by the proposed method , cs|dip has a posterior probability of only 20% , while the partition c|sdip ( in which the qtl would also be present in the c s cross ) has a posterior probability of 80% . for chromosome 4 , we have evidence for a qtl in all four crosses ( although in the cross i p , the maximum lod score was 3.42 , just missing the threshold of 3.44 ) . if we assume that there is no qtl segregating in i p , we would infer the partition ds|cip , while if we take the evidence for a qtl in i p as sufficient , we would infer the partition cp|dis , and this is the partition that li et al . the latter is the partition with the highest posterior probability ( 78% ) , while the former has posterior probability 7% , and a third partition , c|dips , in which case the qtl is segregating in neither i p nor d p , has posterior probability 16% . for chromosome 5 , we see a qtl only in cross i p , and so by the naive approach we would infer the partition i|cdps ; this partition does have the highest posterior probability ( 83% ) and was the partition that li et al . but the maximum lod score for this partition was 3.98 , which does nt meet the 5% significance threshold . ( the genome - scan - adjusted p - value was 0.37 . ) thus , by our proposed approach , we would not infer the presence of a qtl . but if we do allow that there is a qtl , two other partitions are contained within the 95% credible set : dp|cis , with posterior probability 9% , in which case the qtl is also segregating in the cross c d , and is|cdp , with posterior probability 6% , in which case the qtl is also segregating in the cross c s. for chromosome 6 , we have significant evidence for a qtl only in cross c d ( the other three crosses have maximum lod scores of 1.51.9 on chromosome 6 ) , and so the naive method would give the partition cs|dip , which has posterior probability < 0.01% and is not contained in the 95% credible set . the partitions with highest posterior are c|dips ( 47% ) , with the qtl also segregating in c s , and ci|dps ( 45% ) , with the qtl also segregating in c s and i p. the 95% credible set also contains a third partition , ds|cip , with posterior probability 7% . ( 2005 ) had assumed the partition c|dips , which is the partition with highest posterior probability . for chromosome 11 , there was significant evidence for a qtl only in the cross i p , although the cross d p has a maximum lod score of 3.16 ( corresponding to a genome - scan - adjusted p - value of 0.093 ) . the naive approach would give the partition i|cdps , which has posterior probability 0.9% and is not contained in the 95% credible set . if we consider the evidence for a qtl in d p to be sufficient , we would infer the partition p|cdis , which has posterior 16% and was the one that li et al . the partition with highest posterior probability is di|cps ( posterior probability 60% ) , in which case the qtl is also segregating in c d. the 95% credible set also contains the partition ps|cdi ( posterior probability 21% ) , in which case the qtl is segregating in c s but not c d. as with chromosome 5 , the maximum lod score across partitions ( 4.70 ) does not meet our 5% significance threshold , and so by our proposed method we would not infer the presence of a qtl . we have described a formal approach for the joint analysis of multiple crosses to map the origin of qtl alleles to a position on a phylogenetic tree . our approach unites qtl mapping with phylogenetic comparative methods to provide a view of the genetic mechanism underlying phenotypic evolution . further , our approach partitions taxa according to their qtl allele , facilitating haplotype analyses for the fine mapping of qtl . in addition , as part of this work , we have begun to evaluate a variety of experimental design issues for such research , which provides some guidance to researchers seeking to take advantage of this approach . the goal of the work in li et al . the key difficulty in applying this idea is that one must define a unique partition of the strains into the two qtl alleles , a priori . in the presence of multiple qtl , the phenotypes of the strains can not be trusted for inferring the qtl alleles , and in the current application , the six qtl partition the five strains in diverse ways . ( 2005 ) used the pattern of qtl in the different crosses to infer the appropriate partition , which we have ( perhaps overly harshly ) characterized as the naive approach . we have proposed a formal method for comparing the different possible partitions . for two of the six loci , we find that the partition with strongest support is different from that assumed by li et al . ( 2005 ) , and for all six loci there are multiple partitions with reasonable support . as seen in figure 6 , middle , the different partitions can have quite different lod curves and so provide different information on the likely location of the qtl . thus , our formal approach to identifying the well - supported partitions can improve localization of a qtl . moreover , one could combine the information from the multiple partitions to better define the location of the qtl , taking account of the uncertainty in the partition . furthermore , while the application of these ideas to evolutionary studies remains our primary interest , the more straightforward application is in biomedical or agricultural research , as in li et al . ( 2005 ) , for the combined use of multiple crosses to more precisely map a qtl and , subsequently , with an inferred partition ( or partitions ) of strains in hand , to inform the analysis of the haplotypes of the strains ( see , for example , burgess - herbert et al . the results are also valuable for the design of future experiments , if additional crosses are to be performed . our approach has some similarities to the use of local phylogenetic trees to define possible partitions of multiple alleles ( pan et al . 2009 ; zhang et al . 2012 ) and to coalescent - based approaches ( zllner and pritchard 2005 ) for genome - wide association studies . the key distinction of our method is that we seek not just to establish association but also to identify the appropriate partition and so define the origin of the mutant qtl allele on the local phylogenetic tree . in our approach , the qtl location on the tree is not a nuisance parameter but rather is the target of inference . in our simulation studies , we compared the use , for a fixed total sample size , of all possible crosses to different choices of a minimal set of crosses . depending on the underlying true partition of taxa at a qtl , one can choose a minimal set of crosses with considerably higher power . however , given the prior uncertainty in the true partition , and the possibility of multiple qtl that each partition the taxa differently , it is prudent to consider all or at least a larger number of possible crosses . an even more important experimental design question , which we have not considered here , is how to choose which taxa , out of a large number of related taxa , to consider , in the effort to characterize the genetic architecture of a quantitative trait . the approach could be adapted for the analysis of a set of backcrosses , although these would likely need to be of a special form , with the f1 hybrids all crossed to a common parent . there are a number of additional ways in which our analytical framework could be extended . most quantitative traits are affected by multiple qtl , rather than single qtl as assumed here . the restriction that a qtl has a common effect in all crosses in which it segregates might be relaxed , particularly for traits that are heavily shaped by epistasis , such as hybrid sterility and hybrid inviability ( coyne and orr 2004 ) . prior distributions of qtl partitions could incorporate phylogenetic branch lengths ( taxa separated by shorter evolutionary distances are more likely to share qtl alleles ) as well as topologies . finally , future developments might account for variation in the tree . this variation includes both statistical uncertainty associated with phylogenetic inference and real phylogenetic discordance across the genome , which results from incomplete lineage sorting and introgression in recently diverged taxa ( pamilo and nei 1988 ; maddison 1997 ; pollard et al . 2006 ; white et al . 2009 ) . the power of reconstructing qtl evolution as well as the increasing capacity for genetic mapping of complex traits and phylogenetic reconstruction should provide motivation for these extensions in the evolutionary , biomedical , and agricultural communities . software incorporating the proposed methods are available as part of r / qtl ( broman et al . 2003 , http://www.rqtl.org ) , an add - on package to the general statistical software r ( r development core team 2010 ) .

despite advances in genetic mapping of quantitative traits and in phylogenetic comparative approaches , these two perspectives are rarely combined . the joint consideration of multiple crosses among related taxa ( whether species or strains ) not only allows more precise mapping of the genetic loci ( called quantitative trait loci , qtl ) that contribute to important quantitative traits , but also offers the opportunity to identify the origin of a qtl allele on the phylogenetic tree that relates the taxa . we describe a formal method for combining multiple crosses to infer the location of a qtl on a tree . we further discuss experimental design issues for such endeavors , such as how many crosses are required and which sets of crosses are best . finally , we explore the method s performance in computer simulations , and we illustrate its use through application to a set of four mouse intercrosses among five inbred strains , with data on hdl cholesterol .

Methods Theory Simulations Comparison to naive approach All crosses Application Discussion Supplementary Material

adenocarcinoma is the most common type of malignant gastric neoplasm ( 95% ) but gastrointestinal stromal tumors ( gists ) have relatively appeared rare ( 1% ) [ 1 - 4 ] . gists and adenocarcinoma are distinct malignancies originating from different cell layers and the simultaneous development of a gist and gastric adenocarcinoma is relatively rare [ 5 - 10 ] . here we present a very rare combination of synchronous prepyloric gastric adenocarcinoma and a gist of fundic body region . sixty four - year - old female has admitted to our hospital complaining of dyspeptic symptoms , during the last 2 months . chest x - ray and abdominal ct - scan have not shown any signs of metastasis . subsequently the patient has undergone an elective subtotal gastrectomy and billroth - ii gastrojejunal anastomosis during the operation .there was a second nodule has palpated in the fundic body region at the greater curvature which has separately resected . pathology examination has shown a polypoid and infiltrative circumferential mass that has measured 642 cm in antropyloric region on macroscopic examination . in gross examination of specimen the histopathologic examination has revealed a signet ring type poorly differentiated adenocarcinoma of stomach , that has been infiltrating the wall and reaching the subserosa . the separate nodule of fundic body region of stomach was a well circumscribed tan elastic tumoral mass measuring 1 cm in diameter . in microscopic examination it was a spindle cells neoplasm located in muscularis propria extending up to serosa composed of intersecting fascicles of spindle cells with abundant eosinophilic fibrillar cytoplasm and minor degree of nuclear pleomorphism ( figure 2 ) . in immunohistochemical study focal positivity for desmin ( figure 3 ) and diffuse strong positivity for cd117 ( figure 4 ) have detected which has confirmed the diagnosis of gastrointestinal stromal tumor . the patient has received imatinibas adjuvant therapy for the gist , according to the international guidelines for gists risk stratification . four month later on her follow up visit she has shown clinically and radiographically disease free . the collision of adenocarcinoma and gist in the stomach is extremely rare and to the best of our knowledge only few cases have been reported in the english literature [ 5 - 10 ] . in the cases the synchronous tumors have located in different parts of the stomach , in our case there was prepyloric gastric signet cell adenocarcinoma and a proximal gastric gist . gists are typically sessile big soft tumors and could develop necrosis or ulceration of overlying mucosa . however when the gist is sub mucosal or subserosal the gastric mucosa might not be invaded and endoscopic assessment could be normal . in our case preoperative diagnosis was adenocarcinoma and during laparotomy we have incidentally found a small nodule in proximal part of stomach and the histopathological and immunohistochemical examination of the specimen have revealed the diagnosis of gist . this designates a heterogeneous group of mesenchymal malignancies that consist of spindle or epithelioid cells with varying degrees of differentiation . these tumors had an annual incidence of approximately 10 - 15 cases per 1 million people ; however gists are the most common mesenchymal tumors of the gastrointestinal tract accounting for 0.1 to 3% of all gi tumors [ 12 , 13 ] . these tumors are thought to originate either from the stem cells that differentiate towards interstitial cells of cajal or directly from interstitial cells of cajal [ 14 , 15 ] . in general gists could distinguish from other spindle or epithelioid cell tumors by expressing cd117and cd 34 in 50 - 80% of cases [ 14 , 15 ] . ninety percent of gists have a mutation in the kit oncogene but 10% miss this mutation . approximately 70 - 85 % of patients have a complete resection but overall five - year survival is only 50% . since 2002 a novel therapy , imatinib mesylate , has introduced to treat this kind of malignancies . this is a tyrosine kinase inhibitor and has demonstrated with great dramatic effects in majority of patients [ 16 , 17 ] . they have considered whether such an association was incidental coexistence , or the two lesions have connected by a connecting relationship . some articles suggest that gene mutations or a single carcinogenic agent might interact with two neighboring tissues inducing tumors development of different histotypes in the same organ . but no evidence of this last hypothesis has yet been found [ 10 , 21,22 ] . both tumors have different precursor cells and molecular make up and if there were a single carcinogen , these types of tumor would probably diagnose . more often simple coincidence have also known as the case especially in geographical regions with high incidence rate of gastric cancer such as japan . although helicobacter pylori infection has been implicated in gastric cancer development , there is no evidence of such association in gist . n - methyl - n nitro - nnitrosogunidine has inducedgastric adenocarcinoma development of following oral administration in rats and when it has combined with agents such as aspirin or stress , leiomyosarcomashas developed in combination with epithelial tumors . other articles have reported induction of gastric adenocarcinoma after injection of 9 , 10-dimethyl-1 , 2-benzanthrancene ( dmba ) where management with dmba and cellophane plate could cause mainly the induction of gastric sarcomas . in collision tumors the adenocarcinoma has been determined to have a greater unfavorable effect on prognosis than the gist , even if the gist has belonged to the high - risk group .

simultaneous a collision tumor of stomach consisting of adenocarcinoma and gastrointestinal stromal tumor ( gist ) is very rare based on our knowledge . this coexistence has rarely been reported in literatures.we report a case of 64-year - old woman who has diagnosed with prepyloric poorly - differentiated diffuse signet - ring cell type adenocarcinoma and has undergone an elective d2 total gastrectomy . during operation another mass in fundic body region has found.the pathologic examination of the mass has shown gist . immunohistochemical staining for cd117 and desmin was positive whilst that for s100 was negative.this case reports the simultaneous two tumors development of different histotypes and natures in the same organ .

Introduction Case Presentation Discussion

stressful situations affect all endocrine axes and differ in the response during acute and chronic phases of stress . the physiological rationale behind these alterations is to change the internal milieu of the organism helping to fight the external threat to the homeostasis . previous attempts to correct these hormonal imbalances did not yield beneficial results in clinical trials . low circulating thyroid hormones with hypogonadism and hypercortisolism are the predominant changes in acute stress . few studies have reported that the low thyroid hormones are independent predictors of mortality in patients admitted to intensive care units ( icu ) , suggesting the inclusion of the thyroid profile in these scoring systems . there appears a continuum of changes in critically ill patients , starting with low triiodothyronine ( t3 ) followed by low thyroxine ( t4 ) and lastly low thyroid stimulating hormone ( tsh ) . the pendulum of intensive glycemic control in icu is swinging with different trials giving conflicting opinions . the varying cutoff of glycemic control coupled with rapidity of change in glycosylated hemoglobin ( hba1c ) lead to increase in mortality in recent studies . prolactin is a hormone with a variety of roles , and the secretion is increased in a variety of conditions including stressful situations . there are no data available to assess the level of prolactin as a marker of the severity of the stress or indirectly leading to increase in mortality . surprisingly , no data exist from india regarding the endocrinological parameters in critically ill patients and hence we conducted this prospective observational study to assess the thyroid hormone profile , prolactin levels , and hba1c in relation to survival in patients admitted to medical icu . a total of 100 consecutive patients admitted to medical icu irrespective of the underlying diagnosis and diabetes state were included in this prospective , observational study . admission into icu was based on the presentation of the patient and underlying clinical conditions unrelated to the study objectives . patients with a known history of thyroid disease , intake of drugs altering thyroid function , were excluded from the study . all the patients had a detailed clinical examination and were managed appropriate to their primary condition . the patients were divided into two groups for comparison : group 1 survivors ( discharged from the hospital ) and group 2 nonsurvivors ( patients succumbed to their illness inside the hospital ) . an informed consent , to participate in the study , was obtained from the patients or relatives where appropriate , and the study protocol was approved by the local hospital ethics committee . fasting venous blood samples were collected immediately on admission to icu from all patients and were subjected for hormone analyses . samples were tested for total t3 , total t4 , tsh , prolactin , and glycosylated hemoglobin in addition to the standard icu protocol tests . the normal reference range for thyroid hormones in our laboratory miu / l ) , t3 ( 67156 ng/ dl ) , t4 ( 4.511.6 g / dl ) , prolactin ( 015 ng / ml males , 025 females ) . any deviation of the hormone results from the normal ranges is considered to be abnormal ( low or elevated ) . thyroid and prolactin hormones were estimated by solid phase competitive chemiluminescence and hba1c using the high performance liquid chromatography method . we did not repeat the hormonal assays a second time in the icu or prior to discharge in survivors . free thyroid hormones were not measured in the study group to prevent the variability associated with these hormones . summary data are presented as mean values sd and comparison between groups was done by mann fisher 's exact test and chi - square test were used to compare frequency of variables among two groups . p values were reported for all statistical tests and a value of < 0.05 was considered to be significant . a total of 100 consecutive patients admitted to medical icu irrespective of the underlying diagnosis and diabetes state were included in this prospective , observational study . admission into icu was based on the presentation of the patient and underlying clinical conditions unrelated to the study objectives . patients with a known history of thyroid disease , intake of drugs altering thyroid function , were excluded from the study . all the patients had a detailed clinical examination and were managed appropriate to their primary condition . the patients were divided into two groups for comparison : group 1 survivors ( discharged from the hospital ) and group 2 nonsurvivors ( patients succumbed to their illness inside the hospital ) . an informed consent , to participate in the study , was obtained from the patients or relatives where appropriate , and the study protocol was approved by the local hospital ethics committee . fasting venous blood samples were collected immediately on admission to icu from all patients and were subjected for hormone analyses . samples were tested for total t3 , total t4 , tsh , prolactin , and glycosylated hemoglobin in addition to the standard icu protocol tests . the normal reference range for thyroid hormones in our laboratory is given below : tsh ( 0.34.6 miu / l ) , t3 ( 67156 ng/ dl ) , t4 ( 4.511.6 g / dl ) , prolactin ( 015 ng / ml males , 025 females ) . any deviation of the hormone results from the normal ranges is considered to be abnormal ( low or elevated ) . thyroid and prolactin hormones were estimated by solid phase competitive chemiluminescence and hba1c using the high performance liquid chromatography method . we did not repeat the hormonal assays a second time in the icu or prior to discharge in survivors . free thyroid hormones were not measured in the study group to prevent the variability associated with these hormones . summary data are presented as mean values sd and comparison between groups was done by mann fisher 's exact test and chi - square test were used to compare frequency of variables among two groups . p values were reported for all statistical tests and a value of < 0.05 was considered to be significant . the baseline profile of study population ( 48 females and 52 males ) is given in table 1 . the mean age of the study population was 58.7 16.9 years ( range , 1694 ) with average duration of icu stay 3.3 3.1 days ( range , 118 ) . there was a significant linear correlation of tsh with age in the entire study population [ figure 1 ] . hba1c did not show such correlation with age in the entire study subjects ( r = 0.00012 , p = 0.9124 ) . baseline profile of study participants correlation between tsh and age in entire study population . out of the 100 patients studied , 64 survived and discharged from the hospital whereas remaining 36 succumbed to their illness . low t3 is the only significant difference in nonsurvivors when compared with all other studied parameters [ figure 2 ] . the distribution of thyroid hormone abnormalities in our study group are as follows : low t3 alone ( 45 ) , low t3 and t4 ( 13 ) , low t3 , t4 and tsh ( 3 ) , mixed patterns ( 16 ) , and normal thyroid profile ( 23 ) . a total of 61 patients had low t3 ( defined as less than 65 ng / dl ) and out of them 16 also had low t4 ( defined as less than 4.5 g / dl ) . the mortality rate was not different between patients with low t3 alone ( 19 nonsurvivors out of 45 ) and low t3 and t4 [ 9 nonsurvivors out of 16 ( which includes 13 patients of low t3 and t4 and 3 patients of low t3 , t4 and tsh ) ] at presentation ( p = 0.5697 ) . however out of 39 patients with normal t3 , only 8 patients succumbed to their illness ( p = 0.0111 ) when compared with 28 nonsurvivors in patients with low t3 . there was no significant difference observed in the profile between survivors and nonsurvivors with respect to t4 , tsh and prolactin . our study demonstrated that low t3 is an important marker of the severity of the illness and predicts mortality in icu . our study showed low t3 ( 61% ) is the commonest abnormality followed by lowt4 ( 14% ) and low tsh ( 7% ) . previous data from pediatric icu patients from mumbai showed low t3 in 80% , low t4 in 50% , and low tsh in 6.7% patients , and it was conducted in 30 critically ill children and controls of less than 12 years age admitted in pediatric icu . two samples were collected from all patients , first at admission and second sample at the time of discharge from icu or death . this study showed that mean t3 and t4 levels were significantly lower in critically ill children than controls . the combination of low t3 and t4 together increased the mortality risk by 30 times . our study differs in the age of the study population ( adults ) , number of study samples ( single sample at admission only ) , and lack of the control group from the previous study explaining the discrepancy in observed data . euthyroid sick syndrome is the term used to describe thyroid hormonal changes in critically ill patients due to nonthyroidal illness . low t3 is the earliest manifestation followed by low t4 and finally low tsh , indicating a continuum of changes in the spectrum . a similar study involving pediatric icu patients showed that low t3 is a good predictor of mortality , and the risk is increased by 30 times when it is associated with low t4 . however , that trend was not observed in our study , and this could be due to difference in age and number of study population and performing a single sample estimation instead of serial monitoring in our study . the demographic profile of the study patients did not differ significantly between the survivors and nonsurvivors . cardiovascular diseases constitute the common reason as we have a combined medical icu and cardiac icu in our hospital . this is followed by infectious diseases ( complicated malaria , sepsis with multiorgan dysfunction syndrome ) and neurological disorders ( cerebrovascular accident , subarachnoid hemorrhage and intra cerebral hemorrhage ) . tsh showed a linear correlation with age in our study population [ figure 1 ] . this was explained earlier by many investigators that the age - related elevation in tsh could be due to increasing autoimmunity , environmental , and genetic factors . although insulin resistance and diabetes are also related to the age , our data did not show any correlation between hba1c and age . this could be explained because of the selection bias of critically ill patients in the study which does not represent the general population . elevated prolactin is seen in 31 patients of the study group . out of them , 14 survived and 17 succumbed to their illness . prolactin is an immunomodulatory hormone involved in the endocrine response to the stress , and hyperprolactinemia is a common finding in initial phases . blunted prolactin response during chronic stress is speculated to lead to increased susceptibility to infection . previous reports demonstrate that admission and fasting glucose is an important marker of short - term outcomes in hospitalized patients . our data did not show any difference in outcomes based on hba1c and glucose values . hba1c does not vary with acute stress and admission hyperglycemia in icu patients may be an indirect marker of severe stress . the limitations of our study include small sample size , single blood sample for hormonal assay , lack of control group , and serial monitoring for the hormonal changes . to conclude , our study suggests that low t3 is an important marker of mortality in critically ill patients . further studies involving a large number of patients with serial evaluation for changes in the hormone profile are required to unravel the mystery of critical care endocrinology .

objective : alteration in thyroid hormones are seen in critically ill patients admitted to intensive care units . our objective was to study the thyroid hormone profile , prolactin and , glycosylated hemoglobin ( hba1c ) at admission and analyze their correlation with mortality.materials and methods : in this single centre , prospective , observational study , 100 consecutive patients ( 52 m ; 48f ) admitted to medical icu irrespective of diagnosis were included . patients with previous thyroid disorders and drugs affecting thyroid function were excluded . all participants underwent complete physical examination and a single fasting blood sample obtained at admission was analyzed for total triiodothyronine ( t3 ) , total thyroxine ( t4 ) , thyroid stimulating hormone ( tsh ) , hba1c , and prolactin . the patients were divided into two groups : group 1 survivors ( discharged from the hospital ) and group 2 nonsurvivors ( patients succumbed to their illness inside the hospital ) . the data were analyzed by appropriate statistical methods and a p - value of < 0.05 was considered significant.results:the mean age of the participants was 58.7 16.9 years and the mean duration of icu stay was 3.3 3.1 days . a total of 64 patients survived , whereas remaining 36 succumbed to their illness . the baseline demographic profile was comparable between survivors and nonsurvivors . nonsurvivors had low t3 when compared with survivors ( 49.1 32.7 vs. 66.2 30.1 , p = 0.0044 ) . there was no significant difference observed between survivors and nonsurvivors with respect to t4 , tsh , hba1c , and prolactin.conclusion:our study showed that low t3 is an important marker of mortality in critically ill patients . admission hba1c , prolactin , t4 , and tsh did not vary between survivors and nonsurvivors .

I M Study population Biochemical measurements Statistical analysis R D C

based on a definition from the psychologist and philosopher williams james , attention is taking possession of the mind in clear and vivid form , of one out of what may seem several simultaneously possible objects or trains of thoughts . it implies withdrawal from some things in order to deal effectively with others " ( 1).along these lines , visual attention as a cognitive property is known to provide a critical base for learning ( 2 ) , working memory ( 3 ) , self - regulation ( 4 ) and word learning ( 5 ) . according to multiple models one of the most important types of attention with a significant role in learning and enhancing school achievement is selective or focused attention ( 7 ) . selective attention is defined as a preferential allocation of limited processing resources to events that have become behaviorally relevant ( 8) and depends on working memory capacity ( 9 , 10 ) . overall , sustained selective attention has an important role in academic performance ( 11 , 12 ) such as reading efficiency ( 13 - 15 ) and mathematical skills ( 16 ) . according to posner and rothbart , the stimulation of brain networks which involve in attention mechanism could enhance this skill in early childhood ( 17 ) . therefore , it is worthwhile to investigate the possible effect of interventions in this critical period . results underscore the need for research on the course of attention problems and the necessity to test interventions on children s early attention problems and their effects on subsequent academic achievement ( 18 ) . different tools areavailable to assess various types of attention . some currently validated neuropsychological tests for attention in children include the dtest ( 19 ) , test of everyday attention for children ( tea - ch ) ( 20 ) , stroop ( 21 ) and trail making test(part b ) ( 22 ) which allow measuring the visual selective attention , and there is alsothe persian version of the sustained auditory attention capacity test ( 23)which is designed to assess auditory sustain attention . since recently , there exist some computerized instruments to test cognitive skills such as attention which provide abundant proof . these instruments include test of variables of attention ( tova ) ( 24 , 25 ) , the integrated visual and auditory continuous performance test ( iva plus ) ( 26 ) and the connors ' continuous performance test(cpt ) ( 27)which assesses sustained attention . such computer - based assessments have two major benefits : first , they can be used to score thetests promptly , theyare ableto keep proper record of reaction time and accurate responses and can also generate an interpretive profile based on the normative data and provide concurrent stimuli ( 28 ) ; andsecond , they seem to be quite interesting for children and canincrease their motivation to have more cooperation and participation during the evaluation ( 29 ) . although a variety of computer - based assessments for auditory selective / sustained attention , such as paced auditory serial addition test ( pasat ) ( 30)and test of sustained selective attention ( tossa ) ( 31),are available , it seems there is a limitation in computer - based assessmentofvisual selective attention . stroop interference testwasoriginally developed as a paper - based tool to measure selective attention and cognitive flexibility ( 32 ) , ability to set shifting ( 33 ) , inhibition ( 34)and extinction ( 35 ) . the original stroop has been translated into numerous languages such as chinese , czechoslovakian , german , hebrew , swedish , japanese ( 35 ) , spanish ( 36 ) and persian ( 37 ) . there are a variation of stroop tasks i.e. , word - color and number - color . some limitations of this test are that the tool may not be administered to illiterate subjects such as preschoolers and is not specific for selective attention as it assesses set shifting and executive function as well . while attention difficulties are widespread among preschool children ( 7 ) , development of a tool to evaluatethe selective visual attention which fits into children s conditions and requirements seems crucial . toachievethis goal and upon designing the selective attention test complying with children s requirements , four important factors were considered asessential and they are as follows : 1)when children are illiterate , using the pictorial stimuli is the preferred method as elementary school children can grasp visualized concepts more easily and they can reply to picture - based questions as instantly as written concepts ( 38);2)tasks were preferred to be designed in agame format because games are considered the most significant means of communication in elementary school children ( 29 ) and may notably make them motivated once experimenters try to evaluate their cognitive skills . games can also allow children to have enhanced attentional control as well as greater cognitive flexibility . this would be served as a new route to better address developmental disorders ( 39 ) ; 3 ) simple design and use of familiar stimuli should be preferred . attention tests rarely resemble daily life activities and most such tests require quite a lot of focus , probably much more than daily life activities;4)the investigation of attention to both visual fields is required . it is well known that right hemisphere distributes attention in both hemispheres and visual fields . the activation of the attentional network appears to occur primarily in the right hemisphere ( 6 ) . the objectives of the current study were to design and develop a computer - based visual selective attention test ( sevat ) with stimuli requiring the attention level in daily life , and secondly , to evaluate the psychometric properties including content , face and convergent validity and test - retest and internal consistency reliability of the developed test . the test was designed as a game in order to engage children in a play and prevent them from feeling bored . the study involved the assessment of original and parallel forms of the computer - based selective visual attention test and was carried out in two phases : - phase 1 : the development of computer - based selective visual attention test ( sevat):the parallel form of the computer - based sevatwas designed toimprove the test reliability and eliminate the carry over and learned effect . the reliability for the parallel test was measured by comparing two different tests with similar but not fully equal content . this wasbasically done by creating a bank of questions or stimuli which measure the same quality after which stimuli are randomly divided into two separate tests . absent or insufficient consistency in each test ( for instance difference in question items or the content ) or measurement error diminishes the test reliability ( 40 ) . to create the preliminary design of this test , all variables involved in the computer - based selective attention test were taken into account . this was based on the available evidence and inputs provided from our experts panelwhich has been described in our previous study ( 41 ) . the first phase of this study ( the development of sevat ) is outlined below . stimuli selection : based on our previous record , 20 experts from various related disciplines including cognitive science , rehabilitation and computer - based game designer ( 9 occupational therapists , twocognitive neuroscientists , twopsychologists , sixcomputer game designers and one pediatric psychologist ) validated the selected stimuli(n = 200 ) for both the original and parallel versions . the stimuli were selected from a picture bank consisting of 600 pictures in different categories including cloths , familiar cartoons characters ( which are popular in media ) , fruits , foods , animals , toys , geometric shapes and signs , letters and numbers ( 42 - 44 ) . based on the consensus reached bythe experts panel , pictures from cloths , familiar cartoons characters , fruits , foods , animals and toys categories were selected . these pictures were shown to children while they were being asked to decidewhether the pictures were attractive , familiar and simple to recognize . results demonstrated that the clothing subgroup was the least attractive ( 97%agreements ) while the food and fruit subgroups ( 100% agreements ) were the most attractive items . eventually , the test contained 5 subgroups which were attractive to children and acceptable based onthe view points of the experts . task : the test comprised of20 trials ( 10 right-10 left visual fields in order to assess the visual field effect on attention allocation ) . in each trial , fivepictures of each subtest were framed . they were shown in the column of theright or left side of the screen , and one of them was taken as the target . in each trial , first , the target picture was largely displayed at the middle of the screen and was then paused for 1500 milliseconds based on theexperts ' opinion ( 41 ) . next , the target picture shrank to small size and moved above a column with fivecells in theright ( or left ) side of the screen and stayed there till the end of trial presentation ( in order to decrease the memory effect ) . each cell of thecolumns was differently colored . then , five pictures moved horizontally from the left side of the screen towards this column . after the first 10 replications , the position of thecolumn and direction of thepictures were changed in order to compare the asymmetric effect of the attention network . software : the software codes were defined in action script 3 and the test was executed in adobe flash professional cs 5 , adobe air 3 , adobe photoshop cs 5.5 , sublime text 2 and notepad 9.8 . the attribute of this test were reaction time in millisecond , accuracy and false reaction . - phase 2 : the psychometric properties of computer - based sevat content validity : ten experts ( occupational therapists ) who did not take part in the first stage endorsed the appropriateness of thequality and quantity of each trial of the test . the inclusion criteria were as follows:1)being the author of at least onerelevant article and 2)acquiring 10-years academic work experience as a faculty member . the content validity ratio ( cvr ) and content validity index ( cvi ) were calculated based on thelawshe method ( 45 ) . responses from experts were pooled and the number indicated the " essentiality " for each item . face validity : after validatingeach stimulus , tenchildren(7 years old ) who did not take part in the first stageassessed the degree of attractiveness , the presentation time and degree of simplicity of each trial . besides , they identified how much each task was interesting using the visual analog scale ( vas ) where 0 indicated boring and 10 indicated very interesting . in addition , once the test was over , all participants ( 60 children ) answered the open question of " do you want to play it again ? convergent validity : sixty first - grade students were enrolled to measure the test - retest reliability and convergent validity of the test . the participantswere all selected through convenience sampling method from two elementary schools located in the1district of tehran during april - may 2013 . participants were 30 girls with the mean age of 80.83 months and standard deviation of 3.26 and 33 boys with the mean age of 81.50 months and standard deviation of 2.58 . the inclusion criteria were age 78 - 84 months years old , normal visual acuity and hearing , no color blindness confirmed by the ishihara test , normal visual field documented by visual confrontation test performed by an occupational therapist , normal intelligence score iq90 based on raven intelligence questionnaire for children and fluency in reading color names ability . the participants were excluded from the study if they revealed any history of a neurological disorder , loss of consciousness due to head injury , any medical condition that might affect cerebral functioning and epilepsy based on their medical record and interview with their parent(s ) . lack of adhd signs was confirmed using the teacher version of conners rating scales for children in elementary schools ( 46 ) which was confirmed by their teachers . three boys were excluded from thestudy due to fever and lack of proper cooperation . in order to evaluate the convergent validity , the correlation between theaverage of reaction time and accuracy of computer - based sevatand thepersian version of computerized stroop color - word test was determined . the persian version of computerized stroop color - word test ( ravansinainc , iran)includes two stages . in the first stage , the training phase , theparticipant should choose the color of the circle which is shown on the monitor in four possible colors of blue , red , yellow and green and press the keys which are covered with colorful labels ( v ( blue ) , b ( red ) , n ( yellow ) , m ( green)]on the keyboard . the main part of the test consists of 96 colorful words - 48 colorful congruent words ( the meaning of the word complies with the ink color in which the word is written ) and 48 colorful incongruent words ( the meaning of the word does not comply with the ink color in which the word is written ) - which wasdisplayed inpseudo - randomly order on the middle of the monitor for 2000 milliseconds ( ms ) with 800 ms inter - stimulus interval ( isi ) . the participantswere asked to identify the color of the words regardless of their meaning ( 47 ) . reliability : to examine the test - retest reliability , the parallel version was designed and all the 60 children were administered the original and parallel versions in a single session . procedure : all children participating in this study completed the two versions ( original and parallel ) of thecomputer - based sevatand the persian version of computerized stroop color - word test in a random order . all children had a snack before the experiment with 5 - 10 minutes resting time between the tests . participants were seated comfortably on a chair in aquiet room at their schools in the morning during 8 - 12 am . the participantswere initially briefed about the overall procedure ( by training in practice block ) and clicked on the correct picture using the mouse . the ethical protocol of this study was based on the approval from the ethic committeeof iran university of medical sciences ( iums ) and wassigned by all theparticipants and one of their parents . result of the kolomogorov - smirnov test determined the non - normal distribution of the stroop test data and normal distribution of theoriginal and parallel versions of sevat . as such , the spearman correlation coefficients , intra - class correlation coefficient ( icc ) and cronbach 's alpha coefficients were used to examine the convergent validity , test - retest reliability and internal consistency , respectively . the reliability correlation coefficients less than 0.4 , between 0.4 and 0.7 and more than 0.7 were considered as weak , tolerable to fine and great reliability , respectively ( 49 ) . result of the kolomogorov - smirnov test determined the non - normal distribution of the stroop test data and normal distribution of theoriginal and parallel versions of sevat . as such , the spearman correlation coefficients , intra - class correlation coefficient ( icc ) and cronbach 's alpha coefficients were used to examine the convergent validity , test - retest reliability and internal consistency , respectively . the reliability correlation coefficients less than 0.4 , between 0.4 and 0.7 and more than 0.7 were considered as weak , tolerable to fine and great reliability , respectively ( 49 ) . content validity : the content validity ratio ( cvr ) of the sevat s 20 trials was determined by 10 occupational therapists . while the experts marked 19 trials as " essential " , the cvr for all trials was1 except forone trial ( animals ' pictures cvr=0.8 ) . the content validity index ( cvi ) face validity : based on the inputs collected from10 first - grade participants , the test was perceived to be attractive ( n=10 , 100% ) , the time duration for each trial was sufficient ( n=8 , 80% ) and the task was simple ( n=8 , 80% ) . besides , they acknowledgedthat the task was interesting ( mean vas= 9.5).the answers of all theparticipants to the question " do you want to play it again ? " were yes . test - retest reliability : with regards to the test - retest reliability using the icc , there was a correlation between the original and parallel version of sevat(p<0.001 , r=0.778 ) ( table 1 ) . sem : standard error of measurement , sd : standard deviation , m : mean , ul : upper , limit , ll : lower limit , cn : number of correct answers internal consistency : the internal consistencies ( cronbach 's alpha ) of scores in the original and parallel tests were 0.857 and 0.831 , respectively . cronbach s alpha of each subgroups revealed that no item needed to be deleted , since all were less than the total score ( table 2 ) . * : all subgroups are significantly correlated at p<0.05 the correlation between the subgroups and the total scores in the both versions aredemonstratedin table 2 . there wasa significantrelationship between the subgroups and the total scores in the original ( 0.759 < r < 0.818 ) as well as the parallel ( 0.714 < r < 0.802 ) versions of thesevat . the correlation between the subgroups and the total score for theoriginal version of sevat was shown to be tolerable to fine ( 0.434 < r < 0.601),and it was weak to tolerable ( 0.394 < r < 0.575)for theparallel version of sevat . convergent validity : the spearman s correlation coefficient demonstrated asignificant positive relationship between the number of correct answers and reaction time to correct answers in the original / parallel versions of sevat with the congruent / incongruent stimuli of the stroop test ( table 3 ) . cn : number of correct answers , rt : reaction time to corrected answers , * * : p<0.001 is significant , * : p<0.05 is significant , r : spearman s rho correlation , ms : millisecond repeated - measure anova demonstrated neither a significant main / interaction effects of the right and left visual field in the original ( f ( 1 , 53 ] = 0.003 , p= 0.956 ) and parallel ( f ( 1 , 57 ] = 0.379 , p= 0.541 ) tests on the reaction time to corrected answers nor on the number of correct answer of these two versions of the computer - based original ( f ( 1 , 57 ] = 0.970 , p= 0.329 ) and parallel ( f ( 1 , 59 ] = 0.506 , p= 0.480 ) sevat . the aim of this study was to develop and validate an instrument , which is interesting to children , to test their selective attention . to do so , a computer - based sevat was designed and developed . following theadministration of the test to first - grade children , the validity ( content , face and convergent ) and reliability ( test - retest and internal consistency ) of the test was assessed . one limitation of applying the attentional models onyounger children was thegreater overlap with other developing skills ; for instance , executive function , language , visuospatial skills ( 51 ) . hence , the design of the current test was based on the perceptual matching tasks method in which childrenwatched thetarget picturesin the monitor and chose the picture which was the same as the target picture among the5 other pictures . in other words , the participantswere asked to track the target pictureamong the other stimuli which were moving from theright to theleft or vice versa ( based on the visual field ) with the task being somehow similar to visual tracking . basically , these two methods are similar to other tasks for selective attention testing as described by mahone and schneiderin 2012 perceptual matching tasks , central - incidental learning tasks and visual search tasks as common methods to measure the selective attention ( 7 ) . hayakawa and colleagues recorded the responses of 111 childrento colorful pictures to be more rapid than the gray scale regardless of the content as compared to the adults ( 52 ) . task designers believed that illiterate childrencould grasp concepts in pictures faster than letters , numbers and words as confirmed by evidence ( 53)as well , and they could understand concepts in familiar pictures more quickly than theunfamiliar ones . the target stimuli in thesevat was shown at the middle part of the monitor and in a larger size than other stimuli and then became equal to others in thesevat based on the experts opinion which was recorded in our previous study ( 41 ) . this might have rooted in the fact that concentration and fixation in visual field relies on the center and larger objects are processed in shorter period of time which is in agreement with the results foundby yao and colleagues ( 2011 ) . they declared that categorization of the complex natural images may occur within a limited area of the visual field , referred to as " field of attention " ( fa).the fa is limited to20 x 24 of visual field within almost 0.1 second without eye movement . as such , the target stimuli in the stroop test arein the middle of the visual field ( 48 ) . in thesevat , each of the5 stimuli in thetrial moves horizontally in a straight line from the right to the left and vice versa on the monitor . thenchildrenshould track the stimulus which is found as same as the target.chosing this design for sevat was done based on the agreements of the experts panel ( 41).firstly , thevisual tracking is considered as an essential skill for reading ( 55 ) . ( 56)and maunsell et al . ( 57 ) studies , moving objects and orientation changes may attract more attention capacity . based on the lieberman et al . study , moving objects are more interesting for childrenand cause more excitement ( 58 ) . the hierarchical visual perception processing which begins with eye movement is followed by visual attentionand is completed with visual memory ( 59 ) . as stated by burnham et al.(2014 ) , parallel with load theory , the visual and spatial working memory may influence selective attention ( 9 ) . consequently , test designers are suggested to reduce the impact of working memory by selecting 5 stimuli as distracters since normal working memory capacity for adult is 72 , or by letting the target stimulus remain displayed on the screen until the end of thereplication . studies.they showed that the responses of children in the multiple - object tracking task ( parts tracking and recognizing the moving position)were affectedbytheir age ( 60 ) . thus,6-year - old children can track the positions of more than four moving itemsbecause of their working memory capacity ( 61 , 62 ) . no significant difference was found between the two visual fieldswith regards to the reaction time and the number of correct answerswhen the two versions were compared . they found a significant difference in responses from left vs. right visual fields and confirmed the existence of hemispheric asymmetry in selective attention and concluded that stimuli similarity may play a critical role in this asymmetry ( 63 ) . although such result should be validated by examining the test in adhd or patients with unilateral neglect , some possible reasons for this disparity may be small sample size , unrestricted head movement during the test , lack of sensitivity of the test ( for which some electrophysiology modalities such as erp or eye tracking are preferred ) and presenting 10 trials for each right or left visual field orderly instead of randomly;tojustify this , conductingfurther research is suggested . validity : one of the most important factors in developing tests is their validity . regarding the content validity stages of the computer - based sevat , the value of both versions of the test was approved by the experts panel . according to the experts analysis , the content validity of thewhole test , stimuli , psychophysics properties and the homogeneity of computer - basedsevat subgroups werequite favorable forassessing selective attention . with regards all children found this test to be interesting and they wanted to play it again . however , they indicated that the stroop test was boring for them and madethem feel asanxious as at the time of theexamination . with respect to the convergent validity , there was a positive and significant correlation between raw scores in the original and parallel versions of the sevat test and stroop test . therefore , the sevatmay be a proper tool to measure selective attention in 7 year - old children . this means that there were very strong relationships between different subgroups of the sevat with the total scores . in addition , the different subgroups of the computer - based sevat were strongly interrelated , indicating a good internal consistency for the test . meanwhile , exclusion of each subgroup decreased the internal consistency of the scale which confirmed the sevat measuring a specific area . concerning the test - retest reliability of the computer - based sevat , findings onthe repeatability of thescores , usingtheparallel version to examine test retest in asingle session , demonstrated agreat relationship . this suggested that the original and parallel versions of the computer - based sevat may be conducted interchangeably . further studies should be conductedto assess the differentiated validity of thesevat in other age groups of preschool childrenand in other disorders such as adhd , learning disorders and pdd . however , the main limitation of this study was the lack of other computer - based visual selective attention tests to measure convergent validity in children , and expectedly lack of relevant evidence to compare the results . moreover , lack of any alternative test rather than thestrooptestmadeus to wait till the end of the first grade in whichkids acquire an acceptable literacy level . the computer - based selective visual attention test is an easily administered instrument to assess selective attention in children who were not literate . considering the good validity and reliability of thesevat , itcanbe used as a test besides other children s cognitive assessment toolbox . children were found to perceive it as agame they like to play and theydemonstrated very good cooperation during the test . the applicability of such a test alsoneeds to be examined in other age groups ( 3 - 7 year - old kids ) and in different subgroups with neuro - developmental predicaments .

background : visual attention is known as a critical base for learning . the purpose of the present study was to design , develop and evaluate the test - retest and internal consistency reliability as well as face , content and convergent validity of the computer- based selective visual attention test ( sevat ) for healthy first - grade school children . methods : in the first phase of this study , the computer - based sevat was developed in two versions of original and parallel . ten experts in occupational therapy helped to measure the content validity using the cvr and cvi methods . face validity was measured through opinions collected from 10 first - grade children . the convergent validity of the test was examined using the spearman correlation between the sevat and stroop test . in addition , test - retest reliability was determined by measuring the intra - class correlation ( icc ) between the original and parallel versions of the sevat in a single session . the internal consistency was calculated by cronbach 's alpha coefficients . sixty first grade children ( 30 girls/30boys ) participated in this study . results : the developed test was found to have good content and face validity . the sevat showed an excellent test - retest reliability ( icc= 0.778 , p<0.001 ) and internal consistency ( cronbach 's alpha of original and parallel tests were 0.857 and 0.831 , respectively ) . sevat and stroop test demonstrated a positive correlation upon the convergent validity testing . conclusion : our results suggested an acceptable reliability and validity for the computer - based sevat in the assessment of selective attention in children . further research may warrant the differential validity of such a test in other age groups and neuro - cognitively disordered populations .

Introduction Methods Statistical Analyses Results Discussion Conclusion

rebamipide ophthalmic suspension was developed for the treatment of dry eyes and for other corneal diseases , promoting the secretion of both mucin in tear fluid and membrane - associated mucin , increasing the number of goblet cells , and restoring the barrier function of the corneal epithelium . we report a case of a persistent corneal epithelial defect in a patient with diabetes treated with topical application of rebamipide ophthalmic suspension . a 73-year - old woman had a history of type 2 diabetes for 35 years and nonproliferative diabetic retinopathy for 23 years . a corneal ulcer was detected , and culture of corneal scrapings was performed , with staphylococcus aureus and streptococcus canis being isolated . the infection was treated with levofloxacin eye drops and ofloxacin ophthalmic ointment based on the sensitivity profile of the isolate . however , a corneal epithelial defect persisted for approximately 2 months despite continuing treatment with 0.1% hyaluronic acid ophthalmic suspension and 0.3% ofloxacin eye ointment . the persistent corneal epithelial defect showed improvement at 2 weeks after treatment with rebamipide unit dose 2% ophthalmic suspension , and it did not recur even when vitrectomy was subsequently performed for vitreous hemorrhage due to progression of diabetic retinopathy . this is the first report about efficacy of rebamipide unit dose 2% ophthalmic suspension for presenting persistent corneal epithelial defect in a patient with diabetes . in the present case , the suggested mechanisms are the following : improving the corneal barrier function , stabilization of mucin on the keratoconjunctival epithelium , and improving the wettability and stability of the tear film , which resulted in the promotion of healing of the corneal epithelial defect in a short time period . ocular complications of diabetes include diabetic retinopathy , diabetic cataract , diabetic ocular motility disorder , neovascular glaucoma , secondary glaucoma , diabetic optic neuropathy , uveitis , and diabetic keratopathy.1,2 among them , diabetic keratopathy is unlikely to be associated with irreversible visual impairment , but it can lead to persistent corneal epithelial damage that is difficult to treat.3 moreover , there is the risk that corneal epithelial disorder could increase susceptibility to bacterial or fungal infections.4 in patients with diabetes , attention must be paid to the general increased risk of infection , which is not only a problem for the eyes . rebamipide was developed in the 1990s as an oral agent for the treatment of gastric ulcer and gastritis.57 in recent years , its mucosal - protective effect has also been applied to protect the keratoconjunctival epithelium,8,9 following the development of ophthalmic rebamipide products for the treatment of dry eyes.811 rebamipide ophthalmic suspension has been reported to exhibit multiple pharmacological effects , such as promoting the secretion of both mucin in tear fluid and membrane - associated mucin , increasing the number of goblet cells,8,9 restoring the barrier function of the corneal epithelium,12,13 and anti - inflammatory activity.14 it has been reported that rebamipide ophthalmic suspension is effective not only for dry eyes but also for other corneal diseases such as sjgren s syndrome,15 persistent corneal erosion,16 superficial limbic keratopathy,17 alkaline corneal injury,18 lid wiper epitheliopathy,19 and lagophathalmos.20 however , no reports have been published concerning the efficacy of rebamipide ophthalmic suspension for persistent corneal epithelial defects associated with diabetic keratopathy . here , we report a case with persistent corneal epithelial defect after infectious corneal ulcer in a patient with diabetes , which resolved following topical application of 2% rebamipide ophthalmic suspension for 2 weeks . a 73-year - old woman presented to the department of ophthalmology of juntendo university shizuoka hospital with a sudden onset of discharge and ophthalmalgia in the left eye . hemoglobin ( hb ) a1c had ranged between 7.2% and 8.0% in recent years , indicating inadequate glycemic control . she also had a history of nonproliferative diabetic retinopathy for 23 years and had not undergone retinal photocoagulation . , a corneal ulcer was noted in the left eye with corneal opacity ( figure 1 ) . further , conjunctival injection and chemosis and/or conjunctivochalasis on the lower part of burbar conjunctiva were observed . corrected visual acuity was 14/20 and 16/20 in the right and left eyes , respectively . topical application of 1.5% levofloxacin ( lvfx ) antimicrobial eye drops ( cravit ophthalmic solution 1.5% ; santen pharmaceutical co. ltd , osaka , japan ) four times daily was commenced together with 0.3% ofloxacin ophthalmic ointment ( tarivid ophthalmic ointment 0.3% ; santen pharmaceutical co. ltd ) twice daily . cefdinir capsules ( cefzon ; astellas pharmaceutical co. ltd , tokyo , japan ) were also administered orally ( 100 mg three times daily for 3 days ) . staphylococcus aureus and streptococcus canis were isolated by culture of corneal scrapings , and both of these bacteria were found to be sensitive to lvfx . at the first hospital visit , hba1c was 7.3% . tear secretion was evaluated at 12 mm in the right eye and 11 mm in the left eye by schirmer s tear test . tear breakup time in both eyes was 4 seconds . at 2 weeks after the start of treatment , there were no signs of infection , the corneal ulcer reduced , and her symptoms of eye discharge and the ophthalmalgia resolved . in contrast , clinically a lesion of corneal epithelial defect 1 mm in size was still noted . even though additional administration of 0.1% hyaluronic ophthalmic suspension ( hyalein ophthalmic solution 0.1% ; santen pharmaceutical co. ltd ) six times daily , the corneal epithelial defect persisted ( figure 2 ) . we diagnosed persistent corneal epithelial defect associated with diabetes as well as corneal hypoesthesia and diabetic keratitis . vitreous hemorrhage occurred in the left eye 2 months after the start of treatment , and visual acuity decreased from 16/20 to 8/20 . the patient required vitrectomy , but it could not be done until the corneal epithelial defect healed . accordingly , she was treated with 2% rebamipide ophthalmic suspension ( mucosta ophthalmic suspension unit dose 2% ; otsuka pharmaceutical co. ltd , tokyo , japan ) four times daily , and the corneal epithelial defect healed after 2 weeks . vitrectomy was then performed , and administration of this drug was discontinued after vitrectomy , while lvfx eye drops and 0.1% betamethasone ophthalmic suspension were used . after surgery , any corneal epithelial defect did not recur after surgery ( figure 3 ) , and her corrected visual acuity had recovered to 16/20 at 3 months after surgery . in patients with a persistent corneal epithelial defect , a corneal epithelial lesion caused by trauma or surgery fails to heal . it is often difficult to treat , and patients may have underlying diseases such as diabetes , corneal neuropathy , or corneal epithelium adhesion factor disorder.21 a persistent corneal epithelial defect is generally treated by topical application of artificial tears , hyaluronic acid , and ophthalmic ointment , wearing a therapeutic soft contact lens , or topical application of serum.22,23 however , the defect is often refractory to these treatments . use of fibronectin or peptide has also been investigated by some researchers , but these agents are not available yet clinically.21,24 the risk of infection is increased , particularly when the patient has diabetes.4 in the present patient , bacterial infection could have occurred due to a corneal epithelial disorder related to poor glycemic control , and a persistent corneal epithelial defect was noted after treatment of the infection . diabetic keratopathy may be associated with neuropathic keratitis in patients with a persistent corneal epithelial defect , and dry eyes may occur secondary to a reflex decrease of tear secretion due to corneal hypoesthesia and/or secondary to reduced tear and mucin secretion due to efferent nerve dysfunction.25 tear secretion was not decreased in this patient , but there was a possibility of other neurological dysfunction . the development of diabetic keratopathy has been also suggested to be related to loss of nerve - derived trophic factors following a decrease in corneal sensation . furthermore , there was another possibility of dysfunction of the tear meniscus and/or an ectopic tear meniscus by conjunctivochalasis or chemosis as shown in figures 1 and 2 . it might bring disturbance of stability of the tear film as described in the previous report26 and lead to persistent corneal epithelial defect . in this patient , a persistent corneal epithelial defect that was refractory to standard treatment resolved after 2 weeks of topical therapy with rebamipide ophthalmic suspension and did not recur when vitrectomy was performed subsequently . during the follow - up period , the main pharmacological effects of rebamipide ophthalmic suspension include promoting the secretion of mucin in tears and membrane - associated mucin , increasing the number of goblet cells , and restoring the barrier function of the corneal epithelium by increasing the expression of tight junction proteins , as well as an anti - inflammatory effect.814 such actions could have been exhibited in this patient with diabetic keratopathy . in brief , as a result of junctions between corneal epithelial cells being strengthened to improve corneal barrier function , mucin was stabilized on the corneal epithelium , and this improved the wettability and stability of the tear film , resulting in promotion of healing of the corneal epithelial defect . it has also been reported that inflammation occurs due to oxidative stress and increased expression of nuclear factor - kappa b in diabetic keratopathy.27 rebamipide has been reported to have an anti - inflammatory effect and to inhibit the production of interleukin-6 , interleukin-8 , and tumor necrosis factor- by human corneal epithelial cells,1214 so these anti - inflammatory effects would also lead to improvement of persistent corneal epithelial defect . rebamipide ophthalmic suspension exhibited a beneficial effect on a presenting persistent corneal epithelial defect in a patient with diabetes relatively soon after the start of treatment .

objectiverebamipide ophthalmic suspension was developed for the treatment of dry eyes and for other corneal diseases , promoting the secretion of both mucin in tear fluid and membrane - associated mucin , increasing the number of goblet cells , and restoring the barrier function of the corneal epithelium . we report a case of a persistent corneal epithelial defect in a patient with diabetes treated with topical application of rebamipide ophthalmic suspension.case presentationa 73-year - old woman had a history of type 2 diabetes for 35 years and nonproliferative diabetic retinopathy for 23 years . she presented to our department with discharge and ophthalmalgia in the left eye . a corneal ulcer was detected , and culture of corneal scrapings was performed , with staphylococcus aureus and streptococcus canis being isolated . the infection was treated with levofloxacin eye drops and ofloxacin ophthalmic ointment based on the sensitivity profile of the isolate . however , a corneal epithelial defect persisted for approximately 2 months despite continuing treatment with 0.1% hyaluronic acid ophthalmic suspension and 0.3% ofloxacin eye ointment . her hemoglobin a1c was 7.3% . the persistent corneal epithelial defect showed improvement at 2 weeks after treatment with rebamipide unit dose 2% ophthalmic suspension , and it did not recur even when vitrectomy was subsequently performed for vitreous hemorrhage due to progression of diabetic retinopathy.conclusionthis is the first report about efficacy of rebamipide unit dose 2% ophthalmic suspension for presenting persistent corneal epithelial defect in a patient with diabetes . in the present case , the suggested mechanisms are the following : improving the corneal barrier function , stabilization of mucin on the keratoconjunctival epithelium , and improving the wettability and stability of the tear film , which resulted in the promotion of healing of the corneal epithelial defect in a short time period .

Objective Case presentation Conclusion Introduction Case presentation Discussion Conclusion

fibroblast growth factors ( fgfs ) form a family of generally extracellular signaling peptides , which are key regulators of many biological processes ranging from cell proliferation to the control of embryonic development in metazoans . ever since the mitogenic activity of fgf - like factors was first observed in 1939 and the first fgf factor was isolated in the 1970s , a large number of members of this gene family have been isolated and characterized in different metazoans . fgfs are small proteins ( between 17 and 34 kda ) characterized by a relatively well conserved central domain of 120 to 130 amino acids . this domain is organized into 12 antiparallel sheets forming a triangular structure called beta trefoil . in general , fgfs function through binding to a tyrosine kinase receptor ( fgfr ) on the surface of the cell membrane . two fgf ligands bind a dimeric receptor in the presence of heparan sulphate proteoglycan ( hspg ) allowing the transphosphorylation and activation of the intracellular tyrosine kinase domain of the receptor . binding to fgfrs usually activates several intracellular cascades ( i.e. , ras / mapk , pi3k / akt , and plc/pkc ) which may regulate the transcription of different target genes . through the activation of these cytoplasmic pathways , the fgf signal controls several major cellular functions such as cell proliferation , migration , differentiation , or survival . an intracellular mode of action has also been described in the case of fgf1 but it is poorly documented . concerning the evolutionary history of the fgf gene family , several studies using molecular phylogenetics as well as synteny conservation analyses have been performed [ 48 ] . the first phylogeny - based classifications of the gene family were proposed before the whole complement of fgf genes was described in mammals which led to incomplete conclusions [ 5 , 8 ] . the first phylogenetic studies including all the mammalian fgfs proposed a division of the gene family into six or seven subfamilies . in 2005 , popovici and collaborators performed the first study including both protostome and deuterostome fgfs as well as fgfs from baculoviruses , an arthropod - specific group of viruses . they proposed to divide the fgf gene family into eight subfamilies : subfamily a ( including orthologs of fgf 1 and 2 ) , subfamily b ( orthologs of fgf 3 , 7 , 10 , and 22 ) , subfamily c ( orthologs of fgf 4 , 5 , and 6 ) , subfamily d ( orthologs of fgf 8 , 17 , 18 , and 24 from vertebrates but also of egl-17 , pyr , and ths from protostomes ) , subfamily e ( orthologs of fgf 9 , 16 , and 20 but also of let-756 from nematodes ) , subfamily f ( orthologs of fgf 11 , 12 , 13 , and 14 ) , subfamily g ( orthologs of fgf 15/19 , 21 , and 23 ) , and subfamily h which is specific of arthropod fgfs ( i.e. , bnl ) and of fgfs found in arthropod - specific viruses . this classification is widely accepted today , however , the phylogenetic position of fgf3 and fgf5 is not completely solved , which calls into question the constitution of the two subfamilies b and c. moreover , the description of fgf genes in the sea anemone nematostella vectensis now raises the question of the timing of the appearance and diversification of the fgf gene family . in this study we take advantage of the exponential increase of publicly available genomic sequences to present an update of the fgf gene content in different evolutionary lineages . phylogenetic approaches , together with synteny conservation analyses of these data , allow us to propose a new classification of the fgf gene family which ( i ) confirms the paralogy relationships of the fgf4/5/6 subfamily members and ( ii ) suggest that orthologs of the mammalian fgf3 form a new subfamily . the recent development of high throughput sequencing techniques has generated a large number of sequences available in different public databases . among them we have searched for fgf domain coding sequences within the major metazoan phyla , in order to clarify the evolutionary history of this family . we have limited our study to the analysis of amino acid sequences deposited in the genbank , the ensembl , and the jgi databases for cnidarians , lophotrochozoans , ecdysozoans , and deuterostomes , although many ests sequences putatively coding for fgf proteins might also be found . fgf genes were previously described in two anthozoan species : nematostella vectensis and acropora millepora [ 10 , 11 ] . in nematostella , 13 genes encoding fgf ligands were predicted from the genome sequence but their phylogenetic relationships with bilaterian fgfs are not fully established . four of these genes group with the fgf8/17/18/24 subfamily and six group with the fgf1/2 subfamily with low support . in the hydrozoan hydra magnipapillata we have found 4 predicted genes coding for fgfs ( see table 1 ) . among them , one ( called fgf24 ) belongs to the fgf8/17/18/24 subfamily . another one groups with several nematostella fgf genes whose position is not robustly supported but might belong to the fgf1/2 subfamily ( see figure s1 in supplementary material available online at doi:10.1155/2012/298147 ) . for the other two , no clear relationship with either nematostella or bilaterian fgfs can be proposed according to phylogenetic reconstructions . we also looked for ctenophore est sequences putatively encoding fgf domains but we failed to find any in public databases . in protostomes , fgf genes have only been described in ecdysozoans , particularly in arthropods . three genes have been characterized in the model organism drosophila melanogaster [ 12 , 13 ] , called branchless ( bnl ) , thisbe ( ths ) , and pyramus ( pyr ) . in the coleopteran tribolium castaneum , four fgf genes called tc - fgf1a , tc - fgf1b , tc - fgf8 , and tc - bnl have also been identified . ths and pyr from drosophila , as well as tc - fgf8 from tribolium , were shown to belong to the fgf8/17/18/24 subfamily , whereas tc - fgf1a , and tcfgf1b belong to the fgf1/2 subfamily . on the other hand , branchless orthologs from both species show no clear evolutionary relationships with any of the vertebrates fgf gene subfamilies leading popovici and collaborators to propose a new subfamily including bnl from arthropods and baculovirus - specific fgf genes . in the genome of the nematode caenorhabditis elegans two fgf genes are found called let-756 ( lethal protein 756 ) and egl-17 ( egg laying defective 17 ) [ 4 , 15 ] , which are members of the fgf9/16/20 and fgf8/17/18/24 subfamilies , respectively . in order to obtain a more complete picture of the diversity of the fgf gene family in ecdysozoans , we searched other available sequences ( see table 1 ) . thus , in different nematode species we only found orthologs of the two known c. elegans genes ( figure s2 ) . in arthropods , we found fgf coding genes in the crustacean daphnia pulex , in the chelicerate ixodes scapularis , and in insects from different classes such as apis mellifera , harpegnathos saltator , or pediculus humanus ( see table 1 ) . the orthology relationships of the two fgf genes we found in daphnia can not be clearly determined , whereas for all the other arthropods the different genes we found always belong to the bnl , fgf1/2 , or fgf8/17/18/24 subfamilies ( figure s2 ) . no study of the fgf gene set in lophotrochozoans has been published yet so we searched for lophotrochozoan fgf coding sequences in genbank and in the complete genome sequences of the mollusc lottia gigantea and of the annelids helobdella robusta and capitella teleta . we found only one gene in capitella whose position in the fgf phylogenetic tree is not robustly supported , but probably belongs to the fgf8/17/18/24 subfamily . in lottia gigantea , two fgf genes are present in the complete genome , and again their evolutionary relationship with the different subfamilies can not be clearly determined even if the best blast hit results for these genes are always orthologs of the fgf8/17/18/24 and fgf9/16/20 subfamilies ( see table 1 ) . taken together , these data demonstrate ( i ) that lophotrochozoans also possess some fgf coding genes , although quite divergent from the other protostome genes , and ( ii ) that members of only four subfamilies , fgf1/2 , fgf8/17/18/24 , fgf9/16/20 , and bnl , can be clearly found in protostomes . deuterostomes comprise vertebrates , the related invertebrate chordates ( urochordates and cephalochordates ) and three other invertebrate taxa : hemichordates and echinoderms , which form the ambulacraria group , and the recently described phylum of xenoturbellida . nothing is known concerning the fgf gene content in xenoturbella and we did not find any fgf coding sequence for this group . conversely , recent studies have shown that one fgf gene exists in the sea urchin strongylocentrotus purpuratus ( i.e. , echinoderm ) , and we have identified in the databases six fgf genes in the hemichordate saccoglossus kowalevskii of which one gene can be clearly assigned to the fgf8/17/18/24 subfamily . three other genes are orthologs of the fgf9/16/20 subfamily , indicating that an hemichordate - specific duplication occurred for this gene ; another one has been previously shown to be ortholog of the fgf19/21/23 ; the sixth gene shows no clear orthology relationships with any fgf gene subfamily ( see table 1 ) . in chordates , the fgf gene content is also different among the three subphyla . in cephalochordates , eight fgf genes have been found and orthology relationships using phylogenetics or conservation of synteny approaches have been suggested for six of them ( i.e. , fgf1/2 , fgf8/17/18 , fgf9/16/20 , fgfa ortholog of fgf3/7/10/22 , fgfb ortholog of fgf4/5/6 , and fgfc ortholog of fgf19/21/23 ) . in the urochordate ciona intestinalis , six genes encoding fgf ligands have been described , and we identified one more gene in databases , called fgf - na1 , bringing the total fgf gene content to seven . of them , only two were shown to be clear orthologs of the fgf8/17/18/24 and fgf11/12/13/14 subfamilies . in another urochordate , the larvacean oikopleura dioica , we found six fgf coding genes , among which two can be assigned to the fgf11/12/13/14 subfamily , and one to the fgf9/16/20 subfamily ( see table 1 and figure s4 ) . in vertebrates , an explosion in the number of genes encoding fgfs occurred and we can find between 19 and 27 fgf genes depending on the species . this explosion is not specific to the fgf gene family and is linked to the two rounds of genome duplication ( three rounds in teleosts ) that occurred in this lineage as previously demonstrated [ 4 , 21 ] . in sarcopterygians we identified 19 fgf genes in the chicken and 23 in the coelacanth , whereas 22 fgf genes ( fgf 123 ) have been characterized in mouse and human ( the mouse fgf15 is the ortholog of the human fgf19 ) . these 22 mammalian genes were previously used to reconstruct the evolutionary history of the family [ 4 , 6 ] , which led to the classification of fgfs into seven paralogy groups . however , in teleosts , an additional round of genome duplication ( 3r hypothesis ) occurred , which , together with a high number of fgf gene losses , produced 27 fgf genes in the zebrafish . due to the low sequence conservation of most of the fgf genes found in early divergent metazoan lineages , and the short length of the fgf domain , we have based our phylogenetic study on vertebrate fgfs , as in previous studies [ 4 , 6 ] . however , the new fgf sequence data , particularly within chordates , allow us to suggest a new classification of the fgf gene family in metazoans , which is divided into 8 subfamilies instead of 7 ( in addition to the arthropod + baculoviruses specific family proposed by popovici et al . ) . these families are the fgf1/2 , fgf3 , fgf4/5/6 , fgf7/10/22 , fgf8/17/18/24 , fgf9/16/20 , fgf11/12/13/14 and fgf19/21/23 ( figures 1 and s5 ) . in all the studies performed so far , the vertebrate fgf3 always grouped into either the subfamily fgf3/7/10/22 or the subfamily fgf3/4/6 [ 4 , 6 , 8 ] . in fact , the correct classification of fgf3 is still debated and assignment to one or another subfamily depends on the methods used . therefore , most of the phylogenetic analyses published grouped fgf3 with fgf7 , fgf10 , and fgf22 , but with very low node robustness . other studies , using the genomic locations of this gene , grouped it with fgf4 and fgf6 and it has even been suggested that the fgf3/4/6 and fgf19/21/23 subfamilies can be assembled into a single subfamily fgf3/4/6/19/21/23 ( with fgf5 grouping in this case with the fgf1/2 subfamily ) . here , based particularly on results obtained through the study of gene content , phylogenetic distribution , and conservation of synteny between amphioxus and vertebrates , we propose a new evolutionary scenario in which fgf3 forms a new subfamily ( figures 1 , 2 , and s5 ) . this scenario could reconcile the different evolutionary hypotheses suggested in previous studies . in our hypothesis , an ancestral fgf gene ( named fgf3/4/5/6 ) was duplicated in tandem before chordate diversification . thus , the putative ancestor ( either eumetazoan or chordate ancestor ) had two fgf genes maintained in cluster : fgf3 and fgf4/5/6 . this situation can still be observed in the cephalochordate branchiostoma floridae in which fgfb and fgfe are clustered in a genomic region showing synteny conservation with the vertebrate locus containing the fgfs 3 , 4 and 6 ( figure 3 ) . this hypothesis implies a loss of fgf3 in different lineages , the number of lineages that lost fgf3 depends on the timepoint at which this gene appeared ( i.e. , in urochordates in one hypothesis ( figures 2(b ) and 5 ) , or in urochordates , ambulacrarians , protostomes , and cnidarians in the other hypothesis , see figure 5 ) . according to this scenario the origin of fgf3 would be ancient ( i.e. , at least prior to chordates diversification ) and not due to the vertebrate - specific genome duplications . indeed , depending on the phylogenetic approach and on the gene set used for the phylogenetic reconstruction , it clusters either with fgf4/6 or with fgf1/2 [ 4 , 23 ] . moreover , conservation of synteny also suggests the paralogy of fgf1 , 2 , and 5 . however , a deeper synteny analysis of the human fgf5 locus shows conservation of this locus with both the fgf1/2 and fgf4/6 loci ( figure 3 ) . this mixed syntenic conservation , together with our phylogenetic analyses supporting the fgf4/5/6 subfamily ( figure 1 ) , suggests that fgf5 is a real paralog of fgf4 and 6 . the partial synteny conservation with the fgf1 and 2 loci might be explained by a genomic translocation of the fgf5 locus ( including its neighbouring genes bmp3 , paqr3 ) close to the anxa3 locus ( figures 2(a ) and 3 ) . phylogenetic reconstructions using fgf sequences from all metazoan phyla often fail to completely solve the orthology relationship between the different members of this family mainly because of the reduced size of the fgf domain and because of the high divergence of the sequences between the different lineages . however , using the phylogenetic distribution of fgf genes into eight subfamilies , we can propose evolutionary scenarios accounting for the fgf gene content found in the different metazoan lineages . we focus mainly on two of these hypotheses : a first hypothesis where the eight fgf subfamilies are chordate - specific ( figures 4 and 5 , hypothesis 1 ) and a second hypothesis where the eight subfamilies were ancestral to all eumetazoans ( figure 5 , hypothesis 2 ) . in both hypotheses , the evolutionary history of the fgf gene content in chordates is the same ( figure 4 ) , but depending on the hypothesis , it changes for the other metazoan lineages ( figure 5 ) . as we have shown , in cnidarians ( diploblastic metazoans ) we found the presence of , at least , orthologs of the fgf8/17/18 and probably fgf1/2 subfamilies . thus , we can suggest that the eumetazoan ancestor possessed at least one ortholog of these two subfamilies . our analyses suggest that the arthropod ancestor already possessed at least three fgf genes belonging to the fg1/2 , fgf8/17/18 and bnl subfamilies ( figure 5 ) . two possible evolutionary scenarios can be drawn for bnl genes . in the first scenario , a bnl ortholog might have existed ancestrally and then been lost in all metazoan lineages except arthropods . then this gene was captured by baculoviruses after the arthropod radiation . in a second scenario , an arthropod fgf gene was translocated into baculoviruses and , following a period of fast evolution leading to the loss of any phylogenetic signal , reintegrated into the arthropod genome . in the ancestor of nematodes , two fgf genes , orthologs of the fgf9/16/20 and taking these results into account , we can propose the existence of a minimal fgf gene set of three genes in the ancestor of ecdysozoans ( orthologs of fgf1/2 , fgf8/17/18/24 and fgf9/16/20 ) . the few data obtained in lophotrochozoans do not allow us to clearly conclude on the fgf gene set of the protostome ancestor . however , we can suggest the presence of at least members of the fgf1/2 , fgf8/17/18 , and fgf9/16/20 subfamilies . the two hypotheses proposed here for the evolutionary history of the fgf gene family ( figure 5 ) suggest that a single paralogous gene for each subfamily was kept in cephalochordates and that specific gene duplications or losses did not occur during evolution in this lineage ( figure 4 ) . in fact , genetic conservation in amphioxus is not restricted to fgfs since different studies have shown that gene content in amphioxus tends to be associated with very few gene losses [ 2428 ] . concerning other chordates , even if the phylogenetic distribution of the seven urochordate fgf genes is not strongly supported ( see figure s4 ) , we can assume that c. intestinalis has orthologs of the fgf4/5/6 , fgf7/10/22 , fgf8/17/18 , fgf9/16/20 , fgf11/12/13/14 , and fgf19/21/23 subfamilies but that it lost the orthologs of the fgf1/2 and fgf3 subfamilies ( figure 4 ) . moreover , the seventh gene ( ci - fgfl ) , as proposed by popovici et al . , could be a specific duplication of fgf7/10/22 . in sarcopterygian vertebrates , the gene set of the different species suggests that numerous gene losses occurred following the two rounds of genome duplication ( from eight ancestral genes , after two rounds of duplication , we should find 32 genes , but depending on the species we find between 19 and 23 genes moreover , some lineage - specific gene losses also occurred in sarcopterygians ; for example , the loss of fgf24 in tetrapods and losses of fgf11 , 17 , and 21 in chicken . in teleosts , gene losses were even more important , since instead of 46 genes ( i.e. , a duplication of the 23 fgf genes present in the osteichthyan ancestor ) we only find 27 in zebrafish . indeed , duplicated copies generated by this third genome duplication were only retained for fgf10 , fgf6 , fgf17 , fgf18 , and fgf20 ( figure 4 ) . in non - chordate deuterostomes , the only fgf gene found in the sea urchin can not be assigned to any fgf subfamily using phylogenetic reconstructions , whereas five of the six genes found in s. kowalevskii belong to the fgf8/17/18/24 , fgf9/16/20 , and fgf19/21/23 subfamilies ( figure s3 ) . the remaining gene does not show clear phylogenetic relationships with the different fgf subfamilies . therefore , whatever the evolutionary hypothesis ( i.e. , chordate - specific duplications versus early duplication giving rise to eight subfamilies in the ancestral eumetazoan ) , we can propose that there were at least three fgf genes in the ambulacrarian ancestor ( i.e. , orthologs of fgf8/17/18/24 , fgf9/16/20 , and fgf19/21/23 ) ( figure 5 ) . this result suggests that the deuterostome ancestor had probably at least these three genes plus fgf1/2 which is present in chordates and in protostomes but seems to be lost in the ambulacraria . at this stage of the analysis it is difficult to say if specific chordate duplications led to the eight chordate fgfs ( hypothesis 1 , figure 5 ) , or if there was already eight genes in the deuterostome ancestor , several of them having being lost in ambulacraria ( hypothesis 2 , figure 5 ) . here , for simplicity , we showed two extreme scenarios , one starting from the minimum gene set in the eumetazoan ancestor ( only two genes ) and the second starting from the maximum ( eight genes ) . these two major evolutionary scenarios ( figure 5 ) imply different duplication / loss evolutionary histories . the first hypothesis implies two main points : ( i ) the ancestral eumetazoan had an fgf gene set of at least two genes ( orthologs of fgf1/2 and fgf8/17/18/24 ) and ( ii ) important chordate - specific duplications occurred generating the present diversity of the fgf gene family observed in this lineage , which is divided into eight subfamilies ( hypothesis 1 , figure 5 ) . thus , from eight ancestral fgf gene families already present in the eumetazoan ancestor , six gene losses occurred in cnidarians , five in protostomes and five in ambulacrarians ( hypothesis 2 , figure 5 ) . the second hypothesis is less parsimonious than the first , but no matter which is correct , what seems clear is that the evolutionary history of the fgf gene family required numerous events of gene duplication and gene loss at different times and in different evolutionary lineages . the next question we should address in the near future is which are the implications of this complicated evolutionary history of the fgf gene family on the functional evolution of this signal and in the morphological evolution of metazoans . fgf sequences were identified using blastp search in the ncbi and jgi databases using all known fgf domain amino acid sequences . sequence accession numbers of fgf sequences identified in this study are shown in table 1 . fgf amino acid sequences were aligned using clustalx and regions of ambiguous homology were removed . neighbour - joining tree was generated using mega version 5 with a poisson model and a discrete gamma - distribution model with four rate categories . maximum likelihood ( ml ) tree was built using phyml3.0 with a jtt model as proposed by prottest2.4 . the node robustness of both trees was estimated by a bootstrap test ( 100 replicates ) . the fgf domain coding region of retrieved sequences was aligned with known fgf sequences from metazoans using t - coffee . maximum likelihood ( ml ) trees were generated using phyml3.0 with a lg+g model as proposed by prottest2.4 .

fibroblast growth factors ( fgfs ) are small proteins generally secreted , acting through binding to transmembrane tyrosine kinase receptors ( fgfrs ) . activation of fgfrs triggers several cytoplasmic cascades leading to the modification of cell behavior . fgfs play critical roles in a variety of developmental and physiological processes . since their discovery in mammals , fgfs have been found in many metazoans and some arthropod viruses . efforts have been previously made to decipher the evolutionary history of this family but conclusions were limited due to a poor taxonomic coverage . we took advantage of the availability of many new sequences from diverse metazoan lineages to further explore the possible evolutionary scenarios explaining the diversity of the fgf gene family . our analyses , based on phylogenetics and synteny conservation approaches , allow us to propose a new classification of fgf genes into eight subfamilies , and to draw hypotheses for the evolutionary events leading to the present diversity of this gene family .

1. Introduction 2. The FGF Gene Content Varies among 3. The FGF Gene Family Is Composed by Eight Subfamilies 4. The Evolutionary History of the FGF Gene Family Is Characterized by Gene Duplications and Gene Losses 5. Materials and Methods

recently , perceptual learning ( the long - term improvement in perceptual abilities , including distinguishing differences in sensory features , such as contrast and orientation , as a result of repeated perceptual experiences ) has attracted much attention on the part of vision scientists , with the hope that research on perceptual learning will lead to a better understanding of the mechanism of perceptual plasticity . however , it is highly controversial as to what part of the brain is associated with perceptual learning . here , we will discuss the controversy . it has been suggested that perceptual learning is unique and distinguishable from other forms of learning in many aspects , including task rules , associations , and strategies . one of the unique characteristics of perceptual learning is that perceptual improvements are often specific to trained stimuli . in one study , for example , after presentation of three parallel lines , including one center task line and two lateral reference lines , participants were asked to indicate whether the center line appeared closer to the left or the right reference line . however , this improvement was not found when participants were tested with novel orientations and novel target positions . such specificity has been found in various features , including orientation ( and its vicinity ) [ 2 - 4 ] , motion direction of training stimuli , and also retinotopic location where the stimuli are presented . this specificity is consistent with the characteristics of neurons in areas early in the sensory visual pathway with small receptive fields and specific responses to primitive stimulus features . a number of studies , however , have indicated that such high specificity is not always shown in perceptual learning . one such study showed that the extent of the transfer of performance improvement from the trained to untrained orientations may depend on the degree of task difficulty . a more recent study developed a novel double - training paradigm that employed conventional feature training ( e.g. contrast ) at one retinal location and additional training with an irrelevant feature / task ( e.g. orientation ) at a second retinal location , either simultaneously or at a different time . this approach allowed perceptual learning of a task to transfer to a new retinal location . although several studies ( including the above experiments ) have reported a few exceptions to the specificity of perceptual learning , the specificity is still considered as one of the main properties of perceptual learning . the most straightforward way to test whether changes of sensory areas occur after perceptual learning is to look directly inside the brain , and various studies have tried to figure out which regions are altered as a result of perceptual learning . a number of these studies have focused on changes in the primary visual cortex ( v1 ) , the earliest cortical stage of the visual area , because neurons of v1 have the smallest receptive field and respond highly selectively to specific features , including orientation and location : such characteristics of v1 neuron activity are consistent with aspects of specificity in perceptual learning . studies have found enhanced tuning specificity of neurons in v1 in monkeys and cats or increased blood - oxygen - level - dependent ( bold ) signals in the trained area of v1 in humans [ 13 - 16 ] . however , some single - unit studies ( i.e. recording the electrical impulses in single neurons ) of monkeys have failed to find any changes in v1 after perceptual learning . one study showed that extensive training with monkeys did not change the selectivity and responsiveness of neurons in v1 . another study reported that the basic properties of receptive fields of v1 neurons , such as loca - tion , size , and orientation selectivity , were not changed after perceptual training , although the influence of con - textual stimuli ( that were placed outside the receptive fields ) on the activity of v1 neurons was altered . yang and maunsell found that perceptual learning induced changes not in v1 but in v4 in monkeys . it has also been found that neurons in the middle temporal complex ( mt ) region of the visual cortex in monkeys were better tuned to the trained motion direction , at least during the experiment . on the other hand , some recent studies using monkeys have suggested that perceptual learning is associated with changes outside the sensory regions altogether . it has been found that , while perceptual learning of coherent ( group ) motion was not associated with responses in neurons in the mt area , it was in the lateral intraparietal area , which is usually regarded as being beyond the sensory system , and is related to perceptual decision - making . this finding is consistent with a well - established model , in which perceptual learning results from changes in weights of connections between the sensory areas and the decision - making areas . controversies remain regarding whether or not perceptual learning is associated with changes in the sensory region of the brain . one of the main difficulties in addressing and answering this question lies in the fact that different experiments of perceptual learning have been conducted with different sets of stimuli , methods , and paradigms , without the perspective of systematically investigating perceptual learning . thus , in order to resolve the controversy , stan - dardizing experimental conditions in which perceptual learning occurs should be a priority .

perceptual learning is defined as long - term improvement in perceptual abilities as a result of perceptual experiences . it is controversial as to whether perceptual learning is associated with changes in a sensory region of the brain or not . here , we review research that supports , or otherwise , the sensory change hypothesis and discuss what needs to be done in the future to answer this question more definitively .

Introduction Specificity of perceptual learning Changes in brain areas associated with perceptual learning Conclusion Competing interests

the incidence of atrial fibrillation ( af ) and af - related strokes increase with age. warfarin has been clearly shown to effectively prevent thromboembolic events in patients with af , especially in elderly patients. however , warfarin therapy is often underutilized in elderly patients due to a higher risk of bleeding and poor tolerability . recently , non - vitamin k antagonist oral anticoagulants ( noacs ) such as dabigatran and rivaroxaban have been shown to be non - inferior or even superior to warfarin for long - term stroke prevention in patients with non - valvular af . , a recent meta - analysis reported that noacs did not cause excess bleeding and were associated with equal or greater efficacy than warfarin therapy in elderly patients ( 75 years ) . moreover , subgroup analysis of major clinical trials in asian populations showed even better results for noacs in terms of bleeding complications . , therefore , it is expected that noacs would be an effective alternative to warfarin , or even a better option , in patients with a higher risk of bleeding . as societies worldwide have aged , the efficacy and safety of noacs in extremely elderly patients or octogenarians have emerged as an important area of research . as renal function decreases with age and creatinine levels poorly reflect renal function in elderly patients , the bleeding risk of noacs could be substantial in this extreme age group . our present study aimed to evaluate the efficacy ( prevention of stroke or systemic embolism ) and safety ( risk of major bleeding ) of noacs and warfarin in korean octogenarian patients in a real - world setting . we performed a systematic computerized search of our hospital 's database ( asan biomedical research environment ) , and selected patients who were 80 years old with non - valvular af ( 418 patients on noacs and 232 patients on warfarin ) at asan medical center between january 2011 and september 2014 . patients receiving anticoagulant therapy for the purpose of primary or secondary prevention of ischemic stroke or systemic embolism were solely selected . non - valvular af was defined as rhythm disturbance occurring in the absence of rheumatic mitral valve disease , a prosthetic heart valve , or mitral valve repair . patients were excluded if they were taking anticoagulants for other purposes including prevention or treatment of pulmonary thromboembolism or deep vein thrombosis ; if they had bridging therapy with noac or pretreatment before cardioversion ; if they did not have at least two months of follow - up after medication ; if they had a creatinine clearance ( crcl ) of < 30 ml / min . finally , 148 patients were enrolled into the noacs group and 145 patients were enrolled into the warfarin group , respectively ( figure 1 ) . all patients were treated with noacs ( 148 patients , 50.5% ) or warfarin [ target international normalized ratio ( inr ) : 2.03.0 ; 145 patients , 49.5% ] according to the patient 's or physician 's preference . of the 148 patients that received noacs , 52 ( 35.1% ) received dabigatran [ 48 on a low - dose ( 110 mg twice a day ) and 4 on a common dose ( 150 mg twice a day ) ] and 96 ( 64.9% ) received rivaroxaban [ 32 on a low dose ( 15 mg once daily ) and 64 on a common dose ( 20 mg once daily ) ] . apixaban was not included in our analysis because it was not available in our hospital during the study period . types ( dabigatran or rivaroxaban ) and doses ( low dose or common dose ) of noacs were prescribed at the discretion of the attending physicians . stroke was defined as the sudden onset of a focal neurological deficit lasting at least 24 h. systemic embolism was defined as acute vascular occlusion of an extremity or major organ documented at the time of autopsy , angiography , or vascular imaging . major bleeding was defined as ( 1 ) fatal bleeding , ( 2 ) symptomatic bleeding in a critical area or organ , such as intracranial , intraspinal , intraocular , retroperitoneal , intraarticular , or pericardial , or intramuscular with compartment syndrome , and/or ( 3 ) bleeding causing a fall in hemoglobin level of 2 g / dl or leading to the transfusion of 2 units of whole blood or red cells . two investigators ( kwon ch and kim ms ) reviewed all medical records of the study patients during follow - up and adjudicated all stroke , systemic embolism , and bleeding events that contributed to the pre - specified outcomes . event rates are presented as event numbers per 100 patient - years of follow - up . , chicago , il ) , and data are expressed as the mean sd ( continuous variables ) or as frequency ( categorical variables ) . when comparing baseline variables between the noacs and warfarin groups , continuous variables were compared using the student 's t test and mann - whitney u test , and categorical variables were compared using the chi - square test or fisher 's exact test . hazard ratios ( hrs ) and p values were calculated by the use of multivariable cox 's regression analysis that included sex , anticoagulant type , concomitant antiplatelet use , and has - bled score . the kaplan - meier method was used to estimate the survival - free rate of major bleeding between the treatment groups . additionally , the survival rates were compared using the log - rank test . we performed a systematic computerized search of our hospital 's database ( asan biomedical research environment ) , and selected patients who were 80 years old with non - valvular af ( 418 patients on noacs and 232 patients on warfarin ) at asan medical center between january 2011 and september 2014 . patients receiving anticoagulant therapy for the purpose of primary or secondary prevention of ischemic stroke or systemic embolism were solely selected . non - valvular af was defined as rhythm disturbance occurring in the absence of rheumatic mitral valve disease , a prosthetic heart valve , or mitral valve repair . patients were excluded if they were taking anticoagulants for other purposes including prevention or treatment of pulmonary thromboembolism or deep vein thrombosis ; if they had bridging therapy with noac or pretreatment before cardioversion ; if they did not have at least two months of follow - up after medication ; if they had a creatinine clearance ( crcl ) of < 30 ml / min . finally , 148 patients were enrolled into the noacs group and 145 patients were enrolled into the warfarin group , respectively ( figure 1 ) . all patients were treated with noacs ( 148 patients , 50.5% ) or warfarin [ target international normalized ratio ( inr ) : 2.03.0 ; 145 patients , 49.5% ] according to the patient 's or physician 's preference . of the 148 patients that received noacs , 52 ( 35.1% ) received dabigatran [ 48 on a low - dose ( 110 mg twice a day ) and 4 on a common dose ( 150 mg twice a day ) ] and 96 ( 64.9% ) received rivaroxaban [ 32 on a low dose ( 15 mg once daily ) and 64 on a common dose ( 20 mg once daily ) ] . apixaban was not included in our analysis because it was not available in our hospital during the study period . types ( dabigatran or rivaroxaban ) and doses ( low dose or common dose ) of noacs were prescribed at the discretion of the attending physicians . stroke was defined as the sudden onset of a focal neurological deficit lasting at least 24 h. systemic embolism was defined as acute vascular occlusion of an extremity or major organ documented at the time of autopsy , angiography , or vascular imaging . major bleeding was defined as ( 1 ) fatal bleeding , ( 2 ) symptomatic bleeding in a critical area or organ , such as intracranial , intraspinal , intraocular , retroperitoneal , intraarticular , or pericardial , or intramuscular with compartment syndrome , and/or ( 3 ) bleeding causing a fall in hemoglobin level of 2 g / dl or leading to the transfusion of 2 units of whole blood or red cells . two investigators ( kwon ch and kim ms ) reviewed all medical records of the study patients during follow - up and adjudicated all stroke , systemic embolism , and bleeding events that contributed to the pre - specified outcomes . event rates are presented as event numbers per 100 patient - years of follow - up . , chicago , il ) , and data are expressed as the mean sd ( continuous variables ) or as frequency ( categorical variables ) . when comparing baseline variables between the noacs and warfarin groups , continuous variables were compared using the student 's t test and mann - whitney u test , and categorical variables were compared using the chi - square test or fisher 's exact test . hazard ratios ( hrs ) and p values were calculated by the use of multivariable cox 's regression analysis that included sex , anticoagulant type , concomitant antiplatelet use , and has - bled score . the kaplan - meier method was used to estimate the survival - free rate of major bleeding between the treatment groups . additionally , the survival rates were compared using the log - rank test . a p value < 0.05 was considered statistically significant . in addition , the has - bled scores as determined by previous bleeding history , hypertension , abnormal renal / liver function , stroke , bleeding history or predisposition , labile international normalized ratio , elderly , and drug or alcohol use were significantly higher in the patients in the noacs group than in those in the warfarin group . the median follow - up duration was 10.9 months ( interquartile range , 5.221.2 months ) for the noacs group and 12.8 months ( interquartile range , 5.324.9 months ) for the warfarin group . a total of 29 patients ( 9.9% ) had concomitant antiplatelet agent with none on dual antiplatelet therapy . there was no significant difference in number of patients on concomitant antiplatelet agents between noacs group ( n = 15 , 10.1% ) and warfarin group ( n = 14 , 9.7% ) . mean inr of patients in the warfarin group was measured 2.1 1.5 at the last follow - up . the efficacy and safety outcomes according to the treatment group are presented in table 2 and figure 2 . the incidence rates of stroke or systemic embolic events were low in both anticoagulant groups and there were no significant differences in stroke or systemic embolic events between the treatment groups . however , major bleeding events occurred in a significant numbers of patients treated with both noacs and warfarin . major bleeding events tended to be lower in the low dose noacs group than the common dose noacs or warfarin groups , but the difference was not statistically significant ( figure 2b ) . values are expressed as the mean sd , median ( interquartile range ) , or n ( % ) . cad : coronary artery disease ; cha2ds2 vasc score : cumulative score of congestive heart failure , hypertension , age ( 75 years or 65 years ) , diabetes , stroke , vascular disease , and sex ( female ) ; egfr : estimated glomerular filtration rate ; has - bled score : cumulative score of hypertension , abnormal renal and liver function , stroke , bleeding , labile inrs , elderly ( e.g. , age > 65 years ) , and drugs or alcohol ; mi : myocardial infarction ; noacs : non - vitamin k antagonist oral anticoagulants ; se : systemic embolism . p value between treatment groups was achieved for the overall follow - up duration by univariable cox regression model . major bleeding occurred in 15 patients ( 10.1% ) in the noacs group and 24 patients ( 16.4% ) in the warfarin group ( figure 3 ) . gastrointestinal bleeding was the most common cause of major bleeding in both groups [ 6 patients ( 4.1% ) in the noac group vs. 10 patients ( 6.8% ) in the warfarin group ] . intracranial bleeding occurred in one patient ( 0.7% ) in the noac group and three patients ( 2.1% ) in the warfarin group . major bleeding events tended to increase according to has - bled scores but no statistically significant differences were shown ( online data figure s1 ) . likewise , no significant difference was found between the patients with vs .. without concomitant antiplatelet agents ( 5/29 , 17.2% vs. 34/264 , 12.9% ) . concomitant antiplatelet agent was not associated with an increased incidence of major bleeding in cox regression analysis ( hrs = 1.273 , 95% ci : 0.4973.263 , p = 0.615 ) . among the 29 patients on antiplatelet therapy , major bleeding occurred in 2 out of 14 patients in the warfarin , 3 of 11 patients in the low dose noacs , and no one ( 0/4 patients ) in common dose noacs group , respectively ( log rank , p = 0.572 ) . on the other hand , major bleeding events significantly increased in patients with decreased renal function ( crcl : 3044 ml / min ) ( figure 4 ) . meier analysis revealed a significant difference in the incidence of major bleeding according to renal function ( figure 5 ) . has - bled : cumulative score of hypertension , abnormal renal and liver function , stroke , bleeding , labile inrs , elderly ( e.g. , age > 65 years ) , and drugs or alcohol ; noacs : non - vitamin k antagonist oral anticoagulants . in addition , the has - bled scores as determined by previous bleeding history , hypertension , abnormal renal / liver function , stroke , bleeding history or predisposition , labile international normalized ratio , elderly , and drug or alcohol use were significantly higher in the patients in the noacs group than in those in the warfarin group . the median follow - up duration was 10.9 months ( interquartile range , 5.221.2 months ) for the noacs group and 12.8 months ( interquartile range , 5.324.9 months ) for the warfarin group . a total of 29 patients ( 9.9% ) had concomitant antiplatelet agent with none on dual antiplatelet therapy . there was no significant difference in number of patients on concomitant antiplatelet agents between noacs group ( n = 15 , 10.1% ) and warfarin group ( n = 14 , 9.7% ) . mean inr of patients in the warfarin group was measured 2.1 1.5 at the last follow - up . the efficacy and safety outcomes according to the treatment group are presented in table 2 and figure 2 . the incidence rates of stroke or systemic embolic events were low in both anticoagulant groups and there were no significant differences in stroke or systemic embolic events between the treatment groups . however , major bleeding events occurred in a significant numbers of patients treated with both noacs and warfarin . major bleeding events tended to be lower in the low dose noacs group than the common dose noacs or warfarin groups , but the difference was not statistically significant ( figure 2b ) . values are expressed as the mean sd , median ( interquartile range ) , or n ( % ) . cad : coronary artery disease ; cha2ds2 vasc score : cumulative score of congestive heart failure , hypertension , age ( 75 years or 65 years ) , diabetes , stroke , vascular disease , and sex ( female ) ; egfr : estimated glomerular filtration rate ; has - bled score : cumulative score of hypertension , abnormal renal and liver function , stroke , bleeding , labile inrs , elderly ( e.g. , age > 65 years ) , and drugs or alcohol ; mi : myocardial infarction ; noacs : non - vitamin k antagonist oral anticoagulants ; se : systemic embolism . p value between treatment groups was achieved for the overall follow - up duration by univariable cox regression model . major bleeding occurred in 15 patients ( 10.1% ) in the noacs group and 24 patients ( 16.4% ) in the warfarin group ( figure 3 ) . gastrointestinal bleeding was the most common cause of major bleeding in both groups [ 6 patients ( 4.1% ) in the noac group vs. 10 patients ( 6.8% ) in the warfarin group ] . intracranial bleeding occurred in one patient ( 0.7% ) in the noac group and three patients ( 2.1% ) in the warfarin group . major bleeding events tended to increase according to has - bled scores but no statistically significant differences were shown ( online data figure s1 ) . likewise , no significant difference was found between the patients with vs .. without concomitant antiplatelet agents ( 5/29 , 17.2% vs. 34/264 , 12.9% ) . concomitant antiplatelet agent was not associated with an increased incidence of major bleeding in cox regression analysis ( hrs = 1.273 , 95% ci : 0.4973.263 , p = 0.615 ) . among the 29 patients on antiplatelet therapy , major bleeding occurred in 2 out of 14 patients in the warfarin , 3 of 11 patients in the low dose noacs , and no one ( 0/4 patients ) in common dose noacs group , respectively ( log rank , p = 0.572 ) . on the other hand , major bleeding events significantly increased in patients with decreased renal function ( crcl : 3044 ml / min ) ( figure 4 ) . kaplan meier analysis revealed a significant difference in the incidence of major bleeding according to renal function ( figure 5 ) . has - bled : cumulative score of hypertension , abnormal renal and liver function , stroke , bleeding , labile inrs , elderly ( e.g. , age > 65 years ) , and drugs or alcohol ; noacs : non - vitamin k antagonist oral anticoagulants . our present study is a retrospective analysis to compare noacs with warfarin therapy for stroke prevention in asian octogenarian patients with non - valvular af . the major findings of our analyses are as follows : ( 1 ) the incidence rates of stroke or systemic embolism were low in octogenarian patients , and there was no significant difference in the efficacy outcomes ( stroke or systemic embolism ) between the noacs and warfarin treatments ( 1.16% for noacs vs. 2.98% for warfarin per 100 patient - years , p = 0.46 ) ; and ( 2 ) in contrast , major bleeding occurred in a significant number of patients with both noacs ( 8.96 per 100 patient - years ) and warfarin ( 12.46 per 100 patient - years ) treatments , which was not significantly different between the two groups ( p = 0.29 ) . in our present study series , stroke and systemic embolism event rates were low and were not significantly different between the noacs and warfarin groups . recent studies in asian populations reported similar rates of stroke or systemic embolism , ranging from 1.26% to 2.6% per year with noacs and from 2.61% to 3.4% per year with warfarin . , , the mean age of the study population of the previous asian studies was around 70 years , whereas the mean age of our study patients was 83.7 years . in addition , the patients in the noacs group were significantly older than those in the warfarin group in this study . taking these facts into consideration , noacs appear to be not only non - inferior , but may also be more effective than warfarin at preventing embolic events in very old ( 80 years ) af patients . moreover , a recent meta - analysis of elderly patients ( 75 years ) that supported this assumption also reported that the incidence of stroke or systemic embolism was significantly lower with noacs than warfarin therapy ( 3.3% vs. 4.7% ; odds ratio = 0.65 ; 95% ci : 0.480.87 ) . in this study , patients treated with low dose noacs experienced numerically fewer stroke or systemic embolism events than those treated with common dose noacs or warfarin . in the randomized evaluation of long - term anticoagulation therapy ( re - ly ) trial , the risks of stroke or systemic embolism were not statistically different between the two doses ( 110 mg and 150 mg ) of dabigatran in elderly patients aged 75 years . in a japanese trial that used low - dose ( 15 mg once daily ) rivaroxaban ( mean age of study population , 71 years ) , there was a strong trend for a reduction in the rate of stroke / systemic embolism with low dose rivaroxaban vs. warfarin ( hr = 0.49 ; p = 0.050 ) . a recent chinese study suggested that low dose dabigatran achieved superior stroke risk reduction than warfarin in chinese octogenarian patients with af . therefore , low dose noacs may be non - inferior than common dose noacs or warfarin at preventing stroke or systemic embolism in east asian octogenarians . the risks of total bleeding and major bleeding were relatively high in our current study patients . one study found that the cumulative incidence of major hemorrhage for octogenarians was 13.1 per 100 patient - years , which was consistent with our present findings . however , an italian prospective observational study reported a low rate of major bleeding ( 1.87 per 100 patient - years ) in octogenarians on warfarin . in other recent sub - analyses of randomized trials , the risk of major bleeding was 4.374.40 per 100 patient - years on warfarin in patients aged 75 years . previous sub - analyses according to old age ( 75 years ) reported that the incidence of major bleeding was 4.435.10 per 100 patient - years on noacs . , in asian patients ( mean age , about 70 years ) , the risk of major bleeding on noacs was reported to be 2.993.59 per 100 patient - years . , , compared with these previous results , the risk of major bleeding on noacs was about twice as high in our current study population . given that our result was drawn from the real - world setting , the risk of major bleeding in octogenarian patients seems to be markedly high with both noacs and warfarin . the risks of major bleeding tended to be lower in patients treated with low dose noacs than in those treated with common dose noacs and warfarin therapy in our analysis . moreover , the patients in our noacs group were significantly older and had higher has - bled scores and previous bleeding history than those in the warfarin group . based on these results , low dose noacs may not only be non - inferior , but may be superior to common dose noacs or warfarin for preventing major bleeding in frail patients such as octogenarians . a simple laboratory test with a capability of indicating the effects of different dosages of noacs or gauging the degree of anticoagulation would be of great help to adjust dosage , especially at the beginning of noac treatment . in the sub - analysis , major bleeding risks tended to be higher in patients with moderate - to - high bleeding risk ( has - bled score 2 ) than in those with low bleeding risk ( has - bled score 1 ) . however , major bleeding was significantly higher in patients with stage 3b chronic kidney disease ( crcl 3044 ml / min ) than in other less decreased renal function groups . therefore , circumspection is needed when prescribing noacs and warfarin to patients with decreased renal function . although warfarin is effective for the prevention of stroke and systemic embolism in af , advanced age and asian ethnicity are associated with a greater risk for warfarin - related bleeding , especially intracranial hemorrhage. our current analysis also showed an increased tendency for major bleeding with warfarin compared with noacs . therefore , noacs would be an attractive alternative to warfarin for achieving fewer thromboembolic and bleeding events in asian octogenarian patients . second , the number of patients analyzed was relatively small and the follow - up period was relatively short . thus , we could not compare the efficacy and safety between different noacs . of note , apixaban was not included in our analysis . considering previous results of apixaban on the superior safety outcomes , bleeding in our patient cohort might have been different if apixaban was available . however , as there has been no head - to - head comparison using different noacs , it is difficult to extrapolate individual noacs results to comparison of different noacs . fourthly , we could not test patient 's adherence to prescribed anticoagulant regimen . finally , we did not calculate time - in - therapeutic range for the warfarin group , and thus could not evaluate the appropriateness of warfarin therapy . however , our study largely reflects the current status of real - world anticoagulation practice , and deserves its significance . despite these limitations , our findings are meaningful because they reveal the incidence of stroke or systemic embolic events and major bleeding risks in noacs or warfarin groups in a real - world clinical setting for asian octogenarian patients . the incidence rates of stroke or systemic embolism are low in asian octogenarian af patients treated with warfarin or noacs . however , major bleeding events can be excessively high in both anticoagulant groups , especially in patients with decreased renal function . the efficacy and safety outcomes tended to decrease non - significantly in patients with low dose noacs than in those treated with common dose noacs or warfarin therapy . in the future , a well - designed , prospective study on the optimal anticoagulant regimen ( low dose regimen and new criteria for prescription of low dose noacs ) is required in elderly asian population , especially in patients with impaired renal function . in our present study series , stroke and systemic embolism event rates were low and were not significantly different between the noacs and warfarin groups . recent studies in asian populations reported similar rates of stroke or systemic embolism , ranging from 1.26% to 2.6% per year with noacs and from 2.61% to 3.4% per year with warfarin . , , the mean age of the study population of the previous asian studies was around 70 years , whereas the mean age of our study patients was 83.7 years . in addition , the patients in the noacs group were significantly older than those in the warfarin group in this study . taking these facts into consideration , noacs appear to be not only non - inferior , but may also be more effective than warfarin at preventing embolic events in very old ( 80 years ) af patients . moreover , a recent meta - analysis of elderly patients ( 75 years ) that supported this assumption also reported that the incidence of stroke or systemic embolism was significantly lower with noacs than warfarin therapy ( 3.3% vs. 4.7% ; odds ratio = 0.65 ; 95% ci : 0.480.87 ) . in this study , patients treated with low dose noacs experienced numerically fewer stroke or systemic embolism events than those treated with common dose noacs or warfarin . this result was consistent with those of previous studies . in the randomized evaluation of long - term anticoagulation therapy ( re - ly ) trial , the risks of stroke or systemic embolism were not statistically different between the two doses ( 110 mg and 150 mg ) of dabigatran in elderly patients aged 75 years . in a japanese trial that used low - dose ( 15 mg once daily ) rivaroxaban ( mean age of study population , 71 years ) , there was a strong trend for a reduction in the rate of stroke / systemic embolism with low dose rivaroxaban vs. warfarin ( hr = 0.49 ; p = 0.050 ) . a recent chinese study suggested that low dose dabigatran achieved superior stroke risk reduction than warfarin in chinese octogenarian patients with af . therefore , low dose noacs may be non - inferior than common dose noacs or warfarin at preventing stroke or systemic embolism in east asian octogenarians . the risks of total bleeding and major bleeding were relatively high in our current study patients . one study found that the cumulative incidence of major hemorrhage for octogenarians was 13.1 per 100 patient - years , which was consistent with our present findings . however , an italian prospective observational study reported a low rate of major bleeding ( 1.87 per 100 patient - years ) in octogenarians on warfarin . in other recent sub - analyses of randomized trials , the risk of major bleeding was 4.374.40 per 100 patient - years on warfarin in patients aged 75 years . previous sub - analyses according to old age ( 75 years ) reported that the incidence of major bleeding was 4.435.10 per 100 patient - years on noacs . , in asian patients ( mean age , about 70 years ) , the risk of major bleeding on noacs was reported to be 2.993.59 per 100 patient - years . , , compared with these previous results , the risk of major bleeding on noacs was about twice as high in our current study population . given that our result was drawn from the real - world setting , the risk of major bleeding in octogenarian patients seems to be markedly high with both noacs and warfarin . the risks of major bleeding tended to be lower in patients treated with low dose noacs than in those treated with common dose noacs and warfarin therapy in our analysis . moreover , the patients in our noacs group were significantly older and had higher has - bled scores and previous bleeding history than those in the warfarin group . based on these results , low dose noacs may not only be non - inferior , but may be superior to common dose noacs or warfarin for preventing major bleeding in frail patients such as octogenarians . a simple laboratory test with a capability of indicating the effects of different dosages of noacs or gauging the degree of anticoagulation would be of great help to adjust dosage , especially at the beginning of noac treatment . in the sub - analysis , major bleeding risks tended to be higher in patients with moderate - to - high bleeding risk ( has - bled score 2 ) than in those with low bleeding risk ( has - bled score 1 ) . however , major bleeding was significantly higher in patients with stage 3b chronic kidney disease ( crcl 3044 ml / min ) than in other less decreased renal function groups . therefore , circumspection is needed when prescribing noacs and warfarin to patients with decreased renal function . although warfarin is effective for the prevention of stroke and systemic embolism in af , advanced age and asian ethnicity are associated with a greater risk for warfarin - related bleeding , especially intracranial hemorrhage. our current analysis also showed an increased tendency for major bleeding with warfarin compared with noacs . therefore , noacs would be an attractive alternative to warfarin for achieving fewer thromboembolic and bleeding events in asian octogenarian patients . second , the number of patients analyzed was relatively small and the follow - up period was relatively short . thus , we could not compare the efficacy and safety between different noacs . of note , apixaban was not included in our analysis . considering previous results of apixaban on the superior safety outcomes , bleeding in our patient cohort might have been different if apixaban was available . however , as there has been no head - to - head comparison using different noacs , it is difficult to extrapolate individual noacs results to comparison of different noacs . finally , we did not calculate time - in - therapeutic range for the warfarin group , and thus could not evaluate the appropriateness of warfarin therapy . however , our study largely reflects the current status of real - world anticoagulation practice , and deserves its significance . despite these limitations , our findings are meaningful because they reveal the incidence of stroke or systemic embolic events and major bleeding risks in noacs or warfarin groups in a real - world clinical setting for asian octogenarian patients . the incidence rates of stroke or systemic embolism are low in asian octogenarian af patients treated with warfarin or noacs . however , major bleeding events can be excessively high in both anticoagulant groups , especially in patients with decreased renal function . the efficacy and safety outcomes tended to decrease non - significantly in patients with low dose noacs than in those treated with common dose noacs or warfarin therapy . in the future , a well - designed , prospective study on the optimal anticoagulant regimen ( low dose regimen and new criteria for prescription of low dose noacs ) is required in elderly asian population , especially in patients with impaired renal function .

backgroundthe efficacy and safety of non - vitamin k antagonist oral anticoagulants ( noacs ) and warfarin in asian octogenarian atrial fibrillation ( af ) patients have not been established in a real - world setting . we aimed to evaluate the efficacy and safety of noacs and warfarin in korean octogenarian patients.methodsa total of 293 consecutive patients aged 80 years with non - valvular af who had taken either noacs ( 148 cases , 50.5% ) or warfarin ( 145 cases , 49.5% ) were retrospectively reviewed . the efficacy outcome was the composite of stroke or systemic embolism . the safety outcome was major bleeding.resultsthe follow - up duration was 375 patient - years ( 172 patient - years with noacs and 203 patient - years with warfarin ) . patients on noacs were slightly older ( p = 0.006 ) and had slightly higher has - bled scores ( p = 0.034 ) . the efficacy of both anticoagulants was high ( 1.16% for noacs vs. 2.98% for warfarin per 100 patient - years , p = 0.46 ) . the safety outcome was relatively high in both noacs and warfarin groups ( 8.96% vs. 12.46% , p = 0.29 ) . the efficacy and safety outcomes tended to decrease non - significantly in low dose noacs than in common dose noacs or warfarin ( 0.85% vs. 1.84% vs. 2.98% in efficacy outcome , p = 0.69 ; and 6.97% vs. 13.29% vs. 12.46% in safety outcome , p = 0.34).conclusionsnoacs were highly effective for prevention of stroke or systemic embolism in asian octogenarian af patients . however , major bleeding occurred excessively high in both anticoagulant groups . further study is required on the optimal anticoagulant regimen in octogenarian population .

Introduction Methods Study subjects Efficacy and safety outcomes Statistical analysis Results Study subjects Efficacy and safety outcomes Discussion Efficacy of NOACs and warfarin Safety of NOACs and warfarin Limitations of the study Conclusions

the ability of a newborn baby , fresh out of the womb , to attach to the maternal nipple and begin sucking leads many to label the behavior as innate . some extend this concept of innate behavior to include reflexes , denoting fixed action patterns organized as sensory - motor circuits in the brain stem or spinal cord [ 1 , 2 ] , as well as the rhythmic firing of central pattern generators ( cpgs ) , also located in the central nervous system , that produce correlated neuromuscular sucking rhythms . the concept of innate behavior is controversial , to say the least [ 4 , 5 ] . criticisms abound because such behaviors , when carefully observed and measured are not fixed but are highly variable [ 6 , 7 ] . moreover , so - called instinctive behaviors , under the scrutiny of experimental analysis , prove to be based on various forms of prior experience and learning [ 8 , 9 ] . similarly , while the firing of cpgs may correlate with sucking rhythms , it has yet to be shown that such isolated elements actually combine with other discrete components to create the real behavior of the suckling newborn , behavior that adapts to the unpredictable , dynamic geometry of the mother 's body , and behavior in real time and in real contexts . congenital is a more accurate and defensible term with which to denote a capability in behavior that is present at birth . in contrast to innate and instinctive , congenital is more obviously a description of status at birth than it is an explanation of its basis or origins [ 10 , 11 ] . explaining the developmental origins of a congenital capability such as nipple attachment and sucking by a newborn upon confronting for the first time its mother 's external body in highly novel environment is a formidable challenge of clinical significance . the experimental literature , based on studies with non - human animals , contains a wealth of information pertinent to a better understanding of the onset and development of oral feeding skills . this literature includes some impressive findings concerning the onset of nipple attachment and sucking by newborn rat pups . a brief description of the postnatal onset of sucking by rat pups will help frame the forthcoming presentation and analyses : rat pups are born after a gestation period of about three weeks . they are born as litter , averaging 10 pups ( mothers have 12 nipples ) , blind , deaf , and furless , with limited strength and coordination . for about 6 hrs prior to parturition , labor contractions can be seen rippling vertically on the mother 's abdomen or indenting her sides as she stretches her body . more than 100 labor contractions can be observed during a rat 's labor . as each pup emerges from the birth canal , encased in an amniotic sac with the umbilical cord and placenta trailing , the dam assists with licking and gentle tugging . the mother removes the sac by licking and nibbling , consumes the placenta and membranes , licks the pup some more , licks herself , and then repeats the sequence as the next pup emerges . only after all the pups are thus delivered and the placentas are all consumed , does the rat dam turn her attention to the newborns , which she gathers into a clump in the nest and settles over them . we have described and quantified the labor and delivery process in rats , noting the stimulation received by the pups during labor and throughout the birth process . in the nest , with the dam hovering above the pups , the infants are active . they orient to the dam 's ventrum , probe against her body and root along the ventrum until they orally grasp a nipple and suck . it is difficult to observe directly the natural sequence of events that lead to the rat pups ' initial nipple attachments and sucking . when the dam settles on her newly born litter she is typically crouched above the pups within a nest that affords poor visibility . fortunately , the newborn rat 's behavior is robust and orderly ; when placed under suspended artificial surfaces simulating various properties of the dam 's ventrum , newborn rats show an organized repertoire of behaviors . they travel , wriggle , turn on their sides and upside down , ventroflex , probe the surface , and audibly bark , all in a state of heighted behavioral arousal . other studies have been conducted with the dam anesthetized and the pup 's behavior thus isolated for analysis . thus , it is known that olfactory cues present on the rat mother 's nipples and ventrum are necessary and sufficient for newborn pups to locate and orally apprehend a nipple to suck . these odor cues can be removed by washing the nipples and surrounding body surfaces that eliminates suckling [ 14 , 15 ] . nipple attachment and suckling by newborns can be reinstated , however , by painting onto the dam 's ventrum a distillate of the wash taken from the dam 's body or by painting nipples with amniotic fluid or maternal saliva . other substances , both natural and atypical were tried , but no others were effective in reinstating nipple attachment . knowledge that amniotic fluid is a sufficient stimulus to elicit the newborn 's first nipple attachment led to preliminary considerations of two , mutually exclusive possibilities . one was that the key olfactory stimulus is somehow predetermined and that the newborn is correspondingly and inherently prepared ( hard - wired the second possibility was that the perinate responds with nipple attachment and sucking to the amniotic odor stimulus because of its previous experience with amniotic fluid . they reasoned that if amniotic fluid is a behaviorally potent stimulus because the fetus experienced it previously , then if some other odor was similarly experienced , it should have the same behavioral potency as amniotic fluid . they tested this bold hypothesis by adding a novel , lemon - like substance to the amniotic fluid , and then testing whether this chemical would rescue the newborn 's ability to make its first attachment to the washed nipples of a mother rat . the previously validated experimental procedure involved externalizing the uterine horns of a gestational day ( gd ) 20 dam and injecting a small quantity ( 0.2 ml ) of a citral and saline solution through the transparent wall of the uterus into the amniotic fluid . the uteri were replaced in the dam 's peritoneum , the laparotomy incision was closed , and gestation was completed without complications . then , on gd 22 , pups were delivered by caesarean section and placed immediately for one hr in a warmed nest where they were stroked with a soft artist 's brush for 1 hr in the presence of the citral odor . the test procedure involved presenting the caesarean - delivered pups with an anesthetized parturient rat dam ( not the subject pups ' mother ) . if the dam 's nipples were washed , pups did not attach to nipples , but when citral was on the dam , the treated newborns attached to a nipple and sucked ! natural odors of an unwashed dam were not effective for the citral - treated perinates . the new odor had replaced the natural stimulus . they performed an additional experiment in which pups were exposed to citral ( a ) in utero , ( b ) immediately after birth with stroking , or ( c ) both in utero and with postnatal stroking . only pups with the combined experiences attached to the washed , citral - scented nipples and not to the unwashed , normal nipples . pedersen and blass ' study provided important new insights into the initial plasticity of the newborn rats ' sucking , especially the specification of the cues that can activate and direct the behavior . it seems clear that the establishment of the olfactory control of sucking is determined by the experiences of the perinatal rat pup . but , what are the essential experiences for establishing the newborn 's sucking responses to maternal cues ? we adapted elements of our previous investigations of the perinatal rats ' sensory experiences in the uterine environment and of the birth process [ 12 , 1820 ] to demonstrate that specific components of maternal stimulation are sufficient conditions for the odor learning that establishes the newborn 's sucking responses to maternal cues . the present paper is a review of some of this past research as well as a report of additional , previously unpublished data that , together , provide a new view of how the experience of being born creates a context for learning . that is , embedded in flow of events that constitute the birth process are forms and levels of stimulation that , together , create the contingencies for early , rapid learning in the fetus , as it becomes a newborn . we will show that this learning , though general in initial form , is expressed in the natural context of the mother 's body as organized , adaptive , seemingly goal - directed behavior . we will first review an analysis of rat maternal behavior during labor and delivery from which we derived a set of novel tools that enabled us to simulate the major components of vaginal birth . we will also review some of our evidence that fetal and neonatal rats ( perinates ) have sensory capabilities sufficient to experience the birth process , at least the elements that are needed for basic associative learning . then , we will present data showing that the perinates ' responses to simulations of the birth process ( a ) augment nipple attachment and sucking , ( b ) establish odor - guided responses to the mother , and ( c ) induce neural conditions that mediate state transitions between fetal and neonatal behavioral systems which can account for the activation and expression of the newborn 's initial sucking behavior . under laboratory conditions , norway rats typically give birth on the 22nd day of gestation ; by breeding our animals on a known day , we were able to be present with appropriate video arrangements to view and record the dams ' labor and delivery . from these videorecordings , we quantified an average of 144.6 labor contractions during the six hours prior to the birth of the first pup from eight dams . figure 1 illustrates the three types of visible labor contractions in rat dams and shows the average frequency of each during the 6 hrs of labor . behavioral expressions of labor in the rat progress from uterine peristalsis to lordosis contractions followed by vertical contractions that occur in close association with birth of each pup . the brisk , linear decline in intercontraction intervals shown in figure 2 indicates how the contractions quicken as parturition approaches . from our systematic observations , we are able to describe the labor and delivery in the rat . duration of the delivery phase of parturition ( first to last birth ) ranged from 40 to 136 min , with dams delivering and average of 10.1 ( 1.1 ) pups . delivery duration and litter size were positively related ( r = .73 , p < as each pup begins to emerge from the birth canal , the dam typically adopts a head - between - heels posture , which facilitates delivery by enabling the mother to use her teeth to grasp the newborn and extract it from the vagina . mothers lick and handle each pup , removing and consuming the embryonic membranes , activities that produce cutaneous stimulation and augmented evaporative cooling of the newborn 's body . dams provided about 2 min of continuous stimulation to each newborn while participating in its delivery . each pup also received bursts of vestibular stimulation as the dam rotated its body while systematically consuming the products of gestation . during the initial phases of intense tactile and vestibular stimulation , as birth membranes were removed , especially from the head , pups began to emit the robust gasps that are characteristic of the onset of independent respiration , and thereafter they displayed gross movements and audible vocalizations . after the immediate postpartum licking and handling of each newborn , the dam often refocused her attention on previous newborns , providing each one with about 2.5 min of additional licking and handling . overall , licking by the dams was distributed relatively evenly across the pups ' bodies : head ( 39% ) , body ( 24% ) , anogenital area ( 32% ) , ( see for additional details ) . such observations help to specify events to which the newborn rat is exposed during birth . each pup received a protracted bout of repetitive tactile and vestibular stimulation associated with the dam 's handling and licking . during parturition , offspring are exposed to seemingly harsh forms of stimulation related to cooling and with compressions under the weight of the dam 's body . after systematically describing and analyzing the kinds and amounts of stimulation sustained by rat fetuses as they were being delivered vaginally , we endeavored to assess quantitatively some of the most prominent forms of stimulation . among the forms of birth stimuli that we analyzed were uterine compressions , cooling and rewarming , and maternal licking . from these analyses , we created a set of procedures and tools to mimic the biological stimuli that represent the physical bases of the pups ' experience of being born . uterine contractions , for example , were measured by surgically removing a single fetus from one of the paired uterine horns of a g18 rat installing a small balloon in its place in utero . the balloon was connected to a thin polyethylene tube that ran subcutaneously to the dam 's back and was externalized at the nape of the neck . the tubing could be connected to a pressure transducer with which we measured the forces exerted on the fetuses by the mother 's behavior and by uterine contractions . the dams ' contractions ranged from 2 to 30 mm hg . by attaching an inflated balloon to a small , spring - based calibrated scale , we could apply with the balloon surface a reliable force of 15 mm hg to a single fetal rat or to a newborn ( see figure 3 ) . in this way , we established a protocol for simulating a vaginal birth for rat fetuses : 15 , 20 sec - long compressions delivered at a rate of 1 per min , cooling ( 22c ) , stroking with a soft brush ( 2 min ) , and rewarming ( 33c ) . several of our analyses have focused on the how the birth process , beginning with the mother 's labor contractions , helps organize the fetal - to - neonatal transition . breathing and suckling are two vital behavioral adaptations of the newborn . in one set of studies , we applied our tools to study the components of birth that are important in the onset of pulmonary respiration , perhaps the most essential and immediate requirement of the newborn . the respiratory movements present in utero are episodic and unrelated to gas exchange [ 22 , 23 ] . at birth , however , breathing becomes continuous and regulated to meet the newborn 's oxygen requirements . we found that compressions simulating uterine contractions were necessary for initiating breathing in late gestation rat fetuses . the effectiveness of simulated labor contractions could arise from some mechanical ( nonsensory ) effect of the compression , or cutaneous ( sensory ) effects on the offspring . in a study of gentle stroking of cesarean delivered pups ( without simulated labor contractions ) , only 25% nonstroked pups survived for 1 hr postpartum compared to 100% stroked pups supporting a role for sensory stimulation . these observations fit well with reports of adaptive neuroendocrine changes and neurobehavioral advantages in neonates , both term and preterm , exposed to tactile and kinesthetic stimulation [ 25 , 26 ] . paradigm to examine more complex behavioral patterns in newborn rats in a study of how suckling becomes established . fetal rats were either exposed to labor contractions or not then cesarean delivered as described earlier , except that we manipulated postpartum ambient temperature using one of three biologically relevant temperatures . newborns were exposed to the cool room - temperature environment ( 22c ) or to a warmer temperature maintained at nest ( 33c ) or intrauterine ( 36c ) temperature . after 1 hr postpartum exposure to one of the three temperature regimens , pups from all groups were placed at nest temperature then tested for nipple attachment . the 22c condition contained the sequence of thermal exposures experienced by a vaginally born rat pup under typical thermal conditions . the treatment regime , then , was designed to represent the sequence and duration of stimulation that normally occurs prior to and immediately after vaginal birth , leading to the onset of suckling . at 2 hr postpartum , we found that 90% of vaginally delivered pups attached to a nipple ( table 1 ) . the most dramatic effects of prenatal compression were seen between pups that experienced thermal conditions similar to those of normal , vaginally delivered pups ( i.e. , the room temperature condition ) , whereas thermal effects were most evident in pups exposed to atypically warm temperatures ( i.e. , the intrauterine temperature condition ) . these studies link the major postnatal milestones of pulmonary ventilation and suckling to birth experience . we sought to determine the mechanisms underlying the effectiveness of birth stimuli in facilitating the fetus - to - newborn transition . human babies show a surge of plasma catecholamines associated with the stress of being born , a physiological response to labor and squeezing through the birth canal [ 27 , 28 ] . vaginally delivered infants show exhibit both enhanced respiratory performance and increased alertness compared to cesarean - delivered infants whose mothers did not undergo full labor [ 2931 ] . catecholamine concentrations are higher in vaginally delivered human infants as compared to cesarean - delivered infants . we analyzed plasma catecholamines at 0 to 2 hr - old following either : ( a ) vaginal birth , ( b ) cesarean section with simulated labor contractions , or ( c ) cesarean section without labor contractions ( mimicking planned cesarean delivery ) . pups were exposed to the major elements of the rat 's natural birth process , as we have described ( i.e. , umbilical cord occlusion , tactile stimulation and cooling ) . only pups exposed to actual or simulated labor showed an immediate and profound rise in norepinephrine and epinephrine , to levels up to 35% greater than those of noncompressed pups . our results , the first reported in the perinatal rat , closely parallel those reported in human studies and studies using the precocial sheep model [ 27 , 33 ] . labor contractions do more than move the fetus through the birth canal . whether by design ( natural selection ) or by incidental effect , contractions provide a form of stimulation that serves to facilitate two neonatal achievements : pulmonary respiration and suckling . birth stimuli , that is , the range , levels , and patterns of stimulation that comprise the birth process , might have multiple roles in the successful transition from fetal to postnatal life . our simulated birth model incorporates actual forms and levels of sensory and physiological stimuli to which the rat is exposed during natural vaginal birth and allows us to specifically parcel out the effects of labor on postpartum functions . the experience of labor is associated with a number of positive neonatal outcomes , including lung compliance , respiratory integrity [ 3537 ] , blood flow , resistance to oxidative stress , neonatal neurological condition , and complex global eeg patterns . human infants are particularly responsive to odors emanating from their mother 's nipple / areola region and can identify the nipple by smell [ 42 , 43 ] . amniotic fluid and breast odors are regulators of infant sucking behavior , comfort , and distress reactions [ 4446 ] . learning about natural breast odors is enhanced in neonates that experience labor contractions , possibly mediated by ne . together with the results reported herein , these studies support the view that prenatal events associated with labor initiate a cascade of neural , physiological and behavioral changes that assist the neonate 's successful transition to postnatal life events that assist the newborn infant 's adaptation to the extrauterine world . we now describe an original experiment conducted in our laboratory by abel in which individual , externalized , near - term rat fetuses received a combination of the simulated birth stimuli described earlier ( see figure 3 ) while in the presence of the odor citral and then tested for their responses to a rat dam with natural odors , washed of natural odors and with citral added . specifically , while still residing in their amniotic sac and uterine horn that had been gently brought outside the dam 's abdomen , each pup received a series of simulated labor contractions . pups were next removed from the uterus , at which time there occurred a bout of tactile stimulation associated with removal of the birth membranes . following this birth , each pup was stroked with a soft brush , mimicking the normal maternal licking and it also experienced cooling as it would after a natural birth and then rewarming as it would , had it been brought into the nest for maternal brooding . in effect , we created a simulated birth sequence . one set of pups experienced their birth in the presence of citral that was injected into the amniotic fluid prior to the intrauterine compressions and that was in the air around the pup while it was stroked and cooled and rewarmed . alternatively , saline was used instead of an odorant for the littermate control subjects , that otherwise experienced the same birth sequence . the goal was to test the hypothesis that an arbitrary odor , paired with the experience of birth stimuli , would become a conditioned odor capable of evoking nipple attachment behavior from a newborn . our regime of stimulation was a controlled , 135 min analog of pedersen and blass ' 50-hr - long process used to induce a newborn rat 's nipple attachment to novel odor . in contrast to their approach , we were able to specify and control the kinds , quantities , and timing of a specific stimulation sequence , and to observe the perinate at each stage of experimental manipulation . we predicted that a perinatal sequence of experiences in association with an otherwise neutral olfactory cue would lead to rates of nipple attachment to that cue , similar to those of vaginally delivered newborn rat pups to the odor of amniotic fluid . if the outcome of the simulated birth experience was equivalent to a natural delivery , we would consider this a successful empirical demonstration of sufficiency . we will have demonstrated that the experience of a simulated birth , quantitatively comparable to a natural , vaginal birth , is sufficient to establish a conditioned response to an odor that is expressed as nipple attachment and the onset of sucking in an , otherwise , nave newborn . animal experimentation was conducted in accordance with the guidelines of the indiana university institutional animal care and use committee and the nrc guide for the care and use of laboratory animals ( copyright 1996 , national academy of science ) . one hundred twenty - six fetal rats , derived from 24 , time - mated sprague - dawley rat dams ( rattus norvegicus ) were used as subjects . all breeding and maintenance was conducted in the animal behavior laboratory at indiana university . the first day that sperm was detected in a vaginal lavage was recorded as the day of conception ( gestational day [ g]0 ) , with birth expected on g22 . on g21 , pregnant dams were briefly anesthetized with isoflurane ( aerrane , ohmed ppd inc . , an area overlying the lumbar region was shaved and a small ( 3 cm ) dermal incision exposed the vertebral column . to eliminate movement and sensation below the ribcage , 100% ethyl alcohol ( 0.1 ml ) was administered via intrathecal injection between the t12 and l1 vertebrae . after confirming loss of sensation , the female was placed in a plexiglas holding apparatus and her lower body immersed into a heated ( 37.5c 5c ) saline bath . a midline laparotomy was performed and the dams ' paired uterine horns were gently externalized into the bath . figure 4 depicts the prenatal and postnatal manipulations . for each dam , either citral ( sigma chemical co. , st . louis , 50 l in 4 ml / l isotonic saline ) or vehicle alone was injected into the amniotic fluid surrounding target fetuses . beginning with the fetus in the second ovarian position , amniotic sacs of three - to - four adjacent fetuses were injected . a 30 ga hypodermic needle was inserted through the transparent uterine wall and into the amniotic sac near each fetus ' snout . immediately following either citral or saline injections , compressions of 1015 mm hg pressure were administered to fetuses in one uterine horn using a small latex balloon . such pressures are within the range of pressures typically experienced by rat fetuses during labor contractions [ 4951 ] . compressions were delivered at the rate of one , 15 sec compression per min for 15 min . upon completion of the compressions , fetuses were removed individually from the uterus and delivered onto gauze pads moistened with either citral ( 1 ml of 4 ml citral / l isotonic saline ) or isotonic saline - moistened ( 1 ml ) gauze pads ( figure 4 ) . immediately following delivery from the uterus , two cotton - tipped swabs were used to remove the birth membranes from the newborns , umbilical cords tied with surgical silk , and placentas removed . each neonate was stroked with a soft - bristled artist 's brush until respiratory activity was established ( approximately 2 - 3 min per litter ) . next , the newborns experienced temperature fluxes similar to those observed after a natural birth sequence in the laboratory . they were placed onto saline - moistened gauze pads in individual glass dishes ( pyrex 80 40 ) at room temperature ( 22c 0.5c ) for 60 min , then moved to an incubator maintained at nest temperature ( 33c 1c ) for an additional 60 min . at 60 min postpartum , pups that had received pre- and postnatal exposure to citral were placed individually in glass dishes on citral - moistened gauze pads ( 1 ml citral solution / pad ) . these pups remained in the warm citral ambience for 5 min then transferred back to the original dishes containing saline pads in a noncitral incubator for the remainder of the second postnatal hr . pups in both conditions were handled identically throughout the experiment except for the presence of citral . to ensure olfactory isolation , care was taken to maintain separate citral and noncitral incubators during the postnatal exposure and testing periods . physical stimulation in the form of compression or stroking is necessary for the establishment of respiration in newborn rat pups [ 19 , 20 ] . in the present experiments , postnatal stroking was required to elicit respiratory activity in the noncompressed subjects ; equivalent durations of stroking were provided to all groups . to verify that alterations in frequency of suckling onset between compressed and noncompressed newborns were not related to deficits in respiration , respiratory movements were sampled ( 1 min ) at 3 postpartum time points : 10 min postpartum ; 1 hr postpartum ( while at 22c ) ; 2 hr postpartum ( while at 33c ) . approximately 20 min prior to testing nipple attachment , a recently parturient ( 1 - 2 day postpartum ) dam was anesthetized with a ketamine / xylazine mix ( ip ; 100 mg / ml ; 0.9 ml / kg , 20 mg / ml ; 0.5 ml / kg ) and placed within a 33c test incubator in the supine position . at 120 min post - delivery , each pup was gently grasped and held for up to 120 sec with its snout in contact with a nipple of the test dam . successful attachment to a nipple was verified visually and then by testing if the pup maintained oral grasp of the nipple while gently retracted from the dam . following the first attachment trial , the dam was moved to a second heated ( 33c ) incubator and citral - scented gauze pads ( 5 pads ; 1 ml citral solution / pad ) were rubbed across the ventrum , thus infusing the fur with citral odor . the scented pads were then placed alongside the dam , further contributing to the citral odor within the incubator . then , to further verify the effectiveness of perinatal exposure to citral in promoting nipple attachment to a citral - scented dam , one group of compressed but citral - nave newborns was tested first on a citral - scented dam and then on a normal dam . mcnemar chi - square for dependent measures was used to analyze frequency of nipple attachment . posthoc comparisons were made with newman - keuls with a cutoff of p < 0.05 . the nipple attachment test used in the present experiment reveals robust and reliable behavior in newborn rats . the leftmost histogram bar in figure 5 shows that 90% of the vaginally - delivered newborns held before the ventrum of a natural ( unwashed ) anesthetized dam attached to a nipple and suckled . note that this was the first attachment for each pup . thus , this testing method enables rapid and reliable expression of the onset of postnatal ingestion , and the 90% attachment rate following vaginal birth can be used as standard against which we can evaluate the results of the simulated birth experiences . newborn pups that experienced a simulated vaginal birth in the presence of natural amniotic odors , including the regime of in utero compressions caesarean delivery membrane stripping cooling stroking rewarming ( see figure 3 ) attached to a nipple in 89% of the tests , as shown by the first hatched bar in figure 5 . the legend under that bar , amniotic fluid / natural , indicates that these pups experienced unadulterated amniotic fluid odors and were with a natural , unwashed dam . newborns that experienced the a simulated vaginal birth absent compressions in the presence of natural amniotic odors , attached in only about 44% of the trials , which was a significant decrement in relation to littermates treated identically but with the compressions . the contrasting result is seen in the open bar next to the hatched bar in figure 5 . thus , the complete simulated birth sequence ( including compressions ) , produced rates of nipple attachment in newborns that were fully comparable to those in vaginally delivered pups . newborn pups that experienced a simulated vaginal birth in the presence of citral in their amniotic fluid and in the atmosphere during stroking ( figure 4 ) attached to a nipple in 89% of the tests with a citral - scented dam , as shown by the stippled bar in figure 5 . newborns that experienced the simulated vaginal birth absent compressions in the presence of natural amniotic odors , attached in only about 20% of the trials with the citral - scented dam , a significant decrement in relation to littermates treated identically but with compressions . the open bar , adjacent to the stippled bar in figure 5 , shows the contrasting outcome . thus , the simulated birth sequence in the presence of citral , including compressions , produced rates of nipple attachment to a citral - scented dam that were fully comparable to those seen in vaginally - delivered pups and to pups that experienced the full simulated birth in the presence of amniotic odors when tested with a correspondingly natural - scented dam . the rightmost pair of histograms show that newborns that experienced simulated birth stimuli in the presence of citral in their amniotic fluid and in the atmosphere during stroking ( figure 4 ) when tested with a natural scent dam ( no citral during the test ) attached to a nipple in only 20% and 4% of the trials , for the compressed and noncompressed subjects . clearly , newborns that experienced birth in a citral environment were not prepared to attach to nipples on the body of a dam with only the natural scent of the species . but , we know that these newborns are capable of attaching to a nipple , as evidenced by the performance of the simulated birth group depicted by the stippled bar . for the citral - birthed pups , citral had become a necessary stimulus for the initial attachment . respiratory rates at the three , sampled time - points ( 10 , 60 , and 120 min ) were unaffected by either citral or compression ( p > .10 ) . as expected , however , there was a significant increase in respiration within all groups during the final hour at the warmer temperature ( f(2,120 ) = 320.8 , p < .01 ) . the absence of in utero compressions of the fetus was associated with poor performance in the onset of nipple attachment . it might be tempting to conclude that compressions mimicking labor contractions are necessary for efficient initiation of nipple attachment in the newborn , but the present experiment was not designed to allow such a conclusion . although we categorized each operation as a separate form of stimulation , the perinate might be less discriminating in its responsiveness and all forms of stimulation might simply be additive and incrementally increase the level of arousal in the pup . thus , compressions might just add to the experience of general stimulation in the pup and nipple attachment rates might reflect levels of general arousal . even if true , such an effect would not account for the second broad finding , that odors paired with birth stimuli become conditioned stimuli for nipple attachment . the experience of a vaginal birth , real or simulated , appears to give behavioral meaning to the odors experienced in association with the birth stimuli . schaal and colleagues have suggested that amniotic odors provide a bridge from the fetus ' prenatal world to its postnatal environment , and the present results suggest that this bridge is constructed by the experiences embedded in parturition and that they result in a newborn behavior that has been rapidly assembled to follow the bridge to a nipple and the onset of suckling . stimulation associated with labor and delivery plays a key role in assisting the fetus ' transition to postnatal life by inducing and canalizing specific behaviors , and thereby operating as a critical link in the chain of behavioral adjustments required for adaptation to the postnatal habitat . fetal sensory experience appears to set into motion physiological processes that permit the onset of postpartum behavior and the expression of early learning . it makes sense , both logically and scientifically , to discard the idea that suckling is an innate or instinctive or hard - wired behavior in a newborn baby . nevertheless , it is also sensible to revel in the readiness and competence of a newborn mammal to adjust immediately to severance of its umbilical connection to the uterine world and to make an oral connection to the mother 's body and begin suckling . we recognized the ability of a newborn mammal to suckle by designating it as a congenital behavior , that is , present at birth . clearly , suckling is an important congenital behavior worth understanding for it is one of the primary adaptations to newborn life for all infant mammals , serving not only nutritive , immunological , and general physiological functions , but it is also a powerful component of bonding with the mother and creating a social context which supports sensory , motor , and cognitive development . much of what we explored in the present paper are lines of research that have been important in demystifying the kinds of basic processes that can explain the newborn 's congenital abilities to orient to novel features on the mother 's body surface and to initiate the complex , but vital behavior of suckling . from the findings that we reviewed , it can be concluded that the combination of sensory and motor processes that constitute successful suckling are rapidly assembled during the course of perinatal events . we focused on the roles of birth stimuli and specifically on the experience of being born . in the experiments we described , rat pups that did not experience the mechanical and thermal forces associated with vaginal birth failed to make the fetus - to - newborn transition . moreover , by providing individual perinates with a simulated birth experience , it was possible to induce in them the dramatic developmental changes that serve the transition from fetus to newborn . there is now abundant evidence that learning is an important component of the birth transition in rats and in humans . thus , this perinatal learning takes place in the context of the experience of being born . it appears that the set of sensory , endocrine , and neural events that comprise the physiological transition of birth also serve as factors in the perinate 's learning about the odor cues that are present in utero and carry over into the ex utero world . these are the same cues that the newborn then uses to orient to the mother 's body and that stimulate nipple attachment and suckling . we are impressed by the multi - leveled functions of sensory and physiological events of birth , but much more remains to be understood about them and how they operate during parturition . here , we can speculate on some of the implications we see when considering the experimental findings from rats in the context of human births and the onset of suckling . as students of mammalian development , indeed , our past initial analyses of rat parturition ( e.g. , [ 12 , 19 , 20 , 34 , 51 ] ) were shaped by lagercrantz and slotkin 's perspective on the stress of human vaginal birth . the results of our experiments with rats resemble their observations with human birth , and we have been able to take advantage of opportunities to control and manipulate the birth stimuli to gain insights into the embedded and embodied learning processes . we are particularly struck by the contrasting picture presented by prematurely - born infants who enter the postnatal world at a stage of development when their sensorimotor function is not yet prepared for suckling . while it may be beautiful and exciting to witness the eventual onset of sucking in a baby born at less than 30 weeks of age , it is sobering to contemplate the dramatically different factors and unnatural schedule of experiences that direct the prematurely - born baby to suck : a premie 's early postnatal development may be supported by intravenous nutrition and then gastric intubation until the baby presents signs of readiness for oral feeding . nurses , therapists and parents may then use a variety of techniques to gently and gradually facilitate the transition to sucking and ingestion . how different it is for the baby born at term , for whom the process is short , and in many regards , even intense and abrupt . we see great potential in understanding the necessary and sufficient developmental steps as precursors to improved management and guidance of early ingestion . other researchers have compared the development of feeding skills of term babies and prematurely born infants . schaal and colleagues ( cf . , ) , for example , have focused on the absence of pairings of chemosensory cues and nutritive intake when babies are fed by gavage . their perspective extends to many aspects of experience that normally contribute to the integration of breathing , suckling , and swallowing . recognition of such differences may be an important step towards identifying factors that contribute to the problems experienced by some babies and that lead to the higher incidence of feeding disorders in children born prematurely ( cf . , ) .

understanding the developmental origins of congenital capabilities such as sucking is fundamental knowledge that can contribute to improving the clinical management of early feeding and facilitate the onset of oral ingestion . we describe analyses in rats showing that sensory stimulation in utero and during birth establishes the newborn 's sucking responses to maternal cues . we mimicked elements of labor and delivery ( viz . , compressions simulating labor contractions , stroking simulating postnatal maternal licking of the newborn , and postnatal thermal flux ) , and used them to induce postnatal respiration and nipple attachment in caesarian - delivered pups . we report herein new data showing that , by simulating a fetal rat 's experience of being born , specific components of vaginal birth provide sufficient conditions for the odor learning that guides newborn 's sucking responses . in contrast , the absence of in utero compressions was associated with poor sucking onset . knowing how birth stimuli contribute to the first nipple attachment and constitute a context for learning to suckle is an important step toward better management of some early feeding problems . it can serve also as a foundation for understanding the challenges of facilitating sucking by babies born prematurely so that they do not experience the typical contingencies mediating onset of oral ingestion .

1. Introduction 2. Methods 3. Results and Discussion 4. Conclusions and Reflections

randomized study in management of olp patients was planned and conducted during the period of september 2012 to july 2013 in the department of oral medicine and radiology , rajah muthiah dental college and hospital , annamalai university , to compare the effectiveness with topical triamcinolone acetonide 0.1% , clobetasol propionate 0.05% , and tacrolimus in orabase 0.03% . a formal ethical clearance to conduct this study was obtained from the ethical clearance committee of the college . the patients for the study were selected among the outpatients who visited the department of oral medicine and maxillofacial radiology . a total of 30 subjects were randomized using randomization chart and divided into three groups . group i -10 patients with clinically and histologically confirmed olp subjects were recruited to receive topical triamcinolone acetonide 0.1% for 6 weeksgroup ii -10 patients with clinically and histologically confirmed olpsubjects were recruited to receive topical clobetasol propionate 0.05% for 6 weeksgroup iii -10 patients with clinically and histologically confirmed olp subjects were recruited to receive topical tacrolimus 0.03% for 6 weeks . group i -10 patients with clinically and histologically confirmed olp subjects were recruited to receive topical triamcinolone acetonide 0.1% for 6 weeks group ii -10 patients with clinically and histologically confirmed olpsubjects were recruited to receive topical clobetasol propionate 0.05% for 6 weeks group iii -10 patients with clinically and histologically confirmed olp subjects were recruited to receive topical tacrolimus 0.03% for 6 weeks . inclusion criteria were clinically symptomatic oral lesions confirmed by histologically to be olp and exclusion criteria were patients who had underwent treatment for olp within 4 weeks before the study , pregnant or nursing women , skin lesions and lesion extending to soft palate , and tonsils are excluded from the study . a detailed case history was recorded for all patients , its nature , duration , and associated with skin lesions are noted . all the patients were subjected to a thorough general physical and oral clinical examination and details were recorded on a standard pro forma . in provisionally diagnosed olp patients , lesion size was measured based on staging given by farzaneh agha - hosseini et al . [ table 1 ] . after establishing the clinical diagnosis , the patients were subjected to routine blood investigations to rule out any systemic ailments . for the histopathological confirmation of the subjects with olp , all the three groups were instructed to apply the topical ointments on the lesional site . topical agent is applied 4 times a day for 6 weeks and subjects were checked at 1 , 3 , and 6 week for the remission lesion . statistical analysis of the data was carried out with spss for windows 9.0 software ( spss , inc . , staging system for lichen planus lesion size after the end of 1 week , group a and c ( triamcinolone 0.1% and tacrolimus 0.03% ) show no changes , whereas in the group b ( clobetasol 0.05% ) , three subjects with white striae with erosion > 1 cm is reduced to white striae with erosion < 1 cm . in all the three group a , b , and c , there are 10 subjects . of 10 patients , 7 subjects in each group are in stage 1 ( white striae only ) and 3 patients are in stage 3 ( white striae with erosion more than 1 cm ) . after the end of 3 weeks in group a ( triamcinolone 0.1% ) , 1 subject shows no lesion . in group b ( clobetasol 0.05% ) , 7 subjects show no lesion and three subjects show white striae only . in group c ( tacrolimus 0.03% ) , 1 subject from white striae with erosion > 1 cm is reduced to white striae with erosion < 1 cm . at the end of 6 weeks in group a ( triamcinolone 0.1% ) , 7 subjects show no lesion and 3 patients show white striae only . in group b ( clobetasol 0.05% ) , all the 10 subjects show no lesion . in group c ( tacrolimus 0.03% ) , 3 subjects show no lesion , 5 subjects show white striae only , and 2 patients show no improvement ( white striae with erosion more than 1 cm ) . there is a significant difference in all the three groups in the 3 and 6 week . as there is evident of significant difference in all three groups in the 3 and 6 week , we carried out mann whitney tests on each pair of groups and used the bonferroni correction ( that is , significance level / number of pairwise tests ) to compare the p value . we used 5% level of significance for three treatments , hence compared the p value for each mann whitney test with 0.05/3 = 0.017 . if the significance value is less than the 0.017 , then we infer the treatments have the difference . after the end of 1 week , group a and c ( triamcinolone 0.1% and tacrolimus 0.03% ) show no changes , whereas in the group b ( clobetasol 0.05% ) , three subjects with white striae with erosion > 1 cm is reduced to white striae with erosion < 1 cm . in all the three group a , b , and c , there are 10 subjects . of 10 patients , 7 subjects in each group are in stage 1 ( white striae only ) and 3 patients are in stage 3 ( white striae with erosion more than 1 cm ) . after the end of 3 weeks in group a ( triamcinolone 0.1% ) , 1 subject shows no lesion . in group b ( clobetasol 0.05% ) , 7 subjects show no lesion and three subjects show white striae only . in group c ( tacrolimus 0.03% ) , 1 subject from white striae with erosion > 1 cm is reduced to white striae with erosion < 1 cm . at the end of 6 weeks in group a ( triamcinolone 0.1% ) , 7 subjects show no lesion and 3 patients show white striae only . in group b ( clobetasol 0.05% ) , all the 10 subjects show no lesion . in group c ( tacrolimus 0.03% ) , 3 subjects show no lesion , 5 subjects show white striae only , and 2 patients show no improvement ( white striae with erosion more than 1 cm ) . there is a significant difference in all the three groups in the 3 and 6 week . as there is evident of significant difference in all three groups in the 3 and 6 week , we carried out mann whitney tests on each pair of groups and used the bonferroni correction ( that is , significance level / number of pairwise tests ) to compare the p value . we used 5% level of significance for three treatments , hence compared the p value for each mann whitney test with 0.05/3 = 0.017 . if the significance value is less than the 0.017 , then we infer the treatments have the difference . olp is a t - cell - mediated chronic inflammatory oral mucosal disease of unknown etiology , but it is believed to result from an abnormal t - cell - mediated immune response in which basal epithelial cells are recognized as foreign because of changes in the antigenicity of their cell surface . it is a relatively common disorder that is estimated to affect 0.52.0% of the general population . olp affects primarily middle - aged adults , and the prevalence is greater among women . in this study , we included patients in the age range of 1865 years . age distribution table [ table 2 ] shows that the maximum percentage of patients included in the study falls in the range of 3050 years and the mean age of patients in the group is 39.77 years . our results are consistent with the another study who reported the typical age of presentation is between 30 and 60 years , but its occurrence in younger people and children is not uncommon . this study shows that the incidence was higher in females ( 60% ) when compared to males ( 40% ) . similar observations were found in some of the previous studies found that in a study of 30 olp patients , 56.7% were females and 43.3% were males [ table 3 ] . probable reason for the increased incidence of olp in females may be due to greater psychological stress as a consequence of activities of hormones . frequency distribution table for gender olp exists in many clinical forms . however , in the present study , only two clinical forms could be recorded : reticular and erosive . in the current study , the incidence of reticular form of olp is more frequent ( 21 out of 30 patients ) , followed by erosive olp ( 9 out of 30 patients ) . the lesion size was also reduced in the clobetasol propionate ( mean rank of 9.0 ) when compared with triamcinolone acetonide 0.1% ( mean rank of 12.0 ) . this was proved another study that clobetasol propionate compared with triamcinolone acetonide provides a more immediate clinical response [ table 4 ] . the lesion size was also reduced in the triamcinolone acetonide 0.1% ( mean rank of 8.20 ) when compared with tacrolimus 0.03% at the end of 6 weeks ( mean rank of 12.80 ) [ tables 57 ] . this is in contrast to the study who found tacrolimus 0.1% ointment induced a better initial therapeutic response than the triamcinolone acetonide 0.1% . this can be because the concentration of tacrolimus ( 0.1% ) they used is more than that of our study which is 0.03% . the lesion size was also reduced in the clobetasol propionate ( mean rank of 7.0 ) when compared with tacrolimus 0.03% ( mean rank of 14.0 ) at the end of 6 week [ table 8 ] . this was supported by another study done who reported that clobetasol propionate 0.05% ointment was found to be more useful than tacrolimus 0.1% in the treatment of olp . this is in contrast to the study done by who found tacrolimus to be as useful as clobetasol in the treatment of olp . treatment progression ( lesional ) after the end of 1 week treatment progression ( lesional ) after the end of 3 week treatment progression after the end of 6 week comparing all three groups a , b , and c test statistics for groups b and c the other study evaluated the effect of different formulation of clobetasol with other corticosteroids in the treatment of olp and emphasized that clobetasol had better effects . as there were few studies done to compare the effectiveness of corticosteroids with tacrolimus in the treatment of olp , this study was undertaken . in this study , we infer that clobetasol propionate 0.05% is useful in effectively reducing the lesion size at the end of 6 weeks in olp subjects , and also that clobetasol propionate 0.05% has got the better therapeutic effect when compared with triamcinolone acetonide 0.1% and tacrolimus ointment 0.03% [ tables 9 and 10 ] . however , for increasing the strength of the study , a detailed blinded , randomized trial with a large sample size could be pursued . it is concluded that clobetasol propionate 0.05% ointment has higher efficacy when compared to triamcinolone acetonide 0.1% ointment and tacrolimus ointment 0.03% in the management of olp .

background : oral lichen planus ( olp ) is believed to result from an abnormal t - cell mediated immune response . the most useful agent in the treatment is corticosteroids . the present study will be aimed at evaluation of therapeutic efficiency of two corticosteroids triamcinolone acetonate ( 0.1% ) and clobetasol propionate with tacrolimus orabase ( 0.03% ) , an immunomodulator in the management of olp.aim:to compare the effectiveness of topical triamcinolone acetonate ( 0.1% ) , clobetasol propionate ( 0.05% ) , and tacrolimus orabase ( 0.03% ) in the management of olp and also to compare which has less recurrence.study design : the study comprises 30 patients , all were diagnosed with olp clinically and histopathologically . they are randomly divided into three groups : group a - triamcinolone acetonate ( 0.1% ) , group b - clobetasol propionate ( 0.05% ) , and group c - tacrolimus ( 0.03% ) . a formal informed consent was obtained from all of them who participated in the study.results and conclusion : subjects in the group a ( triamcinolone 0.1% ) and group b ( clobetasol 0.05% ) show a significant reduction in lesion size than that of group c ( tacrolimus 0.03% ) . group b ( clobetasol 0.05% ) shows a better significant reduction in lesion size than that of group a ( triamcinolone 0.1% ) . the overall treatment response was significant better in the group b ( clobetasol 0.05% ) . no recurrence was observed in any of the three groups at the end of 3 months . it is concluded that clobetasol propionate 0.05% ointment has higher efficacy when compared to triamcinolone acetonide 0.1% ointment and tacrolimus ointment 0.03% in the management of olp . it was also inferred that triamcinolone 0.1% has better effects than tacrolimus 0.03% .

Materials and Methods Inference Lesion size Inference 1 Inference 2 Inference 3 Discussion Conclusion Financial support and sponsorship Conflicts of interest

diabetic retinopathy is a leading cause of adult blindness and is the most common complication of diabetes . it affects more than 90% of people with diabetes , ultimately leading to retinal edema , neovascularization , and , in some patients , vision loss [ 1 , 2 ] . systemic control of blood glucose can slow down the progression of diabetic retinopathy but fails to stop or reverse clinical signs of it [ 3 , 4 ] . hence understanding the molecular pathways governing the pathophysiology of dr and targeting them is essential to the prevention of catastrophic visual loss arising from vision - threatening complications of diabetic retinopathy such as macular edema , vitreous hemorrhage , and tractional retinal detachment . melanocortins are endogenous peptides that possess a wide range of biological activities , including inhibition of leukocyte activation , promotion of inflammation resolution , and the ensuing tissue protection [ 512 ] . these effects on the immune response are brought about by five distinct melanocortin receptors , termed from mc1 to mc5 , which are ubiquitously expressed except for the mc2 which is localised to the adrenal glands . within the eye , mc3 , mc4 , and mc5 are expressed in the inner neural retinal layers [ 14 , 15 ] , with mc3 and mc4 expression being reported also in the layer of retinal ganglion cells [ 14 , 15 ] . mc5 alone has been detected in the neural outer plexiform layer , whilst mc1 and mc5 are detected in retinal pigment epithelial cells [ 16 , 17 ] . work is limited to the most common melanocortin peptide , -melanocyte stimulating hormone ( -msh ) , which activates all mc receptors ( except mc2 ) , controls the development and neurotrophism of the ocular tissues [ 1820 ] , and exerts protective effects on the retinal vascular endothelial cells [ 21 , 22 ] . the present study aimed at establishing the efficacy of melanocortin peptides in the prevention of dr and characterizing the mc subtypes engaged . we made use of a mouse model of stz - induced dr , an experimental system suitable for replicating the early signs of nonproliferative dr , such as loss of retinal pericytes and capillaries , thickening of the vascular basement membrane and increased vascular permeability . using a combination of biochemical and functional analyses , streptozotocin was purchased from sigma - aldrich ( city , country ) , mtii from bachem ltd . ( saffron walden , essex , uk ) , and shu9119 from phoenix pharmaceuticals ( karlsruhe , germany ) . other compounds were supplied ( bms-470539 , agrp ) or synthetized ( pg-901 , pg20n ) by professor grieco ( university of naples federico ii ) . all compounds were stored at 20c before use and dissolved in sterile pbs , ph 7.4 . this study was performed according to the guidelines of the ethic committee for animal experiments at the second university of naples . c57bl/6 mice ( harlan , italy ) aged 7 to 10 weeks were rendered diabetic with one intraperitoneal injection of stz ( 65 mg / kg , sigma - aldrich , st . louis , mo , usa ) freshly dissolved in 10 mm citrate buffer ( ph 4.5 ) . development of diabetes ( defined by blood glucose greater than 250 mg / dl ) was verified 1 week after the stz injection ( glucometer elite xl ; bayer corp . , blood glucose levels were checked intermittently throughout the study in order to confirm the maintenance of the diabetic condition . c57bl/6 mice were divided into 8 groups ( n = 10 animals per group ) , labelled consecutively from 1 to 10 to repeat the fluorescein angiography ( fag ) to the same animal at each time point considered . mice were randomised into the following experimental groups : ( 1 ) nondiabetic mice ; ( 2 ) diabetic mice ; ( 3 ) diabetic mice treated with intravitreal injection of the mc1 receptor agonist bms-470539 ; ( 4 ) diabetic mice treated with intravitreal injection of the mixed mc3-mc4 receptor agonist mtii ; ( 5 ) diabetic mice treated with mc1 receptor antagonist agouti related protein ( agrp ; ) ; ( 6 ) diabetic mice treated with intravitreal , mc5 agonist pg-901 ; ( 7 ) diabetic mice treated with intravitreal mc3-mc4 receptor antagonist shu9119 , ; ( 8) diabetic mice treated with intravitreal mc5 receptor antagonist pg20n , . in all cases , animals were monitored over a 16-week period for the development of diabetes , with specific analyses at weeks 8 , 12 , and 16 when fluorescein angiography was conducted . at the end of each time course the animals were sacrificed and the eye ball was displaced forward by placing curved forceps around the posterior part and cut in two halves . on one half of each eye the cornea was cut using a sharp blade or scalpel , and the retina was squeezed through the cut together with residual pigment epithelium and lens by applying gentle pressure with the forceps . dissected retina was placed in cooled pbs , freed from nonretinal tissue using the forceps , and immediately frozen in liquid nitrogen and stored at 80c for subsequent biochemical analysis . the other half of each eye was fixed by immersion in 10% neutral buffered formalin and paraffin - embedded for immunohistochemistry . seven days after the development of diabetes the mice were anesthetized by pentobarbital ( 45 mg / kg in saline ) . tropicamide ( 5% ) was instilled into the right eye of each animal , in order to induce dilatation of pupils , and tetracaine ( 1% ) was injected for local anaesthesia . physiological saline or mc receptor ligand preparations ( 5 l volume ) were administered via intravitreal injection into the right eye using sterile syringes fitted with a 30-gauge needle ( microfine ; becton dickinson ag , meylan , france ) , as previously described . the following mc receptor ligands were used , at the indicated dose as selected from the reported publications : bms-470539 , 33 mol ; mtii , 9.3 nmol ; shu 9119 , 9 nmol ; pg-901 , 7.32 nm ; pg20n , 130 nm ; agouti related protein or agrp , 1 g . fag was performed by using a topcon trc-50dx apparatus ( topcon , tokyo , japan ) following intraperitoneal injection of 10% fluorescein sterile solution ( 1 ml / kg body weight , ak - fluor ; akorn , inc . ) . fundus photographs were captured in order to display the retinal vasculature and to evaluate the early typical alterations of diabetic microangiopathy . a commercial kit ( phoenix pharmaceuticals , inc . , karlsruhe , germany ) was used following the manufacturer protocol in order to assess the levels of the protein within the retina of nondiabetic and diabetic mice with retinopathy . total rna was extracted using rneasy plus mini kit ( qiagen , west sussex , uk ) , according to the manufacturer 's instructions . contaminating dna was removed from rna preparations using the ambion turbo dna - free system ( life technologies , paisley , uk ) using manufacturer 's instructions . the concentration and purity of the rna were then analysed using the nandrop nd-1000 ( nanodrop technologies , wilmington , de ) . complementary dna ( cdna ) was obtained by reverse transcription ( rt ) of 1 g of total dnase - treated rna , using the superscript iii reverse transcriptase system ( invitrogen , carlsbad , ca , usa ) and oligo(dt ) primers following manufacturer 's protocol . conventional pcr was performed for detecting the expression of murine mc1r , mc3r , and mc5r genes using cdna ( 150 ng / reaction ) , specific primers ( quantitect primer assays , qiagen , west sussex , uk ) , and thermo scientific 1.1x reddymix pcr master mix ( life technologies , paisley , uk ) . the following amplification profile was applied : 95c for 2 min ; 35 cycles94c for 30 s , 55c for 35 s , and 72c for 65 s , followed by final elongation step at 72c for 5 min . melanocortin receptor expression was quantified using the predesigned quantitect primers ( abi prism 7900 sequence detection system ; applied biosystems inc . ) and 2x power sybr green mastermix ( applied biosystems , thermo fisher scientific inc . , paisley , uk ) . cycle threshold ( ct ) values were measured and calculated by the sequence detector software . relative amounts of mrna in diabetic retinas were normalized to endogenous control ( gapdh ) and to the healthy controls . western blot was performed on the retinal tissues 16 weeks after the onset of diabetes , monitoring the m2 marker , the mannose receptor cd206 , and the m1 marker , the integrin x / cd11c , according to di filippo et al . . retinal samples were homogenized on ice using ripa buffer ( santa cruz biotechnology , milan , italy ) , containing a protease inhibitor cocktail tablet ( roche diagnostics , mannheim , germany ) . protein concentrations were determined using the bio - rad protein assay ( bio - rad laboratories , milan , italy ) . a total of 100 g of proteins were separated on denaturing 8% sds - page and transferred to pvdf membrane . the following primary antibodies were used : anti - m2 mannose receptor ( cd206 ) ( 1 : 400 , abcam , cambridge , uk ) , anti - m1 integrin alpha x / cd11c ( 1 : 200 , bioss , usa ) . donkey anti - rabbit polyclonal igg ( abcam , cambridge , uk ) and goat anti - mouse polyclonal igg ( santa cruz biotechnology , usa ) secondary antibodies were used at concentration of 1 : 1000 and 1 : 2000 , respectively . a specific kit ( ary006 , r&d systems , abingdon , uk ) was used for the simultaneous measurement of the production of a number of pro- and anti - inflammatory cytokines and chemokines from mouse retinas . to assess the levels of occludin and vascular endothelial growth factor ( vegf ) in the retina of diabetic mice , the quantikine elisa kits ( r&d systems , abington , uk ) were used , according to the manufacturer 's protocol . ocular tissue sections ( 5 m ) were serially cut from paraffin - embedded tissue and labelled for the detection of ki-67 by immunohistochemistry , according to previous published protocol . briefly , sections were incubated with primary mouse monoclonal anti - ki67 ( pp-67 ) antibody ( dilution 1 : 250 , abcam , cambridge , uk ) for 30 min at room temperature . sections were then washed with pbs and incubated with biotin - conjugated goat anti - mouse igg secondary antibodies and avidin - biotin peroxidase complex ( dba , milan , italy ) . for the in vivo experiments , statistical analyses were assessed either by student 's t - test ( when only two groups were compared ) or one - way analyses of variance ( anova ) , followed by dunnett 's post hoc test ( more than two experimental groups ) . intraperitoneal injection of stz ( 65 mg / kg ) to c57bl/6 mice caused an elevation of the glycemia levels , which remained almost constant throughout the duration of the 16-week observation ( table 1 ) . these levels were not affected by drug treatment at any of the time points under investigation . in contrast , the endogenous levels of -msh within the retina were significantly reduced after 16 weeks of diabetes ( nondiabetic , 72 ng / ml 7 ; diabetic , 27 ng / ml 11 ) . fluorescein angiography ( fag ) analysis performed over the 16 weeks of diabetes showed structural changes in the retinal vessels with an increased vascular tortuosity and microvascular changes in 8 of the 10 mice analyzed ( data at week 12 ) . indeed , an irregular retinal vessel caliber and microaneurysms were seen at both time points ( figure 1 ) . no signs of deviation from the normal retina vascularization were seen after 8 weeks of diabetes ( figure 1 ) . next we determined the expression patterns of selected mc receptor expression in the retina of diabetic mice that had developed retinopathy , with a focus on mc1 , mc3 , and mc5 receptors since implicated in the process of inflammation and tissue protection . by conventional pcr we could detect the mc1 and mc5 signals , but not the mc3 ( figure 2 ) . using qpcr , mc1 and mc5 displayed a plastic response to diabetes , with elevated expression being quantified by week 16 ( figure 2 ) . intravitreal injections of the mc1 receptor agonist bms-470539 ( 33 mol ) or mc5 receptor agonist pg-901 ( 7.32 nm ) decreased retinal damage , as demonstrated by fag . indeed , regular course and caliber of retinal vessels without microvascular changes or vessel leakage were present at each time point considered after intravitreal injection of mc1 receptor agonist bms-470539 and mc5 receptors agonists pg-901 , as compared to the untreated diabetic mice with retinopathy ( figure 3 ) . to investigated a potential involvement of the mc pathway by endogenous peptides , we tested the effect of receptor antagonists . intravitreal injection of pg20n ( mc5 antagonist ) and agrp ( mc1 antagonist ) worsened the retinal injury with evident changes already after 8 weeks after induction of diabetes . due to the presence of a venous loop ( figure 4 ) and an extensive retinal vessel leakage with progressive dye diffusion ( figure 4 ) at 16 weeks after induction , hyperfluorescent areas were observed after treatment with either of the two compounds . of interest , intravitreal injection of molecules that activate mc3 , like the agonist mtii ( dual mc3-mc4 agonist ) or the antagonist shu9119 ( dual mc3-mc4 antagonist ) , did not produce changes of the microvascular bed into the retina of diabetic mice ( figure 5 ) . in diabetic mice suffering from retinopathy , cellular tight junctions were damaged as demonstrated by the low levels of occludin detected in retinal homogenates ( figure 6 ) . of interest , levels of this cell junction marker progressively decreased with the development of retinopathy , reaching the lowest level detected at week 16 after stz ( figure 6 ) . such a nadir was further reduced following intravitreal injection of the mc1 and mc5 receptor antagonist agrp and pg20n , respectively , over the different time points ( figure 6 ) . conversely , administration of bms-470539 or pg-901 increased the retinal occludin levels at 8 weeks , 12 weeks ( data not shown ) , and 16 weeks , compared to untreated diabetic mice ( p < 0.01 , figure 6 ) , demonstrating a protective effect downstream activation of mc1 or mc5 , respectively . modulation of mc3 signals was without effects ( figure 6 ) . as we observed profound alterations in the microcirculation , visual images complemented by the loss of tight junction proteins ( of which occludin was selected as faithful marker ) , we then measured expression of a fundamental angiogenic factor . retinal levels of vegf were increased ( + 66 3% ) in diabetic mice suffering from retinopathy at 16 weeks after stz ( p < 0.01 versus nondiabetic ; figure 6 ) . these levels were further increased following intravitreal injection of the mc5 antagonist pg20n ( + 35 2.2% on top of diabetic values , p < 0.01 versus diabetic ; figure 6 ) or mc1 antagonist agrp ( + 36.2 1.8% , p < 0.01 versus diabetic ; figure 6 ) . agonism at mc1 or mc5 decreased levels of vegf in the retina of diabetic mice back to levels detected in retinas of untreated diabetic mice ( p < 0.01 ; figure 6 ) . mc3-mc4 appear not be involved in this protective effect , as the compounds mtii and shu9119 failed to modulate vegf levels assayed during the development of retinopathy in diabetic mice ( p > 0.05 ; figure 6 ) . in line with this trend , immunohistochemistry for ki-67 showed a decrease in the percentages of positive stained area / total stained area following intravitreal injection of bms-470539 ( mc1 agonist , 64.2 6% versus diabetic ) or pg-901 ( mc5 agonist , 68.6 7% ) as calculated against the values quantified in week 16 diabetic mice ( figure 7 ) . western blotting of retina homogenates showed that the presence of the cd11c marker for m1 macrophages was increased in diabetic mice at all time points considered , compared with healthy nondiabetic mice ( figure 8) . there was a good correlation between the number of m1 macrophages and the levels of occludin in the retina with an r = 0.9732 . the number of m1 macrophages was further increased by intravitreal injection of the mc1 or mc5 antagonist ( figure 8) . in contrast , intravitreal injection of the mc1 or mc5 agonist in diabetic mice affected by retinopathy decreased the binding for cd11c ( figure 8) . to complement these analyses , intravitreal treatment with bms-470539 or pg-901 increased cd206 detection , when compared to diabetic mice ( figure 8) , in line with the improvement of the ocular signs recorded with the fag . the proinflammatory cytokine il-1 was increased by ~61% in response to the development of retinopathy ( p < 0.01 versus nondiabetic mice without retinopathy ; figure 9 ) . the melanocortin receptor antagonists agrp and pg20n further increased expression levels for il-1 , il-1 , il-6 , mip-1 , mip-2 , and mip-3 ( figure 9 ) . for example , il-1 was increased by 26 2% and 28 1.8% , respectively , for agrp and pg20n ( p < 0.01 versus diabetic ) . administration of bms-470539 or pg-901 significantly diminished il-1 , il-1 , il-6 , mip-1 , mip-2 , and mip-3 in the retina ( p < 0.01 versus diabetic ; figure 9 ) . mtii and shu9119 did not significantly affect the expression of these proinflammatory mediators ( figure 9 ) . a similar trend was observed for the proinflammatory chemokines mip-1 , mip-2 , and mip-3 , where the highest levels were reached in diabetic mice 16 weeks after diabetes induction ( figure 9 ) . modulation of mc1 and mc5 receptor signaling by means of agonists and antagonists significantly modified mip-1 , mip-2 , and mip-3 levels ( figure 9 ) . finally , and of further interest , while il-10 levels were low in the retina of diabetic mice with retinopathy , the expression of this anti - inflammatory cytokine was significantly increased after the injection of either mc1 or mc5 agonist , for example , + 64 7% and + 56 4.2% for bms-470539 and pg-901 , respectively ( p < 0.01 versus diabetic mice ) ( figure 9 ) . in this study we investigated the putative protective effect of intravitreal injection of melanocortin agonists in a model of streptozotocin- ( stz- ) induced diabetic retinopathy ( dr ) in mice . this is in light of the incomplete and still ongoing knowledge of the pathogenetic molecular mechanism underlying dr , the lack of structural , functional , and biochemical studies in human subjects , and the need of new local therapeutic options . the data presented here indicates that mice suffering from prolonged ( 16 weeks ) diabetes develop retinal alterations typical of nonproliferative diabetic retinopathy ( dr ) , such as microaneurysms with irregular vascular course and vessel leakage , appearing from 12 weeks after the onset of diabetes . these alterations were markedly reduced by the intravitreal injection of the mc1 and mc5 melanocortin receptor agonists bms-470539 and pg-901 , respectively . these compounds preserved a regular course and caliber of the vessel with no signs of leakage even 16 weeks after diabetes induction . in contrast , animals treated with the mc1 antagonist agrp , or the mc5 antagonist pg20n , showed worsening of dr clinical signs . as early as 8 weeks after induction of diabetes , approximately 80% of mice treated with mc1mc5 antagonists display appearance of venous loop with marked leakage , due to an increased vascular permeability , and vascular tortuosity . therefore , these antagonists enable identification of a protective melanocortin tone in the eye during dr . dr is clinically divided in two types : nonproliferative ( npdr ) and proliferative ( pdr ) . thus , npdr is characterized by microaneurysms , dot and blot hemorrhages , and , in severe cases , retinal microvascular damage and intraretinal microvascular abnormalities . pdr , on the other hand , is characterized by abnormal retinal neovascularization due to capillary nonperfusion , and retinal ischemia . vascular changes characteristics of diabetic retinopathy in humans have been widely documented in diabetic rats , dogs , and cats [ 3439 ] , including the breakdown of the blood - retinal barrier , damage in nonvascular retinal neurons and mller glial cells , thickening of the capillary basement membrane , reduction in the number of pericytes , and an increase in the number of acellular capillaries [ 3439 ] . the model we used here replicates the early signs of nonproliferative dr , such as loss of retinal pericytes and capillaries , thickening of the vascular basement membrane , and increased vascular permeability , signs that were significantly reduced by activation of retinal mc1 and mc5 receptors . these receptors are part of the 4 receptors that are differentially expressed in the neuroretina layers [ 12 , 16 ] ; as mc3 and mc4 receptors are localised in the layer of retinal ganglion cells , mc5 receptors are expressed in the neural outer plexiform layer , whilst the retinal pigment epithelial cells express mc1 and mc5 receptors [ 16 , 17 ] . they translate the actions of melanocortins in ocular immunity , development , and health , and in neurotrophism of eye tissues [ 1820 ] , together with biomolecular changes relating to cell protection . mc3 and mc5 do not appear to transduce the protective effects of melanocortin peptides , at least in these setting and with respect to the markers under analysis in our setting . dr is a pathology initiated by hyperglycemia which overall ( i ) increases polyol pathway flux ; ( ii ) increases advanced glycation end - product ( age ) formation ; ( iii ) activates protein kinase c ( pkc ) isoforms ; and ( iv ) increases hexosamine pathway flux . these events lead to upregulation of vegf , insulin - like growth factor ( igf ) , angiopoietins ( ang-2 ) , tumor necrosis factor- ( tnf- ) , and il-6 [ 4143 ] , responsible for a florid inflammatory response within the eye . modulation of melanocortin receptor activity did not affect systemic glycemia , suggesting therefore local activation of protective mechanisms . although we can not rule out potential off target activity of the melanocortin receptor agonists that may influence the results , we propose that specific activation / deactivation of inflammatory and oxidative signaling regulated by selective melanocortin receptor agonists may constitute an alternative approach for the treatment of dr , affording protection of retinal vessels , slowing down , and/or preventing the onset of early vascular changes typical of dr . congruent with these effects , and the notion of localised responses , functional actions of mc1mc5 evoked changes in the main mediators of the inflammatory response including cytokines ( such as il-1 , il-1 , il-6 , and il-10 ) and chemokines ( such as mip-1 , mip-2 , and mip-3 ) . these actions were married to changes of the main markers of vessel proliferation such as vegf and ki-67 . this evidence is supported by previous and almost extensive studies on melanocortin activities in a wide range of settings , including their protective effects in chondrocytes [ 44 , 45 ] and human primary cells and in vivo models of diseases like rheumatoid arthritis , colitis , allergic airway inflammation , or ischemia reperfusion injury [ 12 , 16 , 36 , 47 ] . these multiple properties are likely due to the ability of melanocortins to reduce production of proinflammatory cytokines by inhibiting nf-b translocation to the nucleus as demonstrated by manna and aggarwal or production of anti - inflammatory cytokines such as il-10 from monocytes as demonstrated by redondo et al . further support to the data presented and discussed here derives from the protective and anti - inflammatory properties of melanocortins in experimental models of exogenous uveitis [ 20 , 48 ] and of retinal degeneration . retinal mc1mc5 activation also modified the retinal macrophage population commonly associated with the released cytokines , and with the disruption of normal retina structure . in this context we observed a high level of m1 macrophages within the retina of diabetic mice that developed retinopathy , as evidenced by the western blotting performed with the specific m1 marker cd11c , with respect to the mice that developed diabetes only without retinopathy . these macrophages are notoriously characterized by a strong propensity to the production of cytokines and nitric oxide and reactive oxygen , which contribute to the retinal vascular damage . m2 macrophages were abundantly present into the retina after the stimulation of the mc1 or mc5 for 8 weeks . noteworthily , these macrophages are associated with resolution of the immune - inflammatory responses into tissues activated by previous insults [ 50 , 51 ] and into the consequent tissue regeneration . although clinically dr can be managed through the control of the metabolic glucose pathway , we conclude this study by proposing that stimulation of the endogenous melanocortin system in the eye through the local activation of mc1 and mc5 may reduce the retinal damage caused by diabetes . this may be the start of a melanocortin - based therapy for dr , especially when considering that several natural and synthetic melanocortin receptor agonists are under clinical experimentation [ 52 , 53 ] .

we hypothesize that melanocortin receptors ( mc ) could activate tissue protective circuit in a model of streptozotocin- ( stz- ) induced diabetic retinopathy ( dr ) in mice . at 1216 weeks after diabetes induction , fluorescein angiography ( fag ) revealed an approximate incidence of 80% microvascular changes , typical of dr , in the animals , without signs of vascular leakage . occludin progressively decreased in the retina of mice developing retinopathy . qpcr of murine retina revealed expression of two mc receptors , mc1r and mc5r . the intravitreal injection ( 5 l ) of the selective mc1 small molecule agonist bms-470539 ( 33 mol ) and the mc5 peptidomimetic agonist pg-901 ( 7.32 nm ) elicited significant protection with regular course and caliber of retinal vessels , as quantified at weeks 12 and 16 after diabetes induction . mouse retina homogenate settings indicated an augmented release of il-1 , il-1 , il-6 , mip-1 , mip-2 , mip-3 , and vegf from diabetic compared to nondiabetic mice . application of pg20n or agrp and mc5 and mc1 antagonist , respectively , augmented the release of cytokines , while the agonists bms-470539 and pg-901 almost restored normal pattern of these mediators back to nondiabetic values . similar changes were quantified with respect to ki-67 staining . finally , application of mc3-mc4 agonist / antagonists resulted to be inactive with respect to all parameters under assessment .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

dyes are a group of additives used to improve the appearance of foods , textiles , and medicine allowing the homogenizing and the assertion of the color , which is the most important sensory characteristic . synthetic dyes have been used because they are more resistant to changes in temperature and acidity than natural dyes . all of these compounds contain a chromophore group and different substituents resulting in a large group of synthetic dyes , each with particular chemical properties . the main feature of these compounds is the presence of an azo group ( n = n ) and aromatic groups , resulting in a substance with high electron conjugation and a high molar absorption coefficient , making it useful at low concentrations . tartrazine , also known as yellow 5 or e 102 dye , is one of the most important synthetic azo dyes used in the food industry to confer a yellow color to food . it is soluble in water ( 14 mg/100 ml ) giving a yellow color to the solution . it is usually applied in pastries , baked goods , snacks , drinks , biscuits , ice cream , and other sweets . in spite of its useful qualities , tartrazine has also been associated with allergenic effects , hyperactivity , and attention deficit disorder . for this reason , the toxicity of tartrazine was studied in the early 60s by the expert committee on food additives of fao / who , which established an acceptable daily intake ( adi ) of 7.5 mg kg of body weight per day . moreover , since 2010 , foods containing tartrazine must carry the warning may alter the activity and attention in children . in mexico , this dye is regulated according to the official mexican standard nom-218-ssa1 - 2011 which allows 100 mg l as the maximum amount of tartrazine in commercial beverages . in general , the methodology for the quantification of dyes involves a sample treatment , identification , and quantification steps . the chosen method depends on the type of food and the lipid , protein , and carbohydrate content . other properties such as acid - base properties of the analyte and the interferences present in the sample matrix are also important . thus , when liquid chromatography , capillary electrophoresis , and electrochemical techniques are used , it requires a simple treatment of the sample , usually dilution and subsequent filtration . however , these instrumental methods have certain disadvantages such as the high cost of analysis ( equipment and reagents ) and lower analysis rate ( 24 samples per hour ) [ 8 , 9 ] . on the other hand , if the determination of dyes is completed using a quick and simple spectrophotometric technique , it must be considered that the presence of preservatives ( sodium benzoate or citrate ) and proteins may interfere significantly during the quantification step . according to this , the isolation of the sample dye using different extraction materials is critical during the analytical process . anion exchange , where acid dyes are retained by sulfonic groups present in the polymer structure , and liquid - liquid extraction ( n - butanol - water ) based on the formation of ion pairs with trimethyloctadecylammonium salts have been proposed . the solid phases used for this purpose were zeolite or silica c18 ; the retained dye was eluted from the solid phase with methanol [ 12 , 13 ] . additionally , activated carbon has been proposed as colorant adsorbent because it has an excellent surface area and a well - defined pore structure that favors the retention of the analyte [ 1417 ] . despite its versatility , the activated carbon has the disadvantage of being difficult to separate from the aqueous matrix where it was dispersed . in order to facilitate separation of the extraction support from the liquid phase , afakov and afak mspe is based on the use of magnetite - modified activated carbon as the solid phase with paramagnetic properties . for this reason , the support can be easily isolated from the dispersion medium by applying an external magnetic field . the main advantages of mspe are as follows : ( 1 ) presenting the possibility of using large volumes of samples , greatly reducing the time of pretreatment and the analysis result ; ( 2 ) having great interaction between analytes and the solid phase with the full dispersion of the adsorbent in the sample ; and ( 3 ) providing easy isolation of the adsorbent from the analytical matrix , reducing the risk of loss of analyte . in spite of their promising qualities , the mspe has been used mainly for the separation of antibiotics and other organic molecules . the use for the extraction of dyes has been limited to the determination of reactive red 198 , and methylene blue . in all cases , the main advantage of the adsorbent support was its selectivity in the extraction of the analyte and the possibility of using volumes from 100 to 1000 ml , providing shorter analysis times as compared to conventional techniques . according to the above - mentioned , the purpose of this work is to design a methodology based on magnetic solid phase extraction using magnetite - modified carbon for the spectrophotometric analysis of tartrazine . the method was used for the analysis of this dye in a complex matrix of nonalcoholic beverages . for the synthesis of the magnetite - modified carbon , a commercial activated vegetable carbon from clarimex s.a . the synthesis was performed in two stages : in the first stage , magnetite was obtained by precipitation and its partial oxidation of iron ( ii ) sulfate heptahydrate feso47h2o ( 3.6 g ) . the iron precursor was dissolved in 100 ml of deionized water , stirring constantly and keeping at 60c . the ph solution was adjusted to 10.0 0.2 and a stream of air was passed through the reaction mixture . the initial green precipitate ( fe(oh)2xh2o ) turned black after 40 minutes of reaction as a consequence of the partial oxidation of fe(ii ) to fe(iii ) by the action of the o2 from the air stream ; the black color of the precipitate is characteristic for fe3o4 . in the second step , 1.0 g of activated carbon was added to the reaction vessel and the mixture was stirred for 30 minutes . the magnetic phase was separated with a magnet and washed three times with distilled water . the solid phase was dried at 60c for 24 h. the solid phase was pulverized in an agate mortar and stored in a desiccator until use . in order to carry out the characterization of the synthesized magnetite - modified carbon , various instrumental techniques were used . x - ray powder diffraction analysis was performed in a philips pw1710 instrument equipped with a copper anode and an automatic divergent opening . the conditions for the analysis were 1.54 cuk radiation ; 40 kv voltage tube ; 30 ma current tube ; 0.500 intensity ratio ( a2/a1 ) ; 1 divergence slit ; 0.1 receiving slit ; ( 2 ) 5 initial angle ; ( 2 ) 70 end angle . morphological analysis of the solid was performed in a scanning electron microscopy ( sem ) jeol jsm-820 . qualitative analysis and determination of the distribution of magnetite in the solid were performed with a link qx-2000 analyzer by energy dispersive x - ray spectroscopy . all spectra were obtained at 15 kv , a distance of 39 mm , and 2,500 counts ; the detector angle relative to the sample in all cases was 45. for the extraction studies , 0.05 g of magnetite - modified carbon was mixed with 20.0 ml of aqueous solution of tartrazine and stirred mechanically for 30 minutes . the ph value for tartrazine solution was varied using acetate ( ph = 5.0 ) , phosphate ( ph = 7.0 ) , and borate ( ph = 9.0 ) solutions at 1.0 mol l concentration . after the extraction , the solid phase was separated using a neodymium magnet and the remaining liquid phase was analyzed by spectrophotometry at a wavelength of 434 nm in a uv - vis spectrophotometer hach dr-2700 with a quartz cell with 1.0 cm of path length . thus , the remaining tartrazine was quantified by interpolation in a calibration line constructed with standard solutions of tartrazine ( 10.0100.0 mg a control experiment was carried out using activated carbon in order to evaluate the effect of the magnetic modifications in support of the tartrazine extraction . for the elution of the retained tartrazine from the synthetized support , several eluting systems were evaluated following this procedure in triplicate : 50 mg of solid phase containing tartrazine was mixed with 2.0 ml of eluent and stirred using ultrasound for 5 minutes . 2 ml of the resulting solution was transferred to a 10 ml volumetric flask and filled with eluent solution up to the mark . the eluted tartrazine was quantified by interpolation in a calibration line constructed with absorbance values of standard solutions of tartrazine ( 10.0100.0 mg six samples of commercial beverages containing tartrazine were analyzed in triplicate following this protocol : 10 ml aliquot of the drink was mixed with 2.5 ml of 1.0 mol l acetate buffer solution and transferred to a 25 ml volumetric flask and then deionized water was added up to the mark . later , 20.0 ml of this solution was placed in a polypropylene tube containing 75 mg of magnetic support and mechanically stirred for 30 minutes in order to extract the dye . after the extraction , the solid phase was removed from the aqueous matrix using a neodymium magnet . the solid phase was then mixed with 1.0 ml of eluent and stirred for 5 minutes using ultrasound to remove the extracted tartrazine . the liquid phase was transferred to a 10 ml volumetric flask and filled with elution solution up to the mark . the concentration of tartrazine in the last solution was determined spectrophotometrically . in order to evaluate the proposed methodology , this method considers a calibration line using standard solutions of tartrazine from 5 to 20 mg l. samples were prepared as follows . an aliquot of 0.5 ml was diluted adding a mobile phase up to 5 ml . in order to introduce the samples to the chromatographic system , it was necessary to filter it using membranes of 0.45 m pore size . instrumental techniques were used to provide information about the composition and structure of the magnetic modified carbon . thus , the x - ray diffraction ( xrd ) studies were performed in order to determine the iron oxide form present in the solid . the xrd diffractograms from figure 1(a ) show the signals labeled as m that correspond to the characteristic diffraction lines of fe3o4 ( 2 = 30.1 , 35.5 , 43.1 , 53.4 , 57.0 , and 62.6 ) according to the joint committee on powder diffraction standards . the broadband signal observed between 20 and 30 for the 2 angle ( figure 1(b ) ) is characteristic of amorphous carbon , the raw material . the morphological study with scanning electron microscopy ( sem ) for activated carbon shows a uniform phase with inhomogeneous particle sizes greater than 20 m ( figure 2(a ) ) . the micrograph is consistent with sem studies performed without modifying the activated carbon . in the case of the synthetized support , it can be seen that the activated carbon is covered by a phase with a smaller size ( figure 2(b ) ) . this was confirmed with the energy dispersive spectrum ( figure 2(c ) ) that shows a larger amount of carbon for the section ( i ) , while the fe - content is greater for the area ( ii ) , so it is concluded that the magnetite phase is covering the activated carbon . the extraction of tartrazine from standard solutions using the synthetized modified carbon is shown in figure 3 . the capability of the synthetized modified carbon for the extraction of tartrazine was also evaluated at different ph values . the results shown in figure 4 correspond to acidic , basic , and neutral medium adsorption isotherms constructed by plotting the concentration of tartrazine in the solution at equilibrium ( m ) against the concentration of the sorbate on the solid phase ( mmol kg ) after adsorption . additionally , table 1 shows the maximum quantity of adsorbate on the solid support at different ph values . according to figure 4 and table 1 , the decrease of ph values results in the increase of the amount of absorbed tartrazine . this is consequence of the interaction of tartrazine in its anionic form with the acid form of the magnetite at low ph values . in basic medium a repulsion between the negative charges of tartrazine in solution and the support is reflected in the reduction of the adsorbate retention . based on these results , ph of 5.0 was selected as the most suitable value for the retention of dye . as part of the characterization of the mspe - dye system , the analysis of the isotherm values using a scatchard plot demonstrates the value of the affinity constant k d for the following dissociation reaction : ( 1)tst+s , where ts corresponds to tartrazine adsorbed on the support , t is the tartrazine in solution , and s is the magnetic modified carbon support . logk d values are shown in table 2 , observing a linear trend which is associated with the homogeneity of the support . because this is a dissociation constant , it follows that the support with a higher affinity is the activated carbon ; however , the synthetized support has a suitable logk d value because in the retention - elution methodologies design , it is recommended that the support has an average affinity to the substrate with logk d values between 7.0 and 4.0 . additional studies on the selection of the best chemical conditions for the tartrazine elution adsorbed on the magnetic modified carbon were performed . thus , several eluting systems were evaluated for the elution step : methanol , acetonitrile , basified methanol , and basified acetonitrile [ 28 , 29 ] . after the spectrophotometric analysis of the eluted tartrazine , it can be seen that basified methanol provides the greater signal ( table 3 ) as a consequence of removing a greater amount of tartrazine . for this reason , this eluent was chosen for elution of tartrazine in the following experiments . to optimize the conditions for the retention and elution of tartrazine involved in the mspe system the main advantage of this technique is that it provides useful information with minimal experimentation using matrices of special design ( orthogonal arrays ) , in which columns ( factors or controllable parameters ) and rows ( experiments ) are accommodated in such a way that a combination of factors and levels of each experiment are indicated . the selected response factor was the percentage of recovery for the analysis of 20 ml of a solution of 30 mg l tartrazine . the selected control factors ( parameters ) , each at 3 levels , were sample volume , volume of eluent , mass of magnetic modified carbon support , and naoh concentration in the eluent . based on an l9 ( 34 ) taguchi orthogonal array , figure 5 shows a typical graph obtained by plotting the average percentage of recovery for each factor against each of its levels . according to this , the most suitable conditions for tartrazine adsorption - elution were 20 ml sample , 1 ml of eluent , 75 mg of magnetic modified carbon , and a concentration of 0.25 mol l naoh for the basified methanol solution . these conditions correspond to experiment number 4 , which has the highest percentage of dye recovery . additionally , the contribution percentage of each variable was determined by ascertaining that naoh concentration in the eluting solution has the greater effect ( 45.4% ) , followed by the sample volume ( 23.6% ) , the mass of adsorbent ( 20.4% ) , and the eluent volume ( 10.6% ) . the higher contribution of the eluting solution in the tartrazine elution step confirms the theory of charge - repulsion between support and analyte , which is favored at a higher concentration of naoh . under the optimized conditions described above , calibration lines using tartrazine standard solutions in the concentration range of 5.0 to 30.0 mg the obtained signal ( au ) was measured in triplicate and the calibration lines were plotted using the average signal of the eluted tartrazine . calibration lines show a linear dependence between the average signal and the concentration of tartrazine present in the initial standard solution . reported in table 5 , it can be seen that the proposed methodology allows for the quantification of tartrazine in drinks at levels established by the official mexican standard nom-218-ssa1 - 2011 which allows 100 mg l as the maximum amount of tartrazine in commercial beverages . several nonalcoholic beverages containing tartrazine also have additives as proteins and preservatives that improve physical appearance and shelf life . for this reason , the tartrazine adsorption - elution method was evaluated adding several interfering compounds . the evaluated interferents included casein , egg albumin , acesulfame k , sodium benzoate , aspartame , sodium citrate , glucose , and sucrose . solutions of each interfering compound were prepared dissolving 10 mg in 10 ml acetate buffer . to perform the test , 75 mg of magnetic modified carbon was mixed with 20 ml of 30 mg l tartrazine solution and 3 ml of interferent solution . after this absorption step , 1 ml of basified methanol with naoh 0.25 mol l was used to elute tartrazine . then 0.5 ml of the eluted solution was transferred to a 5 ml volumetric flask and filled up to the mark . results did not show a % rsd value higher than 5% of the analytical signal in a similar experiment without interferents . according to this , the main components of every beverage that were reported by the manufacturer are listed in table 6 . following the developed and optimized method , additionally , in table 7 it is possible to observe the results for the analysis of samples using the hplc reference method and mspe - hplc ( figure 6 ) . for each beverage , the average concentration of tartrazine obtained using both methods was compared using a t - test with 2 degrees of freedom and 95% of confidence ( t tab = 4.3 ) . additionally , the mspe is a robust preconcentration technique that can be coupled even to spectrophotometry or hplc . in the present work , an activated carbon covered with magnetite support was synthesized ; this support has magnetic properties that allow its separation by applying an external magnetic field . the best conditions for the extraction and elution of tartrazine were an initial sample volume of 20 ml , buffered with acetate buffer solution , at ph 5 , and mixed with 75 mg of magnetic modified carbon , tartrazine elution with 1 ml of naoh 0.25 mol l in methanol . thus , the proposed sample treatment coupled to spectrophotometric analysis is an alternative to the analysis of azo dyes in the food industry because the parameters , analytical precision , and accuracy are similar to hplc methodologies . however , the proposed methodology saves time and is less expensive than the reference method .

a method is presented for magnetic solid phase extraction of tartrazine from nonalcoholic beverages . the method involves the extraction and clean - up by activated carbon covered with magnetite dispersed in the sample , followed by the magnetic isolation and desorption of the analyte by basified methanol . the tartrazine eluted from the magnetic support was determined by spectrophotometry . under optimal conditions , the linear range of the calibration curve ranges from 3 to 30 mg l1 , with a limit of detection of 1 mg l1 . the method was validated by comparing the results with those obtained by hplc . a precision of < 5.0% was obtained in all cases and no significant differences were observed ( p < 0.05 ) .

1. Introduction 2. Materials and Methods 3. Results and Discussion 4. Conclusions

a 5-year - old boy presented with 4-week history of increasing right shoulder and elbow pain , paresthesia , and had demonstrated limited right shoulder adduction above the horizontal plane , following an episode of gastroenteritis . subsequently , he developed wasting of the supraspinatus and infraspinatus muscles , causing significant functional impairment . he had subtle dysmorphic features of hypotelorism , epicanthic , and mild midface hypoplasia , simple helix with small ears , pectus excavatum , and unusual skin folds on the forearms ( which were more prominent during infancy ) . magnetic resonance imaging of the brachial plexus showed patchy decreased signal within the right supraspinatus and infraspinatus muscles indicative of denervation . a diagnosis of hereditary neuralgic amyotrophy secondary to a de novo sept9 mutation was confirmed with the identification of a pathogenic de novo heterozygous mutation , c.262c > t [ p.arg88trp ] ( performed in diagenom gmbh , medical genetics laboratory germany http://www.diagenom.de/ ) . the child was administered a single infusion of 50 g ( 2 g / kg ) intravenous immunoglobulin as induction treatment and showed an improvement in his right shoulder function and a reduction in pain within 6 hours of treatment . he continued to receive monthly maintenance intravenous immunoglobulin infusion ( dose 0.4 g / kg ) over 12-month period . five months into treatment , he evolved to have left - sided brachial neuritis features , although were significantly attenuated to the pain and the muscle bulk wasting compared to the initial presentation . twelve months into treatment , patient regained full functions of both right and left shoulders with recovery of scapular muscle bulk . the septin family of guanosine triphosphate - binding proteins serve as scaffolds and diffusion barriers that control the cellular localization of numerous proteins . there are 13 known mammalian septin genes , with > 30 protein isoforms because of alternate splicing . sept9 is involved in t - cell development and proliferation , as well as being highly expressed in schwann cells in the peripheral nerve . under hypoxic conditions , the c.262c > t mutation reduces the translation of the sept9_v4 isoform , which encodes the sept9 protein isoform e ( genbank nm_001113494.1 and np_001106966.1 ) . an altered response to stress and the inherent role of sept9 in myelin maintenance and t - cell development can account for the episodic nature of hereditary neuralgic amyotrophy . similarly , alternate sept9 isoforms , for example , could play differential roles during embryonic development , thus accounting for the dysmorphic features associated with the condition . cochrane review of the treatment of neuralgic amyotrophy provided some evidence , suggesting early corticosteroid therapy with or without intravenous immunoglobulin might have a positive effect on pain and recovery in a few patients . adult patients with hereditary neuralgic amyotrophy have demonstrated favorable outcomes from intravenous immunoglobulin after failure to response to corticosteroid . the mechanistic effects of intravenous immunoglobulin in autoimmune diseases include ( 1 ) antibodies , ( 2 ) complement , ( 3 ) degenerative proinflammatory molecules , ( 4 ) gene expression , and ( 5 ) stimulating schwann cell maturation . gene expression profiles in patients with inflammatory myopathies treated by intravenous immunoglobulin have demonstrated significant dysregulation across a number of systems . most notably , downregulated genes included the cell adhesion genes such as icam-1 and kal1 . intravenous immunoglobulin - induced dysregulation of gene expression in key inflammatory , cellular migration , and cell survival pathways has been demonstrated in autoimmune diseases such as dermatomyositis and inclusion body myositis . the multimodal effects of intravenous immunoglobulin , including altered gene expression , may be relevant to our case in the context of his relapse . this relapse occurred in the absence of any infectious or traumatic triggers and was clinically attenuated by the ongoing maintenance of monthly intravenous immunoglobulin dosing , postulating an epigenetic modification of the disease process . how this myriad of clinicopathological mechanisms promotes such a successful modulation of hereditary neuralgic amyotrophy in our patient remains unclear . while the initial hereditary neuralgic amyotrophy episode in our patient appeared to have been triggered after an episode of viral gastroenteritis , the second episode occurred during intravenous immunoglobulin treatment without any infective triggers , although the clinical course and severity were significantly attenuated by the ongoing administration of intravenous immunoglobulin . thus , the authors hypothesize that the c.262c > t mutation in exon 2 of the sept9 gene generated pathology via the numerous isoforms under specific conditions and that intravenous immunoglobulin can play a role at the epigenetic level of improving dysfunctional sept9 expression . our case also demonstrated that intravenous immunoglobulin is a safe and effective form of therapy for children with hereditary neuralgic amyotrophy .

hereditary neuralgic amyotrophy is a rare disorder characterized by the sudden onset of recurrent episodes of painful brachial plexus neuropathies , followed by atrophy within a few weeks . the authors present the case of a 5-year - old boy who developed hereditary neuralgic amyotrophy in the right upper limb after a gastroenteritis illness . he made a full and rapid recovery with the use of intravenous immunoglobulin . a subsequent episode in the left upper limb during the course of intravenous immunoglobulin was significantly attenuated . a de novo c.262c > t mutation in exon 2 of the sept9 gene was identified . to our knowledge , he is the first pediatric patient with sept9 hereditary neuralgic amyotrophy to be treated with intravenous immunoglobulin . the authors hypothesize that the c.262c > t mutation in exon 2 of the sept9 gene generates pathology via the numerous isoforms under specific conditions and that intravenous immunoglobulin can play a role at the epigenetic level of improving dysfunctional sept9 expression .

Case Report Discussion

a 59-year - old male with atypical chest pain and intermediate pretest probability underwent dual - source computed tomography angiography ( cta ) . cta was performed with 80 ml contrast agent at 6.0 ml / s , 100 kv tube voltage and retrospective ecg - gated protocol ( slice thickness , 0.6 mm ; overlap , 0.4 mm ) with radiation exposure of 12.1 msv . multiplanar reconstructions demonstrated a borderline ( 60% luminal stenosis ) mixed plaque in the proximal segment of left anterior descending artery ( lad ) and mild atherosclerotic lesions in the left circumflex and right coronary artery with total calcium agatston score of 678 ( fig . 1a ) . cross - sectional images of lad demonstrated a mixed plaque with low attenuation area proximal to calcium spots and positive remodeling ( fig . 1b f ) . based on patient s preferences , aggressive medical therapy with a high - dose statin , after 6 months the patient presented with acute anterior st - elevation myocardial infarction caused by thrombotic lesion in the proximal lad ( fig . 1 g , h ) . although he underwent primary percutaneous coronary intervention of the culprit lad , nyha class ii heart failure symptoms developed.fig . 1a curved multiplanar reconstruction of a high - risk lesion in the proximal left anterior descending artery ( lad ) causing future ischemic event . b f serial cross sections demonstrating mixed plaque with low attenuation area proximal to calcium spots and positive remodeling . g , h left coronary angiography showing high - grade thrombotic lesion ( arrowheads ) in the proximal lad . lad left anterior descending artery , lcx left circumflex a curved multiplanar reconstruction of a high - risk lesion in the proximal left anterior descending artery ( lad ) causing future ischemic event . b f serial cross sections demonstrating mixed plaque with low attenuation area proximal to calcium spots and positive remodeling . g , h left coronary angiography showing high - grade thrombotic lesion ( arrowheads ) in the proximal lad . lad left anterior descending artery , lcx left circumflex plaque rupture and thrombus formation play key roles in the onset of acute coronary syndrome . based on previous autopsy studies the majority of culprit lesions are typically nonstenotic , contain a large necrotic core with a thin overlying fibrous cap , and induce expansive remodeling of the vascular segment . recently , stone et al . reported the results of a prospective study assessing the relationship between lesion characteristics and new cardiovascular events among previously stented subjects . in conclusion , although frequently angiographically mild most lesions causing future ischemic events were characterized by a large plaque burden ( 70% ) and/or small luminal area ( 4.0 mm ) as determined by intravascular ultrasonography . recently , cardiac cta has been proposed as a promising noninvasive tool for identification of rupture - prone plaques prior to a subsequent coronary event . pundziute et al . demonstrated that an increase in coronary segments with detectable non - obstructive plaques was associated with increased mortality . furthermore , not only total plaque burden but also proximal plaque location was related to future ischemic events . in the only ct study assessing plaque characteristics prior to major cardiovascular events , motoyama et al . showed that plaques with low ct attenuation and positive remodeling are at particularly high - risk for rupture . indeed , in our case , the presence of mixed plaque with positive remodeling in the proximal segment of lad was associated with development of subsequent acute coronary syndrome . interestingly , we identify a specific type of vulnerable plaque distribution characterized by low attenuation area proximal to multiple calcium spots . certainly , with the widespread application of cta and the advent of new low radiation ct scanners , noninvasive identification of rupture - prone plaques becomes technically feasible . however , the inclusion of noninvasive fortune - telling in future cta appropriateness criteria would require conducting clinical trials focused on the development of tailored medical interventions for the prevention of plaque rupture . currently , preventive or therapeutic management may include minimizing risk factors using life style changes , systemic drug therapy , or mechanical plaque sealing by coronary stenting . in our case , aggressive medical therapy did not prove beneficial in preventing future ischemic event , suggesting that conservative management is not always the right choice .

recently , cardiac cta has been proposed as a promising noninvasive tool for identification of rupture - prone plaques prior to a subsequent coronary event . this task is particularly challenging but the reward is high : identification of high - risk lesions could preclude plaque thrombosis and possibly prevent acute coronary syndromes . we present a case of a borderline mixed plaque with positive remodeling in the proximal left anterior descending artery ( lad ) . after 6 months and despite aggressive medical therapy , the patient developed acute st - elevation myocardial infarction caused by a thrombotic lesion in the proximal lad . we review the literature on ct characteristics of vulnerable plaque and discuss the possible preventive interventions .

Case in point

the main symptoms of this syndrome are balance disturbances . very often the patients do not present with any other symptoms except for positional vertigo and dizziness , so the differential diagnosis of its origin is very difficult . along with balance disturbances , transient focal neurological symptoms are sometimes observed , specific for the brain region supplied by the vertebrobasilar artery ( vba ) . mechanical endogenous and exogenous factors , such as muscle tone disturbances , osteoarthrosis , herniated cervical disc , inflammation , or artheriosclerosis , may cause vbi , due to restriction of blood flow in the vba . we often observe these symptoms during normal physical activity that particularly involve neck and shoulder movements . there are also descriptions of vbi symptoms associated with neck pain , torticollis , and stiff neck . occasionally the onset of these symptoms has been reported after improper manipulations of the cervical spine . terret distinguishes the set of symptoms connected with vbi as follows : the presence of these symptoms can influence social and occupational life , as well as the quality of life . unfortunately , many of the methods used to control vbi are often ineffective . sometimes it is necessary to involve an interdisciplinary team , but this is very costly and time - consuming . low level laser therapy ( lllt ) has gained recently popularity in the treatment of arterial occlusion . lllt produces non - thermal ( bio - stimulating ) effects , due to an average power less than 500 mw . the biological effects of laser stimulation are observed at a cellular level , and are thought to stabilize the cell membrane , increase intracellular transport , and release endorphins and many other cytokines . the stimulation of the treated region is reported to cause the expansion of blood vessels and an increased blood flow volume . the increase in blood flow is probably caused by the vasodilator reflex via the central nervous system . exposure to external laser stimulation in patients with ischemic heart disease produces improved rheology of blood , a protective effect on the erythrocyte membrane and an inhibition of lipid peroxidation . laser light illumination is also reported to reduce the re - stenosis rate after successful balloon angioplasty with coronary stent implantation . the improvement of microcirculation after biomodulation with lllt ( 780 nm ) has been demonstrated by magnetic resonance imaging ( mri ) . lllt is reported to enhance vasodilatation , as well as proliferation of microvasculature , and is also thought to increase the level of oxygen content in tissue . laser irradiation at 810 nm ( 10 , 30 and 110 mw ) has also been reported to inhibit the vascular contraction reaction induced by noradrenaline ( na ) and phenylephrine ( phe ) , due to stimulation of nitric oxide release and guanyl cyclase . there have also been reports of intravenous laser blood irradiation used to good effect in body - building athletes . positive effects have observed during laser therapy of venous ulcers ( 900 nm diode laser , pulsed ) combined with radiofrequency ( rf ) current . the main goal of our research was to evaluate the impact of lllt of the vertebral artery bilaterally on vbi symptoms , balance , and global stability using manual tests , the berg balance scale , and a freeman s balance platform . we examined 25 patients diagnosed with chronic vertebrobasilar insufficiency ( vbi ) , 20 females and 5 males , mean age 64 years . the patients were evaluated with de klyn s diagnostic test , followed by a qualitative assessment of stability , using a berg balance scale . this scale is composed of 14 tests evaluating mobility on a scale from 0 ( worst ) to 4 ( best ) , taking into account the time and accuracy of the specific activity . the tests were done three times : before treatment , 30 minutes after the first laser application , and after ten stimulation sessions . the next step was the evaluation of global stability , using a freeman electronic balance platform , the easytech libra ( figures 1 , 2 ) . the test lasted for 30 seconds , during which time the patient s task was to maintain a normal upright position on an unstable support plane . a ctl-1100 low power laser was used , with a probe of 810830 nm , power of 100 mw , and energy density of ed=4 j / cm ; the wave was modulated into a frequency of 6 khz . the laser probe at the top consisted of a 1 cm quartz window , and delivered a collateral beam . we have established our own protocol , which involves irradiation with a laser beam at 5 points on the skin along the vertebral artery in the cervical region , bilaterally , using delicate pressure . the irradiation was conducted 10 times : once a day from monday to friday for two weeks , with a weekend break . the analysis of results from the de klyn test before and after therapy was performed with cochran s q test , while the results from the berg balance scale were analyzed by calculating - the spearman rank correlation coefficient . to evaluate the statistical significance of all three tests , the friedman test was used , with the level of statistical significance assumed at p<0.05 . a ctl-1100 low power laser was used , with a probe of 810830 nm , power of 100 mw , and energy density of ed=4 j / cm ; the wave was modulated into a frequency of 6 khz . the laser probe at the top consisted of a 1 cm quartz window , and delivered a collateral beam . we have established our own protocol , which involves irradiation with a laser beam at 5 points on the skin along the vertebral artery in the cervical region , bilaterally , using delicate pressure . the irradiation was conducted 10 times : once a day from monday to friday for two weeks , with a weekend break . the analysis of results from the de klyn test before and after therapy was performed with cochran s q test , while the results from the berg balance scale were analyzed by calculating - the spearman rank correlation coefficient . to evaluate the statistical significance of all three tests , the friedman test was used , with the level of statistical significance assumed at p<0.05 . the results of all three tests were combined in order to evaluate the impact of laser irradiation on blood supply in the posterior region of the brain . no side effects or complications were observed during therapy . during the test , the patients were asked to answer questions about their symptoms : headache , vertigo , tinnitus and nausea ; the occurrence of nystagmus was also noted . we noticed a statistically significant reduction in complaints of headache ( p=0.0005 ) , vertigo ( p=0.0000 ) and tinnitus ( p=0.0387 ) after therapy . we did not observed any statistically significant differences in such symptoms as nausea ( p=0.8187 , n.s . ) and nystagmus ( p=0.3678 , n.s . ) statistical analysis of the results from the berg balance scale revealed statistically significant differences in almost all tested features ( table 1 ) . during the initial and final test , the patients received maximum scores for sitting unsupported and changing of position from sitting to standing . that is why we did not observe any statistically significant changes after treatment , due to the ceiling effect . the final evaluation of global stability , conducted on the easytech libra platform , was also analyzed statistically . we took into account the total surface of support , the spread surface of support , the extended time and the time of reaction . we observed a tendency towards improvement in all parameters after ten sessions of laser irradiation , but a statistically significant difference was observed only in the total surface of support ( p=0.017 ) and the spread surface of support for the left foot before and after therapy ( p=0.030 , p=0.025 ; figure 6 , table 2 ) . we did not observe any differences in any parameters when comparing results before and 30 minutes after the first session . during the test , the patients were asked to answer questions about their symptoms : headache , vertigo , tinnitus and nausea ; the occurrence of nystagmus was also noted . we noticed a statistically significant reduction in complaints of headache ( p=0.0005 ) , vertigo ( p=0.0000 ) and tinnitus ( p=0.0387 ) after therapy . we did not observed any statistically significant differences in such symptoms as nausea ( p=0.8187 , n.s . ) and nystagmus ( p=0.3678 , n.s . ) statistical analysis of the results from the berg balance scale revealed statistically significant differences in almost all tested features ( table 1 ) . during the initial and final test , the patients received maximum scores for sitting unsupported and changing of position from sitting to standing . that is why we did not observe any statistically significant changes after treatment , due to the ceiling effect . the final evaluation of global stability , conducted on the easytech libra platform , was also analyzed statistically . we took into account the total surface of support , the spread surface of support , the extended time and the time of reaction . we observed a tendency towards improvement in all parameters after ten sessions of laser irradiation , but a statistically significant difference was observed only in the total surface of support ( p=0.017 ) and the spread surface of support for the left foot before and after therapy ( p=0.030 , p=0.025 ; figure 6 , table 2 ) . we did not observe any differences in any parameters when comparing results before and 30 minutes after the first session . vertebrobasilar insufficiency ( vbi ) is a condition characterized by insufficient blood supply to the posterior portion of the brain , which is responsible for balance , coordination , vision and other functions . the most frequently reported accompanying symptoms in the studies by grad and baloh were visual ( diplopia , blindness , hallucinations ) . these are very alarming symptoms that usually bring the patient to consult a physician . in differential diagnosis it is important to exclude meniere s disease , migraine and labyrinthitis , and ischemic heart disease . it is also very important to perform manual tests to check for arterial occlusion or disturbances in blood supply due to osteoarthritis . the most popular instrument used in the diagnosis of vbi is de klyn s test . the berg balance test is often used to evaluate the level of balance disturbances occurring during simple activities of daily living . we also try to evaluate quantitative data pertaining to balance disturbances that occur during posture support on an unstable platform ( a freeman platform ) . the problem of vbi is especially important if the patient is over 55 and has other stroke risk factors . patients with these symptoms must quit smoking , lower the cholesterol level through diet , and exercise regularly . drugs are often used to control blood pressure , block platelet function , and lower the cholesterol level . the search is underway for other methods that may be useful in improving blood supply to the posterior regions of the brain . the basic mechanisms of interactions between different wavelengths and tissues are still not fully understood . steg was the first to study in vitro the influence of argon laser ( 488514.5 nm ) and power supply below 100 mw on vascular smooth muscle cells ( vsmcs ) . he noticed that lower doses of power supply ( < 100 mw ) caused vasodilatation , and high doses ( > 1 w ) caused vasoconstriction . the laser in pulse mode did not cause any reaction , but in constant mode caused vascular constriction . maegawa and toshiyuki demonstrated the influence of infrared laser ( 830 nm ) on vascular smooth muscle cells ( vsmcs ) . no can operate as a free radical or as an activator of guanyl cyclase ( gc ) . some authors decline that the heme included in gc serves as a chromophore absorbing laser and ultraviolet light . we studied a laser wavelength of 830 nm because of its deep penetration and proven clinical effect . we tried to demonstrate that it penetrates through the skin and reaches the vascular wall , where it initiates biochemical changes . schaffer et al . irradiated the planta pedis of healthy volunteers , teggi treated patients with meniere s disease , hirschl treated patients with raynaud s phenomenon , and trelles irradiated leg blood vessels with success . tullberg exposed the masseter muscle to a gallium - aluminium - arsenide laser because of muscle pain and demonstrated an increase in microcirculation . he concluded that 10 minutes after stopping irradiation , the diameter and blood flow volume of the artery had increased significantly . our results with a diode laser at =830 nm support these observations . in de klyn s test we observed a reduction in such symptoms as headache , vertigo and tinnitus after tens session of irradiation , due to better blood supply to the posterior regions of the brain . patients performed almost all tasks better after treatment than before , probably due to vasodilatation caused by changes in the vascular wall . 10 days of therapy improved blood circulation in the region of the vestibular nuclei , the cerebellum and the cerebellar peduncle . the better the blood supply , the better the tissue perfusion and nourishment . there were no effects of a single session . this is presumably the reason why patients improve in balance tasks after 10 sessions of laser stimulation . such improvement can not be gained due to transient vasodilatation , but rather thanks to better perfusion of nerve tissue and increased oxygen content . we can safely conclude that laser stimulation at 830 nm with a power supply of 100 mw can be a successful method in the treatment of patients with vertebrobasilar insufficiency . our results suggest that the main reason for improvement after 10 days of therapy in global stability and balance , along with reduction of vbi symptoms , is better blood perfusion and an increased level of oxygen in brain tissue . the procedures we used turned out to be very sensitive in the evaluation of vbi symptoms .

summarybackgroundthe purpose of our experiment was to determine whether laser stimulation can improve microcirculation in the posterior regions of the brain in patients with vertebrobasilar insufficiency ( vbi).material / methodswe studied 25 patients ( 20 female , 5 male , mean age 64 ) diagnosed with chronic vbi . all were evaluated using the de klyn test , followed by qualitative assessment of stability using a berg balance scale and evaluation of global stability using an electronic balance platform . a ctl-1100 low power laser was used with standard parameters . we established a protocol for laser irradiation at 5 points along the vertebral artery in the cervical region bilaterally . irradiation was performed 10 times over two weeks.resultssignificant improvement occurred after therapy in headache ( p=0.0005 ) , vertigo ( p<0.0000 ) , and tinnitus ( p=0.0387 ) . no significant differences were observed in nausea or nystagmus caused by head rotation . the berg balance scale results showed significant differences in almost all features . there was a tendency towards improved stability in all parameters , and statistically significant differences in the total surface of support and the spread surface of support for the left foot.conclusionslaser stimulation as applied in this study can be useful in the treatment of patients with vbi . the main reason for improvement in global stability , balance , and other vbi symptoms is better blood perfusion .

Background Material and Methods Device and parameters Statistical analysis Results De Klyns test Berg Balance Scale Discussion Conclusions

a 2-month - old boy weighing 2000 g was planned to undergo laser photocoagulation for rop under general anesthesia . he was born at 28 weeks gestation , weighing 1190 g. his apgar scores were 6 at 1 min and 7 at 5 min . he required 1 week of mechanical ventilation for respiratory distress syndrome and was ultimately diagnosed with moderate grade bpd , which required supplemental oxygen ( o2 ; 1 l / min via nasal cannula ) . he developed a grade ii intraventricular hemorrhage and underwent an external ventricular drain operation due to post - hemorrhage hydrocephalus 1 week before rop surgery . general anesthesia was established by inhalation anesthesia using sevoflurane ; there were no associated adverse events . preoperative evaluation revealed fair patient condition with a blood pressure of 65/40 mmhg , heart rate of 130 beats / min , and spo2 of 95% under the aforementioned supplemental oxygen fifteen minutes before the surgery , one drop of 1% tropicamide followed 30 s later by one drop of 2.5% phenylephrine was instilled in each eye twice at 5 min intervals . at the operation room , the patient 's spo2 was 92% under o2 ( 1 l / min via nasal cannula ) , systolic blood pressure 70 mmhg , and heart rate 125 beats / min . anesthesia was induced by inhalation of sevoflurane . during manual ventilation using face mask with 100% o2 and 6 vol% sevoflurane , spo2 did not increase above 92% . after tracheal intubation with a 3.0 mm internal diameter endotracheal tube , spo2 remained 90% under fio2 1.0 and scattered wheezing was detected in both lung fields . under pressure - controlled ventilation , the tidal volume was only 7 - 8 ml at a pressure of 20 mmhg , end - tidal concentration of sevoflurane 3.8 - 3.9% , and end - tidal carbon dioxide 30 mmhg . salbutamol nebulization was applied immediately and 5 min after the induction of anesthesia , spo2 increased gradually to 96% and the wheezing was resolved incompletely . therefore , fio2 could be reduced to 0.3 - 0.5 to maintain the target spo2 , 90 - 94% , during the surgery . next morning , extubation was performed and supplemental o2 ( 1 l / min ) was continuously administered via nasal cannula . he was born at 25 weeks gestation and weighed 1000 g. his apgar scores were 8 at 1 min and 9 at 5 min . he required 3 weeks of nasal cpap therapy for respiratory distress syndrome and was ultimately diagnosed with moderate grade bpd , which required supplemental oxygen . one drop of 1% tropicamide followed 30 s later by one drop of 2.5% phenylephrine was instilled in each eye . at that time he was receiving o2 ( 1 l / min via nasal cannula ) . five minutes later , a second drop of both tropicamide and phynylephrine were instilled in each eye . about 10 min later , his saturation on pulse oximetry was slowly decreased from 94 to 88% , and mild wheezing was detected on both lung fields . blood pressure was 75/40 mmhg and heart rate was 135 beats / min . during preparation of the nebulizer , he received o2 at a rate of 8 l / min through a face mask , followed by inhaled salbutamol while positioned slightly head - up position with o2 supplied continuously through the nasal cannula . the saturation was restored to 93 - 94% and the wheezing was resolved after 20 min . follow - up chest radiograph revealed no interval changes . at the next eye review , a 2-month - old boy weighing 2000 g was planned to undergo laser photocoagulation for rop under general anesthesia . he was born at 28 weeks gestation , weighing 1190 g. his apgar scores were 6 at 1 min and 7 at 5 min . he required 1 week of mechanical ventilation for respiratory distress syndrome and was ultimately diagnosed with moderate grade bpd , which required supplemental oxygen ( o2 ; 1 l / min via nasal cannula ) . he developed a grade ii intraventricular hemorrhage and underwent an external ventricular drain operation due to post - hemorrhage hydrocephalus 1 week before rop surgery . general anesthesia was established by inhalation anesthesia using sevoflurane ; there were no associated adverse events . preoperative evaluation revealed fair patient condition with a blood pressure of 65/40 mmhg , heart rate of 130 beats / min , and spo2 of 95% under the aforementioned supplemental oxygen fifteen minutes before the surgery , one drop of 1% tropicamide followed 30 s later by one drop of 2.5% phenylephrine was instilled in each eye twice at 5 min intervals . at the operation room , the patient 's spo2 was 92% under o2 ( 1 l / min via nasal cannula ) , systolic blood pressure 70 mmhg , and heart rate 125 beats / min . anesthesia was induced by inhalation of sevoflurane . during manual ventilation using face mask with 100% o2 and 6 vol% sevoflurane , spo2 did not increase above 92% . after tracheal intubation with a 3.0 mm internal diameter endotracheal tube , spo2 remained 90% under fio2 1.0 and scattered wheezing was detected in both lung fields . under pressure - controlled ventilation , the tidal volume was only 7 - 8 ml at a pressure of 20 mmhg , end - tidal concentration of sevoflurane 3.8 - 3.9% , and end - tidal carbon dioxide 30 mmhg . salbutamol nebulization was applied immediately and 5 min after the induction of anesthesia , spo2 increased gradually to 96% and the wheezing was resolved incompletely . therefore , fio2 could be reduced to 0.3 - 0.5 to maintain the target spo2 , 90 - 94% , during the surgery . next morning , extubation was performed and supplemental o2 ( 1 l / min ) was continuously administered via nasal cannula . he was born at 25 weeks gestation and weighed 1000 g. his apgar scores were 8 at 1 min and 9 at 5 min . he required 3 weeks of nasal cpap therapy for respiratory distress syndrome and was ultimately diagnosed with moderate grade bpd , which required supplemental oxygen . for mydriasis , one drop of 1% tropicamide followed 30 s later by one drop of 2.5% phenylephrine was instilled in each eye . at that time he was receiving o2 ( 1 l / min via nasal cannula ) . five minutes later , a second drop of both tropicamide and phynylephrine were instilled in each eye . about 10 min later , his saturation on pulse oximetry was slowly decreased from 94 to 88% , and mild wheezing was detected on both lung fields . blood pressure was 75/40 mmhg and heart rate was 135 beats / min . during preparation of the nebulizer , he received o2 at a rate of 8 l / min through a face mask , followed by inhaled salbutamol while positioned slightly head - up position with o2 supplied continuously through the nasal cannula . the saturation was restored to 93 - 94% and the wheezing was resolved after 20 min . follow - up chest radiograph revealed no interval changes . at the next eye review , the sudden occurrence of bronchospasm after anesthesia induction can originated from various factors including inadequate depth of anesthesia , endobronchial intubation , partially obstructed tube , and drug - induced anaphylactic reaction . the first case presented with a duration of 10 min and self - limited , bilateral wheezing , normal blood pressure , and heart rate without skin changes , hypotension , and angioedema . furthermore , this patient underwent general anesthesia 1 week before and 1 week after the surgery by the same anesthesiologist and through the same methods of inhalation anesthesia ( vima ) . considering this information , a main cause other than related with anesthesia was searched for . an alternative explanation for the desaturation event could be possible acute pulmonary congestion following pulmonary hypertension due to the abrupt increased left - to - right shunt in pda patients . however , this hypothesis was not be supported by physical examination ; he had definite wheezing , not crepitations . interestingly , we were briefed concerning some episodes of desaturation following instillation of mydriatics in premature infants at our pediatric intensive care unit ; they had similar clinical presentations with case 2 . therefore , associated relationships between the mydriatics and the co - existing diseases of premature infants were strongly suspected . there is no definite guideline for dosage of phenylephrine ophthalmic solution and the historic recommendation for instillation of phenylephrine ophthalmic drops in infants is 1 drop of 2.5% solution in each eye every hour . however , clinicians ' concern that is biased towards local mydriatic effect can lead to larger administration of ophthalmic drops , as in these cases and other reports relevant to adverse effects . meanwhile , a question of the difference arises because there are many former infants with bpd who underwent ophthalmic examination in this institute who did not experience bronchoconstriction . we investigated the incidence of wheezing combined with desaturation , which is closely related temporally to the instillation of phenylephrine in patients with bpd of our neonatal intensive care unit during last 6 months . therefore , our clinicians are now paying particular attention to the dosage of the drug and conduct monitoring during ophthalmic examination of the infants with bpd , even though the causal relationship between bpd severity and the occurrence of bronchoconstriction remains unknown . bpd , or chronic lung disease of infancy , occurs in 40% of very low - birth - weight infants and the development increases as the birth weight descends below 1500 g. the assessment of bpd is conducted at 28 days postnatally or 36 weeks postmenstrual age on the basis of o2 requirement . the disorder is classified as mild , moderate , or severe following gestational age and the degree of o2 requirement . the clinical features of bpd include tachypnea , intercostals retractions , increased airway resistance , wheezing or coarse crackle , and reactive airway . meanwhile , mirmanesh et al . have demonstrated bronchoprovocation in bpd infants using phenylephrine eye drops but not in control infants . the authors concluded that the -adrenergic activity of phyenylephrine could exacerbate the bronchospastic component of bpd . increased -adrenergic activity has been suggested as a contributor to bronchoconstriction in asthmatic patients and -receptor antagonists mitigates asthmatic symptoms . phenylephrine reportedly tends to increased airway obstruction in sporadic asthma although it was not consistent in severe asthma . the present cases appear to be bronchospasm in premature infants during anesthesia induction and ophthalmic examination . it seems to be the more reasonable interpretation that aggravated bronchospastic component of bpd infant might be induced by -adrenergic eye drops worsened by the airway stimulation during tracheal intubation . this view supports the inference that desaturation did not occur at screening of rop using one drop of phenylephrine . the other reported side effects of phenylephrine are increased blood pressure , cardiac arrhythmia , renal failure , and pulmonary edema . shell reported that 80% of the volume of eye drop passes down the nasolacrimal canal , which is highly vascular mucosa , where it can enter the systemic circulation . the estimated standard drop volume is about 35.4 l and this fixed volume is far less diluted by circulating blood in infants who have much smaller volume . therefore , efforts to reduce the drop volume for minimalization of side effects have been performed ; other methods are punctuate pressure and eyelid closure . the present two patients had slight changes in blood pressures and heart rates during the events , but these were not serious . phenylephrine plasma concentration after administration of a 2.5% solution to anesthetized adult patients was reported as 2 - 3 ng / ml after 10 - 20 min , with no serious cardiovascular side effects . it is difficult to estimate the exact volume of administered phenylephrine into the eyes in this report because excess drugs flowed down out of the eyes when eyelids were closed after instillation . therefore , the use of reduced volume of the drug is more important in infant patients . from the cases described above , phenylephrine can be a causative agent to initiate or aggravate bronchoconstriction in premature infants affected by bpd ; although the causal relationship can not be definitely concluded . we recommend that the minimal dosage of phenylephrine needed to attain proper mydriasis should be instilled to infant patients , and the possibility of bronchoconstriction occurrence could be kept in mind , especially in case of infants with lower body weights who are affected by bpd .

premature infants requiring an ophthalmic examination or even surgery for retinopathy of prematurity ( rop ) have a high prevalence of co - existing bronchopulmonary dysplasia ( bpd ) . reactive airway is one of the clinical presentations of bpd . we report two cases of bronchoconstriction following instillation of mydriatic eye drops . one occurred during induction of anesthesia for laser photocoagulation and the other before screening of rop . the most likely cause in each case was phenylephrine eye drops . we recommend that the minimal dosage of phenylephrine needed to attain proper mydriasis should be instilled to infant patients , and the possibility of bronchoconstriction occurrence kept in mind , especially for infants with low body weight with bpd .

Case Reports Case 1 Case 2 Discussion

clinical future and treatment of some of the vaginitis , such as trichomonas vaginitis ( tv ) , vulvovaginal candidiasis ( vvc ) and bacterial vaginosis ( bv ) are well defined , while other abnormal vaginal conditions are yet to be defined . in 2002 , ( 1 ) suggested term aerobic vaginitis ( av ) based on bacteriological , immunological and clinical characteristics . this study has been conducted for better understanding of frequency and clinical characteristics of av , where symptoms , signs and laboratoty tests ( ph and amino - odor test ) have been analyzed in patients diagnosed with one or mixed infections . these results should help in clinical determination of the causes for vaginal symptoms and more accurate diagnosis and treatment of av . examine clinical characteristics of aerobic vaginitis and mixed infection for the purpose of better diagnostic accuracy and treatment efficiency . prospective research has been conducted at clinic for gynecology and obstetricity , department for microbiology and pathology at polyclinic for laboratory diagnostic and gynecology and obstetricity department at health center sapna in period from may 2007 till january 2008 . the examinees with clinical signs of vaginitis had some of the stated symptoms ( increased vaginal secretion , changed colour of secretion , changed colour of vaginal walls , subjective problems , changed ph value of vaginal environment and positive amino - odor test ) . examination programme consisted of three parts : taking anamnesis data ( interview)clinical gynecological examinationmicrobiological examination of vaginal and cervical smear taking anamnesis data ( interview ) clinical gynecological examination microbiological examination of vaginal and cervical smear interview consisted of the following data : age of the examinee , marital status , number of deliveries , number of miscarriages and symptoms which indicated presence or absence of vaginitis . speculum examination showed clinical characteristics of vaginal wall : redness , presence of vaginal secretion and change in its quality . presence of 3 or more clinical characteristics are considered to be positive for diagnosis of vaginitis . determination of ph value of vaginal environment was performed with indicator tape with span from 0 to 14 . colour indicator tape was put on lateral arch of vagina and results showed on the tape within 30 - 60 seconds . ph value above 4,0 was considered significant in vaginitis diagnosis . after determining ph value of vaginal environment , test included putting vaginal secretion on the glass and pouring 2 - 3 drops of 10% koh . after that , vaginal and cervical smears were taken for microbiological analysis of aerobic and anaerobic microorganisms and antibiogram . smear that was taken for the microbiolgical analysis has been examined with standard microbiological methods : examination of the preparation coloured by gram and cultivated on standard microbiological bases such as blood and endo agar and identification of increase with biochemical methods . examination to resistence has been done by disc - difuse method on mler - hinton base . analysis of vaginal flora was performed under the microscope with 400 times magnification where presence and absence of lactobacili , change of flora considering presence of coccus bacterial flora or short curved sticks and combinations , presence of clue cells and presence of parasites and fungi were recorded . leukocyte finding was graded by number of leukocytes found under the 400 times magnification in the field of view : result with less than 10 leukocytes in the field of view and result with more than 10 leukocytes in the field of view . bv is defined with findings that have 3 out of 4 possible criterion : liquid homogenous grey secretion , presence of clue cells , ph value higher than 4,0 and positive aminoodor test . av was determined based on criterion by donders : enhanced yellow secretion , ph value 5 , negative aminoodor test , increased number of leukocytes > 10 , absence of lactobacilli and microbiologically isolated microorganisms : escerichia coli ( e. coli ) , staphylococcus aureus , group b streptococcus and enterococci . findings were processed by methods of descriptive statistics , student t - test , x test . differences for values p<0,05 were considered statistically significant and differences for values p<0,01 statistically highly significant . the examined group of women n-100 were in reproductive period with average age of 32,622,6 , and married in 85% ( n-85 ) . examining vaginal smears of the examinees with signs of vaginitis in 96% ( n-96 ) different microorganisms which belong to aerobic and anaerobic bacteria , protozoa and av has been found in 51% ( n-51 ) of the examinees , candida albicans in 17% ( n-17 ) , bv in 15% ( n-15 ) , trichomonas vaginalis in 13% ( n-13 ) and 4% ( n-4 ) of the examinees did nt have microbiological cause of vaginitis . in 21% ( n-21 ) of the examinees av most common causes of av are e. coli ( n-55 ) and e. faecalis ( n-52 ) . av and candida albicanis have been found in ( 13/30 , 43% ) , trichomonas vaginalis in ( 9/30 , 30% ) and bv ( 8/30 , 26% ) . examining clinical characteristics of av and associated infections of av and vvc , tv and bv , enhanced secretion has been recorded in 100% ( n-51 ) of the examinees with different characteristics of vaginal secretion ( table 1 . ) vaginal secretion is in 70,05% ( n-36 ) yellow coloured , secretion of thick consistency is in 61,53% ( n-31 ) and changed smell of secretion is in 29,94% ( n-15 ) of the examinees with av . colour of vagina wall changed into red is recorded in 31,13% ( n-16 ) and pruritis or itching in genital area had 72,54% ( n-37 ) of the examinees with av . increased ph value of vagina has been found in 94,10% ( n-48 ) and normal in 5,88% ( n-3 ) . ph value 5 in 72,54% ( n-37 ) and ph value 6 in 21,56% ( n-11 ) . legend : a - arithmetic mean + standard tolerance traits of vaginal secretion , clinical and biochemical characteristics of the examinees with signs of av results of microbiological examination of the examinees with signs of vaginitis most of the examinees had ph value 5 . the average ph value of vaginal environment in the examinees with av was 5,150,54 and in associated presence of av and vvc , tv and bv was 5,290,56 which is higher value considering presence of av alone but that is not statistically significant difference ( p>0,05 ) . amino - odor test was negative in the examinees with av , while with associated infections it was positive in 29,94% ( n-15 ) . microbiological examination hasnt recorded presence of lactobacili in vaginal secretion while leukocytes have been elevated in all of the examinees with av in 100% ( n-51 ) . in 1990 helen mcdonald warned that women with the risk of preterm labor had two types of abnormal vaginal secretion , first is bv and second are other aerobic microorganisms such as e.coli and klebsiella ( 2,3 ) . in 80 - 90% of cases enhanced vaginal secretion is associated with microbiological cause which can be identified and most of the vaginal infections are consequence of the infection with synergistic bacteria ( bacterial vaginosis and nonspecific vaginitis ) , fungi ( vulvovaginal candidiasis ) and protozoa ( trichomoniasis ) . it is considered that approximately 50% of infections are caused by bacteria and 50% by fungi and parasite ( 4 ) . in this research aerobic bacteria play significant role in ethiology of vaginitis and they are often associated with two or more causes which indicates to polymicrobe ethiology of vaginitis ( 5 ) . av has been found in 51% ( n-51 ) , alone in 21% ( n-21 ) and associated in 30% ( n-30 ) . it is most commonly associated with candida albicans in ( 13/30 , 43% ) , trichomonas vaginalis in ( 9/30 , 30% ) and bv in ( 8/30 , 26% ) . in similar studies of av fan founds av as the main cause of vaginitis in one study in 14,7% and in other in 23,74% . in 58% av is mixed with another causes such as vvc in 30% , tv in 25% and bv in 45% ( 6,7 ) . percentage of representation of av in our research is higher in relation to the quoted one but the percentage of association with other types is the same . although many studies state that the frequency of av is still unknown ( 8) , the frequency in pregnant women is in 25% . av is mostly caused by e.coli and e.faecalis while other causes havent been found in this research , although donders states that causes of av are : e. coli , enterococi , staphylococcus sp . and group b of streptococcus ( 9 ) . e.coli is cited as one of the most common causes of this vaginitis and sometimes is isolated alone . the role of e.coli in vaginitis is very contraversial and this microorganism is one of the main causes of neonatal sepsis and chorioamnionitis ( 10 ) . enhanced and changed vaginal secretion has been found in all of the examinees with av , that is with yellow coloured secretion in 70,05% ( n-36 ) which is similar to fan research who found yellow vaginal secretion in 63% of the examinees with av . red colour of vagina walls has been recorded in 31,13% ( n-16 ) and pruritus or itching in 72,54% ( n-37 ) of the examinees with av . elevated ph value of vaginal environment has been found in 94,10% ( n-48 ) , while in similar study ph higher than 4,5 has been found in 84% of the examinees with av ( 10 ) . the absence of lactobacilli ( 11 ) is a characteristic of av and in this study lactobacilli havent been found in the examinees with av . donders also , in several of his studies , records abnormal status of lactobacilli , that is , their absence , which is a negative factor and enables development of infection , especially in pregnancy ( 11 , 12 , 13 , 14 , 15 ) . enhanced number of leukocytes has been found in 100% ( n-51 ) of the examinees . the other studies also confirm abnormal vaginal flora in women with the risk for preterm labor and presence of e.coli with or without signs of inflamation and increased number of leukocytes in secretion ( 16 , 17 , 18 ) . av is frequent infection of lower genital system and it does nt differentiate from other vaginal infections by its clinical characteristics . in high percentage it is associated with other infections . it is very important to pay attention to presence of av as mixed infection or special entity when dignosing vaginitis , especially in pregnancy . therapeutic treatment of av differentiates from other types of vaginitis and wrong diagnose can lead to wrong treatment and complications .

abstractaim of the work : examine clinical characteristics of aerobic vaginitis and mixed infection for the purpose of better diagnostic accuracy and treatment efficiency.materials and methods : prospective research has been conducted at clinic for gynecology and obstetrics , department for microbiology and pathology at polyclinic for laboratory diagnostic and gynecology and obstetrics department at health center sapna . examination included 100 examinees with the signs of vaginitis.examination consisted of : anamnesis , clinical , gynecological and microbiological examination of vaginal smear.results:the average age of the examinees was 32,622,6 . examining vaginal smears of the examinees with signs of vaginitis in 96% ( n-96 ) different microorganisms have been isolated , while in 4% ( n-4 ) findings were normal . av has been found in 51% ( n-51 ) of the examinees , candida albicans in 17% ( n-17 ) , bv in 15% ( n-15 ) , trichomonas vaginalis in 13% ( n-13 ) . in 21% ( n-21 ) av was diagnosed alone while associated with other agents in 30% ( n-30 ) . most common causes of av are e. coli ( n-55 ) and e. faecalis ( n-52 ) . av and candida albicanis have been found in ( 13/30 , 43% ) , trichomonas vaginalis in ( 9/30 , 30% ) and bv ( 8/30 , 26% ) . vaginal secretion is in 70,05% ( n-36 ) yellow coloured , red vagina wall is recorded in 31,13% ( n-16 ) and pruritus in 72,54% ( n-37 ) . increased ph value of vagina found in 94,10% ( n-48 ) . the average ph value of vaginal environment was 5,150,54 and in associated presence of av and vvc , tv and bv was 5,290,56 which is higher value considering presence of av alone but that is not statistically significant difference ( p>0,05 ) . amino - odor test was positive in 29,94% ( n-15 ) of associated infections . lactobacilli are absent , while leukocytes are increased in 100% ( n-51 ) of the examinees with av.conclusion:av is vaginal infection similar to other vaginal infections . it is important to be careful while diagnosing because the treatment of av differentiates from treatment of other vaginitis .

1. INTRODUCTION 2. AIM OF THE WORK 3. MATERIALS AND METHODS 4. RESULTS 5. DISCUSSION

lipopolysaccharide ( lps ) is a major component of the cell wall of gram - negative bacteria and is a well - known potent inducer of inflammation and inflammatory bone loss [ 15 ] . lps is known to induce the production of many local factors , including proinflammatory cytokines , such as tnf- and il-1 , from macrophages or other cells involved in mediating the inflammatory response in tissues . there is reason to suggest that osteoclast recruitment could be central to diseases involving bone erosion , such as rheumatoid arthritis , periprosthetic bone loss , postmenopausal osteoporosis , and periodontal disease . such osteoclast formation and activation require the expression of two factors : receptor activator of nf-b ligand ( rankl ) and macrophage colony stimulating factor ( m - csf ) . furthermore , tumor necrosis factor- ( tnf- ) has also been reported to induce osteoclast formation in vitro [ 1214 ] and in vivo [ 15 , 16 ] . these inflammatory cytokines have been linked with lps - induced osteoclast formation and bone destruction in vivo and in vitro [ 2 , 1720 ] . muramyl dipeptide ( mdp ) , the minimal essential structural unit responsible for the immunological activity of pgns , is distributed ubiquitously in the cell walls of both gram - negative and gram - positive bacteria . it has been reported that mdp can enhance the production of tnf- when injected into mice and can cause lethal shock in mice challenged with lps . in addition , mdp has been shown to synergistically enhance lps - induced proinflammatory cytokine production in human monocyte cells . mdp alone can not induce osteoclast formation in mouse cocultures of primary osteoblasts and hematopoietic cells ; however , it can enhance osteoclast formation induced by lps , il-1 , and tnf- but not by 1,25-dihydroxy - vitamin - d3 ( 1,25(oh)2d3 ) or prostaglandin - e2 ( pge2 ) . indeed , it has been shown that mdp can upregulate rankl expression in osteoblasts treated with lps or tnf- but not those treated with 1,25(oh)2d3 . in this study , we show that mdp enhances lps - induced osteoclast formation in vivo and increases the expression of rankl in vivo and in stromal cell cultures in vitro . mdp also enhances the lps - induced expression of tlr4a signal transducing receptor for lps both in vivo and in stromal cells in vitro . two- to 10-week - old male c57bl6/j mice were purchased from clea japan ( tokyo , japan ) for use in this study . escherichia coli lps was purchased from sigma - aldrich ( st . louis , mo ) . ( beverly , ma ) : polyclonal anti - phospho - p44/42erk , anti - phospho - jnk , anti - phospho - p38 , anti--actin , and anti - rabbit igg horseradish peroxidase- ( hrp- ) linked antibodies . mice calvariae were injected daily for 5 days with pbs , lps alone ( 10 g / day or 100 g / day , referred to as low or high , resp . ) , mdp ( 100 g / day ) alone , or lps ( 10 g / day ) and mdp ( 100 g / day ) ( lps + mdp ) . the mice were then sacrificed , and the calvariae were immediately harvested and fixed overnight in 4% paraformaldehyde at 4c . samples were then demineralized in 14% ethylene - diaminetetraacetic acid for 3 days at 4c . the sections were stained for trap activity and counterstained with hematoxylin for analysis of osteoclast formation . in addition , the percentage of interface of bone marrow space covered by osteoclasts was histomorphometrically determined in specimens derived from each sample . serum was obtained from mice after 5 days of daily lps administration with or without mdp . the levels of tracp 5b were determined using a mouse trap assay kit ( ids , tyne and wear , uk ) . tracp 5b levels were measured at 405 nm using an absorption microplate reader ( model 550 ; bio - rad , richmond , ca ) . the levels of c - terminal telopeptide fragments of type i collagen were determined using a mouse ctx assay kit ( ids , tyne and wear , uk ) . c - terminal telopeptide fragments of type i collagen levels were measured at 450 nm using an absorption microplate reader ( model 550 ; bio - rad , richmond , ca ) . for in vitro experiments , bone marrow cells from the femora and tibiae of mice were flushed with culture medium . the harvested cells were incubated in dulbecco 's modified eagle 's medium ( dmem ; sigma - aldrich ) containing 10% fetal bovine serum , 100 iu / ml penicillin g ( life technologies , carlsbad , ca ) , and 100 g / ml streptomycin ( life technologies ) . after 2 weeks of culture , cells were washed with pbs to remove floating cells . adherent cells from these cultures were used as bone marrow stromal cells in this study . adherent bone marrow stromal cells were incubated in culture medium supplemented with high or low lps alone , lps + mdp , or mdp alone . after 3 days of culture , total rna was isolated from adherent cells using an rneasy mini kit ( qiagen , valencia , ca ) . for in vivo experiments , harvested calvariae were frozen in liquid nitrogen , ground using a micro smash ms-100r ( tomy seiko , tokyo , japan ) , and then centrifuged in 800 l of trizol reagent ( invitrogen , carlsbad , ca ) . all cdna was synthesized from 2 g of total rna using reverse transcriptase and oligo - dt primers ( invitrogen ) in a reaction volume of 20 l . the mrna expression levels of trap , cathepsin k , rankl , and tlr4 were quantified by real - time rt - pcr using a thermal cycler dice real time system ( takara , shiga , japan ) . reactions were performed in a 25 l volume containing 2 l of cdna , 12.5 l of sybr premix ex taq ( takara ) , and 25 pmol/l primers . the cycling conditions were as follows : 95c for 10 s for initial denaturation followed by 45 cycles of amplification , with each cycle consisting of a denaturation step at 95c for 5 s and an annealing step at 60c for 30 s. gene expression levels were normalized to glyceraldehyde 3-phosphate dehydrogenase ( gapdh ) mrna . the following primers were used : for gapdh , 5-ggtggagccaaaagggtca-3 and 5-gggggctaagcagttg - gt-3 ; cathepsin k , 5-gcagaggttgtactatga-3 and 5-gcaggcgttgttcttatt-3 ; trap , 5-aacttgcgaccattgtta-3 and 5-ggggacctttcgttgatgt-3 ; rankl , 5-cctgaggccagccattt-3 and 5-cttggcccagcct-3 ; and tlr4 , 5-cactgttcttctcctgcctgac-3 and 5-tggttgaagaaggaatgtcatc-3. calvariae were harvested and the soft tissues were carefully removed . calvariae were then fixed in pbs - buffered formaldehyde ( 4% ) for 3 days at 4c and then washed with pbs for radiological analysis . microfocus computed tomography ( scanxmate - e090 ; comscan , kanagawa , japan ) was used to assay the bone resorption pits in the calvariae , and tri/3d - bon64 software ( ratoc system engineering , tokyo , japan ) was used to build three - dimensional reconstruction images of the calvariae . the ratio of bone destruction to total area was calculated using imagej ( nih , bethesda , md ) . stromal cells were cultured in serum - free dmem for 3 h before treatment with lps and/or mdp for the various durations , as indicated . treated cells were washed twice with ice - cold pbs and then lysed in lysis buffer ( cell signaling technology ) containing a protease inhibitor mixture . cell lysates ( 30 g ) were boiled in the presence of lithium dodecyl sulfate sample buffer ( life technologies ) for 5 min and subjected to sds polyacrylamide gel electrophoresis using 415% mini - protean tgx gels ( bio - rad , hercules , ca ) . proteins were transferred to nitrocellulose membranes using trans - blot turbo ( bio - rad ) and incubated in blocking solution ( 5% bovine serum albumin in tris - buffered saline containing 0.05% tween-20 ) for 1 h to reduce nonspecific binding . membranes were then exposed to primary antibodies for 1 h at 4c , washed four times , and then incubated with anti - rabbit igg hrp - conjugated secondary antibody for 30 min . membranes were again washed extensively and then incubated with enhanced chemiluminescence detection using supersignal west femto maximum sensitivity substrate ( thermo fisher scientific , wilmington , de ) . lps was administered with or without mdp into the supracalvariae of mice to analyze the effect of mdp on lps - induced osteoclastogenesis in vivo . in the high lps ( 100 g / day ) group and the lps + mdp group , numerous osteoclasts were observed . in comparison , significantly fewer osteoclasts were observed in the low lps ( 10 g / day ) , mdp alone , or pbs groups ( figures 1(a ) , 1(b ) , 1(c ) , and 1(d ) ) . real - time rt - pcr was undertaken to analyze cathepsin k and trap mrna levels two markers of osteoclasts . we found that both cathepsin k and trap mrna were significantly higher in the lps + mdp group and the high lps group as compared with the low lps group ( figure 1(e ) ) . to further analyze the effect of mdp on lps - induced osteoclast formation in vivo , lps ( 10 g / day ) was injected into mouse calvariae with increasing concentrations of mdp ( 0 , 1 , 10 , and 100 g ) . we found that higher mdp concentrations led to an increase in osteoclast number in a dose - dependent manner ( figure 2 ) . we next used microfocus computed tomography to assess the degree of bone destruction observed in the calvariae of mice administered with lps ( figure 3(a ) ) . we found significantly more bone destruction in the high lps group as compared with the pbs group . in addition , bone destruction in the lps + mdp group was higher than that in the low lps group ( figure 3(b ) ) . this increased bone destruction was corroborated by the tracp 5b serum analysis , where we found that tracp 5b was increased in the high lps group as compared with that in the pbs , low lps , and mdp only groups . moreover , tracp 5b serum levels were higher in the lps + mdp group than in the pbs , low lps , and mdp only groups ( figure 3(c ) ) . c - terminal telopeptide fragments of type i collagen serum levels were also higher in the lps + mdp group than in the pbs , low lps , and mdp only groups ( figure 3(d ) ) . we found that rankl mrna was elevated in the high lps and lps + mdp groups as compared with pbs , low lps , and mdp alone groups . mdp was thus able to enhance lps - induced rankl expression in vivo ( figure 4 ) . bone marrow stromal cells were cultured for 3 days in the presence of lps with or without mdp to ascertain the effect of these two additives on rankl expression in stromal cell cultures in vitro . we found elevated rankl mrna expression in the high lps group as compared with the pbs , low lps , and mdp alone groups . similarly , rankl mrna was significantly higher in the lps + mdp group as compared with the pbs and low lps groups ( figure 5 ) . pth ( 100 g / day ) was administered with or without mdp into mouse supracalvaria to analyze the effect of mdp on pth - induced osteoclastogenesis in vivo . we observed numerous osteoclasts with the higher concentration of pth ( 10 g / day ) , which was significantly diminished in mice treated with low - dose pth ( 1 g / day ) , pth ( 1 g / day ) + mdp , mdp alone , or pbs ( figures 6(a ) , 6(b ) , 6(c ) , and 6(d ) ) . cathepsin k and trap mrna levels were significantly increased in the high pth group as compared with the pth + mdp , pbs , low pth , and mdp alone groups ( figure 6(e ) ) . mice calvariae were injected daily for 5 days with pth ( 1 g ) + mdp ( 100 g ) in a 100 l volume of pbs or separately with high pth ( 10 g ) , low pth ( 1 g ) , mdp ( 100 g ) , or pbs alone to ascertain the effect of these compounds on rankl . we found that rankl mrna was higher in the high pth group than in the pth + mdp , pbs , low pth , or mdp alone groups ( figure 6(f ) ) . we next determined the effect of mdp on lps- and pth - induced tlr4 expression , a receptor for lps . we found that tlr4 mrna expression levels were higher in the high lps and lps + mdp groups than in the pbs , low lps , and mdp alone groups . on the other hand , pth did not induce tlr4 mrna and mdp did not enhance tlr4 mrna in the presence of pth ( figure 7 ) . bone marrow stromal cells were cultured for 3 days in lps or pth with or without mdp . in these cultures , we show that tlr4 mrna with high lps ( 100 ng / ml ) was higher than that in the pbs , low lps ( 10 ng / ml ) , or mdp alone groups . in addition , tlr4 mrna expression in the lps ( 10 ng / ml ) + mdp group was significantly higher than that in the pbs and low lps ( 10 ng / ml ) groups . as seen in the in vivo analysis , pth was also unable to induce tlr4 mrna in stromal cells and this could not be recovered with the coadministration of mdp ( figure 8) . finally , we sought to explore the molecular mechanisms through which mdp enhances lps - activated signaling . we showed that lps activated erk , p38 , and jnk in mouse bone marrow stromal cells after 15 min incubation . mdp alone was unable to induce phosphorylation of any of the kinases ; however , mdp enhanced lps - induced phosphorylation of all three kinases after just 15 min of incubation ( figure 9 ) . in this study , we evaluated the effect of mdp in lps - induced osteoclast formation and bone resorption in vivo . to our knowledge , this is the first time that this analysis has been reported . we found that mdp enhances lps - induced osteoclast formation and bone resorption and also enhances lps - induced rankl and tlr4 expression in vivo and in stromal cell in vitro . furthermore , mdp enhanced lps - induced phosphorylation of erk , p38 , and jnk kinases in stromal cells , although mdp alone could not induce their activity . it has been reported that lps can induce osteoclast formation and bone resorption in certain clinical conditions , such as periodontal diseases [ 2 , 25 ] . we have previously shown that osteoclasts can be induced in calvariae and in periodontal membrane tissues in the presence of lps . yang et al . showed that mdp enhances lps - induced osteoclast formation when cocultured with osteoblasts in vitro . in the present study , we evaluated whether mdp could enhance lps - induced osteoclast formation and bone resorption in vivo . we found that a daily injection of 100 g / day for 5 days was sufficient to induce osteoclasts in vivo , but not with injections of 10 g / day for 5 days . next , to analyze the effect of mdp on lps - induced osteoclastogenesis in vivo , the lower concentration of lps was administered with or without mdp into mouse supracalvaria . we found increased numbers of osteoclasts and an elevated expression of osteoclast markers ( cathepsin k and trap ) with high lps ( 100 g / day ) and with low lps ( 10 g / day ) plus mdp but not with low lps ( 10 g / day ) or mdp alone or with the vehicle , pbs . serum tracp 5b levels with lps ( 10 g ) plus mdp were higher than that in the lps only group . investigated the effect of pgn on lps - induced osteoclast formation and bone resorption and found that pgn significantly induced osteoclast formation and bone resorption in mice coinjected with lps . thus , it is likely that mdp might be the key component in lps - induced osteoclast formation and bone resorption as mediated by pgn . lps has also been reported to stimulate osteoblast production / secretion of rankl . in the present study , we , too , found elevated rankl mrna levels in the high - dose lps group as compared with the control groups both in vivo and in vitro , indicating that lps induced rankl expression in stromal cells . yang et al . also examined osteoblasts cultured in the presence of lps with or without mdp . however , we showed that mdp alone could not induce rankl expression either in vitro or in vivo , suggesting that mdp enhances the effect of lps . we also evaluated whether mdp could enhance pth - induced osteoclast formation and bone resorption . in the present study , the results suggested that although mdp affects lps - induced signaling it can not affect pth - induced signaling . tlr4 induces the natural host defense system by rapidly triggering proinflammatory processes [ 3638 ] . lps is recognized by tlr4 on the cell surface [ 39 , 40 ] . in this study , we found that lps enhances tlr4 expression in mouse calvariae and in stromal cell culture . furthermore , we found that mdp could enhance lps - induced tlr4 expression in vivo and in stromal cells . these results provide further support for the premise that mdp enhances lps signaling , and its signaling through tlr4 may be how mdp enhances the effects of lps . cyclooxygenase- ( cox- ) 2 and pge2 are reportedly increased in dental pulp fibroblasts by costimulation with nod1 or nod2 ligands and tlr2 or tlr4 ligands . furthermore , the production of il-1 , il-6 , and il-8 in these fibroblasts is accelerated by costimulation with these ligand combinations through the increased expression of traf6 . it has been reported that mdp synergistically enhances osteoclast induction by lps , il-1 , and tnf- through increased rankl expression in osteoblasts . have also shown that lps activates the phosphorylation of erk , p38 , and jnk in osteoblasts . we corroborated these results , showing that lps activates all three kinases in mouse bone marrow stromal cells . . also showed that lps stimulated erk1/2 phosphorylation in osteoblasts and that this could be enhanced by mdp . however , they did not check the effect of lps on other mapks , such as p38 and jnk . we found that mdp enhanced the phosphorylation of erk , p38 , and jnk that was induced by lps in stromal cells . although these results provide some insight into the signaling pathways activated by lps , the exact mechanism by which mdp enhances lps signaling is unclear , and further studies are needed to clarify this point . we found that mdp enhances lps - induced osteoclast formation , as measured by increased rankl and tlr4 expression in vivo and in vitro . our findings suggest that mdp might play an important role in pathological bone resorption in diseases with associated bacterial infections , such as periodontitis .

lipopolysaccharide ( lps ) is bacterial cell wall component capable of inducing osteoclast formation and pathological bone resorption . muramyl dipeptide ( mdp ) , the minimal essential structural unit responsible for the immunological activity of peptidoglycans , is ubiquitously expressed by bacterium . in this study , we investigated the effect of mdp in lps - induced osteoclast formation and bone resorption . lps was administered with or without mdp into the supracalvariae of mice . the number of osteoclasts , the level of mrna for cathepsin k and tartrate - resistant acid phosphatase ( trap ) , the ratio of the bone destruction area , the level of tartrate - resistant acid phosphatase form 5b ( tracp 5b ) , and c - terminal telopeptides fragments of type i collagen as a marker of bone resorption in mice administrated both lps and mdp were higher than those in mice administrated lps or mdp alone . on the other hand , mdp had no effect on osteoclastogenesis in parathyroid hormone administrated mice . mdp enhanced lps - induced receptor activator of nf-b ligand ( rankl ) expression and toll - like receptor 4 ( tlr4 ) expression in vivo and in stromal cells in vitro . mdp also enhanced lps - induced mitogen - activated protein kinase ( mapk ) signaling , including erk , p38 , and jnk , in stromal cells . these results suggest that mdp might play an important role in pathological bone resorption in bacterial infection diseases .

1. Introduction 2. Material and Methods 3. Results 4. Discussion 5. Conclusions

obesity is defined as a complex and multifactorial condition affected by interaction of genetic , metabolic , social , behavioral , and cultural factors . obese people experience impairments resulting in a significant impact on health and contribute to reduced quality of life ( qol ) [ 2 , 3 ] . an individual is considered obese if he / she has a bmi ( body mass index ) of 30 or more . qol is a multidimensional construct which is often measured as a subjective assessment of different life domains . the identification of a set of simultaneous factors that contribute to a better quality of life can help to determine the comparative efficacy of different treatments and to assess the impact of treatment on patients everyday life . , this type of investigations has not been the focus of many prior research . fontaine and cheskin , in their study , dispositional optimism defined as the expectation or belief in positive outcomes in the future has been shown to be associated positively with physical well - being . however , there are few studies where the role of dispositional optimism in qol in obese patients is studied . in the literature and in consonance with carr and colleagues the impact of body physical health on quality of life has been broadly documented . although the relation between physical function limitation and negative affect has not been fully studied in obese people , studies suggest that other chronic physical conditions interfere in functioning of these patients , which in turn triggers negative affect . the authors refer that the obese people have personal characteristics that may affect their mood and contribute to poor health or interpersonal discrimination . studies reveal that the impact of obesity on feelings and emotions is associated with changes in negative affect rather than in positive affect [ 9 , 10 ] . however , the relationship between positive and negative affect with qol remains unclear . according to wiczinski and colleagues obesity has been shown to be associated with a reduced qol . however , andenaes and colleagues refer that social support has rarely been studied in obese people . for obese people , these persons are highly susceptible to institutional and interpersonal discrimination , teasing and , problematic relationships with family members [ 9 , 10 ] . according to ogden and clementi obesity influences not only individuals health but also their psychological state . in obese people with appropriate support , stigma may present the sufficient triggers to encourage the changes which are necessary for weight loss and improve their qol . although these psychosocial factors identified as predictors of qol are linked and not easily separated , often they have been analysed individually . there is a lack of studies that analyse the simultaneous association between psychosocial predictors and qol . then , it will be relevant to examine the simultaneous impact of them on qol . the aim of the present study was to evaluate the simultaneous impact of dispositional optimism , positive and negative affect , stigma , and social support factors on quality of life , in portuguese obese patients . to explore the complexity of the relationship between variables we use structural equation model ( sem ) that is the only analysis that allows complete and simultaneous tests of all the relationships [ 14 , page 679 ] . we have constructed a model ( figure 1 ) in which we described the influence of psychosocial variables on qol , controlling for socio - demographic and clinical variables . it was suggested that the negative effect of stigma is dependent in part on the internal perceptions , beliefs , and emotions of the stigmatized person , above and beyond the effects of direct discrimination by others . then we hypothesized that stigma exerts a mediator effect between positive / negative affect and qol components . these patients were approached directly by their physicians during the consultation in outpatient departments of four central portuguese hospitals ( a hospital located in the central coast of portugal , lisbon , and four on the north coast , oporto ) . inclusion criteria are as follows : ( 1 ) diagnosis of obesity , disease diagnosed at least 3 years prior to the study ; ( 2 ) age 17 years at the time of the interview ; ( 3 ) educational level higher than 6 years ; ( 4 ) to return to usual daily life with disease under control ; ( 5 ) no cognitive disturbances . prior to data collection , ethical approval for this study was obtained from the institutions ' ethical committees . after a description of the study aims and the participant rights , all patients who met the inclusion criteria agreed to participate . obese patients completed self - report questionnaires to assess sociodemographic , clinical , psychosocial , and quality of life variables . data regarding age , sex , education , severity of disease perception ( generally , how do you classify your illness ? coded using an increasing scale from 1 : nothing serious to 11 : very serious ) , and time since obesity diagnosis were analised . severity of disease was assessed with an anchoring vignette scale following the recommendations of sen and the eurostat statistics report practices . dispositional optimism was evaluated with the life orientation test - revised ( lot - r ) . the lot - r was developed to assess individual differences in generalized optimism versus pessimism . it consists of ten statements , in which three items reflect expectations for positive outcomes , three for negative outcomes , and four are filter items . the optimism score was calculated by adding the three optimism questions value and the pessimism score was calculated by adding the three pessimism questions value . the overall lot - r score was calculated by reverse scoring the three pessimism scores and summing responses to all six questions . ( 2 ) positive affect and negative affect . to assess positive affect ( pa ) and negative affect ( na ) , the validated portuguese version of the positive and negative affect schedule ( panas ) scale , constructed by watson et al . it consists of twenty statements , in which ten items reflect expectations for pa and ten for na . items were averaged to obtain scale scores , and higher scores of pa indicate more positive affect or the extent to which the individual feels enthusiastic , active , and alert . a higher score of na indicates more negative affect , which reflects the individual aversive mood states and general distress . the authors of panas calculated the cronbach coefficients in different samples and found that they ranged from 0.90 to 0.96 for pa and from 0.84 to 0.87 for na . portuguese version shows similar characteristics to the original , with a cronbach of 0.86 for the positive affect and 0.89 for the negative affect scales . self - perception of stigma was assessed using a five - item one - dimensional questionnaire , answered in a likert type scale with seven alternatives between totally agree and totally disagree , developed by pais - ribeiro et al . . social support was assessed with the social support survey ( mos ) [ 24 , 25 ] . this is a multidimensional self - questionnaire , adapted to the portuguese population , that evaluates various dimensions of social support . the mos consists of four separate social support subscales : emotional / informational , tangible , affectionate , and positive social interaction . all subscales have shown strong reliability over time with a cronbach higher than 0.91 . the 36-item short - form health survey ( sf-36 ) , developed for the mos study , was used and divided into eight dimensions that represent two major components : the physical and the mental components of health . in this study , we used the results from the iqola project , in which a second - order factor was found , with three components of sf-36 ( general well - being all scales and the component scores are positively scored so that higher scores represent better health - related qol . the portuguese version of the mos sf-36 [ 28 , 29 ] shows a cronbach of 0.70 . structural equation modeling ( sem ) was used to test the conceptual model to evaluate the simultaneous impact of dispositional optimism , positive and negative affect , stigma , and social support factors on quality of life . sem is a multivariate technique that allows for representing , estimating and testing theoretical models that involve several relationships between variables ( observed and latent ) , in order to understand the patterns of correlation / covariance between them . latent variables are not directly observed , generally they correspond to hypothetical constructs or factors which are explanatory variables presumed to reflect a continuum that is not directly observable [ 14 , 30 ] . sem is a combination of factor and path analyses , corresponding to the measurement and structural models , respectively . first , we applied confirmatory factor analysis ( cfa ) ( measurement model ) in order to assess whether all the latent variables were represented by their respective indicators ( observed variables ) . the structural model indicates the direct and indirect effects of latent and observed variables ( which are not indicators of latent variables ) . before estimating the hypothesized model the distribution of continuous variables was analised to assess significant departure from normality . to account for the nonnormality of the data the satorra - bentler scale chi - square test was used as an index of discrepancy between the original correlation matrix and the correlation matrix estimated from the model . a nonsignificant p value ( p > 0.05 ) and the ratio ( s b)/df < 3 would represent a good model fit . as the significance of a chi - square test is dependent on the number of subjects , other goodness - of - fit indexes were also used . comparative fit index ( cfi ) , with maximum value 1.00 , is derived from the comparison of the hypothesized model with the independent model ; a value of cfi > 0.90 suggests a close fit ; root mean square error approximation ( rmsea ) values help to answer the question of how well the model would fit the population covariance matrix if it were available ; values less than 0.05 indicate a good fit , being acceptable values until 0.08 [ 14 , 30 , 3537 ] . based on multivariate lagrange multiplier ( lm ) tests , post - hoc modifications to the proposed model were made to add new paths as necessary . to compare two or more models the akaike information criterion ( aic ) the significance of all direct and indirect effects was evaluated to determine which variables have a direct and indirect impact on qol . the r values were calculated for all predictors , mediators , and outcome variables to determine the proportion of explained variance in outcome . in figure 2 rectangles represent observed variables and circles represent latent variables ; the error terms of observed variables are represented by e and of latent variables are represented by d ( disturbances ) ; single - headed arrows represent the influence of one variable in another , and double - headed arrows represent associations between pairs of variables . analyses were conducted with the eqs 6.1 package and a level of significance of 0.05 was considered . the possible mediation of stigma between positive / negative affect and qol components was assessed based on the traditional method proposed by baron and kenny . a mediating variable transmits the effect of an independent variable on a dependent variable [ 40 , 41 ] . the analysis of this effect requires several steps : ( 1 ) positive ( negative ) affect is a predictor of a qol component , ( 2 ) a positive ( negative ) affect is a predictor of stigma , ( 3 ) controlling for stigma , the relationship between a positive ( negative ) affect and a qol component should reduce or cease to be statistically significant . if it fails to be statistically significant , then we have a full mediation model ( i.e. , mediator explains completely the relationship between a psychosocial variable and qol component ) . however , if the relationship between a positive ( negative ) affect and qol component decreases significantly , we have a partial mediation . the indirect effect may be estimated in two ways , either a^b^ or c^-c^ , where c is the regression coefficient of the model regressing the qol component on positive ( negative ) affect a is the regression coefficient relating positive ( negative ) affect and stigma , b is the regression coefficient relating stigma and the qol component adjusted for positive ( negative ) affect , and c is the coefficient relating positive ( negative ) affect and qol component but now adjusted for stigma . the value of the mediated or indirect effect estimated by taking the difference in the coefficients , c^-c^ , corresponds to the reduction in the independent variable ( positive / negative affect ) effect on the dependent variable ( qol components ) when adjusted for the mediator ( stigma ) . to test for significance , the difference is then divided by the standard error of the difference and the ratio is compared to a standard normal distribution . the mean age of patients was 42.98 years ( sd = 11.3 ) and 86.5% were female . mean level education was 8.17 years ( sd = 4.19 ) , mean time since diagnosis was 11 years ( sd = 9.5 ) , and mean perception of severity of disease was 7.31 ( sd = 2.69 ) . first , the individual impact of each psychosocial factor in qol components , controlling for sociodemographic and clinic variables , was analised . then , the simultaneous impact of dispositional optimism , positive and negative affect , stigma and social support factors on qol components was analysed , evaluating the hypothetical model postulated in the aim of the study . tables 2 and 3 show the results obtained for the measurement and structural models , for the first analysis where each psychosocial factor was independently analysed . for all psychosocial factors , all factor loadings between each indicator and latent variables were statistically significant , indicating that all were well represented by their respective indicators . the structural modelfit statistics indicate an acceptable model fit for all psychosocial factors ( table 3 ) . controlling for sociodemographic and clinical variables , all factors had a statistically significant impact on the components of qol . models results showed that an optimist attitude , a good social support , a lower perception of stigma , and more positive affect contribute to better general well - being and better physical and mental health . just the negative affect behaves like a negative predictor of qol . the following results refer to the model where the simultaneous impact of psychosocial variables on quality of life was considered . measurement model include eight latent variables ( dispositional optimism , negative and positive affect , stigma , social support , general well - being , and physical and mental health ) and 43 observed variables referring to the corresponding indicators of the eight latent variables . the results showed a satisfactory model fit : s b832 = 1271.8896 , p < 0.001 ; ( s b)/df = 1.52 ; cif = 0.90 ; rmsea = 0.054 , rmsea ( 90% ic ) = ( 0.04 ; 0.06 ) . all factor loadings between each indicator and latent variables were statistically significant , indicating that all were well represented by their respective indicators . the proportion of explained variance for each indicator was also moderate to high ( r values ranging from 0.22 to 0.87 ) . according to the objective of this research , our main model analyse the simultaneous impact of dispositional optimism , positive and negative affect , stigma , and social support on qol controlling for sociodemographic and clinical variables . the mediation effect of stigma between positive / negative affect and the qol components was also examined ( model 1 ) . however , the social support and dispositional optimism were found not to be statistically significant and were subsequently removed from the model , corresponding to model 2 and model 3 , respectively . results of overall model fit and of the comparison between the three models are shown in table 4 . the results show that fit indexes are comparable in the three models , although in the model 1 and model 2 the cfi values were in the borderline . based on the akaike information criterion ( aic ) we chose to present model 3 . the results ( figure 2 ) showed that age has a negative impact ( b = 0.327 ) and school grade has a statistically significant positive impact ( b = 0.182 ) on physical health . the severity of disease perception influences statistically and positively the mental health ( b = 0.138 ) . a simultaneous direct and positive impact between stigma and physical ( b = 0.245 ) and mental health ( b = 0.252 ) was found . positive affect had a statistically and positively significant impact on the components of qol : general well - being ( b = 0.528 ) , physical health ( b = 0.233 ) , and mental health ( b = 0.340 ) . negative affect had also an impact , but statistically negative , on general well - being ( b = 0.319 ) , physical health ( b = 0.275 ) , and mental health ( b = 0.577 ) . mediation analyses were evaluated testing the significance of the indirect effect between predictors and qol components . the results showed two statistically significant indirect effects , one meaning that stigma exerts a partial mediation between positive affect and mental health ( a^b^=0.05 , p < 0.05 ) and the other that stigma exerts a partial mediation between negative affect and physical health ( a^b^=-0.067 , p < 0.05 ) . the prevalence of obesity is increasing rapidly and becomes a major public health problem in many countries . the prevalence in portugal is 15.1% , lower than that reported in the usa ( 35.9% ) . several successful weight reduction programs have been implemented in portugal [ 44 , 45 ] . our study is concentrated on psychosocial predictors of qol , which are related and not easily separated . there is a lack of studies that have examined the simultaneous associations between psychosocial predictors and quality of life outcomes . our study contributes to the reduction of this fact and to better understand the role of psychosocial variables in the quality of life . the factors identified as predictors of qol could be helpful for health care and improving the measurement of treatment efficacy and help to assess and compare the efficacy of different treatments . these findings can help to assess the impact on how patients feel and function in their everyday life . despite the strengths of this study , it is important to note some of its limitations . the cross - sectional design does not allow any conclusions on the longitudinal evaluation of these patients . furthermore , this is a hospital - based study and patients attending primary health care units are underrepresented . although our findings constitute a relevant contribution , further studies are needed to better address the topic of qol in obese patients . the primary goal of this study was to identify the psychosocial predictors of qol in a portuguese obese patients . to briefly summarize our findings , controlling for sociodemographic and clinical variables , we found that positive and negative affect and the stigma factors were relevant predictors of qol . in this study , first the individual impact of dispositional optimism , positive and negative affect , stigma , and social support factors on qol components was analysed , in order to compare our findings with those from other studies with similar approaches . the results are consistent with the literature [ 2 , 810 ] , showing that a more optimistic attitude , a better positive affect , a lower perception of stigma or a better social support contribute to general to a better qol . however the principal goal of the study was to take into account simultaneous psychosocial variables , with the aim to clarify their simultaneous impact on qol . the dispositional optimism and the social support have been referred as important factors in the life of obese individuals . in this study their impacts on qol cease to be significant in presence of positive and negative affect and stigma factors . shows that obese persons have significantly higher levels of negative affect than their thinner peers . also a systematic review shows that a quarter of the population in germany displayed definite stigmatizing attitudes about obesity . similar results were found by sutin and terracciano about negative attitudes toward obese people in the american society resulting in poorer mental health outcomes and that weight discrimination increases risk for obesity . in concordance with these findings our study suggests that negative attitudes toward obese people or stigma can result in poor health outcomes . puhl and heuer report that stigma and discrimination toward obese persons are pervasive and pose numerous consequences for their psychological and physical health . similarly , schafer and ferraro reported that obesity is widely recognized as a health risk , representing a disadvantaged social position . they also refer that perceived weight discrimination is harmful and increases the health risks of obesity . puhl et al . , also show that the language used by health professionals expresses negative attitudes toward overweight and obese people , and has negative impacts on obese people . this study reveals that positive affect has a statistically significant and positive impact on all components of qol . more enthusiastic and active people have a better subjective well - being and a better physical and a better mental health . other researches [ 9 , 10 ] support that the positive and negative affect reveal that obese patients are more likely to have negative affect and have more negative feelings such as distress , anger , fear , and shame . obese people with lower perception of stigma have a better quality of life , in physical and mental domains . vartanian and smyth refer that several antiobesity campaigns appear to embrace stigmatization of obese individuals as a public health strategy . those campaigns are based in the idea that stigmatizing obese individuals will motivate them to change their behavior and will also result in successful behavior changes . puhl and heuer refer that stigmatization of obese patients represents serious risks to physical health . the results of this study also showed the relation between negative affect and physical health where mediated by stigma , as well as the relation between positive affect and mental health . the use of sem allows us to understand the complexity of the simultaneous relationships between the variables we use . the study suggests that all the variables are important but when taken together they can have different levels of importance for the explanation of the results .

living with obesity is an experience that may affect multiple aspects of an individual 's life . obesity is considered a relevant public health problem in modern societies . to determine the comparative efficacy of different treatments and to assess their impact on patients ' everyday life , it is important to identify factors that are relevant to the quality of life of obese patients . the present study aims to evaluate , in portuguese obese patients , the simultaneous impact of several psychosocial factors on quality of life . this study also explores the mediating role of stigma in the relationship between positive / negative affect and quality of life . a sample of 215 obese patients selected from the main hospitals in portugal completed self - report questionnaires to assess sociodemographic , clinical , psychosocial , and quality of life variables . data were analysed using structural equation modeling . the model fitted the data reasonably well , cfi = 0.9 , rmsea = 0.06 . more enthusiastic and more active patients had a better quality of life . those who reflect lower perception of stigma had a better physical and mental health . partial mediation effects of stigma between positive affect and mental health and between negative affect and physical health were found . the stigma is pervasive and causes consequences for psychological and physical health .

1. Introduction 2. Methods 3. Results 4. Discussion

a mutation of the glucocerebrosidase ( gba ) gene , located on chromosome 1q21 and encoding the lysosomal glucocerebrosidase enzyme ( acid beta - glucosidase , ec.3.2.1.45 ) , is inherited in an autosomal recessive fashion . mutations disrupting the function of this enzyme lead to substrate accumulation in lysosomes , particularly in cells of the reticuloendothelial system . type i gd is by far the most common form ; it most often presents with hepatosplenomegaly , cytopenias , bone marrow infiltration , skeletal involvement , or a combination of these.1 in the portuguese population the most frequent mutation is n370s ( 63%),2 similar to the ashkenazi jewish population . amaral et al3 demonstrated that portuguese patients with homozygous n370s mutation present an overall milder manifestation of gd , whereas compound heterozygous patients showed no clear genotype / phenotype correlation and ranged from clinically undetectable to severe forms of gd . two rarer mutations , g377s and n396 t are commonly encountered in the portuguese population.3,4 the n396 t mutation has been described as having the highest residual enzyme activity and a generally milder neuroprotective phenotype ( although clinical heterogeneity was found).5 we report two sisters of portuguese descent with gaucher disease who demonstrate the following features : 1 ) n396 t homozygosity in siblings with consanguineous parents ; 2 ) striking phenotypic differences in sisters with identical gba mutations ; and 3 ) the success of enzyme replacement therapy ( ert ) in correcting the peripheral cytopenias in one of the sisters who is human immunodeficiency virus ( hiv ) positive , thus enabling her to receive anti - hiv therapy without the occurrence of profound cytopenias . after approval by the ethics review committee at mount sinai hospital , toronto , both subjects consented to a review and publication of their cases . a 254 bp fragment of exon 9 of gba was polymerase chain reaction ( pcr)-amplified with forward primer 5ccagtgtgagctgtct 3 and reverse primer 5gagatgataggcctggtatg 3. pcr conditions were as follows : initial denaturation for 3 min at 94c , 30 cycles of 1 min at 94c , 1 min at 58c , and 1 min at 72c , and a final extension of 5 min at 72c . the pcr - amplified dna fragments were purified using the wizard pcr preps dna purification resin ( promega , madison , wi ) . mutation n396 t creates a cleavage site for the restriction endonuclease rsai ( new england biolaboratory , ipswitch , ma ) in the mutant allele . upon pcr amplification , restriction endonuclease digestion , and electrophoresis in 8% polyacrylamide , the wild type allele will yield two dna bands of 201 bp and 53 bp , whereas the mutant allele will give rise to 3 dna bands of 133 bp , 68 bp , and 53 bp . a 254 bp fragment of exon 9 of gba was polymerase chain reaction ( pcr)-amplified with forward primer 5ccagtgtgagctgtct 3 and reverse primer 5gagatgataggcctggtatg 3. pcr conditions were as follows : initial denaturation for 3 min at 94c , 30 cycles of 1 min at 94c , 1 min at 58c , and 1 min at 72c , and a final extension of 5 min at 72c . the pcr - amplified dna fragments were purified using the wizard pcr preps dna purification resin ( promega , madison , wi ) . mutation n396 t creates a cleavage site for the restriction endonuclease rsai ( new england biolaboratory , ipswitch , ma ) in the mutant allele . upon pcr amplification , restriction endonuclease digestion , and electrophoresis in 8% polyacrylamide , the wild type allele will yield two dna bands of 201 bp and 53 bp , whereas the mutant allele will give rise to 3 dna bands of 133 bp , 68 bp , and 53 bp . a female patient was diagnosed with gd in 1986 , at age 43 , following a liver biopsy and bone marrow aspirate ( hepatosplenomegaly was also found at this time ) after 20 years of uninvestigated anemia . this patient was then diagnosed with hiv infection , contracted from her husband , in 1996 . her gd complicated treatment with anti - retrovirals , as she was becoming progressively more pancytopenic , not in keeping with her hiv diagnosis , and required blood transfusions ( about two transfusions per month up until november of 1996 ) . anti - retrovirals were discontinued in december of 1996 followed by an improvement in her blood counts . the patient did not offer the diagnosis of gd at this time ; in fact , she only remembered after she was re - diagnosed with gd in january of 1997 . her beta - glucosidase level was very low at 0.1 nmol / mg / h ( normal wbc activity : 12.7 , interquartile range 6.417.7 nmol / mg / h ) . with respect to her gd , she had chronic low back pain ( worsening during the winter months ) , occasional night sweats , but no abdominal pain or susceptibility to infection or bleeding diathesis . before enzyme replacement therapy ( ert ) g / l , white cell count ( wcc ) 2.7 10/l , neutrophils 1.71.9 10/l , platelets 77108 10/l , and ferritin her spleen was 12 cm below the left costal margin and liver 8.5 cm below the right . dexa scans for bone mineral density revealed diffuse osteopenia throughout the skull , cervical , thoracic , and lumbar spines , femora , and humeri . focal areas of endosteal scalloping , lysis , and sclerosis were identified within the femurs . ert with the recombinant imiglucerase ( cerezyme ; genzyme , cambridge , ma ) was started at 2000 units intravenously every two weeks ( 30 u / kg ) in may of 1997 . after 3 infusions of ert her blood counts improved with hb 112 g / l , wcc 2.6 10/l , neutrophils 2.7 10/l , and platelets 79 10/l . antiretrovirals were reinitiated in may 1997 ( nelfinavir 750 mg tid , delavirdine 400 mg tid and didanosine 125 mg bid ) and were well tolerated . in july of 1997 her viral load was < 500 copies / ml ( down from 53,000 copies / ml in march ) with a cd4 count of 129 and a stable hb at 114 she suffered a compression fracture of the 12th thoracic vertebra due to the gd in july of 1997 . bony pain has occurred in her right ankle , tibia , lower back , legs , and hips . she also experienced scalp tenderness and pain in her teeth , which led to full dental extractions . in the summer of 1999 she developed a frozen shoulder leading to a rigorous physiotherapy regimen . in february of 2000 she fractured her right tibia as a result of a fall . she contracted a herpes zoster infection in 1999 , which was treated with 7 days of acyclovir . in 2003 , a urinary tract infection was successfully treated . she was diagnosed with type ii diabetes mellitus in november of 2004 and remains on dietary control for this . at last check there is a family history of type ii diabetes , including her mother , father , 2 sisters , and her brother . her dose of 2000 units biweekly ( 30 u / kg , may 1997 ) was lowered to 1600 units biweekly ( march 1998 ) , and lowered further to her current dose of 1200 units biweekly in june 2001 until it was interrupted in august 2009 due to enzyme shortages . ert was reinitiated in january 2010 at 1600 units biweekly and was then reduced to 1200 units biweekly in june 2010 . though her bony pain ( lower back ) and hepatosplenomegaly persist , she is quite stable on her regimen of ert and antiretrovirals ( nelfinavir , delavirdine , and abacavir which replaced didanosine in november 2001 ) . at her last visit ( 2010 ) her weight was 68.1 kg , blood pressure 148/80 , and her spleen was palpable 5 cm below the left costal margin . an mri of her abdomen revealed a liver volume of 1723 ml ( 1913 ml in 2003 ) and a spleen volume of 389 ml ( 547 ml in 2003 ) . dexa scan in january 2006 showed severe osteoporosis of the lumbar spine and left femoral neck , with a high risk of fracture ( unchanged from previous report ) . a 48-year - old woman was diagnosed with gd in 1998 upon recommendation due to her sister s ( patient 1 ) diagnosis . like her sister , 113 g / l , wcc 5.5 10/l , neutrophils 3.5 10/l , and platelets 159 10/l ; as were her routine chemistries , with the exception of a high serum ferritin at 775 g / l . measurement of white blood cell beta - glucosidase activity in 1998 revealed it to be 0.1 nmol / mg / h . her liver volume was measured at 1785 ml ( high normal volume ; 1680 ml in 2008 ) . of interest , her splenic volume was measured at 75 ml on two separate occasions ( 2003 and 2010 ) , which is small ; normal for her size should be 160170 ml . on skeletal survey and mri , her femurs show the typical erlenmeyer flask deformity of gd but no other major abnormalities were seen ( 2009 ) . dexa scans for bone marrow density ( 2009 ) revealed osteopenia in the spine and femoral neck . this patient does complain of occasional bone pain in her back and legs with prolonged activity . she denies any abdominal discomfort , fevers , night sweats , or appetite problems and her energy level is good . she has a history of iron deficiency anemia that has responded to iron supplementation , but no other cytopenias . so far , her disease remains almost without clinical manifestation and she is physically asymptomatic . she has had no hospitalizations , operations , or significant illnesses . she and her sister share the same two parents , who themselves are second cousins . a comparison of the patients clinical findings is presented in table 1 . a female patient was diagnosed with gd in 1986 , at age 43 , following a liver biopsy and bone marrow aspirate ( hepatosplenomegaly was also found at this time ) after 20 years of uninvestigated anemia . this patient was then diagnosed with hiv infection , contracted from her husband , in 1996 . her gd complicated treatment with anti - retrovirals , as she was becoming progressively more pancytopenic , not in keeping with her hiv diagnosis , and required blood transfusions ( about two transfusions per month up until november of 1996 ) . anti - retrovirals were discontinued in december of 1996 followed by an improvement in her blood counts . the patient did not offer the diagnosis of gd at this time ; in fact , she only remembered after she was re - diagnosed with gd in january of 1997 . her beta - glucosidase level was very low at 0.1 nmol / mg / h ( normal wbc activity : 12.7 , interquartile range 6.417.7 nmol / mg / h ) . with respect to her gd , she had chronic low back pain ( worsening during the winter months ) , occasional night sweats , but no abdominal pain or susceptibility to infection or bleeding diathesis . before enzyme replacement therapy ( ert ) g / l , white cell count ( wcc ) 2.7 10/l , neutrophils 1.71.9 10/l , platelets 77108 10/l , and ferritin her spleen was 12 cm below the left costal margin and liver 8.5 cm below the right . dexa scans for bone mineral density revealed diffuse osteopenia throughout the skull , cervical , thoracic , and lumbar spines , femora , and humeri . focal areas of endosteal scalloping , lysis , and sclerosis were identified within the femurs . ert with the recombinant imiglucerase ( cerezyme ; genzyme , cambridge , ma ) was started at 2000 units intravenously every two weeks ( 30 u / kg ) in may of 1997 . after 3 infusions of ert her blood counts improved with hb 112 g / l , wcc 2.6 10/l , neutrophils 2.7 10/l , and platelets 79 10/l . antiretrovirals were reinitiated in may 1997 ( nelfinavir 750 mg tid , delavirdine 400 mg tid and didanosine 125 mg bid ) and were well tolerated . in july of 1997 her viral load was < 500 copies / ml ( down from 53,000 copies / ml in march ) with a cd4 count of 129 and a stable hb at 114 she suffered a compression fracture of the 12th thoracic vertebra due to the gd in july of 1997 . bony pain has occurred in her right ankle , tibia , lower back , legs , and hips . she also experienced scalp tenderness and pain in her teeth , which led to full dental extractions . in the summer of 1999 she developed a frozen shoulder leading to a rigorous physiotherapy regimen . in february of 2000 she fractured her right tibia as a result of a fall . she contracted a herpes zoster infection in 1999 , which was treated with 7 days of acyclovir . in 2003 , a urinary tract infection was successfully treated . she was diagnosed with type ii diabetes mellitus in november of 2004 and remains on dietary control for this . at last check there is a family history of type ii diabetes , including her mother , father , 2 sisters , and her brother . her dose of 2000 units biweekly ( 30 u / kg , may 1997 ) was lowered to 1600 units biweekly ( march 1998 ) , and lowered further to her current dose of 1200 units biweekly in june 2001 until it was interrupted in august 2009 due to enzyme shortages . ert was reinitiated in january 2010 at 1600 units biweekly and was then reduced to 1200 units biweekly in june 2010 . though her bony pain ( lower back ) and hepatosplenomegaly persist , she is quite stable on her regimen of ert and antiretrovirals ( nelfinavir , delavirdine , and abacavir which replaced didanosine in november 2001 ) . at her last visit ( 2010 ) her weight was 68.1 kg , blood pressure 148/80 , and her spleen was palpable 5 cm below the left costal margin . an mri of her abdomen revealed a liver volume of 1723 ml ( 1913 ml in 2003 ) and a spleen volume of 389 ml ( 547 ml in 2003 ) . dexa scan in january 2006 showed severe osteoporosis of the lumbar spine and left femoral neck , with a high risk of fracture ( unchanged from previous report ) . a 48-year - old woman was diagnosed with gd in 1998 upon recommendation due to her sister s ( patient 1 ) diagnosis . like her sister , 113 g / l , wcc 5.5 10/l , neutrophils 3.5 10/l , and platelets 159 10/l ; as were her routine chemistries , with the exception of a high serum ferritin at 775 g / l . measurement of white blood cell beta - glucosidase activity in 1998 revealed it to be 0.1 nmol / mg / h . her liver volume was measured at 1785 ml ( high normal volume ; 1680 ml in 2008 ) . of interest , her splenic volume was measured at 75 ml on two separate occasions ( 2003 and 2010 ) , which is small ; normal for her size should be 160170 ml . on skeletal survey and mri , her femurs show the typical erlenmeyer flask deformity of gd but no other major abnormalities were seen ( 2009 ) . dexa scans for bone marrow density ( 2009 ) revealed osteopenia in the spine and femoral neck . this patient does complain of occasional bone pain in her back and legs with prolonged activity . she denies any abdominal discomfort , fevers , night sweats , or appetite problems and her energy level is good . she has a history of iron deficiency anemia that has responded to iron supplementation , but no other cytopenias . so far , her disease remains almost without clinical manifestation and she is physically asymptomatic . she has had no hospitalizations , operations , or significant illnesses . she and her sister share the same two parents , who themselves are second cousins . a comparison of the patients clinical findings is presented in table 1 . she was also anemic , neutropenic , and thrombocytopenic before starting ert . in the case of the second patient these findings are absent and her gd likely would have gone undetected and undiagnosed had it not been for the findings in her sister s case . there is often poor correlation between genotype and phenotype6 in gd and these sisters are but another example . second , patient 2 has an exceptionally small splenic volume at 75 ml ; for her size the normal volume is in the range of 160170 ml . we were unable to find any report with similar findings in a patient with gd . the first attempt at antiretroviral therapy resulted in worsening of the patient s cytopenias due to the underlying gd . although this patient would not have met the criteria for enzyme replacement therapy in our province ( ontario ) under normal circumstances,6 her need for antiretroviral treatment without marked diminution of her blood counts prompted the gaucher treatment review committee of ontario to make an exception and recommend ert . ert ultimately enabled her to resume treatment with antiretrovirals , and both treatments are well tolerated by the patient . some inborn errors of metabolism , for example mucopolysaccharidosis , exhibit good correlation between residual enzyme activity ( -l - iduronidase ) and genotype as well as with the biochemical phenotype throughout the clinical course of this lysosomal storage disorder.7 in gd we may assume that the highest residual enzyme activity may result in the mildest phenotype . in the cases presented here both patients have a beta - glucosidase level of 0.1 nmol / mg / h as well as being homozygous for the n396 t gba gene mutation , indicating that phenotype is not related to either the specific genetic mutation or to the level of residual enzyme activity .

gaucher disease ( gd ) is characterized by reduced activity of glucocerebrosidase leading to complications in the reticuloendothelial system . n396 t , a rarer mutation of the glucocerebrosidase gene , has been encountered in portuguese populations and has generally been associated with milder phenotypes . this report presents brief histories of two portuguese sisters , both with homozygous n396 t mutations . these patients are phenotypically very different despite the fact that in both patients residual enzyme activity is very low . the case of patient 1 is complicated by comorbid diabetes mellitus and human immunodeficiency virus ( hiv ) infection . enzyme replacement therapy ( ert ) improved this patient s clinical picture sufficiently to enable antiretroviral treatment to proceed for the hiv . this report demonstrates the poor correlation of clinical gd with genotype as well as with residual enzyme activity . it further illustrates how treatment of the underlying gd with ert improved symptoms allowing for antiretroviral therapy thereby improving both the gd and hiv .

Introduction Materials and methods -glucosidase gene analysis Report of cases Patient 1 Patient 2 Discussion

anterior uveitis ( au ) is the most common form of intraocular inflammation , and accounts for 50% to 92% of total uveitis cases in most western countries and 28% to 50% of all uveitis cases in some of the asian countries , such as korea , japan , and india ( 1 ) . as the second most common au next to idiopathic hla - b27 negative au , hla - b27 positive au accounts for 18% to 32% of all au cases in western countries and 6% to 13% of all au cases in asia ( 2 ) . in a previous hospital - based study , au accounted for approximately 28.1% of all uveitis cases in korea ( 3 ) , and 35% to 47% of au patients were positive for hla - b27 in other studies ( 4 , 5 ) . hla - b27 positive au is distinguishable from its hla - b27 negative counterpart and is characterized by early onset , male preponderance , frequent association with systemic diseases , and a high tendency for recurrence ( 2 , 6 ) . there have been many comparative studies on the prognosis of hla - b27 positive and negative au with conflicting results . some studies revealed more favorable outcomes for hla - b27 positive au ( 7 , 8) , whereas others reported the opposite ( 9 ) . in addition , an equal ocular outcome was observed for both hla - b27 positive and negative groups in some studies ( 10 - 14 ) . this study was performed to assess the clinical features and prognosis of hla - b27 positive au compared with hla - b27 negative au in a korean population . in addition , the effects of associated systemic disease on hla - b27 positive au were also evaluated . this study was a retrospective case - controlled study , and was approved by institutional review board . the medical records of all patients with au seen at the uveitis service of a university hospital in korea , between january 1996 and december 2006 were reviewed throughout patients ' entire follow - up and those who were tested for the presence of the hla - b27 allele were included in this study . hla - b27 typing was conducted for patients who agreed to perform the test after receiving information on the diagnostic , therapeutic , and prognostic significance of hla - b27 typing . exclusion criteria were patients with an associated primary uveitic condition ( e.g. , fuchs ' heterochromic cyclitis or infectious uveitis ) and other systemic and/or ocular diseases that are likely to be associated with ocular complications and visual prognosis independent of the hla - b27 antigen ( e.g. , sarcoidosis , behcet 's disease , proliferative diabetic retinopathy , retinal vascular obstruction , glaucoma not associated with the present au ) . patients were divided into two groups : those with a negative hla - b27 haplotype who presented with idiopathic au ( group i ) and those who were positive for hla - b27 ( group ii ) . group ii was further divided into two subgroups ; patients with a systemic disease association ( e.g. , spondyloarthropathy , inflammatory bowel disease ) ( group iia ) and those who had no evidence of systemic disease association ( group iib ) . a detailed medical and ophthalmologic history taking , a complete blood count , liver function tests , blood urea nitrogen , serum creatinine , urinalysis , c - reactive protein , anti - streptolysin o , rheumatoid factor , antinuclear antibody , serologic tests for toxoplasmosis and syphilis , human immunodeficiency virus test , hepatitis b and c tests , angiotensin - converting enzyme , and chest radiography were performed at the initial visit for each patient . in patients with previous episodes of uveitis , the total number of previous attacks and the age at their first episode were recorded during patient interviews . the ophthalmological examination performed at every visit included best - corrected visual acuity ( bcva ) , slit - lamp biomicroscopy , tonometry , and indirect ophthalmoscopy ; and systemic disease association was documented in every possible case . fluorescein angiography , optical coherence tomography , and anterior segment and fundus photography were performed when indicated . patients without prior rheumatologic evaluation at the time of inclusion were referred to a rheumatologist , and medical records were reviewed for patients with a previous rheumatologic follow - up . the characteristics of the uveitis were analyzed according to the definitions of the standardization of uveitis nomenclature ( sun ) working group ( 15 ) . au was defined by anterior chamber cell grade of 1 + ( graded according to the sun working group grading scheme ) of acute onset . all patients were treated according to the degree of intraocular inflammation ( cells in the anterior chamber or vitreous cavity or both ) using a stepladder steroid - sparing therapeutic algorithm ( 16 ) . periocular corticosteroids were used for severe , recurrent , or chronic episodes , for cystoid macular edema , and for patients in whom systemic corticosteroids were contraindicated . long - term topical nonsteroidal anti - inflammatory drugs ( nsaids ) were sometimes used to prevent relapse of inflammation in cases of active inflammation recurrence with attempted topical steroid withdrawal . short course systemic corticosteroids were given if the inflammation could not be controlled with previous therapy . the distribution of counts was analyzed using chi - square test and fisher 's exact test where appropriate for the determination of statistical significance . for the comparison of mean values , independent t - test and wilcoxon 's rank sum test , chicago , il , u.s.a . ) was used , and the results were considered to be significant at p values of less than 0.05 . eighty - two korean patients were included in the present study , and 27 patients ( 40 eyes ) tested hla - b27 negative and suffered from au of unknown etiology ( group i ) . fifty - five hla - b27 positive patients ( 88 eyes ) ( group ii ) were further divided into 29 ( 52.7% ) patients ( 47 eyes ) with systemic disease association ( group iia ) and 26 ( 47.3% ) patients ( 41 eyes ) with no systemic disease association ( group iib ) . the median follow - up period for all 82 patients was 36.5 months ( interquartile range , 16.0 - 75.3 months ) . there was no obvious male or female predominance in group i ( male : female ratio , 1.08:1 ) , whereas there were approximately three times more male patients in group ii ( male : female ratio , 2.9:1 ) , and this difference between groups i and ii was statistically significant ( p=0.040 ) . among the two subgroups of the hla - b27 positive group , group iia ( male : female ratio , 8.7:1 ) had a significantly higher male : female ratio than did group iib ( male : female ratio , 1.4:1 ) ( p=0.007 ) . the age of onset of au was statistically similar between hla - b27 negative and positive au groups ( p=0.919 ) , and the age of onset of group iia was significantly younger than that of group iib ( p=0.015 ) . hla - b27 positive au showed more severe anterior chamber inflammation than its hla - b27 negative counterpart . the mean grade of anterior chamber cells and the rate of hypopyon formation were significantly higher in the eyes of group ii than in those of group i ( p=0.006 and 0.034 , respectively ) ; hypopyon occurred almost exclusively in hla - b27 positive eyes ( table 2 ) . the proportions of anterior chamber cells of grade 3 or more and grade 4 were significantly higher in the eyes of the hla - b27 positive group than in the eyes of the hla - b27 negative group ( p=0.001 and 0.041 , respectively ) ( fig . 1 ) . in the analysis of the anterior chamber inflammation between the eyes of groups iia and iib , there were no statistically significant differences ( p>0.05 , table 2 , fig . 1 ) . a clear distinction of the visual outcome during the active inflammatory stage was observed between hla - b27 negative and positive groups ( table 2 ) . approximately four out of five hla - b27 negative au eyes ( 81.5% ) had bcva of 20/40 or better during the active inflammatory stage , whereas approximately two out of three hla - b27 positive au eyes ( 65.7% ) had bcva worse than 20/40 . in addition , about one out of three hla - b27 positive au eyes ( 32.8% ) had bcva of 20/200 or worse , whereas less than one out of ten hla - b27 negative au eyes ( 7.4% ) had bcva of 20/200 or worse ( p=0.011 ) . the proportion of eyes with bcva of 20/40 or better was significantly larger in group i than in group ii ( p<0.001 ) , and the proportion of eyes with bcva between 20/40 and 20/100 and the proportion of eyes with bcva between 20/100 and 20/400 were significantly larger in group ii than in group i ( p=0.031 and 0.030 , respectively ) . in the analysis of the worst bcva between the eyes of groups iia and iib , there were no significant differences in all ranges of visual acuity ( p>0.05 , table 2 ) . systemic or periocular steroids were required in significantly more patients in the hla - b27 positive group ( approximately 4 out of 5 patients ) than in the hla - b27 negative group ( approximately 1 out of 2 patients ) ( p=0.015 , table 3 ) . further analysis revealed that both oral and periocular steroids were used more frequently in hla - b27 positive patients than in hla - b27 negative patients ( p=0.032 and 0.021 , respectively ) . the presence of a systemic disease association made no significant difference in the medical treatment of au in the hla - b27 positive group ( p>0.05 , table 3 ) . the disease duration and course including the frequency of uveitis attack are summarized in table 4 . approximately 9 out of 10 study patients ( 92.6% of group i and 92.7% of group ii ) had limited ( 3 months or less ) au with a mean duration of about one month , and approximately 9 out of 10 study patients had repeated episodes of au ( 85.2% of group i and 90.9% of group ii ) . there were no significant differences in the proportions of limited / persistent , single / repeated , and chronic cases and in the duration of an episode between hla - b27 negative and positive au groups ( p>0.05 ) , but au occurred significantly more often in patients with the hla - b27 haplotype ( 2.07 attacks / year ) than in those without the hla - b27 haplotype ( 1.47 attacks / year ) ( p=0.007 ) . no significant differences in the disease duration and course were observed between hla - b27 positive patients with or without associated systemic disease ( p>0.05 , table 4 ) . the ocular complications and final visual outcomes in the four study groups are described in table 5 . the most common ocular complication observed in both hla - b27 negative and positive groups was increased intraocular pressure ( iop ) ( 40.0% and 27.3% , respectively ) . however , there were no significant differences in the proportions of eyes with cataract , cystoid macular edema , increased iop , secondary glaucoma , or posterior synechia between hla - b27 negative and positive au groups and between hla - b27 positive au groups with or without systemic disease ( p>0.05 ) . group i and ii ( and group iia and iib also ) showed similar good final visual outcomes ( table 5 ) . over 90% of eyes in each study group had final bcva of 20/40 or better , and 86.1% ( 31/36 ) , 82.8% ( 72/87 ) , 89.1% ( 41/46 ) , and 75.6% ( 31/41 ) of the eyes in groups i , ii , iia , and iib , respectively , had final bcva of 20/20 . there were no significant differences in the mean logmar ( logarithm of the minimum angle of resolution ) bcva between the eyes of groups i and ii and between the eyes of groups iia and iib ( light perception was assigned the logmar equivalent 2.70 ) ( p=0.687 and 0.161 , respectively ) 2 shows the kaplan - meier survival curves of eyes with a potential bcva of 20/40 and 20/32 in hla - b27 negative versus positive au patients , and there was no significant difference between hla - b27 negative and positive au patients ( p=0.8118 and 0.4286 , respectively ; by log rank test ) . there was only one legally blind eye ( bcva of 20/200 or worse ) with final bcva of light perception among all study eyes . this patient , who had ankylosing spondylitis and the hla - b27 haplotype , had his first au occurrence in the left eye when he was 24 yr old , and he had secondary chronic angle closure glaucoma after recurrent au episodes . glaucoma implant surgery and a penetrating keratoplasty were performed in his left eye , but his bcva eventually decreased to light perception . there was no obvious male or female predominance in group i ( male : female ratio , 1.08:1 ) , whereas there were approximately three times more male patients in group ii ( male : female ratio , 2.9:1 ) , and this difference between groups i and ii was statistically significant ( p=0.040 ) . among the two subgroups of the hla - b27 positive group , group iia ( male : female ratio , 8.7:1 ) had a significantly higher male : female ratio than did group iib ( male : female ratio , 1.4:1 ) ( p=0.007 ) . the age of onset of au was statistically similar between hla - b27 negative and positive au groups ( p=0.919 ) , and the age of onset of group iia was significantly younger than that of group iib ( p=0.015 ) . hla - b27 positive au showed more severe anterior chamber inflammation than its hla - b27 negative counterpart . the mean grade of anterior chamber cells and the rate of hypopyon formation were significantly higher in the eyes of group ii than in those of group i ( p=0.006 and 0.034 , respectively ) ; hypopyon occurred almost exclusively in hla - b27 positive eyes ( table 2 ) . the proportions of anterior chamber cells of grade 3 or more and grade 4 were significantly higher in the eyes of the hla - b27 positive group than in the eyes of the hla - b27 negative group ( p=0.001 and 0.041 , respectively ) ( fig . 1 ) . in the analysis of the anterior chamber inflammation between the eyes of groups iia and iib , there were no statistically significant differences ( p>0.05 , table 2 , fig . 1 ) . a clear distinction of the visual outcome during the active inflammatory stage was observed between hla - b27 negative and positive groups ( table 2 ) . approximately four out of five hla - b27 negative au eyes ( 81.5% ) had bcva of 20/40 or better during the active inflammatory stage , whereas approximately two out of three hla - b27 positive au eyes ( 65.7% ) had bcva worse than 20/40 . in addition , about one out of three hla - b27 positive au eyes ( 32.8% ) had bcva of 20/200 or worse , whereas less than one out of ten hla - b27 negative au eyes ( 7.4% ) had bcva of 20/200 or worse ( p=0.011 ) . the proportion of eyes with bcva of 20/40 or better was significantly larger in group i than in group ii ( p<0.001 ) , and the proportion of eyes with bcva between 20/40 and 20/100 and the proportion of eyes with bcva between 20/100 and 20/400 were significantly larger in group ii than in group i ( p=0.031 and 0.030 , respectively ) . in the analysis of the worst bcva between the eyes of groups iia and iib , there were no significant differences in all ranges of visual acuity ( p>0.05 , table 2 ) . systemic or periocular steroids were required in significantly more patients in the hla - b27 positive group ( approximately 4 out of 5 patients ) than in the hla - b27 negative group ( approximately 1 out of 2 patients ) ( p=0.015 , table 3 ) . further analysis revealed that both oral and periocular steroids were used more frequently in hla - b27 positive patients than in hla - b27 negative patients ( p=0.032 and 0.021 , respectively ) . the presence of a systemic disease association made no significant difference in the medical treatment of au in the hla - b27 positive group ( p>0.05 , table 3 ) . the disease duration and course including the frequency of uveitis attack are summarized in table 4 . approximately 9 out of 10 study patients ( 92.6% of group i and 92.7% of group ii ) had limited ( 3 months or less ) au with a mean duration of about one month , and approximately 9 out of 10 study patients had repeated episodes of au ( 85.2% of group i and 90.9% of group ii ) . there were no significant differences in the proportions of limited / persistent , single / repeated , and chronic cases and in the duration of an episode between hla - b27 negative and positive au groups ( p>0.05 ) , but au occurred significantly more often in patients with the hla - b27 haplotype ( 2.07 attacks / year ) than in those without the hla - b27 haplotype ( 1.47 attacks / year ) ( p=0.007 ) . no significant differences in the disease duration and course were observed between hla - b27 positive patients with or without associated systemic disease ( p>0.05 , table 4 ) . the ocular complications and final visual outcomes in the four study groups are described in table 5 . the most common ocular complication observed in both hla - b27 negative and positive groups however , there were no significant differences in the proportions of eyes with cataract , cystoid macular edema , increased iop , secondary glaucoma , or posterior synechia between hla - b27 negative and positive au groups and between hla - b27 positive au groups with or without systemic disease ( p>0.05 ) . group i and ii ( and group iia and iib also ) showed similar good final visual outcomes ( table 5 ) . over 90% of eyes in each study group had final bcva of 20/40 or better , and 86.1% ( 31/36 ) , 82.8% ( 72/87 ) , 89.1% ( 41/46 ) , and 75.6% ( 31/41 ) of the eyes in groups i , ii , iia , and iib , respectively , had final bcva of 20/20 . there were no significant differences in the mean logmar ( logarithm of the minimum angle of resolution ) bcva between the eyes of groups i and ii and between the eyes of groups iia and iib ( light perception was assigned the logmar equivalent 2.70 ) ( p=0.687 and 0.161 , respectively ) . 2 shows the kaplan - meier survival curves of eyes with a potential bcva of 20/40 and 20/32 in hla - b27 negative versus positive au patients , and there was no significant difference between hla - b27 negative and positive au patients ( p=0.8118 and 0.4286 , respectively ; by log rank test ) . there was only one legally blind eye ( bcva of 20/200 or worse ) with final bcva of light perception among all study eyes . this patient , who had ankylosing spondylitis and the hla - b27 haplotype , had his first au occurrence in the left eye when he was 24 yr old , and he had secondary chronic angle closure glaucoma after recurrent au episodes . glaucoma implant surgery and a penetrating keratoplasty were performed in his left eye , but his bcva eventually decreased to light perception . many studies have been reported on the clinical features and prognosis of hla - b27 positive au ( 7 - 14 , 17 , 18 ) . however , the ocular complications and visual outcomes of hla - b27 positive au compared to hla - b27 negative au continue to be controversial . as mentioned in an earlier report ( 2 ) , some of the conflicting findings may result from differences in the follow - up period and in the inclusion and diagnostic criteria used in various studies . evaluation of the effect of the hla - b27 haplotype on the ocular and visual prognosis of au in patients with hla - b27 positive au compared to the hla - b27 negative au group is complicated by the heterogeneity of the hla - b27 negative au group ( 2 ) . that is , inclusion of distinct uveitic entities , which are likely to be associated with ocular complications and visual prognosis independent of the hla - b27 antigen ( such as sarcoidosis and behcet 's disease ) , may make it difficult to evaluate the effect of the hla - b27 antigen on the complications and outcomes of au . in the present study , only idiopathic cases of hla - b27 negative au were included to minimize potential confounding factors , similarly to a previous report ( 9 ) . in addition , the effects of associated systemic disease on hla - b27 positive au were also evaluated by further dividing the hla - b27 positive au group into two subgroups : patients with a systemic disease association and those who had no evidence of systemic disease association . the clinical features of hla - b27 positive au in this study are generally similar to those in previously published reports from other western ( 7 - 12 , 14 , 17 ) and asian countries ( 13 , 18 ) . the common characteristics include an increased frequency among male patients and a significant association with hla - b27-related systemic disease as well as a significant cellular reaction in the anterior chamber with hypopyon requiring more aggressive treatment and with a higher frequency of recurrent attacks . in terms of the ocular complications and final visual outcomes , for which there have been conflicting results reported , the present study revealed no significant difference in the overall outcome between the hla - b27 negative and positive groups . a previous study with less favorable outcomes for hla - b27 positive au was conducted on patients seen between 1982 and 1993 ( 9 ) . therapeutic strategies for hla - b27 positive au have somewhat changed , and more intensive treatment is now given to hla - b27 positive au patients . this more aggressive treatment for hla - b27 positive au may explain the similar overall outcomes between hla - b27 negative and positive groups in the current study , which reviewed au patients treated between 1996 and 2006 . in terms of the effect of the systemic disease association on the hla - b27 positive au , our study showed no significant difference in the ocular complications and final visual outcomes between hla - b27 positive au patients with systemic disease ( group iia ) and those with no systemic disease ( group iib ) . this finding is in accord with the results of earlier reports ( 9 , 16 ) . one of the earlier reports revealed that the mean recurrence rate of inflammation was higher in hla - b27 positive patients with systemic disease ( 3.6 attacks ) than in those with no systemic disease ( 5.2 attacks ) ( 9 ) . however , another report showed that there was no significant difference in the mean frequency of attacks between hla - b27 positive au patients with systemic disease ( 0.8 attacks / year ) and those with no systemic disease ( 0.7 attacks / year ) ( 16 ) , and our study results were consistent with the latter one with the median frequency of attacks of 2.07 and 2.05 attacks / year in groups iia and iib , respectively . previous reports on the clinical characteristics of hla - b27 positive au in asian countries are scarce , and no comparative study on the clinical characteristics of hla - b27 positive and negative aus in korean populations has been reported in the international ophthalmic literature . in an earlier report ( 18 ) , chinese au patients with the hla - b27 haplotype had a generally good visual prognosis with 90.3% of the affected eyes having a visual acuity better than 20/40 , although 66.8% of patients had recurrent uveitis episodes and 31.4% and 14.3% of the affected eyes had posterior synechiae and cataract , respectively . in another report from thailand ( 13 ) , clinical features of hla - b27 positive and negative acute au were similar to those reported in western countries with no significant differences in the visual outcomes between hla - b27 positive and negative groups . in contrast to most prior western reports that noted a larger proportion of increased iop in the hla - b27 positive group than in the hla - b27 negative group ( 9 , 12 ) , however , the proportion of cases with increased iop was significantly higher in hla - b27 negative group than in hla - b27 positive group . in the current study , an increased iop ( > 21 mmhg ) and secondary glaucoma were more common in the hla - b27 negative patients ( 40.0% and 10.0% , respectively ) than in the hla - b27 positive patients ( 27.3% and 2.3% , respectively ) , although there were no statistically significant differences ( p=0.150 and 0.076 , respectively ) . the increased iop may be attributed to the au itself and/or the steroid treatment for au . in addition , the etiology of hla - b27 negative au in asia might include more cases of various viral infections ( often associated with increased iop ) as suggested in a previous study ( 13 ) . previous studies on the clinical characteristics and prognosis of hla - b27 positive and/or negative au in korean patients were published in a domestic ophthalmologic journal ( 19 , 20 ) . ( 19 ) recruited 32 au patients from 462 hla - b27 positive spondyloarthropathy patients ; the clinical characteristics of hla - b27 positive au were similar to this study except for the prominent unilateral involvement ( 31/32 , 96.8% ) and no occurrence of hypopyon ( 0/32 , 0% ) . however , the follow - up period for the 32 au patients was not mentioned and therefore these differences might be due to a shorter follow - up . however , patients with posterior uveitis were included ( 4/27 eyes ) making the group more heterogeneous . a comparative study between hla - b27 positive and negative au patients ( 5 ) showed more severe inflammation in the anterior chamber and more aggressive treatment in hla - b27 positive au compared to hla - b27 negative au , and the final visual outcomes were similar between the two groups . however , the number of subjects was relatively small ( 16 in hla - b27 positive group and 18 in hla - b27 negative group ) . the current study analyzed the largest data set to date available on korean patients with hla - b27 positive and negative au . in addition , we compared the subgroups of hla - b27 positive au with or without systemic disease . the significance of our results may partly be limited by referral bias as this study was based at a university hospital ( tertiary referral center ) with more complicated and severe cases . thus , the clinical features of both hla - b27 negative and positive aus would generally have a better prognosis than is described in this study , as pointed out in a previous report ( 2 ) . in addition , our results are also subject to selection bias because hla - b27 typing was conducted only for patients who agreed to perform the test after receiving information on the diagnostic , therapeutic , and prognostic significance of hla - b27 typing . in conclusion , the ocular and visual outcomes of hla - b27 positive au patients in korea are generally good and show no significant difference from those of hla - b27 negative au . the more aggressive treatment for significantly severer and recurrent anterior chamber inflammation in hla - b27 positive au is a feasible explanation for these findings . no significant differences in clinical characteristics , medical treatment , disease duration and course , and final ocular and visual outcomes were observed between the hla - b27 positive aus with or without associated systemic disease .

clinical features and prognosis of hla - b27 positive anterior uveitis ( au ) were assessed compared with hla - b27 negative au in a korean population , based on the medical records of au patients seen at a university hospital . twenty - seven hla - b27 negative , idiopathic au patients ( group i ) and 55 hla - b27 positive au patients ( group ii ) were studied . hla - b27 positive group was further divided into 29 with associated systemic disease ( seronegative spondyloarthropathy ) ( group iia ) and 26 without associated systemic disease ( group iib ) . significantly more severe anterior chamber inflammation in terms of anterior chamber cells ( p=0.006 ) and hypopyon formation ( p=0.034 ) was observed with higher frequency of au attacks ( p=0.007 ) in the hla - b27 positive group than in the hla - b27 negative group . systemic / periocular steroids were required in significantly more patients in the hla - b27 positive group than in the hla - b27 negative group ( p=0.015 ) . however , no significant differences were observed for final ocular and visual outcomes between these two groups . associated systemic disease made no significant difference in the clinical features and prognosis in the hla - b27 positive au patients . in conclusion , despite more severe inflammation and a higher recurrence rate , hla - b27 positive au shows similar good final ocular and visual outcomes compared to hla - b27 negative , idiopathic au in a korean population .

INTRODUCTION MATERIALS AND METHODS RESULTS Clinical features Ocular complications and final visual outcomes DISCUSSION

diabetic polyneuropathy ( dpn ) is the most common long - term complication in diabetes mellitus and affects more than 50% of patients1 . dpn can affect any part of the nervous system ( distal , proximal , large , small , motor , or autonomic fibers ) . accurate diagnosis of peripheral neuropathies is possible with the use of clinical and electrophysiological tests . nerve conduction studies ( ncss ) are noninvasive , sensitive , and objective procedures2 . in recent years , due to improved technology , ultrasonography ( us ) has been regarded as an inexpensive , reproducible , and more comfortable technique , and it can be utilized as an alternative method for detecting neuropathies . most studies have investigated the peripheral nerves at the vulnerable sites , such as the median nerve at the carpal tunnel and the tibial nerve at the medial malleolus in diabetic patients3 , 4 . on the other hand , hobson - webb et al . argued that the cross - sectional area ( csa ) of the lower extremity peripheral nerves did not significantly differ between dpn patients and controls5 . so far , there are no studies that have evaluated the upper extremity nerves at multiple sites in diabetic patients . in this blinded , prospective study , we aimed to investigate the usefulness of us for the diagnosis of polyneuropathy in diabetic patients by investigating the median and ulnar nerves . one hundred seven patients ( 72 females and 35 males ) who had type-2 diabetes mellitus according to the criteria of the american diabetes association6 and were referred to the physical medicine and rehabilitation electrodiagnosis laboratory , marmara university , were enrolled in the present study . additionally , we recruited 14 healthy age - matched volunteers without diabetes or carpal tunnel syndrome ( cts ) as controls . patients who had thyroid or liver disorders , high blood urea nitrogen , any inflammatory disorder , or any malignancy , those who consumed alcohol , and those who had had a previous carpal tunnel operation were excluded from the study . patients who complained of ulnar entrapment and those with isolated ulnar nerve entrapment based on electrodiagnostic tests were also excluded . the study protocol was approved by the local ethics committee , and all patients gave written informed consent before participating in the study . systemic and neuromuscular examinations ( light touch , pinprick , position , temperature , vibration senses , knee and ankle stretch reflexes ) were performed by a clinician who was blinded to the results of the nerve conduction studies ( ncss ) and us . according to a literature search , no gold standard for the diagnosis of cts and dpn has been established ; therefore , we used clinical evaluation and electrophysiological findings for the diagnosis . for clinical dpn , a scoring system was used based on a previous study7 , and the patients were defined as with or without dpn . a katz hand diagram was used for clinical cts8 , 9 . ncss were performed with conventional procedures and a standard device ( medtronic - keypoint , denmark , 2007 ) by the same physician , who was blinded to the clinical assessment . all studies were performed at standard room temperature 25 c . for the motor ncss of the median , ulnar , peroneal , and tibial nerves and second lumbrical - interosseous muscle median - ulnar distal latency ( limuld ) , the compound muscle action potential ( cmap ) was recorded with surface electrodes from the abductor pollicis brevis muscle for the median nerve , the abductor digiti minimi muscle for the ulnar nerve , the abductor hallucis longus muscle for the tibial nerve , and the extensor digitorum brevis muscle for the peroneal nerve with a standard distance of 8 cm . for the sensory ncss sensory ncss were recorded using cup electrodes from the third digit antidromically with a standard distance of 14 cm for the median nerve , from the fifth digit with a standard distance of 12 cm for the ulnar nerve , from the first digit with a standard distance of 9 cm for the radial nerve , and from the midpoint of the calf 14 cm from the lateral malleolus for the sural nerve . for limuld , median and ulnar motor ncss were recorded from the second lumbrical - interosseous muscle with a standard distance of 9 cm for the median and ulnar nerves . the average reference values for the nerve conduction velocities ( ncvs ) in our laboratory are 50 m / s for the median and ulnar motor ncvs and 40 m / s for the tibial and peroneal motor ncvs . electrophysiological diagnoses of cts and dpn were obtained according to the normative values established in our laboratory . values of greater than 3.7 ms for median motor nerve distal latency and median sensory nerve velocity , slower than 50 m / s for the wrist - third digit segment , and more than 0.4 ms for limuld were considered to indicate median nerve demyelination10 . subjects with abnormal electrodiagnostic results in one or more nerves in the upper limbs , in addition to the median nerve and one or more nerves in the lower limbs , were considered to have dpn . the electrophysiological testing was extended if a suspicious condition , such as ulnar neuropathy and radiculopathy , was present . patients with any other neuropathic findings , such as isolated ulnar nerve entrapment or radiculopathy , were excluded from the statistical analysis . finally , patients were classified into four groups according to electrophysiological diagnosis : normal , cts , dpn , or cts in the background of dpn ( dpn+cts ) . sonographic examinations were performed with a 618 mhz linear array probe ( mylab esaote , genoa , italy ) by a well - trained specialist who was blinded to the participant s history and ncs results . all examinations were performed with the participants in a supine position on a table . nerve csas were measured at various levels : the hook of hamate ( mham ) , pisiform bone ( mpsi ) , radioulnar joint ( mrue ) , distal one - third of the forearm ( mdis ) , proximal one - third of the forearm ( mprox ) , and medial epicondyle ( mepi ) for the median nerve , and the radioulnar joint ( urue ) , distal one - third of the forearm ( udis ) , proximal one - third of the forearm ( uprox ) , and medial epicondyle ( uepi ) for the ulnar nerve . the transducer was placed perpendicular to the nerves on the skin , and no additional pressure was applied other than its own weight . the csa was measured by tracing the nerve just inside its hyperechoic rim , and three measurements were obtained with the probe repositioned . the average value was used for each level . a csa of the median nerve greater than 10 mm at the pisiform level was used for sonographic diagnosis of cts in accordance with the literature and our laboratory values11 , 12 . statistical analyses were performed using the statistical package for the social sciences software ( 11.5.0.spss version 11.5.0 ) . categorical values ( gender , duration of diabetes , and clinical scores ) were analyzed using tests . to correlate us findings with other parameters , the pearson correlation coefficient and anova tests were used . to assess the optimal possible cut - off values of sonographic nerve csas for the diagnosis of dpn , receiver operating characteristics ( roc ) curves were used . a total of 140 hands ( 28 control , 24 normal , 34 cts , 26 dpn , 28 dpn+cts ) of 63 patients and 14 control subjects were included in the analysis ( mean ages of 47.6 13.1 , 43.1 11.7 , 50.3 8.01 , 51.4 12.5 , and 59.1 5.04 , respectively ) . in diabetic patients , eight hands were excluded based on ulnar entrapment findings , and six hands were excluded based on radiculopathy . there was a significant increase in the median nerve csa in the cts and dpn+cts groups when compared with the control , normal , and dpn groups at the radioulnar joint , pisiform , and hook of hamate hook levels ( table 1table 1.mean csas of the median nervecontrol ( n=28)normal ( n=24)cts ( n=34)dpn ( n=26)dpn+cts ( n=28)mrue ( mm)8.9 1.79.7 1.814.5 5.1 * 10.8 1.912.5 2.6*mpsi ( mm)8.8 1.39.2 1.714.4 4.7 * 10.5 2.312.5 3.3*mham ( mm)9 1.38.8 1.812.9 3.4 * 10.3 2.711.5 2.6*mdis ( mm)6 1.17.3 1.57.02 1.47.5 2.8 * 6.8 1.2mprok ( mm)5.4 1.16.4 1.36.2 1.16.8 2.3 * 6.3 1.4mepi ( mm)8.7 1.59.9 2.110.2 2 * 10.5 1.8 * 10.6 1.8csas : cross - sectional areas ; mham : median nerve at the hamatum hook ; mpsi : median nerve at the pisiform ; mrue : median nerve at the radioulnar joint ; mdis : median nerve at the distal one - third level of the forearm ; mprox : median nerve at the proximal one - third level of the forearm ; mepi : median nerve at the medial epicondyle . the csas of the median nerve at the distal one - third of the forearm and proximal one - third of the forearm levels were higher in the dpn group compared with the control group ( p=0.038 and p=0.035 ) . there was a significant increase at the mepi in the cts , dpn , and dpn+cts groups when compared with the control group ( table 1 ) . csas : cross - sectional areas ; mham : median nerve at the hamatum hook ; mpsi : median nerve at the pisiform ; mrue : median nerve at the radioulnar joint ; mdis : median nerve at the distal one - third level of the forearm ; mprox : median nerve at the proximal one - third level of the forearm ; mepi : median nerve at the medial epicondyle . * p<0.05 there was no statistically significant difference in the ulnar nerve at the radioulnar joint and distal one - third of the forearm levels between the groups . at the uprox level , there was a significant increase in ulnar nerve csa in the dpn group ( 6.5 1.4 ) compared with the cts group ( 5.5 0.9 ) . at the medial epicondyle level , the csa of the ulnar nerve was significantly smaller in the control group ( 7.7 1.1 ) compared with the cts ( 9.2 1.9 ) , dpn ( 9.2 1.6 ) , and dpn+cts ( 9.3 1.4 ) groups ( table 2table 2.mean csas of the ulnar nervecontrol ( n=28)normal ( n=24)cts ( n=34)dpn ( n=26)dpn+cts ( n=28)urue ( mm)5.6 0.85.5 0.96.2 1.66.4 1.96.2 1udis ( mm)5.9 0.85.9 1.15.6 0.96.1 16.1 0.8uprox ( mm)6.1 15.9 1.25.5 0.96.5 1.4 * 6 0.9uepi ( mm)7.7 1.18.1 1.69.2 1.9 * 9.2 1.6 * 9.3 1.4*post hoc analysis : p=0.014 for dpn vs. cts at the uprox ; p=0.01 , p=0.003 , and p=0.002 for dpn vs. control , cts vs. control , and dpn+cts vs. control at the uepi , respectively . csas : cross - sectional areas ; urue : ulnar nerve at the radioulnar joint ; udis : ulnar nerve at the distal one - third level of the forearm ; uprox : ulnar nerve at the proximal one - third level of the forearm ; uepi : ulnar nerve at the medial epicondyle . * p<0.05 ) . post hoc analysis : p=0.014 for dpn vs. cts at the uprox ; p=0.01 , p=0.003 , and p=0.002 for dpn vs. control , cts vs. control , and dpn+cts vs. control at the uepi , respectively . csas : cross - sectional areas ; urue : ulnar nerve at the radioulnar joint ; udis : ulnar nerve at the distal one - third level of the forearm ; uprox : ulnar nerve at the proximal one - third level of the forearm ; uepi : ulnar nerve at the medial epicondyle . * p<0.05 in the roc analysis , cutoff values of 8.5 mm at the uepi with 71.4% specificity and 70.4% sensitivity and 5.5 mm at the uprox , udis , and urue levels with 25% , 32.1% , and 42.9% specificity and 75.9% , 74.1% , and 75.9% sensitivity , respectively , corresponding to the highest diagnostic accuracy for dpn in terms of ulnar nerve csa ( table 3table 3.cutoff values for the uepi for the diagnosis of dpncutoff value , mmsensitivityspecificityarea under the roc curveuepi8.570.471.40.787uprox5.575.9250.530udis5.574.132.10.554urue5.575.942.90.649uepi : ulnar nerve at the medial epicondyle ; uprox : ulnar nerve at the proximal one - third level of the forearm ; udis : ulnar nerve at the distal one - third level of the forearm ; urue : ulnar nerve at the radioulnar joint ) . uepi : ulnar nerve at the medial epicondyle ; uprox : ulnar nerve at the proximal one - third level of the forearm ; udis : ulnar nerve at the distal one - third level of the forearm ; urue : ulnar nerve at the radioulnar joint according to the above cutoff values , the most effective sonographic parameter for dpn diagnosis was the csa at the uepi . to compare the diagnostic utility of us with ncs , a new sonographic classification was applied to the groups ( table 4table 4.ultrasonographic classificationnormal : mpsi<10 mm and bilateral uepi<8.5 mmcts : mpsi>10 mm and bilateral uepi<8.5 mmdpn : mpsi<10 mm and bilateral uepi>8.5 mmdpn+cts : mpsi>10 mm and bilateral uepi>8.5 mmcts : carpal tunnel syndrome ; dpn : diabetic polyneuropathy ; mpsi : median nerve at the pisiform ; uepi : ulnarnerve at the medial epicondyle ) . cts : carpal tunnel syndrome ; dpn : diabetic polyneuropathy ; mpsi : median nerve at the pisiform ; uepi : ulnarnerve at the medial epicondyle in this study , the csas of the ulnar nerve were larger at epicondyle level in the patients with diabetic polyneuropathy . additionally , median nerve csas were larger in diabetic patients with carpal tunnel syndrome at wrist levels compared with those of the healthy controls . diabetic distal symmetrical sensorimotor polyneuropathy is the most common form of neuropathy in diabetic patients and can cause many serious complications such as diabetic foot , charcot joint , and flexion contractures , which reduce quality of life13 . upper limb symptoms are often associated with proximal spreading of the dpn ; however , these symptoms can be observed in other or adjunctive entrapment neuropathy components such as cts and ulnar neuropathy at the elbow . a previous study showed that the limuld difference can help to detect cts in the background of dpn in ncss10 . conversely , us has been used for the diagnosis of entrapment neuropathies such as cts and dpn11 , 15,16,17 . wong et al.15 demonstrated that a median nerve csa greater than 9.8 mm supports a diagnosis of cts with 89% sensitivity and 83% specificity . additionally , el - miedany et al.11 suggested that a median nerve csa of 10 mm confirms a diagnosis of cts with 97.9% sensitivity and 100% specificity . watanabe et al.3 , 4 showed that the median nerve ( at the wrist ) and tibial nerve ( at the ankle ) csas were increased in diabetic patients when compared with their control group and that csas were negatively correlated with motor nerve conduction velocity . in our study , we found a significant increase in the median nerve csa at the epicondyle level in the cts ( 10.1 2 ) , dpn ( 10.2 2 ) , and dpn+cts ( 10.6 1.7 ) groups when compared with the control group ( 8.7 1.5 ) . additionally , the median nerve csa was greater at wrist levels than in the control and dpn groups if there was cts with or without dpn . these results support the finding that the median nerve enlarges at the wrist in carpal tunnel syndrome , as reported in previous studies . in another study , chen et al.17 compared median nerve csas among diabetic patients with cts and dpn+cts . they found greater csas at the wrist and in the carpal tunnel in the latter group . however , median nerve csas are not helpful in the diagnosis of polyneuropathy , and they do not discriminate cts in the background of dpn according to our results . the us features of ulnar nerve csas have not been systematically studied to a sufficient extent in diabetic patients . in a study of 98 patients with dpn and 90 controls , the median and ulnar nerve csas were found to be increased in demyelinating neuropathies18 . arumugam et al.19 compared patients with dpn with normal controls and found that ulnar nerve csas were significantly increased ( p=0.016 ) at the level of mid - forearm . the ulnar nerve may become enlarged at the elbow due to structures that pressure the nerve ( ganglia , anconeus epitrochlearis muscles , etc . ) , and this can lead to nerve entrapment . furthermore , in addition to entrapment , peripheral nerve thickening can occur as a result of thickening of capillary walls in the endoneurium and increased intracellular hydration due to increased sorbitol in diabetic patients20 , 21 . to minimize the effect of local nerve entrapment , clinical and electrophysiological exclusion was performed . in the current study , we measured the ulnar nerve from four regions . we found increased csas at the epicondyle level in the dpn and dpn+cts groups and as an interesting finding in cts patients with diabetes mellitus when compared with the control group . these results showing that electrophysiological cts can be a part of the polyneuropathy in diabetic patients should be interpreted carefully . kim et al.22 also found increased csas of the median nerve in dpn - only patients compared with those of healthy controls at the wrist . therefore , ultrasonographic cts diagnoses are inconsistent with electrophysiological results in patients with dpn . the current diagnostic criteria for cts , dpn , and dpn+cts should be reconsidered . it appears that , clinical , electrophysiological , and ultrasonographic diagnoses should be confirmed with a new gold standard technique by further studies with a larger population . the cutoff values derived from roc analysis and an ulnar csa greater than 8.5 mm at the epicondyle level supported the diagnosis of dpn with 70.4% sensitivity and 71.4% specificity in our study . the usefulness of us in diagnosis of ulnar nerve entrapment was not examined in this study ; thus , these cutoff values patients who had clinical or electrodiagnostic ulnar nerve entrapment were excluded . in view of this cutoff and the literature , a sonographic classification can be done according to ulnar nerve csas at the medial epicondyle and median nerve csas at the wrist ( table 4 ) . according to our results , four normal subjects were diagnosed as cts and five normal subjects were diagnosed as dpn by using us . two possible reasons for these results are as follows : these patients might have had cts or dpn but were electrophysiologically normal , or us might have exhibited some degree of false - positive results . the most important limitation of our study was that focal entrapment neuropathies might have been confused with dpn because they can not be distinguished accurately . this bias was minimized by use of blinded researchers and standardized protocols . in conclusion , neither us nor ncss are a gold standard for the evaluation of peripheral nerves . ncs reflects nerve function better than us and provides valuable information for differential diagnosis . us is a more comfortable technique for the patient and provides a dynamic evaluation . increased csas of the ulnar nerve at the medial epicondyle level can be useful for the diagnosis of dpn , particularly for screening . in general , the relationship between generalized neuropathy and focal entrapment neuropathies is complex and difficult to clarify . we suggest that the combination of us and ncs may be used for the diagnosis of neuropathies in diabetic patients .

[ purpose ] the aim of this study was to investigate the usefulness of ultrasonography for the diagnosis of polyneuropathy in diabetic patients by examination of the median and ulnar nerves . [ subjects and methods ] sixty - three diabetic patients and fourteen controls were enrolled in the study . nerve conduction studies were performed on both upper and lower limbs . median and ulnar nerve cross - sectional areas were measured at the wrist and forearm levels in 140 hands by ultrasound . [ results ] the median nerve cross - sectional area was increased at the hook of hamatum , pisiform bone , and radioulnar joint levels in patients with carpal tunnel syndrome . the ulnar nerve area at the medial epicondyle was significantly increased in the diabetic polyneuropathy ( 9.2 1.6 ) , diabetic polyneuropathy plus carpal tunnel syndrome ( 9.3 1.4 ) , and carpal tunnel syndrome ( 9.2 1.9 ) groups compared with the control group ( 7.7 1.1 ) . in receiver operating characteristics analysis , the cutoff value of the ulnar nerve was 8.5 mm2 at ulnar epicondyle with 71.4% specificity and 70.4% sensitivity , corresponding to the highest diagnostic accuracy for diabetic polyneuropathy . [ conclusion ] ultrasonographic examination of the median and ulnar nerves can be an alternative or additional diagnostic modality for the evaluation of neuropathies in diabetic patients .

INTRODUCTION SUBJECTS AND METHODS RESULTS DISCUSSION

congenital adrenal hyperplasia ( cah ) is an autosomal recessive adrenal steroid synthesis disorder that is transferred genetically and is characterized by increased adrenocorticotropic hormone ( acth ) secretion due to glucocorticoid and mineralocorticoid deficiency . an increase in acth synthesis can result in hyperplasia of acth - sensitive tissues in the adrenal glands and other sites such as the testes , leading to testicular masses widely known as tart , or testicular adrenal rest tumor . tart is often an asymptomatic benign lesion that frequently occurs in male cah patients with a reported prevalence of up to 94% . yet , the prevalence , etiology , and functional features of testicular tumors due to 11-hydroxylase deficiency are not clearly known . the present article is a case study of bilateral tart in a patient with 11-hydroxylase deficiency - driven cah . a 16-year - old male patient was referred from the pediatrics clinic to our clinic with a diagnosis of 11-hydroxylase deficiency - driven cah after the determination of bilateral testicular masses . the patient 's history revealed a diagnosis of 11-hydroxylase deficiency - driven cah at a young age . although the patient 's laboratory data from an early age were not available , the patient had been using dexamethasone 10.75 mg and spironolactone 1100 mg irregularly . the physical examination revealed multiple bilateral solid nodules in the testes of approximately 0.5 to 1.5 cm . the results of routine hematologic and biochemical tests and the levels of prolactin , luteinizing hormone , and follicle - stimulating hormone were normal . the values of serum markers for testis tumors , such as alpha - fetoprotein ( afp ) , beta - human chorionic gonadotropin ( hcg ) , and lactate dehydrogenase ( ldh ) , were within normal ranges . cortisol , acth , and dehydroepiandrosterone sulfate levels were likewise normal , unlike the elevated levels of 17-hydroxyprogesterone and 11-deoxycortisol , which were 23 ng / ml ( < 2 ng / ml ) and 238 ng / ml ( < 8 ng / ml ) , respectively . scrotal ultrasonography revealed the following testicular sizes : right , 41 mm21 mm , and left , 43 mm22 mm . both testes contained multiple solid heterogenic hypoechoic nodules of different sizes ranging from approximately 21 mm15 mm to 14 mm10 mm with well - drawn borders and increased vascularity as indicated by the arrows ( fig . scrotal magnetic resonance imaging revealed multiple solid nodules with the largest diameter being 18 mm in the right testis and 11 mm in the left . after intravenous gadolinium injection , intense homogeneous contrast accumulation was seen in the nodular lesions with contoured lobes and well - drawn borders ( fig . the patient 's sperms were cryopreserved in case he underwent bilateral orchiectomy on the basis of malignant pathological findings . because the testicular tumor could not be differentiated as malignant or benign on the basis of the laboratory and imaging findings , the patient underwent a right high inguinal testicular exploration . because the report of the frozen section analysis was benign , orchiectomy was not performed . after the tunica albuginea was sutured , the testis was placed back into the scrotum . histopathological analysis revealed that the cells forming the mass were similar to leydig cells with separated fibrous tissue ; significant , nucleolus , eosinophilic cytoplasm ; and polygonal shapes forming in some areas nests and at other areas layers . immunohistochemical analysis revealed that the tumor cells totally diffused with vimentin and melan - a but were focally immunopositive to inhibin and creatine . placental alkaline phosphatase and ae1/ae3 were immunonegative and the tissue was defined as tart ( fig . the patient was diagnosed with tart , glucocorticoid treatment was initiated , and the patient was followed up . moreover , tart is generally seen in insufficiently treated or untreated patients with cah owing to the elevated acth levels . hence , it is often detected in adolescents and young adults . in the present case , changes in the levels of 11-deoxycortisol to cortisol and 11-deoxycorticosterone to corticosterone were decreased owing to the defect in 11-hydroxylase activity . a decrease in cortisol levels leads to acth stimulation and thus to growth in adrenal tissue and adrenal ectopic tissues . tarts are very difficult to differentiate from leydig cell tumors ( lcts ) , which are mostly common in stromal testicular neoplasia leading likewise to precocious puberty and testicular masses . the presentation of these two entities is the same , yet the therapeutic approaches differ . whereas lcts require surgical treatment , most cases of tarts respond to steroid - suppressive therapy . in the diagnosis of tart and malignant tumors , although the initial evaluation of the present case was in favor of testicular malignancy ( lcts ) or tart , for differentiation , biopsy results are considered to be conclusive . the clinical manifestations of tarts are changes in blood pressure and bilateral tumors accompanied by a family history of tart . the bilateral presence of tart is determinant in diagnosis ; however , 3% of bilateral masses consist of lcts . precocious puberty and gynecomastia might be evident in both ; however , gynecomastia is more frequent in lct . the laboratory findings supporting tart are hypokalemia and normal tumor indicators such as hcg , afp , and ldh . in ultrasonography , tart is prevalent in the form of multiple hypoechoic nodules , whereas lcts appear as single hypoechoic nodules . the present case was a 16-year - old male patient with a history of hypertension and multiple bilateral lesions . therefore , in the present case , a high inguinal testicular exploration with nodal excision was done to analyze frozen sections to determine the prospective treatment modality . in case the histopathological diagnosis was malignant and bilateral orchiectomy was thus unavoidable , cryopreservation was done before the procedure . because the frozen section report was benign , orchiectomy was not performed . , the patient was enrolled into the follow - up protocol and referred to pediatric endocrinology for glucocorticoid treatment planning . although tart is not among the prevalent tumors , one of the most important problems is its differentiation from malignant tumors . despite the fact that clinical , radiological , and biochemical indicators support the diagnosis , histopathological diagnosis is decisive . in patients with cah , early diagnosis and conservative treatment in tart patients is essential because a delayed radical approach will result in prospective infertility and testicular hypofunction . in the present case , clinical , radiological , and biochemical diagnoses supported tart ; yet biopsy to make a decisive diagnosis could not be conducted . in conclusion , to prevent irreversible testicular damage , early detection of tart is important . cah patients should be regularly followed up for tart , and those with nodular testicular lesions should be well evaluated before any invasive treatment and diagnosis modalities are preferred by urologists .

testicular adrenal rest tumors ( tart ) occur often as asymptomatic nodules in corticotropin - dependent lesions aberrant adrenal tissue in congenital adrenal hyperplasia ( cah ) patients . the present manuscript is about an unusual case of a 16-year - old cah patient due to 11-hydroxylase deficiency . he underwent testicle biopsy because of testicle tumor suspicion and diagnosed with tart .

INTRODUCTION CASE REPORT DISCUSSION

vulvar and vaginal squamous cell carcinomas ( vv - scc ) are rare malignancies with a world - standardized annual incidence of around 1 - 3 per 100,000 women . although many hypotheses have been proposed in the etiology of vulvar cancer , it has no specific factor . prior studies have reported infection with human papillomavirus ( hpv ) types are associated with high - risk hpvs ( hrhpvs ) of cervical cancer to be etiologically involved in vv - scc . other risk factors , including lifetime number of male sexual partners , genital warts , tobacco smoking , and low socioeconomic status are involved . however , other , yet poorly defined etiologic factors that influence the risk of vv - scc either without or in conjunction with hrhpv infection must exist . the relationship between hpv infection and female lower genital tract neoplasia has been established in the past 20 years . during the same period of time , studies have also shown that patients infected with human immunodeficiency virus ( hiv ) have a propensity to develop certain neoplastic diseases . conley et al showed a 16-fold increase in the development of vulvovaginal and perianal condylomata acuminata or intraepithelial neoplasia in a cohort of hiv - infected women compared with uninfected women . another series found that hiv - infected patients had a 3.3-fold increased risk of recurrent or persistent vulvar intraepithelial neoplasia after treatment compared with hiv - uninfected patients . a 29-year - old female patient presented to the dermatology department with a nonhealing ulcer on the vulva of 4 months duration . her medical history revealed that she was a housewife married for 6 years with no extramarital exposure . the patient 's known hiv - risk factor was her husband , who was reportedly hiv - positive . physical examination revealed a moderately built women with an erythematous verrucous indurated growth measuring about 2 cm 1 cm over the right side of labia majora , covered with dirty grayish - white precipitate [ figure 1 ] . there was no enlargement of lymph nodes and on careful examination rest of vagina and cervix were normal . cd4 count is 216 cells / mm pap smear was normal and colposcopic examination of cervix and vagina were normal . histopathology of the lesion from labia majora revealed focally invasive moderately differentiated scc [ figures 2 and 3 ] . her chest x - ray was found to be normal and computed tomography - abdomen revealed ill - defined soft tissue lesion in the vaginal region . the patient was in stage1 vulvar cancer , and she underwent modified radical vulvectomy with primary closure [ figure 4 ] . postoperative recovery was uneventful , and no recurrence was seen over a follow - up period of 9 months . closer view of the verrucous growth low power - pointer shows malignant changes high power - infiltration in squamous epithelium showing atypical cell with nuclear hyperchromasia , pleomorphism after surgery modified radical vulvectomy with primary closure according to national aids control organization hiv estimations 20122013 , the estimated number of people living with hiv / aids in india were 20.89 lakhs ( 1549 age group ) . over the past 15 years , it has become widely accepted that there is an association between cervical disease and infection with the hiv . invasive cervical cancer was designated in 1993 as an aids case defining illness by the centers for disease control and prevention . since both cervical and vulvar cancers share certain risk factors , and invasive cervical cancer can occur simultaneously or metachronously with invasive vulvar cancer . a 23-fold risk increase for vulvar / vaginal cancer has been shown for people who have received organ transplants . similarly , hiv - positive women appear to be an increased risk of vaginal cancer and precancer , though the magnitude of the increased risk varies in published papers from around 7 ( vulvar and vaginal cancer combined ) to 21 times higher . there are only nine reported cases of invasive vulvar cancer in hiv - seropositive women in the literature . . our study has demonstrated that invasive vulvar carcinoma is not uncommon in younger age group and this could be linked to immunosuppression . vulvar cancer can occur independent of hormonal influence as there is no difference in binding capacity of estrogen receptors in normal , atrophic and malignant skin . without properly functioning immune system tumor cells escape destruction and proliferate unchecked . the genetic factor control various factors such as individual susceptibility and ability to activate and deactivate carcinogens , to produce interferons , which may affect patient susceptibility to viral infections and malignancies and regulation of the immune system . therefore , our patient developed invasive squamous cell cancer due to immunosuppression caused by hiv infection . management of invasive vulvar cancer in this young population needs to be balanced between appropriate curative surgery , which will often be radical , versus the desire to perform less mutilating surgery in young women . so we have opted for modified radical vulvectomy with primary closure . with increasingly comprehensive care and more effective antiretroviral and antimicrobial therapies , hiv - infected patients with compromised immunity are now surviving for extended periods of time . we can expect that lower genital tract neoplasia is likely to become a more common presentation of hiv disease among infected women , and hence strategies need to be developed for early detection and treatment of anogenital neoplasia and invasive malignancies in the setting of hiv - induced immunodeficiency . due to the rarity of primary vulvar carcinoma , the clinical behavior of this neoplasm in the hiv - infected patient is poorly understood . our case indicates that although vulvar carcinoma is a disease of the elderly , young women infected with hiv are predisposed to vulvar carcinoma . clinicians caring for hiv - infected women should be careful to routinely examine the vulva and perianal region and to biopsy any suspicious areas for early diagnosis and treatment to improve patients prognosis .

vulvar squamous cell carcinomas ( scc ) are rare malignancy of unknown etiology . only 10% of these tumors occur under the age of 40 years . we are describing one such rare case where a 29-year - old female patient had presented with nonhealing ulcer over vulva since 4 months . histopathology revealed invasive scc of the vulva . the occurrence of invasive vulvar scc in a younger patient is rare . in this patient , it is most likely precipitated by immunodeficiency caused by human immunodeficiency virus .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION Financial support and sponsorship Conflicts of interest

elisa kits for the determination of insulin were purchased from alpco diagnostics , and leptin kits were purchased from millipore . [ p]-atp was purchased from perkin - elmer , sn-1,2-dioleylglycerol was from avanti , and most other reagents and chemicals were purchased from sigma - aldrich . the generation of the hypoxia - induced rat model of iugr has been described in detail previously ( 2325 ) . at birth , litters were reduced to eight male pups and litters that contained fewer than eight viable male pups were reduced to eight offspring with as many males as possible . at 3 weeks of age , female offspring were killed and male pups were weaned and housed two per cage . immediately after weaning , all offspring exposed to different prenatal interventions ( control , n = 36 from seven litters ; and iugr , n = 36 from eight litters ) started receiving an hf diet ( 45% fat ; research diets d12451 ) . in addition , half of the animals from each litter were randomly allocated to receive additional supplementation with resv in the diet ( 4 g / kg of diet ) . therefore , four experimental groups were created : control offspring receiving hf diet ( control hf - c ; n = 18 from six litters ) , control offspring receiving hf diet plus resv ( control hf - r ; n = 18 from six litters ) , iugr offspring receiving hf diet ( iugr hf - c ; n = 18 from six litters ) , and iugr offspring receiving hf diet plus resv ( iugr hf - r ; n = 18 from six litters ) . the bioavailability of resv administered in the diet is low ( 0.1% ) , mainly because of intestinal breakdown , absorption , and liver metabolism ( 14 ) . therefore , the final plasma concentration of this molecule achieved with the dose administered in this study was within expected therapeutic values ( 1020 mol / l range ) ( 26 ) . to determine which measurements were performed on each animal , rats born from the same dam within each experimental group were randomly assigned to three possible subgroups ( designated a , b , or c ) ; see supplementary fig . 1 for details . because all rats included in each subgroup belonged to a different litter , we used the offspring as the unit of analysis . after 9 weeks of nutritional intervention , body composition was determined using a whole body composition analyzer based on time - domain nuclear magnetic resonance technology ( echomri 4-in-1/1000 ; echo medical systems ) . for the determination of abdominal fat in vivo , rats were anesthetized using inhaled isoflurane ( 2% in compressed air ) and placed into a micro single - photon emission computed tomography ( spect ) scanner flex pre - clinical platform xo - xpet - xspet instrument ( -medica ideas ) . the -camera was programmed to scan 512 projections ( sum of frames = 4 , voltage 60 kdp and 390 ua ) . the observation window was set between the diaphragmatic membrane and the acetabulum for each animal ( 91.78 mm ) , and the magnification factor on the camera was set to 1.29 . the intra - abdominal fat volume was calculated using the software gmi - amira 3.1.1 . threshold density was adjusted by internal volume so that internal organs and large vessels were not counted as intra - abdominal fat tissue and were excluded from calculations . for additional measurements of intra - abdominal fat content , mechanical extraction and weight of different abdominal fat depots ( retroperitoneal , perirenal , mesenteric , epiploic , and subdiaphragmatic ) was performed after dissection . the pearson correlation between methods used to determine the intra - abdominal fat content ( mechanical extraction and micro ct scan ) was r = 0.65 , p = 0.002 . the bland and altman analysis demonstrated a bias between the techniques of 0.14 14.7 g , which demonstrates that both techniques were highly correlated and that the average variability in the determinations made with these techniques was less than 1 g ( < 2% of the average value ) . intra - abdominal organs including liver , spleen , pancreas , and kidneys were dissected and weighed before being frozen . in a subset of rats and after 2 h of fasting , rats were anesthetized using inhaled isoflurane , followed by cervical dislocation , collection of a sample of blood by cardiac puncture , and for the analysis of ampk activity , tissues were dissected and immediately frozen in liquid nitrogen , as described ( 27 ) . in a separate set of animals , rats were fasted 2 h before intraperitoneal injection with insulin ( 1 mu / kg ) and killed as above 15 min after injection . the length of the right tibia bone was measured in all animals . for immunoblotting , homogenates were prepared in ice - cold sucrose homogenization buffer as described ( 27 ) . intra - abdominal fat was extracted and weighed , and samples of omental adipose tissue were fixed in 10% formalin for 48 h and then in 10% methanol . histological sections and hematoxylin / eosin staining were performed at the alberta diabetes institute histology core ( edmonton , ab , canada ) following standardized protocols . digital images of three representative fields were taken using a digital camera mounted on a light microscope at 40 magnification . all images were analyzed with imagej software ( ver 1.43u ; national institutes of health ) . lipids were extracted from 200 l of plasma , and tg , cholesterol ester , and free fatty acids were separated by fast - protein liquid chromatography as described ( 28 ) . liver and skeletal muscle tissues were homogenized , and tg , cholesterol ester , and ceramide content was determined by fast - protein liquid chromatography ( 27 ) . diacylglycerol content was determined by a diacylglycerol kinase assay , according to a well - established procedure ( 29 ) . indirect calorimetry was performed using the comprehensive laboratory animal monitoring system ( oxymax / clams ; columbus instruments ) . after an initial 24-h acclimatization period , rats were monitored every 13 min for 24 h to complete a 12-h dark ( active)/12-h light ( inactive ) cycle . the respiratory exchange ratio ( rer ) , vo2 , vco2 , heat production , and physical activity were measured . after a 5-h fast , rats were injected intraperitoneally with a 50% glucose solution ( 2 g / kg ) for the glucose tolerance test ( gtt ) . blood glucose concentrations were determined using an accu - chek advantage glucometer ( roche diagnostics ) using blood from the tail at baseline and after glucose injection ( 15 , 30 , 60 , 90 , and 120 min ) . for the insulin tolerance test ( itt ) , rats were injected intraperitoneally with insulin ( 1 mu / kg ) after a 2-h fast and the blood glucose concentration was measured from the tail at baseline and after insulin injection ( 15 , 30 , 60 , 90 , and 120 min ) . differences in measurements performed among four groups were analyzed using two - way anova and a bonferroni post hoc test with both iugr and administration of resv as sources of variation . measurements of body weight and food consumption over time , as well as gtt and itt , were analyzed using a two - way anova with both time and group as sources of variation . when interaction between sources of variation included in the two - way anova was detected , interpretation of the overall anova was dictated by the significance observed in the post hoc analyses . elisa kits for the determination of insulin were purchased from alpco diagnostics , and leptin kits were purchased from millipore . [ p]-atp was purchased from perkin - elmer , sn-1,2-dioleylglycerol was from avanti , and most other reagents and chemicals were purchased from sigma - aldrich . the generation of the hypoxia - induced rat model of iugr has been described in detail previously ( 2325 ) . at birth , litters were reduced to eight male pups and litters that contained fewer than eight viable male pups were reduced to eight offspring with as many males as possible . at 3 weeks of age , female offspring were killed and male pups were weaned and housed two per cage . immediately after weaning , all offspring exposed to different prenatal interventions ( control , n = 36 from seven litters ; and iugr , n = 36 from eight litters ) started receiving an hf diet ( 45% fat ; research diets d12451 ) . in addition , half of the animals from each litter were randomly allocated to receive additional supplementation with resv in the diet ( 4 g / kg of diet ) . therefore , four experimental groups were created : control offspring receiving hf diet ( control hf - c ; n = 18 from six litters ) , control offspring receiving hf diet plus resv ( control hf - r ; n = 18 from six litters ) , iugr offspring receiving hf diet ( iugr hf - c ; n = 18 from six litters ) , and iugr offspring receiving hf diet plus resv ( iugr hf - r ; n = 18 from six litters ) . the bioavailability of resv administered in the diet is low ( 0.1% ) , mainly because of intestinal breakdown , absorption , and liver metabolism ( 14 ) . therefore , the final plasma concentration of this molecule achieved with the dose administered in this study was within expected therapeutic values ( 1020 mol / l range ) ( 26 ) . to determine which measurements were performed on each animal , rats born from the same dam within each experimental group were randomly assigned to three possible subgroups ( designated a , b , or c ) ; see supplementary fig . 1 for details . because all rats included in each subgroup belonged to a different litter , we used the offspring as the unit of analysis . body weight and food intake was measured weekly from birth . after 9 weeks of nutritional intervention , body composition was determined using a whole body composition analyzer based on time - domain nuclear magnetic resonance technology ( echomri 4-in-1/1000 ; echo medical systems ) . for the determination of abdominal fat in vivo , rats were anesthetized using inhaled isoflurane ( 2% in compressed air ) and placed into a micro single - photon emission computed tomography ( spect ) scanner flex pre - clinical platform xo - xpet - xspet instrument ( -medica ideas ) . the -camera was programmed to scan 512 projections ( sum of frames = 4 , voltage 60 kdp and 390 ua ) . the observation window was set between the diaphragmatic membrane and the acetabulum for each animal ( 91.78 mm ) , and the magnification factor on the camera was set to 1.29 . the intra - abdominal fat volume was calculated using the software gmi - amira 3.1.1 . threshold density was adjusted by internal volume so that internal organs and large vessels were not counted as intra - abdominal fat tissue and were excluded from calculations . for additional measurements of intra - abdominal fat content , mechanical extraction and weight of different abdominal fat depots ( retroperitoneal , perirenal , mesenteric , epiploic , and subdiaphragmatic ) was performed after dissection . the pearson correlation between methods used to determine the intra - abdominal fat content ( mechanical extraction and micro ct scan ) was r = 0.65 , p = 0.002 . the bland and altman analysis demonstrated a bias between the techniques of 0.14 14.7 g , which demonstrates that both techniques were highly correlated and that the average variability in the determinations made with these techniques was less than 1 g ( < 2% of the average value ) . intra - abdominal organs including liver , spleen , pancreas , and kidneys were dissected and weighed before being frozen . in a subset of rats and after 2 h of fasting , rats were anesthetized using inhaled isoflurane , followed by cervical dislocation , collection of a sample of blood by cardiac puncture , and for the analysis of ampk activity , tissues were dissected and immediately frozen in liquid nitrogen , as described ( 27 ) . in a separate set of animals , rats were fasted 2 h before intraperitoneal injection with insulin ( 1 mu / kg ) and killed as above 15 min after injection . the length of the right tibia bone was measured in all animals . for immunoblotting , homogenates were prepared in ice - cold sucrose homogenization buffer as described ( 27 ) . intra - abdominal fat was extracted and weighed , and samples of omental adipose tissue were fixed in 10% formalin for 48 h and then in 10% methanol . histological sections and hematoxylin / eosin staining were performed at the alberta diabetes institute histology core ( edmonton , ab , canada ) following standardized protocols . digital images of three representative fields were taken using a digital camera mounted on a light microscope at 40 magnification . all images were analyzed with imagej software ( ver 1.43u ; national institutes of health ) . lipids were extracted from 200 l of plasma , and tg , cholesterol ester , and free fatty acids were separated by fast - protein liquid chromatography as described ( 28 ) . liver and skeletal muscle tissues were homogenized , and tg , cholesterol ester , and ceramide content was determined by fast - protein liquid chromatography ( 27 ) . diacylglycerol content was determined by a diacylglycerol kinase assay , according to a well - established procedure ( 29 ) . indirect calorimetry was performed using the comprehensive laboratory animal monitoring system ( oxymax / clams ; columbus instruments ) . after an initial 24-h acclimatization period , rats were monitored every 13 min for 24 h to complete a 12-h dark ( active)/12-h light ( inactive ) cycle . the respiratory exchange ratio ( rer ) , vo2 , vco2 , heat production , and physical activity were measured . after a 5-h fast , rats were injected intraperitoneally with a 50% glucose solution ( 2 g / kg ) for the glucose tolerance test ( gtt ) . blood glucose concentrations were determined using an accu - chek advantage glucometer ( roche diagnostics ) using blood from the tail at baseline and after glucose injection ( 15 , 30 , 60 , 90 , and 120 min ) . for the insulin tolerance test ( itt ) , rats were injected intraperitoneally with insulin ( 1 mu / kg ) after a 2-h fast and the blood glucose concentration was measured from the tail at baseline and after insulin injection ( 15 , 30 , 60 , 90 , and 120 min ) . differences in measurements performed among four groups were analyzed using two - way anova and a bonferroni post hoc test with both iugr and administration of resv as sources of variation . measurements of body weight and food consumption over time , as well as gtt and itt , were analyzed using a two - way anova with both time and group as sources of variation . when interaction between sources of variation included in the two - way anova was detected , interpretation of the overall anova was dictated by the significance observed in the post hoc analyses . consistent with our previous report ( 9 ) , exposure of rats to prenatal hypoxia had no effect on body weight gain ( fig . food intake was decreased in iugr offspring compared with control rats independently of the administration of resv , despite similar body weights ( fig . these data suggest that additional mechanisms must be involved in maintaining body weight in iugr offspring to compensate for the decrease in food consumption . consistent with this finding , physical activity was significantly reduced in iugr offspring compared with control offspring ( fig . although the mechanisms involved in maintaining body weight in control rats and iugr rats may differ , neither iugr nor resv administration affected whole body lean and fat tissue composition ( fig . after exposure to a normoxic ( 21% o2 ) or a hypoxic ( 11.5% o2 ) prenatal environment that caused iugr , we examined the effect of postnatal feeding an hf ( hf - c ) diet or an hf diet supplemented with resv ( hf - r ) to rat offspring for 9 weeks d : total physical activity in 24 h. e : total body composition estimated by spect . resv is 4 g / kg of diet . * p < 0.05 for the respective sources of variation ( iugr and resv administration ) using two - way anova ; p < 0.05 vs. controls after a bonferroni post hoc test comparing iugr and control offspring receiving the same diet ( n = 6 per group ) . as expected , rats fed an hf diet exhibited a low rer as a result of increased availability of fat as an energy source ( table 1 ) . changes in the rer were not observed in control offspring compared with offspring born iugr . however , iugr rats exhibited a reduction in vo2 , vco2 , and heat production during both light and dark cycles relative to controls regardless of whether they were receiving resv in their diets ( table 1 ) . gas exchange ratio and heat production in control and iugr rats fed hf diet with or without resv experiments were performed after 9 weeks of nutritional intervention ( int ) . * values of p < 0.05 for the respective sources of variation ( iugr and resv ) using two - way anova ( n = 6 per group ) . despite similar body weight and total body composition , offspring born iugr and exposed to an hf diet exhibited increased total and relative ( adjusted by total body fat ) intra - abdominal fat distribution compared with control rats , whereas resv reduced the abdominal fat content as determined by both abdominal tomographic imaging and surgical dissection of fat depots ( fig . the effect of iugr and administration of resv on fat distribution among the different intra - abdominal fat depots is reported in supplementary table 1 . rats receiving resv displayed a reduction in the absolute abdominal fat content regardless of whether the rats were born iugr ( fig . although the administration of resv to control offspring did not affect the content of abdominal fat as a percentage of body weight , resv reduced this parameter in iugr offspring to levels comparable with those observed in controls ( fig . 2d ) , suggesting that resv causes a redistribution of fat to depots other than the abdomen in iugr rats . consistent with our previous results ( 9 ) , iugr offspring fed an hf diet had larger adipocyte diameters than control offspring receiving the same nutritional intervention ( fig . 2f and g ) , whereas resv caused a comparable decrease in the relative adipocyte diameter in both iugr and control offspring ( fig . 2f and g ) . in agreement with greater abdominal fat mass , circulating leptin levels were higher in hf - fed iugr rats compared with control hf - fed offspring ( fig . more importantly , resv decreased the plasma levels of leptin in offspring born iugr but had little or no effect on controls ( fig . measurements were made after 9 weeks of an hf - c or an hf - r ( resv is 4 g / kg of diet ) . a : representative axial views of the abdominal cavity obtained by x - ray computed tomography and ( b ) subsequent three - dimensional reconstructions of intra - abdominal fat deposits . total ( c ) and relative ( d ) intra - abdominal fat adjusted by total body fat determined by spect is shown . f : representative pictures of omental fat tissue histological preparations ( hematoxylin - eosin ; scale bar , 50 m ) . g : average intra - abdominal adipocyte diameter . * p < 0.05 for the respective sources of variation ( iugr or resv ) using two - way anova ; p < 0.05 vs. controls after a bonferroni post hoc test comparing iugr and control offspring receiving the same diet ( n = 6 per group ) . ( a high - quality digital representation of this figure is available in the online issue . ) interestingly , although administration of resv had no effect on control offspring , resv reduced circulating levels of tg and free fatty acids in offspring born iugr ( table 2 ) . in addition , liver and skeletal muscle tg , diacylglycerol , and ceramide levels were elevated in iugr offspring compared with control offspring , and these values were significantly lower in resv - treated rats ( table 2 ) , demonstrating a plasma lipid lowering effect of resv as well as the prevention of accelerated peripheral organ steatosis during the consumption of an hf diet . circulating and tissue lipid concentrations of control and iugr rats fed hf diet with or without resv measurements were made after 9 weeks of hf diet with or without resv 4 g / kg of diet . ffa , free fatty acids . * p < 0.05 for the respective source of variation such as prenatal hypoxia ( iugr ) , resv , or int using two - way anova ; p < 0.05 vs. controls receiving the same diet after a bonferroni post hoc test ( n = 6 per group ) . because the major effect of high levels of circulating lipids and their accumulation in tissues is the development of insulin resistance and impaired glucose handling , we used gtt and itt to investigate whole body glucose homeostasis . although iugr and resv had no effect on fasting blood glucose levels after 9 weeks of hf diet ( fig . 3a ) , resv prevented the development of hyperinsulinemia and elevated the homeostasis model assessment index in iugr offspring ( fig . 3 g and i ) compared with control offspring , and resv improved both glucose disposal ( fig . together , these results indicate that resv administration prevents iugr rats from developing hf - induced insulin resistance . measurements were made after 9 weeks of hf - c or hf - r ( resv is 4 g / kg of diet ) on : fasting blood glucose levels ( a ) , fasting plasma levels of insulin ( b ) , and homeostasis model assessment ( homa ) index ( c ) . hf - c rats gtt ( d ) , hf - r fed rats gtt ( e ) , and gtt summary information ( f ) are presented as area under the curve ( auc ) . hf - c rats itt ( g ) , hf - r fed rats itt ( h ) , and itt summary information ( i ) are presented as auc . ip , intraperitoneal . * p < 0.05 for the respective source of variation ( iugr or resv ) using two - way anova ( bar graphs ) or a repeated - measures anova ( gtt and itt ) ; p < 0.05 vs. controls receiving the same diet after a bonferroni post hoc test ( n = 6 per group ) . the insulin signaling cascade regulates both hepatic glucose output as well as glucose transport into skeletal muscle ; therefore , we determined the phosphorylation status of protein kinases in the insulin signaling cascade in the tissues of rats isolated 15 min after insulin injection . feeding an hf diet to iugr rats impaired insulin - stimulated akt phosphorylation at ser-473 ( activating site ) in both liver and gastrocnemius muscle ( fig . 4a ) . in agreement with the interpretation of data from gtt and itt , the addition of resv to the hf diet of iugr rats prevented a decrease in insulin - stimulated akt phosphorylation in the liver and skeletal muscle . interestingly , insulin - stimulated akt phosphorylation was higher in the muscles of both control and iugr offspring fed an hf diet supplemented with resv compared with those rats receiving an hf diet alone , demonstrating that the muscle insulin sensitizing effects of resv were not confined to only iugr offspring . to further characterize the source of the signaling defect , we measured the phosphorylation of upstream regulators of akt . phosphorylation of insulin receptor substrate ( irs)-1 at ser-1101 ( inhibitory site ) was higher in liver and skeletal muscle of iugr offspring compared with controls ( fig . moreover , the inhibitory phosphorylation of irs-1 was reversed by resv treatment in both organs ( fig . 4b ) . because irs-1 is directly phosphorylated by protein kinase c ( pkc ) at ser-1101 and pkc is activated in tissues where lipids , especially diacylglycerols , accumulate , we measured the phosphorylation of pkc at thr-538 ( activating site ) . during hf - diet feeding , liver and skeletal muscle pkc activity was increased in iugr rats compared with controls ( fig . 4c ) . more importantly , and consistent with the reduction of lipid accumulation in the tissues ( table 1 ) and prevention of glucose intolerance and insulin resistance ( fig . 3 ) , pkc phosphorylation was reduced by resv in the iugr offspring ( fig . 4c ) . together , these data indicate that resv prevented molecular signaling defects observed in iugr rats fed an hf diet , and these improvements contributed to the prevention of hf - induced insulin resistance in iugr rats . measurements were made in the liver and gastrocnemius tissues of rats after 9 weeks of hf - c or hf - r . phosphorylation of akt ( p - akt to akt ratio ; a ) , phosphorylation of the irs-1 ( p - irs to irs ratio ; b ) , and phosphorylation of pkc ( p - pkc/tubulin ; c ) are shown . * p < 0.05 for the respective source of variation ( iugr or resv ) using two - way anova ( bar graphs ) ; p < 0.05 vs. controls receiving the same diet after a bonferroni post hoc test ( n = 6 per group ) . to further characterize the mechanisms for the metabolic benefits of supplementing the diets of iugr rats with resv , we investigated ampk signaling . 5a ) , resv clearly activated ampk as determined by its phosphorylation at its activating site ( thr-172 ) . consistent with the increased ampk activity , resv increased acc phosphorylation at ser-79 ( inhibitory site ) in rat liver and skeletal muscle ( fig . 5b ) . given the ability of activated hepatic ampk to decrease fatty acid and tg synthesis ( 19,20 ) and increased ampk in skeletal muscle to promote glucose disposal ( 22 ) , these data indicate that resv - mediated activation of ampk contributes to the prevention of hf - induced insulin resistance in iugr rats . measurements were made in the liver and gastrocnemius muscle tissues of rats after 9 weeks of hf - c or hf - r . a : phosphorylation of ampk ( p - ampk to ampk ratio ) . b : phosphorylation of acc ( p - acc to acc ratio ) . * p < 0.05 for the respective source of variation ( iugr or resv ) using two - way anova ( bar graphs ) ; p < 0.05 vs. controls receiving the same diet after a bonferroni post hoc test ( n = 6 per group ) . consistent with our previous report ( 9 ) , exposure of rats to prenatal hypoxia had no effect on body weight gain ( fig . food intake was decreased in iugr offspring compared with control rats independently of the administration of resv , despite similar body weights ( fig . these data suggest that additional mechanisms must be involved in maintaining body weight in iugr offspring to compensate for the decrease in food consumption . consistent with this finding , physical activity was significantly reduced in iugr offspring compared with control offspring ( fig . although the mechanisms involved in maintaining body weight in control rats and iugr rats may differ , neither iugr nor resv administration affected whole body lean and fat tissue composition ( fig . after exposure to a normoxic ( 21% o2 ) or a hypoxic ( 11.5% o2 ) prenatal environment that caused iugr , we examined the effect of postnatal feeding an hf ( hf - c ) diet or an hf diet supplemented with resv ( hf - r ) to rat offspring for 9 weeks d : total physical activity in 24 h. e : total body composition estimated by spect . resv is 4 g / kg of diet . * p < 0.05 for the respective sources of variation ( iugr and resv administration ) using two - way anova ; p < 0.05 vs. controls after a bonferroni post hoc test comparing iugr and control offspring receiving the same diet ( n = 6 per group ) . as expected , rats fed an hf diet exhibited a low rer as a result of increased availability of fat as an energy source ( table 1 ) . changes in the rer were not observed in control offspring compared with offspring born iugr . however , iugr rats exhibited a reduction in vo2 , vco2 , and heat production during both light and dark cycles relative to controls regardless of whether they were receiving resv in their diets ( table 1 ) . gas exchange ratio and heat production in control and iugr rats fed hf diet with or without resv experiments were performed after 9 weeks of nutritional intervention ( int ) . * values of p < 0.05 for the respective sources of variation ( iugr and resv ) using two - way anova ( n = 6 per group ) . despite similar body weight and total body composition , offspring born iugr and exposed to an hf diet exhibited increased total and relative ( adjusted by total body fat ) intra - abdominal fat distribution compared with control rats , whereas resv reduced the abdominal fat content as determined by both abdominal tomographic imaging and surgical dissection of fat depots ( fig . the effect of iugr and administration of resv on fat distribution among the different intra - abdominal fat depots is reported in supplementary table 1 . rats receiving resv displayed a reduction in the absolute abdominal fat content regardless of whether the rats were born iugr ( fig . although the administration of resv to control offspring did not affect the content of abdominal fat as a percentage of body weight , resv reduced this parameter in iugr offspring to levels comparable with those observed in controls ( fig . 2d ) , suggesting that resv causes a redistribution of fat to depots other than the abdomen in iugr rats . consistent with our previous results ( 9 ) , iugr offspring fed an hf diet had larger adipocyte diameters than control offspring receiving the same nutritional intervention ( fig . 2f and g ) , whereas resv caused a comparable decrease in the relative adipocyte diameter in both iugr and control offspring ( fig . 2f and g ) . in agreement with greater abdominal fat mass , circulating leptin levels were higher in hf - fed iugr rats compared with control hf - fed offspring ( fig . 2e ) . more importantly , resv decreased the plasma levels of leptin in offspring born iugr but had little or no effect on controls ( fig . measurements were made after 9 weeks of an hf - c or an hf - r ( resv is 4 g / kg of diet ) . a : representative axial views of the abdominal cavity obtained by x - ray computed tomography and ( b ) subsequent three - dimensional reconstructions of intra - abdominal fat deposits . total ( c ) and relative ( d ) intra - abdominal fat adjusted by total body fat determined by spect is shown . f : representative pictures of omental fat tissue histological preparations ( hematoxylin - eosin ; scale bar , 50 m ) . g : average intra - abdominal adipocyte diameter . * p < 0.05 for the respective sources of variation ( iugr or resv ) using two - way anova ; p < 0.05 vs. controls after a bonferroni post hoc test comparing iugr and control offspring receiving the same diet ( n = 6 per group ) . ( a high - quality digital representation of this figure is available in the online issue . ) interestingly , although administration of resv had no effect on control offspring , resv reduced circulating levels of tg and free fatty acids in offspring born iugr ( table 2 ) . in addition , liver and skeletal muscle tg , diacylglycerol , and ceramide levels were elevated in iugr offspring compared with control offspring , and these values were significantly lower in resv - treated rats ( table 2 ) , demonstrating a plasma lipid lowering effect of resv as well as the prevention of accelerated peripheral organ steatosis during the consumption of an hf diet . circulating and tissue lipid concentrations of control and iugr rats fed hf diet with or without resv measurements were made after 9 weeks of hf diet with or without resv 4 g / kg of diet . * p < 0.05 for the respective source of variation such as prenatal hypoxia ( iugr ) , resv , or int using two - way anova ; p < 0.05 vs. controls receiving the same diet after a bonferroni post hoc test ( n = 6 per group ) . because the major effect of high levels of circulating lipids and their accumulation in tissues is the development of insulin resistance and impaired glucose handling , we used gtt and itt to investigate whole body glucose homeostasis . although iugr and resv had no effect on fasting blood glucose levels after 9 weeks of hf diet ( fig . 3a ) , resv prevented the development of hyperinsulinemia and elevated the homeostasis model assessment index in iugr offspring ( fig . 3 g and i ) compared with control offspring , and resv improved both glucose disposal ( fig . , these results indicate that resv administration prevents iugr rats from developing hf - induced insulin resistance . measurements were made after 9 weeks of hf - c or hf - r ( resv is 4 g / kg of diet ) on : fasting blood glucose levels ( a ) , fasting plasma levels of insulin ( b ) , and homeostasis model assessment ( homa ) index ( c ) . fed rats gtt ( e ) , and gtt summary information ( f ) are presented as area under the curve ( auc ) . hf - c rats itt ( g ) , hf - r fed rats itt ( h ) , and itt summary information ( i ) are presented as auc . * p < 0.05 for the respective source of variation ( iugr or resv ) using two - way anova ( bar graphs ) or a repeated - measures anova ( gtt and itt ) ; p < 0.05 vs. controls receiving the same diet after a bonferroni post hoc test ( n = 6 per group ) . the insulin signaling cascade regulates both hepatic glucose output as well as glucose transport into skeletal muscle ; therefore , we determined the phosphorylation status of protein kinases in the insulin signaling cascade in the tissues of rats isolated 15 min after insulin injection . feeding an hf diet to iugr rats impaired insulin - stimulated akt phosphorylation at ser-473 ( activating site ) in both liver and gastrocnemius muscle ( fig . 4a ) . in agreement with the interpretation of data from gtt and itt , the addition of resv to the hf diet of iugr rats prevented a decrease in insulin - stimulated akt phosphorylation in the liver and skeletal muscle . interestingly , insulin - stimulated akt phosphorylation was higher in the muscles of both control and iugr offspring fed an hf diet supplemented with resv compared with those rats receiving an hf diet alone , demonstrating that the muscle insulin sensitizing effects of resv were not confined to only iugr offspring . to further characterize the source of the signaling defect , we measured the phosphorylation of upstream regulators of akt . phosphorylation of insulin receptor substrate ( irs)-1 at ser-1101 ( inhibitory site ) was higher in liver and skeletal muscle of iugr offspring compared with controls ( fig . moreover , the inhibitory phosphorylation of irs-1 was reversed by resv treatment in both organs ( fig . because irs-1 is directly phosphorylated by protein kinase c ( pkc ) at ser-1101 and pkc is activated in tissues where lipids , especially diacylglycerols , accumulate , we measured the phosphorylation of pkc at thr-538 ( activating site ) . during hf - diet feeding , liver and skeletal muscle pkc activity was increased in iugr rats compared with controls ( fig . 4c ) . more importantly , and consistent with the reduction of lipid accumulation in the tissues ( table 1 ) and prevention of glucose intolerance and insulin resistance ( fig . 3 ) , pkc phosphorylation was reduced by resv in the iugr offspring ( fig . 4c ) . together , these data indicate that resv prevented molecular signaling defects observed in iugr rats fed an hf diet , and these improvements contributed to the prevention of hf - induced insulin resistance in iugr rats . measurements were made in the liver and gastrocnemius tissues of rats after 9 weeks of hf - c or hf - r . phosphorylation of akt ( p - akt to akt ratio ; a ) , phosphorylation of the irs-1 ( p - irs to irs ratio ; b ) , and phosphorylation of pkc ( p - pkc/tubulin ; c ) are shown . * p < 0.05 for the respective source of variation ( iugr or resv ) using two - way anova ( bar graphs ) ; p < 0.05 vs. controls receiving the same diet after a bonferroni post hoc test ( n = 6 per group ) . to further characterize the mechanisms for the metabolic benefits of supplementing the diets of iugr rats with resv , we investigated ampk signaling . 5a ) , resv clearly activated ampk as determined by its phosphorylation at its activating site ( thr-172 ) . consistent with the increased ampk activity , resv increased acc phosphorylation at ser-79 ( inhibitory site ) in rat liver and skeletal muscle ( fig . 5b ) . given the ability of activated hepatic ampk to decrease fatty acid and tg synthesis ( 19,20 ) and increased ampk in skeletal muscle to promote glucose disposal ( 22 ) , these data indicate that resv - mediated activation of ampk contributes to the prevention of hf - induced insulin resistance in iugr rats . measurements were made in the liver and gastrocnemius muscle tissues of rats after 9 weeks of hf - c or hf - r . a : phosphorylation of ampk ( p - ampk to ampk ratio ) . b : phosphorylation of acc ( p - acc to acc ratio ) . * p < 0.05 for the respective source of variation ( iugr or resv ) using two - way anova ( bar graphs ) ; p < 0.05 vs. controls receiving the same diet after a bonferroni post hoc test ( n = 6 per group ) . our previous work established that iugr offspring subjected to an hf diet are more susceptible to developing several components of the mets than control offspring fed the same diet ( 9 ) . because resv has been demonstrated to be an insulin - sensitizing molecule ( 13,14,20,30 ) , we tested the efficacy of resv in alleviating the development of hf - mediated pathologic metabolic phenotypes in offspring born from pregnancies complicated with iugr . interestingly , even in the absence of increased body weight , iugr offspring exposed to an hf diet exhibited increased abdominal fat , elevated abdominal adipocyte size , hyperlipidemia , insulin resistance , and impaired glucose disposal . importantly , these significant pathophysiological alterations were alleviated when the hf diet was supplemented with resv . although resv has been shown to improve insulin resistance and glucose disposal in other rodent models ( 13,14,20,30 ) , to our knowledge this is the first study demonstrating that early postnatal administration of resv in the diet of young rats improved the metabolic profile of hf - fed offspring born iugr secondary to a prenatal hypoxic insult . an interesting phenomenon observed with our iugr model is that although prenatal hypoxia had no effect on total body composition after an hf diet , iugr was associated with increased absolute and relative intra - abdominal fat content compared with control offspring . although we have yet to determine the mechanism(s ) responsible for this , we do show that resv decreases the amount of fat located in the abdominal cavity and reduces adipocyte diameter . this observation is important given the relatively short length of the intervention ( only 9 weeks ) compared with other studies showing the beneficial effects of resv on fat distribution when administered for up to 60 weeks ( 3133 ) . because we also show that administration of resv prevented the diet - induced increase in plasma lipids that is observed in iugr offspring , it is likely that reduced circulating levels of lipids contribute to the reduced lipid storage by adipocytes . however , we can not explain why resv specifically reduces visceral fat without altering whole body fat content . with that said , previous work has shown that incubation of isolated adipocytes with resv reduced lipogenesis and increased lipolytic rates ( 34 ) . based on this , we speculate that resv preferentially targets abdominal adipocytes to increase lipolysis and reduce the mass of this fat depot . because intra - abdominal fat is a major source of adipokines and cytokines associated with metabolic disorders ( 35,36 ) , the reduced abdominal fat mass in iugr offspring fed an hf diet supplemented with resv corresponds with a lower level of leptin observed in these rats . these results are consistent with evidence showing that supplementation of hf diets with resv can prevent diet - induced obesity in rodents ( 13,14,20 ) , in part , by diminishing visceral adipose tissue ( 14,37 ) , although this is the first evidence that resv reduces adiposity in young rodents . as mentioned , resv reduced the hf diet - induced hyperlipidemia that is observed in iugr offspring . resv inhibited fatty acid and tg synthesis by isolated hepatocytes ( 37,38 ) , suggesting that the lipid - lowering effects of resv could be attributed to direct effects of this molecule on hepatic function . consistent with this , we provide evidence that the lipid - lowering effects of resv may be attributed to activation of ampk and reduced activity of acc in the liver , thus resulting in the inhibition of fatty acid synthesis and decreased accumulation of tg in the liver . because increased fatty acid utilization by skeletal muscle also contributes to lowering plasma lipid levels ( 39 ) , we also show that activation of the ampk / acc axis occurs in the skeletal muscle as well . because activation of the ampk / acc signaling axis in muscle increases fatty acid oxidation ( 18 ) , this may also contribute to lowering plasma lipid levels in iugr offspring when hf diets are supplemented with resv . therefore , the lipid - lowering effects of resv in iugr rats could be a result of ampk - mediated reduction of hepatic lipid synthesis ( 17 ) and increased oxidation of fatty acids by the skeletal muscle ( 18 ) . our finding that resv activates ampk in young rodents fed an hf diet is consistent with previous reports indicating that ampk activation is the primary mechanism by which resv mediates these beneficial effects ( 1517 ) . recent findings using hf - fed ampk-1 and -2deficient mice demonstrated that the effects of resv on insulin sensitivity required the presence of either ampk isoform ( 16 ) . moreover , activation of ampk in skeletal muscle increases glucose utilization in glucose - intolerant mice in an insulin - independent fashion ( 40 ) . although our data implicate ampk as being involved in the beneficial effects of resv , we also investigated whether additional molecular signaling mechanisms may contribute . for example , the pkc / irs / akt signaling pathway is centrally involved in insulin sensitivity in the liver and skeletal muscle ( 41 ) and subsequently regulates glucose uptake in muscle ( 42 ) . in agreement with this , previous work suggested that impaired signaling through this pathway contributes to insulin resistance and decreased glucose disposal in association with the accumulation of lipotoxic lipid intermediates ( 43 ) . consistent with this , our data show that the pkc / irs / akt signaling pathway in the liver and skeletal muscle of iugr offspring fed an hf diet is significantly impaired , whereas resv restores this pathway and tissue lipids to levels observed in control offspring fed an hf diet . thus we conclude that the ability of resv to prevent insulin resistance and glucose intolerance in iugr offspring exposed to an hf diet involves activation of ampk and the prevention of impaired akt signaling in liver and skeletal muscle . in conclusion , our data suggest that the consumption of hf diets by iugr offspring predisposes young rats for the development of glucose intolerance and peripheral insulin resistance without affecting insulin secretion . most importantly , this is the first study demonstrating that postnatal administration of resv in the diet of young rats can improve the metabolic profile of hf - fed offspring born from pregnancies complicated by iugr . specifically , we show that supplementation with resv is well tolerated and can reduce the susceptibility to hf diet induced metabolic alterations in fat distribution , adipocyte size , hyperlipidemia , glucose disposal , and insulin resistance . moreover , we also provide molecular evidence that the improvement of glucose homeostasis by resv may be attributed to insulin sensitization of the peripheral tissues by preventing impaired akt signaling as well as by activation of ampk and potentially improving glucose utilization via an insulin - independent mechanism . based on these data , we suggest that resv should be considered for further testing as a therapy for the pediatric population born iugr . indeed , postnatal therapies for the metabolic defects associated with being born iugr are currently lacking , and resv represents the first potential pharmacological treatment that , if administered to vulnerable pediatric patient populations consuming high - calorie diets , could reduce the susceptibility for an adverse metabolic profile .

objectivea prenatal hypoxic insult leading to intrauterine growth restriction ( iugr ) increases the susceptibility to develop metabolic syndrome ( mets ) later in life . since resveratrol ( resv ) , the polyphenol produced by plants , exerts insulin - sensitizing effects , we tested whether resv could prevent deleterious metabolic effects of being born iugr.research design and methodspregnant rats were exposed to either a normoxic ( control ; 21% o2 ) or a hypoxic ( iugr ; 11.5% o2 ) environment during the last third of gestation . after weaning , male offspring were randomly assigned to receive either a high - fat ( hf ; 45% fat ) diet or an hf diet with resv ( 4 g / kg diet ) for 9 weeks when various parameters of the mets were measured.resultsrelative to normoxic controls , hypoxia - induced iugr offspring developed a more severe mets , including glucose intolerance and insulin resistance , increased intra - abdominal fat deposition and intra - abdominal adipocyte size , and increased plasma triacylglycerol ( tg ) and free fatty acids , as well as peripheral accumulation of tg , diacylglycerol , and ceramides . in only iugr offspring , the administration of resv reduced intra - abdominal fat deposition to levels comparable with controls , improved the plasma lipid profile , and reduced accumulation of tg and ceramides in the tissues . moreover , resv ameliorated insulin resistance and glucose intolerance as well as impaired akt signaling in the liver and skeletal muscle of iugr offspring and activated amp - activated protein kinase , which likely contributed to improved metabolic parameters in resv - treated iugr rats.conclusionsour results suggest that early , postnatal administration of resv can improve the metabolic profile of hf - fed offspring born from pregnancies complicated by iugr .

RESEARCH DESIGN AND METHODS Reagents. Experimental animals and diets. Determination of body composition and adiposity. Analysis of tissues. Determination of liver, muscle, and plasma lipids. Indirect calorimetry and physical activity. Glucose and insulin tolerance tests. Statistical analyses. RESULTS Body weight gain, energy intake, and physical activity. Intra-abdominal fat distribution and adipocyte morphometry. Lipid profile, lipid accumulation, and glucose homeostasis. Insulin signaling. DISCUSSION Supplementary Material

conventional lentiviral vectors based on hiv-1 establish permanent genetic modification of target cells owing to the fact that their integrase - dependent mechanisms ensure semirandom chromosomal insertion of the transported foreign nucleic acids . in gene therapy settings , these mechanisms are a crucial feature for achieving stable complementation of genetic defects in proliferating target cells and effector progenies . in the context of genome editing approaches , however , the lentiviral dna insertion mechanisms should best be disabled in order to ensure that the resulting episomal vector templates are available as substrates for hr or for transient designer nuclease expression . as previously mentioned , the short - term presence of designer nucleases in target cells is important for reducing the chances that deleterious effects caused by off - target activity arise . therefore , by using trans - complementing packaging constructs harboring specific point - mutations in the hiv-1 pol region , researchers can assemble lentiviral particles whose integrase moiety contains disabling amino acid substitutions at crucial positions within its catalytic pocket ( i.e. , d64 , d116 , and/or e152 ) ( figure 4 ) . importantly , these so - called class i integrase mutations are nonpleiotropic in that they interfere specifically with proviral establishment and not with any other of the viral transduction steps , such as , receptor binding , uncoating and nuclear import of the reverse - transcribed linear double - stranded vector genomes . hence , integrase - defective lentiviral vectors ( idlvs ) , made with the aid of such packaging constructs serve as valuable vehicles for delivering nucleic acid templates for gene targeting and/or transient designer nuclease gene expression . of note , similarly to their integration - proficient counterparts , the tropism of idlv particles are normally altered by endowing them with envelop proteins derived from viruses whose cell surface receptors are different from those engaged by hiv-1 . accordingly , such pseudotyping manoeuvres permit narrowing or expanding the range of cell types transduced by vector particles . for instance , to confer broad host range and high physical particle stability to lentiviral vectors , the vesicular stomatitis virus glycoprotein - g ( vsv - g ) idlvs were the first viral vectors to be tested in the context of designer nuclease - assisted genome editing experiments . these experiments , involving zfn technology and various human target cell types ( e.g. , k562 erythromyeloblastoid leukemia cells , lymphoblastoid cells , and embryonic stem cells ) , provided an initial proof - of - concept for using idlvs in designer nuclease - induced gene addition and gene repair studies . the former and latter experiments comprised , respectively , inserting recombinant dna at specific genomic sequences ( i.e. , ccr5 ) and correcting il2rg mutations underpinning x - linked severe combined immunodeficiency ( x - scid ) . these data revealed that idlv genomes can serve as efficient hr substrates yielding , in some cell types , homology - directed dna targeting frequencies exceeding 10% of the total target cell population with the majority of cells harboring mono - allelic insertions . these initial data has been followed - up by various other studies in which idlv transfer of donor dna templates resulted in the addition of reporter and therapeutically relevant transgenes into safe harbour loci in a diverse set of target cells , including human myocytes , human epithelial stem cells , and ipsc lines . examples of these experiments are the site - specific chromosomal insertion of microdystrophin and fanca transgenes into the safe harbour ccr5 locus in , respectively , human muscle progenitor cells and ipscs from reprogrammed fibroblasts of fanconi anemia patients . it is worth mentioning however that , in common with any other hr - based genome editing approaches , the recruitment of idlv donor dna for gene addition or for gene repair purposes is limited in non - dividing or quiescent cells due to the fact that hr occurs preferentially during the g2/s phase of the cell cycle , when endogenous repairing templates are available . hence , the cellular dna of quiescent primary cells , of which many display a high therapeutic relevance , is particularly difficult to edit through hr . an outstanding example of such cells is provided by primitive cd34 human hematopoietic stem cells ( hscs ) . hscs are defined as cells capable of long - term multilineage repopulation of the hematopoietic compartment in conditioned immune - deficient mice . of note , only genome modification at the hsc level is expected to ensure life - long correction of genetic disorders affecting components of the hematopoietic system . aiming at improving hr - based genome editing of these cells , genovese et al . have developed a protocol in which donor dna and zfn delivery into hscs is carried out by idlv transduction and synthetic mrna electroporation , respectively . crucially , this transduction / electroporation protocol is combined with exposing target cells not only to cytokines but also to 16,16-dimethyl - prostaglandin e2 ( dmpge2 ) mixed with the aryl - hydrocarbon receptor protein antagonist , stemregenin 1 ( sr1 ) . the rationale for including dmpge2 and sr1 was to interfere with the loss of stem cell properties resulting from hsc exposure to extended ex vivo culture conditions and cell cycle - activating cytokines . by using these methods , the authors report that homology - directed gene targeting frequencies at aavs1 and il2rg in bona fide hscs are increased , as stringently demonstrated by serial transplantation of human cd34 cells from primary to secondary nsg ( nod - scid - il2rg ) mice . in a subsequent study , hoban et al . have also tested an ex vivo protocol based on the transfer of zfn - encoding mrna and idlv donor templates into bone marrow - derived cd34 cells for correcting the a - to - t transversion in -globin alleles causing sickle cell anemia . considering that the yields of functional lentiviral vector particles decrease sharply with increasing transgene size , it is possible that generating idlvs containing the 4.1-kb cas9 open reading frame ( orf ) from streptococcus pyogenes results in idlv preparations with low functional particle titers . in addition , experimental results indicate that the genetic instability resulting from frequent reverse transcriptase template switching events within tale repeats in lentiviral vector genomes leads to defective particles . this makes the assembly of talen - encoding idlvs dependent on substantial orf optimization for minimizing the frequency and length of unstable repetitive tracts . of note , the same principle of sequence identity reduction has permitted to package and deliver transcriptional units encoding two zfn monomers in single idlv particles . this two - in - one approach is especially useful at low transduction rates since it ensures that each transduced cell is exposed to both members of a working zfn pair at the proper 1:1 stoichiometry . an issue pertaining to the optimal use of idlvs as designer nuclease expression platforms is that of the susceptibility of their genomes to epigenetic silencing mechanisms in transduced cells . these mechanisms involve the action of cellular histone deacetylases and have been shown to curtail dsb - induced targeted mutagenesis after idlv - mediated transfer of zfn expression units . finally , another issue regards the susceptibility of free - ended double - stranded idlv genomes to illegitimate , idlv templates can become captured at off - target or spontaneous dsbs and form undesirable dna structures such as concatemers and non - hr - derived junctions involving target or off - target sequences . these adverse genome - modifying events contribute to reduce the fidelity of the genome editing process as a whole . in contrast to lentiviral vectors , recombinant adeno - associated viral vectors ( raavs ) lack an integration machinery ( figure 5 ) . as a result , once in target cell nuclei , their genomes remain mostly in an episomal status with only a small fraction of them becoming incorporated in the cellular dna ( 0.10.5 integrations per infectious unit ) presumably upon nonhomologous end - joining mediated repair of sporadic chromosomal dsbs . these vectors entered the scene of homology - directed gene targeting during the late 1990 's , after the demonstration that viral particle transduction of single - stranded raav donor dna yields more than 1,000-fold higher frequencies of gene repair ( up to 1% of the total target - cell population ) when compared to those achieved by transfecting conventional donor plasmids . despite the feasibility of this approach , including in in vivo settings , the dominance of off - target insertions combined with the high dependency on large multiplicities of infection ( > 10 total vector particles per cell ) and cell selection schemes , has contributed to the initiation of research lines based on designer nuclease - assisted raav donor dna targeting . like previous data had shown for hr substrates delivered in the context of standard plasmids , experiments based on inducing dsbs at chromosomally integrated reporter genes by the homing endonuclease i - scei , provided a proof - of - concept for combining sequence - specific nucleases with raav donor dna in gene - targeting settings indeed , these initial studies revealed that raav - based gene targeting can be enhanced by approximately 100-fold if a dsb is generated at a predefined target locus . in this realm , and similarly to idlvs , raavs have been mostly used so far for delivering donor dna templates and zfns . of note , when compared to those of cas9 and talen , zfn orfs are the smallest ( i.e. , ~1.2 kb per monomer versus ~4.1 kb and ~3 kb for s. pyogenes cas9 and talen orfs , respectively ) . this permits the flexible construction and packaging of transcriptional units encoding one or even two zfns in single raav particles whose effective maximum capacity is only ~4.5 kb ( figure 5 ) . clearly , in addition to talen and cas9 nuclease delivery , the low packaging capacity of raav also introduces some limitations on the designing of hr substrates for the purpose of site - specific addition of whole transcriptional units . in any case , the combination of zfn and raav technologies has clearly proven its potential for not only targeted gene disruption and deletion but also for gene repair strategies . in what the latter genome editing approaches are concerned , these experiments involved the targeting of both reporter and endogenous loci after the delivery of zfns and gene correcting templates into a diverse panel of human cell types . these different cell types included , u2os osteosarcoma cells , hek 293 cells , hela cervix carcinoma cells , ht-1080 fibrosarcoma cells , and bona fide human embryonic stem cells ( escs ) as well as ipscs . noticeably , due to the very diverse range of tools , experimental models and conditions , the gene - targeting frequencies in both absolute and relative terms ( i.e. , targeted versus random insertion events ) , varied substantially . as an example , asuri et al . compared zfn - induced gene repair levels after transducing escs with a hr template packaged either in natural or variant aav capsids . the latter capsid type , isolated by sequential cycles of biopanning of libraries of cap - mutant viruses on target cells , confers high - level raav transduction of hard - to - transfect escs and ipscs . the authors showed , by using a highly quantitative readout system based on the rescue of defective reporter gene expression , that the transfer of corrective donor dna by the molecularly evolved raav variant ( r459 g ) yielded significantly higher ( ~10-fold ) zfn - induced gene repair levels in escs ( ~1.3% of the total target cell population ) when compared to those resulting from using a prototypic , serotype 2-based , raav . importantly , the proportion of random raav dna chromosomal insertions was not augmented by the presence of active zfns in the transduced cells . collectively , this and the above - mentioned studies established that site - specific dsb formation serves as a potent trigger for homology - directed gene targeting of donor dna delivered in the context of single - stranded raav genomes . owing to a favorable set of characteristics , raavs are particularly suited for testing genome - editing strategies in vivo . these characteristics include low immunogenicity in immunocompetent animal models and amenability to tissue tropism modification methodologies based on engineered capsids generated by rational or directed evolution approaches . moreover , reminiscent of the above - described tropism engineering strategies involving enveloped lentiviral vectors ; nonenveloped raavs can also be pseudotyped . in this case , raav genomes consisting of foreign dna flanked by prototypic aav serotype 2 inverted terminal repeats , are packaged within the capsids of other natural aav isolates such as those of serotypes 1 , 5 , 6 , 8 , or 9 . these novel capsid - modified raavs are powerful gene delivery tools in that they can bypass pre - existing immunity associated with the presence of neutralizing antibodies against particular raav serotype(s ) and can overcome transductional blocks linked to the absence of viral receptor(s ) on the surface of specific cell types or tissues . in addition to the previously mentioned work in which a molecularly evolved raav was used , another case in point is provided by the body - wide transduction of murine tissues by raav2/6 vectors , that is , aav serotype 2-derived raav genomes pseudotyped by packaging in aav serotype 6 capsids . moreover , it has been shown that raav2/8 particles achieve frequencies of murine liver cell transduction that are 10- to 100-fold higher than those obtained by using vectors based on other serotypes . importantly , these experiments equally revealed that the raav2/8 gene delivery activity was not hindered in animals preimmunized by exposure to other aav serotypes . the relevance and utility of raavs in in vivo settings is also underscored by the fact that a first proof - of - principle for designer nuclease - induced genome editing in vivo involved the use of these vectors in a murine model of hemophilia b , a blood coagulation disorder caused by factor ix deficiency . in particular , raav2/8 particles containing a corrective cdna spanning exons 2 through 8 of human f9 were administered to new - born hemophilia b mice together with raav2/8 particles encoding donor - matched zfns targeting intron-1 of a defective human f9 transgenic allele . gene targeting was detected and meaningful in that it resulted in 37% of normal levels of circulating factor ix that led to the improvement of the disease phenotype as measured by clot - formation kinetic assays . of note , molecular analysis of genomic dna from treated mice revealed that therapeutic construct insertions at the intended target site occurred through both homologous and non - hr . the latter , vector genome capture events , were likely caused by end - to - end nonhomologous end - joining of broken chromosome and aav inverted terminal repeat sequences . a subsequent study extended these findings of aav / zfn - mediated in vivo therapeutic genome editing to adult hemophilia b mice . the in vitro and in vivo transfer of rgn components by raavs , has also been initiated . after constructing and validating shortened expression units encoding cas9 and sgrnas , sens et al . were able to demonstrate delivery of cas9 alone or together with a sgrna by single vector particles built on chimeric aav - dj capsids . the latter all - in - one raav construction achieved approximately 8% indel formation at a target mirna locus in hek 293 t cells when applied at a multiplicity of infection of 10 particles per cell . however , in mouse livers , rgn - induced indel formation at the conserved mirna target locus by different raav constructs was invariably below 1% at 2 weeks postadministration . these in vivo results have been complemented by other animal model experiments in which raav - mediated delivery of rgn components served as a direct , transgenesis - free , approach for studying gene function in the mammalian brain . these initial studies together with the advent of shorter cas9 variants bode well for the implementation of raav / rgn tools in different in vitro and in vivo systems . indeed , ran et al . have recently used a comparative genomic analysis to isolate and characterize a staphylococcus aureus cas9 protein whose relatively small size permits flexible raav design , including copackaging of both rgn components within single vector particles . the delivery of these tools into the livers of c57bl/6 mice by raav2/8 particles led 1 week after intravenous administration to approximately 5 and 40% indel formation at apob and pcsk9 sequences , respectively . the sizable packaging capacity of adenoviral vectors ( advs ) combined with their high - titers and efficiency in transducing dividing and nondividing cells , makes them a broadly applicable option for in vitro and in vivo delivery of designer nucleases and donor dna templates ( figure 6 ) . similarly to raavs , advs started to be deployed in the context of homology - directed gene targeting experiments that did not involve designer nuclease - induced dsb formation . in these experiments , helper - dependent advs , advs , were chosen owing to their lack of viral genes , permitting the use of high multiplicities of infection , and high capacity , allowing for large donor dna packaging and delivery . indeed , ohbayashi et al . utilized helper - dependent advs with 18.6 kb homology arms to correct a mutation in hprt through hr without the involvement of artificial dsb formation in mouse es cells . with the emergence of ipscs , helper - dependent advs were also shown to be useful for correcting disease - related mutations in these pluripotent stem cells . in particular , they were used to repair several mutations in lmna alleles associated with laminopathies , thus expanding the application of this gene delivery system to human disease modeling and targeted gene repair . a follow - up study by aizawa et al . , demonstrated that regardless of the transcriptional status of the target gene , helper - dependent advs can mediate both gene knock - ins and gene knockouts by hr with high fidelity in both ipscs and escs of human origin . of note , however , the absolute gene targeting levels achieved by helper - dependent advs are rather low requiring as a result the use of drug - based selection pressure for isolating the desired targeted clones . similarly to lentiviral and adeno - associated viral vector systems , advs are equally amenable to tropism modification and good manufacturing practice methodologies . the former strategies include exchanging the apical fiber motifs of prototypic species c serotypes , which interact with the coxsackie b virus and adenovirus receptor ( car ) , with those of other natural serotypes ( e.g. , species b adenoviruses ) , which interact with other primary receptors . fiber swapping genetic retargeting strategy allows by - passing the absence of car on the surface of human cells with scientific and therapeutic value such as hematopoietic stem / progenitor cells , mesenchymal stromal cells , and muscle progenitor cells . alternative adv retargeting methods include capsid modifications by genetic fusion of fiber or pix capsid proteins to heterologous ligands or by chemical binding of capsid components to targeting moieties . in this regard , it is noteworthy mentioning that the first testing of a therapeutic approach based on genome editing entails zfn - mediated ccr5 knockout in cd4 t - cells from acquired immune deficiency syndrome patients after their ex vivo transduction with fiber - modified adv particles . examples of other genome - editing studies based on the integration of adv and zfn technologies include the targeted mutagenesis of endogenous t - cell receptor genes in lymphocytes and of ccr5 and -globin alleles in hematopoietic stem / progenitor cells . moreover , homology - directed gene targeting induced after adv - mediated delivery of zfns , is equally being pursued in various cell types such as myoblasts , epithelial stem cells , and keratinocytes . highlighting their versatility , adv systems have in addition to zfns been validated for delivering talens and rgn complexes into human somatic cells regardless of their transformation status . concerning the former research it was found that , in striking contrast to lentiviral vector systems , the direct repeat arrays coding for the dna - binding domains of talens are stable during adv production in complementing packaging cell lines . importantly , the resulting vector preparations led to dose - dependent and high - level ( up to 67% ) targeted dsb formation in exposed cells ( e.g. , muscle progenitor cells and mesenchymal stromal cells ) . the genetic stability of advs is also underscored by the fact that transcriptional units encoding zfn or talen dimers can be packaged intact in single vector particles . due to the sizable length of talen orfs ( ~3.0 kb per monomer ) , the latter studies deployed the high - capacity gutless adv platform ( figure 6 ) . in addition to the aforementioned muscle progenitor cells and mesenchymal stromal cells , the combination of adv and talen technologies has served for inducing site - specific dsb formation in ipscs as well as in cd34 cells isolated from g - csf - mobilized peripheral blood mononuclear cells . recently , various research groups started exploiting the efficient transduction of particular murine tissues by advs for studying genetic lesions underlying the emergence of specific cancers and , subsequently , modeling their progression in vivo . such approaches based on the direct induction of targeted genomic changes in vivo ( e.g. , mutations , inversions , and translocations ) are more expeditious than those based on transgenic mice and mimic more accurately the stochastic mosaicism characteristic of many tumors . for instance , zhang et al . succeeded in inducing higher rates of apc mutations in the murine liver after tail vein injection of talen - encoding advs than those achieved after plasmid hydrodynamic injections ( 33 versus 719% , respectively ) . have in turn deployed rgn - encoding advs for inducing an approximately 11 mb chromosomal inversion involving the alk and eml4 loci to model the development of non small - cell lung cancer in vivo . besides cancer modeling the former gene is a transcriptional factor involved in the activation of metabolic target genes ; the latter is associated with low - density lipoprotein cholesterol levels , with its loss - of - function correlating with reduced risk of coronary heart disease development . collectively , these experiments strengthened the view that , together with raavs , advs serve as a valuable platform for introducing designer nucleases in vivo . however , with the expansion and finer follow - up of in vivo genome editing procedures , one can expect encountering the immunological hurdles identified previously in countless gene transfer studies in animals . these hurdles include the activation of innate and adaptive immune responses against viral particle components and foreign antigens derived from transgenic and , in the case of helper - independent advs , viral orfs . moreover , the long - term presence of designer nucleases in target tissues adds yet another hurdle that needs to be tackled by , for instance , incorporating regulatory devices for minimizing the risks of chromosomal mutations and/or rearrangements . in addition to the introduction of designer nucleases into target cells , advs are also being exploited as a source of donor dna templates for homology - directed gene editing after site - specific chromosomal dsb formation by zfns , talens , and rgns . in this regard , it has been shown that combining designer nucleases ( i.e. , talens and rgns ) and adv - mediated donor dna transfer induces homology - directed gene targeting that is more specific and accurate than that resulting from delivering donor dna templates through conventional nonviral vectors or idlvs . the finding of precise genome editing resulting from designer nuclease - induced adv donor dna targeting ( ad.iting , in short ) could be attributed to the capping of linear adv dna by the 5 ' covalently - attached viral terminal protein which , presumably , reduces non - hr events . the resulting targeted , single - copy , donor dna integrants lead to uniform transgene expression in gene - modified cell populations . a synopsis of the main characteristics of the viral vector systems being repurposed as gene - editing devices is presented in table 1 , whereas their principal pros and cons are summarized in table 2 . on the basis of this review and on the information gathered in table 1 and table 2 , there is no evidence for an ideal one - fits - all combination of gene delivery and gene - editing tools . instead , one can put forward the view that a specific arrangement(s ) of these tools is best suited to achieve a particular goal . in conclusion , viral vectors can serve a dual role in genome engineering efforts by delivering into virtually any human cell type , templates for not only designer nuclease expression but also for targeted chromosomal integration of foreign dna . these features , combined with their well - established production systems and regulatory history build - up , are expected to foster and expand their application in genome editing settings , including in the realm of translational research . conventional lentiviral vectors based on hiv-1 establish permanent genetic modification of target cells owing to the fact that their integrase - dependent mechanisms ensure semirandom chromosomal insertion of the transported foreign nucleic acids . in gene therapy settings , these mechanisms are a crucial feature for achieving stable complementation of genetic defects in proliferating target cells and effector progenies . in the context of genome editing approaches , however , the lentiviral dna insertion mechanisms should best be disabled in order to ensure that the resulting episomal vector templates are available as substrates for hr or for transient designer nuclease expression . as previously mentioned , the short - term presence of designer nucleases in target cells is important for reducing the chances that deleterious effects caused by off - target activity arise . therefore , by using trans - complementing packaging constructs harboring specific point - mutations in the hiv-1 pol region , researchers can assemble lentiviral particles whose integrase moiety contains disabling amino acid substitutions at crucial positions within its catalytic pocket ( i.e. , d64 , d116 , and/or e152 ) ( figure 4 ) . importantly , these so - called class i integrase mutations are nonpleiotropic in that they interfere specifically with proviral establishment and not with any other of the viral transduction steps , such as , receptor binding , uncoating and nuclear import of the reverse - transcribed linear double - stranded vector genomes . hence , integrase - defective lentiviral vectors ( idlvs ) , made with the aid of such packaging constructs serve as valuable vehicles for delivering nucleic acid templates for gene targeting and/or transient designer nuclease gene expression . of note , similarly to their integration - proficient counterparts , the tropism of idlv particles are normally altered by endowing them with envelop proteins derived from viruses whose cell surface receptors are different from those engaged by hiv-1 . accordingly , such pseudotyping manoeuvres permit narrowing or expanding the range of cell types transduced by vector particles . for instance , to confer broad host range and high physical particle stability to lentiviral vectors , the vesicular stomatitis virus glycoprotein - g ( vsv - g ) idlvs were the first viral vectors to be tested in the context of designer nuclease - assisted genome editing experiments . these experiments , involving zfn technology and various human target cell types ( e.g. , k562 erythromyeloblastoid leukemia cells , lymphoblastoid cells , and embryonic stem cells ) , provided an initial proof - of - concept for using idlvs in designer nuclease - induced gene addition and gene repair studies . the former and latter experiments comprised , respectively , inserting recombinant dna at specific genomic sequences ( i.e. , ccr5 ) and correcting il2rg mutations underpinning x - linked severe combined immunodeficiency ( x - scid ) . these data revealed that idlv genomes can serve as efficient hr substrates yielding , in some cell types , homology - directed dna targeting frequencies exceeding 10% of the total target cell population with the majority of cells harboring mono - allelic insertions . these initial data has been followed - up by various other studies in which idlv transfer of donor dna templates resulted in the addition of reporter and therapeutically relevant transgenes into safe harbour loci in a diverse set of target cells , including human myocytes , human epithelial stem cells , and ipsc lines . examples of these experiments are the site - specific chromosomal insertion of microdystrophin and fanca transgenes into the safe harbour ccr5 locus in , respectively , human muscle progenitor cells and ipscs from reprogrammed fibroblasts of fanconi anemia patients . it is worth mentioning however that , in common with any other hr - based genome editing approaches , the recruitment of idlv donor dna for gene addition or for gene repair purposes is limited in non - dividing or quiescent cells due to the fact that hr occurs preferentially during the g2/s phase of the cell cycle , when endogenous repairing templates are available . hence , the cellular dna of quiescent primary cells , of which many display a high therapeutic relevance , is particularly difficult to edit through hr . an outstanding example of such cells is provided by primitive cd34 human hematopoietic stem cells ( hscs ) . hscs are defined as cells capable of long - term multilineage repopulation of the hematopoietic compartment in conditioned immune - deficient mice . of note , only genome modification at the hsc level is expected to ensure life - long correction of genetic disorders affecting components of the hematopoietic system . aiming at improving hr - based genome editing of these cells , genovese et al . have developed a protocol in which donor dna and zfn delivery into hscs is carried out by idlv transduction and synthetic mrna electroporation , respectively . crucially , this transduction / electroporation protocol is combined with exposing target cells not only to cytokines but also to 16,16-dimethyl - prostaglandin e2 ( dmpge2 ) mixed with the aryl - hydrocarbon receptor protein antagonist , stemregenin 1 ( sr1 ) . the rationale for including dmpge2 and sr1 was to interfere with the loss of stem cell properties resulting from hsc exposure to extended ex vivo culture conditions and cell cycle - activating cytokines . by using these methods , the authors report that homology - directed gene targeting frequencies at aavs1 and il2rg in bona fide hscs are increased , as stringently demonstrated by serial transplantation of human cd34 cells from primary to secondary nsg ( nod - scid - il2rg ) mice . in a subsequent study , hoban et al . have also tested an ex vivo protocol based on the transfer of zfn - encoding mrna and idlv donor templates into bone marrow - derived cd34 cells for correcting the a - to - t transversion in -globin alleles causing sickle cell anemia . considering that the yields of functional lentiviral vector particles decrease sharply with increasing transgene size , it is possible that generating idlvs containing the 4.1-kb cas9 open reading frame ( orf ) from streptococcus pyogenes results in idlv preparations with low functional particle titers . in addition , experimental results indicate that the genetic instability resulting from frequent reverse transcriptase template switching events within tale repeats in lentiviral vector genomes leads to defective particles . this makes the assembly of talen - encoding idlvs dependent on substantial orf optimization for minimizing the frequency and length of unstable repetitive tracts . of note , the same principle of sequence identity reduction has permitted to package and deliver transcriptional units encoding two zfn monomers in single idlv particles . this two - in - one approach is especially useful at low transduction rates since it ensures that each transduced cell is exposed to both members of a working zfn pair at the proper 1:1 stoichiometry . an issue pertaining to the optimal use of idlvs as designer nuclease expression platforms is that of the susceptibility of their genomes to epigenetic silencing mechanisms in transduced cells . these mechanisms involve the action of cellular histone deacetylases and have been shown to curtail dsb - induced targeted mutagenesis after idlv - mediated transfer of zfn expression units . finally , another issue regards the susceptibility of free - ended double - stranded idlv genomes to illegitimate , idlv templates can become captured at off - target or spontaneous dsbs and form undesirable dna structures such as concatemers and non - hr - derived junctions involving target or off - target sequences . these adverse genome - modifying events contribute to reduce the fidelity of the genome editing process as a whole . in contrast to lentiviral vectors , recombinant adeno - associated viral vectors ( raavs ) lack an integration machinery ( figure 5 ) . as a result , once in target cell nuclei , their genomes remain mostly in an episomal status with only a small fraction of them becoming incorporated in the cellular dna ( 0.10.5 integrations per infectious unit ) presumably upon nonhomologous end - joining mediated repair of sporadic chromosomal dsbs . these vectors entered the scene of homology - directed gene targeting during the late 1990 's , after the demonstration that viral particle transduction of single - stranded raav donor dna yields more than 1,000-fold higher frequencies of gene repair ( up to 1% of the total target - cell population ) when compared to those achieved by transfecting conventional donor plasmids . despite the feasibility of this approach , including in in vivo settings , the dominance of off - target insertions combined with the high dependency on large multiplicities of infection ( > 10 total vector particles per cell ) and cell selection schemes , has contributed to the initiation of research lines based on designer nuclease - assisted raav donor dna targeting . like previous data had shown for hr substrates delivered in the context of standard plasmids , experiments based on inducing dsbs at chromosomally integrated reporter genes by the homing endonuclease i - scei , provided a proof - of - concept for combining sequence - specific nucleases with raav donor dna in gene - targeting settings . indeed , these initial studies revealed that raav - based gene targeting can be enhanced by approximately 100-fold if a dsb is generated at a predefined target locus . in this realm , and similarly to idlvs , raavs have been mostly used so far for delivering donor dna templates and zfns . of note , when compared to those of cas9 and talen , zfn orfs are the smallest ( i.e. , ~1.2 kb per monomer versus ~4.1 kb and ~3 kb for s. pyogenes cas9 and talen orfs , respectively ) . this permits the flexible construction and packaging of transcriptional units encoding one or even two zfns in single raav particles whose effective maximum capacity is only ~4.5 kb ( figure 5 ) . clearly , in addition to talen and cas9 nuclease delivery , the low packaging capacity of raav also introduces some limitations on the designing of hr substrates for the purpose of site - specific addition of whole transcriptional units . in any case , the combination of zfn and raav technologies has clearly proven its potential for not only targeted gene disruption and deletion but also for gene repair strategies . in what the latter genome editing approaches are concerned , these experiments involved the targeting of both reporter and endogenous loci after the delivery of zfns and gene correcting templates into a diverse panel of human cell types . these different cell types included , u2os osteosarcoma cells , hek 293 cells , hela cervix carcinoma cells , ht-1080 fibrosarcoma cells , and bona fide human embryonic stem cells ( escs ) as well as ipscs . noticeably , due to the very diverse range of tools , experimental models and conditions , the gene - targeting frequencies in both absolute and relative terms ( i.e. , targeted versus random insertion events ) , varied substantially . as an example , asuri et al . compared zfn - induced gene repair levels after transducing escs with a hr template packaged either in natural or variant aav capsids . the latter capsid type , isolated by sequential cycles of biopanning of libraries of cap - mutant viruses on target cells , confers high - level raav transduction of hard - to - transfect escs and ipscs . the authors showed , by using a highly quantitative readout system based on the rescue of defective reporter gene expression , that the transfer of corrective donor dna by the molecularly evolved raav variant ( r459 g ) yielded significantly higher ( ~10-fold ) zfn - induced gene repair levels in escs ( ~1.3% of the total target cell population ) when compared to those resulting from using a prototypic , serotype 2-based , raav . importantly , the proportion of random raav dna chromosomal insertions was not augmented by the presence of active zfns in the transduced cells . collectively , this and the above - mentioned studies established that site - specific dsb formation serves as a potent trigger for homology - directed gene targeting of donor dna delivered in the context of single - stranded raav genomes . owing to a favorable set of characteristics , these characteristics include low immunogenicity in immunocompetent animal models and amenability to tissue tropism modification methodologies based on engineered capsids generated by rational or directed evolution approaches . moreover , reminiscent of the above - described tropism engineering strategies involving enveloped lentiviral vectors ; nonenveloped raavs can also be pseudotyped . in this case , raav genomes consisting of foreign dna flanked by prototypic aav serotype 2 inverted terminal repeats , are packaged within the capsids of other natural aav isolates such as those of serotypes 1 , 5 , 6 , 8 , or 9 . these novel capsid - modified raavs are powerful gene delivery tools in that they can bypass pre - existing immunity associated with the presence of neutralizing antibodies against particular raav serotype(s ) and can overcome transductional blocks linked to the absence of viral receptor(s ) on the surface of specific cell types or tissues . in addition to the previously mentioned work in which a molecularly evolved raav was used , another case in point is provided by the body - wide transduction of murine tissues by raav2/6 vectors , that is , aav serotype 2-derived raav genomes pseudotyped by packaging in aav serotype 6 capsids . moreover , it has been shown that raav2/8 particles achieve frequencies of murine liver cell transduction that are 10- to 100-fold higher than those obtained by using vectors based on other serotypes . importantly , these experiments equally revealed that the raav2/8 gene delivery activity was not hindered in animals preimmunized by exposure to other aav serotypes . the relevance and utility of raavs in in vivo settings is also underscored by the fact that a first proof - of - principle for designer nuclease - induced genome editing in vivo involved the use of these vectors in a murine model of hemophilia b , a blood coagulation disorder caused by factor ix deficiency . in particular , raav2/8 particles containing a corrective cdna spanning exons 2 through 8 of human f9 were administered to new - born hemophilia b mice together with raav2/8 particles encoding donor - matched zfns targeting intron-1 of a defective human f9 transgenic allele . gene targeting was detected and meaningful in that it resulted in 37% of normal levels of circulating factor ix that led to the improvement of the disease phenotype as measured by clot - formation kinetic assays . of note , molecular analysis of genomic dna from treated mice revealed that therapeutic construct insertions at the intended target site occurred through both homologous and non - hr . the latter , vector genome capture events , were likely caused by end - to - end nonhomologous end - joining of broken chromosome and aav inverted terminal repeat sequences . a subsequent study extended these findings of aav / zfn - mediated in vivo therapeutic genome editing to adult hemophilia b mice . the in vitro and in vivo transfer of rgn components by raavs , has also been initiated . after constructing and validating shortened expression units encoding cas9 and sgrnas , sens et al . were able to demonstrate delivery of cas9 alone or together with a sgrna by single vector particles built on chimeric aav - dj capsids . the latter all - in - one raav construction achieved approximately 8% indel formation at a target mirna locus in hek 293 t cells when applied at a multiplicity of infection of 10 particles per cell . however , in mouse livers , rgn - induced indel formation at the conserved mirna target locus by different raav constructs was invariably below 1% at 2 weeks postadministration . these in vivo results have been complemented by other animal model experiments in which raav - mediated delivery of rgn components served as a direct , transgenesis - free , approach for studying gene function in the mammalian brain . these initial studies together with the advent of shorter cas9 variants bode well for the implementation of raav / rgn tools in different in vitro and in vivo systems . indeed , ran et al . have recently used a comparative genomic analysis to isolate and characterize a staphylococcus aureus cas9 protein whose relatively small size permits flexible raav design , including copackaging of both rgn components within single vector particles . the delivery of these tools into the livers of c57bl/6 mice by raav2/8 particles led 1 week after intravenous administration to approximately 5 and 40% indel formation at apob and pcsk9 sequences , respectively . the sizable packaging capacity of adenoviral vectors ( advs ) combined with their high - titers and efficiency in transducing dividing and nondividing cells , makes them a broadly applicable option for in vitro and in vivo delivery of designer nucleases and donor dna templates ( figure 6 ) . similarly to raavs , advs started to be deployed in the context of homology - directed gene targeting experiments that did not involve designer nuclease - induced dsb formation . in these experiments , helper - dependent advs , advs , were chosen owing to their lack of viral genes , permitting the use of high multiplicities of infection , and high capacity , allowing for large donor dna packaging and delivery . indeed , ohbayashi et al . utilized helper - dependent advs with 18.6 kb homology arms to correct a mutation in hprt through hr without the involvement of artificial dsb formation in mouse es cells . with the emergence of ipscs , helper - dependent advs were also shown to be useful for correcting disease - related mutations in these pluripotent stem cells . in particular , they were used to repair several mutations in lmna alleles associated with laminopathies , thus expanding the application of this gene delivery system to human disease modeling and targeted gene repair . a follow - up study by aizawa et al . , demonstrated that regardless of the transcriptional status of the target gene , helper - dependent advs can mediate both gene knock - ins and gene knockouts by hr with high fidelity in both ipscs and escs of human origin . of note , however , the absolute gene targeting levels achieved by helper - dependent advs are rather low requiring as a result the use of drug - based selection pressure for isolating the desired targeted clones . similarly to lentiviral and adeno - associated viral vector systems , advs are equally amenable to tropism modification and good manufacturing practice methodologies . the former strategies include exchanging the apical fiber motifs of prototypic species c serotypes , which interact with the coxsackie b virus and adenovirus receptor ( car ) , with those of other natural serotypes ( e.g. , species b adenoviruses ) , which interact with other primary receptors . this fiber swapping genetic retargeting strategy allows by - passing the absence of car on the surface of human cells with scientific and therapeutic value such as hematopoietic stem / progenitor cells , mesenchymal stromal cells , and muscle progenitor cells . alternative adv retargeting methods include capsid modifications by genetic fusion of fiber or pix capsid proteins to heterologous ligands or by chemical binding of capsid components to targeting moieties . in this regard , it is noteworthy mentioning that the first testing of a therapeutic approach based on genome editing entails zfn - mediated ccr5 knockout in cd4 t - cells from acquired immune deficiency syndrome patients after their ex vivo transduction with fiber - modified adv particles . examples of other genome - editing studies based on the integration of adv and zfn technologies include the targeted mutagenesis of endogenous t - cell receptor genes in lymphocytes and of ccr5 and -globin alleles in hematopoietic stem / progenitor cells . moreover , homology - directed gene targeting induced after adv - mediated delivery of zfns , is equally being pursued in various cell types such as myoblasts , epithelial stem cells , and keratinocytes . highlighting their versatility , adv systems have in addition to zfns been validated for delivering talens and rgn complexes into human somatic cells regardless of their transformation status . concerning the former research it was found that , in striking contrast to lentiviral vector systems , the direct repeat arrays coding for the dna - binding domains of talens are stable during adv production in complementing packaging cell lines . importantly , the resulting vector preparations led to dose - dependent and high - level ( up to 67% ) targeted dsb formation in exposed cells ( e.g. , muscle progenitor cells and mesenchymal stromal cells ) . the genetic stability of advs is also underscored by the fact that transcriptional units encoding zfn or talen dimers can be packaged intact in single vector particles . due to the sizable length of talen orfs ( ~3.0 kb per monomer ) , the latter studies deployed the high - capacity gutless adv platform ( figure 6 ) . in addition to the aforementioned muscle progenitor cells and mesenchymal stromal cells , the combination of adv and talen technologies has served for inducing site - specific dsb formation in ipscs as well as in cd34 cells isolated from g - csf - mobilized peripheral blood mononuclear cells . recently , various research groups started exploiting the efficient transduction of particular murine tissues by advs for studying genetic lesions underlying the emergence of specific cancers and , subsequently , modeling their progression in vivo . such approaches based on the direct induction of targeted genomic changes in vivo ( e.g. , mutations , inversions , and translocations ) are more expeditious than those based on transgenic mice and mimic more accurately the stochastic mosaicism characteristic of many tumors . for instance , zhang et al . succeeded in inducing higher rates of apc mutations in the murine liver after tail vein injection of talen - encoding advs than those achieved after plasmid hydrodynamic injections ( 33 versus 719% , respectively ) . have in turn deployed rgn - encoding advs for inducing an approximately 11 mb chromosomal inversion involving the alk and eml4 loci to model the development of non small - cell lung cancer in vivo . besides cancer modeling , other experiments sought to mutagenize cebp and pcsk9 ( ref . the former gene is a transcriptional factor involved in the activation of metabolic target genes ; the latter is associated with low - density lipoprotein cholesterol levels , with its loss - of - function correlating with reduced risk of coronary heart disease development . collectively , these experiments strengthened the view that , together with raavs , advs serve as a valuable platform for introducing designer nucleases in vivo . however , with the expansion and finer follow - up of in vivo genome editing procedures , one can expect encountering the immunological hurdles identified previously in countless gene transfer studies in animals . these hurdles include the activation of innate and adaptive immune responses against viral particle components and foreign antigens derived from transgenic and , in the case of helper - independent advs , viral orfs . moreover , the long - term presence of designer nucleases in target tissues adds yet another hurdle that needs to be tackled by , for instance , incorporating regulatory devices for minimizing the risks of chromosomal mutations and/or rearrangements . in addition to the introduction of designer nucleases into target cells , advs are also being exploited as a source of donor dna templates for homology - directed gene editing after site - specific chromosomal dsb formation by zfns , talens , and rgns . in this regard , it has been shown that combining designer nucleases ( i.e. , talens and rgns ) and adv - mediated donor dna transfer induces homology - directed gene targeting that is more specific and accurate than that resulting from delivering donor dna templates through conventional nonviral vectors or idlvs . the finding of precise genome editing resulting from designer nuclease - induced adv donor dna targeting ( ad.iting , in short ) could be attributed to the capping of linear adv dna by the 5 ' covalently - attached viral terminal protein which , presumably , reduces non - hr events . the resulting targeted , single - copy , donor dna integrants lead to uniform transgene expression in gene - modified cell populations . a synopsis of the main characteristics of the viral vector systems being repurposed as gene - editing devices is presented in table 1 , whereas their principal pros and cons are summarized in table 2 . on the basis of this review and on the information gathered in table 1 and table 2 , there is no evidence for an ideal one - fits - all combination of gene delivery and gene - editing tools . instead , one can put forward the view that a specific arrangement(s ) of these tools is best suited to achieve a particular goal . in conclusion , viral vectors can serve a dual role in genome engineering efforts by delivering into virtually any human cell type , templates for not only designer nuclease expression but also for targeted chromosomal integration of foreign dna . these features , combined with their well - established production systems and regulatory history build - up , are expected to foster and expand their application in genome editing settings , including in the realm of translational research .

genome editing based on sequence - specific designer nucleases , also known as programmable nucleases , seeks to modify in a targeted and precise manner the genetic information content of living cells . delivering into cells designer nucleases alone or together with donor dna templates , which serve as surrogate homologous recombination ( hr ) substrates , can result in gene knockouts or gene knock - ins , respectively . as engineered replication - defective viruses , viral vectors are having an increasingly important role as delivery vehicles for donor dna templates and designer nucleases , namely , zinc - finger nucleases ( zfns ) , transcription activator - like effector nucleases ( talens ) and clustered , regularly interspaced , short palindromic repeats ( crispr)-associated cas9 ( crisprcas9 ) nucleases , also known as rna - guided nucleases ( rgns ) . we review this dual role played by engineered viral particles on genome editing while focusing on their main scaffolds , consisting of lentiviruses , adeno - associated viruses , and adenoviruses . in addition , the coverage of the growing body of research on the repurposing of viral vectors as delivery systems for genome editing tools is complemented with information regarding their main characteristics , pros , and cons . finally , this information is framed by a concise description of the chief principles , tools , and applications of the genome editing field as a whole .

Viral Vectors as Gene-Editing Tools Lentiviral vectors Adeno-associated viral vectors Adenoviral vectors

pulmonary sling is a vascular abnormality wherein the left pulmonary artery arises from the right pulmonary artery and then traverses between the esophagus and the trachea toward the hilum of the left lung . it was first described by glaevecke and doehle in 1897 . since then , about 100 cases have been reported in the world . the average age at the onset of symptoms , such as respiratory distress and cyanosis , is 2 months and about half have symptoms from birth . so , adult cases are very rare , are most often asymptomatic and usually found incidentally . when combined with complete cartilaginous tracheal rings in the absence of posterior membranous portion , it is called ring - sling complex . in that case , we here report an adult case who was diagnosed as pulmonary sling with complete tracheal ring by ct and bronchoscopy along with a literature review . she had had symptoms of airway obstruction , such as wheezing , hoarseness and mild dyspnea since a young infant . blood pressure was 140/90 mmhg , pulse rate was 80/min , body temperature was 36.5c and respiration rate was 16/min . on physical examination , she was alert , but had a slight dyspneic appearance . there were no cyanosis , chest deformities and cardiac murmurs . fev1 was 1.52l ( 66.2% of predicted value ) and fvc was 1.90l ( 54.5% of predicted value ) on pulmonary function test . complete cartilaginous ring without posterior membranous portion was found on the entire trachea ( fig . 1 ) . the plain chest x - ray showed a right mediastinal mass - like density and a long - segment tracheal narrowing ( fig . 2 ) . the chest ct revealed the anomalous left pulmonary artery originating from the right pulmonary artery and its posterior course between the trachea and the esophagus ( fig . she was discharged without specific treatment because of mild symptoms which are mainly caused by complete tracheal ring and not by tracheal compression due to vascular anomaly . the term vascular ring was introduced to describe the mediastinal vascular anomalies causing tracheobronchial compression by dr . the pulmonary sling is a kind of vascular ring and the term was first used by contro et al . in 1958 to distinguish it from other vascular anomalies . carl et al . reported that when vascular rings were classified into four groups , as follows , 1 ) complete vascular rings with double aortic arch or right aortic arch 2 ) pulmonary sling 3 ) innominate artery compression and 4 ) miscellaneous , pulmonary sling was about 4.5% . embryologically , it has been suggested that it is caused by a maldevelpment of the left ventral pulmonary artery bud due to growth failure or reabsorption . the left lung may capture its arterial supply by connection of the left postbronchial plexus with the right sixth arch through capillaries caudal to the lung bud . then , as the lung bud grows caudally , the course of the left pulmonary artery is behind the developing trachea - bronchial tree . about half have cardiac or tracheo - bronchial anomalies which determine the prognosis . according to christoph dohleman s review , the associated cardiac anomalies were 49% and among those , patent ductus arteriosus , ventricular septal defect and atrial septal defect were most common . tracheal stenosis with complete tracheal rings was the most common anomaly , followed by stenosis of main stem bronchus , tracheal bronchus and tracheo - esophageal fistula . wells et al . proposed a classification system assigning pulmonary sling without complete tracheal rings to type 1 and pulmonary sling with complete tracheal ring to type 2 . ring - sling complex can be classified into a lethal form and a form in which there is enough pars membranacea left to allow sufficient tracheal growth . the two forms can be distinguished only by their clinical course , i.e. , either severe respiratory symptoms with progression or mild symptoms without progression . bronchoscopy and echocardiography should be performed to evaluate the combined cardiac or tracheo - bronchial anomalies . the plain radiographic features include unequal aeration due to compression of the right main bronchus by the anomalous vessel , low carina , horizontal equal - length right and left mainstem bronchi and long - segment tracheal stenosis . diagnostic considerations such as dilated azygous vein , lymphadenopathy , foregut cyst or esophageal neoplasm should be excluded . most cases can be diagnosed by ct or mri , but misinterpretation can occur because of a bifurcation - like structure of the pulmonary artery . the left pulmonary artery can be missed because of its different level of crossing the carina or main bronchus . was the first to propose the now most common corrective surgical procedure : division and reimplantation of the anomalous left pulmonary artery into the pulmonary trunk anterior to the trachea with division of the ligamentum arteriosum . because of high operation mortality and loss of function of the left lung due to obstruction of the reconstructed vessel , a conservative approach with symptomatic management was recommended initially . but recent development of operation technique has resulted in low operation mortality and good patencty of the reconstructed vessel . so , in view of the seriousness of this condition and the fact that reports of surgical management have been encouraging , current policy is to offer an operation as soon as the diagnosis is made .

pulmonary sling is a rare congenital condition in which the left pulmonary artery arises from the right pulmonary artery forming a sling around the trachea causing tracheal compression . many cases are associated with cardiovascular and tracheo - bronchial anomalies . when combined with complete tracheal ring , it is called ring - sling complex . the average onset of symptoms is 2 months and about half have symptoms from birth . the anomaly , if not corrected , can be fatal within the first year of life . in an adult , it is most often asymptomatic and usually found incidentally . we report an adult case who was diagnosed as pulmonary sling with complete tracheal ring by ct and bronchoscopy along with a literature review .

INTRODUCTION CASE REPORT DISSCUSSION

type 2 diabetes mellitus ( t2 dm ) is a major global chronic disease with immense and increasing healthcare costs and a high disease burden . diabetes and diabetes - related complications considerably decrease health - related quality of life ( hrql ) . there is an indispensable need to study how diabetes care can further be improved to limit the disease burden and costs . health care systems attempt to deal with chronic diseases by standardizing treatment and clinical practice . important policy strategies include the development of national clinical practice guidelines and indicators for the quality of care [ 47 ] . a review of observational studies examining the relationship between guideline - defined diabetes processes and health outcomes notes that effects are often surprisingly small and inconsistent . health care planners are optimistic about the capacity of patients to take responsibility for their health and the management of their chronic illness [ 9 , 10 ] . the promotion of patients ' involvement in the management of their chronic disease has become a popular concept and is delineated in the chronic care model and the patient empowerment approach [ 11 , 12 ] . a patient - centered approach to diabetes care , endorsed as a central aim by the american diabetes association and the european association for the study of diabetes , includes patient education but goes beyond this to embrace multiprofessional care , care management activities , and a proactive , respectful communication with patients . others argue for a broader inclusion of patient - centered measures in studies of quality of diabetes care [ 1416 ] . studies have shown that diabetes care provided along these lines enhances metabolic control and clinical outcomes , in particular , when patients engage actively in their self - management [ 1720 ] . accordingly , we would argue that care delivery based on a partnership model between health professionals and patients should improve patient commitment to their health behaviour , self - management , and adherence , which can be conceptualised as patient outcomes . striving towards the use of patient - oriented quality of care indicators , the main limitation is a lack of empirical data . in fact , clinical trials may not be very suitable for determining the impact of these indicators when implemented in actual practice . population - based observational studies can offer both a view close to health care provision in practice and data on a wide range of structure , process , and outcome indicators of diabetes care . drawing on data from two population - based survey studies that were conducted in a region in southern germany from 2003 to 2008 we performed a post hoc analysis to test whether patients well supported by health professionals ( as indicated by higher levels of care processes such as medical examinations , diabetes education , and multiprofessional care as well as high treatment satisfaction and good quality of the relationship between patients and physicians ) attain higher levels of health behaviour and self - management and better adherence as well as less disease - related burden and higher hrql . the study population consisted of 486 participants with t2 dm who took part in either of two follow - up survey studies conducted in 200305 ( f3 ) and 200608 ( f4 ) . f3 was a follow - up cohort study ( n = 3184 ) to a 1994 - 1995 population - based monica survey ( s3 ) with a response rate of 76% . f4 was a follow - up cohort study ( n = 3080 ) of the kora s4 survey conducted in 19992001 with a response rate of 80% . the kora research platform ( cooperative research in the region of augsburg ) is a population - based data pool established in 1996 to continue and expand the monica project in augsburg , a region with a mixed urban and rural population of about 600,000 inhabitants in the southern part of germany , about 70 km west of munich . four cross - sectional health surveys ( s1 to s4 ) have been performed in the city of augsburg and its two surrounding counties at five - year intervals from 1984/85 onwards , each drawn as an independent random sample . the four cross - sectional surveys serve as cohorts for long term follow - up studies like f3 and f4 . both studies utilize the sampling in the original surveys , although data may not be fully representative due to death and loss to follow - up . study designs , sampling methods , and data collection have been described in detail elsewhere . both surveys included a personal interview , several self - administered questionnaires ( including the sf-12 questionnaire on hrql ) , medical examinations , physical measurements , computer assisted documentation of medication during the last 7 days ( idom ) , and laboratory tests . the analysed data is based mainly on items from a questionnaire filled in by participants with diabetes but includes information collected in the interview ( social - demographic data ; type and duration of diabetes ; cardiovascular comorbidity , bmi , physical activity , smoking , and alcohol ) and sf-12 questionnaire data . for the present analysis , only questions with identical wording and answer choice order were included to ascertain the validity of the joint analysis of both studies . both studies were approved by the ethics committee of the bavarian medical association and by the bavarian commissioner for data protection and privacy . only study participants with type 2 diabetes in f3 and f4 were included in our analysis . diabetes status and type of diabetes were assessed by a question in the interview ( self - report of a physician - confirmed diagnosis of diabetes ) . negative self - reports were checked with documentation of respective antidiabetes medication ( atc codes : a10a and a10b ) and corrected , if necessary . in case of doubt , the primary physician was contacted to confirm the diagnosis . of the n = 3184 participants of f3 , n = 259 were classified as participants with type 2 diabetes , respectively , n = 227 of the n = 3080 participants of f4 . we excluded n = 11 ( f3 ) respective n = 8 ( f4 ) participants with self - reported type 1 diabetes to improve sample homogeneity . the sample for analysis consists of 486 participants in total , combining the data of those two surveys to increase sample size for the analysis . participants over 75 years of age filled in a shortened version of the sf-12 in the f3 survey , leading to a higher number of missing values for hrql . diabetes care processes are defined in this study as elements of diabetes care that result from direct interactions between health professionals and patients . processes of diabetes care were assessed with the following variables : ( 1 ) medical examinations and advice , ( 2 ) diabetes education , ( 3 ) treatment satisfaction , ( 4 ) patient - perceived quality of patient / physician relationship , and ( 5 ) multiprofessional care . five types of medical examinations ( eye exam , foot exam , hba1c lab , blood pressure , and protein / urine testing ) and two types of advice given by the physician on diet and physical exercise were assessed by the percentage of participants who reported this activity as having been performed during the last 12 months ( yes / no ) . treatment satisfaction was assessed with a single item : in total , how satisfied are you with the diabetes treatment ( including treatment with insulin , tablets and/or diet ) you have been receiving in the past weeks ? responses from 1 ( very dissatisfied ) to 7 ( very satisfied ) were analyzed across the entire range . the quality of the patient / physician relationship was assessed by items relating to four different quality aspects : comprehensibility of information , opportunity to ask questions , shared decision - making , and psychological support . responses for these variables were dichotomized as excellent , good versus other to ascertain good discriminatory power . multiprofessional care was assessed by two items asking whether dieticians and/or podiatrists were involved in the diabetes care ( yes / no ) during the past 12 months . to prepare process parameters for the multivariate analysis , we added up answers to respective questions in each group ( medical examinations ( 7 items ) , quality of patient / physician relationship ( 4 items ) , and multiprofessional care ( 2 items ) ) , which were identical in wording and answer format ( see table 5 ) . diabetes education ( number of classes attended ) and treatment satisfaction ( range 17 ) were already available as single values . missing values were set to 0 except for missings with regard to treatment satisfaction , where the sample mean value of 5 was imputed . we excluded participants with > 3 missings in the variables relating to process parameters to minimize the need for such imputations in this dataset with its many missing values ( see table 5 ) but to retain a workable sample size for the multivariate analyses . in this study we perceive self - management , adherence , and health behaviour as intermediate patient outcomes , that is , activities that may result from care processes providing effective support of patients . complications and health - related quality of life are considered as medium and long term outcome indicators . taken together , patient outcomes were assessed with the following variables : ( 1 ) patient self - management , ( 2 ) adherence , ( 3 ) health behaviour , ( 4 ) diabetes complications , and ( 5 ) health - related quality of life . participants were asked whether and how frequently they had self - monitored feet , weight , blood glucose , and blood pressure within the past 6 months . each item was dichotomized into 1 for frequencies of once a month or more and 0 for less . these activities are included in a validated scale of diabetes self - care activities ( summary of diabetes self care activities , sdsca ) , although this scale uses a different design to assess frequency . adherence was assessed with self - reported information on whether participants were following medical advice regarding medication , physical activity , diet , and foot care ( i ) without difficulties , ( ii ) with some difficulties , or ( iii ) with major difficulties . each item was dichotomized into 1 for a report of no difficulties and 0 for some or major difficulties . for descriptive analysis the respective answer category reads does not apply to me ( table 5 ) . for health behaviour , we used self - reported information on physical activity , smoking , and alcohol consumption and coded them in accordance with guidelines [ 2527 ] . ( 2 hr / week regularly in winter and summer ) versus 0 ( < 2 hr / week regularly in winter , summer , or both ) . smoking is dichotomized into 1 ( never - smokers and ex - smokers ) and 0 ( regular and occasional smokers ) . alcohol intake is transformed by using cut - off values of weekly consumption in gram ( 0 = men > 20 g , women > 10 g ; 1 = equal or less ) . diabetes - related burden was assessed with regard to common diabetes complications and the occurrence of hyper- and hypoglycaemia . diabetic complications refer to the clinical diagnosis ( ever versus never ) of retinopathy , poor blood circulation in legs , peripheral neuropathy , and microalbuminuria . two items ask to recall the occurrence of hypoglycemic and/or hyperglycemic episodes during the past 6 months ( yes versus no ) . hrql is assessed with the sf-12 , a validated questionnaire and short form of the sf-36 . values are expressed as two scores , the physical health score and mental health score ( pcs and mcs ) . all of the above variables are described in table 5 with regard to their wording , the number of missing values , and the coding used for all analyses . covariates included in the regression analysis are time of survey , patient age , sex , educational level ( basic education versus higher ) , diabetes duration , diabetes treatment type , and comorbidities ( history of stroke / myocardial infarction : yes / no ) . treatment type refers to ( 1 ) no antidiabetic medication , ( 2 ) oral hypoglycemic agents ( oha ) , and ( 3 ) insulin treatment . age and duration of diabetes are entered as continuous variables . for sample description we added information on the bmi ( body mass in kilograms divided by the square of height in units of meters ( kg / m2 ) ) , health insurance status ( % statutory ) , and enrolment in a diabetes type 2 disease management program ( t2dm - dmp ) . descriptive statistics ( percentages , means ( sd ) ) were generated for sample characteristics and process and outcome parameters . differences between the populations of the two survey periods with time of survey entered as dichotomous variables ( f3 , f4 ) were tested by student 's t - test for continuous variables and -test for categorical variables . multiple logistic regression models were used to examine the association between care processes with patient outcomes , controlling for age , sex , education , treatment type , cardiovascular comorbidities ( previous myocardial infarction or stroke ) , and time of survey participation as covariates . odds ratios ( or ) were calculated for binary variables . for continuous variables , such as quality of life scores , p values less than 0.05 are considered as statistically significant but used in an explanatory sense to retrieve further hypotheses . the sociodemographic characteristics of the total sample and of groups divided by treatment type , ( 1 ) no antidiabetic medication , ( 2 ) oral hypoglycemic agents ( oha ) , and ( 3 ) insulin treatment , are shown in table 1 . about half of the sample was treated with oral hypoglycemic agents ( oha ) ( n = 259 , 53% ) , with the remainder equally divided between those on insulin only and insulin combination treatment ( n = 111 , 23% ) and those without antidiabetic medication ( n = 116 , 24% ) . average diabetes duration varies across the groups with different treatment types from 5.6 years in the group without antidiabetic medication to 16.2 years in the group with insulin treatment . overall t2 dm disease management - enrolment was 20% ; it was lowest in the group with no medication . there were no differences between the survey periods regarding baseline variables entered in the regression analyses ( table 4 ) . blood pressure testing was the most frequent ( 95% ) and feet exams the least frequent ( 50% ) of medical examinations and advice . of the seven types of medical examinations and advice , participants received a mean of 4.2 ( 2.2 sd ) . half of the participants had attended at least one patient education class ( 51% ) . across all participants , the mean value for treatment satisfaction was 5.3 ( 1.6 sd ) on a rating scale from 1 ( very dissatisfied ) to 7 ( very satisfied ) . ( 78% ) , compared with the comprehensibility of information ( 87% ) , the opportunity to ask questions ( 90% ) , and shared decision - making ( 85% ) . of the four items , participants rated an average of 2.9 ( sd 1.5 ) items as good or excellent . participants reported low use of multiprofessional care : only 24% had used a podiatrist during the last 12 months , 17% a dietician . patient self - management , that is , monthly or more self - monitoring of blood - pressure , weight , feet , and blood - glucose , was reported by 6580% of participants with the highest percentage for monitoring weight ( 81% ) . differences between high adherence with respect to medication and feet care ( > 80% ) and much lower adherence with regard to physical activity and diet ( ca . only 14% of participants reported to engage in regular physical activity of more than 2 hours per week . however , more than 88% reported not smoking and 73% moderate / no alcohol consumption . disease - related burden was increased for 9% of participants with diabetic retinopathy , 12% with microalbuminuria , 21% with poor circulation in legs , and 29% with peripheral neuropathy . more than half of the participants stated to have experienced episodes of hyper- and hypoglycemia in the last 6 months . mean hrql was 41.5 in the physical component score ( pcs-12 ) and 49.8 in the mental component score ( mcs-12 ) . we excluded n = 70 participants ( 14% of the total sample ) because of > 3 missing values in variables pertaining to care processes ( f3 : n = 49 ; f4 : n = 21 ) . most of them were participants who did not fill in the diabetes - specific questionnaire ( f3 : n = 34 of n = 259 ; f4 : n = 11 of n = 227 ) . associations with patient self - management , health behaviour , disease - related burden , and health - related quality of life were strongest for medical examinations and advice , diabetes education , and quality of relationship with physician and less strong for treatment satisfaction and multiprofessional care . a higher number of medical examinations and advice were associated with self - monitoring of blood pressure ( or 1.18 ; ci : 1.03 , 1.35 ) , feet ( or 1.24 ; ci : 1.09 , 1.42 ) , and blood glucose ( or 1.23 ; ci : 1.07 , 1.42 ) . however , participants with more medical examinations and advice also reported less frequently that they had no difficulties with adherence to diet ( or 0.82 ; ci 0.70 ; 0.95 ) . participation in diabetes education was positively associated with self - monitoring feet ( or 1.30 ; ci 1.06 , 1.60 ) and blood glucose ( or 1.50 ; ci 1.18 , 1.90 ) . patient - perceived positive quality of relationship with the physician was most strongly associated with adherence to medication ( or 1.92 ; ci : 1.39 , 2.64 ) and the mental component score of hrql ( mean score difference 2.04 ci : 0.95 , 3.13 ) . it was less strongly , but still significantly , associated with adherence to recommendations regarding diet ( or 1.33 ; ci : 1.04 , 1.71 ) and feet care ( or 1.33 ; ci : 1.02 ; 1.73 ) as well as self - monitoring of weight ( or 1.26 , ci : 1.00 ; 1.58 ) . multiprofessional care was positively associated with self - monitoring of blood glucose ( or 1.63 , ci : 1.02 , 2.62 ) . contrary to our hypothesis , a number of associations indicated that participants reporting a higher level of care processes were more likely to report diabetes - related complications , episodes of hyperglycemia , and lower scores in the mental component of hrql . participants who receive multiprofessional care are less likely to be free of poor blood circulation in legs ( or 0.54 ; ci : 0.35 , 0.83 ) , peripheral neuropathy ( or 0.68 ; ci : 0.47 , 0.99 ) , and hyperglycemia ( or 0.61 ; ci : 0.40 ; 0.91 ) . the risk of no retinopathy decreases with more diabetes education ( or 0.75 ; ci : 0.63 ; 0.90 ) , and the physical component hrql score is lower ( mean score difference : 1.01 ; ci : 1.76 ; 0.26 ) . the risk of no microalbuminuria decreases with a higher mean score in medical examination and advice ( or 0.79 ; ci : 0.63 ; 0.99 ) . finally , the only association found for treatment satisfaction indicates that participants with more treatment satisfaction are less likely to not have been diagnosed with retinopathy ( or 0.71 ; ci : 0.51 ; 0.98 ) . to investigate the robustness of our results , sensitivity analyses were performed . models were calculated when ( 1 ) adjusting for diabetes duration instead of treatment type , ( 2 ) diabetes treatment in four ( insulin only ; insulin and oha ; oha ; no medication ) versus three groups ( insulin only or insulin and oha ; oha ; no medication ) , and ( 3 ) controlling for t2dm - dmp enrolment . in each case measuring quality of care requires process and outcome measures that go beyond specific clinical interventions to integrate components that are guided by the patients themselves [ 1416 , 32 ] . we have tried to capture quality of care broadly by relating care processes to patient outcomes , expanding the set of indicators to include patients ' activities and experiences . following our hypotheses , frequent medical examinations increase the likelihood of self - monitoring activities . patient - experienced positive relationship with physician is associated with higher adherence to medical recommendations , for example , medication and the sf-12 mental component score . contrary to our expectation , higher levels of medical examinations and multiprofessional care did not preclude disease - related burden but were associated with it . this may indicate that patients ' support by health professionals is being initiated too late and is only intensified once complications are present . this study , however , used a cross - sectional design , which introduces problems with confounding . we have adjusted for cardiovascular comorbidity and treatment type , but these adjustments may not be enough to control for the intensified health care needs of sicker patients ( i.e. , those with more complications ) . further research with prospective studies is needed to reevaluate these findings . on a descriptive level , our results provide evidence that the frequency of care processes still falls short in germany . with the exception of blood pressure , all medical examinations required to be performed yearly are reported only from 50%75% of participants . for example , annual eye exams are recommended for all patients with t2 dm , but in our data only about two thirds of the patients reported receiving one in the past 12 months . only 5060% of participants reported receiving advice on diet or on physical exercise or ever participating in patient diabetes education . guidelines recommend that all patients should receive these types of examinations and advice as well as patient education . patient self - monitoring levels as reported in this study must also be regarded as relatively low level , considering that 2030% of patients do not carry out these activities at least on a monthly basis . however , in the light of diabetes treatment guidelines which only very generally recommend that physicians should review health behaviour with each patient on a regular basis ( i.e. , at least annually ) this may be explainable [ 7 , 34 ] . although self - monitoring of weight was reported relatively more often compared to the other types of self - monitoring , adherence to medical recommendations concerning physical activities and diet was difficult for the majority of participants . whilst adherence to most types of medical recommendations , except recommendations concerning physical activity , is higher when patients perceive the quality of patient - physician relationship to be good , patients ' self - monitoring is associated with more frequent medical examinations , advice , and diabetes education . in the guidelines , self - monitoring of blood glucose reimbursement of glucose test strips has been cut for oha - treated patients with diabetes in 2011 by the federal regulatory bodies . care processes were not associated with any of the three types of health behaviour which we assessed , that is , physical activity , smoking , and alcohol consumption . only about 15% of participants report regular physical exercise . participants do better managing smoking and alcohol consumption , but approximately 30% report a higher than recommended intake of alcohol and approximately 10% are smoking . these figures are consistent with data from a nationwide german health survey , carried out between 2008 and 2011 . . only half of the participants in our study state that they have attended diabetes education classes at least once . ( 2008 ) conclude that patient education must have a clear program at the outset and be reinforced at additional points of contact and should be delivered by a team of educators . there need to be more efforts to monitor age , sex , and socioeconomic differences in health behaviour to target interventions and evaluate these kinds of complex interventions . in our study , we found that a higher patient - perceived quality of patient - physician relationship is associated with a higher score for the mental component of health - related quality of life ( mcs-12 ) , roughly equalling the difference in mcs-12 scores between women with and without diabetes . this indicates the potential benefits of intensified patient - oriented care processes for patient outcomes . the strength of this study is its population - based approach , providing data regardless of contact to medical care providers or membership in a particular sickness insurance fund . baseline characteristics of our sample , such as the distribution across the treatment groups ( no medication , oha , and insulin ) , are similar to what has been found for patients with t2 dm in other study samples in germany . we have used multiple logistic regression models and adjusted for important covariables such as education , cardiovascular comorbidity , and duration of diabetes . models proved to be very robust when sensitivity analyses were performed , that is , when adjusting for diabetes duration instead of treatment type . the questionnaire used in this study did not contain validated scales for the assessment of care processes or self - management , such as the patient assessment of chronic illness care ( pacic ) , diabetes management self - efficacy scale ( dmses ) , diabetes treatment satisfaction questionnaire ( dtsq ) , or sdsca scale , most of which are not available in german or have only recently been translated [ 24 , 43 ] . we combined the items on medical examinations , quality of patient - physician relationship , and multiprofessional care to reduce complexity of the analysis . this must be regarded as exploratory and calls for further validation or the use of validated scales in future studies . with regard to measuring hrql , the use of disease - specific quality of life questionnaires for type 2 diabetes in addition to generic questionnaires such as the sf-12 is important to capture the full spectrum of experiences with diabetes , including the psychological burden of the disease . thus the analysis was run on a smaller sample , removing participants with > 3 missing values in process or outcome variables . the assessment of comorbidities and diabetic complications based on patient - reports may be particularly susceptible to information and recall bias . however , studies that use insurance data or review physicians ' charts have found comparable rates of comorbidities and diabetic complications in germany [ 45 , 46 ] . a comparison with data from the largest statutory health insurance fund in germany shows good agreement with regard to hba1c testing ( in our data 64% , health insurance data 69% ) but a higher frequency of self - reported eye exams ( in our data 69% , health insurance data 35% ) . other types of medical examinations studied here are not accounted for in administrative data in way that would be comparable to our data . our data only captured some aspects of quality of care while others may be added by other studies . also , classifying the elements as done in this study is one way to conceptualise possible associations and there may be others which are equally valuable . for example , treatment satisfaction can be regarded as patient outcome , when factors not under control of the health care system or the health professionals are considered equally important . following this , self - monitoring , adherence , and health behaviours can be treated as care processes when focusing on the interaction between health professional and patient to initiate , adopt , and maintain actions . in this study however , we perceive self - management , adherence , and health behaviour as intermediate outcomes , that is , activities that may develop when care processes work well beforehand . generalizations from this rather small regional study with mainly self - reported data should be done carefully and only in the light of additional data . this study relied mainly on self - reported questionnaire data with its limitations in validity and reliability . however , the data offer rich insights on patients ' perceptions of quality of diabetes care , which are rare and valuable for expanding our understanding of patient - oriented processes and outcomes in diabetes care . efforts to improve diabetes care need to go beyond guidelines to standardizing treatment and clinical practice and integrate indicators pertaining to higher levels of patient - oriented care processes and outcomes . our study underlines the importance of monitoring and evaluating diabetes care by drawing on patient - reported indicators for both processes and outcomes as an indispensable part of clinical practice . our results stress the importance of finding more effective strategies to support patients to change health behaviour , in particular with regard to physical activity . attention should be paid to fostering the patient - perceived quality of patient - physician relationship . diabetes education must broaden its reach and scope , for example , in the field of health behaviour . rather than programs delivered just once per patient , it must be remodelled into providing long - term support to maintain patient engagement [ 47 , 48 ] . further research is warranted to consider how diabetes self - management is associated with patients ' prioritization of health outcomes and quality of life , caregiver support as well as costs .

objective . this study aims to examine the relationship of diabetes care processes and patient outcomes with an expanded set of indicators regarding patient - oriented care delivery , such as treatment satisfaction , the quality of patient - physician relationship , and a wider range of patient outcomes such as self - management , health behaviour , disease - related burden , and health - related quality of life ( hrql ) . methods . the study population consisted of 486 participants with type 2 diabetes in two population - based follow - up surveys , conducted in 2003 to 2005 and 2006 to 2008 in southern germany . data were self - reported and questionnaire - based , including the sf-12 for hrql . multiple regression models were used to identify associations between care processes and outcomes with adjustment for confounders . results . frequent medical examinations increased the likelihood of self - monitoring activities , such as foot care . a positive patient experienced relationship with their physician is associated with higher adherence to medical recommendations , such as medication intake , and the score of the sf-12 mental component . participants with diabetes - related complications reported higher levels of medical examinations and multiprofessional care . conclusions . indicators of patient - oriented care should become an indispensable part of diabetes clinical practice guidelines with the aim of striving for more effective support of patients .

1. Introduction 2. Methods 3. Results 4. Discussion and Conclusion

the genus acanthotrema ( digenea : heterophyidae ) are intestinal parasites of fish - eating birds and mammals . acanthotrema acanthotrema , the type species , was originally described from a bird ( sterna maxima ) in 1928 in brazil , and other species were subsequently documented . currently , 8 species are included in this genus ; a. acanthotrema , a. armata , a. cursitans , a. felis , a. hancocki , a. martini , a. tanayensis , and a. tridactyla . the newest species is a. felis , which was described in 2003 from the small intestine of stray cats in the republic of korea . various brackish water fish have been reported to be the second intermediate host for acanthotrema species including the mud sucker gillichthys mirabilis and the southern california killifish for a. hancocki and the goby acanthogobius flavimanus for a. felis . for example , a. acanthotrema has been reported from brazil , a. hancocki , a. martini , and a. cursitans from the united states , a. tridactyla from egypt and kuwait , a. armata from spain , a. tanayensis from the philippines , and a. felis from korea . the definitive hosts for a. acanthotrema , a. armata , a. hancocki , and a. martini are birds , including sea gulls , and those of a. felis , a. cursitans , and a. tanayensis are mammals , particularly cats . , with the exception of a. felis . a 70-year - old man residing in muan - gun , korea , expelled a single adult worm of a. felis after praziquantel treatment , together with 148 heterophyes nocens , 65 gymnophalloides seoi , 30 stictodora fuscata , 1 stictodora lari , and 1 stellantchasmus falcatus . we describe here 4 additional human cases naturally infected with a. felis in southern coastal areas of korea . during surveys of human intestinal flukes in shinan - gun ( 1990 ) , muan - gun ( 1995 ) , and yeongam - gun ( 2003 ) , jeollanam - do , korea , small trematode egg ( ste ) positive cases in kato - katz fecal smears were subjected to adult fluke collection after anthelmintic treatment and purging . briefly , praziquantel at a dose of 10 - 15 mg / kg was orally administered and an hour later the patient was given 30 g of magnesium sulfate . all the diarrheic stools were collected from each case for 4 - 5 hr and examined under a stereomicroscope . ten specimens of a. felis were recovered from 4 patients ( 1 - 7 per person , average 2.5 worms ) ( table 1 ) . all 4 patients were commonly infected with other heterophyid flukes including h. nocens , pygidiopsis summa , s. fuscata , and heterophyopsis continua . the number of specimens of the aforementioned fluke species was much higher than that of a. felis ( table 1 ) . the patients were suffering from vague abdominal discomfort and indigestion , sometimes accompanied by frequent stool , lethargy , and anorexia . however , it was considered that these symptoms were not necessarily due to a. felis infection . the patients had habitually eaten raw flesh of brackish water fish , such as the mullet and goby . the morphological characteristics and measurements ( m ) of the recovered a. felis adults are as follows ( table 2 ) . the worms were pear - shaped and were covered with fine tegumental spines , except near the posterior extremity ( fig . their average body size was 472 in length ( range , 405 - 510 ) and 269 ( 230 - 300 ) in width . the ventral sucker was embedded in the ventrogenital sac which had a distinct membranous covering . the ventrogenital sac was located in the median line , usually at the anterior end of the middle third of the body . inside the ventrogenital sac , 3 sclerites were observed ; 1 was short and thumb - like , 1 was long and blunt - ended , and 1 was long and broadly tipped ( fig . the gonotyl was u - shaped , unspined , located right to the sclerite complex , and was included in the ventrogenital sac . two testes were ovoid , posterolateral to the ovary , and a little obliquely side - by - side , and were located at the posterior half of the body . the bipartite seminal vesicle was connected to the genital sinus and then to the genital opening in the ventrogenital sac . vitellaria distributed from the post - testicular level to the posterior extremity , forming 2 large groups of follicles . the uterus formed a transverse loop immediately in front of the ovary , and nearly filled up the posterior half of the body . the morphological characteristics and measurements ( m ) of the recovered a. felis adults are as follows ( table 2 ) . the worms were pear - shaped and were covered with fine tegumental spines , except near the posterior extremity ( fig . their average body size was 472 in length ( range , 405 - 510 ) and 269 ( 230 - 300 ) in width . the ventral sucker was embedded in the ventrogenital sac which had a distinct membranous covering . the ventrogenital sac was located in the median line , usually at the anterior end of the middle third of the body . inside the ventrogenital sac , 3 sclerites were observed ; 1 was short and thumb - like , 1 was long and blunt - ended , and 1 was long and broadly tipped ( fig . the gonotyl was u - shaped , unspined , located right to the sclerite complex , and was included in the ventrogenital sac . two testes were ovoid , posterolateral to the ovary , and a little obliquely side - by - side , and were located at the posterior half of the body . the bipartite seminal vesicle was connected to the genital sinus and then to the genital opening in the ventrogenital sac . vitellaria distributed from the post - testicular level to the posterior extremity , forming 2 large groups of follicles . the uterus formed a transverse loop immediately in front of the ovary , and nearly filled up the posterior half of the body . since the first discovery of a. felis in korea , its presence has been documented several times in the country . adult flukes were reported from feral cats caught near pusan and shinan - gun and from a human in muan - gun . the present study adds shinan - gun and yeongam - gun as new localities for human infections . metacercariae of a. felis were discovered in 7 ( 35.0% ) of 20 a. flavimanus in haenam - gun , and in 31 ( 91.2% ) of 34 a. flavimanus in muan - gun , with the total number of metacercariae being 116 ( 17 per fish ) and 7,292 ( 235 per fish ) , respectively . among the 8 species of acanthotrema , only a. felis is so far known to distribute in korea , and is the only species infecting humans around the world , based on a previous report and the present study . however , humans seem to be a less susceptible host than birds or mammals , and the pathogenicity of acanthotrema worms to humans is unknown . in the 5 known human cases , the number of worms recovered per individual was usually 1 with the present exception of 1 patient who expelled 7 worms . this low number of infected worms probably would not cause any harmful effect to humans . humans may have innate resistance against this fluke , although this issue needs further clarification . however , acanthotrema has fewer than 12 spines or sclerotizations , and stictodora has more than 12 spines on the ventral sucker or ventrogenital sac . it was not difficult to assign our specimens to acanthotrema because they typically had 3 sclerotizations in the ventrogenital sac . other morphological characters included a submedian ovary , a bipartite seminal vesicle , a short prepharynx , absence of spines on the gonotyl , and the presence of 3 sclerites on the ventrogenital sac . a. tanayensis has 4 sclerites which are unarmed and the sclerites of a. acanthotrema consist of 2 armed pieces and a third unarmed piece . a. armata has 2 armed sclerites , and a. cursitans has 2 unarmed , branched sclerites . the present specimens displayed 3 sclerites with spines on the tip , differing from a. acanthotrema and a. tridactyla , which have 2 - 3 clerites with minute spines on the tip . the shape of the sclerites in our specimens was slightly different from that in the original report of this species . the sclerites in the original report consisted of 1 short , thumb - like piece and 2 long and pointed ones . however , in our specimens , the sclerites consisted of 1 short and thumb - like piece , 1 long and broadly tipped piece , and 1 long and blunt - ended piece . the present study is the second report on human a. felis infection following the report of cho et al . . this fluke should be included among the list of human - infecting foodborne intestinal flukes in korea and asia . further studies are required to clarify the geographical distribution and host - parasite relationships of a. felis infection .

acanthotrema felis is an intestinal trematode of cats originally reported from the republic of korea . only 1 human case infected with a single adult worm has been previously recorded . in the present study , we report 4 human cases infected with a total of 10 worms recovered after anthelmintic treatment and purging . all 4 patients reside in coastal areas of jeollanam - do , korea , and have consumed brackish water fish including the gobies , acanthogobius flavimanus . the worms averaged 0.47 mm in length and 0.27 mm in width , and had 3 sclerites on the ventrogenital sac ; 1 was short and thumb - like , another was long and blunt - ended , and the 3rd was long and broad - tipped . they were identified as a. felis sohn , han , & chai , 2003 . surveys on coastal areas to detect further human cases infected with a. felis are required .

INTRODUCTION CASE RECORD Brief description of worms DISCUSSION

bacterial isolates - fifty - five m. tuberculosis isolates obtained from culture stocks at -80c were tested by cvda . eighteen were mdr isolates , nine isolates were only resistant to inh and the remaining 28 were sensitive to both inh and rif . in the present study , h37rv - atcc 25618 ( susceptible to all drugs ) , atcc 35822 ( resistant to inh ) and atcc 35838 ( resistant to rif ) the bactec 460 tb system ( becton & dickinson ) was used as the reference method for the determination of susceptibility in the 18 mdr isolates , whereas the bactec mgit 960 system ( becton & dickinson ) was used as the reference method for the determination of susceptibility in the remaining isolates . preparation of antibiotics and cv - inh , rif and cv were purchased from sigma . stock solutions of inh and rif at 1,000 mg / l were prepared in sterile distilled water and methanol , respectively , and the stock solutions were stored at -20c until use . stock solutions of cv at 25 mg / l were prepared with sterile distilled water , sterilised by filtration and stored at 4c until use . preparation of bacterial inocula - five or six colonies of each the 55 isolates freshly grown on lj media was suspended in a physiological saline tube containing 10 - 15 glass beads and then vortexed for 30 sec . the tube was kept in a vertical position for 1 h at room temperature to allow for the sedimentation of aerosols and large particles . the turbidity of the supernatant was adjusted to a mcfarland standard of 1 ( clsi 2011 ) . preparation of the medium - the bacteria were tested in middlebrook 7h9s broth ( containing 0.1% casiton , 0.5% glycerol and 10% oleic acid , albumin , dextrose and catalase ) . inh and rif were tested at critical concentrations of 0.25 mg / l and 0.5 mg / l , respectively ( martin et al . the test was performed in three tubes , including two assay tubes and one growth control tube . the assay tubes contained inh or rif and the growth control tube was without antibiotics . determination of the cv concentration - in this study , the concentration of cv was determined according to the value of tolerance described by jones and falkinham iii ( 2003 ) . the appropriate test concentration of cv was determined by titration of the stock solution . the most suitable concentration was 100 l of 25 mg / l a stock solution in a 1-ml tube . application of the test - an inh test tube ( 0.25 mg / l ) , an rif test tube ( 0.5 mg / l ) and an antibiotic - free growth control tube were used for each bacterium . a bacterial suspension ( 50 l ) that was adjusted to mcfarland standard 1 was inoculated into the three tubes and the tubes were incubated at 37c . on the seventh day of incubation , 100 l of cv ( 25 mg / l stock solution ) was then added to the tubes and incubated for an additional 24 - 48 h. as cv ( blue / purple ) is decolourised by the growth of bacteria , the isolate was considered to be resistant to that drug if the colour of cv was lost ( figs 1 - 3 ) . a : negative control tube without drug or bacteria ; b : positive control tube with bacteria without drug ; c : test tube with rif ( resistant to rif ) ; d : test tube with isoniazid ( inh ) ( susceptible to inh ) . decolourisation - there is bacterial growth . a clinical multidrug resistant isolate - resistant to isoniazid ( inh ) and rifampicin ( rif ) . a : negative control tube without drug or bacteria ; b : positive control tube with bacteria without drug ; c : test tube with inh ( resistant to inh ) ; d : test tube with rif ( resistant to rif ) . decolourisation - there is bacterial growth . a clinical isolate - susceptible to to isoniazid ( inh ) and rifampicin ( rif ) . a : negative control tube without drug or bacteria ; b : positive control tube with bacteria without drug ; c : test tube with rif ( susceptible to rif ) ; d : test tube with inh ( susceptible to inh ) . the sensitivity , specificity , positive predictive value ( ppv ) , negative predictive value ( npv ) and agreement for inh were found to be 92.5% , 96.4% , 96.1% , 93.1% and 94.5% , respectively . two isolates were found to be sensitive to inh by cvda , though they were resistant according to the reference method . the sensitivity , specificity , ppv , npv and agreement for rif were 88.8% , 100% , 100% , 94.8% and 96.3% , respectively . two rif - resistant isolates were found to be susceptible by cvda ( table ) . tablecomparing the results of crystal violet decolourisation assay ( cvda ) with those obtained with reference methoddrugcvdareference method 460tb / mgit sensitivity ( % ) specificity ( % ) ppv ( % ) npv ( % ) agreement ( % ) rs inhr18/70/192.596.496.193.194.5 s0/227 - ----rifr16/00/088.810010094.896.3 s2/00/37 - ---- a : automated systems included bactec 460 tb and mgit 960 were used as reference methods ; inh : isoniazid ; npv : negative predictive value ; ppv : positive predictive value ; r : resistant ; rif : rifampicin ; s : sensitive . a : automated systems included bactec 460 tb and mgit 960 were used as reference methods ; inh : isoniazid ; npv : negative predictive value ; ppv : positive predictive value ; r : resistant ; rif : rifampicin ; s : sensitive . there is increasing interest in the use of colourimetric methods for the susceptibility testing of m. tuberculosis isolates . these methods have certain advantages in that they are easy to perform , reproducible , reliable and readily available and have a very low cost . the present study is the first to assess cv decolourisation for the evaluation of m. tuberculosis antimicrobial susceptibility . jones and falkinham iii ( 2003 ) showed that cv and malachite green were decolourised by water - borne pathogenic mycobacteria , a feature that is believed to be due to the properties of the bacterial cell wall . it was suggested that decolourisation could be due to the reduction of cv and its sequestration in the lipid fraction . in that same study , water - related mycobacterial pathogens were shown to be tolerant to cv concentrations of up to 15 mg / l ( jones & falkinham iii 2003 ) . therefore , a concentration of less than 15 mg / l was used in the present study . as a result of titration , 100 l of a 25 mg / l stock solution of cv was added to the assay tubes ; thus , the final concentration would be 2.5 mg / l , which the bacteria may be able to tolerate . colourimetric methods , such as the resazurin microplate method , the nitrate reductase assay ( nra ) , ( 2-methoxy-4-nitro-5-sulphophenyl)-2h - tetrazolium-5-carboxanilide , 2,3-bis ( 2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino ) carbonyl]-2h - tetrazolium hydroxide and the malachite green decolourisation assay , have been developed for the drug susceptibility testing of m. tuberculosis clinical isolates and these new colourimetric methods have yielded concordant results with reference methods ( angeby et al . nra requires three different compounds , including sulfanilamide , n-1-naphthylethylenediamine and concentrated hydrochloric acid for the griess reagent ; in addition , freshly prepared griess reagent should be used for the test . in contrast , cv dye is inexpensive and is used for gram staining in clinical microbiology laboratories ; therefore , it can be easily obtained by many laboratories . in this study , the critical concentration used was 0.5 mg / l for rif and the results from two isolates were inconsistent with the reference method : these isolates were sensitive according to cvda , but were resistant with the reference method . however , full agreement may be observed if the critical concentration is reduced by one or two dilutions . this new colourimetric method showed sensitivities , specificities and agreements of 92.5% , 88.8% and 96.4% and 100% , 94.5% and 96.3% , respectively , for inh and rif . however , the low number of tested resistant strains may have resulted in the low sensitivity of the test . for this reason , further studies with more resistant strains are needed before routine laboratory implementation . in conclusion , based on the accuracy reported here , cvda is a rapid , simple , inexpensive and potent method for the detection of inh and rif resistance in m. tuberculosis isolates , particularly in developing countries .

the aim of this study was to investigate the performance of a new and accurate method for the detection of isoniazid ( inh ) and rifampicin ( rif ) resistance among mycobacterium tuberculosis isolates using a crystal violet decolourisation assay ( cvda ) . fifty - five m. tuberculosis isolates obtained from culture stocks stored at -80c were tested . after bacterial inoculation , the samples were incubated at 37c for seven days and 100 l of cv ( 25 mg / l stock solution ) was then added to the control and sample tubes . the tubes were incubated for an additional 24 - 48 h. cv ( blue / purple ) was decolourised in the presence of bacterial growth ; thus , if cv lost its colour in a sample containing a drug , the tested isolate was reported as resistant . the sensitivity , specificity , positive predictive value , negative predictive value and agreement for inh were 92.5% , 96.4% , 96.1% , 93.1% and 94.5% , respectively , and 88.8% , 100% , 100% , 94.8% and 96.3% , respectively , for rif . the results were obtained within eight - nine days . this study shows that cvda is an effective method to detect m. tuberculosis resistance to inh and rif in developing countries . this method is rapid , simple and inexpensive . nonetheless , further studies are necessary before routine laboratory implementation .

MATERIALS AND METHODS RESULTS DISCUSSION

polymerization shrinkage of resin composite restoratives remains a major impediment to their long - term clinical success . contemporary composite materials shrink during polymerization , resulting in a volumetric reduction ranging from 1.5 to 5% depending on the molecular structure of the monomer , the amount of filler , and the rate of cure . during polymerization , the volume of monomers is reduced , which creates sufficient shrinkage stresses to debond the material from dentin , thereby decreasing retention and increasing leakage . factors that influence stress formation include volumetric polymerization shrinkage ; elastic modulus and flow of the resin composite ; adherence of the resin composite to the cavity walls ; the configuration factor of the restoration . cavity configuration factor ( c - factor ) is the ratio of the bonded surface area in a cavity to the unbonded surface area . this means that , in a box - like class i cavity , there may be five times more bonded surface area than the unbonded surface area . much attention has been directed toward producing dentinal adhesives that withstand the forces involved during polymerization shrinkage of composite resins . studies have shown that an effective dentin - adhesive bond depends on the wetting and penetration characteristics of the dentinal adhesive system and the reactivity of the treated dentinal surface . the structure of the collagen in the demineralized dentinal layer also seems to influence the behavior of the bond . adhesive systems that do not excessively demineralize dentin , exposing the collagen fibers and leaving interwoven banded collagen in the demineralized layer , produce superior bond strengths . lately , many research efforts are targeted to develop a nonshrinking high performance polymer for use as a matrix material for dental composite resins [ 4 , 5 ] . one approach was the use of liquid crystalline monomers as a resin which was described to shrink less due to the transition of its nomadic phase to an isotropic amorphous state when photocured . moszner et al . published vinyl cyclopropane derivates as radical curing ring opening monomers , also suitable to copolymerize with common methacrylate - based resins . eick and his collaborators , on the other hand , presented a different chemical approach focusing on the cationic ring opening spiro - ortho carbonates , especially in combination with epoxy monomers . in the recent years , a new cationic ring opening monomer systems have been investigated with the target profile of a low - shrinking , highly reactive , and biocompatible composite that withstands the aggressive environment of the oral situation . the name silorane derives from the combination of its chemical building blocks siloxanes and oxiranes . it exhibits good mechanical properties comparable to those of clinically successful methacrylate - based composite materials and low - shrinkage stress values in comparison to regular methacrylate composites [ 912 ] . reported that the ring - opening chemistry of the siloranes enables at the first time shrinkage values lower than 1 vol % . watts and hindi reported that the relatively slow shrinkage of hermes , silorane - based composite possibly represents an advantage in relation to faster shrinking materials in that smaller and less extended marginal gaps may result from this intrinsic soft start . the low - shrinking composite is expected to be associated with better bonding and improved marginal sealability as it causes a more uniform stress distribution at the restorative composite - tooth interface . in a study made by gerdolle et al . in 2008 comparing the sealability of a packable resin composite ( filtek p60 ) , a compomer ( compoglass f ) , an ormocer ( admira ) and their associated bonding agents ( scotchbond 1 , excite , and admira bond , resp . ) , and a resin - modified glass ionomer ( fuji ii lc ) , they failed to demonstrate the inverse relation between polymerization shrinkage and marginal sealing ability of various polymer restorative materials tested . in 2005 [ 14 , 15 ] conducted series of studies based on the assumption that the novel low - shrink composites ( rbcs ) may offer a potential reduction in polymerization shrinkage and stresses . they tested the hydrolytic stability of oxi and sil consisting of an oxirane / polyol and oxirane / siloxane resin - based matrix . they reported that the decreased water sorption , solubility and associated diffusion coefficient of the experimental silorane rbc , sil may potentially improve hydrolytic stability of rbc restorations demonstrated by the nonsignificant decrease in biaxial flexure strength following medium - term immersion . in 2008 arisu et al . studied the effect of occlusal loading on microleakage of class v cavities restored with a composite preceded by a two - step total - etch adhesive , a two - step self - etch adhesive , or a one - step self - etch adhesive . the two - step adhesive exhibited better marginal sealing than the all - in - one at the enamel margins under 250 n occlusal loading . they stated that , surprisingly , hermes ( an experimental silorane ) in combination with its particularly designed adhesive hermes bond showed leakage along the enamel margins a result which was confirmed clinically in an ongoing clinical investigation . most recently in two different studies that tested the low - shrinking siloranes ' microshear and microtensile bond strength ; lowest bond strength values were measured for silorane - based resin composite [ 17 , 18 ] . again , comparing silorane with methacrylate - based composites revealed that , it was least affected by the change of c - factor . to compare between silorane - based and methacrylate - based systems in marginal adaptation using different cavity configurations . low - shrinking silorane based and methacrylate - based prompt l - pop composite systems ( table 1 ) were experimented with . teeth were debrided with hand scalers and cleaned with a rubber cup and slurry of pumice . standardized box - shaped cavities 2 2 2 mm were made on the teeth 's buccal surfaces at their gingival halves . cavities were positioned about one millimeter above the cementoenamel junction to ensure that the gingival cavity wall is in enamel . positions and dimensions of buccal cavities were standardized through using a template ( 2 2 mm ) prepared in a metal band strip . depth of cavities was standardized by marking the burs at 2 mm length prior to use . prepared teeth specimens were then classified randomly into 5 equal main groups of 20 teeth each ( n = 20 ) relative to the number of cavity surface(s ) to be bonded . in groups group 1 : in which one cavity surface was allowed for bonding ( c - factor = 1/5 ) . group 2 : in which two cavity surfaces were allowed for bonding ( c - factor = 2 /4 ) . group 3 : in which three cavity surfaces were allowed for bonding ( c - factor = 3/3 ) . group 4 : in which four cavity surfaces were allowed for bonding ( c - factor = 4/2 ) . group 5 : in which all cavity surfaces ( including the gingival one ) were allowed for bonding ( c - factor = 5/1 ) . for all of the above specimens the selected unbonded cavity wall(s ) was premarked with a dot using a permanent colored marker on the corresponding surface and away from the cavity margin by about two mm for signaling as well as to facilitate identification . each of the five main groups was further subdivided into two subgroups a and b of ten specimens each ( n = 10 ) for the two studied adhesive / composite systems , namely adper prompt l - pop and silorane , respectively . each of the two adhesives was applied to the preselected cavity walls to be bonded by following the manufacturers ' instructions and under magnification using the dental operating microscope ( dom ) . for the adper prompt l - pop , the mixed adhesive was carefully applied and scrubbed on the preselected cavity wall(s ) for fifteen seconds and gently dried for three to five seconds with compressed air . the material was rubbed for 15 seconds gently and thoroughly air - dried to remove the aqueous solvent . for the silorane adhesive bond system , and the silorane self - etch primer was applied to the pre - selected cavity wall(s ) to be primed and bonded using the special minisponge applicator , rubbed gently for 15 seconds , then air - dispersed carefully . silorane adhesive was then applied similarly and light - cured for 10 seconds also . box cavity samples of subgroups a and b were then restored incrementally with the particular resin - based composite , namely , filtek z250 and filtek silorane , respectively . each increment was photo - irradiated ( heliolux dlx halogen light curing unit vivadent , schaan , liechtenstein ) for 40 seconds/1-mm increment . restorations were then finished and polished with flexible discs ( 803 m , soflex xt pop - on , 3 m espe , st . paul , mn , usa , 3000 6000 rpm ) under simultaneous water cooling . finally restored teeth specimens were stored in water for 24 hours . restored teeth were subjected to thermocycling between 5c and 55c ( 5000 cycles dwelling time 30 seconds ) . teeth specimens were covered with two layers of nail polish except for the restorations and approximately 1 mm margin around . the teeth were then dipped in a 2% methylene blue dye solution for 30 minutes ( according to ) . after dye penetration , the dye film on the tooth 's surface was polished off with a 3 m polishing disc ( soflex xt pop - on 1982 sf ) . each tooth was then sectioned vertically through the center of the restoration with a diamond disk at low speed under water coolant . the sectioned teeth were assessed using a stereomicroscope with an attached camera ( stereo - microscope 47507 , camera m 35 , zeiss , gttingen , germany ) at 24 . captured photomicrographs were transferred to a computer system for measurement of linear dye penetration at gingival margins using an image analysis software program ( image j 1.31b , usa ) . processing of each photomicrograph was done before analysis to ensure standardization of each image for calculation . a color code was done for different structures of the image including tooth structure , filling material , and area of dye ( figure 1 ) . next , the colored image was converted into an 8-bit gray scale image ( black and white ) for easy selection of an appropriate threshold of a grey scale that ensures selection of the area of dye penetration only ( figure 2 ) . on the 8-bit image , automated tracing of the area of interface a color code threshold of the area of dye penetration was undertaken prior to calculation . this was followed by automatic calculation of linear dye penetration at the gingival cavity margins . student s t - test was performed for prompt - l - pop and silorane ( spss . one - way anova for the results of dye penetration ( in mm . ) for prompt - l - pop and silorane was presented in tables 2 and 3 . the test of bonferroni 's results was presented graphically in figures 3 and 4 . for the prompt - l - pop , marginal leakage was detected in all tested teeth groups with exception of group 1 ( c - factor 1/5 ) . thereafter , a minimum gradual increase in the mean linear dye penetration was perceived in groups 2 , 3 , and 4 ( 0.064 mm .097 , 0.066 mm .150 , and 0.067 mm .145 , resp . ) . a statistically significant marked increase in dye penetration was detected in the 5th group ( x0.353 mm .485 ) where the c - factor equals 5/1 ( table 2 ) . figure 3 reflects the result of the bonferroni test , a significant difference was found between group 5 and group 1 with the highest leakage score being in group 5 . for the silorane groups , linear marginal leakage occurred in groups 1 , 2 and maximized in group 5 with a mean of 0.030 mm .067 , 0.031 mm .070 , and 0.104 mm .149 , respectively . on the other hand , one - way anova revealed a statistically significant highest leakage score in group 5 ( c - factor 5/1 ) . bonferroni test revealed a significant difference between group 5 and each of group 3 and 4 towards group 5 ( figure 4 ) . comparison between silorane and prompt - l - pop in the overall mean leakage of the five groups collectively was made using paired samples statistics and paired samples correlation ( tables 4 and 5 ) . the prompt - l - pop mean leakage score was found to be markedly higher than that of the silorane ( .1101 versus .0329 , resp . ) . this difference was found to be statistically significant ( p = 0.034 ) . figure 5 is a graphical representation of the mean dye penetration ( in mm . ) for prompt - l - pop and silorane with different cavity configurations . the present study was undertaken to investigate the effect of cavity configuration ( c - factor ) on marginal adaptation of low - shrinking silorane - based composite ( filtek silorane / silorane adhesive bond system ) . a methacrylate - based composite : different cavity configurations ( c - factors ) were used to examine their possible effect on the linear leakage at the gingival margins of box - shaped cavities . cavities on buccal surfaces of extracted human premolars were made with the gingival walls about 1 mm coronal to the cemento - enamel junction to allow for an enamel and dentin gingival wall . to facilitate careful application of each of the two adhesives only on the prespecified cavity wall(s ) the procedure of adhesive application was done under high magnification ( 22x ) using the dental operating microscope ( dom ) . this was further made easier by the use of the minisponge applicator delivered with the silorane adhesive bond system . for the adper prompt l - pop , two layers of the self - etch adhesive were applied with no waiting time for the second layer as recommended by the manufacturer for best performance of the material . the time of immersion of the specimens in 2% methylene blue dye for 30 minutes was selected according to the studies of ernst et al . [ 19 , 20 ] . they found it to be a suitable enough time for testing linear leakage at the class v cavities with good correlation to the scanning electron microscopy for testing marginal adaptation at the enamel margins . this latter parameter was found to be relatively high in both tested materials ( tables 2 and 3 ) . the high standard deviation was related to the fact that in many of the specimens from the same group the leakage score was found to equal zero . in the adper prompt l - pop subgroups , when the standard deviations were added , a clear general trend toward an increase in the leakage score with the increase in c - factor was found . leakage in group 5 was found to be more than 5 times greater than that of groups 2 , 3 , and 4 . using the one - way anova , a possible explanation is that this is because in the above - mentioned group , the c factor was high ( equals 5 ) . they described that a large unbonded area would facilitate composite plastic deformation during polymerization before the gel point is reached , thus reducing the final stress values . it is known that the ratio of bonded versus unbonded areas ( c factor ) plays an important role with regard to the formation of shrinkage stress . the compensation of polymerization shrinkage by relaxation of the resin monomers is increasingly restricted by increasing c factor . this explains the significantly higher leakage score related to groups 5 for both adhesives used in the present study . as for the silorane , recorded linear gingival leakage for each tested group asmussen and peutzfeldt reported that the novel silorane - based resin composite had significantly lower polymerization contraction than the other methacrylate - based composites . this would appear to indicate that ring opening has taken place with a concomitant contraction that is relatively small . eick et al . found that the stability and insolubility of siloranes in aqueous solutions containing epoxide hydrolase , porcine liver esterase , or dilute hcl enhances their potential as good candidate monomers for use in dental composite materials . the silorane resin is more hydrophobic than conventional methacrylate resins due to its siloxane backbone , so it results in reduced water uptake and related phenomena [ 7 , 23 ] . detected micropermeability in several self - etching and etch - and - rinse adhesives with voids demonstrated along the resin - bonded interface except for silorane and optibond fl that showed an adhesive layer free from water trees and micro - permeability . the higher risk of defects at the resin - dentine interface , which may represent the pathway for hydrolytic and enzymatic degradation of resin - dentine bonds over time , would thus be minimized . on the other hand , it showed however the highest leakage score with a c factor of 5 , although the extent of this linear leakage was only about one - third that of prompt - l - pop ( 0.104 ( .149 ) and 0.353 ( .485 ) , resp . ) . the erratic behaviour of leakage scores of silorane relative to c - factor denotes that c - factor might have an insignificant effect on silorane . the null hypothesis that the marginal adaptation of silorane is not affected by the cavity configuration ( c - factor ) can not be accepted . although silorane - based composite system was least affected by the change of c - factor and resulted in a statistically significant good marginal adaptation as compared to the methacrylate - based one , it showed tendency toward higher leakage score with c - factor of 5 . although both tested adhesives are self - etch , yet silorane adhesive bond system is a two - step system while prompt - l - pop is a one - step all - in - one system . this may derive another explanation for the enhanced marginal adaptation that was proved by the lower linear leakage of the silorane adhesive , based upon the aforementioned tactical difference in bonding . nevertheless , it was reported in many previous studies that the two - step self - etch adhesives exhibit better marginal sealing than all - in - one [ 16 , 2729 ] . ola studied the microshear and microleakage behavior of filtek silorane / silorane adhesive bond and filtek z250/prompt l - pop systems and reported that although both systems resulted in almost similar bond strength values , nanoleakage pathway and extent vary immensely among the different adhesives used suggesting a different behaviour of the adhesive joint in both materials during functioning and on aging with expected variation of bond durability and longevity of bonded restorations . under the circumstances of the present investigation , the following conclusions can be drawn . the null hypothesis that the marginal adaptation of a low - shrinking composite silorane is not affected by the cavity configuration ( c - factor ) was rejected . however , silorane was least affected by the change of c - factor marginal adaptation of filtek silorane / silorane adhesive bond system as tested by linear dye penetration along the gingival wall of box cavities was found to be generally higher than the filtek z250/prompt l - pop system .

aim . to investigate the effect of c factor on marginal adaptation of low - shrinking composite ( silorane).the null hypothesis was that the marginal adaptation of silorane is not affected by the cavity configuration . materials and methods . a silorane based and a methacrylate based composites , with their corresponding self - etch adhesive systems filtek silorane / silorane adhesive bond system and filtek z250/prompt l - pop respectively were used . standardized cavities were prepared on the buccal surfaces of 100 maxillary premolars . teeth were grouped into 5 groups ( n = 20 ) , for the 5 c factors . restored teeth were subjected to thermocycling . microleakage testing was done and linear dye penetration was assessed using a stereomicroscope . statistical analysis was done using the student 's t - test . results . for the methacrylate based systems ' overall leakage score was significantly higher than the silorane - based one ( p = 0.034 ) . for the methacrylate - based , leakage was found in all tested teeth groups except group 1 ( c factor 1/5 ) . for the silorane , one - way anova revealed a statistically significant increase in dye penetration in the 5th group ( p = 0.010 ) . conclusions . the null hypothesis was rejected . the silorane - based resin although it resulted in a statistically significant good marginal adaptation , it showed tendency toward a high leakage score with c - factor of 5 .

1. Introduction 2. Aim of study 3. Materials and Methods 4. Results 5. Discussion 6. Conclusions

abducens nerve palsy is the most common of the ocular paresis in adults,1 , 2 with sudden onset of binocular horizontal diplopia as the bothersome symptom . sixth cranial nerve palsies can be secondary to etiologies such as vascular , viral illness , inflammation , trauma , and undetermined in few cases . in younger patients the incidence of idiopathic sixth nerve palsies varies between 9.3 and 13.2/100,000 in the caucasian population , with idiopathic reasons contributing to 26% of the total incidence . this case report deals with an acute onset esotropia due to abducens nerve paresis in a 25 year young adult presumably due to an idiopathic etiology or a viral illness . the natural history of the clinical presentation , findings , and role of vision therapy is emphasized through this case report . a 25-year - old male presented with chief complaint of sudden onset , binocular horizontal , uncrossed diplopia during the past 1 week associated with eye pain in right eye . he also complained of vomiting and a radiating headache precipitated by stress , computer work and other near work . there was no history of significant systemic illness or any ocular or head injury , and he denied any recent viral illness . the local ophthalmologist had administered a 10-day course of intravenous methyl prednisolone injection along with tablet prednisolone 5 mg ( 10 tab / day ) for three days . cover test revealed a 35 prism diopter right esotropia at distance and a 25 prism diopters right esotropia at 40 cm . ocular motility showed mild restriction of abduction ( 1 ) in the right eye and rest of the movements were full . mri brain results ( plain and contrast ) were within normal limits and no lesions / demyelination were identified . binocular vision assessment revealed poor stereopsis , normal monocular accommodation , unmeasurable fusional vergence due to constant diplopia and reduced monocular accommodative facility and gradient ac / a ratio of 4:1 . the diagnostic data is provided in table 1 . due to constant diplopia and poor fusional ranges , the patient could fuse with 40 base - out fresnel prisms in front of the right eye . as the patient was a frequent traveler he preferred using frosted glasses instead of fresnel prisms . at the 3 month follow - up , diplopia had reduced considerably except in extreme right gaze . the frequency of the diplopia decreased , although diplopia persisted in right gaze , and this was stable for the past one month with no improvement noticed by the patient . visual acuity was 20/20 , n6 in both the eyes and worth four dot test showed fusion for distance and near . the cover test revealed a 16 pd esophoria at distance and 10 pd esophoria at near . however , there were still significant reduced negative fusional vergence , and accommodative facility ( table 1 ) . although there has been considerable improvement probably due to spontaneous recovery , the nfv amplitudes and accommodative facility were still reduced and the patient was symptomatic . considering no significant improvement over the past month , vision therapy was recommended to improve divergence amplitudes and to improve accommodative facility . three broad goals were established for vision therapy , developing divergence amplitudes for distance and near , improving accommodative facility ( monocularly and binocularly ) , and improving saccadic / pursuit eye movements ( due to diplopia in lateral gaze ) . on re - assessment at the end of 10 sessions , asthenopic symptoms were reduced , and no diplopia was noticed for distance and near . the distance and near angles reduced significantly from 16 pd esophoria to orthophoria for distance and 2 pd esophoria at near . the goals of vision therapy and details of vision therapy is sequenced in table 2 , table 3 respectively . after 10 sessions of in - office vision therapy , he was advised to continue home - based therapy using the transparent eccentric circles , life saver card , brock string and accommodative flippers . a six month follow - up revealed stable alignment , and no symptoms with good compliance to home vision therapy . the most common causes for non - traumatic sixth nerve paresis in children and adults include central nervous system mass lesions , demyelination and inflammation , vasculopathy , and multiple sclerosis.5 , 6 idiopathic presentations in adults can account for up to 22% of cases . spontaneous recovery of 6 nerve paresis is common ( in almost 71% of affected individuals ) in traumatic sixth nerve palsy at 6 months after onset,7 , 8 , 9 and the angle of deviation is the most important determining the prognosis . in our case , vision therapy improved the patient 's range of fusion and thus significantly reduced the incidence of diplopia in both these patients . saccadic peak velocities and latency are documented to be affected in sixth nerve palsies and hence saccadic training was thought to be constructive to improve saccades especially toward the paretic side . though there is absence of quality data to suggest eye movement therapy may be helpful , from a physiological perspective we considered that this could be beneficial in preventing secondary contracture of the extraocular muscles . also it has been well documented in literature that a high percentage of patients with a 6th nerve palsy show spontaneous remission that may take months . thus , aggressive optometric treatment with prism , lenses , and vision therapy can help the patient be more comfortable during the time it takes for remission to occur , and also speed up the improvement in function . though it could be argued that the natural history would allow for spontaneous resolving of symptoms even without active intervention , our case emphasizes the short course of vision therapy that could be of potential benefit and immediate relief to visually bothering symptoms of diplopia and asthenopia . vision therapy plays a significant role in improving fusional ranges , reduce asthenopic symptoms , and improve eye movements , thereby meeting the visual demands of the patient in idiopathic abducens nerve paresis . thorough neurological investigations are required to rule out life threatening illness before commencing the therapy .

the natural history of idiopathic abducens nerve paresis and the role of conservative management such as vision training during the recovery process is not well documented in the literature to the best of our knowledge . this case report presents the natural recovery process of idiopathic abducens nerve paresis in a young adult and the role of vision therapy in the recovery process .

Introduction Case history Clinical findings Three month follow UP Discussion Conclusion Conflicts of interest

multiple sclerosis ( ms ) as one of the most frequent diseases of the central nervous system ( cns ) in young adults often entails persistent physical and mental disability . the prevalence is assumed to be 400,000 people in the united states and approximately 2,1 million people worldwide . mostly , ms begins with a relapsing course ( relapse remitting ms , rrms ) . after years , it leads to a progressive course ( secondary progressive ms , spms ) [ 3 , 4 ] . another form of ms , progressive - relapsing ms ( prms ) , is defined as a progressive disease from onset with acute relapses and with periods of progression between relapses . nearly 10% of ms patients develop primary progressive ms ( ppms ) , which is defined as a progressive type from onset with temporary impairment . ms is mainly characterized by multitopic inflammation and demyelination . as the disease proceeds , the role of axonal loss and gliosis increases . , one therapy with a single immune mechanism can not fit such a complex pathogenic disease . at the present time , the anti - inflammatory , immunomodulatory , or immunosuppressive treatments are mainly effective in the early phase of the disease but are of less advantage in the progressive phase . therefore , an axon - protective therapy will be essential to reduce disease progression . current treating strategies of progressive ms are rare . there is general agreement that intravenous methylprednisolone ( ivmp ) administration ( 1000 mg daily for 35 days ) is first - line therapy in the recovery from relapses [ 810 ] . ivmp recovers the blood - brain barrier ( bbb ) by downregulating adhesion molecule expression . furthermore , it induces different immunological changes as inhibition of proinflammatory cytokines , lymphocyte apoptosis , and remyelination . so , as of a result , their immunosuppressive and anti - inflammatory power glucocorticoids are established in the standard treatment for acute relapses . although ivmp could reduce the duration of a relapse , no effect on the exacerbation rate or on the development of long - term disability was determined . the benefit of corticosteroids in the treatment of acute relapses has been examined in clinical trials . another double - blind , placebo - controlled , randomized trial of high - dose methylprednisolone ( 1 g iv daily for 5 days ) was arranged in 35 patients with ppms . a statistically significant amelioration of the expanded disability status scale ( edss ) score was observed . one phase ii randomized controlled trial ( rct ) in rrms compared the benefit of repeated pulsed ivmp with ivmp at the same dosage but administered only for relapses . it could be demonstrated that pulsed ivmp decreased the development of t1 black holes , brain atrophy progression , and associated development of permanent disability . on the other hand , pulsed application of intravenous corticosteroids is related to transient and dose - dependent side effects , such as temporary mood disorders , gastric ulcer , headache , and myalgia . chronic administration may even result in more serious side effects , such as hypertension , hyperglycemia , decline of cardiac conditions , osteoporosis and an increased incidence of fractures , hepatic steatosis , infection , cataract , and transient memory impairment . consequentially , one interesting alternative may be the intrathecal administration of triamcinolone acetonide ( tca ) , which has been adopted for the treatment of many other diseases . this paper reviews data on the efficacy of intrathecal steroid application in the treatment of ms . trials were classified according to the system established by the american academy of neurology ( aan ) . a number of historical papers deal with advantages and disadvantages of intrathecal administration in ms . since 1953 , several mainly uncontrolled trials have been published . different dosages and diverse conventional steroid compounds , that is , methylprednisolone acetate ( mpa ) or tca , are mentioned . despite the controversial discussion especially in progressive ms patients with predominantly spinal symptomatology according to some trials , positive effects could be noticed [ 1820 ] ( table 1 ) . in 1953 , kamen and erdman referred treating a patient with rrms with intrathecal hydrocortisone ( hc ) and intramuscular adrenocorticotropic hormone ( acth ) . in a couple of open - label , uncontrolled trials between 1961 and 1963 , boines [ 24 , 25 ] reported 7580% recovery , particularly of spasticity with intrathecal mpa in 42 patients during a follow up of 1252 weeks . goldstein et al . reported that intrathecal mpa decreased csf -globulin in ms but without correlation to improvement of spasticity . in 1964 , van buskirk et al . performed an open - label , uncontrolled prospective study of intrathecal mpa in 20 patients . the treatment appears to decrease spasticity in 14 patients and consequently results in improved walking distance and bladder function . in 1970 , again goldstein et al . referred in an open - label , uncontrolled trial to 38 patients treated with 4 to 8 intrathecal mpa infusions and followed up for 2 to 8 years . neurological examinations revealed an initial improvement in 30 patients that remained stable in only 6 patients . in 1973 , again nelson et al . reported in an open - label , uncontrolled prospective study on 23 patients with ms . all the above - mentioned studies have to be rated as class iv evidence , only . for the first time , rohrbach et al . performed a double - blind , randomized , controlled trial ( short report ) . one cohort was treated either with 3 or 4 intrathecal tca injections of 80 mg . the other cohort received oral triamcinolone starting with 48 mg / d in descending dosage . in the intrathecal cohort , a better and consistent improvement in the spinal score could be observed than the other treatment arm . this study corresponds to class ii evidence . in 1992 , heun et al . conducted an open - label , randomized , prospective , unblinded study on 50 ms patients with different ms forms ( rrms , ppms , and spms ) . one group received 3 intrathecal tca injections of 40 mg on days 1 , 8 , and 15 ; the other cohort was treated with methylprednisolone 100 mg i.v . from day 1 to 5 , then in descending dose . no significant difference in the examined frequency of improved neurological symptoms or in edss between the two cohorts was found . , the majority of the mentioned historical trials of intrathecal steroid for ms performed in the past were uncontrolled and have to be rated as class iv evidence . despite their lacks , the trials of rohrbach et al . and heun et al . are notable ( class ii / iii evidence ) . especially trials that conform to generally defined criteria of evidence - based medicine are missing . according to intrathecal tca applications repeated lumbar punctures under double - blind design including the agreement of patients and the ethical committee are nowadays not feasible . intrathecal mpa therapy for ms caused transient urinary incontinence in two of 20 patients . in two other reports on 61 patients , constrictive arachnoiditis in thoracic or lumbar area , aseptic meningitis , subarachnoid haemorrhage , and neurogenic bladder were described [ 27 , 28 ] . other mentioned complications were brain damage , spinal cord lesions , and dense widespread pachymeningitis [ 3234 ] . in spite of these reports , the revival of intrathecal steroid treatment started with the positive results of a trial on intractable postherpetic neuralgia , in which 89 subjects received up to 4 intrathecal methylprednisolone administrations within 4 weeks without any serious side effects . in a rapid succession , a few further open - label uncontrolled trials were performed following a different treatment regime [ 3739 ] ( table 2 ) . performed an open - label , uncontrolled , prospective trial on the short - term and long - term efficacy and tolerability of repeated intrathecal tca application . 36 patients with progressive ms ( 22 spss , 14 ppms , edss < 7.5 ) were included . patients did not receive steroids and were on a stable immunomodulatory drug treatment for at least 4 weeks before the start of the study . they had to show symptom progression of at least one point on the edss scale , in the last 2 years before study entry , but had to be stable for at least 4 weeks before inclusion . an atraumatic ( sprotte ) needle was used in order to minimize the risk of postlumbar puncture syndrome . edss scores significantly decreased ( p = .00065 ) , and the walking distance ( wd ) significantly increased ( p = .003 ) . patients with an improvement in their edss or wd were provided to receive further treatment with one tca application at an individual rate every 6 to 12 weeks . the follow - up treatment period amounted to 13.1 6.22 , 323 ( mean s.d . , the post hoc analysis demonstrated that a significant decline of edss and the improvement of wd occurred after first initial 6 tca applications and then remained stable . neither a significant impact of covariates in statistical analysis nor relevant side effects were found . a temporary increase of csf protein above 500 mg / l and transitory increase of csf cells ( maximum cell count was 38/l ) was noticed . 5 patients developed a slight post - lumbar puncture syndrome , but they did not abandon further tca applications . this study illustrated efficacy and safety of repeated intrathecal tca administration in progressive ms patients with spinal symptoms . the application frequency ( 6 tca injections within 3 weeks and follow - up injection every 6 to 12 weeks ) was markedly higher in contrast to other previous trials . although long - term data did not prove any further improvement of neurological symptoms , the amelioration reached remained robust over the following treatment period with one tca application every 6 to 12 weeks . hellwig et al . performed another open - label , uncontrolled , prospective study on 161 ms patients ( 35 ppms , 122 spms , 4 rrms ) with pronounced spinal symptoms on the impact of the administration of 40 mg of the sustained released steroid tca . subjects did not suffer from an acute onset of exacerbation or recent pronounced increased progression of ms symptoms . edss , barthel index , wd , and somatosensory evoked potentials ( sseps ) were analysed before start and at the end of the tca treatment . atraumatic sprotte needles were used to avoid post - lumbar puncture syndrome [ 41 , 43 ] . edss and barthel indices were enhanced , wd increased , and latencies of ssep of the median and tibial nerves were reduced in all patients at serial evaluation ( p < .0001 for all variables ) . 5 patients abandoned the study due to lumbar puncture headache . in this uncontrolled trial , an improvement of spinal symptoms , wd , and ssep latencies in progressive ms patients were documented , and the results from a previous trial were confirmed . the electrophysiological results may mirror a certain potential of intrathecal tca administration for demyelinating actions . again steroids were suspected to induce a neuronal cell injury due to brain atrophy [ 10 , 22 , 44 ] . another open - label , uncontrolled , prospectice trial on short - term efficacy of repeated intrathecal tca applications in progressive ms dealt with this aspect . in addition to the mentioned clinical parameters , csf was examined for the unspecific markers of cell injury neuron - specific enolase ( nse ) , tau - protein , s 100b , and -amyloid [ 4549 ] . 6 tca injections , performed every third day , reduced edss ( initial : 5.4 1.3 , 37.5 ( mean sd , range ) ; end : 4.9 1.1 ; 2.56.5 ; p < .001 ) and significantly increased wd primarily after the fourth tca injection . these results indicated that the role of tca administrations is undercharged in those trials without any persuasive clinical output [ 18 , 20 ] . this supported the statement that the sustained released steroid tca is not toxic and causes no relevant cell injury or deterioration of neuronal cells [ 10 , 20 , 44 , 5053 ] . previous studies showed that repeated intrathecal tca administrations generated a clear prolonged benefit in patients with progressive ms suffering from mainly spinal symptoms . mitoxantrone ( mix ) application is performed similarly in progressive ms patients with a continuous , rapid worsening of symptoms . in contrast to tca administration , mix application is a worldwide accredited therapy to diminish or abandon progression . hence , a cumulative maximal life - time dose should be respected [ 5456 ] . based on this consideration , hellwig et al performed an open - label study over a 52-week - long interval and compared tca and mix therapy in two matched cohorts of subjects with progressive ms . only patients with progressive the mix dose was minimized to 10 mg / m and 8 mg / m dependent on patients ' stable condition . edss significantly decreased and wd significantly increased ( p < .001 ) after the initial 6 tca administrations and then remained relatively constant . neither edss nor wd deteriorated in any of the tca patients . on the other hand , mix therapy did not significantly influence edss ( p = .056 ) or wd ( p = .12 ) , even though no additional decline of edds or wd was measured . two patients in the mix arm suffered from moderate nausea . an isolated and temporary increase in csf protein ( > 500 mg / l ) and a temporary rise of csf cells without development of neurological symptoms in all subject was observed . 8 patients in the tca arm suffered from post - lumbar puncture syndrome without termination of further tca treatment . again , the efficacy and safety of repeated intrathecal tca administrations in progressive ms patients with predominantly spinal symptoms was approved [ 37 , 38 ] . it has to be pointed out that a rate with 6 tca applications within 3 weeks was definitively higher compared to previous trials . following this concept , especially ppms and spms patients appear to improve initially and then remain stable during tca treatment at least over one year . in contrast in this trial , mix therapy did not improve edss or wd , but no significant impairment was recognized . other trials approved a positive impact of mix on ms symptoms especially in patients with progressive ms and superposed relapses [ 54 , 57 , 58 ] . the number of relapses in the year before mix treatment started is regarded to be a predictive parameter in mix efficacy in ms patients . in this trial therefore , the lack of edss improvement could be attributed to this . in conclusion , maybe a combination of both should be investigated in progressive ms patients as it has been performed with ivmp and mix . despite the mentioned limitations , this study has to be rated as class iii evidence . up to now , clinical trials on patients with progressive ms demonstrated no distinct proof of a potent symptomatic treatment intended to improve or at least stabilize disability , as soon as the progressive phase of the disease stage appears . immunomodulatory treatment minimizes the rate of ms relapses noticeably but shows no evident positive effects in patients with progressive ms . numerous papers dealt with the efficacy of intrathecal application of different dosages of various released steroid compounds , above all methylprednisolone acetate was used . this formerly used steroids were mainly short acting cortisone derivates . further , these steroids were administrated intrathecally less frequently . so , these trials lacked of detailed selection and clinical characterization of ms patients , with small sample sizes , low steroid dosages , and only a few intrathecal administration of mostly short - acting cortisone derivates [ 19 , 20 , 36 ] . beneficial but controversialy discussed effects were mentioned in progressive ms patients with predominantly spinal symptoms according to case reports , open - label trials , and one double - blind , controlled study ( class of evidence ii ) with the sustained released steroid tca [ 1820 ] . as is known , the anti - inflammatory impact of a steroid application depends not only on the dosage but also on the duration of exposure [ 9 , 10 , 61 ] . hence , the frequency of application and the utilization of a delayed released steroid derivative as tca are recommendable . in a rapid succession , a few further open - label uncontrolled trials were performed following a different treatment regime [ 3739 ] . 6 injections of 40 mg of the sustained released steroid derivate tca were administered within 3 weeks . patients with an improvement of edss or wd were provided to receive further treatment with one tca application in an individual rate every 6 to 12 weeks . all forecited more recent open label trials were performed in patients with progressive ms with mainly spinal symptoms . they documented a significant improvement of edss and wd , respectively . with additional administrations , a stable effect was achieved . however , the mechanism which these improvements are based on is unacquainted . one item debated was the decrease of spasticity by the long - acting steroid . but a significant decrease of antispastic scores was not essential to achieve the mentioned results in recent trials . another point of discussion could be that intrathecal administration of a sustained released steroid circumvents the bbb and has a positive impact on the still continuing chronic inflammation process . the one thing common to all the recent examples we gave was that they had all been focused on progressive ms patients without signs of an acute exacerbation . the before - described great number of serious side effects could not be reproduced in the recent trials . there were some raised concerns about a possible neuronal cell injury promoting effect induced by the administered steroid , with inducing brain atrophy [ 10 , 22 , 44 ] . the additional serial assessment of potential unspecific cell injury markers , that is , nse or s-100 , in csf of progressive ms patients treated with repeated intrathecal tca did not provide evidence of such a steroid associated risk . particularly , the long half - life of the applied sustained released steroids appears to be the key of the missing proof of a toxic effect . further detailed trials with examination of selected csf biomarkers in ms patients treated with intrathecal steroids are necessary to illuminate these interesting aspects . in general , all of the mentioned historical and recent studies have to be classified just as class ii the ideal trial design would be a randomized , placebo - controlled , double - blind one . in this case , repeated performance of intrathecal placebo application under double - blind conditions with the consent of patients and the ethical committee seems not to be realistic . contrariwise , one could claim that due to the limited evidence for efficacy of intrathecal tca treatment , the only existing open - label , not placebo - controlled study with repeated lumbar punctures is unethical without level a evidence . from this point of view a multicenter clinical study has to be established to evaluate these items and to compare systemic and intrathecal steroid treatment , initially in progressive ms patients with predominantly spinal symptoms and afterwards in patients with an acute relapse . in addition to the investigation of the long- and short - term benefits , potential risks related to the intrathecal application have to be examined in a blinded analysis . furthermore , the potential efficacy of intrathecal tca treatment combined with mix in progressive ms has to be explored . anyhow , the intrathecal tca administration has to be taken into account as one therapy option in handpicked ms patients with a slow progressive clinical course with predominantly spinal symptom features . the intrathecal tca application should be offered by neurologists with a comprehensive experience in this special treatment . in fact , an individual risk - benefit analysis and the patient 's approval are required .

at the present time , anti - inflammatory , immunomodulatory , or immunosuppressive treatments of multiple sclerosis ( ms ) are mainly effective in the early phases of the disease but are of less advantage in progressive phases . current therapeutic strategies of both primary and secondary progressive ms are rare . one alternative may be intrathecal application of triamcinolone acetonide ( tca ) . number of papers deal with advantages and disadvantages of intrathecal administration in ms . former trials lacked detailed selection of ms patients , with small sample sizes , low steroid dosages , and only a small number of intrathecal administration of short acting steroids . the present paper summarizes recent trials performed following a different treatment regime . they were conducted in patients with progressive ms suffering mainly from spinal symptoms and documented a significant improvement of edss and walking distance ( wd ) . intrathecal tca administration is a proposal to take into account as one therapy option in patients with a progressive clinical course and predominantly spinal symptoms .

1. Introduction 2. Historical Experiences with Intrathecal Steroids in Multiple Sclerosis 3. Recent Trials with Intrathecal TCA Administration in Progressive Multiple Sclerosis 4. Conclusion

vitamin d deficiency has been classically associated with rickets in childhood and osteomalacia in adults . however , the vitamin d receptor is ubiquitous , and the study of the physiologic roles of vitamin d has revealed health consequences of poor vitamin d status that extend beyond the skeletal system . vitamin d has been found to have a potential role in autoimmune and inflammatory processes , and there is a growing literature that suggests that low vitamin d status may contribute to the development of insulin resistance , hypertension , and the metabolic syndrome ( ms ) [ 27 ] . evidence from randomized , placebo - controlled trials also suggests that vitamin d supplementation effectively reduces insulin resistance [ 8 , 9 ] . serum 25-hydroxyvitamin d3 , produced by the hydroxylation of vitamin d3 ( cholecalciferol ) in the liver , reflects body stores of vitamin d. over the past two decades , serum 25(oh)d concentrations have markedly decreased in the general us population . only 23% of children and adults were considered to be vitamin d sufficient ( serum 25(oh)d 30 mg / l ) according to national data from 2001 to 2004 , as compared to 45% in 19881994 . additionally , over the past 3 decades , the prevalence of childhood obesity has increased , and with that has come a parallel increase in obesity - related sequelae such as non - alcoholic fatty liver disease ( nafld ) [ 11 , 12 ] . nafld is the most common form of liver disease in the pediatric population , with a prevalence of 8.0% ( as defined by alt > 30 nafld is also more common among those with greater adiposity and elevated fasting insulin levels . with a rise in the number of overweight children and adolescents , it is important to consider the implications of poor vitamin d status on the development and progression of obesity and its comorbidities . given the increasing prevalence of hypovitaminosis d and the increasing prevalence of nafld , it is possible that there is an association between low - vitamin d status and nafld . to our knowledge , no previous study has examined the association between serum 25(oh)d concentrations and the presence of suggested nafld in a large , nationally representative sample of the us adolescent population . previous smaller studies have investigated the relationship between vitamin d status and nafld in children and adults with conflicting results [ 1416 ] . the purpose of this study was to utilize data from a national sample to investigate whether suspected nafld is independently associated with hypovitaminosis d in adolescents . data were examined regarding 1630 individuals aged 1219 years who participated in the national health and nutrition examination survey ( nhanes ) from 2001 to 2004 . nhanes is an ongoing series of cross - sectional surveys conducted by the national center for health statistics of the centers for disease control and prevention . data is collected from a nationally representative sample of the noninstitutionalized civilian population in the usa . during a home interview , participants provide information concerning family medical history , current medical conditions , medication use , and socioeconomic and demographic characteristics . additional data are collected from participants who are randomly assigned to visit mobile examination centers . approximately 5000 individuals are surveyed annually , and about half are children and adolescents . the details of the measurement and analysis of alt concentrations and serum 25-hydroxyvitamin d in nhanes have been previously described [ 7 , 12 ] . serum 25(oh)d reflects the vitamin d obtained from sunlight exposure as well as from dietary intake . the vitamin d status of subjects was categorized into quartiles of serum 25(oh ) d in those analyses where vitamin d was treated as a categorical variable : i ( 19 ng / ml ) , ii ( 19 ng / ml > serum(oh)d 25 ng / ml ) , iii ( 25 ng / ml > serum(oh)d 31 ng / ml ) , and iv ( > 31 ng / ml ) . other studies of the associations between hypovitaminosis d and cardiovascular disease risk factors have used similar but not identical values to assess vitamin d status ; however , there is no consensus for defining hypovitaminosis d [ 6 , 7 , 13 , 14 ] . additionally , there is currently no consensus on optimal concentrations of 25(oh ) d as measured in serum . adolescents with serum alt 30 u / l were classified as having suspected nafld in analyses where vitamin d was treated as a categorical variable . while the most accurate diagnosis of nafld requires a biopsy , other observational studies also use elevated concentrations of serum alanine aminotransferase as a surrogate marker for nafld [ 12 , 1517 ] . data regarding age , sex , race , bmi , waist circumference , and poverty level were also evaluated . subjects with an age- and gender - adjusted bmi > 5th percentile and < 85th percentile were classified as normal weight ; those with a bmi 85th but < 95th percentile were classified as overweight ; those with a bmi 95th percentile were classified as obese . age- and gender- specific waist circumference was categorized as < 90th or > 90th percentile . race / ethnicity was categorized as non - hispanic white , non - hispanic black , mexican american , or other ( including multiracial or other hispanics ) . the following exclusion criteria were applied to this sample : ( 1 ) positive for hepatitis b or hepatitis c , ( 2 ) pregnant , ( 3 ) adolescents who had not fasted for at least 6 hours , ( 4 ) type 1 diabetes ( defined as adolescents who were taking insulin ) , ( 5 ) type 2 diabetes , ( 6 ) bmi < 5th percentile , ( 7 ) taking hmg - coa reductase inhibitors or valproic acid , two common medications that may cause elevated alt as a side effect , and ( 8) adolescents with serum iron concentrations > 170 micrograms / dl . no information regarding the time of year in which the measurements of serum 25(oh)d or alt were collected was available for analysis in this study . when the serum 25(oh)d of subjects was categorized into quartiles , the prevalence of suspected nafld in adolescents was identified only by serum alt 30 . bivariate and multivariate analyses using sas ( version 8.2 ) and sudaan ( version 7.5 ) software were performed . in bivariate analyses both bmi and waist circumference status were included and independent t - tests were employed . multivariate analyses , included age , sex , race , adiposity ( as measured by bmi ) , and poverty status . all of the variables were included in the multivariate logistic regression analysis to determine independent associations with suspected nafld . the following multivariate models were employed : ( 1 ) age , gender , race / ethnicity , bmi , and poverty status , ( 2 ) age , gender , race / ethnicity , waist circumference , and poverty status , and ( 3 ) age , gender , race / ethnicity , and poverty status . for each of these models , we also used three different thresholds of alt to define suspected nafld , including alt 20 , alt 30 , and alt 40 . finally , we conducted an additional bivariate analysis treating both 25(oh)d and alt as continuous variables . when serum 25(oh)d was treated as a continuous variable , the prevalence of suspected nafld in adolescents was identified using three different thresholds of alt , including alt 20 , alt 30 , and alt 40 . bivariate and multivariate analyses were also conducted using sas ( version 8.2 ) and sudaan ( version 7.5 ) software to adjust for age , sex , race , adiposity ( as measured by bmi or waist circumference ) , and poverty status . all of the variables were included in multivariate logistic regression analyses to determine independent associations with nafld . furthermore , as a continuous variable , correlation of alt with serum 25(oh)d was examined . serum alt 30 u / l was most prevalent in subjects with the poorest 25(oh)d status . in the bivariate analyses , suspected nafld was identified in 12.31% of adolescents in the lowest quartile of serum 25(oh)d compared to 6.91% in the second quartile , 6.81% of adolescent in the third quartile , and 7.14% of adolescents in the fourth quartile ( p = .05 , table 1 ) . additionally , male adolescents were more likely to have suspected nafld than females ( males have a 13.70% of elevated alt , while for females , it is only 2.66% ; p < .001 ) . suspected nafld rates increased with higher bmi : for normal - weight adolescents , the prevalence of suspected nafld was 3.25 , while for overweight adolescents , the prevalence was 9.03% and 25.76% for obese adolescents . the prevalence of suspected nafld varied by race / ethnicity with 11.63% for mexican americans and 6.01% for non - hispanic blacks additionally , bmi status was taken out of the multivariate analyses investigating the independent association between serum 25(oh)d and suspected nafld controlling for age , gender , race , and poverty status and it was found that individuals with the lowest quartile of 25(oh)d levels had significantly higher rates of suspected nafld compared to those in the fourth quartile ( first quartile versus fourth quartile : or : 2.44 , 95% ci : 1.095.48 ) . however , no significant association was found for those in the second versus those in the fourth quartile ( or = 0.82 , 95% ci : 0.322.06 ) or those the in third versus those in the fourth quartile ( or = 0.83 , 95% ci : 0.321.89 ) . adjusted odds ratios ( aor ) and 95% confidence intervals from multivariate analyses for the risk of suspected nafld are shown in table 2 . gender and bmi were both significantly independently associated with suspected nafld ( p < .05 ) . adolescent males were 6.25 times more likely than females to have suspected nafld ( 95% ci 3.5910.92 ) . obese adolescents were 11.57 times more likely to have suspected nafld ( 95% ci 5.9322.60 ) when compared to normal - weight adolescents . in contrast , serum 25(oh)d was not independently associated with suspected nafld in the multivariate model . in bivariate analyses treating vitamin d as a continuous variable , a lower mean value of serum 25(oh)d was observed in subjects with alt 30 as compared to those with an alt < 30 . mean vitamin d was lower still among those with an alt 40 when compared to those with alt < 40 . in contrast , there was no difference in mean vitamin d level when individuals with alt levels below 20 were compared to those with alt levels 20 ( table 3 ) . when both alt and vitamin d status were used as continuous , we found that with one unit of vitamin d increasing , there is likely 0.059 unit of alt decreasing ( p = .045 ) . in bivariate analyses , waist circumference > 90th percentile was significantly associated ( p < .001 ) with suspected nafld at all thresholds ( alt 20 , 30 and 40 ) not shown . analyses were conducted to investigate potential interactions between obesity and serum 25(oh)d and their relationship alt 30 . it was found that only obese adolescents , irrespective of vitamin d status , were at increased risk for elevated alt ( data not shown ) . also not shown in tables are the following results treating vitamin d as a continuous variable in the multivariate models described in the methods section . vitamin d was not independently associated with suspected nafld in the multivariate analyses that included either bmi or waist circumference . when the multivariate models did not include either bmi or waist circumference variables , serum 25(oh)d levels were , however , significantly associated with suspected nafld as defined by alt 30 ( or : 0.96 ; 95% ci : 0.920.99 ) and alt 40 ( or : 0.93 ; 95% ci : 0.880.99 ) . the findings of this study demonstrate that while serum 25(oh)d was inversely associated with alt , this association was abolished by adjusting for obesity as a confounding factor . thus , these findings do not indicate an independent association between vitamin d status and suspected nafld , as suggested by alt level . this is true when vitamin d status was assessed both categorically and as a continuous variable . it is well known that adolescents with obesity and its comorbidities are at increased risk for developing nafld and that increased bmi is a significant independent predictor of hypovitaminosis d . low concentrations of serum 25(oh)d found in overweight and obese adolescents may reflect an inadequate diet or a more sedentary lifestyle with less time spent outdoors , resulting in less sunlight exposure [ 10 , 17 , 18 ] . it also is possible that lower serum 25(oh)d levels in heavier individuals reflect the sequestration of vitamin d in adipose tissue . other predictors of hypovitaminosis d in adolescents may include ethnicity , season , latitude , and milk and juice consumption [ 17 , 20 ] . in the statistical models treating serum 25(oh)d as a categorical variable , obesity and male gender were found to be independently associated with suspected nafld ; lower levels of 25(oh)d were not found to be independently associated with nafld after adjusting for confounding variables including age , sex , race , bmi , and poverty level . these results were confirmed by treating 25(oh)d as a continuous variable and assessing for three different levels of alt , that is , 20 , 30 , and 40 u / l , as potential measures of nafld . the method of measuring adiposity ( bmi or waist circumference > 90th percentile ) did not affect the results of these multivariate analyses . hypovitaminosis d was , however , independently associated with suspected nafld in the only multivariate model that did not include either bmi or waist circumference . considering that adiposity is well documented as contributing to the risk of developing nafld , these results suggest that it is obesity , rather than vitamin d status , that is in fact independently associated with nafld . there is currently a paucity of studies investigating the relationship between vitamin d status and nafld in adolescents . the findings reported here are consistent with another study by ashraf et al . . those authors found no significant differences in alt or aspartate aminotransferase ( ast ) when comparing adolescents with or without adequate concentrations of serum 25(oh)d . adequate serum 25(oh)d was defined as a concentration greater than 15 ng / ml . however , the study by ashraf et al . was limited to 51 african american female adolescents who were obese . the current study includes a larger , nationally representative sample of adolescents that more accurately reflect the usa population . in contrast , a study by targher et al . found , for the first time , that adults with biopsy - proven nafld had higher rates of hypovitaminosis d than matched control subjects . observed an inverse relationship between serum 25(oh)d and biopsy - determined diagnoses of nafld , independent of insulin sensitivity and the metabolic syndrome . however , that study involved a small sample of only 60 adults and these results may not be applicable to adolescents because adults may accumulate a number of other insults to the liver over their lifespans . in the pediatric population , another small study also identified lower concentrations of serum 25(oh)d in children with biopsy - proven nonalcoholic liver disease . it also is possible that 25-hydroxylation of vitamin d may be reduced when there is preexisting liver damage , rather than that low vitamin d levels lead to liver disease . racial and ethnic differences in rates of nafld have been documented for some time in the usa [ 13 , 21 , 22 ] . elevated alt concentrations are more common in hispanic adolescents [ 23 , 24 ] . in contrast , non - hispanic black adolescents have a lower prevalence of nafld . during 19992004 , rates of elevated alt concentrations ( > 30 u / l ) were 11.5% among mexican american adolescents , 6.0% among black adolescents , and 7.4% among white adolescents . the mechanisms underlying these differences are not known , although non - hispanic black adolescents have less intraperitoneal fat and less lower extremity fat compared to whites and hispanics , and intraperitoneal fat has been identified as a potential risk for liver damage at a young age [ 13 , 25 ] . these data come from cross - sectional analyses and thus have substantial limitations for drawing causal inferences . a definitive diagnosis of nafld requires a liver biopsy which is not feasible in large - scale epidemiological studies . alt is a widely accepted biomarker for liver fat accumulation ; however , it is neither as specific nor as sensitive as biopsy . there is no consensus regarding a standard threshold for elevated alt , although previous values used in the literature range from 20 to 40 u / l [ 13 , 26 ] . future studies may explore the correlation of vitamin d and liver pathology using ultrasonography , as it is a valuable non - invasive method of screening for liver disease [ 27 , 28 ] . it also is well recognized that season exerts major influences on cutaneous vitamin d3 production . photosynthesis of vitamin d is higher with more exposure to uvb sunlight . of note , a recent study of adults found higher levels of most liver function tests in the winter , suggesting that seasonal variation be taken into consideration when establishing either reference intervals or cut - off values , especially regarding aminotransferases . also , no data were available regarding alcohol consumption in this sample . future studies of adolescent nafld should consider utilizing alcohol consumption as an exclusion criterion . oral contraceptives use has been associated with higher serum 25(oh)d and also may be deserving of investigation in future studies . this study , like others before it , indicates that overweight and obese adolescents are much more likely than normal - weight adolescents to have elevated serum alt , a surrogate biomarker for nafld . it is unclear whether poor vitamin d status contributes directly to the risk of developing nafld , or if this association is overwhelmingly confounded by obesity . this study examined the relationship between hypovitaminosis d and suspected nafld and did not find that low - vitamin d status is an independent predictor of nafld . it is important for clinicians to identify and treat children with obesity and its comorbidities as early as possible . in a prospective study , forouhi et al . demonstrated that low - vitamin d status is a predictor of future hyperglycemia and insulin resistance . previous work has also found that insulin sensitivity improves after vitamin d supplementation [ 8 , 9 ] . therefore , further research is needed to determine if vitamin d supplementation might be effective in preventing or treating nafld in obese adolescents .

this study investigated a potential independent association between hypovitaminosis d and suspected nonalcoholic fatty liver disease ( nafld ) in a nationally representative sample of the us adolescents . data from 1630 subjects 1219 years of age were examined using the national health and nutrition examination survey , 20012004 . the vitamin d status of subjects was categorized into quartiles of serum 25-hydroxyvitamin d. subjects with serum alt > 30 u / l were classified as having suspected nafld . data regarding age , sex , race , bmi , and poverty level were also analyzed in bivariate and multivariate analyses using sas and sudaan software . suspected nafld was identified in 12.1% of adolescents in the lowest quartile compared to 6.9% of adolescents in the second quartile , 8.0% in the third quartile , and 13.17% in the highest quartile of serum 25(oh)d concentrations ( p = .05 ) . in analyses utilizing vitamin d as a continuous variable , no independent association was found between vitamin d levels and rates of elevated alt levels . in multivariate analyses , higher risks for suspected nafld were observed in males and overweight adolescents ; however , vitamin d status was not found to be independently associated with suspected nafld after adjusting for obesity .

1. Introduction 2. Methods 3. Statistical Analyses 4. Results 5. Discussion 6. Conclusions

in terms of fractures , osteoporosis is one of the leading health problems in the western world according to the world health organization and is a growing problem due to the aging population [ 1 , 2 ] . however , in terms of bone mineral density ( bmd ) t - score less than 2.5 , osteoporosis is only one of the many risk factors for fractures . a prior fracture is yet another well - known risk factor for a subsequent fracture , independent of bmd . the risk of a subsequent fracture is doubled in the presence of a prior fracture ( pooled relative risk [ rr ] , 2.0 ) . however , several studies have shown that the risk of subsequent fracture is not constant , but fluctuates over time , being highest immediately after the initial fracture [ 4 , 5 , 68 ] . one of the earliest studies on the timing between first and subsequent fractures focused on men and women who had been hospitalized because of a clinical vertebral fracture and in whom the risk of all subsequent fractures was highest within the first year . lindsay et al . found that within 1 year after an incident radiographic vertebral fracture , 20% of patients had a new radiographic vertebral fracture . these observations had a growing impact on further research on timing of subsequent fractures in relation to a first fracture , and focused on all fractures or specific initial or subsequent fracture locations . if subsequent fractures cluster in time , this has as a clinical consequence the need for immediate attention for fracture patients to decrease the risk of subsequent fracture . furthermore , if fractures cluster in time , algorithms for case findings should take into account the variable risk of subsequent fracture over time . however , the time relation between fractures has been reported in several ways in terms of rr , absolute risk ( ar ) , as percentages of all subsequent fractures that occurred over short - and long - term follow - up , and as survival or cumulative curves . first and subsequent fractures were studied at variable fracture locations ( vertebral , nonvertebral , major , minor , and hip fractures ) . we reviewed these aspects in the literature on studies that reported the time relation between fractures and , as far as reported , review the rr , ar , and percent of subsequent fractures according to baseline and subsequent fracture location . morphometric vertebral fractures are the most frequent osteoporosis - related fractures , but only around one - third come to clinical attention with the classical signs and symptoms of an acute fracture . therefore , studies on vertebral fractures differ in including only clinical vertebral fractures or in systematic performance of radiographs of the thoracic and lumbar spine . it was performed by analyzing placebo - treated patients ( n = 2,725 ) pooled from several fracture studies with risedronate . these women had prevalent vertebral fractures [ 9 , 10 ] , low femoral neck bmd , or risk factors for hip fracture . women with serum 25-hydroxyvitamin d levels of less than 16 ng / ml ( 40 nmol / l ) at baseline also received vitamin d supplementation ( up to 500 iu / d ) . in this study , the 1-year incidence of radiographic vertebral fractures could be analyzed in three groups of patients : 1 ) patients without a prevalent fracture ; 2 ) patients with a prevalent radiographic vertebral fracture before the start of the follow - up , and of which the timing of the previous radiographic vertebral fracture was unknown ; and 3)patients who developed a new radiographic vertebral fracture during the study and who were followed yearly for the development of subsequent radiographic vertebral fractures . the cumulative incidence of new radiographic vertebral fractures in the first year of the study follow - up ( ie , the ar for new radiographic vertebral fractures in patients with and without previous radiographic vertebral fracture of unknown timing ) was 6.6% in the total group ( fig . 1 ) . 1one - year absolute risk ( ar ) for repeat radiographic vertebral fractures ( vfs ) one - year absolute risk ( ar ) for repeat radiographic vertebral fractures ( vfs ) in patients with of one or more radiographic vertebral fractures at baseline , in whom the timing of fractures was unknown , the risk of sustaining a radiographic vertebral fracture increased by fivefold during the initial year of the study compared with the incidence in subjects without prevalent radiographic vertebral fractures at baseline ( rr , 5.1 ; 95% ci , 3.18.4 ; p < 0.001 ) . the 1-year ar for a first radiographic vertebral fracture was 1.9% , 4.6% in the presence of one vertebral fracture of unknown radiographic vertebral fracture and 9.9% and 12.5% in the presence of more than one or two radiographic vertebral fractures of unknown timing at baseline , respectively . among the 381 participants who developed an incident radiographic vertebral fracture during the study follow - up , the incidence of a new radiographic vertebral fracture in the subsequent year was 19.2% ( 95% ci , 13.624.8 ) . in summary , this study indicated that the 1year ar for subsequent radiographic vertebral fractures is 1.9% for a first radiographic vertebral fracture , 4.6% in the presence of a radiographic vertebral fracture of unknown timing , and 19.2% within 1 year after a radiographic vertebral fracture had occurred . this study clearly showed that the risk of repeat radiographic vertebral fractures is highest during the first year after a radiographic vertebral fracture . a study focused on the magnitude and time course of the increase in risk of further fractures during a mean follow - up of 2.4 years ( maximum , 8 years ) in patients who were hospitalized for vertebral fracture ( n = 28,869 ) . it has been shown that there was a marked increase in subsequent incidence of hip and all fractures within the first year following hospitalization for vertebral fracture in both men and women . the increase in fracture risk was more marked following low - energy vertebral fracture than following high - energy trauma . the rr for an incident fracture ( compared with the general population ) was at any age higher at 6 months ( 3.948.7 , according to age ) than at 4 years ( 1.415.2 , according to age ) , was higher in men ( 5.648.7 , according to age ) than in women ( 3.932.0 , according to age ) , and was higher in younger than in older patients ( fig . 2 ) . the ar , expressed as the incidence of all subsequent fractures , was higher at 6 months ( 7.8% to 21.5% , according to age ) than at 4 years ( 1.9% to 10.2% , according to age ) and higher in women ( 8.0% to 21.5% , according to age ) than in men ( 7.8% to 16.0% , according to age ) . the timing of the percentage of fracture according to time of follow - up was not mentioned . 2risk ratio and absolute risk of subsequent fracture risk ratio and absolute risk of subsequent fracture it was performed by analyzing placebo - treated patients ( n = 2,725 ) pooled from several fracture studies with risedronate . these women had prevalent vertebral fractures [ 9 , 10 ] , low femoral neck bmd , or risk factors for hip fracture . women with serum 25-hydroxyvitamin d levels of less than 16 ng / ml ( 40 nmol / l ) at baseline also received vitamin d supplementation ( up to 500 iu / d ) . in this study , the 1-year incidence of radiographic vertebral fractures could be analyzed in three groups of patients : 1 ) patients without a prevalent fracture ; 2 ) patients with a prevalent radiographic vertebral fracture before the start of the follow - up , and of which the timing of the previous radiographic vertebral fracture was unknown ; and 3)patients who developed a new radiographic vertebral fracture during the study and who were followed yearly for the development of subsequent radiographic vertebral fractures . the cumulative incidence of new radiographic vertebral fractures in the first year of the study follow - up ( ie , the ar for new radiographic vertebral fractures in patients with and without previous radiographic vertebral fracture of unknown timing ) was 6.6% in the total group ( fig . 1 ) . 1one - year absolute risk ( ar ) for repeat radiographic vertebral fractures ( vfs ) one - year absolute risk ( ar ) for repeat radiographic vertebral fractures ( vfs ) in patients with of one or more radiographic vertebral fractures at baseline , in whom the timing of fractures was unknown , the risk of sustaining a radiographic vertebral fracture increased by fivefold during the initial year of the study compared with the incidence in subjects without prevalent radiographic vertebral fractures at baseline ( rr , 5.1 ; 95% ci , 3.18.4 ; p < 0.001 ) . the 1-year ar for a first radiographic vertebral fracture was 1.9% , 4.6% in the presence of one vertebral fracture of unknown radiographic vertebral fracture and 9.9% and 12.5% in the presence of more than one or two radiographic vertebral fractures of unknown timing at baseline , respectively . among the 381 participants who developed an incident radiographic vertebral fracture during the study follow - up , the incidence of a new radiographic vertebral fracture in the subsequent year was 19.2% ( 95% ci , 13.624.8 ) . in summary , this study indicated that the 1year ar for subsequent radiographic vertebral fractures is 1.9% for a first radiographic vertebral fracture , 4.6% in the presence of a radiographic vertebral fracture of unknown timing , and 19.2% within 1 year after a radiographic vertebral fracture had occurred . this study clearly showed that the risk of repeat radiographic vertebral fractures is highest during the first year after a radiographic vertebral fracture . a study focused on the magnitude and time course of the increase in risk of further fractures during a mean follow - up of 2.4 years ( maximum , 8 years ) in patients who were hospitalized for vertebral fracture ( n = 28,869 ) . it has been shown that there was a marked increase in subsequent incidence of hip and all fractures within the first year following hospitalization for vertebral fracture in both men and women . the increase in fracture risk was more marked following low - energy vertebral fracture than following high - energy trauma . the rr for an incident fracture ( compared with the general population ) was at any age higher at 6 months ( 3.948.7 , according to age ) than at 4 years ( 1.415.2 , according to age ) , was higher in men ( 5.648.7 , according to age ) than in women ( 3.932.0 , according to age ) , and was higher in younger than in older patients ( fig . 2 ) . the ar , expressed as the incidence of all subsequent fractures , was higher at 6 months ( 7.8% to 21.5% , according to age ) than at 4 years ( 1.9% to 10.2% , according to age ) and higher in women ( 8.0% to 21.5% , according to age ) than in men ( 7.8% to 16.0% , according to age ) . the timing of the percentage of fracture according to time of follow - up was not mentioned . 2risk ratio and absolute risk of subsequent fracture risk ratio and absolute risk of subsequent fracture a total of 799 patients were followed during a mean follow - up of 22 years after their initial hip fracture . after the initial hip fracture , 27% of all subsequent fractures ( mean number of subsequent fractures per patient : 2.3 , range 111 fractures / patient ) occurred within 2 years and 73% within 5 years . the ar over 22 years was 45% in the total group and 86% in survivors . this indicates that the 2-year ar was about 12% in the total group and about 23% in survivors , and that the 5-year ar was 33% and 63% , respectively . a study in elderly living in a nursing home ( n = 184 ) showed the same trend . the ar of the subsequent fractures was 12% within 1 year and 21% within 5 years , indicating that more than half of subsequent fractures during 5-year follow - up occurred within 1 year after a hip fracture . in a study that included more than 170,000 men and women with an initial hip fracture , almost 28,000 patients sustained a subsequent hip fracture during 25-year follow - up ( mean follow - up , 3.8 years ) . after a first hip fracture , the cumulative incidence of subsequent hip fracture was 9% within 1 year and 20% within 5 years , compared with 2% and 12% , respectively , in subjects without a hip fracture . thus , nearly half of all subsequent hip fractures during 5-year follow - up occurred within 1 year . the rr for a second hip fracture was 11.8 at 1 month , decreasing exponentially to 3.0 at 6 months and 2.2 at 1 year , and did not normalize until after 15 years [ 14 ] . risk factors for a second hip fracture were female sex , age , alcoholism , any prior fracture , living alone , and having a higher income [ 14 ] . in addition , almost all fractures after the initial hip fracture were caused by low - energy traumatic accidents ( eg , fall from standing height or less , fall from a chair , or fall out of bed ) [ 12 , 13 , 14 , 15 , 16 ] . one study focused on the risk of hip , forearm , clinical vertebral , or shoulder fractures in women and men between 60 and 80 years of age from the time they had a hip , clinical vertebral , or shoulder fracture in both outpatients and hospitalized patients . of all subsequent hip , clinical vertebral , forearm , or shoulder fractures during a follow - up of 5 years , 34% occurred within the first year after the initial fracture ( range , 31% to 45% ) and progressively decreased to 9% during the 5th year ( fig . 3percentage of subsequent fractures during a 5-year follow - up period percentage of subsequent fractures during a 5-year follow - up period we published a population - based study focusing on all clinical fractures ( including high - energy or low - energy trauma fractures ) in postmenopausal women [ 5 ] . during a follow - up of 20 years ( mean , 9 years ) , 23% of all subsequent fractures were sustained within 1 year after the initial fracture and 54% within 5 years . after 15 years , the subsequent fracture risk was no longer higher than the initial fracture risk [ 5 ] . in the dubbo osteoporosis epidemiology study in australia , in community - dwelling men and women older than 60 years of age , the ar of subsequent low - energy trauma fracture was similar for men and women [ 4 ] . about 41% of the subsequent fractures in women and 52% in men occurred within 2 years after the initial fracture during a follow - up of 16 years . however , with the expected increase in initial fracture risk with age , the excess risk decreased over time from initial fracture ( p = 0.003 and p = 0.001 for women and men , respectively ) . after 10 years of follow - up , the subsequent absolute fracture risk was no longer elevated compared with the risk of a first fracture . in a retrospective study , the time relation between fractures was studied between the time of prior fracture ( n > 8,000 ) and the time a bmd measurement was performed , and the risk of subsequent fracture ( n > 1,700 ) during a follow - up for a maximum of 10 years after the index bmd measurement . the rr after major fractures was 1.9 ( 95% ci , 1.62.3 ) after the bmd measurement in patients who had a fracture history less than 1 year before the bmd measurement , decreasing toward 1.6 ( 95% ci , 1.32.1 ) if the previous fracture had occurred more than 10 years ago ( p < 0.001 for trend ) . after minor fractures , the rr was 1.49 ( 95% ci , 1.11.9 ) and 1.1 ( 95% ci , 0.81.5 ) , respectively . however , this study did not report the exact timing between fractures , as the timing from bmd measurement and subsequent fracture was not reported . in view of the large database in that study , more detailed analysis of the time relation between fractures the etiology of clustering of fractures needs further investigation in terms of bone - related risk factors ( eg , cortical and trabecular bone loss due to immobility ) , fall - related risk factors ( eg , immobility , postural instability , muscle strength , plastering , use of walking device),and post - fracture care for morbidity ( eg , locomotor revalidation after lower limb fractures ) . the clustering of fractures in time indicates the need for immediate attention in both men and women who sustain a first fracture to prevent the occurrence of a subsequent fracture . the high increase of subsequent fractures immediately after a first fracture creates a window of opportunity to prevent subsequent fractures . however , no studies are available on fracture prevention immediately after a fracture . such studies will be needed in view of the immediate burden of subsequent fractures in patients with a first fracture , who can easily be identified clinically . in addition , when treatment with osteoporosis medication is considered , such treatment should be chosen on the basis of proven short - term efficacy in the reduction of vertebral and nonvertebral fractures . how far additional fall prevention strategies would further decrease subsequent fracture risk is unknown and is a field for further clinical research .

a prior fracture is a well - documented risk factor for a subsequent fracture and it doubles the risk of subsequent fractures . few studies have investigated the time that elapses between the initial and subsequent fracture . these studies show that the subsequent fracture risk is not constant , but fluctuates over time . the risk of subsequent vertebral , hip , and nonvertebral non - hip fractures is highest immediately after initial hip , clinical , and radiographic vertebral fractures and nonvertebral fractures and declines afterward , regardless of gender , age , and initial fracture location . these studies indicate the need for early action after an initial fracture with medical interventions that have an effect within a short term to reduce the preventable risks of subsequent fractures .

Introduction Clustering in Time of Fractures after a Vertebral Fracture Repeat Morphometric Vertebral Fractures Fractures after Clinical Vertebral Fractures Clustering in Time of Fractures after a Hip Fracture Clustering in Time after Clinical Fractures Conclusions

the university of pittsburgh medical center ( upmc ) operates 20 hospitals throughout western pennsylvania . when a patient passes away , the decedent requires extensive paperwork , transportation , and , occasionally , an autopsy . the pathology department is often involved in managing these cases , including performing all medical autopsies that come from outside institutions . beyond managing the paperwork , the staff deals with multiple departments ( medical records , security , and nursing staff ) within multiple hospitals ; this further complicates tracking . within upmc , many other areas of pathology have improved their efficiency by utilizing tools such as the lean process and technological advances . for example , surgical pathology cases are routinely tracked as to their status in the workflow , including stages of grossing , histology processing , and the ordering of special studies . prior to 2004 , the autopsy service lacked any digital applications to manage deaths and the subset of decedents requiring autopsies . when the morgue received a decedent , notifying and mobilizing the appropriate residents , staff , and personnel delayed autopsies . clarifying autopsy authorizations and limitations required additional time , and identifying the clinical staff involved in a case was cumbersome . we computerized and streamlined these processes in an effort to improve our efficiency , monitor documentation , prevent transportation and storage issues , and to assess the value of incorporating new technology into the administrative tasks associated with decedents and autopsies . the information services department developed upmc remains tracker to track decedents location , documentation , and autopsy status , using the input from various departments including nursing , security , pathology , and medical records . development required the expertise of a senior software architect / engineer , a senior analyst , and representative personnel from nursing , security , and pathology . net ( c sharp ) with an microsoft sql server 2008 database back end ( microsoft corporation one microsoft way redmond , wa 98052 - 63993 ) . the website and database are housed on internal servers and each has a failover server in the event of a primary web or database server failure . upmc remains tracker allows a search of the enterprise patient database to assist with data entry and lookup of the enterprise master patient index ( empi ) for entry of multiple remains under a single patient that is used to link fetal remains ( still births , iufd and terminations ) to a patient . due to the frequent receipt of remains from outside ( non - upmc ) facilities , the system can also function independently of the epatient system to allow manual entry of all information . the application is kept secure by limiting access through the hospital 's intranet and virtual private network through the secure site when accessed off - site . all access to the system is managed through the identity management system ( ims ) . individual users are required to create application specific passwords in addition to their intranet passwords . the role of each user is defined , limiting access to parts of the applications based on roles . upmc remains tracker is not linked to the laboratory information system and is used solely for tracking the status of a decedent , not for entry of autopsy findings or pathologic diagnoses . the diagram demonstrates the relationships and dependencies within the application database design of the core entities . the design provides for workflow flexibility at multiple facilities through switches and facility - specific setup , sharing of common entities such as coroner offices and funeral homes , and a consolidated repository of remains data for the organization while tracking the movement of remains within a facility , throughout the organization and their final release to an outside entity nursing , security , and pathology personnel required training to facilitate the deployment of upmc remains tracker . nurses , security staff , and transport personnel were trained differently depending on the facility . the application was initially deployed at upmc magee women 's hospital from 2004 to 2009 . it was later deployed to the two hospitals with the highest average census and largest autopsy volume . subsequently , smaller regional hospitals deployed the application once the larger institutions were using the application successfully . cases were flagged if the time between death and nursing completing their module was greater than 5 hours or the time of nursing module completion was within 15 minutes of the time of the release of remains from the morgue . the audit trail of these cases was analyzed to assess the likelihood that the nursing unit had released a body to transport staff without completing the nursing module and needed to be contacted to do so . the information services department developed upmc remains tracker to track decedents location , documentation , and autopsy status , using the input from various departments including nursing , security , pathology , and medical records . development required the expertise of a senior software architect / engineer , a senior analyst , and representative personnel from nursing , security , and pathology . net ( c sharp ) with an microsoft sql server 2008 database back end ( microsoft corporation one microsoft way redmond , wa 98052 - 63993 ) . the website and database are housed on internal servers and each has a failover server in the event of a primary web or database server failure . upmc remains tracker allows a search of the enterprise patient database to assist with data entry and lookup of the enterprise master patient index ( empi ) for entry of multiple remains under a single patient that is used to link fetal remains ( still births , iufd and terminations ) to a patient . due to the frequent receipt of remains from outside ( non - upmc ) facilities , the system can also function independently of the epatient system to allow manual entry of all information . the application is kept secure by limiting access through the hospital 's intranet and virtual private network through the secure site when accessed off - site . all access to the system is managed through the identity management system ( ims ) . individual users are required to create application specific passwords in addition to their intranet passwords . the role of each user is defined , limiting access to parts of the applications based on roles . upmc remains tracker is not linked to the laboratory information system and is used solely for tracking the status of a decedent , not for entry of autopsy findings or pathologic diagnoses . the diagram demonstrates the relationships and dependencies within the application database design of the core entities . the design provides for workflow flexibility at multiple facilities through switches and facility - specific setup , sharing of common entities such as coroner offices and funeral homes , and a consolidated repository of remains data for the organization while tracking the movement of remains within a facility , throughout the organization and their final release to an outside entity nursing , security , and pathology personnel required training to facilitate the deployment of upmc remains tracker . nurses , security staff , and transport personnel were trained differently depending on the facility . the application was initially deployed at upmc magee women 's hospital from 2004 to 2009 . it was later deployed to the two hospitals with the highest average census and largest autopsy volume . subsequently , smaller regional hospitals deployed the application once the larger institutions were using the application successfully . cases were flagged if the time between death and nursing completing their module was greater than 5 hours or the time of nursing module completion was within 15 minutes of the time of the release of remains from the morgue . the audit trail of these cases was analyzed to assess the likelihood that the nursing unit had released a body to transport staff without completing the nursing module and needed to be contacted to do so . upmc remains tracker provided real - time access for all involved parties in managing patient deaths and autopsies . patients who pass away in participating hospitals were entered into the system and tracked from their location . nursing staff enter information related to paperwork completion , patient identifiers , times of completion , and individuals or organizations who have been contacted related to processing the death [ video 1 ] . during the process of decedent transport once the decedent is transported to the morgue , the entry is moved into the remains in morgue category and the status is updated to either release to funeral home pending or the autopsy team then enters additional information about the funeral home , autopsy start time , autopsy end time , whether the decedent is available for transport , and any additional comments . decedents who arrive for an autopsy from non - participating institutions are manually entered into the system upon receipt in the morgue . the diagram depicts the workflow for upmc remains tracker from the initial input of patient demographics by the nursing staff to the completed status of an autopsy . if an autopsy is not performed , these fields are not completed and the decedent is released to the funeral home . the ongoing tracking of a decedent 's status allows staff to remotely investigate the location and availability of a decedent screen captures of upmc remains tracker autopsy module . the screen captures depict the modules within upmc remains tracker where autopsy staff initially enter ( a ) and complete ( b ) relevant information relating to the commencement and completion of the autopsy the initial deployment of upmc remains tracker facilitated the tracking of 1088 remains from 2004 to 2009 at magee women 's hospital . from the implementation of the enterprise version in april 2009 to february 2011 a formal survey of pathology residents use of upmc remains tracker was answered by 19 of 27 residents . of these 19 residents , 9 did not use the old system and 10 used the old and the upmc remains tracker systems . in addition , all of the residents using upmc remains tracker rated the application as useful or very useful . all of the residents who had experience with the previous system felt upmc remains tracker improved their ability to identify pending cases . the survey of the house staff identified 10 cases over a 1-year period in which decedents appeared in the morgue without documentation in upmc remains tracker as autopsy pending . we did not have documentation of this rate in the previous system . in 7 of the 10 cases , the decedents were from institutions without upmc remains tracker and were logged in upon arrival . three of the 10 cases demonstrated non - compliance in proper upmc remains tracker documentation . these cases of non - compliance were due to untrained transport personnel neglecting to log the decedents and nursing staff failing to finalize their modules . evaluation of nursing compliance showed 93% compliance among the 100 most recent decedents and 90% compliance among the 100 most recent cases requiring autopsies . among all the decedents , two cases demonstrated non - compliance with an excessive delay in completing the nursing component and less than 5 minutes between nursing completion and security releasing the remains . five cases suggested non - compliance , evidenced by the nursing module being completed abnormally late . among the 100 cases requiring autopsies , 3 demonstrated non - compliance with an excessive delay in completing the nursing component and less than 5 minutes between nursing completion and security releasing the remains . seven cases suggested non - compliance with excessively late completion of the nursing module and chronological proximity to morgue receipt or commencement of the autopsy . the autopsy - related cases with compliance issues were divided between nine adult cases and eight fetal cases . of the 17 autopsy - related cases , 7 demonstrated a longer than usual delay in completion of paperwork without other evidence of non - compliance . the return on investment was not quantified as the return was based on improved patient care and savings in time with improved correspondence and real - time knowledge of decedent statuses . assessment of the nursing staff 's perception and acceptance of the application and savings in time and effort was based on casual discussions . the nursing staff voiced satisfaction with a reduction in phone calls , emails , correspondence , and ability to prepare work schedules based on knowledge received from the system . they also felt the application was user - friendly and requested that upmc remains tracker be implemented throughout the upmc system . the use of upmc remains tracker for tracking events surrounding the autopsy process resulted in consolidation of patient tracking and improved access to decedent information [ figure 4 ] . upmc remains tracker improved the ability to ascertain which remains required an autopsy and which remains could be directly released to funeral directors . ( a ) the initial workflow shows the cumbersome and inefficient previous approach to identifying cases requiring an autopsy . cases required access to paper records , contacting multiple personnel via telephone , poor monitoring of possible autopsy candidates . ( b ) the new structure of identifying cases is encompassed and addresses by upmc remains tracker , thus facilitating more efficient and convenient access to pending cases by involving the nursing staff , security , and autopsy personnel , the application allowed immediate monitoring of the location and status of decedents . by allowing real - time access to the whereabouts and status of decedents , a wide range of staff gained confidence in accessing the status of decedents and were able to schedule staffing . pathology residents could quickly identify clinical staff and security involved in the cases to clarify information . in addition , the autopsy service uses a 2 p.m. cut - off for starting autopsies , and upmc remains tracker provided useful documentation of the time of receipt of remains . these functions were perceived as marked improvements from the previous paper and telephone - based system . upmc remains tracker also allowed the security personnel to monitor decedents locations and mitigate security risks until the remains were released to funeral homes . the implementation of any new clinical application is daunted by the challenge of user - acceptance and compliance . in this case , the pathology staff eagerly adopted the application . security staff were pleased that the application allowed them to quickly document receipt of remains . although a formal survey was not completed , casual discussions and requests for further implementation support their satisfaction . the majority of nursing documentation is now performed electronically , and nursing reported entering data in upmc remains tracker easier to navigate than the previous forms , the application easy to use , and the interface with the epatient system useful . it was not performed proactively , however , the retrospective evaluation demonstrated a high degree of compliance . the 93% overall compliance rate is a testament to the usability and convenience of the application and the replacement of the previous method . the cases of non - compliance suggest that the clinical staff still have leeway in their timeliness of completing their modules . on busy units , the nursing staff may release the body to transport staff and then subsequently complete the paperwork as time allows . this creates an opportunity for decedents to arrive in the morgue without completion of the modules . it would be ideal to require that all paperwork be complete prior to the remains being transported . unfortunately , nurses need flexibility to complete the paperwork as their responsibilities to the other patients may hamper the immediate completion of decedent paperwork . they likely represent training issues or lapses due to time constraints on the nursing units . fortunately , upmc remains tracker allowed rapid identification of the involved staff and helped facilitate rapid completion of paperwork in these rare cases when a nursing unit must be contacted . the process is complicated by the large number of involved staff , types of paperwork , transient locations of decedents , and inconsistent autopsy requests . implementing upmc remains tracker improved these processes , and developing a central application for inputting decedent data led to useful gains in the tracking , management , and accuracy of the process . while other divisions , including cytopathology , have begun to extensively involve technology in their workflows , incorporating technology into issues surrounding the medical autopsy has been less pronounced . upmc remains tracker demonstrates that the process of identifying decedents and tracking them and their paperwork can benefit from computerization and improve efficiency surrounding managing decedents and the events surrounding autopsies as well as improve interdepartmental communication .

all hospitals deal with patient deaths . multiple departments and personnel must be coordinated to ensure that decedents are safely managed . prior to 2004 , at the university of pittsburgh medical center ( upmc ) , when a patient passed away , the process of alerting involved personnel , transporting the decedent , and tracking the completion of clinical documents was cumbersome and inefficient . in order to address these concerns , upmc remains tracker , a web - based application , was developed to improve the efficiency and simplify the logistics related to the management of patient deaths . the upmc information services division developed upmc remains tracker , an application that tracks decedents locations , documentation status , and autopsy status within upmc hospitals . we assessed qualitative improvement in decedent remains tracking , decedent paperwork management , and staff satisfaction and compliance . upmc remains tracker improved the process of tracking decedents locations , identifying involved personnel , monitoring autopsy requests , and determining the availability for funeral home transportation . resident satisfaction with upmc remains tracker was generally positive and scored as improved efficiency and makes identifying and tracking decedents much easier . additionally , the nursing staff reacted favorably to the application . a retrospective review of the use of the application in the management of 100 decedents demonstrated a 93% compliance rate . among the cases requiring an autopsy , there was a 90% compliance rate . the process of tracking decedents , their paperwork , involved staff , and decedent autopsy status is often inefficient . this assessment suggests that incorporating new technologies such as upmc remains tracker into the management of hospital deaths provides accurate tracking of remains , streamlines the administrative tasks associated with deaths , and increases nursing and resident satisfaction and compliance .

INTRODUCTION MATERIALS AND METHODS UPMC Remains Tracker Development UPMC Remains Tracker Deployment RESULTS DISCUSSION

fahr 's disease is a rare disorder that was first described by karl theodor fahr in 1930 . it usually presents with either slow progressive cognitive decline , psychiatric disturbance , or movement disorders . we describe a patient with an acute deterioration in the level of consciousness and a ct scan demonstrating both subarachnoid blood and idiopathic basal ganglia calcification ( ibgc ) . further investigations showed a right posterior communicating artery aneurysm to be the source of the hemorrhage . we postulate that the extensive calcification in fahr 's disease negatively affects both brain parenchyma and intracranial vessels predisposing these individuals to such an acute presentation . a 54-year - old housewife without any significant previous medical history , or any neurological problem presented with a transient loss of consciousness followed by headache and confusion . her blood investigation , which included coagulation profile , blood cell count and serum electrolytes , was normal . brain computerized tomography ( ct ) showed two major findings : first , diffuse bilateral subarachnoid hemorrhage involving the basal cisterns and both sylvian fissures ; and second , extensive calcification involving the basal ganglia , thalamus , corona radiata , and deep cerebellar nuclei [ figure 1 ] . axial noncontrast ct scan of the brain shows extensive symmetrical calcification at the level of the ( a ) cerebellum , ( b ) basal ganglia , ( yellow arrow ) ( c ) thalamus and ( d ) white matter . formal cerebral angiography revealed a right posterior communicating artery aneurysm as the probable source of the sah . an attempt at coiling this aneurysm failed because of a tortuous internal carotid artery precluding safe access to the aneurysm [ figure 2 ] . right internal carotid angiogram showing a multilobulated right posterior communicating artery aneurysm measuring 7.8 5.7 4.2 mm with the neck of the aneurysm measuring 3.3 mm ( white arrow ) . the patient was thereafter taken to the operating room where she underwent a right pterional craniotomy and clipping of the posterior communicating artery aneurysm . her postoperative course was complicated by a right - sided upper extremity monoparesis due to a small middle cerebral artery territory ischemic infarct . however , over the following days she improved but experienced mild vasospasm that was treated medically with euvolemia and milrinone . she was also investigated for disorders that may cause abnormal calcium deposition which proved negative . the patient was eventually discharged from the hospital to a rehabilitation program where she showed significant improvement . the 6-month follow - up angiogram revealed no new aneurysms and no recanalization of the clipped aneurysm . fahr 's disease , or idiopathic basal ganglia calcification is a rare syndrome that is characterized by abnormal intracranial calcification in the absence of any systemic calcium disorder . different names have been given to abnormally excessive calcification within the brain parenchyma and cerebral vessels , reflecting the confusion regarding what causes this disorder [ table 1 ] . names of ibcg with vascular predilections calcification has been described in the globus pallidus , caudate nucleus , putamen , thalamus , dentate nuclei , cerebellar lenticular nucleus , thalamus , the white matter of the cerebral cortex , as well as major intracranial vessels and those supplying the basal ganglia and the cerebellum . typical presentation starts in the 4th to 5th decade of life with a slow cognitive decline , psychiatric abnormalities or movement disorders such as parkinson 's tremor , dystonia or cerebellar ataxia . microscopic and biochemical analysis of brain deposits in fahr 's disease reveals that the stroma contains mainly calcium and protein without collagen or mucopolysaccharides . these deposits occur in vessel walls of arterioles , capillaries , veins , and in the perivascular spaces . the calcium deposits are generally symmetrical and may be seen in the walls of small and medium sized vessels that could have resulted from inflammatory processes in the vessels . an acute deterioration in the level of consciousness a potential cause may be a complex - partial seizure as reported in a patient who had had a mild psychiatric disturbanceprior to a seizure episode . in another case , simone et al . , described a 69- year - old patient who presented with recurrent episodes of deterioration in the level of consciousness and who was found to have classical radiological findings of fahr 's disease , in addition to pseudo - hypoparathyroidism , the correction of which improved his clinical status . subarachnoid hemorrhage from a ruptured intracranial aneurysm has a poor prognosis with mortality rate of 50% , with 20% of survivors remaining severely disabled . histopathologically , aneurysms are associated with a loss of the media interna along with the elastic lamina as well as a thinning of the wall . there is also an associated intimal thickening in the parent artery . in larger aneurysms calcification may be seen either in the wall of the vessels or at the neck of the aneurysm . earlier descriptions of fahr 's disease postulate a vascular pathophysiological process with calcification in both small and large vessels . our case represents ibgc presenting with an sah as a first presentation . despite the heavy calcification seen on imaging she was asymptomatic before the event . we suggest that this could represent a subset of patients in whom there may be a predilection for intracerebral vessel symptomatology prior to the eventual onset of cognitive and psychiatric disturbances . the association of ibgc and an intracranial aneurysm has to date remained unreported in the literature . this case represents a first for fahr 's disease presenting with an aneurysmal subarachnoid bleeding . fahr 's disease is a chronic slowly progressive neurodegenerative disorder that most commonly will present with acute deterioration in the level of consciousness , secondary to seizures . we report a case of fahr 's disease in which this acute deterioration was secondary to an aneurysmal subarachnoid hemorrhage . this observation suggests that a brain cta should be performed in patients with unexplained recurrent episodes of loss of consciousness , to rule out an aneurysm , even if they are known to have ibgc , so as to not attribute it to an epilepsy disorder .

fahr 's disease is a rare disorder of slowly progressive cognitive , psychiatric , and motor decline associated with idiopathic basal ganglia calcification ( ibgc ) and widespread calcification in the brain and cerebellum . acute presentation of ibgc is most often as a seizure disorder ; however , we present a case of an acute ibcg presentation in which the cause of the deterioration was an aneurysmal subarachnoid hemorrhage .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSIONS

angiopoietin-2 ( ang2 ) works in concert with vegf to promote neoangiogenesis , and in the absence of vegf , vessels that have been destabilized by ang2 will undergo apoptosis and regress . though there has been numerous biochemical data to support this paradigm [ 17 ] , there is sufficient data to suggest a more complex role for ang2 . for example , at high concentrations ang2 acts as an agonist of tie2/tek , providing a prosurvival signal to endothelial cell ( ec ) , which is a similar function as ang1 . although all tumor models show an upregulation of ang2 , its role in tumor angiogenesis has proven to be quite complex and variable , depending on the tumor model investigated [ 814 ] . ang2 upregulation is seen primarily in ec of small cell lung cancer , hepatocellular carcinoma , neuroblastoma , gastric cancer , colon cancer , and kaposi sarcoma , with ang2 being associated with poor prognosis in many of these tumors [ 816 ] . upregulation of ang2 along with vegf upregulation suggests that vessel destabilization by ang2 is a critical step required to allow for vegf - induced neoangiogenesis . in astrocytomas , ang2 has been found to be upregulated in gbms compared to lgas and nb [ 11 , 1719 ] . the source of ang2 is mainly reported to be the ec ; however , one study and our own unpublished data suggest that ang2 may also be expressed by malignantly transformed astrocytoma cells . a noteworthy observation made by stratmann et al . is that expression of ang2 appears to be vessel size- or vessel type - dependent . ang2 expression was confined to ec of smaller vessels and not seen in larger vessels suggesting that ang2 promotes in - situ angiogenesis and is more intimately involved with capillary - like vascular structures in tumors [ 18 , 20 ] . a more recent study identifies ang2 as a marker of tumor cell invasion in high - grade astrocytomas , with little ang2 expression seen in the center of human gbm compared to the invasive peripheral edge of the tumors where ang2 is expressed by both the vascular and neural elements . they also found that upregulation of ang2 in u87 xenografts had a pronounced invasive phenotype compared to the parental u87 mg xenografts that had no ang2 expression . they propose that ang2 confers a more invasive phenotype to the tumor cells via either activation of mmp-2 , independent of tie2/tek receptor activation , or perhaps via activation of integrins . in this study , we have focused on deciphering the distinct contribution of ang2 to gbm angiogenesis and vessel development . additionally , ang2 induces vascular architectural changes that are pathological and aberrant in comparison to control tumor vessels . this aberrancy in vasculature is not seen in human gbms , which suggests that ang2 is not constantly upregulated in human tumors and alludes to a stage - dependent upregulation of ang2 . established human u87-mg gbm cells were obtained from american type culture collection ( atcc , rockville , md ) and u373-mg cell lines were a gift from b. westermark ( uppsala , sweden ) . these gbm lines were chosen as they provide variability in their degree of baseline angiopoietin and vegf - a expression , in addition to variable tumorigenicity potential and differences in genetic aberrations . they were maintained in dulbecco 's minimal essential medium ( dmem ) ( cellgro , herndon , va ) supplemented with 10% fbs and penicillin - streptomycin antibiotics . full - length human ang2 cdna ( a gift from k. alitalo , helsinki , finland ) was subcloned into the psec vector ( invitrogen ) to allow generation of myc - histidine epitope - tagged constructs . the ang - myc / his sequence was subcloned into the bamh1 and ecor1 sites of the pcagg vector that contained a cmv promoter along with a chicken -actin enhancer element . stable cell lines expressing ang2 , were generated by transfection of the vector pcagg - ang - myc / his - zeocin into u87 and u373 gbm lines using lipofectamine 2000 ( gibco / brl ) as per the manufacturer 's instructions . twenty stable clones , selected with 1mg / ml of zeocin ( invitrogen ) , were examined for ang2 expression by western blot analysis as described below . two single clones with highest expression of ang2 above baseline parental levels , as well as one pooled clone of ang2 were selected for each of the three gbm lines ( u87:ang2 , u373:ang2 ) . corresponding control stable cell lines were generated using empty - vector transfectants . as described previously , briefly , u87-mg cell lines were transfected with ptet - off ( clontech , palo alto ) vector and stable clones selected and maintained in 1 mg / ml and 500 g / ml of g418 , respectively . thirty of the tet - off clones were assayed by transfecting with the reporter construct ptre - luc and subsequent examination of luciferase activity with a luciferase assay . the highest tetracycline inducible clone was selected to generate double stable tet - off cell lines ( data not shown ) . double stable tet - off u87-mg cell lines overexpressing ang2 were generated by cotransfecting u87-mg : tet - off stable cells with ptre - ang2 with the ptk - puromycin vector . stable clones were selected in 3 mg / ml of puromycin , and twenty clones were tested for induction of ang2 expression by immunoprecipitation followed by western blotting , as described below . for control u87-mgtet - off double stable cell lines , ptre - red vector expressing the ds - red fluorescent protein was used . in vitro testing of tetracycline induction of ang2 expression was determined using varying doses of doxycycline , with the most tightly regulated clones expressing ang2 selected for in vivo experiments . subcutaneous xenografts were generated by growing u87-mg stable clones overexpressing ang2 in the flanks of nod - scid mice . for each stable clone , seven mice were injected with 10 cells suspended in 300 l of pbs , with five mice injected with control empty vector transfectants . tumor growth was measured biweekly , using calipers by two observers in a blinded fashion . as per animal protocol , mice were sacrificed by cervical dislocation after 100 mg / kg brdu injection ( sigma - aldrich ) . tumors were cut in cross sections , with two cross - sections kept in formaldehyde for paraffin blocks and immunohistochemical analysis and the remaining tumor stored in liquid nitrogen . tet - off regulated human u87-mg : ang2 cells ( 10 ) were stereotactically injected 3 mm deep into the frontal cortex of nod - scid mice . mice were treated with dox in the drinking water with three doses of 0 , 1 , and 10 mg / ml . these doses were selected based on prior published studies demonstrating that dox crosses the blood - brain barrier efficiently to regulate gene expression in the brain . when animals exhibited symptoms consistent with failure to thrive or raised intracranial pressure , the mice were sacrificed by perfusion fixation after brdu injection and tail vein injection of 2% evans blue solution ( 2 ml / kg ) to determine intraluminal blood flow and vessel permeability . the time interval between the injection of evans blue and the perfusion and killing of the mice was approximately 30 minutes . four different tumor portions were each cut at 5 m consecutive paraffin sections and stained with the ec specific marker anti - factorviii ( dako ; 1 : 2000 ) , followed by detection with an avidin - biotin complex method-3,3-diaminobenzidine ( vectastain elite ; vector laboratories ) system . microvessel density ( mvd ) was calculated by counting the number of hollow lumen vessels in ten high - power fields ( hpf:500x ) and in five hpf at vascular hot spots . areas that included abnormal vascular structures , such as glomeruloid bodies , were not included in the mvd count as the functional status of these vascular units in both human and xenograft tumors is not known . all analyses were carried out using the microcomputer image device ( mcid - imaging research , inc . ) linked to a color ccd camera ( sony dxc 970 md ) mounted on a transmitted - light microscope ( zeiss axioskop ) . ihc for ec and smc staining was performed using factorviii antibody and smooth muscle antigen ( sma ) staining . standard hematoxylin and eosin ( h&e ) staining and immunohistochemical analysis was performed on 5 m tissue sections from paraffin embedded tissue blocks . primary antibodies used include : factorviii ( rabbit polyclonal antibody # a0082 ; dako ; used at 1 : 2500 ) and a polyclonal goat anti - ang2 antibody ( 1 : 200 and 1 : 400 , santa cruz ) . secondary antibody was a goat antimouse antibody ( zymed ) used at 1 : 200 , and antigens were detected using the avidin - biotin complex method ( vector laboratories ) and diaminobenzidine substrate . all analyses were completed using statview 4.1 for the macintosh ( abacus concepts , berkeley , ca ) . all errors were calculated as the standard error of the mean ( s.e.m . ) . one - tailed student 's t - test was used to compare means ( two sample , unequal variance ) with p < .05 considered statistically significant . parental u87 mg and u373 mg cells have no detectable ang2 ( figures 1(a ) and 1(b ) ) . overexpression of ang2 did not alter the in vitro proliferation rate , morphology , or the vegf expression of the cells compared to parental controls ( data not shown ) . stable transfectants overexpressing the highest levels of ang2 ( a2 - 1 ) and one pooled ( a2-p ) clone were selected for subsequent experiments ( figures 1(a ) and 1(b ) ) . tet - off regulated ang2 stable clones were also established in u87 mg cells , with the most tightly regulated clones selected for in vivo studies ( figure 1(c ) ) . in the u87mg : ang2 tet - off clone , dox at 5000 ng / ml was sufficient to decrease ang2 expression to undetectable levels , as seen in control cell lines ( figure 1(c ) ) . we assessed the impact of ang2 on the growth of gbm xenografts in both subcutaneous ( s.c ) . and intracranial ( i.c . ) tumor models using stable cell lines of u87 mg and u373 mg overexpressing ang2 ( figure 1(b ) ) . xenografts , ang2 overexpression resulted in a significantly faster tumor growth and larger final tumor size compared to controls ( figure 1(b ) and table 1 ) . in i.c . xenografts , ang2 conferred a growth advantage as suggested by a significant decrease in survival and tumor proliferation ( figure 1(c ) and table 2 ) . the response to ang2 was dose - dependent with respect to survival , tumor proliferation , and vascularity ( figure 1(c ) and table 2 ) . mice treated with 0 mg / ml of dox in the drinking water , hence those with xenografts expressing high levels of ang2 , had a significantly shorter survival time , and tumor proliferation was increased by 2.2-fold compared to the mice receiving either 1 or 10 mg / ml of dox , which had comparable survival to controls ( figure 1(c ) and table 2 ) . ang2 is not expressed endogenously by u87 mg cells ( figure 1(a ) ) , therefore , addition of dox can completely turn - off exogenous ang2 and result in similar tumor growth and survival of mice as that of controls . ang2 upregulation resulted in increased mvd and altered vessel size and ec distribution in both s.c . and xenografts ( figure 2 , tables 1 and 2 ) . additionally , in both s.c . and i.c . u87mg : ang2 xenografts , there was an abnormal vascular architecture , characterized by preponderance of small vessels , cord-like distribution of ec and whirling of ec present throughout the tumors , in addition to increased numbers of dilated vessels ( figure 2(a)i and ii ) . the alterations in the microvasculature were dependent on levels of ang2 expression that were regulated by dox in the i.c . u87mg : ang2 models ( figure 1(b ) and table 1 ) . at high levels of ang2 ( 0 mg / ml dox ) , a large number of dilated vessels were present , along with abnormal ec distribution throughout the tumor ( figure 2(b ) ) . with dox suppression ( 10 mg / ml dox ) of ang2 , ec distribution , vessel size , and the overall microvasculature architecture returned to similar structural patterns as is seen in control u87 mg tumors ( figure 2(b ) and table 2 ) . these vascular alterations have not been reported previously ; though the recent publication by hu et al . and lee et al . makes the observation of impaired angiogenesis by ang2 , astrocytomas angiogenesis is postulated to be highly tumor stage - dependant . at their initial growth phase , they coopt and parasitize existing host vessels in an attempt to support their growth , thus the first phase being independent of the tumor angiogenic process [ 18 , 2224 ] . the second growth phase begins when the host mounts a defensive response and the parasitized vascular supply regresses resulting in tumor hypoxia and necrosis , which in turn triggers upregulation of ang2 and vegf [ 23 , 24 ] . therefore , ang2 appears to play a highly phase - dependent role in the progression of malignant astrocytomas . it plays a pivotal role in the cooption of host vessels in the initial phase ; and in supporting in - situ tumor angiogenesis , while in the second phase it allows destabilization of mature vessels , by antagonizing ang1-mediated tie2/tek activation , in order to facilitate mitogenic stimulation of ecs by vegf and promoting tumor neovascularization [ 22 , 24 ] . xenografts , led to an increase in growth rate , final volume and proliferation of gbms along with an increase in tumor angiogenesis . ang2 upregulation resulted in an alteration of vascular structures , marked by abnormal ec distribution , with ec forming cord or capillary - like structures and areas of ec whorling present throughout the tumor , in addition to a high number of dilated vessels . in the model used in this study , there is constant upregulation of ang2 throughout all stages and phase of gbm tumor growth , potentially providing a continual trigger for host vessel cooption and promoting in - situ angiogenesis , thereby increased tumor growth . on the other hand , lee et al . they observe a bimodal expression pattern of ang2 in astrocytomas and support the postulate that ang2 is a vessel destabilize , seen at sites of tumor cell growth , tumor periphery , and around sites of necrosis , presumably to promote neoangiogenesis and support tumor cell growth . however , quite contrary to what one would predict based on this observation , lee et al . also found that ang2 treatment of u87 mg xenografts did not promote but rather restricted astrocytoma growth . moreover , at first glance these results appear to be in opposition with our observations ; however , on closer analysis , both findings can be seen as corroborative and together explain the complex tumor phase - dependent role of ang2 . xenografts on day 4 after tumor implantation followed by biweekly injections of ang2 , whereas in our model ang2 is upregulated constantly throughout all stages of tumor growth . the difference between the level and stages of ang2 upregulation in the two models supports the postulate that ang2 plays a highly tumor stage - dependent role . another evidentiary data that ang2 plays a stage dependent role in glioma angiogenesis is the fact that tumor vascular structures observed in our xenograft models are not evident in human gbm specimens , indicating that ang2 is not upregulated throughout all stages of human gbms , and most likely plays a very precise role at specific stages of gbm growth . the abundant cord or capillary - like vessels in the u87mg : ang2 xenografts may be a result of ang2-mediated modulation of ec motility , migration , and invasion . demonstrate regions of ang2-expressing tumors actively invading the brain , high levels of mmp-2 expression , and increased angiogenesis . additionally , ang2 is known to influence the fate of new tumor vessels , differentiating them into capillaries versus arteries or venous structures . the most likely explanation is that ang2 presents an inhibitory signal , preventing ang1-mediated maturation by of the newly formed tumor vessels . taken together our data indicates that increased ang2 promotes angiogenic growth of gbms . constant upregulation of ang2 throughout all phases of tumor growth results in the abnormal vascular structures seen in our xenografts that are not present in human gbms , suggesting that ang2 upregulation in gbms is very much a tumor stage dependent process and not constant throughout all stages of gbm growth . future studies are required to decipher the precise temporal role of ang2 and whether the combinatorial impact of other angiogenic cytokines with ang2 can be used for therapeutic targets in treatment of gbms .

angiopoietins and tie2 are angiogenic - specific ligand and receptor complex that have been shown to play a critical role in tumor angiogenesis . angiopoietin-2 ( ang2 ) is one of four ligands for receptor tie2 and it is the naturally occurring antagonist to tie2 , inhibiting the action of angiopoietin-1 ( ang1 ) . over the last decade , significant research has focused on elucidating the role of ang2 in cancer biology and its exact role in tumor angiogenesis remains elusive . in this study we have focused on establishing the role of ang2 in angiogenesis of malignant astrocytomas . we have demonstrated that ang2 significantly enhances the vascular growth of malignant astrocytomas and constant upregulation of ang2 throughout all phases of tumor growth generates abnormal vascular structures that are not typically seen in human astrocytomas , suggesting that ang2 plays a tumor stage - dependent role and is not a consistently elevated throughout all growth stages of malignant astroctyomas .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

a thirty - five - year - old male patient presented to our department complaining of diplopia of 6 days duration . ten days previously , he had suffered a chest infection for which he had a course of antibiotics and had made a good recovery . on examination , colour vision tested with ishihara plates was normal , and visual field testing by confrontation was also normal . ocular motility testing revealed signs suggesting bilateral fourth nerve palsy and bilateral sixth nerve palsy . all his reflexes were absent and he had truncal unsteadiness when carrying out heel - to - toe walking . a formal orthoptic assessment was carried out which verified the presence of bilateral fourth and sixth nerve palsy ( figures 4 , 5 , 6 , 7 , 8 , 9 , and 10 ) . pharmacological testing with 0,125% subsequently , the patient had a brain mri scan that did not reveal any abnormalities . on the basis of the clinical findings a diagnosis of miller serum samples were tested for anti - gq1b ganglioside antibodies and an elevated igg titer was reported . it was first described in 1956 as a triad of ophthalmoplegia , ataxia , and areflexia . anti - gq1b ganglioside antibodies have been shown to be a serum marker for mfs . they can be found in 85% of cases and have been proposed as one of the diagnostic criteria for mfs . an mri of the brain is not necessary to make the diagnosis which can be made solely on clinical grounds having excluded other pathology . usually , abnormal high intensity lesions of the brainstem , thalamus , cerebellum , and cerebrum are seen on mri in patients with bickerstaff 's brainstem encephalitis with ophthalmoplegia , ataxia and hypereflexia . the differential diagnosis also includes botulism , cerebrovascular accident , myasthenia gravis , and wernicke 's encephalopathy with the latter being the one closer mimicking mfs , usually presenting with mental changes , ataxia , and extraocular muscle paralysis with nystagmus in a person with nutritional deficiency precipitated by infection , gastrointestinal disorder or trauma . the full triad of mfs is not always present and there might be an overlap with gbs . mydriasis which exhibits denervation hypersensitivity with or without light - near dissociation is also not always present . the natural recovery of the condition is very good in the majority of cases with or without treatment . there are no randomised controlled trials of immunomodulatory therapy in mfs on which to base practice yet . intravenous immunoglobulin has been shown to slightly hasten the periods between ophthalmoplegia and ataxia onset and the start of the alleviation of these symptoms . ophthalmologists should maintain a high level of suspicion of mfs as they may be the first doctors to encounter this condition . careful history taking and the bilaterality of the condition are keys to the diagnosis even though unilateral cases have been reported . after other pathology has been excluded , a prompt referral to a neurologist is mandatory as the condition may progress to gbs with devastating consequences .

miller - fisher syndrome ( mfs ) is a rare condition characterized by the classical triad of ophthalmoplegia , ataxia , and areflexia ( fisher , 1956 ) . it is considered a variant of guillain - barr syndrome ( gbs ) with which it may overlap , or it can occur in more limited forms . we report a case of a thirty - five - year - old male who presented with a six - day history of diplopia , following a recent chest infection . on examination , he was found to have bilateral sixth nerve palsy , bilateral fourth nerve palsy , bilateral areflexical mydriasis , ataxia and total absence of reflexes . after excluding other conditions , a diagnosis of miller - fisher syndrome was made . the patient was administered intravenous immunoglobulin and made an uneventful recovery .

1. Case Report 2. Discussion

animal use was approved by the institutional animal care and use committees at the university of oklahoma health sciences center , oklahoma city , oklahoma , and the university of houston and conformed to the arvo statement for the use of animals in ophthalmic and vision research . the cngb1 line , the rds line ( originally obtained from neeraj agarwal currently at the national eye institute , bethesda , md , usa ) , and the rho line ( originally obtained from janice lem , tufts university , boston , ma , usa ) have been described previously . cngb1 mice on the rds , rds , rho , and rho backgrounds were generated in our facility . wild - type ( i.e. , cngb1/ rds / rho ) , rds , rds , rho , and rho littermates were used from our colony as controls . all animals were maintained in cyclic light ( 12 hours light , 12 hours dark , 30 lux ) and fed standard lab chow . experiments were repeated three to seven times , and densitometry was done using the image lab software ( bio - rad , temecula , ca , usa ) . eyes for immunofluorescence were harvested , fixed , sectioned , and immunolabeled as previously described . primary antibodies are described in the table , and anti - mouse , anti - rabbit , or anti - goat alexafluor conjugated secondary antibodies ( life technologies , grand island , ny , usa ) were used . images were captured on an olympus bx-62 microscope ( center valley , pa , usa ) equipped with a spinning disc confocal unit and analyzed as described previously . antibodies used for immunofluorescence and western blotting tissue collection , processing , and plastic embedding and transmission electron microscopy ( tem ) have been described previously . light microscopy images were captured at 40 using a zeiss ( peabody , ma , usa ) universal microscope . to evaluate outer nuclear layer ( onl ) and os layer thickness , images were captured from central superior and inferior regions containing the optic nerve head , and at least three retinal sections from two to four eyes / genotype were used . assessment of rod photoreceptor function ( scotopic erg ) was performed on dark - adapted animals with a strobe flash stimulus of 157 cd - s / m intensity while photopic responses were recorded using a similar stimulus from light - adapted animals . differences between genotypes were assessed by 1-way or 2-way anova with bonferroni 's post hoc pairwise comparisons . p < 0.05 was considered significant ( p < 0.05 , p < 0.01 , and p < 0.001 ) . animal use was approved by the institutional animal care and use committees at the university of oklahoma health sciences center , oklahoma city , oklahoma , and the university of houston and conformed to the arvo statement for the use of animals in ophthalmic and vision research . the cngb1 line , the rds line ( originally obtained from neeraj agarwal currently at the national eye institute , bethesda , md , usa ) , and the rho line ( originally obtained from janice lem , tufts university , boston , ma , usa ) have been described previously . cngb1 mice on the rds , rds , rho , and rho backgrounds were generated in our facility . wild - type ( i.e. , cngb1/ rds / rho ) , rds , rds , rho , and rho littermates were used from our colony as controls . all animals were maintained in cyclic light ( 12 hours light , 12 hours dark , 30 lux ) and fed standard lab chow . experiments were repeated three to seven times , and densitometry was done using the image lab software ( bio - rad , temecula , ca , usa ) . eyes for immunofluorescence were harvested , fixed , sectioned , and immunolabeled as previously described . primary antibodies are described in the table , and anti - mouse , anti - rabbit , or anti - goat alexafluor conjugated secondary antibodies ( life technologies , grand island , ny , usa ) were used . images were captured on an olympus bx-62 microscope ( center valley , pa , usa ) equipped with a spinning disc confocal unit and analyzed as described previously . tissue collection , processing , and plastic embedding and transmission electron microscopy ( tem ) have been described previously . light microscopy images were captured at 40 using a zeiss ( peabody , ma , usa ) universal microscope . to evaluate outer nuclear layer ( onl ) and os layer thickness , images were captured from central superior and inferior regions containing the optic nerve head , and at least three retinal sections from two to four eyes / genotype were used . layer thickness was measured using adobe photoshop cs5 ( adobe systems , inc . , san jose , ca , usa ) . assessment of rod photoreceptor function ( scotopic erg ) was performed on dark - adapted animals with a strobe flash stimulus of 157 cd - s / m intensity while photopic responses were recorded using a similar stimulus from light - adapted animals . differences between genotypes were assessed by 1-way or 2-way anova with bonferroni 's post hoc pairwise comparisons . p < 0.05 was considered significant ( p < 0.05 , p < 0.01 , and p < 0.001 ) . previously we evaluated the interplay between rds and rhodopsin in os morphogenesis , and here we wanted to understand the effects of eliminating cngb1 at the same time as either rhodopsin or rds . we crossed the cngb1 line , which lacks all cngb1 gene products including cngb1a and garp1/2 , onto the rds , rds , rho , and rho backgrounds ( which were all used as control lines for the purpose of comparison throughout the study ) . at postnatal day ( p ) 30 we assessed levels of rhodopsin , rds , and rom-1 by reducing sds - page / western blot . data are presented as percentage of wt after normalization to actin ( a loading control ) ( figs . c ) and are plotted as means sem ( p < 0.05 , p < 0.01 , and p < 0.001 by 1-way anova with bonferroni 's post hoc comparison ) . though rhodopsin levels were virtually normal in the cngb1 and the rds ( fig . 1a ) , they were reduced in cngb1/rds to 56% of levels in the rds . levels of rhodopsin in the rds were reduced by 84% and were not further reduced by ablating cngb1 . retinal extracts were isolated from p30 eyes of the indicated genotypes and were analyzed by reducing sds - page / western blot . the blots were probed with ( a ) mab 1d4 against rhodopsin , ( b ) anti - rds - ct , and ( c ) anti - rom-1-ct . protein was quantified densitometrically , normalized to actin , and plotted as a percentage of wt ( shown are means sem , * p < 0.05 , * * p < 0.01 , and * * * p < 0.001 by 1-way anova with bonferroni 's post hoc comparison ) . nonreducing sucrose gradient velocity sedimentation ( d , e ) was performed on p30 retinal extracts from wt and cngb1 . fractions from gradients ( 112 ) were further separated by sds - page / reducing western blot . resulting blots were probed with anti - rds - ct ( d ) and anti - rom-1-ct ( e ) . the relative percent of total rds or rom-1 in each fraction was assessed densitometrically and plotted as mean sem from 3 or 4 independent experiments . this more pronounced effect of cngb1 ablation in the rds compared to the rho continued when we examined rds levels ( fig . in cngb1/rds retinas , rds levels were reduced to 54% of those in the rds while rds levels in cngb1/rho remained at 87% of those in the rho . rod outer segment membrane protein-1 levels were not altered in either the cngb1/rds versus the rds or the cngb1/rho versus the rho ( fig . we also observed that rds and rom-1 are severely reduced by the coablation of cngb1 and rhodopsin ( cngb1/rho had rds / rom-1 levels that were 8.8% and 7.9% those of rho , respectively ) . cyclic nucleotide gated channel b1a is known to bind to rds in the os , and proper binding and complex assembly of rds / rom-1 are necessary for os formation , so we asked whether eliminating cngb1 altered rds / rom-1 oligomerization . retinal extracts from wt and cngb1 animals were fractionated on 5% to 20% nonreducing sucrose gradients and then separated on reducing sds - page . in the wt retina , rds is present as tetramers ( fractions 68 ) , octamers ( fractions 45 ) , and higher - order oligomers ( fractions 13 ) while rom-1 is detected only in tetrameric and octameric fractions . 1e ) complex formation in cngb1 retinas , suggesting that rds / rom-1 oligomerization is not tied to cngb1 . previously we observed that cngb1a and garp2 protein levels are reduced by 50% in the rds and are undetectable in the rds . when combined with our data here showing that rds levels are decreased in the cngb1/rds compared to the rds cyclic nucleotide gated channel b1a and rds binding occurs during the os targeting process prior to arrival in the os , so we next used immunofluorescence labeling to ask whether the targeting of rds , rom-1 , rhodopsin , or cngb1a / garp1/2 is affected by co - elimination of cngb1 , rhodopsin , or rds . retinal degeneration slow and rom-1 labeling was properly restricted to the os layer in the wt , cngb1 , rds , cngb1/rho , rho , and cngb1/rho retinas ( fig . 2a , green ) . similarly , rhodopsin localization is not affected in most of these genotypes ; however , some accumulation of rhodopsin in the onl is observed in the cngb1/rho ( fig . large amounts of rhodopsin accumulate in the inner segment and onl , and this is recapitulated in the cngb1/rds ( fig . in contrast , in the rho and cngb1/rho retinas , the majority of rds is not found in the inner segment , but is properly restricted to the distal tips of the photoreceptors , consistent with our previous observation showing that rds and rom-1 are found in the small nascent oss of the rho . however , in the rho and cngb1/rho retinas , some mild mislocalization of rds ( but not rom-1 ) to the inner segment , onl , and outer plexiform layer is seen ( arrows , fig . combined , these data suggest that while rhodopsin is more susceptible to mislocalization than rds , cngb1 ablation has little to no effect on the os targeting of rds , rom-1 , or rhodopsin . eliminating cngb1 does not affect targeting of rds or rhodopsin . paraffin - embedded retinal sections from p30 animals of the indicated genotypes were labeled ( a ) with antibodies against rds ( rds - ct , green ) , rhodopsin ( mab-1d4 , red ) , or rom-1 ( rom1-ct , green ) ; ( b ) mab 1d4 ( red ) or rom1-ct ( green ) ; ( c ) rds - ct or rom1-ct ( green ) , or ( d ) cngb1 gene products ( garp-4b1 , red ) . in all cases nuclei os , outer segment ; onl , outer nuclear layer ; is , inner segment ; opl , outer plexiform layer . conversely , to see whether reduction / elimination of rds or rhodopsin affected cngb1a / garp1/2 targeting , we labeled with garp-4b1 , which recognizes all cngb1 gene products ( fig . 2d , red ) . in wt , rds , and rho retinas , cngb1a / garp1/2 properly localized to the os layer . this observation was replicated in the rho retina ; cngb1a / garp1/2 properly localized to the os layer , even though the rho does not form fully elaborated oss . in striking contrast , and consistent with our western blot data , in the absence of rds ( rds ) , cngb1a and garp1/2 are virtually undetectable in the retina . this decrease in cngb1 gene products in the absence of rds is clearly not due to a requirement for proper os formation , since the oss in the rho retina , while more formed than in the rds , are still just tiny sacs of vesicle - containing membrane at the tip of the os , yet the rho model still expresses cngb1a / garp1/2 . rather it suggests that the stability or transport of cngb1a and/or garp 1/2 are dependent directly on rds or on the initiation / formation of oss by rds ( which can be seen in nascent form even in the rho ) . however , though the differences do not attain statistical significance , mean onl thickness in the cngb1 , cngb1/rds , and cngb1/rho was decreased by 10% to 15% compared to their respective controls ( wt , rds , and rho ) , suggesting that degeneration in the cngb1 starts earlier than that in the rds and rho . there is no difference in onl thickness in rho versus cngb1/rho or rds versus cngb1/rds , suggesting that the photoreceptor degeneration in the rds and rho is not additive with that in cngb1 . representative light micrographs ( lm ) were captured from plastic - embedded retinal sections harvested at p30 from the indicated genotypes . rpe , retinal pigment epithelium ; os , outer segment ; is , inner segment ; onl , outer nuclear layer . ( b , c ) outer nuclear layer and os layer thicknesses were measured in sections captured from the central superior and central inferior retina from 2 to 4 eyes per genotype . plotted are means sem , * p < 0.05 , * * p < 0.01 , and * * * p < 0.001 by 2-way anova with bonferroni 's post hoc comparison . it was previously shown that oss are shorter and more disorganized in the cngb1 and rds retinas compared to wt , and our data confirm this ( fig . 3c ) . interestingly , this effect was additive : in the cngb1/rds , mean os length was 41% of wt , compared to 52% and 73% of wt for rds and cngb1 , respectively ( fig . as expected , at p30 , oss in the rho are similar to those in wt , but we do see os shortening in the cngb1/rho due to the absence of cngb1a ; oss in the rho are 89% of wt , while those in the cngb1/rho are 59% of wt . again , the effects of eliminating cngb1a from the rds retina are more severe than in the rho retina ; for example , oss in the cngb1/rds are decreased to 56% of those in cngb1 ( p < 0.05 ) , while the oss of the cngb1/rho are 81% of cngb1 ( not significant ) . figure 4a shows representative waveforms , and maximum saturating a- and b - wave amplitudes are plotted in figure 4b ( mean sem , p < 0.001 by 1-way anova with bonferroni 's post hoc comparison ) . our results for control animals ( cngb1 , rds , and rho ) are consistent with previous publications ( fig . 4b ) . again , elimination of cngb1 had a much more severe effect in the rds background than it did in the rho background . scotopic a - wave values in the cngb1/rho were not significantly reduced compared to the cngb1 , suggesting that all of the functional decrease in the cngb1/rho is due to the absence of cngb1 . in contrast , in the cngb1/rds , scotopic erg responses were severely reduced compared to both cngb1 and rds ( fig . this effect was seen in both the scotopic a- and b - waves , and scotopic a - waves in the cngb1/rds were virtually undetectable . scotopic erg function is undetectable in the rds and rho retina at p30 , so we did not perform ergs on animals in those backgrounds . the additive erg defect in the cngb1/rds could be due to reductions in cnga1 ; however , levels of cnga1 in cngb1 are virtually undetectable , and this finding is recapitulated in cngb1/rds ( supplementary fig . thus while it is possible that further reduction in cnga1 levels contributes to the additive defects seen in the cngb1/rds , we can not conclusively assess the possibility given that the levels of cnga1 are below the limit of detection . ( a ) representative waveforms ; ( b ) plots of mean amplitude sem from 4 to 7 mice per genotype ( * p < 0.05 , * * p < 0.01 , and * * * p < 0.001 by 1-way anova with bonferroni 's post hoc comparison ) . ( c ) scale bars : 10 m for low - magnification em images and 500 nm for higher - magnification em images . rpe , retinal pigment epithelium ; os , outer segment ; cc , connecting cilium . we conducted tem to determine whether the severe effects of simultaneously eliminating cngb1 and reducing rhodopsin / rds led to defects in os ultrastructure ( fig . the os shortening we quantified on the light microscopy level in the cngb1 is also evident by low - magnification em ( 3000 , top , fig . 4c ) , we find that the disc diameter and often the disc alignment are abnormal in the cngb1 retina . in some cases , new discs grew abnormally parallel to the plasma membrane ( arrow , fig . outer segments in the rds were characterized by abnormal disc size and the formation of highly dysmorphic whorl structures , but interestingly , this phenotype was not worsened in the cngb1/rds retina . outer segment structure in the cngb1/rho was worse than in the rho ( which is largely normal ) . the phenotype in the cngb1/rho was of the same type seen in the cngb1 , namely , abnormalities in disc size and alignment but not whorl formation ; however , the defects appeared to be more severe in the cngb1/rho compared to the cngb1 . the rds retina forms no os at the tip of the connecting cilia ( fig . 5 , cc marks connecting cilia ) , and the cngb1/rds is not different from the rds . in contrast , the rho forms well - characterized tiny nascent oss ( arrows , fig . similar structures at the distal tip of the connecting cilium were seen in the cngb1/rho ( arrows , fig . outer segment ultrastructure in the rds and rho is not affected by the ablation of cngb1 . scale bars : 10 m for low - magnification em images ( top ) and 500 nm for higher - magnification em images ( bottom ) . though cngb1 is expressed only in rods , secondary cone loss can occur after rod defects . figure 6a shows representative photopic erg waveforms while figure 6b plots mean photopic b - wave amplitudes ( mean sem , p < 0.01 by 1-way anova with bonferroni 's post hoc comparison ) . consistent with previous reports , at this time point significant decreases in cone function are not detected in the rds or cngb1 . likewise , no significant reductions in cone function were noticed in cngb1/rho versus rho or wt . however , a striking 75% reduction in cone function was observed in cngb1/rds compared to wt , rds , and cngb1 . to identify whether this defect was associated with loss of cone cells , m - opsin - positive cones were counted in a region in the superior central retina while s - opsin - positive cones were counted in the inferior central portion of the retina ( representative images in fig . 6c ; fig . consistent with the dramatic decrease in photopic erg response in the cngb1/rds compared to the cngb1 or the rds , we observed a 50% reduction in s - cones in the cngb1/rds compared to cngb1 , rds , or wt controls ( p < 0.001 by 1-way anova ) . photopic ergs were recorded from wt , cngb1 , rds , cngb1/rds , rho , and cngb1/rho at p30 . ( a ) representative waveforms ; ( b ) plots of the mean maximum photopic b - wave amplitude . n = 4 to 7 mice per genotype ( * p < 0.05 , * * p < 0.01 , and * * * p < 0.001 by 1-way anova with bonferroni 's post hoc comparison ) . ( c ) paraffin - embedded retinal sections from p30 animals were labeled with anti s - opsin ( green , top ) and anti - m - opsin ( green , bottom ) and were all counterstained with dapi ( blue ) . os , outer segment ; onl , outer nuclear layer ; opl , outer plexiform layer . ( d ) cells positive for cone opsins were counted in a 300-m region of the central retina either inferior ( s - opsin - positive cells ) or superior ( m - opsin - positive cells ) of the optic nerve . plotted previously we evaluated the interplay between rds and rhodopsin in os morphogenesis , and here we wanted to understand the effects of eliminating cngb1 at the same time as either rhodopsin or rds . we crossed the cngb1 line , which lacks all cngb1 gene products including cngb1a and garp1/2 , onto the rds , rds , rho , and rho backgrounds ( which were all used as control lines for the purpose of comparison throughout the study ) . at postnatal day ( p ) 30 we assessed levels of rhodopsin , rds , and rom-1 by reducing sds - page / western blot . data are presented as percentage of wt after normalization to actin ( a loading control ) ( figs . c ) and are plotted as means sem ( p < 0.05 , p < 0.01 , and p < 0.001 by 1-way anova with bonferroni 's post hoc comparison ) . though rhodopsin levels were virtually normal in the cngb1 and the rds ( fig . 1a ) , they were reduced in cngb1/rds to 56% of levels in the rds . levels of rhodopsin in the rds were reduced by 84% and were not further reduced by ablating cngb1 . retinal extracts were isolated from p30 eyes of the indicated genotypes and were analyzed by reducing sds - page / western blot . the blots were probed with ( a ) mab 1d4 against rhodopsin , ( b ) anti - rds - ct , and ( c ) anti - rom-1-ct . protein was quantified densitometrically , normalized to actin , and plotted as a percentage of wt ( shown are means sem , * p < 0.05 , * * p < 0.01 , and * * * p < 0.001 by 1-way anova with bonferroni 's post hoc comparison ) . nonreducing sucrose gradient velocity sedimentation ( d , e ) was performed on p30 retinal extracts from wt and cngb1 . fractions from gradients ( 112 ) were further separated by sds - page / reducing western blot . resulting blots were probed with anti - rds - ct ( d ) and anti - rom-1-ct ( e ) . the relative percent of total rds or rom-1 in each fraction was assessed densitometrically and plotted as mean sem from 3 or 4 independent experiments . this more pronounced effect of cngb1 ablation in the rds compared to the rho continued when we examined rds levels ( fig . in cngb1/rds retinas , rds levels were reduced to 54% of those in the rds while rds levels in cngb1/rho remained at 87% of those in the rho . rod outer segment membrane protein-1 levels were not altered in either the cngb1/rds versus the rds or the cngb1/rho versus the rho ( fig . we also observed that rds and rom-1 are severely reduced by the coablation of cngb1 and rhodopsin ( cngb1/rho had rds / rom-1 levels that were 8.8% and 7.9% those of rho , respectively ) . cyclic nucleotide gated channel b1a is known to bind to rds in the os , and proper binding and complex assembly of rds / rom-1 are necessary for os formation , so we asked whether eliminating cngb1 altered rds / rom-1 oligomerization . retinal extracts from wt and cngb1 animals were fractionated on 5% to 20% nonreducing sucrose gradients and then separated on reducing sds - page . in the wt retina , rds is present as tetramers ( fractions 68 ) , octamers ( fractions 45 ) , and higher - order oligomers ( fractions 13 ) while rom-1 is detected only in tetrameric and octameric fractions . 1e ) complex formation in cngb1 retinas , suggesting that rds / rom-1 oligomerization is not tied to cngb1 . previously we observed that cngb1a and garp2 protein levels are reduced by 50% in the rds and are undetectable in the rds . when combined with our data here showing that rds levels are decreased in the cngb1/rds compared to the rds cyclic nucleotide gated channel b1a and rds binding occurs during the os targeting process prior to arrival in the os , so we next used immunofluorescence labeling to ask whether the targeting of rds , rom-1 , rhodopsin , or cngb1a / garp1/2 is affected by co - elimination of cngb1 , rhodopsin , or rds . retinal degeneration slow and rom-1 labeling was properly restricted to the os layer in the wt , cngb1 , rds , cngb1/rho , rho , and cngb1/rho retinas ( fig . similarly , rhodopsin localization is not affected in most of these genotypes ; however , some accumulation of rhodopsin in the onl is observed in the cngb1/rho ( fig . large amounts of rhodopsin accumulate in the inner segment and onl , and this is recapitulated in the cngb1/rds ( fig . in contrast , in the rho and cngb1/rho retinas , the majority of rds is not found in the inner segment , but is properly restricted to the distal tips of the photoreceptors , consistent with our previous observation showing that rds and rom-1 are found in the small nascent oss of the rho . however , in the rho and cngb1/rho retinas , some mild mislocalization of rds ( but not rom-1 ) to the inner segment , onl , and outer plexiform layer is seen ( arrows , fig . combined , these data suggest that while rhodopsin is more susceptible to mislocalization than rds , cngb1 ablation has little to no effect on the os targeting of rds , rom-1 , or rhodopsin . eliminating cngb1 does not affect targeting of rds or rhodopsin . paraffin - embedded retinal sections from p30 animals of the indicated genotypes were labeled ( a ) with antibodies against rds ( rds - ct , green ) , rhodopsin ( mab-1d4 , red ) , or rom-1 ( rom1-ct , green ) ; ( b ) mab 1d4 ( red ) or rom1-ct ( green ) ; ( c ) rds - ct or rom1-ct ( green ) , or ( d ) cngb1 gene products ( garp-4b1 , red ) . in all cases nuclei os , outer segment ; onl , outer nuclear layer ; is , inner segment ; opl , outer plexiform layer . conversely , to see whether reduction / elimination of rds or rhodopsin affected cngb1a / garp1/2 targeting , we labeled with garp-4b1 , which recognizes all cngb1 gene products ( fig . 2d , red ) . in wt , rds , and rho retinas , this observation was replicated in the rho retina ; cngb1a / garp1/2 properly localized to the os layer , even though the rho does not form fully elaborated oss . in striking contrast , and consistent with our western blot data , in the absence of rds ( rds ) , cngb1a and garp1/2 are virtually undetectable in the retina . this decrease in cngb1 gene products in the absence of rds is clearly not due to a requirement for proper os formation , since the oss in the rho retina , while more formed than in the rds , are still just tiny sacs of vesicle - containing membrane at the tip of the os , yet the rho model still expresses cngb1a / garp1/2 . rather it suggests that the stability or transport of cngb1a and/or garp 1/2 are dependent directly on rds or on the initiation / formation of oss by rds ( which can be seen in nascent form even in the rho ) . 3a ) . as expected at early time points , onl thickness is not changed in rds or rho versus wt ( figs . however , though the differences do not attain statistical significance , mean onl thickness in the cngb1 , cngb1/rds , and cngb1/rho was decreased by 10% to 15% compared to their respective controls ( wt , rds , and rho ) , suggesting that degeneration in the cngb1 starts earlier than that in the rds and rho . there is no difference in onl thickness in rho versus cngb1/rho or rds versus cngb1/rds , suggesting that the photoreceptor degeneration in the rds and rho is not additive with that in cngb1 . representative light micrographs ( lm ) were captured from plastic - embedded retinal sections harvested at p30 from the indicated genotypes . rpe , retinal pigment epithelium ; os , outer segment ; is , inner segment ; onl , outer nuclear layer . ( b , c ) outer nuclear layer and os layer thicknesses were measured in sections captured from the central superior and central inferior retina from 2 to 4 eyes per genotype . plotted are means sem , * p < 0.05 , * * p < 0.01 , and * * * p < 0.001 by 2-way anova with bonferroni 's post hoc comparison . it was previously shown that oss are shorter and more disorganized in the cngb1 and rds retinas compared to wt , and our data confirm this ( fig . 3c ) . interestingly , this effect was additive : in the cngb1/rds , mean os length was 41% of wt , compared to 52% and 73% of wt for rds and cngb1 , respectively ( fig . as expected , at p30 , oss in the rho are similar to those in wt , but we do see os shortening in the cngb1/rho due to the absence of cngb1a ; oss in the rho are 89% of wt , while those in the cngb1/rho are 59% of wt . again , the effects of eliminating cngb1a from the rds retina are more severe than in the rho retina ; for example , oss in the cngb1/rds are decreased to 56% of those in cngb1 ( p < 0.05 ) , while the oss of the cngb1/rho are 81% of cngb1 ( not significant ) . figure 4a shows representative waveforms , and maximum saturating a- and b - wave amplitudes are plotted in figure 4b ( mean sem , p < 0.001 by 1-way anova with bonferroni 's post hoc comparison ) . our results for control animals ( cngb1 , rds , and rho ) are consistent with previous publications ( fig . , elimination of cngb1 had a much more severe effect in the rds background than it did in the rho background . scotopic a - wave values in the cngb1/rho were not significantly reduced compared to the cngb1 , suggesting that all of the functional decrease in the cngb1/rho is due to the absence of cngb1 . in contrast , in the cngb1/rds , scotopic erg responses were severely reduced compared to both cngb1 and rds ( fig . this effect was seen in both the scotopic a- and b - waves , and scotopic a - waves in the cngb1/rds were virtually undetectable . scotopic erg function is undetectable in the rds and rho retina at p30 , so we did not perform ergs on animals in those backgrounds . the additive erg defect in the cngb1/rds could be due to reductions in cnga1 ; however , levels of cnga1 in cngb1 are virtually undetectable , and this finding is recapitulated in cngb1/rds ( supplementary fig . thus while it is possible that further reduction in cnga1 levels contributes to the additive defects seen in the cngb1/rds , we can not conclusively assess the possibility given that the levels of cnga1 are below the limit of detection . ( a ) representative waveforms ; ( b ) plots of mean amplitude sem from 4 to 7 mice per genotype ( * p < 0.05 , * * p < 0.01 , and * * * p < 0.001 by 1-way anova with bonferroni 's post hoc comparison ) . scale bars : 10 m for low - magnification em images and 500 nm for higher - magnification em images . rpe , retinal pigment epithelium ; os , outer segment ; cc , connecting cilium . we conducted tem to determine whether the severe effects of simultaneously eliminating cngb1 and reducing rhodopsin / rds led to defects in os ultrastructure ( fig . the os shortening we quantified on the light microscopy level in the cngb1 is also evident by low - magnification em ( 3000 , top , fig . 4c ) , we find that the disc diameter and often the disc alignment are abnormal in the cngb1 retina . in some cases , outer segments in the rds were characterized by abnormal disc size and the formation of highly dysmorphic whorl structures , but interestingly , this phenotype was not worsened in the cngb1/rds retina . outer segment structure in the cngb1/rho was worse than in the rho ( which is largely normal ) . the phenotype in the cngb1/rho was of the same type seen in the cngb1 , namely , abnormalities in disc size and alignment but not whorl formation ; however , the defects appeared to be more severe in the cngb1/rho compared to the cngb1 . the rds retina forms no os at the tip of the connecting cilia ( fig . 5 , cc marks connecting cilia ) , and the cngb1/rds is not different from the rds . in contrast , the rho forms well - characterized tiny nascent oss ( arrows , fig . similar structures at the distal tip of the connecting cilium were seen in the cngb1/rho ( arrows , fig . outer segment ultrastructure in the rds and rho is not affected by the ablation of cngb1 . scale bars : 10 m for low - magnification em images ( top ) and 500 nm for higher - magnification em images ( bottom ) . though cngb1 is expressed only in rods , secondary cone loss can occur after rod defects . figure 6a shows representative photopic erg waveforms while figure 6b plots mean photopic b - wave amplitudes ( mean sem , p < 0.01 by 1-way anova with bonferroni 's post hoc comparison ) . consistent with previous reports , at this time point significant decreases in cone function are not detected in the rds or cngb1 . likewise , no significant reductions in cone function were noticed in cngb1/rho versus rho or wt . however , a striking 75% reduction in cone function was observed in cngb1/rds compared to wt , rds , and cngb1 . to identify whether this defect was associated with loss of cone cells , m - opsin - positive cones were counted in a region in the superior central retina while s - opsin - positive cones were counted in the inferior central portion of the retina ( representative images in fig . consistent with the dramatic decrease in photopic erg response in the cngb1/rds compared to the cngb1 or the rds , we observed a 50% reduction in s - cones in the cngb1/rds compared to cngb1 , rds , or wt controls ( p < 0.001 by 1-way anova ) . cone function is significantly reduced in the cngb1/rds retina . photopic ergs were recorded from wt , cngb1 , rds , cngb1/rds , rho , and cngb1/rho at p30 . ( a ) representative waveforms ; ( b ) plots of the mean maximum photopic b - wave amplitude . n = 4 to 7 mice per genotype ( * p < 0.05 , * * p < 0.01 , and * * * p < 0.001 by 1-way anova with bonferroni 's post hoc comparison ) . ( c ) paraffin - embedded retinal sections from p30 animals were labeled with anti s - opsin ( green , top ) and anti - m - opsin ( green , bottom ) and were all counterstained with dapi ( blue ) . os , outer segment ; onl , outer nuclear layer ; opl , outer plexiform layer . ( d ) cells positive for cone opsins were counted in a 300-m region of the central retina either inferior ( s - opsin - positive cells ) or superior ( m - opsin - positive cells ) of the optic nerve . plotted in this study , our goal was to understand how rds ( a rim protein ) , rhodopsin ( primarily a disc protein ) , and cngb1a ( a plasma membrane protein ) are interrelated in their ability to support os structure and function . recent work showed that rds can bind rhodopsin and suggested that a complex composed of cngb1a , rds , and rhodopsin may play a structural role in anchoring the rim to the plasma membrane ( via rds - cngb1a interactions ) , and a functional role ensuring that proteins are properly localized for optimal phototransduction . when combined with other work showing that cngb1a / garp interactions with phosphodiesterase 6 may provide a role for garp in cgmp turnover , these observations suggest that rds may organize the rim region into a hotspot area or environment for highly regulated phototransduction . this hypothesis is consistent with our results here showing that cngb1a and rds can act additively , exacerbating rds haploinsufficiency , and resulting in ( 1 ) severely decreased rod function in cngb1/rds versus cngb1 or rds and ( 2 ) modest additional reductions in the thickness of the os layer and the onl in the cngb1/rds versus the rds and cngb1 . critically , however , these additive effects occur without any difference in rod ultrastructure in cngb1/rds versus rds . this suggests that defects in rod function and overall retinal structure can not be completely attributed to a role for cngb1/rds interactions in maintaining rim structure , but rather that these interactions also organize a functional environment critical for proper signal transduction . this role for rds as an interactor / organizer of many proteins ( i.e. , not just rom-1 ) is consistent with the observation that rds also interacts with rhodopsin as well as the known broader role of tetraspanins , which often act as organizers of membrane domains containing a wide variety of different proteins . an interesting outcome from our work cngb1 is expressed only in rods , and cone function in cngb1 animals is normal at p30 and starts decreasing only later , likely a secondary phenomenon due to rod loss . similarly , while rds is expressed in rods and cones , cones can better tolerate reduced rds levels than rods , so cone function in the rds is also preserved until approximately 4 months of age . yet here we see cone degeneration and a dramatic reduction in cone function in cngb1/rds as early as p30 . this likely represents a rapid acceleration of rds haploinsufficiency in cones ; however , why elimination of cngb1 in rods should accelerate rds - associated cone degeneration is not clear . this cone phenotype is not completely due to overt rod loss since onl thickness is only mildly affected in the cngb1/rds versus the rds . there may be several underlying causes , including overall alterations in retinal homeostasis , altered secretion of signaling factors from rods needed for cone health , or alterations in other cell types such as horizontal cells and retinal glia that interact with both rods and cones . further exploration of the mechanisms underlying this cone defect are of great interest given the proliferation of retinal disease wherein secondary cone loss following rod - specific defects leads to worsened patient visual outcomes . the trafficking pathways for rhodopsin have been extensively studied , and rds and rhodopsin are thought to traffic separately . recent work has shown that in contrast to rhodopsin , the majority of rds does not traffic through the trans - golgi , but uses an unconventional secretory pathway during os targeting . little is known about the regulation of cngb1a / garp1/2 trafficking ; however , recent work from goldberg 's group shows that rds / cngb1a interactions first occur in the inner segment , raising the intriguing possibility that cngb1a may traffic with rds . however , whether the cngb1a would traffic with conventionally or unconventionally processed rds remains to be further explored . here we find that in general , trafficking of rds , rom-1 , and rhodopsin was not affected by cngb1 ablation . the presence of a clear region of cngb1a / garp1/2 immunoreactivity in the distal inner segment region , likely inside the small abnormally formed os nubs , suggests that overall , cngb1a / garp1/2 targeting is not affected by elimination of rhodopsin ; however , we can not assess the role of rds in cngb1a / garp1/2 trafficking because cngb1a / garp1/2 are not detectable in rds mice . thus , it is not possible to differentiate whether cngb1a / garp1/2 trafficking to the os requires rds , whether cngb1a protein stability requires rds , or whether cngb1a trafficking / stability require the rds - mediated assembly of oss . interestingly , in some cases eliminating the cngb1 channel can be beneficial in preventing or retarding retinal degeneration . for example , the removal of cngb1 significantly rescued the rapid degenerative phenotypes in the rd1 mouse . degeneration in the rd1 was hypothesized to be tied to observed elevated cgmp levels . however , the removal of cng channels led to rescue of rod photoreceptors without ameliorating cgmp levels , suggesting that removing cgmp - mediated signaling was beneficial rather than removing cgmp per se . as a parallel , eliminating rds in the rd1 retina ( rds / pde6b ) also delayed retinal degeneration regardless of the massive accumulation of cgmp . our observation that cngb1a levels are drastically reduced in the rds suggests that attenuation of rd1-associated retinal degeneration in the rd1 rds double knockout is likely due to an elimination of the cng channel / cngb1a rather than to the loss of rds per se . in conclusion , we here present data showing that elimination of cngb1 exacerbates rds - associated functional but not structural haploinsufficiency . these observations suggest that rds / cngb1 interactions have a role in os function in addition to structure and are consistent with the hypothesis that rds functions as a component of a multiprotein plasma membrane - rim - disc complex critical for oss .

purposerod photoreceptor outer segment ( os ) morphogenesis , structural integrity , and proper signal transduction rely on critical proteins found in the different os membrane domains ( e.g. , plasma , disc , and disc rim membrane ) . among these key elements are retinal degeneration slow ( rds , also known as peripherin-2 ) , rhodopsin , and the beta subunit of the cyclic nucleotide gated channel ( cngb1a ) , which have been found to interact in a complex . the purpose of this study was to evaluate the potential interplay between these three proteins by examining retinal disease phenotypes in animal models expressing varying amounts of cngb1a , rhodopsin , and rds.methodsouter segment trafficking , retinal function , and photoreceptor structure were evaluated using knockout mouse lines.resultseliminating cngb1 and reducing rds leads to additive defects in rds expression levels and rod electroretinogram ( erg ) function , ( e.g. , cngb1//rds+/ versus rds+/ or cngb1/ ) but not to additive defects in rod ultrastructure . these additive effects also manifested in cone function : photopic erg responses were significantly lower in the cngb1//rds+/ versus rds+/ or cngb1/ , suggesting that eliminating cngb1 can accelerate the cone degeneration that usually presents later in the rds+/. this was not the case with rhodopsin ; reducing rhodopsin levels in concert with eliminating cngb1a did not lead to phenotypes more severe than those observed in the cngb1 knockout alone.conclusionsthese data support a role for rds as the core component of a multiprotein plasma membrane - rim - disc complex that has both a structural role in photoreceptor os formation and maintenance and a functional role in orienting proteins for optimal signal transduction .

Materials and Methods Ethics Statement and Animal Care and Use Immunofluorescence Labeling and Protein Chemistry Light and Transmission Electron Microscopy Electroretinography Statistical Analysis Results Levels of Rhodopsin, RDS, and ROM-1 Are Altered by Co-elimination of CNGB1 and RDS/Rhodopsin Trafficking of OS Protein Is Largely Unaffected by Removing Elimination of CNGB1 Exacerbates OS Shortening When RDS Is Also Reduced Eliminating Elimination of Discussion Supplementary Material

long - term studies of healthy kidney donors have shown that living kidney donation is safe and rarely affects the individual 's health . however , some studies have reported decreased renal function during short to intermediate follow - up periods after living - donor nephrectomy . although controversy over the impact of nephrectomy on donor health exists , chronic kidney disease ( ckd ) has recently been shown to be an important risk factor for cardiovascular disease , thus highlighting the importance of living kidney donor follow - up . currently , there is no standard follow - up protocol for kidney donors following nephrectomy . the most important follow - up factor is kidney filtration of waste products from the circulation , which is defined as the glomerular filtration rate ( gfr ) . the gfr can be estimated by measuring creatinine clearance in the urine . in the clinical setting , however , because of the difficulty in collecting urine ( usually taking 24 hours ) , estimated creatinine clearance or estimated gfr ( egfr ) is used instead . many formulas are available for generating the egfr on the basis of measured serum creatinine levels [ 6 - 8 ] . an alternative method uses serum cystatin c , a low molecular weight protein secreted by most cells in the body . whereas serum creatinine varies with patient age , gender , and muscle mass , serum cystatin , we compared the sensitivity and specificity of each egfr method for predicting ckd development by use of sequential follow - up after donor nephrectomy and investigated the clinical roles of serum cystatin c egfrs versus serum creatinine - based egfrs . from october 2009 to december 2010 , a total of 121 healthy kidney donors underwent donor nephrectomy at our institution . preoperatively , patient medical histories were taken and all donors underwent serum tests including measurement of creatinine and cystatin c , random urine analysis , and measurement of the creatinine clearance rate by use of 24-hour urine collection . patients also underwent technetium diethylenetriaminepentaacetic acid renal scintigraphy and angio - computerized tomography for evaluation of the renovascular system . serum creatinine and cystatin c values were obtained on the 1st , 4th , and 7th postoperative day and at the 1st , 3rd , 6th , and 12th postoperative month . we used the jaffe method ( hitachi 7600 , hitachi high technologies co. , osaka , japan ) for serum creatinine measurement . serum creatinine levels were converted to egfrs by using three different gfr estimation equations : 1 ) the modification of diet in renal disease ( mdrd ) equation , mdrd egfr ( ml / min/1.73 m)=186(scr)(age)(0.742 if female ) ; 2 ) the chronic kidney disease epidemiology collaboration ( ckd - epi ) equation , ckd - epi egfr ( ml / min/1.73 m)=141min ( scr / k or 1)max ( scr / k or 1)0.9931.018 ( if female ) , where k is 0.7 for females and 0.9 for males , is -0.329 for females and -0.411 for males , min indicates the minimum of scr / k or 1 , and max indicates the maximum of scr / k or 1 ; and 3 ) the cockcroft - gault ( gc ) equation , gc egfr ( ml / min/1.73 m)=(140-age(weight in kg)(0.85 if female)/(72scr ) . serum cystatin c levels were measured by using a particle - enhanced immunonephelometric assay ( roche tinaquant cystatin c , roche cobas 6000 turbidimetry , roche diagnostics , barcelona , spain ) . we used the larsson equation for gfr estimation : cys c egfr ( ml / min/1.73 m)=77.239(1.0675cystatin c [ mg / l]-0.1 ) . if the mdrd egfr was lower than 60 ml / min/1.73 m during the follow - up , the patient was diagnosed with " chronic kidney disease " . depending on the mdrd egfr at the 6th postoperative month , we divided the patients into either the ckd group or the normal group . after institutional review board approval , we compared the preoperative and postoperative egfrs ( mdrd , ckd - epi , gc , and cystatin c ) according to the estimation method used and graphed these data on a scatter plot . we analyzed the relationship of postoperative day 4 egfr values and ckd development by using receiver operating characteristic ( roc ) curves . we used the jaffe method ( hitachi 7600 , hitachi high technologies co. , osaka , japan ) for serum creatinine measurement . serum creatinine levels were converted to egfrs by using three different gfr estimation equations : 1 ) the modification of diet in renal disease ( mdrd ) equation , mdrd egfr ( ml / min/1.73 m)=186(scr)(age)(0.742 if female ) ; 2 ) the chronic kidney disease epidemiology collaboration ( ckd - epi ) equation , ckd - epi egfr ( ml / min/1.73 m)=141min ( scr / k or 1)max ( scr / k or 1)0.9931.018 ( if female ) , where k is 0.7 for females and 0.9 for males , is -0.329 for females and -0.411 for males , min indicates the minimum of scr / k or 1 , and max indicates the maximum of scr / k or 1 ; and 3 ) the cockcroft - gault ( gc ) equation , gc egfr ( ml / min/1.73 m)=(140-age(weight in kg)(0.85 if female)/(72scr ) . serum cystatin c levels were measured by using a particle - enhanced immunonephelometric assay ( roche tinaquant cystatin c , roche cobas 6000 turbidimetry , roche diagnostics , barcelona , spain ) . we used the larsson equation for gfr estimation : cys c egfr ( ml / min/1.73 m)=77.239(1.0675cystatin c [ mg / l]-0.1 ) . if the mdrd egfr was lower than 60 ml / min/1.73 m during the follow - up , the patient was diagnosed with " chronic kidney disease " . depending on the mdrd egfr at the 6th postoperative month after institutional review board approval , we compared the preoperative and postoperative egfrs ( mdrd , ckd - epi , gc , and cystatin c ) according to the estimation method used and graphed these data on a scatter plot . we analyzed the relationship of postoperative day 4 egfr values and ckd development by using receiver operating characteristic ( roc ) curves . of 121 kidney donor patients , postoperative 6-month follow - up data were available for 80 cases . among them , 27 patients ( 33.8% ) had an mdrd egfr less than 60 ml / min/1.73 m , which is the standard definition of ckd . the patients ' mean age was 39.711.6 years , and their mean bmi was 23.22.8 kg / m . the egfr values obtained from the four different equations varied before and after the surgery , but cystatin c - based egfr values were the highest of all the methods used . this finding was consistent for the preoperative , postoperative day 4 , and postoperative 6 months data . with use of the mdrd egfr as the reference , the ckd - epi egfr had the strongest correlation with reference values ( ckd - epi egfr preoperative r=0.904 , postoperative r=0.984 ; cystatin c egfr preoperative r=0.124 , postoperative r=0.184 ; gc egfr preoperative r=0.188 , postoperative r=0.146 ) . cystatin c egfr values had a definite tendency toward being the highest among the four egfrs evaluated at all time points . for those who had an mdrd postoperative day 4 egfr less than 60 ml / min/1.73 m , the chance of acquiring ckd ( gfr<60 ml / min/1.73 m at postoperative 6 months ) was 89.0% . the probability was 66.0% when the ckd - epi egfr was used , 74.0% with the gc egfr , and 57.1% with use of the cystatin c egfr ( table 2 ) . in contrast , a cystatin c egfr below 60 ml / min/1.73 m at postoperative day 4 predicted ckd at 6 months with a specificity of 90.3% , which was the highest among the estimation methods used . we generated an roc curve by using the sensitivity and specificity data for ckd prediction derived from each egfr method ( fig . the area under the curve of the mdrd egfr was 0.845 ( 95% confidence interval [ ci ] , 0.763 to 0.928 ) , that of the ckd - epi egfr was 0.844 ( 95% ci , 0.761 to 0.928 ) , that of the gc egfr was 0.712 ( 95% ci , 0.581 to 0.843 ) , and that of the cystatin c egfr was 0.674 ( 95% ci , 0.551 to 0.797 ) . we measured preoperative and postoperative gfrs in kidney donors by using serum cystatin c and creatinine levels . preoperative cystatin c egfrs were slightly higher than the creatinine - based egfrs , and this tendency continued throughout the postoperative follow - up period . compared with the mdrd egfr , the cystatin c egfr was more useful for predicting renal function recovery , especially for patients whose immediate postoperative renal function was marginal . we defined ckd as an mdrd postoperative 6 months egfr lower than 60 ml / min/1.73 m. when the mdrd postoperative day 4 egfr was lower than 60 ml / min/1.73 m , the chance of developing ckd was 89.0% . in contrast , among the patients whose cystatin c postoperative day 4 egfr was lower than 60 ml / min/1.73 m , only 57.1% developed ckd . regarding specificity , the mdrd postoperative day 4 egfr showed 66.7% specificity for predicting ckd development , whereas in the same patient group the cystatin c egfr demonstrated 90.3% specificity . kidney donor renal function is reported to decrease 30 to 40% after donor nephrectomy [ 1 - 3 ] . after ckd was found be an important cardiovascular disease risk factor , institutes that had used extended kidney donation criteria started to focus more on donors ' renal function during their follow - up . it is now generally accepted that scheduled gfr check - ups are mandatory for patients who have donated a kidney . creatinine - based gfr estimation is generally precise but may be affected by the kidney surgery itself during the acute compensatory period . the cystatin c egfr has the advantages described above and is also less affected by the dynamic and hyperfiltrating renal status following donor nephrectomy . on this basis , we designed a prospective study protocol to compare cystatin c egfrs with the various creatinine egfrs . previous studies have shown that serum cystatin c is comparable to serum creatinine as a marker of glomerular filtration changes after donor nephrectomy [ 12 - 14 ] . additionally , our results suggest that cystatin c may assist in predicting ckd in the immediate postoperative period . because the creatinine - based mdrd egfr had good sensitivity but poor specificity , whereas the cystatin c - based egfr had good specificity and poor sensitivity , measuring both cystatin c and creatinine during follow - up will produce a synergistically increased accuracy in predicting kidney donors ' outcomes . the higher mean cystatin c egfr values compared with creatinine egfr values can be interpreted in two ways : cystatin c egfr overestimation or creatinine egfr underestimation . we could not reach a certain conclusion in this respect because both gfr estimation methods were sufficiently reliable in the given situation . louvar et al . reported similar results in postnephrectomy donors , but they did not specify the reason . as a prospective study , our results are more reliable than previous studies using a retrospective design . however , because all laboratory results came from a single institution , the risk of laboratory error exists . there are significant differences in cystatin c measurement across laboratories even with the use of an identical assay from the same manufacturer . the ifcc working group for standardization of cystatin c has been trying to produce and characterize cystatin c reference materials . however , cystatin c has more beneficial aspects for renal function measurement compared with creatinine , and cystatin c egfr equations appear to be simpler and more accurate than creatinine - based equations . the cystatin c egfr is known to be more reliable that serum creatinine - based tests in mild kidney dysfunction . especially in the diabetic population , cystatin c was shown to be superior in detecting renal function decline in comparison with creatinine - based methods . furthermore , acute kidney injury can be detected earlier by serum cystatin c measurement than by evaluating serum creatinine . when renal function is diminished , serum cystatin c reflects gfr changes 1 or 2 days earlier than serum creatinine ; thus , cystatin c may allow earlier detection of acute renal failure . louvar et al . reported that cystatin c egfr models generally overestimate the egfr value after live donor nephrectomy . in this study , the egfr values using cystatin c were usually higher than the values of the other creatinine - based egfrs ( i.e. , mdrd , ckd - epi , and gc ) ( fig . however , controversy exists as to whether cystatin c egfr equations really overestimate the gfr compared with creatinine - based equations . the serum cystatin c concentration is independent of patient age , gender , and muscle mass . therefore , we can assume that the cystatin c - based egfr will be less biased than the creatinine - based egfr by the decreased amount of exercise and muscle mass or alteration of diet in the immediate postoperative period . also , it is still not evident whether kidney donors whose postoperative mdrd egfr is ckd level 3 possess a risk of significant medical complication equal to the general ckd population . because no decisive reports are available , a large , prospective comparison study is required to reach certain conclusions . when the cystatin c egfr value was compared with the serum creatinine - based egfr value , it overestimated the gfr in the overall follow - up period of kidney donors . however , the cystatin c egfr ( cutoff value<60 ml / min/1.73 m ) showed high prediction ability for ckd at postoperative 6 months . therefore , we believe that cystatin c egfr determination is helpful for the early detection of renal function recovery , especially for patients whose immediate postoperative renal function is marginal and who may develop ckd .

purposewe aimed to compare the cystatin c - based estimated glomerular filtration rate ( egfr ) and the serum creatinine - based egfr and to investigate the clinical roles of the cystatin c - based egfr in assessing the follow - up renal function of kidney donors.materials and methodswe enrolled 121 healthy kidney donors who underwent live donor nephrectomy between october 2009 and december 2010 in a prospective manner . serum creatinine and cystatin c were measured preoperatively and were followed after the surgery ( 1st , 4th , and 7th postoperative day and 1st , 3rd , 6th , and 12th postoperative month ) . we also compared the sensitivity and specificity of each egfr method for predicting the development of chronic kidney disease ( ckd ) after donor nephrectomy.resultsfor those who had a modification of diet in renal disease postoperative day 4 egfr of less than 60 ml / min/1.73 m2 , the probability of developing ckd was 89.0% ( chronic kidney disease epidemiology collaboration egfr , 66.0% ; cockcroft - gault egfr , 74.0% ; cystatin c egfr , 57.1% ) . a cystatin c egfr of below 60 ml / min/1.73 m2 at postoperative day 4 predicted ckd at 6 months with a specificity of 90.3% , which was the highest among the estimation methods used . cystatin c egfrs were generally higher than the creatinine - based egfrs.conclusionswe conclude that cystatin c - based estimations of the gfr are helpful for predicting the recovery of renal function in kidney donors and could be added to the follow - up protocol of kidney donors who may develop ckd , especially patients whose immediate postoperative renal function is marginal .

INTRODUCTION MATERIALS AND METHODS 1. Serum creatinine measurement and GFR estimation 2. Serum cystatin C measurement and GFR estimation 3. Data organization and statistical analysis RESULTS DISCUSSION CONCLUSIONS

acinar cell carcinoma of the pancreas is a rare tumor and account for less than 2% of all pancreatic carcinoma . recent literature review showed occasional rare cases with papillary or papillocystic growth pattern that can be mistaken for mass forming cystic neoplasms of the pancreas . cystic pancreatic tumors represent a diverse collection of tumors with varied malignant potential and clinical presentation . the general differential diagnosis includes intraductal papillary mucinous neoplasms ( ipmns ) , cystic neuroendocrine tumors , solid pseudopapillary tumor and mucinous cystic neoplasms . . the correlation of clinical , radiographic , histologic , and immunohistochemical findings would be helpful to establish the accurate diagnosis and management . a 48-year - old caucasian male presented in september 2007 with a 10-year history of intermittent epigastric pain . he reported a recent increase in frequency of the pain , but not in severity . there were no other gastrointestinal symptoms such as weight loss , melena , hematochezia , nausea , vomiting , dysphagia , change in bowel habits , or jaundice . serum amylase , lipase , and tumor markers were normal ( ca 19 - 9 : 7 ku / l , reference range : < 35 ku / l ; cea : 1.0 g / l , reference rage : 5 g / l ) . a combination of imaging studies , including transabdominal ultrasound and computed tomography ( ct ) of the abdomen and pelvis ( figure 1 ) , showed a large heterogeneous cystic lesion in the head of the pancreas measuring 10 6.9 5.5 cm displacing the second segment of the duodenum laterally . the pancreatic duct in the body and tail was only mildly dilated ( 4 mm ) , and the biliary tree was not obstructed . endoscopic ultrasound ( eus ) of the pancreatic mass was performed utilizing a linear curved array echo endoscope ( eg-3630u pentax medical co , montvale , nj ) . a large heterogeneous cystic lesion with smooth margins measuring 10 there were internal solid components adherent to the wall of the lesion but no septations . fine needle aspiration of both the cystic and solid components of the lesion was performed using a 22 gauge ; 8 cm needle ( echotip , wilson - cook medical , inc . , winston - salem , nc ) in 7 passes . approximately 2 cc of thick viscous fluid was aspirated . unfortunately , the aspirated cyst fluid was deemed unsuitable for cyst fluid analysis of cea and amylase levels . the patient underwent pancreaticododudenectomy in november 2007 pathological examination showed a large cystic lesion involving the head of the pancreas with papillary and nodular projections ( figure 2 ) . histological section showed a papillary tumor with fibrovascular cores covered by uniform cells with granular apical accentuation characteristic of acinar cell carcinoma ( figure 3 ) . by immunohistochemistry , the tumor cells were positive for cam 5.2 , amylase , trypsin ( figure 4 ) and focally for synaptophysin , and negative for vimentin , insulin , glucagons , somastostatin , and electron microscopy confirmed the presence of zymogen granules characteristic of acinar cell carcinoma . acinar cell carcinomas of the pancreas are rare tumors and account for less than 2% of all pancreatic carcinomas . the disease most often presents in the seventh decade of life , but can occur at any age . a minority of patients may develop a syndrome consisting of lipase hypersecretion characterized by subcutaneous fat necrosis , polyarthralgia , and eosinophilia . the long - term survival for acinar cell carcinoma is poor , however several studies have confirmed that the clinical course is less aggressive than that of ductal adenocarcinoma . macroscopically , acinar cell carcinoma is typically a large solid and well - circumscribed tumor with rare cystic degeneration . the literature includes rare cases of small - sized intraductal and papillary variants of acinar cell carcinoma . microscopically , these tumors exhibit papillary - shaped epithelial projections with well - formed fibrovascular cores lined by cuboidal cells with acidophlic apical granules . immunohistochemically , the tumor cells are positive for trypsin , lipase , and chymotrypsin , which are specific markers for acinar cell differentiation . by electron microscopy , these tumors exhibit characteristic zymogene granules . the current case is the first large 10 cm mass with a papillocystic pattern of acinar cell carcinoma . recently , there have been advances in the classification of pancreatic neoplasia , including the recognition and better characterization of intraductal neoplasms . in addition to the microscopic dysplastic changes seen with ductal adenocarcinoma , now referred to as pancreatic intraepithelial neoplasia , there is also a group of mass forming intraductal neoplasm , in particular , intraductal papillary mucinous neoplasms . however in female patients mucinous cystic neoplasms and solid pseudopapillery tumors are to be included in the differential diagnosis . all lesions exhibit intracystic papillary formation . cystic neoplasms of the pancreas represent a diverse collection of tumors with varied malignant potential and clinical presentation . they can be predominantly cystic or can result from cystic degeneration of a solid tumor . acinar cell carcinoma with papillocystic pattern can mimic these tumors , and attention to morphologic details , applications of immunohistochemistry and electron microscopy can be useful in establishing the accurate diagnosis . the follow - up on the few reported cases of papillocystic variant of acinar cell carcinoma in the literature showed less aggressive course than the traditional solid variant . this variant may have different biological behavior , but the number of reported cases is too small to draw a definite conclusion . the conventional imaging methods that are used to evaluate cystic lesions of the pancreas are computed tomography ( ct ) , magnetic resonance imaging ( mri ) , and endoscopic retrograde cholangiopancreatography ( ercp ) . high - resolution ct , using thin sections with both enhanced and unenhanced technique , provides detailed information about cyst structure and may facilitate characterization of these lesions . mri has the potential added advantage of determining communication between the cyst and pancreatic duct . ercp is invasive but is more effective in visualizing the ductal anatomy . despite the advancement in cross - sectional imaging technologies , eus on the other hand provides more detailed images of both pancreatic parenchyma and ductal anatomy at the same time , and also permits sampling of cyst fluid , mass lesions , and lymph nodes . for pancreatic carcinoma , eus appears to be superior to conventional imaging including ct , mri , ercp , and angiography , particularly for small masses less than 2 - 3 cm in diameter . it has been reported in several studies that eus has a sensitivity of over 95% for imaging pancreatic tumors 2 cm or less in diameter for pancreatic cystic lesions , a recent prospective , multicentre study of 112 cysts diagnosed by surgical resection or positive fna found a cyst fluid cea level of 192 ng / ml to be accurate in differentiating mucinous from nonmucinous pancreatic cysts ( sensitivity 75% and specificity 84% ) . acinar cell carcinoma rarely exhibit papillary or papillocystic pattern , and , therefore , fall into the challenging differential diagnosis of papillary and cystic pancreatic tumors . the correlation of clinical , radiographic , histological , and immunohistochemical findings would be helpful to distinguish such a tumor from other pancreatic papillary lesions as they carry different prognostic outcome .

acinar cell pancreatic carcinoma is a rare solid malignant neoplasm . recent review of the literature showed occasional cases with papillary or papillocystic growth patterns , ranging from 2 to 5 cm in diameter . we report a large 10 cm pancreatic tumor with papillocystic pathology features involving the pancreatic head . the growth pattern of these tumors could be mistaken for intraductal papillary mucinous tumors or other pancreatic cystic neoplasms .

1. Introduction 2. Case Presentation 3. Discussion 4. Conclusion

sternocleidomastoid tumor of infancy ( scmi ) , also known as fibromatosis colli or muscular fibromatosis of infants , is a benign self limiting fibroblastic lesion involving body of sternomastoid muscle . this lesion is very rare , around 0.4% live birth.[13 ] however , scmi is the most common cause of congenital muscular torticollis accounting for 10 - 20% of the cases . the lesion characteristically manifests between the second and eight weeks of life as firm , fusiform , nontender mass of 2 - 3 cm diameter involving mid or lower part of sternocleidomastoid muscle . the right side is more commonly affected than left and males are affected more than females . management of scmi in majority of cases being conservative , fine - needle aspiration cytology ( fnac ) , as a minimally invasive cost effective and time saving outdoor diagnostic procedure , has an important role to play . the differential diagnosis includes various congenital , inflammatory lesions , neoplastic conditions- both benign and malignant and other forms of infantile fibromatosis that may occur at that site . the diagnosis of scmi is based on characteristic clinical presentation and cytological features that discriminates it from others . we report a case of two - month - old baby diagnosed as scmi on cytology . a two - month - old male child presented with firm fusiform swelling on anterior aspect of neck on right side measuring 2 2 cm . the obstetric history of mother revealed that there was prolonged labor and the baby was delivered by forceps extraction . fnac was performed from the swelling with 23 g needle and 10 ml plastic disposable syringe . the wet smears were fixed in 95% ethanol and processed for papanicolaou stain and the air dried smears were stained with may - grnwald - giemsa stain . microscopy showed moderately cellular smear composed of oval to spindle shaped fibroblastic cells scattered singly or in loose cohesive clusters . cells were having plump oval to spindle nuclei with wispy cytoplasm [ figure 1 ] . background was clean with focal areas showing myxoid material [ figure 2 ] . based on above cytological finding , a diagnosis of sternocleidomastoid tumor of infancy was suggested , and the patient was managed conservatively . clusters of spindle shaped fibroblast with wispy cytoplasm along with multinucleated giant muscle cell ( pap stain , 400 ) myxoid background substances with scanty cellularity representing collagen ( pap stain , 400 ) sternomastoid tumor of infancy is a rare and self limiting entity and has characteristic clinical presentation such as age , sex , site of lesion and history of birth trauma . the different theories proposed to explain the pathogenetic mechanism , include fetal malposition , birth trauma , ischemic necrosis following vascular compression during birth , infection and presence of endogenous factor . a well recognized association between scmi and primiparous birth , breech presentation , forceps deliveries and difficult labour are found . the lesion is often diagnosed clinically by its classical presentation and physical examination . the clinical differential diagnosis includes various congenital lesions such as branchial cyst , thyroglossal cyst and inflammatory condition like tuberculous lymphadenitis , benign neoplastic condition like hemangioma , cystic hygroma and malignant neoplasm like neuroblastoma , rhabdomyosarcoma and lymphoma . radiologic imaging modalities such as ultrasonography and computed tomography are helpful in locating the exact tumor site and in differentiating solid and cystic nature of the lesion . surgical diagnostic biopsy may result in complication such as cosmetic defect due to contracture band and is reserved for difficult cases . fna cytology is a time saving cost effective reliable diagnostic procedure , and as in this case helped to avoid more invasive procedures . cells are predominantly slender , spindle to oval with wispy cytoplasm and nuclei having fine granular chromatin with small to medium sized nucleoli . atrophic degenerated skeletal muscle , multinucleated giant cells and collagen fibres are seen in varying numbers . mitoses are hardly seen.[17 ] the cytological differential diagnosis includes all types of benign proliferation of infancy . low grade fibrosarcoma / infantile fibrosarcoma rarely affects neck region and shows considerable cellularity and atypia . fnac is a safe , minimally invasive , rapid and reliable diagnostic modality for diagnosing sternocleidomastoid tumor of infancy .

sterocleidomastoid tumor of infancy ( scmi ) , also known as fibromatosis colli of infancy , is a benign , self limiting disease of new born characterised by its classical history and clinical presentation of firm to hard fusiform mass in the lower and middle portion of sternocleidomastoid . scmi often appears during early perinatal period between second to fourth weeks of life . a well recognized association between scmi and primiparous birth , breech presentation , prolonged difficult labor and forceps deliveries is found . cytology shows spindle shaped mature fibroblastic cells scattered singly along with degenerated and multinucleated giant muscle cells in a clean background . it is important to differentiate this lesion from different forms of infantile fibromatosis . fine - needle aspiration cytology ( fnac ) , as a time saving , rapid and reliable diagnostic procedure , has got bigger role to play in reassurance of anxious parents , guiding for conservative management and avoiding surgery .

Introduction Case Report Discussion

dry eye syndrome ( des ) is a multifactorial disease of the functional lacrimal unit , formed by lacrimal gland , adnexae , tear film , and ocular surface . dry eye alters and damages corneal and conjunctival epithelium , producing specific symptoms and visual disturbances . in dry eye patients , the ocular surface becomes diffusely irregular with consequent differentiation of the epithelial cells . des can produce an irregularity of corneal epithelial continuity with punctate or widespread defects . in conjunctiva the exact mechanism by which these changes occur has not been clarified , but it may be linked to hyperosmolar tear film stress . the osmotic stress causes a modification of corneal epithelium which determines an increase of the stratum corneum , precursors of cellular coating . chronic inflammation and hyperosmolarity play an important role in the genesis and maintenance of dry eye , since they are both the cause and the consequence in a pathological self - renewing cycle . the osmolarity of the tear film is determined by the presence of cations ( sodium , potassium , calcium , magnesium , and iron ) and anions ( chloride , bicarbonate , and phosphate ) . it has been shown that the cellular hypertonicity of different organisms could be compensated by compatible solutes , which balance the osmotic pressure and do not interfere with cellular metabolism . these solutes include amino acids , carbohydrates , methylamine , and urea [ 4 , 5 ] . these molecules are used by cells to introduce liquids in the intracellular area and maintain cellular volume . experimental data , obtained on cultured corneal epithelial cells , show that compatible solutes , as l - carnitine , erythritol , and betaine , can suppress matrix metalloproteinase ( mmp ) production and activation and expression of proinflammatory cytokines ( tnf- , il-1 , and il-6 ) and chemokines ( il-8 , ccl2 , and ccl20 ) without any modifications of cellular metabolism . in fact , they are able to hydrate and induce an osmoprotective effect on the ocular surface . these macromolecules introduce liquids in the intracellular area producing a direct hydration and a natural osmoprotection [ 6 , 8 ] . the aim of this study is to investigate , in vivo and ex vivo , ocular surface alterations and inflammation in des and modifications related to the use of compatible solutes eye drops . this study was conducted at the department of medicine and ageing science of the g. d'annunzio university of chieti - pescara , italy . the protocol used was approved by the institutional review and the study was conducted in concordance with the tenets of the declaration of helsinki . informed consent was obtained from all the participants after explanation of the nature and the possible consequences of the study . 48 eyes of 24 patients , 15 women and 9 men , age range 1964 years , affected by des have been recruited . inclusion criteria were as follows : current use of artificial tears , schirmer i test < 8 mm , and tear break - up time ( tbut ) < 8 seconds . exclusion criteria were as follows : age < 18 years , pregnant or lactating women , ocular surgery within the last three months , presence of eye infection , presence of glaucoma , and inadequate lid closure . recruited patients were treated by using a combination of sodium carboxymethylcellulose ( 0.5% ) and glycerol ( 0.9% ) eye drops ( optive , allergan inc . ) 4 times daily for 90 days in one randomly selected eye , and the comparator eye ( control eye ) underwent therapy with sodium hyaluronate 0,2% eye drops ( hylogel , visufarma spa ) 4 times daily for 90 days . patients were followed up at 30 , 60 , and 90 days . at the baseline and follow - up visits , the following parameters have been assessed : schirmer i test , tbut , lissamine green staining of the ocular surface graded by the lemp classification , in vivo confocal microscopy ( ivcm ) , and impression cytology of bulbar conjunctiva . at each follow - up visit , microscopic assessment of the ocular surface epithelial health was performed by using ivcm ( rostok cornea module - hrt 2 , heidelberg ) . in each eye examined , at least 100 images of corneal epithelium and 100 images of conjunctival bulbar epithelium in nasal and temporal sector were acquired . the analysed parameters were regularity of the corneal and conjunctival epithelium and evaluation of inflammation within the ocular surface . the presence of inflammatory cells in subepithelial layer and anterior stroma was considered as a marker of inflammatory activation . jose , ca ) was used to define picks of reflectivity from confocal microscopy images . stromal reflectivity was considered an indirect sign of the presence of oedema and keratocyte activation . conjunctival impression cytology samples were collected at each follow - up visit using millicell - cm 0.4m ( millipore , bedford , ma ) and the cells were fixed with cytology fixative ( biofix , bio optica , milano , italy ) . the millicell membranes were hydrated with distilled water ; 80% alcohol was added for 2 min . the membranes were washed in distilled water and phosphate buffered saline ( pbs ) was added for 2 min , followed by 2 washes with wash buffer ( dako , glostrup , denmark ) of 2 min each . louis , mo ) diluted 1 : 290 in pbs was incubated for 20 min at room temperature . the specimens were washed and pbs - bsa 1% was added for 1 hour at room temperature . finally , mmp9 antibody ( dako ) diluted 1 : 50 and il6 antibody ( abcam , cambridge , uk ) at 1 : 200 both in antibody diluent ( dako ) were incubated overnight at 4c . samples were washed and anti - rabbit alexa fluor 488 ( invitrogen , san giuliano milanese , italy ) diluted 1 : 200 and propidium iodide at 1 : 150 were added and incubated for 1 hour at room temperature . membranes were mounted with a drop of fluorescent mounting medium ( dako ) and zeiss confocal lsm 510 ( carl zeiss microimaging gmbh , vertrieb , germany ) was used to visualize the cells . positive ( red nucleus and green cytoplasm ) and negative ( red nucleus ) cells were counted and the positivity percentage was calculated . all evaluations of impression cytology specimens were performed by two independent observers masked to the details of the staining technique used . differences in markers expression for selected antigens were assessed using the student unpaired t - test ( graphpad prism 5 , graphpad software , san diego , ca ) . schirmer i test and tbut did not show a significant modification during the follow - up period , either in optive or in hylogel treated eyes ; moreover , no significant differences were revealed between the two groups . lissamine green staining of the ocular surface evaluated by means of lemp classification showed a significant improvement of ocular surface epithelial regularity in both groups at the end of follow - up period . the morphology of corneal and conjunctival epithelia showed an improvement during the follow - up period . comparing baseline images with findings at 30 , 60 , and 90 days after treatment , a decrease in reflectivity of superficial cells stromal reflectivity showed a significant decrease both in optive group ( p = 0,0009 ) and in hylogel group ( p = 0,0400 ) at the end of follow - up period . moreover , a significant difference was observed at 90 days comparing the two treatment groups ( p = 0,0009 ) ( figure 2 ) . mmp9 expression was significantly downmodulated in optive treated eyes at 30 ( p = 0,0018 ) and 60 and 90 ( p < 0,0001 ) days of therapy when comparing the two treatment groups ( figure 4(a ) ) . comparing the variations of the expression of mmp9 from day 0 to day 90 , a gradual but strong reduction was achieved in optive group ( p < 0,0001 ) , while no significance was observed in hylogel treated eyes ( figure 4(a ) ) . il6 positivity in conjunctival samples revealed significant differences between optive and hylogel group when observed 30 ( p < 0,0001 ) , 60 ( p < 0,0001 ) , and 90 days ( p < 0,0001 ) after treatment ( figure 4(b ) ) . moreover , a significant reduction was achieved among optive treated eyes during all of the follow - up period ( day 0 versus 90 p < 0,0001 ) , while no modifications were observed in hylogel group ( figure 4(b ) ) . hyperosmolarity represents an inflammatory stress to the limbal and corneal epithelium , inducing the expression of proinflammatory cytokines and metalloproteinase which produce an increase of desquamating cellular processes and nucleus / cytoplasm ratio and a reduction of cellular interconnections . tear film osmolarity depends on the dynamic modification of the tear film balance resulting from the production , retention , and elimination of tears . the increase of tear film osmolarity determines a reduction of conjunctival goblet cells , responsible for mucin production with consequent epithelial damage . an in vivo study on mice , testing the effect of topical application of betaine , l - carnitine , and erythritol , showed a significant reduction in number of tunel - positive cells and expression of inflammatory mediators . as already observed by wei and colleagues , the inflammatory mediators associated with des pathogenesis can be divided as follows : ( i ) ubiquitous inflammatory cytokines , ( ii ) th1- and ( iii ) th17-related cytokines , ( iv ) chemokines and their receptors , ( v ) metalloproteinase , and ( vi ) secretory phospholipases . mmp9 is the most important gelatinase present on the ocular surface , and its levels seem to be higher in tears of patients with dry eye . moreover , mmps are responsible for the extracellular matrix destruction observed in various diseases as arthritis , cancer , and autoimmune disorders [ 18 , 19 ] . under stress conditions , such as hyperosmolarity furthermore , mmp9 has been demonstrated to accelerate corneal epithelial regeneration in the healing process by modulating the inflammatory response . therefore , the increase of mmp9 activity on the ocular surface can amplify the chronic immune - based inflammation of dry eye . in our study , the downmodulation of mmp9 expression in compatible solutes treated eye is linked to a clinical improvement of the ocular surface epithelia , suggesting a key role of mmp9 in the physiopathology of the disease . the increased il6 levels in the ocular epithelium indicate an active immune state of the microenvironment . in sjgren syndrome , the ocular surface epithelium is a target of the autoimmune process , and increased levels of il6 could be referred to as the direct involvement of the conjunctiva in the pathogenic mechanism of the disease , indicating a relevant role in ocular surface inflammatory damage . our data showed a decreased positivity for il6 induced by osmoprotective treatment , suggesting an active downmodulation of inflammatory response . the expression of mmp9 and il6 in dry eye patients may indicate that inflammatory mechanisms play a synergistic role in the development of the disease . the osmoprotectants compatible solutes , alone or in combination , were found to protect against stress activation of corneal epithelial cells cultured in hyperosmolar media [ 68 ] . clinical studies on human subjects suffering from des evidenced a noninferior efficacy and safety of the osmoprotective compatible solutes therapy with respect to standard sodium hyaluronate treatment . in vivo confocal microscopy and immunofluorescence staining of impression cytology specimens were previously used in combination to assess modifications of conjunctival and corneal epithelia due to aging or limbal pathologies [ 25 , 26 ] . several discordant results are reported in literature about the real effect of hyaluronic acid compounds and optive on but and schirmer test values [ 24 , 2732 ] ; however , difference in inclusion criteria , molecules concentration , and daily dosage may explain the variability of the outcome . in our results , no changes were observed in but and schirmer test values in both treatment groups , suggesting that both therapies are not able to increase the quantitative production of tears or to improve the lipidic component of the tear film . this finding may be related to our inclusion criteria of enrolled patients suffering from severe form of des . the real clinical effect of osmoprotection on ocular surface is therefore represented by an improvement of epithelia regularity as a consequence of better and specific inflammation control . in conclusion , the ex vivo results of this study indicate that treatment based on compatible solutes eye drops in des determines better control of ocular surface inflammatory activation , with respect to hyaluronic acid therapy . the effect of the decrease of inflammation is revealed in vivo by an improvement of corneal and conjunctival epithelium morphology together with a reduction of corneal stromal reflectivity . in view of this data , osmoprotective approach can represent , alone or in combination , a valid strategy in des management .

the aim of this study is to investigate in vivo and ex vivo ocular surface alterations induced by dry eye disease and modification after osmoprotective therapy . forty - eight eyes of 24 patients suffering from dry eye have been recruited . all patients received optive ( compatible solutes ) eye drops in one randomly selected eye and hylogel ( sodium hyaluronate 0,2% ) in the other . follow - up included a baseline visit and further examination 30- , 60- , and 90-day intervals ( which comprises clinical evaluation , in vivo confocal microscopy ivcm of the ocular surface , and conjunctival impression cytology ) . no significant difference in schirmer i test , tbut , and vital staining results was observed during the follow - up period in both groups . ivcm showed in all patients an improvement of ocular surface epithelial morphology and signs of inflammation ( oedema and keratocyte activation ) . however , these modifications were more evident in patients treated with optive therapy . a significant reduction of the expression of mmp9 and il6 in optive group was observed during the follow - up period in comparison to hylogel treatment . our results show that in dry eye disease therapy based on osmoprotective eye drops determines a reduction of inflammatory activation of ocular surface , with consequent improvement of the quality of corneal and conjunctival epithelium .

1. Introduction 2. Material and Methods 3. Results 4. Discussion 5. Conclusions

central serous chorioretinopathy ( csc ) is a disease characterized by an idiopathic serous neurosensory retinal detachment secondary to leakage from the retinal pigment epithelium ( rpe ) . from eighty to ninty percent of csc regresses spontaneously over several months , but recurrence is observed in 33% to 50% of eyes [ 1 , 2 ] . in spite of the many studies of csc , there is continued controversy in the literature on the need , time , and method of treatment . due to rapid developments in modern imaging methods , it is possible to better understand changes in the retina and their influence on functional results after resolution of subretinal fluid in csc . spectral optical coherence tomography ( sd - oct ) enables a highly detailed in vivo evaluation of the individual retina layers , especially the external limiting membrane ( elm ) and the junction of inner and outer segments of photoreceptors [ 3 , 4 ] . the development of sd - oct technology in recent years has resulted in various authors noting that persistent leaks and subretinal fluid may cause rpe alterations and photoreceptor changes , which may correlate with worse visual acuity [ 57 ] . the aim of the current study is to analyze the microstructural changes in the elm and photoreceptor layer before and after early and late conventional laser treatment for csc . a retrospective observational study included group a , 19 patients ( 19 eyes ) with symptomatic acute csc ( duration < 6 months ) and group b , 16 patients ( 16 eyes ) with symptomatic chronic csc ( duration 6 months ) . treatment was carried out with a slit - lamp - mounted green light laser ( iris gl medical , iridex corp . , mountain view , ca , usa ) using a fundus noncontact lens volk 78 . the parameters were spot size : 100200 m , time : 0.1 s , and mean power used : 110 mw ( 70140 mw ) minimal grey retinal discoloration . the power to deliver burn in the leakage side was determined by test spots in the superotemporal quadrant . exclusion criteria were leakage side in the avascular zone < 500 m from the fovea , previous laser treatment , pdt , ttt or anti - vegf injection , any ocular diseases ( vascular diseases , diabetic retinopathy , retinal detachment , ocular inflammation , etc . ) , or use of corticosteroids . all patients were interviewed and underwent ophthalmologic examinations prior to treatment and 1 , 2 , and 12 months after laser treatment . examinations included : bcva using standard snellen eye charts , intraocular pressure , anterior segment and fundus examination with volk 78d and 90d lenses ( volk optical inc . , mentor , oh , usa ) , and sd - oct analysis ( spectralis ; heidelberg engineering , heidelberg , germany ) with 3.9 m axial resolution and transverse resolution of 14 m . in each patient , we performed horizontal line scan through the fovea and made 19 b - scans on an area of 4.5 6 mm . in the experiment , we derived a medium value from three measurements performed for each patient . we compared the manual measurement performed by 2 ophthalmologists , and the results did not differ more than 5 m and were repeatable . additionally , fluorescein angiography was performed before laser treatment and 12 months after laser treatment . photoreceptor length was measured as the distance between the external limiting membrane ( elm ) and the most protruding outer segment of photoreceptors . retinal thickness was measured as the distance between internal limiting membrane ( ilm ) and the most protruding outer segment of photoreceptors . the value of subretinal fluid in the centre of the fovea was also recorded . in sd - oct , the fovea is recognized as the characteristic foveal depression where there is a lack of the following retinal layers : nerve fiber layer , ganglion cell layer , inner nuclear layer , and inner plexiform layer . statistical analyses were carried out using pearson product - moment correlation coefficient , friedman 's analysis of variance , cochran 's q test , fisher 's exact test , wilcoxon rank - sum test , and mixed - effects generalized linear models ( glms ) . all analyses were conducted using stata 12.1 special edition ( statacorp lp , college station , texas usa ) . in group a , the mean age of the 19 patients was 36.7 5.5 years . the mean age of the 16 patients in group b was 48.8 8.0 years . the mean visual acuity before laser treatment was 0.77 0.16 in group a and 0.51 0.20 in group b ( p = 0.0007 wilcoxon rank - sum test shows a statistically significant difference in visual acuity prior to treatment between group a and group b ) . the visual acuity was correlated significantly with the subretinal fluid , upon its resolution , in group a only ( r = 0.50 , p = 0.0287 pearson product - moment correlation coefficient ) ; in group b , the respective correlation was not substantial ( r = 0.14 , p = 0.6062 ) . descriptive statistics on the following variables : length of the photoreceptors ( the distance between external limiting membrane ( elm ) and the most protruding outer segment of photoreceptors ) , retinal thickness ( the distance between internal limiting membrane ( ilm ) and the most protruding outer segment of photoreceptors ) , and subretinal fluid in the centre of the fovea ( measured before laser treatment 1 month and 12 months after laser treatment ) are shown in table 1 . hyperreflective subretinal deposits in 3 eyes in group a and in 14 eyes in group b demonstrated a noticeable bulge in the rpe before treatment ( p < 0.0001 fisher 's exact test ) . during the first follow - up examination , one month after laser treatment , 16/19 eyes in group a showed complete absorption of subretinal fluid whereas 11/16 eyes in group b showed residual subretinal fluid ( p = 0.004 fisher 's exact test ) . two months after laser treatment , all eyes in group a ( 19/19 eyes ) showed complete absorption of subretinal fluid , whereas 2 eyes in group b showed residual fluid ( p = 0.19 fisher 's exact test ) . one month after laser treatment , hyper - reflective subretinal deposits in 3 eyes in group a demonstrated a noticeable bulge in the rpe . however , after 12 months , the rpe was flat in all eyes ( figure 1 ) . in group b , hyper - reflective subretinal deposits demonstrated a noticeable bulge in the rpe in 14 eyes at 1 month after laser treatment which still persisted in all of those eyes after 12 months ( p < 0.0001 fisher 's exact test ) ( figure 2 ) . twelve months after laser treatment , no patients in group a had noticeable photoreceptor and elm defects ( figure 1 ) , but 15 eyes in group b presented photoreceptor and elm defects ( p < 0.0001 fisher 's exact test ) ( figure 2 ) . twelve months after laser treatment , no patients in group a had noticeable subretinal fluid , but 2 eyes in group b showed residual fluid ( p = 0.19 fisher 's exact test ) . the subretinal fluid absorption varied significantly over time ( before laser treatment and one month and 12 months after laser treatment ) in both investigated groups ( p < 0.0001 in group a , and p = 0.0001 in group b , cochran 's q test ) . however , the laser treatment was to be more effective , in the context of subretinal fluid absorption , in group a in comparison to group b ( p = 0.0010 mixed - effects glm ) . no recurrence was found in either group a or b. no complications were detected in group a. however , 12 months after laser treatment , cnv developed in 1 eye in group b. changes in the length of the photoreceptors and subretinal fluid took place in a very similar pace and direction , both in group a and in group b ( table 1 ) , except for the retinal thickness , where fluctuations were more distinct in group a compared to group b ( p = 0.0132 mixed - effects glm ) , and the visual acuity a larger improvement was observed also in group a versus group b ( p < 0.0001 mixed - effects glm ) . at the final follow - up visit , 12 months after laser treatment , the mean visual acuity in group a was 0.94 0.09 and 0.71 0.17 in group b ( p < 0.0001 wilcoxon rank - sum test ) . there was a fitted model in which the visual acuity played the role of dependent variable , and repeated measures ( before laser treatment and one month and 12 months after laser treatment ) , group a versus group b along with the length of the photoreceptors , subretinal fluid , and retinal thickness were set as the independent variables . apart from the above - mentioned noticeable changes over a 12-month follow - up and between - group differences , the improvement of visual acuity was determined in both examined groups by appropriate retinal thickness ( p = 0.0101 mixed - effects glm ) and observed diminution of the length of the photoreceptors ( p = 0.0266 mixed - effects glm ) . analyzing and comparing the results from both groups of patients ( acute and chronic csc ) prior to laser therapy did not reveal significant differences in the thickness of the retina , elevation of neurosensory retina , or microstructural changes of the retina . during the 12 months of observation after laser treatment , subretinal fluid when analyzing the photoreceptor layer in detail , defects were noted after laser treatment in 93% of eyes with chronic csc but not noted in any case with acute csc at the final examination . defects in the photoreceptor layer conditioned visual acuity , which was statistically better after laser treatment in the group with acute csc in comparison to the chronic csc . analysis of these results supports other authors , according to whom if subfoveal fluid persisted more than 4 months foveal atrophy may occur anytime , and degenerative changes often develop in the macula in csc cases lasting longer than 6 months ; these changes correlate with visual acuity . we also observed that retinal thickness and subretinal fluid correlated significantly with visual acuity 12 months after treatment only with chronic csc . analyzing the length of the outer layer of photoreceptors before laser treatment in the acute and chronic csc groups ( no significant differences existed between these groups ) showed its elongation in relation to healthy eyes , as previously reported by matsumoto et al . . damage to the photoreceptor layer in patients with chronic csc was found only after laser treatment and absorption of subretinal fluid . it was not possible to evaluate any irreversible changes that had already occurred in the photoreceptor layer during active csc . elongation of the outer segments of photoreceptors may be due to a lack of photoreceptor phagocytosis by the rpe , while the duration of the elongation of this layer may affect the simultaneous initiation of photoreceptor apoptosis . spaide hypothesized that increased autofluorescence may represent an photoreceptor outer segments phagocytized by the rpe . one month after laser treatment , only 3/18 eyes in the acute csc group had hyper - reflective subretinal deposits ( which were no longer present at the 12-month followup ) . therefore , photoreceptor outer segment phagocytosis by rpe does not seem prevalent at the onset of csc . however , subretinal precipitates , indicating phagocytosis , were found in 13/15 eyes in chronic csc one month after laser treatment ( and were still present at the 12-month followup ) . furthermore , photoreceptor defects were found after laser treatment in 93% of eyes with chronic csc indicating photoreceptor apoptosis . these facts suggest that both findings develop after the patients have had csc for some time . thus , a benefit of laser therapy for acute csc may be that it limits the process of outer segment photoreceptor phagocytosis and apoptosis , which correlates with better visual acuity in the acute csc patient group ( p < 0.0001 ) . in summary , microstructural changes of the retina shown in sd - oct during active csc show no statistically significant correlation to the duration of the disease . however , after laser treatment subretinal fluid absorption takes less time in patients with acute csc . photoreceptor and elm defects were found in most patients with chronic csc ( p < 0.0001 ) . damage of the photoreceptor layer and elm in patients with chronic csc was found only after laser treatment and the absorption of subretinal fluid . an effect of these factors is that early laser treatment for csc results in better visual acuity than late laser treatment ( p < 0.0001 ) . early laser treatment may cause early resolution of csc , which may prevent situations in which about 10%20% of eyes did not heal spontaneously [ 1 , 2 ] .

purpose . to analyze microstructural changes in the external limiting membrane ( elm ) and photoreceptor layer before and after early and late conventional laser treatment in central serous chorioretinopathy ( csc ) in 12 months follow - up study . methods . a retrospective observational study included group a : 19 patients ( 19 eyes ) with symptomatic acute csc and group b : 16 patients ( 16 eyes ) with symptomatic chronic csc . retinal microstructural changes were analyzed with sd - oct paying a particular role in examining the photoreceptor layer and elm . results . the length of the photoreceptors , prior to treatment , was approximately 84 m in group a and 82,5 m in group b. twelve months after laser treatment , photoreceptor length was approximately 49 m in group a and 43 m ( range 2055 m ) in group b. no patients in group a had noticeable photoreceptor defects nor elm defects , but in 15 eyes in group b photoreceptor and elm defects were detected ( p < 0.0001 ) . conclusions . when analyzing the photoreceptor layer and elm during active csc , it is not possible to evaluate any irreversible changes which have already occurred in this layer . damage to the photoreceptor layer and elm in patients with chronic csc was only found after laser treatment and the absorption of subretinal fluid .

1. Introduction 2. Material and Methods 3. Results 4. Discussion 5. Conclusions

systemic lupus erythematosus ( sle ) is one of the systemic autoimmune diseases characterized by the production of autoantibodies to cellular constituents . autoantibodies are widely used as biomarkers in many types of autoimmune diseases and other diseases such as cancer . one of the most important research areas in which autoantibodies are used is diseases diagnosis . besides its use in diagnosis , the detection of autoantibodies can also provide information about clinical manifestations or prognosis of some autoimmune diseases . the study on biological functions of autoantibody or its antigens can provide us with a better understanding of the mechanism of pathogenesis of autoimmune diseases and thus may give us new insights into the new strategies in autoimmune diseases treatment . some autoantibodies are considered to be highly specific to sle , such as anti - sm and antiribosomal p. however , these autoantibodies are present in only about 15% and 10% of sle patients , respectively [ 2 , 3 ] . though anti - dsdna antibodies are found to be highly presented in sle patients with prevalence of about 70% , its level fluctuates significantly according to disease activity and treatment . patients with sle are still heterogeneous in clinical manifestations and serological characteristics . more new autoantibodies in sle still need to be identified in order to further classify this disease or to better understand its pathogenesis . the human homologue of the mouse double minute 2 ( mdm2 ) , also known as e3 ubiquitin - protein ligase , is known to degrade several central cell cycle regulators including p53 and retinoblastoma ( rb ) protein which are involved in important processes such as cell apoptosis . it was interesting that dna viruses can specifically induce mdm2 expression and then cause b cell lymphoma . this is a mechanism that might contribute in a similar manner to lymphoproliferation in sle induced by self - dna . it was further demonstrated that cytosolic dna can trigger the expression and activation of mdm2 . in mrl - fas mice , an animal model of sle , the expression level of mdm2 was found to be increased and to correlate with disease progression , which provides us with a new molecular target in sle . since abnormally expressed proteins can induce autoimmune response , overexpression of mdm2 in lupus may trigger the production of autoantibody which may serve as a new serologic marker in sle . in this study , we investigated the presence of autoantibody to mdm2 in sera of sle patients and normal human sera ( nhs ) . we found that autoantibody to mdm2 was highly presented in sle patients , which may be used as a new serological marker or therapeutic target in sle . in the current study , 69 normal human sera ( nhs ) and 43 sle patient sera were examined . these sera were obtained from the serum bank of cancer autoimmunity and epidemiology research laboratory at university of texas at el paso ( utep ) , which were originally provided by our clinical collaborators . the diagnosis of sle was established according to the american college of rheumatology criteria [ 8 , 9 ] . mdm2 and p53 cdnas were subcloned into pet28a vector producing fusion proteins with nh - terminal 6x histidine and t7 epitope tags . recombinant protein was further expressed in e. coli bl21 ( de3 ) and then purified using nickel column chromatography ( qiagen , valencia , usa ) . reactivities of the purified recombinant protein have been analyzed by electrophoresis on sds - page and determined with polyclonal anti - mdm2 antibody ( genetex , irvine , usa ) . standard protocol for elisa was conducted as described in our previous study . in brief , a 96-well microtiter plate was coated with recombinant mdm2 or p53 protein overnight at 4c with a final concentration of 0.5 g / ml in phosphate - buffered saline ( pbs ) . the antigen - coated wells were blocked with gelatin postcoating solution at room temperature for 2 h. human sera were diluted at 1 : 100 and then incubated for 2 h at room temperature in the antigen - coated wells , followed by hrp - conjugated goat anti - human igg . the substrate 2,2-azino - bis-3-ethylbenzo - thiazoline-6-sulfonic acid ( abts , sigma - aldrich , st . the average optical density ( od ) value at a wavelength of 405 nm was applied as data analysis . the cutoff value used to designate a positive sample was the mean od value of 69 nhs + 2sd . denatured recombinant mdm2 protein was electrophoresed on 10% sds - page and transferred to nitrocellulose membranes . after blocking in pbs with 5% nonfat milk and 0.05% tween-20 for 1 h at room temperature , the nitrocellulose membrane was incubated overnight with 1 : 200 dilution of human sera at 4c . hrp - conjugated goat anti - human igg ( santa cruz , usa ) was then applied as secondary antibody at a 1 : 10,000 dilution . the immunoreactive bands were detected by ecl kit according to the manufacturer 's instructions ( thermo scientific , waltham , usa ) . the diluted sle sera ( 1 : 80 ) were incubated with recombinant protein mdm2 ( final concentration of recombinant proteins in the diluted human sera was 0.01 g/l ) overnight at 4c and then centrifuged at 10,000 g for 15 min . antigen substrate for iifa test system was incubated with diluted sera ( 1 : 80 ) and preabsorbed sera overnight at 4c . fitc - conjugated goat anti - human igg was then used as secondary antibody at a 1 : 100 dilution . the frequency of autoantibody to mdm2 in the sera was compared using the test with fisher 's exact test . serum level of autoantibody to mdm2 in sle patients and normal human sera was determined by elisa . the mean titer of autoantibody to mdm2 was significantly higher than that in nhs ( figure 1 ) . we then used the mean od value plus 2sd of nhs as the cutoff value to determine the frequency of anti - mdm2 autoantibody positive sera in these three groups . the frequency of anti - mdm2 positive sera was significantly higher in sle patients group ( 23.30% ) than nhs group ( 4.30% ) ( table 1 ) . in order to confirm the presence of anti - mdm2 in sle patients , anti - mdm2 autoantibody positive sera these sera also had strong reactivity with mdm2 recombinant protein in western blotting analysis ( figure 2 ) . to further confirm the reactivity of autoantibodies against mdm2 in sle sera and the intracellular localization of mdm2 , commercially available hep-2 cell slides were used in indirect immunofluorescence assay to examine anti - mdm2 autoantibody positive sle sera . as shown in figure 3 , the anti - mdm2 positive sera had the nuclear staining patterns , while the normal human serum had very weak staining . the fluorescent staining was significantly reduced when the same serum was preabsorbed with recombinant anti - mdm2 protein . since mdm2 has been demonstrated as an important negative regulator of p53 and anti - p53 was also been reported to be found in sle patients , whether there was an association between anti - mdm2 and anti - p53 is still unknown . we further investigated the presence of anti - p53 in these sle patients by elisa . we used the mean od value + 2sd of nhs as the cutoff value to determine the frequency of anti - p53 autoantibody positive sera . consistent with results reported in other studies , the frequency of anti - p53 positive sera was significantly higher in sle patients group ( 39.50% ) than nhs group ( 5.90% ) ( figure 4 ) , and the titer of anti - mdm2 was positively correlated with anti - p53 ( figure 5 ) . the present study showed that anti - mdm2 autoantibody was presented in 23.30% sle patients , significantly higher than normal heathy humans . this suggests that the anti - mdm2 autoantibody might be used as a new serologic marker for sle . the mdm2 protein ( also known in humans as hdm2 ) was first identified as the product of a gene amplified over 50-fold on acentromeric extrachromosomal bodies ( called double minutes ) found in a 3t3 dm spontaneously transformed mouse cell line [ 13 , 14 ] . besides its regulation on p53 , it was found that mdm2 also interacted with many proteins in addition to p53 such as nf-b [ 15 , 16 ] . it was described as one of the tumor associated antigens ( taa ) as mdm2 was overexpressed in several kinds of tumors . it has also been reported that autoantibody to mdm2 can be found in patients with esophageal squamous cell carcinoma . the role of mdm2 in immune regulation can be speculated by its regulation on p53 . in recent years , p53 has been found to be important in both innate and acquired immune regulation [ 20 , 21 ] , and it was necessary in the inhibition of autoimmune inflammation . several studies have found that the presence of anti - p53 in sle patient , with a prevalence of about 26%59% , showed that anti - p53 was related to anti - dna antibodies and can be used as a marker for detecting the disease activity of sle [ 12 , 23 , 24 ] . our study showed that anti - p53 was presented in 39.50% of sle patients , and the titer of anti - p53 was positively correlated with anti - mdm2 . . showed that mdm2 can modulate dendritic cell - induced t cell proliferation and mulay et al . proved that mdm2 was required to induce mrna expression and secretion of nf-b - dependent cytokines upon toll - like receptor stimulation , which were important processes in sle pathogenesis . another study showed that mdm2 can promote sle and inhibition of mdm2 can suppress the abnormal expansion of all t cell subsets , without causing myelosuppression effect on splenic regulatory t cells , neutrophils , dendritic cells , or monocytes . our study further confirmed the importance of mdm2 in the pathogenesis of sle and provided a new serological marker for sle . an increased risk of cancer in sle patients has been observed [ 27 , 28 ] . whether the high prevalence of autoantibodies to mdm2 and p53 was related to the high risk of cancer in sle patients still needs to be clarified . our study is the first one to demonstrate the presence of anti - mdm2 antibody in sle patients . however , an obvious limitation of the present study is the limited clinical information of sle patients included in this study . analysis regarding the association of anti - mdm2 autoantibody and the clinical manifestations was hard to conduct due to the limited clinical information . studies on anti - mdm2 in more sle patients with detailed clinical information are needed to further ensure the role of anti - mdm2 in sle diagnosis , disease activity evaluation , or prognosis prediction . the presence of anti - mdm2 still needs to be investigated in other autoimmune diseases such as rheumatoid arthritis , systemic sclerosis , sjgren 's syndrome , and dermatomyositis . in conclusion , the present study reported a high prevalence of anti - mdm2 in sle patients , which suggests the role of mdm2 in the pathogenesis of sle . the detection of anti - mdm2 autoantibody may provide a new serological marker in sle diagnosis .

introduction . systemic lupus erythematosus ( sle ) is one of the systemic autoimmune diseases characterized by the polyclonal autoantibody production . the human homologue of the mouse double minute 2 ( mdm2 ) is well known as the negative regulator of p53 . mdm2 has been reported to be overexpressed in sle animal model and to promote sle . since abnormally expressed proteins can induce autoimmune response , anti - mdm2 autoantibody was examined in sle patients . methods . anti - mdm2 antibody in sera from 43 sle patients and 69 healthy persons was investigated by elisa . positive samples were further confirmed by western blotting . the immunological feathers of anti - mdm2 positive sera were analyzed by indirect immunofluorescence assay . anti - p53 was also investigated in sle patients by elisa , and the correlation of anti - mdm2 and anti - p53 was analyzed . results . the presence of anti - mdm2 in sle patients was 23.30% , much higher than normal healthy persons ( 4.30% ) . these anti - mdm2 positive sera present a nuclear staining pattern . the presence of anti - p53 in sle patients was 39.50% , and the titer of anti - mdm2 was positively correlated with anti - p53 in sle patients . conclusions . anti - mdm2 autoantibody was detected at high prevalence in sle patients . the detection of anti - mdm2 in sle patients should be clinically useful .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

wilms tumor is also called nephroblastoma and is one of general solid tumors occurring in children , with a death rate of 78 in a million population . the cure rate of wilms tumor has improved dramatically in in the past 30 years owing to a remedy combining radiotherapy , drug therapy , and surgery . the 5-year event - free survival and overall survival reach 77.2 and 87.5% , respectively , according to a recent report . nonetheless , there are no other proper remedies apart from radiotherapy and chemotherapy as ways to cure wilms tumor in case of tumor progress . thus , our intention was to report the case where a metastatic lung tumor was maintained stably , while the metastatic part of the liver was in remission after a complementary hyperthermia therapy ( oncothermia ) and thymosin-1 ( ta1 ) treatment ( zadaxin ) together with a herbal remedy . this therapy was implemented after the patient 's refusal to undergo chemotherapy following recurrence of wilms tumor . the tumor was initially treated with chemotherapy , surgery and radiotherapy but recurred despite re - surgery and additional anticancer chemotherapy . the patient was a 17-year - old mongoloid korean girl who had been diagnosed with wilms tumor in another hospital . after the diagnosis , left radical nephrectomy , actinomycin d , radiotherapy and vincristine + doxorubicin + actinomycin d chemotherapy were applied for 5 months in the hospital . however , a multiple wedge resection was done in the lul and lll parts since multiple metastasis occurred in the lung in june 2014 . then , vincristine + ifosfamide + carboplatin + etoposide were applied ( table 1 ) . however , in october 2014 , a pet - ct scan revealed a newly developed metastatic tumor in the right hepatic lobe . possibly , seeding tumors in the medial margin of the spleen and a fissure in the ligamentum venosum newly developed as well . the patient was recommended to have anticancer chemotherapy again by the hospital but she rejected it , and instead , she started a herbal treatment as an outpatient in the same hospital . the patient received 8 ml inhalation of soram nebulizer solution , soramdan s , had s , cheongjangtang therapy , spiam hc , oncothermia thermotherapy , and zadaxin injection 23 times a week for 9 months ( table 2 ) . as a result , the chest showed consistency in the overall stable disease status of metastatic nodules in the right lung and lul , and the metastatic part of the liver showed remission while constantly improving as seen on the ct scans of november 8th 2014 , january 7th 2015 , april 8th 2015 , and july 15th 2015 ( table 3 ; fig . accompaniment of surgery , radiotherapy , and anticancer chemotherapy can be helpful in increasing the survival rate long term in wilms tumor , but it often leads to severe complications in adulthood . application of a herbal remedy , hyperthermia therapy ( oncothermia ) , and ta1 treatment ( zadaxin ) in wilms tumor patients who visited the hospital showed a meaningful therapeutic effect with a stable maintenance of metastatic lung lesions and remission in the metastatic part of the liver . methods of herbal remedies are inhalation of soram nebulizer solution , oral herbal medicine , and rectal injection . inhalation of soram nebulizer solution is a method that fumigates the liquid extracted from the steam of herbs and injects it into the nasal cavity . the oriental oral medicine and cheongjangtang were made in the form of a pill , steam liquid , and capsule made of single or multiple herbs in a pharmacy , so that they could be absorbed by the patient 's body through rectal injection or simple oral administration . 200 g of roughly 6-year - old wild panax ginseng is washed under running water , decocted in 2,000 ml distilled water , and the decoction is distilled to produce 1,500 ml of fluid . 200 g of c. sinensis is washed under running water , decocted in 2,000 ml distilled water , and the decoction is distilled to produce 1,500 ml of fluid . the two fluids are mixed at a ratio of 1:1 , filtered with 0.45- and 0.2-m filters , and then sterilized in 8-ml vials . each nebulizer therapy was done with this solution and an ultrasonic nebulizer ( omron , ne - u17 ) for 20 min . soramdan s was what was mixed with wild ginseng at a temperature above 120c and finely ground p. ginseng , which is processed at high pressure , at a 7:3 ratio , then mixed well with the same amount of mixed honey and with mixed power mixed at a 2:1:1:2 ratio into 8-gram pills , wrapped in gold foil . had s was made from cordyceps militaris , p. ginseng radix , commiphora myrrha , calculus bovis , margarita , processed boswellia carteri , processed panax notoginseng radix , and processed cremastra appendiculata tuber at a ratio of 3:2:2:2:2:2:4:4 . spiam hc was made from p. ginseng , salvia miltiorrhiza , sanguisorba officinalis , and artemisia capillaris thunberg with honey at a 1:1 ratio ; then , it was made into a pill , wrapped in gold foil . for cheongjangtang , the rhizome of p. ginseng was removed , cleaned well , and processed for 3 h at 120c through autoclave . 600 mg of the processed p. ginseng was cleaned again , decocted with 6 liters of sterilized distilled water to obtain 5 liters of decoction liquid . it is processed at high temperature and pressure , and is included in the soram nebulizer solution , soramdan s , spiam hc , and cheongjangtang that were administered to our patient . it has been shown that treatment of cancer cells in vivo and in vitro with rg3 results in the reduction of proliferation , metastasis , and mortality [ 5 , 6 , 7 ] . upon processing ginseng with heat at 120c , most peaks of ginsenosides rb1 , rb2 , rc , and rd disappeared and the presence of less polar ginsenosides 20(s , r)-rg3 , rk1 , and rg5 was newly detected . reported about recurrence control and metastasis decrease in lymph nodes in patients with metastatic breast cancer as well as decrease in the metastatic part of the lung of patients with metastatic bladder infection after ingestion of had s and administration of soram nebulizer solution . spiam hc is composed of p. ginseng , s. miltiorrhiza , s. officinalis , and a. capillaris thunberg . fractions of s. miltiorrhiza were reported to have excellent anticancer effects in in vitro and in vivo experiments . the hydrothermal extract of s. officinalis has antiproliferative effects and apoptotic activity in hsc4 and hn22 human oral cancer cells ; moreover , a water - soluble polysaccharide extracted from the root of s. officinalis reported about the potential antiproliferative effect of water - soluble polysaccharide fraction extracted from a. capillaris thunberg on human nasopharyngeal carcinoma . a great number of studies show that hyperthermia inhibits angiogenesis , enhances chemo- and radiosensitivity , and induces a high concentration of drugs within a tumor . zadaxin is a pure , synthetic preparation of thymalfasin ( ta1 ) , an amino - terminal acetylated peptide of 28 amino acids which circulates in the blood naturally and is instrumental in the host 's immune response to fight cancer . it directly inhibits the in vitro growth of certain cancer cells . as our case study shows , the integrative medical therapy consisting of oriental medicine , oncothermia , and zadaxin contributed to metastatic part remission and inhibition of wilms tumor progress after unsuccessful surgery and chemotherapy . this case report is meaningful as it demonstrates that oriental medicine combined with oncothermia and zadaxin has a therapeutic effect on tumors and it can complement radiotherapy or anticancer chemotherapy . caution should be exercised when making conclusions on the effect of oriental medicine , oncothermia , and zadaxin therapy on wilms tumor based on just this report . more clinical research is warranted to provide evidence for the validity of this complementary treatment . however , the pet - ct test revealed that a metastatic tumor in the right hepatic lobe newly developed . the patient visited the hospital to receive korean medicine , which was composed of inhalation of the soram nebulizer solution , oral herbal medicine and rectal injection . she also received hyperthermia therapy and ta1 treatment at the same time . according to the results of the simultaneous treatments , the patient 's state showed stable maintenance of the metastatic lung lesion and remission in the metastatic part of the liver .

introductionwilms tumor is one of general solid cancers that occur in children , which carries a death rate of 78 in a million . the cure rate of wilms tumor in the recent 30 years has dramatically been improved , but a proper remedy is still not prepared enough in terms of application in tumor therapy upon recurrence after radiotherapy , surgery and chemotherapy . we present an integrative medical remedy hyperthermia and thymosin-1 treatment focused on herbal remedy since there have been cases in which this remedy contributed to remission in the liver - transferred part in the 4th phase of wilms tumor and stable maintenance of metastatic lung lesion.case presentationour patient , a female korean mongoloid outpatient , was treated from october 25 , 2014 , to july 22 , 2015 . the herbal remedy consisted of 8 ml inhalation of soram nebulizer solution q.d . , soramdan s 8 g p.o . , hangamdan s 1 g p.o . , t.i.d . , cheongjangtang 1030 ml , and spiam hc 8 g p.o . the integrative medical therapy was done with hyperthermia therapy ( oncothermia ) and 1.6 mg of thymosin-1 treatment ( zadaxin ) i.m . according to the ct result on july 15th , 2015 , the liver metastasis was not seen anymore , while the lung metastasis was maintained stably without tumor progress.conclusionsaccompanying integrative medical therapy with herbal remedy in the treatment of wilms tumor showing progress patterns after surgery and chemotherapy can be meaningful as a new remedy .

Introduction Case Presentation Discussion Conclusion Statement of Ethics Disclosure Statement

in 1951 , sir william dameshek postulated the concept of myeloproliferative disorders and furthermore ascribed their development to a hitherto of undiscovered stimulus . the past half - century has since brought light to the cryptic stimulus believed to drive these disabling neoplasms . developing from a host of myelostimulatory mutations , myeloproliferative neoplasms ( mpns ) including polycythemia vera ( pv ) , essential thrombocythemia ( et ) , and myelofibrosis ( mf ) propagate through an evolving cascade of inflammatory conduits well documented to inflict dramatic symptomatology and impair quality of life . great gains have been made in our understanding of how these disrupted signaling pathways coalesce into dysregulated synthesis of cytokines , chemokines , and reactive species that ultimately induce symptoms . in this paper , we discuss the role inflammation plays in mpn pathobiology , disease advancement , and symptom development . the burdensome symptom profile is arguably the most recognizable feature of the mpn disease process and in itself may contribute to reduced life expectancy , as observed in myelofibrosis risk scoring [ 1 , 2 ] . prominent symptoms include fatigue ( 92.7% ) , early satiety ( 61.9% ) , abdominal pain ( 45.9% ) , abdominal discomfort ( 53.2% ) , inactivity ( 60.5% ) , headache ( 48.3% ) , concentration problems ( 61.7% ) , dizziness ( 55.2% ) , numbness ( 61.3% ) , insomnia ( 65.4% ) , sad mood ( 62.7% ) , sexuality problems ( 57.9% ) , cough ( 46.4% ) , night sweats ( 56.4% ) , itching ( 52.6% ) , bone pain ( 48.5% ) , fever ( 20.2% ) , weight loss ( 34.2% ) , and impaired quality of life ( 84.2% ) . the mpn symptom burden has been closely examined for its impact on patient daily living through the mpn landmark survey . this study systematically surveyed 813 mpn patients and discovered that mpn symptoms negatively impacted work hours , number of sick days taken , the need for medical disability and/or early retirement , and overall activities of daily living . patients additionally described feeling anxious and worried about their conditions ( mf , 91% ; pv , 78% ; et , 74% ) which in turn compromised overall quality of life ( mf , 81% ; pv , 66% ; et , 57% ) . adding to the complexity is the recent revelation that mpn symptoms indeed promote the development of other symptoms . an investigation of the symptom of insomnia revealed that the complaint correlates closely with most other mpn related symptoms and functional domains . a similar study investigating correlations with mpn - related sexuality complaints found that this symptom also correlated with other mpn symptoms ( insomnia , depression / sad mood , night sweats , and qol ) , as well as emotional , cognitive , and social domains of functioning . it has been well recognized that the prevalence and severity of symptoms differ by mpn subtype . however , more recent studies have demonstrated that significant heterogeneity exists even within mpn subtypes . a prospective evaluation of 1470 mpn patients discovered the presence of five clusters in pv and et , respectively , and four clusters in mf . symptom clusters in et and pv differed by clinical variables including age , language , gender , the presence of laboratory abnormalities , spleen size , history of hemorrhage , and myeloproliferative neoplasm symptom assessment form total symptom score ( mpn - saf tss ) value . notably , neither pv nor et clusters differed by risk scores suggesting symptomatology likely presents independent of disease stage and risk scoring tools should not be applied as surrogate measurements of disease severity . in mf , clusters differed by a variety of clinical variables as well as risk scores ( dipss ) with increasing degrees of symptomatology correlating with higher risk score categories . recent efforts have aimed to analyze the scope and extent of mpn symptoms in a systematic format . the first investigation was completed in 2007 as a self - reported internet survey of 1179 mpn patients . this revealing study showed that fatigue , pruritus , bone pain , fevers , and weight loss led to restricted participation in physical and social functions and furthermore that available treatment regimens including androgens , steroids , hydroxyurea , and erythropoiesis - stimulating agents not only failed to improve the symptom burden but paradoxically contributed to its development . this survey served as a benchmark for the development of three mpn - specific pro tools : mf - saf , mpn - saf , and mpn - saf tss / mpn-10 . from these instruments , below we discuss these tools individually ( table 1 ) . the myelofibrosis symptom assessment form ( mf - saf ) was created in 2009 and served as the first validated mpn patient reported outcome ( pro ) tool to be made available for clinical and trial settings . a 20-item instrument , the survey attempted to capture the most common symptoms within myelofibrosis and content included issues related to catabolic / proliferative symptoms , quality of life , fatigue , and splenomegaly - associated issues . questions were constructed in a yes , no , or 0 ( absent ) to 10 ( worst imaginable ) scale . the tool proved useful in the open label phase ii trial of the jak2 inhibitor , ruxolitinib . the myeloproliferative neoplasm symptom assessment form ( mpn - saf ) was developed two years later in efforts to capture the symptoms within pv and et as well as mf . this survey included the items present within the mf - saf , along with questions related to microvasculature complications such as headaches , concentration problems , lightheadedness , dizziness , vertigo , numbness / tingling , and sexual dysfunction . this expanded version was structured in a similar format to the mf - saf and proved beneficial in evaluation of a variety of novel targeted compounds including ruxolitinib , ly2784544 , sar302503 , vorinostat , and pegylated interferon [ 1113 ] . the myeloproliferative neoplasm symptom assessment form total symptom score ( mpn - saf tss ; mpn-10 ) is an abbreviated version of the mpn - saf containing the 10 most symptomatic and pertinent items . this tool allows for rapid administration in clinical and trial formats and has replaced the mpn - saf in most settings . the survey has been successfully cross - validated against the eortc qlq - c30 and is available in a variety of languages including english , italian , german , french , mandarin , arabic , spanish , dutch , swedish , portuguese , japanese , hebrew , and czech . in healthy individuals , the inflammatory cascade is driven by a delicate interplay between cellular responses and neurohormonal stimulatory factors / cytokines . although the initial inciting event has yet to be clearly elucidated , all mpn disorders arise from genetic defects within pluripotent stem cell populations that accumulate over the disease course . jak2v617f , a member of the janus kinase signal transduction pathway , was the first recognized mutation inherent to the mpn population ( pv 96% , et 50% , and mf 50% ) . the role the janus kinase cascade ( including jak2 , jak2 , jak3 , and tyk2 ) plays in the signaling of inflammatory cytokines is well documented and profound . as jaks are essential to the signaling of surface growth factor receptors and cytokines bereft of intrinsic kinase activity , constitutive activation , as observed in jak2v617f , induces unregulated signaling of stat transcription factors with resultant cellular growth and propagation . stat3 , in particular , is linked closely with cancer development via activation of immunomodulatory cytokines ( il-6 , il-10 , and il-17 ) , growth factors ( fgf , vegf ) , and matrix metalloproteinases . these products further induce positive autofeedback through the jak / stat pathway , perpetuating cellular malignant potential . in general , cytokines ( interleukins , interferons , and soluble growth factors ; definitions in table 2 ) are important regulators of cellular processes , particularly those involving immunomodulatory activities , cellular growth angiogenesis , and migration . cytokine dysregulation is believed to be associated with other mutations observed within mpns ( idh1/2 , tet2 ) but requires additional investigation . chronic inflammation has been hypothesized to play a supportive role in oncogenesis given its promotion of genomic instability through dna mutations and epigenetic changes , prevention of tumor immune surveillance , and encouragement of clonal evolution [ 17 , 20 , 21 ] . mpn cells ( leukocytes , platelets ) with inherent hypersensitivity to cytokines and or growth factors respond in a proliferative fashion with resultant production of more stimulatory factors . as chronic inflammatory conditions , mpn disorders revolve around a perpetual cycle of dna damage , cellular remodeling , and subsequent fibrosis . this process has been a topic of great interest , especially as it relates to the heterozygous clinical presentation of mpn patients . the relationship between chronic inflammation and mpn symptom development has also been a topic of recent interest . an evaluation of abnormal cytokine expression within myelofibrosis determined that primary myelofibrosis ( pmf ) patients had significantly increased levels of il-1b , il-1ra , il-2r , il-6 , il-8 , il-10 , il-12 , il-13 , and il-15 and tnf-1 , g - csf , ifn- , mip-1 , mip-1 , hgf , inf--ip , and vegf in addition to reduced ifn- levels . il-2r , il-12 , il-15 , and ip-10 were independently predictive of inferior survival . il-2r and il-12 were associated with transfusion needs and hgf , mig , and il-1ra were associated with marked splenomegaly . evaluation of the association between cytokines and mf symptoms was undertaken in 2013 through an ad hoc analysis of 309 mf patients during the blinded phase of the comfort-1 trial evaluating ruxolitinib against placebo . changing levels of five cytokines was significantly associated with change in the mpn - saf tss when controlled for arm , visit - by - arm interaction , age , sex , and body mass index ( bmi ) . , it has previously been shown within other malignancies to promote angiogenesis , induce leukocyte chemotaxis / activation , and stimulate cellular reproduction . a recent study determined il-8 to be associated with elevated levels of circulating blasts and the presence of constitutional symptoms . in polycythemia vera , patients demonstrate increased levels of il-1ra , il-4 , il-5 , il-6 , il-7 , il-8 , il-10 , il-12 , il-13 , ifn- , gm - csf , mcp-1 , mip-1 , mip-1 , hgf , ip-10 , mig , mcp-1 , pdgf - bb , tnf- , ifn- , and vegf [ 25 , 26 ] . pv patients also had significantly elevated levels of il-7 , gm - csf , mip-1 , ip-10 , mig , eotaxin , ifn- , and vegf in comparison to primary mf patients . in addition , hemoglobin count correlated with il-4 and mcp-1 , hematocrit count correlated with tnf- and mcp-1 , lymphocyte count correlated with il-6 and tnf-1 , and jak2v617f mutation status correlated with tnf-1 and pdgf - bb . an analysis of et patients determined this population to have elevated levels of il-1b , il-4 , il-6 , il-8 , il-10 , il-12 , hgf , gm - csf , ifn- , mcp-1 , pdgf - bb , tnf- , and vegf . interestingly , il-4 , il-8 , gm - csf , ifn- , mcp-1 , pdgf - bb , and vegf appeared to be significantly higher in et patients when compared to pv populations and may serve as useful markers to distinguish the two disorders . also within et patients , polynuclear cell counts were found to correlate with hgf , il-6 , il-12 , mg - csf , and vegf whereas red cell counts correlated with pdgf - bb levels . jak2v617f positive status also correlated with pdgf - bb and tnf- . in comparing pv and et patients with vascular complications versus those without complications , no significant differences in cytokine levels however , in comparing pv and et patients with a history of vascular events , et patients have significantly increased levels of il-4 , il-8 , gm - csf , ifn- , mcp-1 , and vegf . interestingly , the specific combination of inflammatory markers appears to be as important as the type of factor present . in mf , the combination of tnf- and timp-1 has been shown to promote survival of cd34 + stem cells whereas the combination of atp and tnf- has been shown to reduce proliferation . for example , pentraxin and crp are well established to play a role in thrombosis and atherogenesis . these biomarkers have been associated with the development of major thrombotic events in pv and et . a recent study also identified low levels of il-12 in mpn patients with vascular complications . altered levels of pdgf , fgf , and vegfb have also been noted in stromal cells of patients with pv , et , and pmf suggesting proinflammatory cytokines promote bone marrow fibrosis which is well established to contribute to anemia and subsequently fatigue [ 29 , 30 ] . cytokines ( bmp-1 , bmp - r2 , bmp-6 , and bmp-7 ) may have a role in promoting the advancement of mpns from early to later stages . of special interest , the presence of specific gene mutations impacts the type and degree of cytokine expression . for instance , jak2v617f positive patients have significantly higher levels of il1b , il-8 , il-17a , and ifn versus triple - negative ( jak2 , mpl negative ) patients . much has yet to be learned about the role cytokines play in mpn symptom development . the growing availability of cost - sensitive cytokine profile testing has offered us what can best be recognized as preliminary data on this complex topic . below we discuss the available literature on specific mpn symptoms and their relationships to inflammation ( table 3 ) . fatigue is a common complaint among cancer patients , present within 3060% of the cancer population . the symptom is particularly prominent within mpns ( pv 85% , et 72% , and mf 84% ) , representing the most common symptom voiced regardless of subtype . mpn - fatigue has been shown to correlate closely with functional capacities . in a novel evaluation of mpn patient functionality , participants were found to perform an average of 25.1 metabolic equivalents ( mets ) , akin to scores observed in parkinson disease patients and dramatically lower than healthy controls ( 45.8 mets ) . a recent study identified positive associations between tnf- and postchemotherapy fatigue in women with breast cancer . anemia is a recognized contributor to this symptom and recent studies have demonstrated that cytokines play a critical role in the development and perpetuation of this comorbidity . il-1 , il-6 , and tnf were recently shown to promote deregulation of erythropoietin with resultant anemia in acute myelogenous leukemia ( aml ) and myelodysplastic syndromes ( mds ) [ 35 , 36 ] . cytokines have been shown to induce dysregulation of the hpa axis and promote a blunted stress response due to subtherapeutic cortisol production . in cancer , fatigue has been closely associated with depressed mood and increased levels of il-6 , a cytokine observed within mpns [ 38 , 39 ] . a survey of 1788 mpn patients confirmed that 32% have been seen or diagnosed with depression and 22.2% had received active treatment of mood disorder within the prior six months suggesting potential association in this population . the combination of cancer - related depression and fatigue also contributes to a sedentary lifestyle which further encourages a proinflammatory state that propagates symptoms . multiple randomized controlled trials have demonstrated that cancer - related fatigue may be reduced through aerobic physical activity , potentially through modulation of cytokine production . the mechanism has yet to be elucidated as intense physical activity has been shown to increase circulating levels of il-6 which subsequently stimulates the production of other anti - inflammatory cytokines including il-1ra and il-10 , and inhibit proinflammatory cytokines such as tnf-. the mpn fatigue project is an international effort performed in collaboration with the mpn forum aiming at evaluating the breadth and efficacy of current strategies targeting mpn fatigue . the study remains ongoing and includes evaluation of treatments such as sleep deprivation , dietary supplements , and exercise . abdominal - related complaints are common among mpn patients , largely attributable to splenomegaly , portal hypertension , mechanical obstruction , and splenic infarcts . an independent source of morbidity and mortality complaints related to the abdomen has included early satiety ( 76% ) , abdominal pain ( 63% ) , abdominal discomfort ( 72% ) , and weight loss ( 48% ) . however , cytokines may also play an important role in the development of this symptom . splenomegaly has been associated with expansion of the malignant clone from the bone marrow microenvironment to extramedullary sites including the spleen . tnf- , in particular , promotes clonal expansion in jak2v617f positive mpns [ 42 , 43 ] . the development of splenomegaly has also been associated with specific cytokines including mig , hgf , and il-1ra . however , interestingly , jak2/stat3 signaling has been shown to promote fibrosis , angiogenesis , and inflammation in the setting of portal hypertension , independent of the presence of malignancy suggesting that regional inflammation also plays a role in abdominal pain , whether or not cancer is present . thrombosis may result in a variety of abdominal complaints , particularly with et and pv . an evaluation of 244 consecutive pv and et patients demonstrated that patients within the highest crp protein tertile had the highest rate of major thrombotic events . similarly patients demonstrating the lowest pentraxin 3 levels had higher risks for major thrombotic events . of interest , values of hs - crp and ptx3 may also be exacerbated by cytokine - induced nerve hyperstimulation , both peripherally and centrally . animal studies have shown increased expression of tnf- , il-1 , and il-6 after nerve injury , cytokines all disproportionately high in the mpn population . in addition , inflammation and trauma have been shown to induce peripheral nerve cell release of inflammatory cytokines within the central nervous system via glial stimulation . the effects of cytokine - mediated pain were demonstrated in a recent study of patients with painful neuropathies where it was observed that this population had twofold higher levels of il-2 mrna and tnf- mrna in comparison to healthy controls . the direct impact these cytokines have on nerves within mpn populations has yet to be investigated . microvascular complaints typically refer to those symptoms that result from disease activity occurring at a capillary level . in the mpns , these symptoms may include headaches , concentration problems , lightheadedness , dizziness , vertigo , numbness / tingling , and sexual dysfunction . historically , neurocognitive disturbances have been attributed to cellular stasis and microthrombosis . proinflammatory cytokine production is believed to be a contributor to cognitive impairment in cancer patients via the disruption of neurohormonal signaling and impaired creation of neurotransmitters . these neurotransmitters include serotonin , dopamine , and norepinephrine , all of which are critical to functions involving homeostasis of sleep , mood , and memory [ 4749 ] . a recent analysis of patients treated with ruxolitinib in the comfort - ii trials identified rantes and pal1 levels to correlate with the complaints of insomnia . the role of inflammation in cognitive impairment has been intensely studied in both animal and human models . in an evaluation of il-6 deficient animals , injection of lipopolysaccharide ( lps , shown to inhibit memory and learning in animals ) failed to induce cognitive impairments suggesting il-6 plays a key role in interrupting the process of memory and learning . in human studies , elevated levels of il-1 , tnf- , il-6 , and crp were also linked to impaired memory and neurodegenerative disorders in the elderly [ 5153 ] . within hematological disorders , patients with elevated levels of il-6 were found to have worsened executive function . interestingly , aml and mds patients with higher levels of il-8 were found to have improved memory . a recent study of jak2v617f transgenic mice demonstrated increased number of mast cells in those with the pv phenotype . these mast cells represent a key source of prostaglandin , leukotriene , histamine , and tryptase , mediators of the inflammatory response with recognized ties to pruritus . a study evaluating symptoms of ruxolitinib treated patients within the comfort - ii trial determined that baseline pruritus was associated with lower ferritin levels , a surrogate marker of inflammation . pruritus , most prominent in pv patients ( 65% ) , may be tied to an inflammatory cellular response as well . basophils have been instigated as a primary mediator for symptom development and studies have demonstrated that the number of constitutively activated and hypersensitive circulating basophils is increased in pv , correlating with the degree of pruritus . recent studies using infrared thermography have documented mast cell degranulation due to temperature shifts with the release of pyrogenic factors such as interleukins , histamine , and leukotrienes [ 56 , 57 ] . both fevers and night sweats are recognized to be partially cytokine driven , typically by il-1 , il-2 , il-6 , tnf- , and ifn . within other malignancies , il-6 has been found to correlate with the presence of b symptoms which serve as a prognostic factor in chronic lymphocytic leukemia ( cll ) and hodgkin 's lymphoma [ 5860 ] . the development of mpn - associated weight loss is complex and relates to a variety of factors including splenomegaly , portal hypertension , and cancer - cachexia . the role of a cytokine - driven proinflammatory state as the nidus for cancer - cachexia is well supported by literature [ 61 , 62 ] . defined as a process of dysregulated carbohydrate and fat metabolism with ongoing skeletal muscle breakdown , the presence of cancer - cachexia is linked to a dismal survival rate in comparison to cancer patients lacking this feature . in cancer patients , tnf- has been shown to induce proteolysis of skeletal muscle and furthermore enhance the expression of genes related to enzymes in the ubiquitin - dependent proteolytic pathway . in a review of cytokine levels present in patients from the comfort - ii trial , weight loss was associated with lower leptin levels and high cd40l was associated with loss of appetite . whether these aberrant cytokines function to support cancer - cachexia or involve an alternative mechanism of action has yet to be investigated . recognizing the substantial impact chronic inflammation has on the mpn symptom burden , attentions have turned to therapies demonstrating efficacy in reducing cytokines . as in other malignancies , improving physical activity and reducing fat intake may reduce inflammatory cytokines and improve survival . in noncancer patients , increased physical activity has been shown to reduce tlr4 signaling and truncate release of inflammatory cytokines . in obese subjects , proinflammatory cytokines have also been shown to be released by white fat which may be subsequently removed through physical activity . in addition to evaluating the effects of sedentary living on the mpn symptom burden , the final phases of the mpn fatigue project involve the development of comprehensive patient activity programs which may have subsequent impact on cytokine - induced symptomatology . recognizing the role constitutive janus kinase signaling plays in inflammation , jak2 inhibition has become a rational target for preventing cytokine dysregulation . a recent study evaluated meaningful changes in cytokine expression following 24 months of ruxolitinib therapy in 63 high - risk mf patients . ruxolitinib was able to induce profound reductions in the expression of tnf- and mip-1 at both 4 weeks and 24 months . the expression of ige was also strongly reduced in almost all patients with direct impact on the amount of activated anti - inflammatory macrophages . a similar study utilized the functional assessment of cancer therapy - lymphoma ( fact - lym ) to evaluate symptoms of ruxolitinib treated patients within the comfort ii trial and compare them to changes in cytokine levels . ten symptoms including fever , weight loss , fatigue , loss of appetite , pain , itching , sleeping well , lack of energy , night sweats , and trouble sleeping were assessed at baseline and weeks 8 , 24 , and 48 . treatment with ruxolitinib led to improved items of itching , night sweats , and weight loss with subsequent reduction in numerous cytokines . loss of appetite improved over time and negatively correlated with decreases in il-1ra levels in ruxolitinib treated patients . the impact emerging jak2 inhibitors such as momelotinib and pacritinib will have on cytokines is of high interest as they progress through clinical trials . importantly , their limited hematological toxicities may be reflective of their selective inhibition of kinases . a recent investigation of pacritinib demonstrated that it selectively spares jak1 while inhibiting jak2 , jak2v617f , flt3 , and irak1 , an il-1 receptor kinase associated with the inflammatory response and suppression of normal hematopoiesis . whether inhibition of irak1 is of clinical significance from a symptomatic standpoint has yet to be investigated . other cellular signaling networks such as the pi3k - akt - mtor pathway impact cytokine development and represent novel targets for intervention . similarly , as antifibrosing agents , hedgehog inhibitors , hypomethylating agents , histone deacetylation inhibitors , and hsp90 inhibitors enter the treatment landscape , knowledge of their impact on inflammation is of great interest . though most data remains in early stages of investigation , knowledge gleaned from other malignancies has offered us potential mechanisms that explain these observed cytokine - symptom associations . however , how these markers differ between mpn subtypes , change with disease progression , and relate to transformation remain unknown . the expanded access to targeted agents has provided a platform by which cytokine signals may be inhibited early within the cascade , limiting their potential for toxicity . it is with great anticipation that we venture into this uncharted territory of cytokine - symptom associations and explore novel therapies hosting high potential for symptomatic benefit .

myeloproliferative neoplasms ( essential thrombocythemia , et ; polycythemia vera , pv ; myelofibrosis , mf ) are monoclonal malignancies associated with genomic instability , dysregulated signaling pathways , and subsequent overproduction of inflammatory markers . acknowledged for their debilitating symptom profiles , recent investigations have aimed to determine the identity of these markers , the upstream sources stimulating their development , their prevalence within the mpn population , and the role they play in symptom development . creation of dedicated patient reported outcome ( pro ) tools , in combination with expanded access to cytokine analysis technology , has resulted in a surge of investigations evaluating the potential associations between symptoms and inflammation . emerging data demonstrates clear relationships between individual mpn symptoms ( fatigue , abdominal complaints , microvascular symptoms , and constitutional symptoms ) and cytokines , particularly il-1 , il-6 , il-8 , and tnf-. information is also compiling on the role symptoms paradoxically play in the development of cytokines , as in the case of fatigue - driven sedentary lifestyles . in this paper , we explore the symptoms inherent to the mpn disorders and the potential role inflammation plays in their development .

1. Introduction 2. Characterization of MPN Symptoms 3. Origins of Inflammation in MPN Patients 4. Inflammation and MPN Symptom Development 5. Improving Symptoms by Targeting Cytokines 6. Conclusion

otitis media with effusion is a common pediatric disease and is considered the most common cause of hearing impairment among children . diagnosis is mainly based on pneumatic otoscopy , pure - tone audiometry , and tympanometry . tympanometry is an objective technique that can detect abnormal middle - ear function consistent with the presence of fluid in the middle - ear cavity . transiently evoked otoacoustic emissions ( teoaes ) are a diagnostic method widely used during the past decade to study cochlear function , in a noninvasive and objective manner . usually , teoaes are present in people who have normal cochlear function and a healthy middle ear . although extensive experience from the use of teoaes in widespread neonatal hearing screening has been gained , little data has been gathered from the population of preschool and school - aged children . because otoacoustic emissions are transmitted from the cochlea to the external ear canal via the middle ear , middle - ear effusion reduces measured emission amplitudes and sometimes eliminates the response entirely . the aim of this study was to evaluate teoaes in the diagnosis of otitis media with effusion in comparison with tympanometry . twenty - one of them were male and 17 female , ranging in age from 4 to 15 years , with a mean age of 8.3 years . both patients and controls underwent clinical otologic and audiological evaluation including medical history , pneumatic otoscopy , tympanometry , and standard pure - tone audiometry . the diagnosis of otitis media with effusion was established when findings in at least three of them were positive . this was used as the gold standard for the comparison of the diagnostic accuracy of teoaes , tympanometry , or their combination . conventional pure - tone audiometry was conducted in a standard sound proof booth , using a two - channel amplaid 455 audiometer and earphones . standard audiometric procedures were applied and the pure - tone thresholds of each ear at frequencies of 0.25 , 0.5 , 1 , 2 , 3 , 4 , and 8 khz were measured . subjects were considered to have a hearing loss if any threshold between 250 and 8000 hz exceeded 20 db hl . when air conduction thresholds were out of normal hearing range , bone conduction thresholds were obtained . standard single - frequency tympanometry was performed with an amplaid 770 clinical admittance meter , using a single frequency 85 db spl ( sound pressure level ) tone set at 226 hz . the range of ear canal pressure was + 400 to 600 dapa . the american speech - language - hearing association guidelines were used to determine if a tympanogram was considered abnormal : ( 1 ) static admittance less than 0.3 mmho ; ( 2 ) an equivalent ear canal volume greater than 1.0 cm when accompanied by a flat tympanogram ; ( 3 ) tympanometric width greater than 200 dapa . teoaes were further performed in all patients and controls , using a dp echoport ilo 292 otodynamics analyzer connected to a portable personal computer . the acoustical stimulation , the data recording , and the data analysis were produced automatically with the aid of this system . testing was performed in a sound - treated room using a standard ilo adult probe with disposable tips . . the nonlinear method of recording was used , allowing the phase - locked cochlear component of the response to be measured . the recording bandwidth was set between 0.75 to 5 khz , stimulus intensity was approximately 80 db , and repetition rate was 50 stimuli / sec . the numbers of responses accepted and rejected by artefact rejection were displayed and updated during averaging . the pass criteria were signal - to - noise ratio 6 db , in four of five 1/2 octave frequency bands at 1 , 1.5 , 2 , 3 , and 4 khz . however , pneumatic otoscopy , tympanometry , and teoaes were performed to both of them successfully , and the diagnosis of otitis media with effusion was established . mean pure - tone thresholds exceeded 20 db hl for the lower and middle frequencies in the group of children with otitis media with effusion , whereas mean values lower than 20 db hl were found in the control group across all the examined frequencies ( table 1 ) . in 72 ears ( 94.7% ) of the group of patients the tympanograms were abnormal and in the remaining 4 ( 5.3% ) they were normal . in 70 ears ( 87.5% ) of the control group tympanograms were normal , whereas in the remaining 10 ears ( 12.5% ) tympanograms were abnormal . in table 2 , the results for sensitivity , specificity , positive predictive value , and negative predictive value , with their corresponding 95% confidence intervals , are shown . in 51 ears of the patients ( 67.1% ) otoacoustic emissions the mean emission amplitude was reduced , compared to the mean value of the control group ( table 1 ) . in 68 of the 80 ears of controls clear comparison of signal - to - noise ratios by independent sample t - test between the two groups showed statistically significant differences . in all cases the values of the patients were lower than the mean value of the controls . in this comparison the sensitivity of teoaes was 67.1% and its specificity was 85% ( table 2 ) . combination of teoaes and tympanometry yielded sensitivity 98.6% and specificity 92.5% , improving further diagnostic accuracy ( table 2 ) . the screening test efficiency values ( overall number of true positives and true negatives divided by the total number of ears tested ) for teoaes , tympanometry , and their combination were , respectively , 76.2% , 91% , and 95.5% . teoaes are a valuable screening tool for hearing impairment , although neither information about the degree or configuration of hearing loss is provided , nor is differential diagnosis between sensorineural and conductive hearing loss possible . teoaes are transmitted from the cochlea through the ossicles and tympanic membrane and measured in the external ear canal . therefore , any middle - ear or outer - ear disorder can practically interfere with transiently evoked otoacoustic emission transmission . it has been reported that artificial manipulation of the middle - ear compliance causes a decrease in the response levels of the otoacoustic emissions . . found that a type b tympanogram precluded recording of transiently evoked otoacoustic emissions . even the presence of negative tympanometric peak pressure has been found to lower the level of teoaes , by approximately 4 db across 1000 to 4000 hz . also , owens et al . reported that in ears with type b and c tympanograms transiently evoked otoacoustic emissions were absent or had reduced amplitudes and concluded that , in general , the use of teoaes is contraindicated in the presence of any middle - ear disorder . furthermore , choi et al . reported that middle - ear effusion or a type b of tympanogram impeded measurement of transiently evoked otoacoustic emissions , whereas type a of tympanogram was found to be associated with present emissions . however , hall iii et al . proposed that otoacoustic emission testing should be performed even in the presence of middle - ear disease . koike and wetmore found that the status of the middle ear greatly affected transiently evoked otoacoustic emission measures , which was most significant with flat tympanograms , mainly indicative of reduced tympanic membrane mobility and the presence of middle - ear effusion . in several reports , high failure rates of teoaes in cases with flat tympanograms were found . ho et al . reported failure rates approaching 71 - 72% in ears with middle - ear effusion and abnormal tympanograms . these authors found good agreement between tympanometry failure and transiently evoked otoacoustic emission failure for the 3- to 5-year - old group of children . similar rates were found in another report of transiently evoked otoacoustic emission measurements , and our rate of approximately 67% failure is in accordance with them . in most of the previously mentioned reports fortunately , quantitive analysis is now possible and objective criteria may be used , as in the present study . have also used teoaes as a hearing screening tool in children with ome , before and after surgery . according to these authors , preoperative teoaes were absent in 93.5% of the ears , but were significantly improved postoperatively . when applying tympanometry and teoaes in hearing screening , the sensitivity and specificity of both tests should be considered . the problem in such studies is the absence of a gold standard , as would be the findings of myringotomy in the examined ears . however , this is not possible in most cases , and several authors have used tympanometry as the gold standard , due to its high sensitivity to middle - ear disorders . taylor and brooks obtained by this method 60% sensitivity and 91% specificity of teoaes compared to tympanometry . recently , liwa et al . combined three diagnostic methods , automated 4-frequency audiometry , toeaes and tympanometry , in hearing screening of school children . the authors used conventional tone audiometry as the reference and found high specificity and low sensitivity values for all the tests , but combination of tympanometry and teoaes yielded 60% sensitivity and 94% specificity , whereas addition of automated 4-frequency audiometry further improved sensitivity to 70% . in our study , we used the combination of positive history , positive otoscopic appearance by pneumatic otoscopy , abnormal tympanographic findings , and elevated threshold in pure - tone audiometry as a gold standard to establish diagnosis . according to these , the sensitivity of tympanometry was as high as 96% and its specificity was 85% . when calculating the sensitivity of teoaes according to the pass criterion , a rate of 67% was obtained , whereas specificity approached 85% . however , in the remaining ears which obtained the pass criterion , transiently evoked otoacoustic emission measurements were lower than controls , at a statistically significant level . it appears , thus , that the sensitivity of teoaes in otitis media with effusion is high , whenever absolute values of teaoe measurements are considered and not only a specificity is lower , because teoaes are also influenced by inner - ear disease , although this is not quite common in the age group of our study . finally , a comment on pure - tone thresholds in standard audiometry should be made . in several reports , mean pure - tone thresholds between 15 and 20 db hl have been found . in our study mean thresholds were approximately 2025 db hl in the standard frequencies of 0.5 , 1 , 2 and 3 khz . it appears , thus , that an audiometric criterion of 20 db would be appropriate to separate normal ears from ears with absent or reduced transiently evoked otoacoustic emissions . from this study , it may be concluded that teoaes should be included in the diagnostic workup of otitis media with effusion . their sensitivity in diagnosing middle - ear disease is high when quantitive measures are used , whereas their specificity is lower , because abnormal results may also be found in cases with inner - ear disease . for this reason , teoaes should always be used along with tympanometry , because a more meaningful interpretation of transiently evoked otoacoustic emission measures in conjunction with tympanometry results is possible .

introduction . otitis media with effusion is a common pediatric disease whose diagnosis is based on pneumatic otoscopy , pure - tone audiometry , and tympanometry . the aim of this study was to evaluate transiently evoked otoacoustic emissions in the diagnosis of otitis media with effusion as compared to tympanometry . patients and methods . 38 children with bilateral otitis media with effusion were studied . 40 normal children of similar age and sex were used as controls . all subjects underwent pneumatic otoscopy , standard pure - tone audiometry , tympanometry , and transiently evoked otoacoustic emissions . results . in the group of children with bilateral otitis media , transiently evoked otoacoustic emissions were absent in 51 ears ( 67% ) . in the remaining 25 ears ( 33% ) the mean emission amplitude was reduced , as compared to the mean value of the control group . conclusions . transiently evoked otoacoustic emissions should be included in the diagnostic workup of otitis media with effusion because it is a fast , reliable , and objective test . transiently evoked otoacoustic emissions should always be used in conjunction with tympanometry , because a more meaningful interpretation of transiently evoked otoacoustic emissions measures is possible .

1. Introduction 2. Material and Methods 3. Results 4. Discussion 5. Conclusion

enhancing the binding potency of carbohydrate inhibitors of protein carbohydrate interactions is an important step towards improved medicinal applications.1 this is mostly the case because of the relatively weak interactions between proteins and carbohydrate ligands . ensuring multivalency of ligands is a proven method to achieve this.2 leca is an important virulence factor of pseudomonas aeruginosa and is involved in bacterial adhesion and biofilm formation.3 the protein has recently become a popular target for the design of multivalent inhibitors.4 the tetrameric protein promotes the adhesion of the bacteria to tissue cell surfaces , thus facilitating subsequent steps such as cell invasion and biofilm formation . inhibiting bacterial adhesion proteins has the potential to become a mild and less resistance - prone method to treat and prevent bacterial infections.5 two of the four binding sites , with specificity for galactosides , are relatively close together with a separation of about 26 .6 this arrangement has led us to design and synthesize divalent galactoside ligands with well - defined and rigid spacers that should allow a chelation - type divalent binding mode.7 flexible spacers are commonly used as they are forgiving of imperfect design and usually yield sizeable potency enhancements in multivalent systems.7 they are , however , not optimal as there will be a significant entropy loss upon binding and , moreover , achieving selectivity will be less likely . in our search for an optimal spacer we found compound 1 ( figure 1 a ) to be a highly potent divalent ligand with nanomolar inhibitory potency.8a the spacer of this structure contains direct linkages between the glucose moieties and the connected triazoles.8 this arrangement leads to a relatively rigid structure , in which rotations of the components can take place , but the overall geometry remains mostly linear . a ) structure of potent divalent leca inhibitor 1 with the relatively rigid glucose - triazole - based spacer ; b ) schematic divalent binding mode of a divalent ligand to two leca subunits ; c ) x - ray structure of leca with bound galactose moieties . the two asp 47 carboxylates in the spacer path are shown explicitly.6 most importantly , good solubility in water was observed . we found that three glucose - triazole units was the optimal length for leca inhibition , while divalent ligands with two and four units showed far inferior inhibition . all data were consistent with a chelating binding mode ; especially convincing was the stoichiometry derived from isothermal titration calorimetry ( itc ) binding experiments . furthermore , the short linkage of just a single carbon between the galactoside ligand and the triazole proved to be a major contributing factor to the success of this compound . in order to further optimize the potency of the compound and to explore the principle of protein spacer interactions , we now report on our functionalization of the spacer of 1 with various functional groups . the presence of the two carboxylates ( asp 47 in each subunit ) is apparent when looking at the path between the two bound galactosides , which the spacer is likely to span on the leca protein surface when chelating bivalent binding occurs ( figure 1 c ) . these two carboxylates are likely to be in close proximity to the 6-oh group on the terminal spacer glucoside units , depending on the rotational state of the molecule . molecular modeling was used in order to gauge whether positively charged functional groups at the c-6 position on the terminal spacer glucoside units would be able to interact with the asp 47 residues . firstly , ammonium groups were used ( as derived from 12 , see below ) . creating a stabilized conformation with the positive charges in close proximity to the asp 47 carboxylates was possible , and this orientation was used as the starting point of additional simulations . when running an unrestrained nanosecond molecular dynamics ( md ) simulation with explicit water molecules , the stabilized geometry persisted throughout the simulation ( see supporting information ) . especially , the two hydrogen - bonded salt bridges , between the asp 47 side chains and the ammonium groups of the protonated form of 12 , remained within 3 and were compatible with a geometry that included two fully bound galactoside ligand units . such a bound geometry was also possible for a compound that included a pyridinium group ( as in 13 ) , but resulted in longer distances between the carboxylate oxygens and the pyridinium nitrogens , due to bigger steric requirements of the pyridinium units . furthermore , while performing a similar md simulation , this structure was not maintained , indicating indeed the larger steric requirements of the pyridinium group when facing the protein surface . these experiments lead to the conclusion that the introduction of ammonium groups would be most promising . we chose to prepare a series of derivatives with various new substituents in the spacer in hopes of further enhancing the leca inhibitory potency of the molecules . positively charged substituents were included , as reasoned above . also , negatively charged and more lipophilic groups were included as these could possibly benefit from interacting with other proximate parts of the protein that would not have been previously obvious . the synthesis of the modified spacers started with two previously prepared building blocks 2 and 3.8 these building blocks were coupled by a double copper(i)-catalyzed azide alkyne cycloaddition ( cuaac ) reaction . next , the two galactosyl axial 4-oh groups of the resulting product 4 were turned into triflates , thus enabling the subsequent substitution by azide with inversion to give 5 . the terminal azides were subsequently linked to the protected galactosyl ligand 6 a by cuaac yielding 7 . selective removal of the tert - butyldimethylsilyl ( tbdms ) groups then gave 8 which is ready for further functionalization . reagents and conditions : a ) cuso45 h2o , naasc , dmf with 10 % h2o , 80 c , 30 min , 85 % ; b ) 1 ) tf2o , 10 % pyridine in ch2cl2 , 0 c , 3 h , 2 ) nan3 , acetone / h2o ( 4:1 ) , rt , o / n , 98 % ; c ) 6 a , cuso45 h2o , naasc , dmf with 10 % h2o , 80 c , 30 min , 64 % ; d ) p - tsoh , ch3cn / h2o ( 7:1 ) , rt , 6 h , 83 % . the two hydroxymethylene groups of compound 8 were oxidized to carboxylic acids using 2,2,6,6-tetramethylpiperidin-1-yl)oxidanyl ( tempo ) ( scheme 2 ) . reaction of 8 with triflic anhydride in the presence of pyridine followed by zempln deprotection gave the bis pyridinium compound 10 . tosylation of the primary hydroxy groups of 8 followed by reaction with sodium azide gave the intermediate 11 . zempln deprotection of 11 , followed by the hydrogenation of the azido groups gave the diamine 12 . cuaac coupling of phenylacetylene to 11 and subsequent zempln deprotection gave the bis - triazole 13 . all final products were purified by preparative high - performance liquid chromatography ( hplc ) . reagents and conditions : a ) 1 ) tempo , naocl , nabr , bu4nbr , nahco3/na2co3 ph 9.5 , 0 c , 2 h , 2 ) naome , meoh , rt , o / n , 38 % ; b ) 1 ) tf2o , 10 % pyridine in ch2cl2 , 0crt , 3 h , 2 ) naome , meoh , rt , o / n , 44 % , c ) 1 ) tscl , dabco , ch2cl2 , rt , o / n , 2 ) nan3 , dmf , 95 c , o / n , 34 % , d ) 1 ) naome , meoh , rt , o / n , 2 ) h2 , pd / c , rt , 60 % , e ) 1 ) phenylacetylene , cuso45 h2o , naasc , dmf with 10 % h2o , 80 c , 30 min , 2 ) naome , meoh , rt , o / n , 24% . the compounds were tested on an array chip in an assay similar to an enzyme - linked immunosorbent assay ( elisa ) , as previously reported.8 fluorescein - labeled leca was incubated with the inhibitors and exposed to a galactoside - functionalized chip surface . monovalent ligand 6 b was previously determined to have an ic50 in this assay of 22 m.8a clearly all divalent compounds were far more potent and showed major multivalency effects ( table 1 ) . the previous best inhibitor , 1 , still remained the most potent compound in the present series with an ic50 in the 2 - 3 nm range , as before . the pyridinium - functionalized 10 and the phenylacetylene - derived 13 showed only a minor drop in potency , with ic50 values in the 5 nm range . larger potency drops of about an order of magnitude were observed for both the negatively charged bis - carboxylate 9 and the positively charged bis - amine 12 . subsequently , itc experiments were conducted , which confirmed the divalent binding mode in all cases , with the stoichiometry n values being close to 0.5 . as before8a the dissociation constants ( kd ) were somewhat higher than the ic50 values from the chip - based elisa - like assay . furthermore the small potency differences of the chip - based assay were not seen in the itc assay . interestingly , when looking at the enthalpic and entropic components of the binding event , the lipophilic and noncharged compound 13 , showed enthalpy entropy compensation , with a lower beneficial binding enthalpy and , at the same time , a lowered entropy loss upon binding . the latter is understandable as an example of the hydrophobic effect where water molecules in an ice - like structure are liberated from the lipophilic surfaces . inhibitory potencies ( ic50 ) of the divalent inhibitors on leca binding[a ] and dissociation constants ( kd ) , stoichiometry , and thermodynamic binding parameters[b ] [ a ] chip - based elisa - like assay : fitc - labeled leca ( 5 g ml ) binding to a galactoside functionalized chip surface . [ b ] obtained from isothermal titration microcalorimetry ( itc ) : [ leca]=2040 m . it proved possible to use selectively protected 6-oh groups to build up the ligand in its protected form . subsequently , the selectively deprotectable silyl groups were removed , and the resulting primary hydroxy groups were converted to carboxylate groups by oxidation , to tosylates and subsequently to azides by substitution , and to pyridiniums via their corresponding triflates . the azides allowed cuaac coupling and also further reduction to the corresponding amino groups . while it was anticipated that some of these groups would be able to take advantage of additional beneficial interactions with the nearby protein surface , we did not observe this through enhanced inhibitory or binding potencies . this was true even for the positively charged groups that could possibly take advantage of the nearby positioned carboxylate groups of asp 47 . however , a possible alternative scenario , where the newly added groups point into the solution and thus away from the protein surface , is apparently more favorable in this case . in future designs nevertheless , the functionalization of the spacers will also be important in order to fine - tune other properties of this type of ligand , such as toxicity and absorption , distribution , metabolism , and excretion ( adme ) , which are important for drug development . general : chemicals were obtained from commercial sources and were used without further purification unless noted otherwise . compounds 2 , 3 , and 6 were synthesized following literature procedures.7 solvents were purchased from biosolve ( valkenswaard , the netherlands ) . anhydrous solvents were dried over molecular sieves of 4 or 3 . thin - layer chromatography ( tlc ) was performed on merck precoated silica 60 plates . spots were visualized by uv light and also by 10 % h2so4 in meoh . microwave reactions were carried out in a microwave initiator system ( biotage , uppsala , sweden ) . analytical hplc runs were performed on an automated hplc system ( shimadzu , kyoto , japan ) with a reversed - phase column ( reprospher 100 , c4 , 5 m , 2504.6 mm , dr . maisch gmbh , ammerbuch - entringen , germany ) which was equipped with an evaporative light scattering detector ( plels 1000 , polymer laboratories , amherst , usa ) and a uv / vis detector operating at 220 nm and 250 nm . preparative hplc runs were performed on an applied biosystems ( waltham , usa ) workstation . elution was effected by using a linear gradient of 5 % ch3cn/0.1 % trifluoroacetic acid ( tfa ) in h2o to 5 % h2o/0.1 % tfa in ch3cn or by a gradient of h2o to 30 % ch3cn in h2o . h and c nmr spectroscopy was carried on an 400-mr spectrometer ( agilent , santa clara , usa ) operating at 400 mhz for h and 100 mhz for c. heteronuclear single quantum coherence ( hsqc ) and total correlated spectroscopy ( tocsy ) nmr ( 500 mhz ) were performed with an inova 500 instrument ( varian , palo alto , usa ) . electrospray ionization mass spectrometry ( esi - ms ) experiments were performed with a shimadzu lcms qp-8000 . high - resolution mass spectrometry ( hrms ) analysis was recorded using an esi - q - tof ii spectrometer ( bruker , billerica , usa ) . the proton numbering scheme of all compounds can be found in the supporting information and is used in the assignments of the signals for the nmr spectra below . isothermal titration microcalorimetry ( itc ) : the lectin leca was obtained from sigma aldrich and was dissolved in buffer ( 0.1 m tris - hcl , 6 mm cacl2 , ph 7.5 ) and degassed . protein concentration ( between 20 and 40 m depending on the ligand affinity ) was checked by measurement of optical density by using a theoretical molar extinction coefficient of 28 000 . carbohydrate ligands were dissolved directly into the same buffer , degassed , and placed in the injection syringe ( concentration range : 0.10.2 mm ) . itc was performed using a microcal auto itc200 ( malvern , worcestershire , uk ) . leca ( 0.020.04 mm ) was placed into the 200 l sample cell at 25 c . titration was performed with injections of carbohydrate ligands ( 2.5 l ) every 120 s. data were fitted using the one - site model using microcal origin 7 software according to standard procedures . fitted data yielded the stoichiometry ( n ) , the association constant ( ka ) , the enthalpy ( h ) and the entropy of binding . the kd value was calculated as 1/ka , and t is 298 k. each ligand test was performed in duplicate . leca inhibiton assay : lectin leca was labeled with fluorescein isothiocyanate ( fitc ) according to a literature procedure.9 microarray experiments were performed by using a pamchip array run on a pamstation 12 instrument ( pam - gene , s - hertogenbosch , the netherlands ) . data were obtained by real - time imaging of the fluorescence signal by a ccd camera . the fluorescence intensities were expressed in arbitrary units , and the relative intensities were the average of the two duplicate spots . aliquots of a solution of fitc - labeled leca ( 5 g ml for all tested compounds ) in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid / bovine serum albumin ( hepes / bsa ) buffer ( 10 mm hepes , 100 mm nacl , 0.1 % bsa . ph 7.4 ) , containing different concentrations of the inhibitors were incubated for 1 h at rt and subsequently added to the galactoside - functionalized chip . the binding process was monitored for 2 h , and the end values of the fluorescence detection were taken for the determination of the ic50 by using prism 5 ( graphpad software , inc . , la jolla , usa ) . molecular modeling : all molecular modeling studies were performed using the molecular graphics , modeling , and simulation program yasara version 13.9.8 ( yasara biosciences , vienna , austria ) . the bivalent ligands were first constructed in yasara as isolated molecules . subsequently , the complex with leca was built by superposition of one of the galactose units of the ligand with a bound galactose of one of the subunits of the leca crystal structure ( pdb i d : 1oko).3a the other galactose unit of the divalent ligand was then pulled into the adjacent galactose binding site of leca by restraint md using distance restraints based on the position of the bound galactose present in the x - ray structure with respect to a number of leca residues . possible electrostatic interactions between two positively charged amino and pyridinium substitutions in the linker region with two asp 47s of leca were investigated in more detail . in order to induce these interactions , the subunits comprising the substituted moieties were first rotated , and subsequently , the nitrogen atoms of respectively the amino and the pyridinium group were restrained to bring them in close proximity to the carbon atoms of the carboxylic acid moieties of asp 47 . after restrained md , the molecules were subjected to a 1000 ps free md simulation in water . general procedure of microwave - assisted click reaction : to a solution of the azide and alkyne compounds in dimethylformamide ( dmf ) with 10 % h2o , was added cuso45 the mixture was then heated by microwave irradiation at 80 c for 30 min . when the mixture cooled to rt,0 the copper salts were removed by a resin ( cuprisorb ) , and the solvents were removed under reduced pressure . compound 4 : a click reaction of a mixture of compound 2 ( 0.253 g , 0.71 mmol ) , compound 3 ( 0.83 g , 1.63 mmol ) , cuso45 h2o ( 0.06 g , 0.24 mmol ) , and naasc ( 0.096 g , 0.48 mmol ) in dmf ( 5 ml ) containing 10 % h2o was performed following the general procedure described above to afford compound 4 ( 0.84 g , 85 % ) ; h nmr ( 400 mhz , cdcl3 ) : = 8.037.89 ( m , 5 h , 4ch benzoyl , h-1 ) , 7.867.76 ( m , 5 h , 4ch benzoyl , h-1 ) , 7.527.26 ( m , 12 h , 12ch benzoyl ) , 6.08 ( dd , j4,3=j4,5=10 hz , 1 h , h-4 ) , 6.025.90 ( m , 2 h , h-4 , h-3 ) , 5.81 ( dd , j5,4=j5,6=9 hz , 1 h , h-5 ) , 5.60 ( dd , j4,3=j4,5=9 hz , 1 h , h-4 ) , 5.515.41 ( m , 2 h , 2h-5 ) , 5.024.92 ( m , 2 h , 2h-3 ) , 4.81 ( dd , j6,5=j6,7=10 hz , 1 h , h-6 ) , 4.674.54 ( m , 3 h , h-7 , 2 h-6 ) , 4.164.07 ( m , 1 h h-8a ) , 4.073.93 ( m , 2 h , 2h-8 ) , 3.913.82 ( m , 2h-7 ) , 3.703.60 ( m , 1 h , h-8b ) , 3.573.51 ( m , 1 h , 6-oh ) , 3.353.29 ( 1 h , 6-oh ) , 2.02 , 1.65 , 1.58 ( s , 9 h , 3ch3 , acetyl ) , 0.90 ( s , 18 h , 2sic(ch3)3 ) , 0.07 ppm ( 2 s , 12 h , 2si(ch3)2 ) ; c nmr ( 100 mhz , cdcl3 ) : =69.97 , 169.10 , 168.95 ( 3c = o acetyl ) , 166.14 , 166.05 , 165.63 , 165.55 ( 4c = o benzoyl ) , 145.61 , 145.58 ( 2c-2 ) , 133.44133.21 ( ch benzoyl ) , 129.99128.41 ( ch benzoyl ) , 129.39129.20 ( c benzoyl ) 123.43 , 122.13 ( 2c-1 ) , 85.55 ( c-3 ) , 77.97 ( 2c-7 ) , 75.75 ( c-5 ) , 75.48 ( c-5 ) , 74.84 ( c-7 ) , 74.03 , 73.77 ( 2c-3 ) , 72.41 ( c-5 ) , 70.85 ( c-4 ) , 69.94 , 69.59 ( 2c-4 ) , 68.92 , 68.53 ( 2c-6 ) , 63.65 , 63.13 ( 2c-8 ) , 61.61 ( c-8 ) , 59.84 ( c-6 ) , 25.99 ( sic(ch3)3 ) , 20.72 , 19.98 , 19.89 ( 3ch3 acetyl ) , 18.44 ( sic(ch3)3 ) , 5.31 ppm ( si(ch3)2 ) ; ms ( esi ) m / z [ m+h ] calcd for c68h84n6o21si2 : 1378.59 , found 1378.00 ; hrms ( q - tof ) m / z [ m+h ] calcd for c68h84n6o21si2 : 1377.5228 , found 1377.5326 . compound 5 : compound 4 ( 0.84 g , 0.61 mmol ) in anhydrous ch2cl2 ( 30 ml ) containing pyridine ( 4.22 ml ) was treated with triflic anhydride ( 12.2 ml of a 1 m solution in ch2cl2 , 12.2 mmol ) . the mixture was stirred at 0 c for 3 h , after which cold 1 n khso4 ( 20 ml ) was added . the organic layer was washed with cold h2o ( 220 ml ) and , once with cold brine ( 20 ml ) , dried over na2so4 , filtered , and concentrated . the residue was dissolved in an acetone / h2o mixture ( 15 ml , 4:1 ) , and nan3 ( 0.397 g , 6.1 mmol ) was added . the mixture was stirred at rt overnight and diluted with a cold h2o / ch2cl2 mixture ( 50 ml , 4:1 ) . the water layer was separated and extracted once with ch2cl2 ( 10 ml ) . the combined organic layers were dried on na2so4 , filtered , and concentrated to afford compound 5 as a yellowish solid ( 0.86 g , 0.60 mmol , 98 % ) ; h nmr ( 400 mhz , cdcl3 ) : =8.007.93 ( m , 4 h , 4ch benzoyl ) , 7.857.72 ( m , 5 h , 4ch benzoyl , h-1 ) , 7.65 ( s , 1 h , h-1 ) , 7.587.26 ( m , 12 h , 12ch benzoyl ) , 5.90 ( d , j3,4=9 hz , 1 h , h-3 ) , 5.865.65 ( m , 3 h , h-4 , 2h-5 ) , 5.57 ( m , 2 h , h-4 , h-5 ) , 5.42 ( dd , j4,3=j45=10 hz , 1 h , h-4 ) , 4.974.88 ( m , 2 h , 2h-3 ) , 4.81 ( dd , j6,5=j6,7=10 hz , 1 h , h-6 ) , 4.614.51 ( m , 1 h , h-7 ) , 4.174.03 ( m , 3 h , h-8a , 2h-6 ) , 4.033.93 ( m , 2 h , 2h-8 ) , 3.683.55 ( m , 3 h , h-8b , 2h-7 ) , 2.01 , 1.69 , 1.62 ( s , 9 h , 3ch3 , acetyl ) , 0.95 ( s , 18 h , 2sic(ch3)3 ) , 0.180.04 ppm ( m , 12 h , 2si(ch3)2 ) ; c nmr ( 100 mhz , cdcl3 ) : =169.85 , 169.01 , 168.96 ( 3c = o acetyl ) , 165.85 , 165.78 , 165.56 , 165.47 ( 4c = o benzoyl ) , 145.18 ( 2c-2 ) , 133.57133.39 ( ch benzoyl ) , 129.96128.44 ( ch benzoyl ) , 129.39129.20 ( c benzoyl ) 123.08 , 121.61 ( 2c-1 ) , 85.64 ( c-3 ) , 79.88 , 79.86 ( 2c-7 ) , 75.01 , 74.96 ( 2c-5 ) , 74.69 ( c-7 ) , 73.60 , 73.35 ( 2c-3 ) , 72.60 ( c-4 ) , 72.17 , 72.12 ( 2c-4 ) , 70.73 ( c-5 ) , 62.50 , 62.40 ( 2c-8 ) , 61.50 ( c-8 ) , 60.43 ( 2c-6 ) , 59.84 ( c-6 ) , 26.04 ( sic(ch3)3 ) , 20.67 , 20.01 , 19.94 ( 3ch3 acetyl ) , 18.57 ( sic(ch3)3 ) , 4.97(5.26 ) ppm ( si(ch3)2 ) ; ms ( esi ) m / z [ m+h ] calcd for c68h82n12o19si2 : 1427.54 , found 1427.75 ; hrms ( q - tof ) m / z [ m+h ] calcd for c68h82n12o19si2 : 1427.5358 , found 1427.5389 . compound 7 : a click reaction of a mixture of compound 5 ( 0.88 g , 0.62 mmol ) and compound 6 a ( 0.570 g , 1.48 mmol ) with cuso45 h2o ( 28 mg , 0.11 mmol ) and naasc ( 0.0443 g , 0.22 mmol ) in dmf ( 15 ml ) containing 10 % h2o was performed following the general procedure described above to afford compound 7 ( 0.87 g , 64 % ) ; h nmr ( 400 mhz , cdcl3 ) : =7.88 ( s , 1 h , h-1 ) , 7.827.68 ( m , 9 h , 8ch benzoyl , h-1 ) , 7.687.59 ( 2 s , 2 h , 2h-1 ) , 7.517.39 ( m , 4 h , 4ch benzoyl ) , 7.367.26 ( m , 9 h , 8ch benzoyl ) , 6.356.22 ( m , 2 h , 2h-5 ) , 5.94 ( d , j3,4=9 hz , 1 h , h-3 ) , 5.885.73 ( m , 2 h , 2h-4 ) , 5.675.52 ( m , 2 h , h-5 , h-4 ) , 5.435.33 ( m , 2 h , 2h-13 ) , 5.275.07 ( m , 6 h , 2h-3 , 2h-11 , 2h-6 ) , 5.034.71 ( m , 7 h , 2 h-12 , 2h-9a , h-6 , 2h-9b ) , 4.634.53 ( m , 1 h , h-7 ) , 4.484.37 ( m , 4 h , 2h-7 , 2h-10 ) , 4.294.04 ( m , 5 h , 2h-15a , h-8a , 2h-15b ) , 3.943.85 ( m , 2 h , 2h-14 ) , 3.80 ( d , j8a,8b=12 hz , 2 h , 2h-8a ) , 3.65 ( dd , j8b,8a=12 hz , j8b,7=3 hz , 1 h , h-8b ) , 3.453.32 ( m , 2 h , 2 h-8b ) , 2.201.88 ( m , 21 h , 7ch3 , acetyl ) , 1.771.63 ( m , 12 h , 4ch3 , acetyl ) , 0.940.84 ( m , 18 h , 2sic(ch3)3 ) , 0.05(0.07 ) ppm ( m , 12 h , 2si(ch3)2 ) ; c nmr ( 100 mhz , cdcl3 ) : =170.83168.96 ( c = o acetyl ) , 165.51 ( c = o benzoyl ) , 165.39 ( c = o benzoyl ) , 165.07 ( c = o benzoyl ) , 144.90 ( 2c-2 ) , 143.54 ( 2c-2 ) , 133.64 , 129.81128.53 ( ch benzoyl ) , 128.81 ( c benzoyl ) 123.66 , 123.57 , 123.14 , 121.67 ( 4c-1 ) , 99.29 , 99.26 ( 2c-10 ) , 85.70 ( c-3 ) , 79.40 , 79.33 ( 2c-7 ) , 75.02 ( c-7 ) , 74.20 , 73.85 ( 2c-5 ) , 73.67 , 73.42 ( 2c-3 ) , 72.70 ( c-5 ) , 72.22 , 72.15 ( 2c-4 ) , 70.99 ( 2c-12 ) , 70.78 ( 2c-14 ) , 70.73 ( c-4 ) , 68.74 ( 2c-11 ) , 67.25 ( 2c-13 ) , 61.84 ( 2c-9 , 2c-8 ) , 61.43 ( 2c-15 , c-8 ) , 60.17 , 60.12 ( 2c-6 ) , 59.81 ( c-6 ) , 25.96 ( sic(ch3)3 ) , 20.9719.92 ( ch3 acetyl ) , 18.52 ( sic(ch3)3 ) , 5.11(5.34 ) ppm ( si(ch3)2 ) ; ms ( esi ) m / z [ m+2 h]calcd for c102h126n12o39si2 : 1100.89 , found 1100.60 ; hrms ( q - tof ) m / z [ m+2 h ] calcd for c102h126n12o39si2 : 1100.3892 , found 1100.8980 . compound 8 : compound 7 ( 0.87 g , 0.40 mmol ) was dissolved in ch3cn / h2o ( 24 ml , 7:1 ) , and p - tsoh ( 0.114 g , 0.60 mmol ) was added . the mixture was stirred at rt for 6 h and was then diluted with ch2cl2 ( 50 ml ) , which was followed by the addition of 10 % nahco3 ( 20 ml ) . the organic layer was washed once with brine ( 20 ml ) and dried over na2so4 , filtered , and concentrated . the residue was purified by silica gel chromatography to afford compound 8 ( 0.65 g , 0.33 mmol , 83 % ) ; h nmr ( 400 mhz , cdcl3 ) : =8.22 ( s , 1 h , h-1 ) , 8.12 ( s , 1 h , h-1 ) , 7.92 ( s , 1 h , h-1 ) , 7.87 ( s , 1 h , h-1 ) , 7.81 ( d , j=8 hz , 4 h , 4ch benzoyl ) , 7.767.69 ( m , 4 h , 4ch benzoyl ) , 7.477.35 ( m , 4 h , 4ch benzoyl ) , 7.317.16 ( m , 8 h , 8ch benzoyl ) , 6.456.33 ( m , 2 h , 2h-5 ) , 6.30 ( d , j3,4=8 hz , 1 h , h-3 ) , 6.015.88 ( m , 2 h , 2h-4 ) , 5.81 ( dd , j5,4=j5,6=10 hz , 1 h , h-5 ) , 5.68 ( dd , j4,3=j4,5=10 hz 1 h , h-4 ) , 5.535.37 ( m , 4 h , 2 h-13 , 2h-6 ) , 5.32 ( d , j3,4=12 hz , 2 h , 2h-3 ) , 5.225.09 ( m , 3 h , 2h-11 , h-6 ) , 5.044.80 ( m , 6 h , 2h-12 , 2h-9a , 2h-9b ) , 4.734.65 ( m , 1 h , h-7 ) , 4.514.40 ( m , 4 h , 2h-7 , 2h-10 ) , 4.334.23 ( m , 2 h , 2h-15a ) , 4.174.07 ( m , 2 h , 2h-15b ) , 4.043.93 ( m , 3 h , 2h-14 , h-8a ) , 3.80 ( d , j8a,8b=12 hz , 2 h , 2h-8a ) , 3.56 ( dd , j8b,8a=12 hz , j8b,7=4 hz , 1 h , h-8b ) , 3.29 ( d , j8b,8a=12 hz , 2 h , 2h-8b ) , 2.201.93 ( m , 21 h , 7ch3 , acetyl ) , 1.861.48 ppm ( m , 12 h , 4ch3 , acetyl ) ; c nmr ( 100 mhz , cdcl3 ) : =170.88169.10 ( c = o acetyl ) , 165.51 ( c = o benzoyl ) , 165.26 ( c = o benzoyl ) , 165.11 ( c = o benzoyl ) , 144.59 , 144.40 , 143.75 , 143.71 ( 4c-2 ) , 133.60 , 129.91128.44 ( ch benzoyl ) , 128.77 , 128.37 ( c benzoyl ) 123.79 ( 2c-1 ) , 123.63 ( 2c-1 ) , 99.20 , 99.10 ( 2c-10 ) , 85.29 ( c-3 ) , 79.35 , 79.15 ( 2c-7 ) , 74.85 ( c-7 ) , 73.99 ( 2c-5 ) , 73.68 , 73.33 ( 2c-3 ) , 72.72 ( c-5 ) , 72.12 ( 2c-4 ) , 70.94 ( 2c-12 ) , 70.83 ( 2c-14 ) , 70.81 ( c-4 ) , 68.84 ( 2c-11 ) , 67.27 ( 2c-13 ) , 61.64 ( 2c-9 ) , 61.45 ( 2c-15 ) , 61.31 ( c-8 ) , 60.64 , 60.56 ( 2c-8 ) , 59.92 , 59.88 ( 2c-6 ) , 59.84 ( c-6 ) , 20.9619.83 ppm ( ch3 acetyl ) ; hrms ( q - tof ) m / z [ m+2 h ] calcd for c90h98n12o39 : 986.3027 , found 986.8078 . compound 9 : a solution of compound 8 ( 51.6 mg , 0.026 mmol ) and tempo ( 0.164 mg , 1.05 mol ) in ch2cl2 ( 1 ml ) was added to a solution of nabr ( 1.1 mg , 10.5 mol ) and bu4nbr ( 3.4 mg , 10.5 mol ) in nahco3/na2co3 buffer ( 1 ml , ph was adjusted to 9.5 with saturated na2co3 ) . the mixture was cooled to 0 c , and naocl ( 614 % , 105 l ) was added dropwise . the mixture was stirred vigorously at 0 c for 2 h and then quenched by the addition of na2s2o3 ( sat . , 0.5 ml ) , after which h2o ( 1.5 ml ) and ch2cl2 ( 4 ml ) were added , and the ph was adjusted to ph 3 with aqueous hcl ( 6 n ) . the organic phase was washed once with brine ( 1 ml ) , dried over na2so4 , and concentrated in vacuo . the resulting oxidized compound was exposed to zmpln conditions , followed by h resin , and was concentrated . the residue was subjected to preparative hplc purification , which gave compound 9 ( 11.1 mg , 0.010 mmol , 38 % ) ; h nmr ( 400 mhz , d2o ) : =8.56 ( s , 1 h , h-1 ) , 8.43 ( s , 1 h , h-1 ) , 8.26 ( s , 2 h , 2h-1 ) , 6.10 ( d , j3,4=12 hz , 1 h , h-3 ) , 5.06 ( d , j9a,9b=12 hz , 2 h , 2h-9a ) , 5.014.91 ( m , 5 h , 2h-9b , h-6 , 2h-3 ) , 4.894.72 ( m , 4 h , 2h-7 , 2h-6 ) , 4.584.41 ( m , 6 h , h-7 , 2h-10 , h-5 , 2h-5 ) , 4.30 ( dd , j4,3=j4,5=9.2 hz , 1 h , h-4 ) , 4.08 ( dd , j4,3=j4,5=9.2 hz , 2 h , 2h-4 ) , 3.973.92 ( m , 2 h , 2h-13 ) , 3.883.70 ( m , 6 h , 2h-15ab , 2h-14 ) , 3.693.61 ( m , 3 h , 2h-12 , h-8a ) , 3.56 ( dd , j11,10=j11,12=8 hz , 2 h , 2h-11 ) , 3.40 ppm ( dd , j8b,8a=12 hz , j8b,7=4 hz , 1 h , h-8b ) ; c nmr ( 100 mhz , d2o ) : =172.26 ( 2c-8 ) , 145.12 ( c-2 ) , 145.01 ( c-2 ) , 144.38 ( 2c-2 ) , 126.65 ( 2c-1 ) , 126.51 ( c-1 ) , 125.47 ( c-1 ) , 102.56 ( 2c-10 ) , 88.28 ( c-3 ) , 78.82 ( 2c-7 ) , 77.71 ( c-7 ) , 75.95 ( 2c-14 ) , 75.04 ( c-5 ) , 75.00 ( c-5 ) , 74.40 ( c-3 ) , 74.38 ( c-3 ) , 74.28 ( c-5 ) , 73.64 ( c-4 ) , 73.59 ( c-4 ) , 73.42 ( 2c-12 ) , 73.30 ( c-4 ) , 71.39 ( 2c-11 ) , 69.33 ( 2c-13 ) , 64.60 ( 2 c-6 ) , 62.41 ( 2c-9 ) , 62.33 ( c-6 ) , 61.68 ( 2c-15 ) , 60.32 ppm ( c-8 ) ; ms ( esi ) m / z [ m+h ] calcd for c40h56n12o26 : 1121.34 , found 1121.05 ; hrms ( q - tof ) m / z [ m+h ] calcd for c40h56n12o26 : 1121.3429 , found 1121.3465 , [ m+na ] 1143.3282 . compound 10 : compound 8 ( 49.2 mg , 0.025 mmol ) was dissolved in dry ch2cl2 ( 2 ml ) with pyridine ( 200 l ) . the mixture was cooled down to 0 c , after which triflic anhydride ( 203 l , 0.203 mmol ) was added dropwise to the above solution . the reaction was allowed to warm up to rt and stirred for 3 h after which 1 n khso4 ( 2 ml ) and ch2cl2 ( 15 ml ) were added . the organic layer was washed once with h2o ( 5 ml ) and once with brine ( 5 ml ) , dried on na2so4 , filtered , and concentrated . the resulting material was then treated with 0.5 m naome in meoh ( 5 ml ) , stirred at rt overnight , after which 1 n hcl was added to adjust to ph6 , and the solvents were evaporated in vacuo . the residue was purified by preparative hplc , which gave compound 10 ( 13.3 mg , 0.011 mmol , 44 % ) ; h nmr ( 400 mhz , d2o ) : =8.69 ( d , j16,17=8 hz , 4 h , 4h-16 ) , 8.56 ( dd , j18,17=j18,17=8 hz , 2 h , 2h-18 ) , 8.42 ( s , 1 h , h-1 ) , 8.38 ( s , 2 h , 2h-1 ) , 8.28 ( s , 2 h , h-1 ) , 8.057.98 ( m , 4 h , 4h-17 ) , 6.06 ( d , j3,4=8 hz , 1 h , h-3 ) , 5.12 ( d , j9a,9b=12 hz , 2 h , 2h-9a ) , 5.004.92 ( m , 3 h , 2h-9b , h-6 ) , 4.924.73 ( m , 8 h , 2h-7 , 2h-6 , 2h-3 , 2h-8a ) , 4.624.42 ( m , 6 h , 2h-10 , 2h-8b , h-7 , h-5 ) , 4.344.23 ( m , 3 h , 2h-5 , h-4 ) , 4.073.98 ( m , 2 h , 2h-4 ) , 3.983.93 ( m , 2 h , 2h-13 ) , 3.883.73 ( m , 6 h , 2h-15ab , 2h-14 ) , 3.713.63 ( m , 3 h , 2h-12 , h-8a ) , 3.633.54 ( m , 2 h , 2h-11 ) , 3.35 ppm ( dd , j8b,8a=12 hz , j8b,7=4 hz , 1 h , h-8b ) ; c nmr ( 100 mhz , d2o ) : =146.77 ( 2 c-18 ) , 145.32 ( 4c-16 ) 144.63 ( 2c-2 ) , 144.37 ( c-2 ) , 144.23 ( c-2 ) , 128.21 ( 4c-17 ) , 125.96 ( 2c-1 ) , 125.56 ( c-1 ) , 124.75 ( c-1 ) , 102.42 ( 2c-10 ) , 87.61 ( c-3 ) , 77.08 ( c-7 ) , 75.87 ( 2c-7 ) , 75.49 ( 2c-14 ) , 74.68(2c-5 ) , 73.84 ( 2c-3 ) , 73.73 ( c-5 ) , 72.96(2c-4 ) , 72.89 ( 2c-12 ) , 72.72 ( c-4 ) , 70.84 ( 2c-11 ) , 68.76 ( 2c-13 ) , 63.61 ( 2c-6 ) , 62.07 ( 2c-9 ) , 61.71 ( c-6 ) , 61.43 ( 2c-8 ) , 61.20 ( 2c-15 ) , 59.76 ppm ( c-8 ) ; ms ( esi ) m / z [ m ] calcd for c50h68n14o22 : 608.23 , found 608.30 ; hrms ( q - tof ) m / z [ m ] calcd for c50h68n14o22 : 608.2311 , found 608.2356 . compound 11 : compound 8 ( 246 mg , 0.125 mmol ) was dissolved in dry ch2cl2 ( 5 ml ) , and tosyl chloride ( 238.4 mg , 1.25 mmol ) and 1,4-diazabicyclo[2.2.2]octane ( dabco ) ( 38 mg , 0.34 mmol ) were added . the residue was redissolved in ch2cl2 ( 15 ml ) and washed once with h2o ( 5 ml ) and once with brine ( 5 ml ) , dried on na2so4 , filtered , and concentrated . the resulting material was purified by silica gel chromatography to give the tosylated compound ( 220 mg , 77.2 % ) . the residue was then dissolved in dry dmf ( 8 ml ) to which nan3 ( 33.6 mg , 0.52 mmol ) was added . the mixture was stirred at 95 c overnight after which the solvent was removed . the residue was dissolved in ch2cl2 ( 15 ml ) , washed once with 1 n khso4 ( 5 ml ) and once with h2o ( 5 ml ) , dried on na2so4 , filtered , and concentrated . the residue was purified by silica gel chromatography to afford compound 11 ( 86.8 mg , 0.043 mmol , 34 % ) ; h nmr ( 400 mhz , cdcl3 ) : =7.95 ( s , 1 h , h-1 ) , 7.827.765 ( m , 11 h , 4ch benzoyl , 3h-1 ) , 7.517.39 ( m , 4 h , 4ch benzoyl ) , 7.367.22 ( m , 8 h , 8ch benzoyl ) , 6.366.23 ( m , 2 h , 2h-5 ) , 5.98 ( d , j3,4=8 hz , 1 h , h-3 ) , 5.925.76 ( m , 2 h , 2h-4 ) , 5.65 ( t , j5,4=j5,6=8 hz , 1 h , h-5 ) , 5.57 ( t , j4,3=j4,5=8 hz , 1 h , h-4 ) , 5.435.35 ( m , 2 h , 2h-13 ) , 5.29 ( d , j3,4=8 hz , 2 h , 2h-3 ) , 5.225.09 ( m , 4 h , 2h-11 , 2h-6 ) , 5.024.83 ( m , 5 h , 2h-12 , 2h-9a , h-6 ) , 4.77 ( d , j9b,9a=12 hz , 2 h , 2h-9b ) , 4.714.56 ( m , 3 h , 2h-7 , h-7 ) , 4.44 ( d , j10,11=8 hz , 2 h , 2h-10 ) , 4.284.18 ( m , 2 h , 2h-15a ) , 4.184.05 ( m , 3 h , 2h-15b , h-8a ) , 3.943.86 ( m , 2 h , 2h-14 ) , 3.723.62 ( m , 1 h , h-8b ) , 3.56 ( t , j8a,8b=12 hz , 2 h , 2 h-8a ) , 2.95 , 2.88 ( 2dd , j8b,8a=12 hz , j8b,7=4 hz , 2 h , 2h-8b ) , 2.211.92 ( 21 h , 7ch3 , acetyl ) , 1.831.59 ppm ( 12 h , 4ch3 , acetyl ) ; c nmr ( 100 mhz , cdcl3 ) : =170.88169.06 ( c = o acetyl ) , 165.36 ( c = o benzoyl ) , 165.28 ( c = o benzoyl ) , 164.99 ( c = o benzoyl ) , 144.72 , 144.65 , 144.25 , 144.24 ( 4c-2 ) , 133.75133.54 , 129.85128.49 ( ch benzoyl ) , 128.72 , 128.29 , 128.26 ( c benzoyl ) 123.49 , 123.40 , 123.30 ( 3c-1 ) , 121.72 ( 2c-1 ) , 99.66 , 99.60 ( 2c-10 ) , 85.68 ( c-3 ) , 77.93 , 77.72 ( 2c-7 ) , 75.00 ( c-7 ) , 73.76 , 73.71 ( 2c-5 ) , 73.50 , 73.28 ( 2c-3 ) , 72.66 ( c-5 ) , 72.07 , 72.03 ( 2c-4 ) , 70.91 ( 2 c-12 , c-4 ) , 70.85 ( 2c-14 ) , 70.81 ( c-4 ) , 68.78 ( 2c-11 ) , 67.23 ( 2 c-13 ) , 62.17 , 62.13 ( 2c-9 ) , 61.43 ( 2c-15 , c-8 ) , 60.81 ( 2c-6 ) , 59.72 ( c-6 ) , 50.58 , 50.37 ( 2c-8 ) , 20.9419.92 ppm ( ch3 acetyl ) ; ms ( esi ) m / z calcd for c90h96n18o37 ( m+2 h ) 1011.91 , found 1012.35 ; hrms ( q - tof ) m / z [ m+2 h ] calcd for c90h96n18o37 : 1011.3092 , found 1011.3091 , [ m+h+na ] 1022.8011 , [ m+2na ] 1033.2923 . compound 12 : compound 11 ( 22.6 mg , 0.020 mmol ) was treated with 0.5 m naome in meoh ( 2.5 ml ) at rt overnight and briefly with h resin . the residue was concentrated and dissolved in h2o ( 2 ml ) , and pd / c ( 15 mg , 10 % pd ) was added . the ph was adjusted to ph 1 by 6 n hcl , and the mixture was stirred at rt under an h2 atmosphere until the hydrogenation was complete . the filtrate was concentrated under reduced pressure and subjected to preparative hplc purification , which gave compound 12 ( 12.9 mg , 0.012 mmol , 60 % ) ; h nmr ( 400 mhz , d2o ) : =8.56 ( s , 1 h , h-1 ) , 8.43 ( s , 1 h , h-1 ) , 8.33 ( s , 2 h , 2h-1 ) , 6.13 ( d , j3,4=8 hz , 1 h , h-3 ) , 5.09 ( d , j9a,9b=10 hz , 2 h , 2h-9a ) , 5.034.89 ( m , 5 h , 2h-3 , h-6 , 2h-9b ) , 4.894.70 ( m , 2 h , 2h-6 ) , 4.664.47 ( m , 6 h , 2h-7 , 2h-10 , h-7 , h-5 ) , 4.414.28 ( m , 3 h , 2h-5 , h-4 ) , 4.083.99 ( m , 2 h , 2h-4 ) , 3.993.93 ( m , 2 h , 2h-13 ) , 3.893.73 ( m , 6 h , 2h-15ab , 2h-14 ) , 3.713.64 ( m , 3 h , 2h-12 , h-8a ) , 3.57 ( dd , j11,10=j11,12=8 hz , 2 h , 2h-11 ) , 3.40 ( dd , j8b,8a=12 hz , j8b,7=4 hz , 1 h , h-8b ) , 3.243.11 ( m , 2 h , 2h-8a ) , 2.86 ppm ( d , j8b,8a=12 hz , 2 h , 2h-8b ) ; c nmr ( 100 mhz , d2o ) : =144.94 , 144.82 ( 2c-2 ) , 144.69 ( 2c-2 ) , 126.18 ( 2c-1 ) , 126.13 ( c-1 ) , 125.07 ( c-1 ) , 102.63 ( 2c-10 ) , 87.97 ( c-3 ) , 77.46 ( c-7 ) , 75.76 ( 2c-14 ) , 74.90 ( 2c-5 ) , 74.51 ( 2c-7 ) , 74.33 ( 2c-3 ) , 74.07 ( c-5 ) , 73.45 ( 2c-4 ) , 73.18 ( 2c-12 ) , 73.13 ( c-4 ) , 71.14 ( 2c-11 ) , 69.09 ( 2c-13 ) , 64.27 ( 2c-6 ) , 62.39 ( 2c-9 ) , 62.08 ( c-6 ) , 61.48 ( 2c-15 ) , 60.12 ( c-8 ) , 40.59 ppm ( 2c-8 ) ; ms ( esi ) m / z [ m+2 h ] calcd for c40h62n14o22 : 546.21 , found 546.90 ; hrms ( q - tof ) m / z [ m+h ] calcd for c40h62n14o22 : 1091.4163 , found 1091.4282 , [ m+na ] 1113.4132 . compound 13 : a click reaction of a mixture of compound 11 ( 61.8 mg , 0.031 mmol ) , phenylacetylene ( 11.1 mg , 0.109 mmol ) , naasc ( 6.5 mg , 0.033 mmol ) , and cuso45 h2o ( 4.1 mg , 0.016 mmol ) was performed following the general procedure described above to afford the coupling product compound ( 54 mg , 80 % ) , which was then treated with naome in meoh ( 0.5 m , 5 ml ) . the mixture was stirred at rt overnight , treated with h resin , concentrated , and subjected to preparative hplc purification , which gave compound 13 ( 9.8 mg , 7.3 mol , 24 % ) ; h nmr ( 400 mhz , d2o with 30 % cd3cn ) : =8.62 ( s , 1 h , h-1 ) , 8.50 , 8.49 ( 2 s , 2 h , 2h-1 ) , 8.46 ( s , 1 h , h-1 ) , 8.42 , 8.41 ( 2 s , 2 h , 2h-1 ) , 8.057.98 ( m , 4 h , 4c-17 ) , 7.75 ( t , j18,17=j18,19=8 hz , 4 h , 4c-18 ) , 7.717.62 ( m , 2 h , 2c-19 ) , 6.21 ( d , j34=9 hz , 1 h , h-3 ) , 5.27 ( d , j9a,9b=12 hz , 2 h , 2h-9a ) , 5.164.99 ( m , 7 h , 2h-9b , 2h-3 , h-6 , 2h-7 ) , 4.924.83 ( m , 2 h , 2h-6 ) , 4.834.70 ( m , 4 h , 2h-8a , 2h-10 ) , 4.704.58 ( m , 4 h , 2h-8b , h-5 , h-7 ) , 4.574.48 ( m , 2 h , 2h-5 ) , 4.43 ( t , j4,3=j4,5=8 hz , 1 h , h-4 ) , 4.214.11 ( m , 4 h , 2h-4 , 2h-13 ) , 4.083.90 ( m , 6 h , 2h-15ab , 2h-14 ) , 3.893.82 ( m , 2 h , 2h-12 ) , 3.823.73 ( m , 3 h , 2h-11 , h-8a ) , 3.46 ppm ( dd , j8b,8a=13 hz , j8b,7=4 hz , 1 h , h-8b ) ; c nmr ( 100 mhz , d2o with 30 % cd3cn ) : =147.90 ( 4c-2 ) , 145.44 ( 2c-2 ) , 130.82129.48 ( 4c-18 , 2c-19 ) , 130.00 ( 2c-16 ) , 126.40 ( 2c-1 ) , 126.21 ( 4c-17 ) , 125.78 ( c-1 ) , 124.76 ( c-1 ) , 123.66 ( 2c-1 ) , 102.73 ( 2c-10 ) , 88.11 ( c-3 ) , 77.554 ( c-7 ) , 76.27 ( 2c-7 ) , 75.81 ( 2c-14 ) , 75.31 ( 2c-5 ) , 74.50 ( 2c-3 ) , 74.20 ( c-5 ) , 73.62 ( 2c-4 ) , 73.38 ( 2c-12 ) , 73.25 ( c-4 ) , 71.29 ( 2c-11 ) , 69.18 ( 2 c-13 ) , 64.29 ( 2c-6 ) , 62.37 ( 2c-9 ) , 62.07 ( c-6 ) , 61.55 ( 2c-15 ) , 60.22 ( c-8 ) , 51.44 ppm ( 2c-8 ) ; ms ( esi ) m / z [ m+2 h ] calcd for c56h70n18o22 : 674.63 , found 674.95 ; hrms ( q - tof ) as a service to our authors and readers , this journal provides supporting information supplied by the authors . such materials are peer reviewed and may be re - organized for online delivery , but are not copy - edited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors .

the bacterial adhesion lectin leca is an attractive target for interference with the infectivity of its producer p. aeruginosa . divalent ligands with two terminal galactoside moieties connected by an alternating glucose - triazole spacer were previously shown to be very potent inhibitors . in this study , we chose to prepare a series of derivatives with various new substituents in the spacer in hopes of further enhancing the leca inhibitory potency of the molecules . based on the binding mode , modifications were made to the spacer to enable additional spacer protein interactions . the introduction of positively charged , negatively charged , and also lipophilic functional groups was successful . the compounds were good leca ligands , but no improved binding was seen , even though altered thermodynamic parameters were observed by isothermal titration calorimetry ( itc ) .

Introduction Results and Discussion Conclusion Experimental Section Supporting Information

microglia and astrocytes are well known to play an important role in homeostasis within the cns and to support neuronal cell function . however , these cell types are now recognized to be key players in the development of protective immune responses or the progression of damaging inflammation during cns disease states ( bauer et al . , 1995 ; stoll and jander , 1999 ; dong and benveniste , 2001 ; fischer and reichmann , 2001 ) . microglia are resident myeloid immune cells of the cns and , similar to other myeloid cells such as macrophages and dendritic cells , these cells are facultative phagocytes and express antigen presenting mhc class ii molecules ( hickey and kimura , 1988 ) . importantly , microglia produce key pro - inflammatory mediators such as il-1 ( martin et al . , 1993 ) , tnf- ( streit et al . , 1998 ) , il-6 ( kiefer et al . , 1993 ) , and bioactive il-12 p70 ( aloisi et al . , 1997 ; suzumura et al . , 1998 ) astrocytes are the major glial cell type in the brain and may also function as immune effector cells ( dong and benveniste , 2001 ) . stimulated astrocytes can express an array of inflammatory cytokines and chemokines that can initiate leukocyte migration across the blood brain barrier and promote effector functions in these infiltrating cells ( dong and benveniste , 2001 ) . as such , these cells are ideally situated to detect and respond to invading pathogens including neurotropic viruses . viral infections in the cns are known to broadly trigger glial activation and the release of pro - inflammatory molecules . for example , it is known that pro - inflammatory cytokines , ifn- and tnf- , are markedly increased in cns tissues during hsv-1 infection in the brain and microglia have been shown to respond to hsv-1 by secreting pro - inflammatory and chemotactic molecules such as tnf- , il-1 , il-6 , il-12 , ccl7 , ccl8 , ccl9 , cxcl1 , cxcl2 , cxcl4 , and cxcl5 ( lokensgard et al . , 2001 ; aravalli et al . , 2006 ) . human microglia have also been shown to respond to rna viruses including wnv by producing cytokines and chemokines ( cheeran et al . , 2005 ) . elevated levels of il-1 are readily detectable in neural tissue from wnv encephalitis patients and cultured human glia produce this potent inflammatory cytokine in response to wnv challenge ( van marle et al . , 2007 ) . we have also documented the ability of primary cultured microglia and astrocytes to respond to several rna and dna viruses , including vesicular stomatitis virus ( vsv ) , sendai virus , murine gammaherpesvirus ( mhv)-68 , and hsv-1 , by producing inflammatory mediators such as il-6 , tnf- , and il-1 ( rasley et al . , 2004 ; chauhan et al . , 2010 ; furr et al . , 2010 , 2011 ) . importantly , we confirmed that in vivo vsv administration results in viral infection of both glial cell types in situ , while earlier studies demonstrated that microglia and astrocytes respond to vsv by proliferating , producing inducible nitric oxide synthase , and increasing the expression of cell surface mhc class ii molecules ( bi et al . , 1995 ) , responses that are likely to set the stage for subsequent inflammatory damage . an immune response to a virus in the cns requires the recognition of this pathogen and the mechanisms by which innate immune cells achieve this have only recently become apparent with the discovery of a variety of cell surface and cytosolic molecules that serve as sensors for viral components . such pattern recognition receptors ( prrs ) are present on and within immune sentinel cells ( furr et al . , 2008 , 2011 ; kielian , 2009 ) and appear to bind conserved viral structures known as pathogen - associated molecular patterns ( pamps ) . first , pamps are unique to microbes and viruses allowing for self versus non - self recognition by the innate immune system . second , pamps are often conserved among similar pathogens allowing a relatively small number of prrs to detect a broad array of challenges . in addition , pamps tend to be essential for microbial / viral survival making pathogen evasion by genetic mutation or deletion unlikely ( medzhitov and janeway , 2002 ) . pattern recognition receptor engagement by pamps can precipitate the production of anti - viral type i interferons ( ifn ) and/or the release of chemotactic and inflammatory molecules that can then direct a subsequent adaptive immune response . three families of prrs have been defined : toll - like receptors ( tlrs ) , nucleotide oligomerization domain ( nod)-like receptors ( nlrs ) , and retinoic acid inducible gene ( rig)-i - like receptors ( rlrs ) . as such , these molecules represent important mechanisms by which a protective host response or potentially damaging inflammation is initiated ( kawai and akira , 2007 ; yoneyama and fujita , 2010 ) . toll was first identified as a gene critical for fruit fly embryogenesis ( hashimoto et al . , 1988 ) but its products were subsequently shown to play an important role in drosophila s immunity to fungal infections ( lemaitre et al . , 1996 ) . interestingly , similar gene products were found in mammalian cells and these tlrs have since been shown to play an important role in the initiation of innate immune responses to infection ( medzhitov et al . , 1997 ) . to date , at least 13 tlrs have been discovered in mammals and members of this family of cell surface receptors can elicit inflammatory and/or anti - viral mediator production and can serve to initiate or modify adaptive immune responses ( as reviewed in kawai and akira , 2008 ) . acute virally induced cns inflammatory responses occur within the first few days following infection and this argues against a central role for activated t cell clones in such responses . indeed , previous studies have shown that acute viral encephalitis can occur in athymic mice ( bi et al . , 1995 ) . that being said , t cell subpopulations , such as th1 and th17 cells , are almost certain to play a key role in sustained virally induced neuroinflammation ( kalinke and prinz , 2012 ) . as such , glial activation via tlrs and other prrs is likely to facilitate antigen presentation to , and costimulation of , such cells and the role of these receptors in the antigen - specific activation of t cells following viral challenge has been extensively reviewed elsewhere ( kawai and akira , 2008 ) . several tlrs have been demonstrated to specifically recognize viral motifs , including tlrs 2 , 3 , 7 , 8 , and 9 . while tlr2 is best known to bind a variety of microbial cell wall component including lipoproteins , peptidoglycans , and lipoteichoic acid present in bacterial cell walls and the yeast cell wall component zymosan , this sensor can also recognize as yet unidentified viral motifs . in contrast , endosomal tlrs such as tlr3 recognize viral double - stranded rna ( dsrna ) and its synthetic analog , polyinosine - deoxycytidylic acid ( poly(i : c ) ) , while tlr7 and tlr8 mediate responses to gu - rich single - stranded rna ( ssrna ) produced in virus - infected cells . studies from our group and others have demonstrated that microglia and astrocytes constitutively express low levels of tlr3 ( jack et al . 2006 ) , tlr7 ( jack et al . , 2005 ) , and tlr9 ( bowman et al . , 2003 ; jack et al . , 2005 ) , but such expression shows marked upregulation following viral infection and/or stimulation with viral components ( bowman et al . , 2003 ; carpentier et al . , 2005 ; jack et al . , 2005 ; mckimmie and fazakerley , 2005 ; mckimmie et al . , 2005 ; bsibsi et al . , while these findings suggest that glial cells could become sensitized to the presence of viral pathogens , it is presently unclear whether sustained stimulation via these sensors can alter the pattern of immune mediator production by glial cells to one that favors the resolution of inflammation . upon ligand binding , tlrs dimerize and undergo conformational changes precipitating a complex cascade of intracellular signaling events that ultimately result in activation of transcription factors including nuclear factor-b ( nf-b ) , and interferon - regulatory factors ( irf ) 3 and 7 ( as reviewed in kawai and akira , 2008 ; wilkins and gale , 2010 ) . nf-b is a critical transcription factor in the regulation of inflammatory cytokine production , while irf-3 and irf-7 activation stimulates expression of anti - viral genes including ifn-. hence , activation of cells via these receptors can initiate the repertoire of defense mechanisms used by the innate immune system against viral pathogens . tlr3 is perhaps the most widely studied prr in the perception of viral pathogens by glial cells . isolated murine wild - type microglia are known to respond to the tlr3 ligand poly(i : c ) by secreting tnf- and il-6 ( melton et al . , 2003 ) . in line with these findings , intracerebral administration of poly(i : c ) has been shown to elicit microglial ( melton et al . , 2003 ; town et al . , 2006 ) and astrocyte ( melton et al . , 2003 ) activation associated with neuronal loss , a response that is nearly absent in tlr3 knockout animals ( town et al . , circumstantial evidence for the involvement of tlr3 in viral encephalitis comes from the finding that the expression of this prr is upregulated following rabv infection prior to the onset of lethal neuroinflammation ( mckimmie and fazakerley , 2005 ; mckimmie et al . , dsrna , a ligand for tlr3 , is produced by wnv during infection and has been shown to trigger the release of cytokines and chemokines from human microglia ( cheeran et al . , 2005 ) . seemingly in keeping with these observations , tlr3 deficient mice were found to be resistant to lethal wnv - associated encephalitis . the fulminate cns inflammatory response seen in wild - type mice , characterized in part by activated microglia , was markedly reduced or absent in knockout animals following intraperitoneal wnv infection ( wang and fikrig , 2004 ) . however , this reduced cns disease occurs despite increased peripheral viral loads and reduced systemic production of anti - viral and pro - inflammatory cytokines ( wang et al . , these results suggest that decreased systemic inflammation in the absence of tlr3 expression may maintain blood brain barrier integrity and prevent wnv access into the cns ( wang et al . , 2004 ) . such a hypothesis is supported by the demonstration that direct intracerebral administration of wnv leads to identical outcomes in wild - type and tlr3 deficient mice ( wang et al . , 2004 ) . however , it must be noted that at least one study appears to contradict this finding in that neuronal wnv replication was increased in tlr3 knockout animals following subcutaneous infection and the reason for this apparent disparity is presently unclear ( daffis et al . , 2008 ) . another endosome - associated prr , tlr7 , also appears to play an important role in inflammatory and/or protective glial responses to viral pathogens . intracerebral administration of the tlr7 agonist imiquimod leads to pronounced neuroinflammation , with upregulated expression of tnf- , il-1 , il-1 , il-6 , and il-12 as well as the chemokines ccl2 , ccl3 , cxcl1 , cxcl9 , and cxcl10 ( butchi et al . , interestingly however , this effect appears to be predominantly due to the activation of astrocytes rather than microglia ( butchi et al . , 2008 ) . upregulation of tlr7 has been demonstrated in the brains of infected mice prior to lethal rabv - induced inflammation ( mckimmie et al . , 2005 ) . furthermore , mice lacking the expression of myd88 , a critical downstream effector molecule of tlrs including tlr7 , have increased susceptibility to an attenuated rabv strain and tlr7 deficient mice exhibited a phenotype with deficits in both the development of peripheral immunity and rabv clearance from the cns ( li et al . , 2011 ) . as such , these data indicate a possible role for tlr7 in viral clearance from infected brain tissue . in contrast , another report has shown that macrophages isolated from tlr7 deficient animals released less il-12 and il-23 in response to in vitro wnv infection and tlr7 knockout mice demonstrated an increased susceptibility to wnv encephalitis ( town et al . , 2009 ) . it has recently been shown that tlr2 contributes to detrimental inflammatory cytokine production in mice following intracranial administration with hsv-1 , with the absence of tlr2 expression leading to decreased peripheral ( kurt - jones et al . , 2004 ) and cns ( aravalli et al . , 2006 ) in addition , multiple reports have shown that maximal in vitro microglial and astrocyte responses to hsv-1 are dependent on the presence of tlr2 ( lokensgard et al . 2012 ) and hsv-1-infected microglia derived from tlr2 deficient mice have been demonstrated to elicit less neuronal oxidative damage and death in mixed neural cell cultures in comparison to infected wild - type microglia ( schachtele et al . , 2010 ) . however , it should be noted that these studies differ in their assessments of the relative importance of this prr in such responses , and marked elevations in serum il-6 concentrations have been found in tlr2 deficient mice following hsv-1 infection ( kurt - jones et al . , 2004 ) . together , these data suggest while tlr2 may play a major role in hsv - induced pathology and mortality , additional mechanism(s ) are likely to be involved . in addition to the detection of hsv virion motifs by tlr2 , genomic hsv dna can be recognized by tlr9 and at least one study suggests that this sensor might play a more significant role in lethal hsv-1 encephalitis than tlr2 ( lima et al . , 2010 ) . in contrast , others have shown that the absence of tlr9 alone does not impact survival , type i ifn levels , or viral replication in the brain following hsv infection ( wang et al . , since tlr2/9 double knockout mice show significantly greater susceptibility to hsv-1 infection than mice deficient in either tlr2 or tlr9 alone ( lima et al . , 2010 ) , it appears likely that these sensors act in a cooperative or synergistic manner . taken together , this body of work suggests that tlr activation is a significant contributor to sustained glial activation , inflammatory mediator production , and neuronal loss during viral cns infections . however , it is important to note that tlrs can also mediate beneficial effects . for example , the activation of glial cells via tlr2 , 3 , or 9 has been shown to initiate the production of type i ifns ( zhou et al . , 2009 ; conrady et al . , 2010 ) which limit viral replication through the induction of proteins such as rnase l and ifn - induced dsrna - activated protein kinase , resulting in mrna degradation and cessation of translation , respectively ( samuel , 2001 ) . furthermore , two recent studies ( zhang et al . , 2007 ; guo et al . , 2011 ) indicate that a genetic deficiency in tlr3 expression can predispose children to hsv-1 encephalitis and implicate a key role for this prr in protective cns immune responses against this , but not other , pathogens . however , the mechanisms that keep the balance between damaging and protective glial responses have not been identified and are likely to include a multitude of variables including the number of infectious organisms , the kinetics of glial activation and immune mediator production , the specific identity of the responsive glial cell , and the direct influence of the pathogen itself on the cellular response . moreover , evidence is accumulating that tlr expression is not limited to glial cells and that neurons can also express such prrs under certain conditions ( as reviewed in carty and bowie , 2011 ) , although , the functional relevance of tlr expression in neurons has not been resolved . while cell - surface receptors like tlrs appear to play an important role in glial responses to extracellular pathogens or those present in intracellular compartments , the ability of such cells to respond to pathogens in the absence of tlr expression suggests that additional mechanisms are present . furthermore , our recent studies employing the model neurotropic rna virus , vsv , demonstrate that viral replication is required to elicit robust immune responses by infected microglia and astrocytes , and indicate that mechanisms exist to sense the presence of replicative viral products within infected cells . we have shown that heat inactivated wild - type vsv or a host - range limited vsv mutant ( grdzelishvili et al . , 2005 ) elicit glial immune responses that are an order of magnitude smaller than those induced by wild - type viral particles ( chauhan et al . , 2010 ) . these results suggest that vsv - induced glial responses are not predominantly mediated by cell surface and/or endosomal prrs and indicate that active viral replication is a critical requirement for such responses . the recent demonstration that microglia and astrocytes express members of the newly described rlr family of prrs may provide a mechanism underlying the replication - dependent nature of glial responses ( furr et al . , 2008 ) . rlrs such as rig - i and melanoma differentiation - associated gene 5 ( mda5 ) have been shown to serve as intracellular prrs for viral nucleic acid motifs ( kato et al . , 2006 ; takeuchi and akira , 2008 ) , and their involvement in inflammatory and anti - viral responses in other cell types raises the intriguing possibility that these cytosolic sensors could play an important role in glial responses to viral infection . in contrast to cell - surface tlrs , rlrs detect viral rna motifs or processed self - rna in the cytoplasm to trigger innate immunity and inflammation ( takeuchi and akira , 2010 ) . these intracellular sensors are responsible for the production of type i ifns in most cell types in response to rna virus infection ( sumpter et al . , 2005 ; kato et al . , 2006 ; in addition to such anti - viral responses , rlr engagement also elicits robust inflammatory cytokine production ( takeuchi and akira , 2010 ) . as shown in figure 1 , helicase interaction with viral rna induces the recruitment of downstream effector molecules including interferon promoter stimulator ( ips)-1 ( also known as visa , cardif , or mavs ) , tnf receptor associated factor ( traf ) 3 ( takeuchi and akira , 2010 ) , and perhaps stimulator of interferon genes ( sting ; ishikawa and barber , 2008 ) , leading to the activation of mitogen activated protein ( map ) kinases , and the ib kinase ( ikk)-related kinases , traf family member - associated nf-b activator ( tank ) binding kinase 1 and ikk - i . these kinases activate the transcription factors nf-b and irf-3 , which translocate into the nucleus and activate transcription of ifn stimulated genes and inflammatory cytokines . rlrs are comprised of three domains : n - terminal caspase activation and recruitment domains ( cards ) , a helicase domain , and a c - terminal domain ( ctd ) . although rig - i and mda5 show structural homology ( yoneyama et al . , 2004 ) and share signaling features ( yoneyama et al . , 2005 ) , it is now known that the two helicases discriminate between differing ligands to trigger innate immune responses to rna viruses . retinoic acid inducible gene ( rig)-i - like receptors serve as cytosolic sensors for viral rna motifs and can initiate anti - viral and inflammatory cell responses . melanoma differentiation - associated gene 5 ( mda5 ) recognizes double - stranded rna moieties ( dsrna ) , while rig - i perceives short single or double - stranded rnas with 5 triphosphate ends ( ppp - ssrna ) . helicase interaction with these viral rnas induces the recruitment of downstream effector molecules including mitochondrial- or peroxisomal - associated interferon promoter stimulator ( ips)-1 , tnf receptor associated factor ( traf ) 3 , and/or stimulator of interferon genes ( sting ) , leading to the activation of ib kinase ( ikk)-related kinases , traf family member - associated nf-b activator binding kinase 1 ( tbk1 ) , and ikk - i . these kinases activate the transcription factors nf-b and interferon - regulatory factors ( irf ) 3 , which translocate into the nucleus and activate transcription of anti - viral and inflammatory cytokines . signaling by rig - i is triggered during infection by a number of rna viruses and by the presence of synthetic rna transcribed in vitro ( sumpter et al . , 2005 ; kato et al . , 2006 ; saito et al . , 2007 ; it appears that rig - i recognizes ssrna or dsrna moieties with 5 triphosphate ends ( 5ppp - ssrna and 5ppp - dsrna , respectively ; hornung et al . 2006 ) or rnas that assume complex secondary structures ( sumpter et al . , 2005 ; saito et al . , 2007 ) . inactive rig - i has an open conformation in which the card domains are sequestered by a helical domain inserted between the helicase moieties . when activated , atp and rna binding induce a major rearrangement in rig - i to a closed conformation in which the helicase and the ctd bind to the blunt end 5ppp - dsrna with perfect complementarity ( kowalinski et al . , 2011 ) . in contrast , mda5 has been reported to be more selective and is triggered during picornavirus infections or in the presence of poly(i : c ) ( gitlin et al . , 2006 ; kato et al . , 2006 ; loo et al . , 2008 ) . the ctd domains of mda5 and rig - i involved in rna binding have been suggested to be responsible for the differences in ligand affinity seen between these rlrs . each have a similar fold and basic surface but distinct rna binding loops exist within the ctd for rig - i and mda5 , and the conformation of this rna binding loop seems to be responsible for sensitivity to dsrna or 5ppp - ssrna . such a conclusion is supported by rlr structural analysis and studies featuring mutation of the basic surface and the rna binding loop ( li et al . , 2009 ; takahasi et al . , we have recently demonstrated that expression of both rig - i and mda5 is discernable in uninfected mouse brain tissue ( furr et al . importantly , we have shown that isolated murine microglia and astrocytes constitutively express rig - i and mda5 transcripts and protein , as well as the critical downstream effector molecule , ips-1 ( furr et al . , 2008 ) . furthermore , the expression of these novel viral sensors has been confirmed in human glial cells ( yoshida et al . circumstantial evidence of a role for these rlrs in rna virus infections of the cns comes from our observation that rig - i and mda5 expression is elevated in the brains of mice following intranasal administration of vsv ( furr et al . , vsv is a neurotropic negative - sense ssrna virus that closely resembles rabv . in mice , intranasal vsv infection results in a severe encephalitis with rapid activation and proliferation of microglia and astrocytes ( huneycutt et al . , 1993 ; bi et al . , 1995 ) and our in vitro studies show that this virus elicits marked increases in rig - i expression by murine and human glial cells ( furr et al . , 2008 , 2010 ) . more direct evidence for the functional nature of rig - i expression in glia comes from our observation that this molecule associates with ips-1 following vsv infection and from the finding that the specific rig - i ligand , 5ppp - ssrna , elicits human astrocyte immune responses ( furr et al . , importantly , we also showed that rig - i knockdown significantly reduces inflammatory cytokine production by vsv - infected human astrocytes and inhibits the production of soluble neurotoxic mediators by virally challenged cells ( furr et al . , 2010 ) . these findings directly implicate rig - i in the initiation of glial inflammatory immune responses and suggest a potential mechanism underlying the neuronal cell death associated with acute viral cns infections . in contrast to the proposed detrimental role for rlr activation following challenge with vsv , other work suggests that ips-1 is essential for triggering protective innate and adaptive immunity against wnv in the cns . in these studies , mice deficient in the rlr adaptor molecule ips-1 exhibited increased susceptibility to wnv infection , characterized by enhanced inflammation , viral replication , and rapid dissemination into the cns ( suthar et al . , 2010 ) . however , it is important to note that glial cells were not the focus of this study and ips-1 dependent ifn responses and limiting of viral replication was attributed to effects on systemically generated immune cells and cortical neurons , perhaps via changes in the numbers and/or function of regulatory t cells ( suthar et al . , 2010 ) . as such , these data suggest an innate / adaptive immune interface mediated through rlr signaling that regulates the balance of the immune response to wnv infection . together , these findings raise the exciting possibility that rlr molecules play important roles in the detection of viral cns pathogens and , depending upon the host cell type and viral pathogen , the initiation of protective immune responses or damaging inflammation within the brain . recently , novel cytosolic dna sensors have been discovered that include dna - dependent activator of interferon - regulatory factors ( dai ; also known as z - dna binding protein 1 ; takaoka et al . , 2007 ) and a dna - sensing inflammasome consisting of the hin200 protein , absent in melanoma 2 ( aim2 ; schroder and tschopp , 2010 ) . acting in concert with tlrs , these receptors may provide a diverse repertoire of mechanisms to alert the cell to viral and microbial dna , leading to the activation of the innate immune system in a similar manner to that seen with rlr - mediated responses to viral rna . dai reportedly senses cytosolic dna using two n - terminal z - dna binding domains ( zbds ) and a third putative dna binding domain located next to the second zbd . analysis of the dai / z - dna complex structure reveals that dai adopts an unusual binding mode for z - dna recognition ( ha et al . , 2008 ) . the dai zbds bind dna and both must be bound for full b - to - z conversion , and so it is conceivable that the binding of two dai proteins to each cytoplasmic dsdna elicits dai dimerization and subsequent innate immune activation ( ha et al . , 2008 ; wang et al . , 2008 ) . importantly , dai has been shown to recognize double - stranded dna in its canonical b helical form ( b - dna ; takaoka et al . , 2007 ) and elicit type i ifn and inflammatory cytokine production in a tlr9-independent manner ( ishii et al . as shown in figure 2 , dai elicits such immune functions via activation of the irf and nf-b transcription factors . dai - induced irf activation is dependent upon tank - binding kinase 1 ( tbk1 ) . in contrast , dai - induced nf-b activation is mediated through interactions between two receptor - interacting protein ( rip ) homotypic interaction motifs ( rhims ) in the dai protein and rhim - containing kinases , rip1 and rip3 ( kaiser et al . , 2008 ; rebsamen et al . , 2009 ) , as shown by the demonstration that knockdown of either rip1 or rip3 inhibits dai - induced nf-b activation . both of these activation pathways appear to be induced via the recruitment of the adaptor molecules ips-1 , traf3 , and sting . the importance of these adaptor molecules in host immune responses to dna viruses is exemplified by the demonstration that the loss of sting renders mice susceptible to lethal hsv-1 infection ( ishikawa and barber , 2008 ) . dna - dependent activator of ifn regulatory factors ( dai ) can serve as a cytosolic sensor for viral or microbial double - stranded dna ( dsdna ) motifs and initiate anti - viral and inflammatory cell responses . dai elicits such immune functions via possible interactions with mitochondrial- or peroxisomal - associated interferon promoter stimulator ( ips)-1 , and/or stimulator of interferon genes ( sting ) , facilitating the activation of the interferon - regulatory factors ( irf ) and nf-b transcription factors . dai - induced irf activation is dependent on tank - binding kinase 1 ( tbk1 ) . in contrast , dai - induced nf-b activation is mediated through interactions involving receptor - interacting protein ( rip ) 1 and rip3 kinases . overexpression of dai in mouse fibroblasts enhances dna - mediated type i ifn production while dai knockdown attenuates responses to viral dna ( takaoka et al . , 2007 ) . in an additional study , dna - mediated activation of nf-b and the induction of nf-b - dependent genes and their products were also significantly inhibited in cells following dai knockdown ( rebsamen et al . , 2009 ) . as such , these data are suggestive of a significant role for dai in dna - mediated activation of the nf-b pathway and viral recognition . however , it is interesting to note that dai - mediated nf-b activation appears to facilitate hiv-1 replication although the mechanisms underlying this effect remain unclear ( hayashi et al . dai is reported to be expressed in the lymph nodes and spleen constitutively , but detectable levels are also found in circulating leukocytes and other tissues including bone marrow and small intestines ( rothenburg et al . , 2002 ) . in the cns , we have shown that microglia and astrocytes constitutively express dai and its effector molecules rip3 and sting , and show that such expression is upregulated following dna virus challenge ( furr et al . in vivo hsv-1 infection elicited an upregulation in microglial dai expression by up to 23.8-fold over that seen in resting cells , and despite strong constitutive expression , hsv-1 exposure was also able to further increase dai expression in astrocytes with a maximal increase of 2.2-fold over that seen in unstimulated cells . interestingly , the ability of viral challenge to augment dai expression by primary glial cells was not limited to this neurotropic alpha herpesvirus , as the lymphotropic gammaherpesvirus , mhv-68 , was also capable of eliciting robust increases in microglial dai expression and caused modest increases in the expression of this molecule in astrocytes . importantly , we showed that transfection with the dai specific ligand b - dna elicits inflammatory cytokine production by isolated glial cells , with induced production of the inflammatory cytokines tnf- and il-6 as rapidly as 6 h post - transfection at levels that matched or exceeded those elicited following a 24-h hsv-1 challenge ( furr et al . , 2011 ) . to confirm the functional status of dai in glial cells and to begin to determine the relative importance of this innate immune sensor in their responses to neurotropic dna viruses , we also assessed the effect of dai knockdown on inflammatory cytokine production by hsv-1 challenged microglia and astrocytes ( furr et al . , 2011 ) . we found that sirna directed against dai significantly attenuated hsv-1 induced tnf- and il-6 production by murine microglia . such an approach also markedly reduced il-6 release by hsv-1 infected astrocytes but was not as effective in reducing tnf- expression by these cells , where a statistically significant reduction was only observed at the highest viral moi used ( furr et al . , 2011 ) . finally , we demonstrated that hsv-1 challenged microglia and astrocytes release neurotoxic mediators and showed that such production is significantly attenuated following dai knockdown ( furr et al . , the functional expression of dai by microglia and astrocytes may represent an important innate immune mechanism underlying the rapid and potentially lethal inflammation associated with neurotropic dna virus infection . however , the involvement of dna sensor(s ) other than dai can not be excluded . for example , a new dna sensor , aim2 , has been identified which binds to dna ( as reviewed in ranjan et al . , 2009 ) . upon dna ligation , aim2 associates with the apoptosis - associated speck - like protein containing a card ( asc ) leading to nf-b and caspase-1 activation and inflammatory cytokine production . aim2 knockdown has been shown to reduce such inflammasome formation and caspase-1 activation in response to dsdna administration and infection with vaccinia virus ( hornung et al . , 2009 ) and stable transfection of cell - lines with aim2 has been demonstrated to confer responsiveness to cytoplasmic dna ( fernandes - alnemri et al . , 2009 ) . to date , the role of aim2 in innate immune responses to dna viruses in the cns has not been explored . while the preceding sections have focused on the roles of specific individual prrs in the detection of viral pathogens by cns cells , it is highly likely that glial responses represent the sum of the inputs from disparate cell surface , endosomal , and cytosolic viral sensors ( as shown in figure 3 ) . we , and others , have demonstrated that the level of expression of a particular tlr , nlr , or rlr by microglia and astrocytes can be regulated by ligands for dissimilar prrs ( bowman et al . , 2003 ; jack et al . , 2005 ; carpentier et al . , furthermore , mechanisms of positive and negative regulation of rlr signaling have been identified that include signaling cross - talk between rlr , nlr and dna - sensing pathways , and caspase networks . for example , it has been shown that mice deficient in the expression of the dai downstream effector molecule sting are highly susceptible to infection by negative - stranded viruses including vsv suggesting a role for this signaling molecule in both dai and rig - i mediated cell activation ( ishikawa and barber , 2008 ) . immunoprecipitation studies indicate sting associates with rig - i complexes in close proximity to endoplasmic reticulum associated mitochondria ( ishikawa et al . , 2009 ; interestingly , a number of rna viruses including yellow fever virus , dengue virus , and hepatitis c virus , encode proteins with significant structural homology to sting and at least one of these proteins produced by the dengue virus has been shown to inhibit sting function ( ishikawa et al . , 2009 ) . as such , these observations suggest a role for sting in anti - viral host responses to both dna and rna viruses . possible interactions between toll - like receptors ( tlrs ; e.g. , tlr3 and tlr7/8 ) , nucleotide oligomerization domain ( nod)-like receptors ( nlrs ; e.g. , nod2 ) , retinoic acid inducible gene ( rig)-i - like receptors ( rlrs ; e.g. , rig - i and mda5 ) and dna - dependent activator of ifn regulatory factors ( dai ) in the detection of viruses and the initiation of glial immune responses . these disparate cell surface , endosomal , and cytosolic sensors share common signaling components including interferon promoter stimulator ( ips)-1 and stimulator of interferon genes ( sting ) , leading to the activation of the transcription factors nf-b and interferon - regulatory factor ( irf ) 3 , which translocate into the nucleus and initiate anti - viral and inflammatory cytokine production . in addition , the activity of rna polymerase iii ( pol iii ) could provide an additional mechanism for the perception of dna viruses via rlrs . another example of cross - talk between viral sensing pathways is the recent demonstration that rig - i may be important in the production of type i ifns by cells in response to dna viral challenge in a dna - dependent rna polymerase iii manner ( ablasser et al . , 2009 ; chiu et al . , 2009 ) . in the proposed model , at - rich double - stranded dna serves as a template for rna polymerase iii and is transcribed into rna containing a 5-triphosphate , the ligand for rig - i . subsequent activation of rig - i by this ligand has been shown to induce type i ifn production and to activate nf-b , and studies employing rna polymerase iii knockdown or pharmacological inhibitors of this enzyme have shown that this pathway is important in cell responses to the gammaherpesvirus epstein - barr virus ( ablasser et al . , 2009 ; chiu et al . , 2009 ) . together , these studies suggest that the transcription of cytosolic viral dna by rna polymerase iii and subsequent rna recognition by rig - i could provide an additional mechanism by which glial cells perceive dna viruses . interestingly , there has been a recent report of a role for the well - characterized bacterial sensor , nod2 , in the recognition of viral infections and the activation of irf-3 via ips-1 ( sabbah et al . , 2009 ) . while nod2 is known to recognize the bacterial cell wall component muramyl dipeptide and trigger nf-b activation via the adaptor molecule rip2 , sabbah et al . ( 2009 ) have provided evidence that this sensor is also important in the detection of ssrna derived from respiratory syncytial virus . however , it is currently unknown if nod2 is directly activated by this viral ligand , or is activated secondarily following association with other prrs or rna binding factors . furthermore , it remains to be determined whether such interactions between nlrs and rig - i - associated signaling components occur in glial cells or whether they play a significant role during viral cns infections . microglia and astrocytes express a diverse array of cell surface , endosomal , and cytosolic molecules that can serve as sensors for rna and dna viruses , either constitutively or following activation . it is also clear that resident cns cells can respond to a diverse array of ligands and that exquisite control of the associated signaling pathways exists leading to the observed complexity in the interactions between the innate and adaptive arms of the host immune response . however , it is obvious that we still do not fully understand the precise nature and structure of the ligands for many of these prrs or their mode of generation during infection . furthermore , the available data suggest that models that ascribe discrete prrs to each particular pathogen are overly simplistic . rather , it appears that tlrs , rlrs , nlrs , and dai function as prrs and/or adaptor molecules that act in a cooperative / synergistic manner to promote glial responses to viral pathogens . in addition to these caveats , it is almost certain that additional prrs await discovery in glial cells and the nature of the interactions between these viral sensors and cellular activation pathways have yet to be determined . finally , it is unclear whether and to what degree viral cns pathogens evade detection or manipulate immune responses to their advantage . answering these questions will lead to greater understanding of the fundamental mechanisms underlying glial activation by neurotropic viruses and will contribute significantly to our understanding of the events that underlie the development of either protective host responses or life threatening neuroinflammation . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

viruses are the major causative agents of central nervous system ( cns ) infection worldwide . rna and dna viruses trigger broad activation of glial cells including microglia and astrocytes , eliciting the release of an array of mediators that can promote innate and adaptive immune responses . such responses can limit viral replication and dissemination leading to infection resolution . however , a defining feature of viral cns infection is the rapid onset of severe neuroinflammation and overzealous glial responses are associated with significant neurological damage or even death . the mechanisms by which microglia and astrocytes perceive neurotropic rna and dna viruses are only now becoming apparent with the discovery of a variety of cell surface and cytosolic molecules that serve as sensors for viral components . in this review we discuss the role played by members of the toll - like family of pattern recognition receptors ( prrs ) in the inflammatory responses of glial cells to the principle causative agents of viral encephalitis . importantly , we also describe the evidence for the involvement of a number of newly described intracellular prrs , including retinoic acid - inducible gene i and dna - dependent activator of ifn regulatory factors , that are thought to function as intracellular sensors of rna and dna viruses , respectively . finally , we explore the possibility that cross - talk exists between these disparate viral sensors and their signaling pathways , and describe how glial cytosolic and cell surface / endosomal prrs could act in a cooperative manner to promote the fulminant inflammation associated with acute neurotropic viral infection .

GLIAL CELLS PLAY A CRITICAL ROLE IN THE INITIATION OF VIRALLY INDUCED NEUROINFLAMMATION TLRs MEDIATE GLIAL RESPONSES TO EXTRA CELLULAR OR ENDOSOMAL VIRAL MOTIFS RIG-LIKE RECEPTORS CAN MEDIATE PROTECTIVE IMMUNE RESPONSES AND DAMAGING CNS INFLAMMATION FOLLOWING RNA VIRUS INFECTION NEWLY DISCOVERED CYTOSOLIC VIRAL SENSORS MAY MEDIATE GLIAL RESPONSES TO DNA VIRUSES PRRs ACT IN A COOPERATIVE MANNER TO INDUCE GLIAL RESPONSES TO VIRAL CHALLENGES CONCLUDING REMARKS Conflict of Interest Statement

as student travel to malaria - risk regions increases , malaria education becomes a more pressing need because infection can rapidly lead to permanent disability or death . many travelers have limited knowledge of malaria despite it being a leading cause of death worldwide , with 200 - 300 million infections and nearly one million deaths each year . in the absence of a malaria vaccine , risk - reduction depends upon the consistent use of personal protection measures and immediate response to the development of symptoms . students who become ill while abroad disrupt activities and unnecessarily burden local health care systems . when symptoms develop after returning home , clinicians may be less familiar with the complexities of malaria diagnosis and treatment , and malaria parasites may be introduced into areas previously cleared of transmission . factors favoring malaria transmission include a low knowledge of malaria and the discomfort , inconvenience , and cost of personal protection measures . this paper describes a malaria knowledge test ( mkt ) developed to test the efficacy of an educational game ( a web - based travel - simulation that informs students about malaria through scenario - based decision - making and outcomes that include health , illness , disability or death ) . mkt development was undertaken when a suitable knowledge test was not identified in the literature . youthful travelers are uniquely vulnerable because they have less experience with the atypical characteristics of many tropical diseases , and they are susceptible to the developmentally normative risk - taking behavior characteristic of adolescents and young adults . although a more detailed description of the overall experimental design , participant sample and mkt items is provided elsewhere , the highlights of mkt development and evaluation are reviewed in this report . following iterative testing of the mkt and an associated game , a summative evaluation was conducted using an experimental design that compared three game versions that varied player access to feedback in response to game decisions . feedback was chosen as the factor of interest because there is limited evidence about which feedback strategies are most effective in the context of brief - exposure educational games , particularly those addressing complex topics with potentially serious consequences if content is misinterpreted . each treatment group was exposed to one of three types of explanatory feedback : i ) a rationale for why a game action had a positive or negative effect , provided automatically as a pop - up text box after each player action ( in - game decision ) ; ii ) a rationale accessed at player - discretion by clicking on a link associated with that action ; and iii ) no access to a pop - up rationale . study abroad program administrators distributed information about the study using internal e - mail lists ; study co - investigators had no direct access to these email lists . approval was obtained from the institutional review board on each campus prior to study deployment . a link within the invitation letter consent was implied when students clicked on the study link , and participation could be terminated at any time . participants were linked sequentially from the pre - game survey to the game and then to the post - game survey . following post - game survey submission , participants were directed to a summary site where they were provided with their pre / post mkt scores and additional malaria resources . the mkt was structured using the dimensions of the self - regulation model ( srm ) and content consistent with us and international standards for malaria education . the srm is centered on the personal construction of meaning that is processed both cognitively and emotionally . the srm proposes that emotions influence behaviors differently than cognitive representations , and are a crucial component of theories to predict how individuals respond to perceived health risks . cognitive representations are assessed within the following dimensions in response to a perceived health threat : identity ( symptoms and labels ) , cause , timeline , consequences ( seriousness ) , control and/or cure , and coherence ( overall understanding ) . emotional representations are examined through the measurement of an individual s degree of fear , anxiety , or worry related to a health threat . coping activities are undertaken in response to health beliefs and the worry or anxiety elicited by these beliefs . in applying the srm to malaria , an accurate understanding of malaria risk and prevention options this emotional processing may then prompt risk reduction actions , such as a rapid response to potential malaria symptoms . it is important to improve representational accuracy for a complex disease such as malaria that has serious consequences and is prevalent in many areas of the world , yet is largely unfamiliar to individuals from non - endemic countries . the process of enhancing the accuracy of personal representations takes time and often repeated exposures because health beliefs can be resistant to change . according to the srm , a student who believes that malaria is no big deal ( i.e. , unlikely and not worrisome ) will have minimal motivation to engage in prevention behaviors . when this student experiences debilitating symptoms secondary to blood stage malaria infection , or learns of a tragic malaria outcome for a peer , this new information impacts the student s representation for malaria and may increase motivation to engage in prevention behaviors . conversely , returning from travel to a malaria - endemic country with no apparent symptoms can reinforce inaccurate information about malaria , such as transmission being rare and/or not serious , and may reduce motivation to seek testing for potential malaria symptoms during the year following risk exposure . however simulated experience offers a safe approach for the refinement of cognitive and emotional representations through trial and error , with feedback provided that is specific to the actions taken . the mkt was constructed to gauge the accuracy of malaria knowledge in a study abroad student population . further , there is evidence that learning experiences that increase an individual s emotional engagement and perception of risk are more likely to change beliefs and behavior than abstract information . to measure the emotional representation for malaria , students were asked to rate their degree of worry about being infected during travel to a malaria - endemic region . this item was part of a risk perception assessment that also included perceived likelihood of being infected with malaria . a pilot test of the initial 12-item mkt was administered on paper with 13 students who were close to departure for a field experience in a malaria - endemic location . the mean age was 22 years , with about half ( 54% ) reporting graduate student status and all recently receiving classroom education about malaria prevention . the mkt items were scored 0 for incorrect and 1 for correct ; the overall mean score was 91% correct . revisions to increase consistency and flow included adding six questions to achieve three per srm dimension and consistently offering five response options in a multiple choice format ( three true / false questions were restructured ) . a second pilot test was conducted over the internet using zoomerang survey software ( markettools , san francisco , ca , usa ) with 36 pre - nursing undergraduate students who had no prior classroom exposure to malaria education . participants were primarily female ( 97% ) and had a mean age of 19 years ( range 18 - 21 ) . eighty percent planned to study abroad , 11% had already returned from a study abroad experience , and 73% had previously traveled outside the united states unrelated to a study abroad experience . three cognitive interviews were conducted with students to further explore their interpretation of the meaning of question stems and response options , and what they liked most and least about content and formatting . following minor text revisions , content validity was tested for items within each dimension of the srm with five travel health specialists , and a survey research specialist suggested formatting edits to enhance online comprehension . the final pre - game survey consisted of an 18-item multiple - choice mkt with five response options ( appendix a ) , and two items that assessed perceptions about the likelihood and degree of worry related to malaria infection that could be acquired during travel to a malaria - endemic region ( appendix b ) . the post - game survey additionally included nine demographic items , one player satisfaction item , and an open - ended text box for comments . first , select findings from the comparison of game versions are provided because the mkt capacity to detect knowledge differences between groups ( by pre / post knowledge gain , game version , past travel , srm dimension ) is central to the evaluation of mkt efficacy . second , an srm dimensional analysis and examination of responses to individual mkt items are reported in order to inform future malaria risk reduction interventions . demographic data is summarized in table 1 for the 482 participants who completed the study protocol . the kuder - richardson 20 ( kr-20 ) coefficient of reliability for measures with dichotomous choices ( correct / incorrect ) was 0.82 pre - game and 0.73 post - game . the pre - game mkt mean score was 6.6 ( 37% correct , sd=4.2 ) and the post - game mean score was 13.8 ( 77% correct , sd=2.8 ) . the pre / post comparison ( t=39.38 , df=481 , p<0.001 ) and large effect size ( 0.767 ) demonstrated a strong overall learning effect . the group that automatically received explanatory feedback after each game action showed the greatest knowledge gain ( f(2482)=6.5 , p<0.005 ) . there were no differences in knowledge gain by study abroad status or by frequency of playing computer games . perceptions of worry about malaria infection increased from pre- to post - game ( t=3.54 , df=477 , p<0.001 , 2-tailed ) and there were differences for the variables of pre / post knowledge scores and worry ratings when examined by travel experience . participants who responded yes to an item about past travel to a malaria - risk region had higher mean knowledge scores both pre - game f(2478)=39.85 , p<0.0001 ) and post - game ( f(2478)=7.54 , p<0.001 ) compared to those who responded no or do nt know , although the malaria - experienced group still answered only 49% of the pre - game knowledge questions correctly . participants reporting past travel to a malaria - risk region had lower worry ratings pre - game f(2478)=17.90 , p<0.01 and post - game f(2478)=21.44 , p<0.01 as compared to those without this reported risk exposure . however worry ratings increased from pre- to post- for both the malaria - experienced ( t=3.098 , df=154 , p<0.01 ) and the malaria - nave ( t=2.483 , df=298 , p<0.01 ) groups . a self - regulation model dimensional analysis revealed that knowledge increased in every dimension , although the timeline and consequences dimensions had the lowest mean scores at both time - points ( table 2 ) . the pre - test items were examined to determine common errors in baseline malaria knowledge . for timeline , 92% were unable to identify the shortest time period from infection to symptoms and 67% did not recognize the possibility of a delayed symptom onset . for consequences , 86% were unaware that malaria infection may result in severe anemia , kidney failure , and brain effects , and 80% were unaware that malaria might be rapidly fatal . additionally , 68% did not know that the infectious agent is a parasite ( cause ) and 82% failed to recognize that the peak biting time for malaria transmission is dusk to dawn ( coherence ) . when participants were asked to choose the best prevention measure from a list of four actions and one do nt know response ( control ) , 49% opted for a non - existent vaccine and 25% selected do nt know . in contrast , identity was the dimension with the greatest gain in representational accuracy after participants completed game play ; nearly all correctly identified malaria symptoms ( 97% ) , the type of diagnostic test ( 99% ) , and the degree of risk globally ( 92% ) . among respondents reporting past travel to a malaria - risk region on the pre - test , 47% opted for a non - existent vaccine and 11% selected do nt know when asked to choose the best prevention measure . the post - test responses for this group were examined as a best - case scenario for malaria comprehension since these students had experienced both actual and simulated exposure to malaria transmission . the three items with the most incorrect responses on the post - test were : malaria can be rapidly fatal ( 63% ) ; malaria infection may result in severe anemia , kidney failure , and brain effects ( 46% ) ; symptoms may first be noticed months after being infected ( 44% ) . this section discusses what the game evaluation data reveal about the mkt as an assessment instrument , and how the mkt is linked to the larger objective of reducing risk among travelers to malaria endemic destinations . the mkt was constructed along the dimensions of the srm to measure the accuracy of malaria beliefs in a study abroad student population . study findings demonstrated acceptable internal consistency ( pre and post kr-20 ) and pre / post sensitivity to change for knowledge and worry about malaria . the mkt items also successfully discriminated between groups by the game version , by travel experience , and by srm dimension . pre - game mkt scores indicated that malaria knowledge deficits exist , while post - game mkt scores improved across all srm dimensions in both the malaria - experienced and malaria - naive groups . this substantial pre / post learning effect is a key precursor for competent adherence to travel recommendations . findings also revealed an increase in the perception of worry about malaria after playing the game . the potential for increased worry to motivate risk - reduction actions is supported by prior data indicating that risk examined as a feeling was a better predictor of risk - reduction behavior than a purely cognitive probability judgment . participants showed evidence of persistent health belief inaccuracies in the two representational dimensions with the lowest pre / post knowledge scores : timeline and consequences . these dimensions may be more complex to comprehend , such as the potential for a delayed symptom onset or for a rapid progression to permanent disability or death once symptoms develop . the significant pre / post increase in mkt scores among participants reporting past travel to a malaria - endemic region indicates that even malaria - experienced travelers can benefit from this type of intervention . the finding that participants with past travel to a risk region had significantly higher pre - and post - mkt scores as compared to those without this travel experience supports the srm precept that concrete experiences impact mental representations . however , the group with past travel to a risk region still answered only 49% of the pre - game knowledge questions correctly . this is consistent with data that has identified knowledge gaps in travelers irrespective of travel history . the pre / post scores were lowest in the srm dimensions of timeline and consequences for all participants irrespective of travel history . most surprising on the pre - test was the enduring belief among nearly half of the malaria - experienced participants that the best malaria prevention measure is a non - existent vaccine . because malaria is a communicable disease with non - specific symptoms that can progress rapidly into a life - threatening illness , knowledge assessment and education about risk - reduction is of the utmost importance . however a 34-item survey was conducted with taiwanese physicians and nurses in 2008 on the broader topic of mosquito - transmitted disease ( malaria , yellow fever , and dengue ) . the malaria item with the most erroneous responses ( 83.2% ) addressed the potential for a delayed symptom onset , a timeline dimension similar to the findings of this study . the complicated nature of parasite physiology in the human body and varying risk by geographic region present challenges to health care providers who must provide pre - travel assessment and education ; individualized risk reduction plans that include vaccines , medication , and chronic care / emergency management ; and diagnosis and treatment across a spectrum of acuity . the authors of this taiwanese study conclude that clinician knowledge deficits might be remedied through increased exposure to international standards for the delivery of travel health services . the present study demonstrates how unique features of a health threat may impact the measurement of the accuracy of knowledge . malaria has a complex timeline dimension ( acute , cyclic , relapsing ) , and consequences that can range from complete resolution with treatment to permanent disability or death if not recognized and treated promptly . few health conditions have similar features , and even fewer have the global prevalence and historic significance of malaria . identifying the malaria content with the greatest likelihood for further , the comparison of game versions showed that automatically providing explanatory feedback in a brief - exposure educational game supports learning better than having learners seek feedback as desired or not providing this feedback . these findings provide valuable information for health educators and clinicians about the malaria content most likely to be misunderstood or under - appreciated , and how to use feedback most effectively in games and simulations to increase the accuracy of representations for malaria . study limitations include a recruitment pool originating from one region of the united states and a low participation rate ( 34% of those who accessed the 30-min online protocol completed it without incentive ) . participants who were female ( 73% ) and white ( 86% ) were overrepresented , although this is consistent with national demographic data for study abroad students who over the past decade have been on average 65% female and 82% white . this study did not test the degree of knowledge retention beyond one post - test , or the impact of increased knowledge and worry on subsequent travel - related behavior . the growing population of students who travel to malaria - endemic regions would benefit from more accessible and engaging approaches to travel health education , and from a test to evaluate malaria knowledge . one such test , the mkt , required about 5 min to complete when administered online to students participating in study abroad programs on seven midwestern u.s the mkt demonstrated acceptable internal consistency and sensitivity to change in response to an educational intervention . game exposure produced significant improvements in mkt scores across all dimensions of the srm in both the malaria - experienced and malaria - naive groups . greater understanding of traveler cognitive and emotional representations about malaria will enhance the creation of more tailored interventions . this presents a hazard when students do not understand , for example , how quickly malaria can progress to death or disability , how parasite drug - resistance or counterfeit drugs can increase risk for a tragic outcome even with a rapid diagnosis , or why symptoms might develop after returning home . this open - access knowledge test may also be adapted to evaluate other malaria education interventions , and for educational outreach among health care providers globally , residents of malaria - endemic regions , and other high risk travel groups ( i.e. , elderly , chronic health conditions , pregnant , or returning to a malaria - endemic region to visit friends / relatives ) .

this paper describes a malaria knowledge test ( mkt ) developed to evaluate a web - based game for students who increasingly travel to malaria - risk regions of the world . the 18-item mkt was structured according to the dimensions of the self - regulation model ( srm ) to measure the accuracy of students beliefs about malaria . an experimental design was used to compare three game versions . students ( n=482 ) participated in 2010 by completing a pre - test , playing a web - based game simulating student travel to malaria - endemic destinations , and completing a post - test . study data support the validity and reliability of the mkt for the evaluation of malaria education interventions and for student self - assessment . use of the mkt to evaluate an educational game about malaria revealed a strong overall learning effect and discrimination by game version , travel experience , and srm dimension . this 5-min test may also be adapted for educational outreach purposes among health care providers globally , residents of malaria - endemic regions , and other high risk travel groups ( e.g. , elderly , chronic health conditions , pregnant , or returning to malaria - endemic regions to visit friends / relatives ) .

Introduction Materials and Methods Procedure Development of the malaria knowledge test Results Discussion Conclusions

when asked to give an account of his creative process , albert einstein reported that language played virtually no role in his thought process . the psychical entities which seem to serve as elements in thought when einstein s brain was examined postmortem , it was noted that among other irregularities , the inferior parietal lobe was significantly larger than normal . the posterior parietal cortex ( ppc ) plays a central role in multisensory integration and environmental - spatial cognition . many recent human imaging ( and also some monkey neurophysiology ) studies demonstrate that the ppc additionally supports various forms of high - order non - spatial cognition that are not necessarily directly related to physical space itself . for example , while the superior parietal lobule ( spl ) tends to process spatial information in a conventional way , the inferior parietal lobule ( ipl ) is often credited with non - spatial cognition . the ipl is said to be evolutionarily new and uniquely expanded in humans and the monkey ppc is said to correspond to the human spl , but there is another view that the monkey ppc possesses functional homologues of both regions . if the latter view is correct , neuroscientists should be able to identify precursory mechanisms of non - spatial information processing in non - human primates . indeed , when monkeys were trained to acquire tool use - a high - order behavior they rarely exhibit naturally - ppc expansion was observed at both microscopic and macroscopic scales . ( a ) monkey ppc ; ( b ) human left ppc ; ( c ) human right ppc . results of meta - analysis ( based on the references listed in figure 2 ) of cortical areas responsible for non - spatial cognition are superimposed . data points in monkeys are projected onto the left hemisphere ( because no particular laterality has been claimed ) , whereas those in human subjects are illustrated independently for each hemisphere ( being biased toward the left hemisphere ) . large and dashed symbols indicate areas estimated from reviews and original papers , respectively , in which coordinates were not clearly specified . arabic numerals indicate brodmann areas ( 40 : supramarginal gyrus ; 39 : angular gyrus ) . aip , anterior intraparietal area ; cip , caudal intraparietal area ; cs , central sulcus ; ips , intraparietal sulcus ; lip , lateral intraparietal area ; mip , medial intraparietal area ; pcs , post central sulcus ; pos , parieto - occipital sulcus ; sf , sylvian fissure ; sts , superior temporal sulcus ; vip , ventral intraparietal area . the following section reviews various recently reported forms of non - spatial representation in the ppc . they are ordered roughly in terms of the level of abstraction of the objects and pseudo - spatial relations represented ( figure 2 ) . the last section considers potential mechanisms that could have enabled the hominid ppc to establish such representations and hypothesizes a general principle to unify these newer forms of representation with the ppc s original functions . left , hypothesized mechanism for increasing abstract levels of representations ( see future directions section for details ) . right , structure of various levels of abstract spaces ( references for respective levels are listed in the far - right column ) . 3d , three - dimensional ; 4d , four - dimensional ; ag , angular gyrus ; aip , anterior intraparietal area ; cip , caudal intraparietal area ; ipl , inferior parietal lobule ; ips , intraparietal sulcus ; lip , lateral intraparietal area ; ppc , posterior parietal cortex ; sii , secondary somatosensory cortex ; smg , supramarginal gyrus ; spl , superior parietal lobule ; tpj , temporo - parietal junction . the ppc is implicated in three - dimensional ( 3d ) object recognition , processing of number and quantity , attention , and memory . the intraparietal sulcus ( ips ) and anterior intraparietal area are activated when concrete 3d objects are recognized , explored , imagined , and constructed . discerning continuous quantity recruits the anterior ips while discrete number processing recruits the bilateral ips [ 14 - 16 ] , forming a mental number line and mental arithmetic . sustained attention to spatial locations recruits the area between the right ips and the ipl . the lateral intraparietal area responds to various features of the stimulus shape [ 20 - 25 ] . angular gyrus and temporo - parietal junction ( tpj ) activity is related to stimulus saliency detection and control . the left and right posterior tpj are active while processing global and local information , respectively . the ppc may play a critical role in working memory [ 30 - 33 ] , although this region can also be active during tasks requiring no working memory . thus , the ppc s apparent role in working memory may reflect a broader function , such as temporally transferring information from present to future ( see temporal space section ) . the tpj plays a crucial role in temporal order judgment tasks as well as in magnitude judgments about numbers . the ppc supports time interval estimation and is active when estimating future object position . in the ppc the ppc processes some aspects of social space , including action understanding , tool use , and self - other relationships , thereby enabling imitation . the ppc is one of the brain areas showing mirror properties [ 42 - 44 ] . imitation activates the left inferior parietal cortex more than observation does , regardless of first- or third - person perspective . the human anterior ips distinguishes between observed and executed movements , suggesting that ppc neurons have hierarchical properties for recognizing sameness or difference of kinematics , goals , and function of motion . the ppc supports tool usage , an extension of the bodily self [ 49 - 52 ] . this faculty may require an implicit equivalence to be drawn between innate body parts and external objects . a proposed brain network subserving such body - part objectification includes the ppc . evaluations of physical and social distance to others involve the superior and inferior ppc , respectively , in accordance with egocentric distance estimation by the parietal cortex . cooperative and competitive tasks recruit a common set of brain regions with competition activating the right inferior parietal lobe more strongly , reflecting the apparent contrast between self and others . the ppc s facility with both concrete spatial cognition and self - other discrimination may have preadapted it to handle perspective transformation in social situations . this in turn could have laid the basis for further functional expansion into realms such as social categorization and , later in evolution , conceptual spaces . finally , the ppc appears to play a role in causal reasoning , mental object manipulation , attention switching , set shifting , and dimensional abstraction . in addition to the role of the ppc in tool usage ( see social space section ) , different ppc areas support broad concepts such as the causal ramifications of using tools and the logical structures of the gestures involved . the spl and smg are differentially activated during rotations of visual and motor imagery , respectively . spatial scanning through mental imagery activated the precuneus , spl , ipl , and ips . the ppc is responsible for mentally manipulating sequentially learned materials , whereas the mid - dorsolateral prefrontal cortex is responsible for monitoring the learned items . ppc activation is also related to cognitive set shifting [ 65 - 70 ] . during a visual search with attention shifts , ppc activation was diminished in elderly people in the solution - search phase of a set - shifting task . perspective taking is one of the prominent qualitative distinctions between the attention - shifting abilities of humans and other primates . ppc activity also correlates with abstract information at various levels and dimensions [ 74 - 77 ] and with modulation of the strength of the visual stimulus and motor planning . the left parietal cortex is involved in the cortical rearranging of the relationship between semantic items in space . the ppc is implicated in three - dimensional ( 3d ) object recognition , processing of number and quantity , attention , and memory . the intraparietal sulcus ( ips ) and anterior intraparietal area are activated when concrete 3d objects are recognized , explored , imagined , and constructed . discerning continuous quantity recruits the anterior ips while discrete number processing recruits the bilateral ips [ 14 - 16 ] , forming a mental number line and mental arithmetic . sustained attention to spatial locations recruits the area between the right ips and the ipl . the lateral intraparietal area responds to various features of the stimulus shape [ 20 - 25 ] . angular gyrus and temporo - parietal junction ( tpj ) activity is related to stimulus saliency detection and control . the left and right posterior tpj are active while processing global and local information , respectively . the ppc may play a critical role in working memory [ 30 - 33 ] , although this region can also be active during tasks requiring no working memory . thus , the ppc s apparent role in working memory may reflect a broader function , such as temporally transferring information from present to future ( see temporal space section ) . the tpj plays a crucial role in temporal order judgment tasks as well as in magnitude judgments about numbers . the ppc supports time interval estimation and is active when estimating future object position . in the ppc , the ppc processes some aspects of social space , including action understanding , tool use , and self - other relationships , thereby enabling imitation . the ppc is one of the brain areas showing mirror properties [ 42 - 44 ] . imitation activates the left inferior parietal cortex more than observation does , regardless of first- or third - person perspective . the human anterior ips distinguishes between observed and executed movements , suggesting that ppc neurons have hierarchical properties for recognizing sameness or difference of kinematics , goals , and function of motion . the ppc supports tool usage , an extension of the bodily self [ 49 - 52 ] . this faculty may require an implicit equivalence to be drawn between innate body parts and external objects . evaluations of physical and social distance to others involve the superior and inferior ppc , respectively , in accordance with egocentric distance estimation by the parietal cortex . cooperative and competitive tasks recruit a common set of brain regions with competition activating the right inferior parietal lobe more strongly , reflecting the apparent contrast between self and others . the ppc s facility with both concrete spatial cognition and self - other discrimination may have preadapted it to handle perspective transformation in social situations . this in turn could have laid the basis for further functional expansion into realms such as social categorization and , later in evolution , conceptual spaces . finally , the ppc appears to play a role in causal reasoning , mental object manipulation , attention switching , set shifting , and dimensional abstraction . in addition to the role of the ppc in tool usage ( see social space section ) , different ppc areas support broad concepts such as the causal ramifications of using tools and the logical structures of the gestures involved . the spl and smg are differentially activated during rotations of visual and motor imagery , respectively . spatial scanning through mental imagery activated the precuneus , spl , ipl , and ips . the ppc is responsible for mentally manipulating sequentially learned materials , whereas the mid - dorsolateral prefrontal cortex is responsible for monitoring the learned items . ppc activation is also related to cognitive set shifting [ 65 - 70 ] . during a visual search with attention shifts , ppc activation was diminished in elderly people in the solution - search phase of a set - shifting task . perspective taking is one of the prominent qualitative distinctions between the attention - shifting abilities of humans and other primates . ppc activity also correlates with abstract information at various levels and dimensions [ 74 - 77 ] and with modulation of the strength of the visual stimulus and motor planning . the left parietal cortex is involved in the cortical rearranging of the relationship between semantic items in space . as outlined above and illustrated in figure 2 ( right ) , various kinds of non - spatial cognition can be grouped and ordered based on the levels of abstraction of the objects and ideally defined spaces represented . assumed coordinate systems for such the pseudo - spatial nature of the high - order cognition supported by the ppc may derive from the essential characteristics of the objects represented but alternatively may derive from the nature of the ppc s pre - existing information - processing mechanisms , namely as a hub for multisensory integration and representing physical environmental space . the meta - analysis in figure 1 illustrates that the ppc areas responsible for these novel forms of cognition are not necessarily clearly segregated , either in monkeys or humans , but does suggest a trend of gradual expansion toward the ipl as the level of abstraction proceeds . thus , it seems that the ppc gradually incorporated high - order cognition as it expanded during hominid evolution while preserving its original principles of operation . what is the explanation for this expansion of function ? here is a hypothesis involving mechanisms for selecting and switching between objects among different represented spaces : ( a ) in classical ( physical ) space , spatial attention toward concrete objects was typically expressed as eye movement ; ( b ) when such attention needed to be sustained or when the attending content needed to be memorized , invisible visualized in the mind s eye , becoming a new virtual dimension in the ppc s existing suite of spatial coordinate systems ; ( c ) once the ppc could visualize an invisible virtual entity , a similar objectification process could be extended further , enabling intentional perspective switching ( figure 2 , left ) . acquiring representations of social space might have accelerated this process . through objectification processes and the development of virtual eyes , flexible and mutually integrated representations of the bodily self , the analogous selves of others , and tools as equivalents of body parts ( and vice versa ) might have served as a bridge between concrete physical and abstract conceptual spaces . as the ppc expanded in both physical volume and range of function ( figure 2 , dashed circle ) , a positive feedback process ( arrow ) could have been established to achieve further human - specific forms of non - spatial conceptual cognition . thus , crucial components of human intelligence derive their character from the precursorial spatial cognition process of the ppc . indeed , language is rife with spatial metaphors for abstract thoughts . non - human primates possess the same precursorial parietal mechanisms as human ancestors ; through training , their cognitive capacities can be artificially extended in the hominid / human direction . if correct , this hypothesis will be valuable in guiding the design of future experimental paradigms , in both animal and human studies , to elucidate the principles of parietal information processing .

the primate posterior parietal cortex ( ppc ) processes information related to environmental physical space . the human ppc has apparently expanded not only in size but also in its functional range to encompass certain abstract and higher - order conceptual spaces . in this report , we review various forms of non - spatial representation in the ppc . these forms are presented roughly in order of the level of abstraction of the objects and pseudo - spatial relations represented . also , we consider mechanisms that could have enabled the hominid ppc to establish such representations . lastly , we offer a general principle to unify the newer forms of representation with the original functions of the ppc .

Introduction and context Major recent advances Perceptual space Temporal space Social space Conceptual space Future directions Competing interests

endometriosis is an estrogen - dependent chronic inflammatory condition that affects women in their reproductive period , and is associated with pelvic pain and infertility . this gynecologic condition has a prevalence of 5% , and a peak between 25 and 35 years of age . a 0.1% annual incidence has been reported among women aged 15 to 49 years . despite the high morbidity and healthcare costs associated with this condition , the exact cause of endometriosis remains unknown , as estrogens fuel ectopic endometrial growth , and alterations of estrogen signaling have been associated with the disease , one of the proposed mechanism may include the influence in levels and availability of sex hormones . it has been hypothesized that participation in recreational or occupational physical activity ( pa ) may decrease estrogen levels and , with extreme exercise , reduce the frequency of ovulation . further , pa may increase levels of sex hormone binding globulin ( shbg ) , which would reduce bioavailable estrogens . hyperinsulinemia may increase concentrations of estrogens through decreasing concentrations of shbg , and may increase concentrations of insulin - like growth factor-1 ( igf-1 , that can stimulate endometrial cell proliferation ) through decreasing concentrations of insulin - like growth factor binding protein ( igfbp)-1 . finally , regular pa seems to have protective effects on diseases that involve inflammatory processes and oxidative stress , as it increases systemic levels of antiinflammatory cytokines . on the basis of these biological hypotheses , in the last years most studies suggested that adult pa decreases endometriosis risk , but up to date , to the best of our knowledge , no meta - analysis has been performed to critically evaluate and statistically combine the results of comparable studies . to summarize the currently available information and to provide the estimates of the possible effect size of this association , we conducted a systematic review and a meta - analysis of epidemiological data from case control and cohort studies , on the relation between pa and risk of endometriosis . this study was undertaken in accordance with the preferred reporting items for systematic reviews and meta - analyses ( prisma ) statement . ethical approval and written informed consent from patients were not necessary because our study was based on summaries and analyses of results of published studies . we carried out a literature search of all case control and cohort studies published as original articles in english up to april 2016 . we searched the electronic databases medline ( 1966 to 2016/04/12 ) and embase ( 1985 to 2016/04/12 ) using the medical subject heading ( mesh ) term physical activity or exercise or walking combined with furthermore , we reviewed reference lists of retrieved articles to search for other pertinent studies . two authors reviewed the papers and independently selected the articles eligible for the systematic review . studies were selected for the review if they met all of the following criteria : case control or cohort study reporting original data ; diagnosis of endometriosis was clinically and/or histologically based ; number or percentage of subject with and without endometriosis according to pa were provided ; full - length articles , published in english . if multiple published reports from a same study were available , we included only the one with the most detailed information . data were extracted independently by 2 investigators and discrepancies were resolved by discussion . for each study , the following information was collected on a standard form : first author 's last name ; year of publication ; country of origin ; study design ; number of subjects ; age , if available ; category of pa , if available ; relative risks ( rr ) or odds ratios ( or ) of endometriosis and corresponding 95% confidence intervals ( ci ) ; covariates adjusted for in the statistical analysis . study quality was independently evaluated by 2 reviewers , using the newcastle - ottawa quality assessment scale for case control ( selection , comparability , exposure ) and cohort studies ( selection , comparability , outcome ) . we combined the or and rr estimates from each study , using the adjusted estimates as published . to account for adjustments in the estimates we computed unadjusted ors from the exposure distributions of cases and controls as reported in the publications if the adjusted or was unavailable . ors and 95% cis were calculated by using both fixed - effect and random - effect models . since the studies included in the meta - analysis were different in many aspects , first of all the design and the population included , we chose to present the results of the random - effect model . the i statistic was used as a measure of heterogeneity , categorized , as suggested by higgins et al , in low ( 25% ) , moderate ( 50% ) , and high ( 75% ) . the funnel plot was used to detect small study effect . in these studies , cases and controls when available , the estimates included in the pooled analyses came from the comparison between cases and controls with the same characteristic ( infertile / infertile , fertile / fertile , unselected / unselected ) . if unavailable , we included the estimates from the comparison with fertile controls . to avoid duplication of data , if a study had 2 control groups and did not report an overall estimate , we chose to include the fertile control group in the main analysis . main comparison was pa yes versus no . when the overall result was not published , we calculated the or from the published numbers of cases and controls ( crude or ) . as we were authors of one of the papers , original data were available and we could calculate and include the adjusted or for pa versus not pa . since in the cohort studies the prevalence of endometriosis was comparatively low , we calculated the ors as estimates of rrs . a dose effect analysis was also planned : as the cut - off values were different among studies , we compared the highest category as reported in each paper versus no pa ; if a moderate level of pa was present , we included it in the low moderate versus no pa analysis , else we included the lowest level of pa as reported . in a paper reporting several levels of pa , we calculated the crude rr of endometriosis for low moderate pa adding subjects under and in the intermediate level , and for high pa adding those over the intermediate level . the results of the meta - analysis were also presented through cumulative meta - analysis over time : studies were added one a time according to publication year , and results summarized as each new study was added . in some cases , the study - specific 95% cis might slightly differ from those published in the original publications because of rounding . we performed an analysis in subgroups by type of controls ( fertile , infertile , both or not specified ) . as some studies included both types of controls , we did not compute an overall estimate , to avoid duplication . a subgroup analysis by type of observational study was initially planned , but as we retrieved just one cohort study reporting current pa , we calculated the pooled estimate including and excluding this study , to evaluate if the result was significantly different . review manager ( revman ; computer program , version 5.3 ; the nordic cochrane centre , the cochrane collaboration , copenhagen , denmark , 2014 ) was used to analyze the data . we carried out a literature search of all case control and cohort studies published as original articles in english up to april 2016 . we searched the electronic databases medline ( 1966 to 2016/04/12 ) and embase ( 1985 to 2016/04/12 ) using the medical subject heading ( mesh ) term physical activity or exercise or walking combined with furthermore , we reviewed reference lists of retrieved articles to search for other pertinent studies . two authors reviewed the papers and independently selected the articles eligible for the systematic review . studies were selected for the review if they met all of the following criteria : case control or cohort study reporting original data ; diagnosis of endometriosis was clinically and/or histologically based ; number or percentage of subject with and without endometriosis according to pa were provided ; full - length articles , published in english . if multiple published reports from a same study were available , we included only the one with the most detailed information . data were extracted independently by 2 investigators and discrepancies were resolved by discussion . for each study , the following information was collected on a standard form : first author 's last name ; year of publication ; country of origin ; study design ; number of subjects ; age , if available ; category of pa , if available ; relative risks ( rr ) or odds ratios ( or ) of endometriosis and corresponding 95% confidence intervals ( ci ) ; covariates adjusted for in the statistical analysis . study quality was independently evaluated by 2 reviewers , using the newcastle - ottawa quality assessment scale for case control ( selection , comparability , exposure ) and cohort studies ( selection , comparability , outcome ) . we combined the or and rr estimates from each study , using the adjusted estimates as published . to account for adjustments in the estimates , we used log or transformation ( and corresponding standard error ) . we computed unadjusted ors from the exposure distributions of cases and controls as reported in the publications if the adjusted or was unavailable . ors and 95% cis were calculated by using both fixed - effect and random - effect models . since the studies included in the meta - analysis were different in many aspects , first of all the design and the population included , we chose to present the results of the random - effect model . the i statistic was used as a measure of heterogeneity , categorized , as suggested by higgins et al , in low ( 25% ) , moderate ( 50% ) , and high ( 75% ) . the funnel plot was used to detect small study effect . in these studies , cases and controls when available , the estimates included in the pooled analyses came from the comparison between cases and controls with the same characteristic ( infertile / infertile , fertile / fertile , unselected / unselected ) . if unavailable , we included the estimates from the comparison with fertile controls . to avoid duplication of data , if a study had 2 control groups and did not report an overall estimate , we chose to include the fertile control group in the main analysis . . when the overall result was not published , we calculated the or from the published numbers of cases and controls ( crude or ) . as we were authors of one of the papers , original data were available and we could calculate and include the adjusted or for pa versus not pa . since in the cohort studies the prevalence of endometriosis was comparatively low , we calculated the ors as estimates of rrs . a dose effect analysis was also planned : as the cut - off values were different among studies , we compared the highest category as reported in each paper versus no pa ; if a moderate level of pa was present , we included it in the low moderate versus no pa analysis , else we included the lowest level of pa as reported . in a paper reporting several levels of pa , we calculated the crude rr of endometriosis for low moderate pa adding subjects under and in the intermediate level , and for high pa adding those over the intermediate level . the results of the meta - analysis were also presented through cumulative meta - analysis over time : studies were added one a time according to publication year , and results summarized as each new study was added . in some cases , the study - specific 95% cis might slightly differ from those published in the original publications because of rounding . we performed an analysis in subgroups by type of controls ( fertile , infertile , both or not specified ) . as some studies included both types of controls , we did not compute an overall estimate , to avoid duplication . a subgroup analysis by type of observational study was initially planned , but as we retrieved just one cohort study reporting current pa , we calculated the pooled estimate including and excluding this study , to evaluate if the result was significantly different . other 2 cohort studies were retrieved , but they only considered past pa . review manager ( revman ; computer program , version 5.3 ; the nordic cochrane centre , the cochrane collaboration , copenhagen , denmark , 2014 ) was used to analyze the data . figure 1 shows the flowchart of the selection of publications . from the literature search , combining embase and medline results we found 109 papers . activating english , human , and not review as filters , we identified 60 studies . after reading abstracts , we excluded 8 case reports , 11 studies without controls , 10 reviews / guidelines , 3 papers on malignancies , and 17 on other subjects ( endometriosis and infertility , endometriosis as reason for surgery , prevalence of endometriosis , bone health , etc . ) . eleven papers were extracted and extensively read : 2 were excluded because they were analyses on the same group of women , 1 because information was just recorded on energetic pa during menstruation . flow chart of the selection of studies on physical activity ( pa ) and risk of endometriosis included in the meta - analysis . then , we identified 1 additional publication by reviewing the reference lists of the retrieved papers . thus , in the present systematic review and meta - analysis , we combined data from 9 studies . two studies were on the same sample of women , but they separately analyzed current and past pa . table 1 shows the main characteristics of the studies included in the present meta - analysis . of these , description of studies included in the meta - analysis of endometriosis and recreational physical activity . seven studies investigated recent pa , whereas 5 also or exclusively asked information about pa during adolescence . we performed two separate meta - analyses , including a total of 3355 cases for recent exposure and 4600 cases for past exposure . pa was evaluated in several different ways : hours of pa per week , metabolic equivalents ( met)-h / week , author - defined low or high intensity activity . the main results of the published studies are reported in table 2 . authors who provided adjusted estimates of or found that current pa was protective against endometriosis : results from cramer et al and garavaglia et al were statistically significant . the cohort study of current pa provided , besides overall estimates , rrs according to fertile status : a slight effect of pa was observed in women with no past or concurrent infertility , but no association emerged when considering infertile women . main results of studies included in the meta - analysis of endometriosis and recreational physical activity . the main limitation of all studies regarded the choice of controls , that were not representative of general population , but were extracted by hospital controls , or infertility clinics , or included in cohorts selected for profession . our search strategy did not exclude studies where cases had clinically confirmed endometriosis , but most selected papers enrolled only women with laparoscopically or surgically confirmed endometriosis as cases . the only exception was the paper by kvaskoff et al , reporting data on past pa , that included only women reporting surgically confirmed diagnosis . figure 2 shows the study - specific and summary ors of endometriosis for ever versus never pa . the summary or was 0.85 ( 95% ci : 0.671.07 ) ( heterogeneity chi - square between studies = 11.12 , p = 0.08 ) . excluding the cohort study reporting current pa , the summary or was 0.73 ( 95% ci : 0.580.92 , heterogeneity chi - square = 3.21 , p = 0.67 ) . rerunning the analysis , only including adjusted estimates , we found an overall or of 0.69 ( 95% ci : 0.530.89 , heterogeneity chi - square 1.69 , p = 0.64 ) . considering i statistic , moderate heterogeneity was present in the overall analysis of current pa ( i = 46% ) , whereas the pooled estimates both from case control studies and adjusted ors showed low heterogeneity ( i = 0% ) . study - specific and summary odds ratios of endometriosis for any versus no physical activity ( 95% confidence interval in brackets ) : ( a ) all studies ; ( b ) only adjusted estimates . excluding each study in turn , the highest estimate was observed excluding vitonis et al ( or 0.73 , 95% ci : 0.580.92 ) , the lowest excluding cramer et al ( 1.02 , 95% ci : 0.931.14 ) . a cumulative meta - analysis ( fig . 3 ) showed a steadily increasing estimate over years , from 0.60 ( 95% ci : 0.420.85 , estimate of cramer et al , 1986 ) to 0.85 ( 95% ci : 0.671.07 ) including the last published study . cumulative meta - analysis of endometriosis for any versus no physical activity ( 95% confidence interval in brackets ) . odds ratios are shown ( with the corresponding 95% ci ) by year of publication of subsequent reports . figure 4 shows the study - specific and summary ors of low moderate current pa ( a ) and high current pa ( b ) , 1.00 ( 95% ci : 0.781.28 ) and 0.75 ( 95% ci : 0.531.07 ) , respectively . study - specific and summary odds ratios of endometriosis for low level ( a ) and moderate / high level ( b ) versus no physical activity ( 95% confidence interval in brackets ) . in fact , in some studies cases were selected for infertility , or a subanalysis for infertility was provided . since all cases were laparoscopically or surgically confirmed , it is likely that women without infertility would undergo these procedures only if pelvic pain was severe : thus , they are different from women who underwent the evaluation for infertility problems . the overall estimate was not calculated , since 1 study was considered in both groups . we found that the or for endometriosis in infertile women was 0.76 ( 95% ci : 0.511.12 ) and in fertile ones , more probably undergoing examination for pelvic pain , 1.03 ( 95% ci : 0.931.14 ) . study - specific and summary odds ratios of endometriosis for any versus no physical activity , by selection of cases ( 95% confidence interval in brackets ) . when the cases were infertile and controls were fertile women , pa appeared more protective ( or 0.60 , 95% ci : 0.440.83 ) , whereas when controls were women not selected for fertility , the result was not significant ( or 1.03 , 95% ci : 0.931.14 ) ( figure not shown ) . information about past pa was collected for different age ranges . however , since the information included at least part of adolescence years ( fig . the heterogeneity was significant ( chi - square 18.99 , p = 0.0008 ) ; the pooled estimate was 0.81 ( 95% ci : 0.641.04 ) : the study by cramer et al indicated a significant inverse association between pa , if started at less than 16 years , and endometriosis risk , and a similar finding emerged in garavaglia et al , whereas none of the other studies indicated such a significant effect , the study by dhillon and holt even suggesting the opposite . study - specific and summary odds ratios of endometriosis for any versus no physical activity during adolescent years ( 95% confidence interval in brackets ) . figure 7 shows the funnel plots for current pa versus no current pa ( a ) and past pa versus no past pa ( b ) . funnel plot of studies on physical activity , current ( a ) and past ( b ) , and risk of endometriosis . or = odds ratio , se = standard error . the general results of this analysis suggest that pa may reduce the risk of endometriosis , but does not conclusively support the hypothesis . although the pooled estimate of adjusted ors shows a significant protective effect of recent pa on endometriosis risk , the overall estimate was not statistically significant when including all retrieved articles . studies on the association between pa during adolescence and endometriosis are inconsistent , and our meta - analysis can not reach conclusive findings . a relationship between pa and endometriosis risk is biologically plausible for both the inflammatory and estrogen - dependent nature of the disease . inflammation is a typical feature of endometriosis , as the presence of ectopic tissue in the peritoneal cavity is associated with overproduction of prostaglandins , cytokines , and chemokines . endometriosis is associated with statistically significantly increased levels of peritoneal interleukin ( il)-6 and il-8 . disease - related excessive production of proinflammatory cytokines might predispose to endothelial dysfunction , accelerated atherosclerosis , and metabolic disorders such as insulin resistance . conversely , myokines secreted by skeletal muscle include various cytokines such as leukemia inhibitory factor , il-7 , irisin , able to induce an antiinflammatory response . it has been shown that fewer inflammatory markers are detectable after long - term behavioral changes involving both reduced energy intake and increased physical exercise . moreover , pa reduces insulin resistance , thus avoiding stimulation possibly linked to hyperglycemia and hyperinsulinemia . hyperinsulinemia may increase levels of estrogens through decreasing concentrations of shbg , and may increase levels of igf-1 through decreasing levels of igfbp-1 . both estrogens and igf-1 stimulates endometrial cell proliferation . finally , regular physical exercise is associated with a cumulative effect of reduction of menstrual flow and of estrogen action . in 2014 , a review on endometriosis and pa addressed the issue of the effects of pa on women with endometriosis , in terms of prevalence and possible therapeutic effects . the authors of this review noted that the few existing studies are observational , with little or no statistical significance , but the indication of an inverse relationship between the practice of physical exercise and the risk of endometriosis may be due to the discomfort experienced by women , that prevent the practice of physical exercise . as a narrative review , among 6 reviewed papers , it included 2 that did not meet our criteria . one of them found that strenuous exercise during menstruation but not in other periods was associated with a 2-fold risk of endometriosis ; the other paper focused on effects of pa on endometriosis related pain and interaction between painkillers and pa , concluding that taking painkillers might be less effective among endometriosis patients performing regular daily sport activities , and , thus , it might impose them to an unnecessary burden of possible side - effects . the data considered in that review are inconclusive regarding the benefits of physical exercise as a risk factor for the disease . the authors also noted that no data existed about the potential impact of exercise on the course of the endometriosis . only recently though it focused on sleep quality and pain threshold , nunes et al considered that performing pa regularly can contribute toward relieving sleep disorders and consequently may improve the quality of sleep ; therefore , patients with endometriosis should be encouraged to exercise during treatment . even if it considers pa in women with endometriosis , this study just addresses a general effect on women 's well being , rather than the role of regular exercise in relieving pelvic pain and affecting the disease course . in the interpretation of the association , the protective effect of high - level pa on risk of endometriosis may be at least partially explained by the fact that women affected by pain related to endometriosis may reduce their level of activity . otherwise , it has been showed that pa lowers pain symptoms . several mechanisms primed with aerobic exercise can lead to an important pain decrease . through numerous neuroendocrine modifications and a modulating action on the central and peripheral nervous systems , regular activity has a large series of possible ways of interacting with the course of pain symptoms . the exercise - induced endogenous analgesia is presumed to be due to the release of endogenous opioids and growth factors and activation of ( supra)spinal nociceptive inhibitory mechanisms orchestrated by the brain . the symptoms , in fact , may be reduced by pa to an extent that the women may not present them ; thus , in these women the endometriosis remains largely undiagnosed . along this line , a previous review on endometriosis and pa reported an article on beneficial effects of pa and interaction between painkillers and pa in women with endometriosis : the authors concluded that taking painkillers might be less effective among endometriosis patients performing regular daily sport activities . this diagnostic bias is of course a potential major limitation of epidemiological studies on the association between pa and endometriosis risk . however , up to date , information about the effectiveness of physical exercise to reduce endometriosis - related pain is scanty , and further research is needed . moreover , since elective endometriosis drug treatment , that is hormones , can lead to depression , investigating whether pa can control these symptoms may be an interesting line of research . even if pa may prevent the current symptoms ( mainly pain ) of endometriosis , we are unable to conclude that it prevents the development and progression of the disease . in order to take into account this point , we have analyzed the role of pa during adolescence , thus , probably , before the onset of the disease . unfortunately , studies on the association between pa during adolescence and endometriosis are inconsistent , and our meta - analysis can not reach conclusive findings . further , we have considered separately the role of pa on the risk of endometriosis in women with pain or infertility . also in this case , the analysis was not conclusive , since studies which have analyzed the role of pa in women with pain and endometriosis are few . we can assume that cases with no infertility , who underwent a laparoscopic evaluation , had experienced pelvic pain , a condition potentially preventing them from regular exercise . to test this hypothesis , vitonis et al performed an analysis on the level of activity 4 years before diagnosis : they observed a moderately protective association between pa and endometriosis , similar to that seen in the main analysis ( activity levels 2 years before diagnosis ) . aiming to account for this potential confounder , findings by cramer et al were adjusted for menstrual pain . on the contrary , dhillon and holt did not consider menstrual pain for inclusion as a confounder , because it could be either in the causal pathway between pa and endometrioma , or a marker of disease . information on pelvic pain was collected by some authors , but not used to adjust or estimates . kvaskoff et al , garavaglia et al , and vitonis et al did not report pain ( chronic or menstrual ) . another potential limitation is that information on pa duration and intensity was not homogeneously collected . cramer et al reported the age at which regular exercise began , so that duration depended on woman 's age at enrolment , and if she continued to exercise regularly ( at least 12 h / wk ) over years . if protection was due to pa duration or initiation at younger age dhillon and holt included women in the category of current pa = yes if they were exercising during the 2 years before the reference date , or according to pa between 12 and 21 years of age , for past pa : in this study , exercise was defined regular if performed at least 24 times per year . information on level of pa at different ages was given in garavaglia et al , but no minimum duration was required to define pa as a regular activity . other authors just recorded information on current pa and did not provide details about duration or type . conversely , kvaskoff et al focused on past pa : walking to school or out - of - school activity , in terms of hours per week between 8 and 15 years . finally , vitonis et al ascertained regular exercise as that performed in the last 2 years ; moreover , they also analyzed cumulative pa , to estimate long - term pa effect . among other confounding factors , we have to consider socioeconomic status and body mass . the diagnosis of endometriosis has been shown to be more frequent among higher social class and more educated women , that are also more frequently involved in leisure activities . closer attention to health may favor the diagnosis of endometriosis , thus producing an incorrect estimation of the real association with pa . further , pa is associated with body weight , which in turn is inversely associated with endometriosis . a few studies included adjustment for these covariates , whereas others did not . thus , we can not totally exclude the possibility that confounding may play some role in the observed association . any misclassification should , however , tend to reduce the estimated association , though in a validity study it has been noted a strong correlation between heavy activities reported but weak or no associations for light or moderate activities . then , high - level pa should be consistently and reliably reported , though the categories of pa are not homogeneously classified through studies . lastly , a limitation of this meta - analysis was that we only searched 2 databases . with reference to other sources of bias , the funnel plots did not show any evidence of small study effect , providing further indication of the robustness of our results . two main methodological problems in the epidemiology of endometriosis are the selection of cases and the choice of controls . in this study , comparison between cases not selected for infertility did not show any effect of recent pa , whereas an inverse association between pa and risk of endometriosis was observed in studies comparing infertile cases and fertile or unselected controls . if cases are infertile , the use of fertile controls may have led to bias . for instance , in controls with a laparoscopic evaluation and no infertility , if the possible symptoms influenced the activity levels , then the protective effect may be due not to biological mechanisms but to impairment . on the other hand , the underlying causes of infertility in controls might influence the results . moreover , the only published cohort study showed opposite results as compared to case control ones . however , it must be considered that we have included crude results in the analysis of pa versus no pa , whereas in the original paper the adjusted rrs showed a modestly protective effect of pa on endometriosis risk . thus , it is of interest to understand the role of pa in the adolescents ( i.e. , probably before the onset of endometriosis ) or later in life . few studies have analyzed the association between pa early in life and subsequent endometriosis risk . the large previously reported french cohort study has suggested that walking 5 or more hours a week at age 8 to 15 years slightly increases the risk of endometriosis later in life . in that study , however , no association emerged with out - of - school pa . the nurses health study ii found an increased risk of endometriosis among women reporting strenuous pa at 12 to 13 years of age . however , also in this study , other types of activity and activity at any other adolescent age were unrelated to the risk . finally , no association emerged between any pa and risk of endometrioma at 12 to 21 years of age in a case control study including 77 cases of endometriosis , conducted in the united states ; in this study even high pa was not related with endometriosis risk . conversely , in an old study conducted by cramer et al , strenuous exercises started at age 15 years decreased endometriosis risk . a recent study showed a protective effect of pa at 15 to 19 years , but it did not suggest a dose effect relation between hours per week and risk reduction . in our estimate , pa in adolescent years was inversely related to endometriosis risk , though the ci includes 1 . whereas single studies showed inconsistent results , in our analysis pa level showed a modest dose effect relation , with no risk reduction for low moderate level of pa and 20% reduction ( although not significant ) for high - level pa . an inverse dose effect relation was retrieved in some studies ( in the comparison with fertile controls ) , but in the nurses health study ii , the rrs of endometriosis declined with increasing pa and then showed an irregular trend for the 2 highest levels : similar trends emerged in the comparison with fertile and infertile controls . it has been suggested that the risk factors ( as well as the pathogenesis ) of pelvic and deep endometriosis may differ . we could not analyze separately the effect of pa on the risk of endometriosis in different sites , given the small number of studies reporting this information . however , in the study by heilier et al , peritoneal endometriosis and deep endometriotic nodules were separately analyzed : the authors concluded that both forms of the disease share similar patterns of risk and protective factors . the general results of this analysis suggest that pa may reduce the risk of endometriosis , but does not conclusively support the hypothesis . although the pooled estimate of adjusted ors shows a significant protective effect of recent pa on endometriosis risk , the overall estimate was not statistically significant when including all retrieved articles . studies on the association between pa during adolescence and endometriosis are inconsistent , and our meta - analysis can not reach conclusive findings . a relationship between pa and endometriosis risk is biologically plausible for both the inflammatory and estrogen - dependent nature of the disease . inflammation is a typical feature of endometriosis , as the presence of ectopic tissue in the peritoneal cavity is associated with overproduction of prostaglandins , cytokines , and chemokines . endometriosis is associated with statistically significantly increased levels of peritoneal interleukin ( il)-6 and il-8 . disease - related excessive production of proinflammatory cytokines might predispose to endothelial dysfunction , accelerated atherosclerosis , and metabolic disorders such as insulin resistance . conversely , myokines secreted by skeletal muscle include various cytokines such as leukemia inhibitory factor , il-7 , irisin , able to induce an antiinflammatory response . it has been shown that fewer inflammatory markers are detectable after long - term behavioral changes involving both reduced energy intake and increased physical exercise . moreover , pa reduces insulin resistance , thus avoiding stimulation possibly linked to hyperglycemia and hyperinsulinemia . hyperinsulinemia may increase levels of estrogens through decreasing concentrations of shbg , and may increase levels of igf-1 through decreasing levels of igfbp-1 . both estrogens and igf-1 stimulates endometrial cell proliferation . finally , regular physical exercise is associated with a cumulative effect of reduction of menstrual flow and of estrogen action . in 2014 , a review on endometriosis and pa addressed the issue of the effects of pa on women with endometriosis , in terms of prevalence and possible therapeutic effects . the authors of this review noted that the few existing studies are observational , with little or no statistical significance , but the indication of an inverse relationship between the practice of physical exercise and the risk of endometriosis may be due to the discomfort experienced by women , that prevent the practice of physical exercise . as a narrative review , among 6 reviewed papers , it included 2 that did not meet our criteria . one of them found that strenuous exercise during menstruation but not in other periods was associated with a 2-fold risk of endometriosis ; the other paper focused on effects of pa on endometriosis related pain and interaction between painkillers and pa , concluding that taking painkillers might be less effective among endometriosis patients performing regular daily sport activities , and , thus , it might impose them to an unnecessary burden of possible side - effects . the data considered in that review are inconclusive regarding the benefits of physical exercise as a risk factor for the disease . the authors also noted that no data existed about the potential impact of exercise on the course of the endometriosis . only recently though it focused on sleep quality and pain threshold , nunes et al considered that performing pa regularly can contribute toward relieving sleep disorders and consequently may improve the quality of sleep ; therefore , patients with endometriosis should be encouraged to exercise during treatment . even if it considers pa in women with endometriosis , this study just addresses a general effect on women 's well being , rather than the role of regular exercise in relieving pelvic pain and affecting the disease course . . the protective effect of high - level pa on risk of endometriosis may be at least partially explained by the fact that women affected by pain related to endometriosis may reduce their level of activity . otherwise , it has been showed that pa lowers pain symptoms . several mechanisms primed with aerobic exercise can lead to an important pain decrease . through numerous neuroendocrine modifications and a modulating action on the central and peripheral nervous systems , regular activity has a large series of possible ways of interacting with the course of pain symptoms . the exercise - induced endogenous analgesia is presumed to be due to the release of endogenous opioids and growth factors and activation of ( supra)spinal nociceptive inhibitory mechanisms orchestrated by the brain . further , pa may keep the pain symptoms of endometriosis at bay . the symptoms , in fact , may be reduced by pa to an extent that the women may not present them ; thus , in these women the endometriosis remains largely undiagnosed . along this line , a previous review on endometriosis and pa reported an article on beneficial effects of pa and interaction between painkillers and pa in women with endometriosis : the authors concluded that taking painkillers might be less effective among endometriosis patients performing regular daily sport activities . this diagnostic bias is of course a potential major limitation of epidemiological studies on the association between pa and endometriosis risk . however , up to date , information about the effectiveness of physical exercise to reduce endometriosis - related pain is scanty , and further research is needed . moreover , since elective endometriosis drug treatment , that is hormones , can lead to depression , investigating whether pa can control these symptoms may be an interesting line of research . even if pa may prevent the current symptoms ( mainly pain ) of endometriosis , we are unable to conclude that it prevents the development and progression of the disease . in order to take into account this point , we have analyzed the role of pa during adolescence , thus , probably , before the onset of the disease . unfortunately , studies on the association between pa during adolescence and endometriosis are inconsistent , and our meta - analysis can not reach conclusive findings . further , we have considered separately the role of pa on the risk of endometriosis in women with pain or infertility . also in this case , the analysis was not conclusive , since studies which have analyzed the role of pa in women with pain and endometriosis are few . we can assume that cases with no infertility , who underwent a laparoscopic evaluation , had experienced pelvic pain , a condition potentially preventing them from regular exercise . to test this hypothesis , vitonis et al performed an analysis on the level of activity 4 years before diagnosis : they observed a moderately protective association between pa and endometriosis , similar to that seen in the main analysis ( activity levels 2 years before diagnosis ) . aiming to account for this potential confounder , findings by cramer et al were adjusted for menstrual pain . on the contrary , dhillon and holt did not consider menstrual pain for inclusion as a confounder , because it could be either in the causal pathway between pa and endometrioma , or a marker of disease . information on pelvic pain was collected by some authors , but not used to adjust or estimates . kvaskoff et al , garavaglia et al , and vitonis et al did not report pain ( chronic or menstrual ) . another potential limitation is that information on pa duration and intensity was not homogeneously collected . cramer et al reported the age at which regular exercise began , so that duration depended on woman 's age at enrolment , and if she continued to exercise regularly ( at least 12 h / wk ) over years . if protection was due to pa duration or initiation at younger age dhillon and holt included women in the category of current pa = yes if they were exercising during the 2 years before the reference date , or according to pa between 12 and 21 years of age , for past pa : in this study , exercise was defined regular if performed at least 24 times per year . information on level of pa at different ages was given in garavaglia et al , but no minimum duration was required to define pa as a regular activity . other authors just recorded information on current pa and did not provide details about duration or type . conversely , kvaskoff et al focused on past pa : walking to school or out - of - school activity , in terms of hours per week between 8 and 15 years . finally , vitonis et al ascertained regular exercise as that performed in the last 2 years ; moreover , they also analyzed cumulative pa , to estimate long - term pa effect . among other confounding factors the diagnosis of endometriosis has been shown to be more frequent among higher social class and more educated women , that are also more frequently involved in leisure activities . closer attention to health may favor the diagnosis of endometriosis , thus producing an incorrect estimation of the real association with pa . further , pa is associated with body weight , which in turn is inversely associated with endometriosis . a few studies included adjustment for these covariates , whereas others did not . thus , we can not totally exclude the possibility that confounding may play some role in the observed association . any misclassification should , however , tend to reduce the estimated association , though in a validity study it has been noted a strong correlation between heavy activities reported but weak or no associations for light or moderate activities . then , high - level pa should be consistently and reliably reported , though the categories of pa are not homogeneously classified through studies . lastly , a limitation of this meta - analysis was that we only searched 2 databases . with reference to other sources of bias , the funnel plots did not show any evidence of small study effect , providing further indication of the robustness of our results . two main methodological problems in the epidemiology of endometriosis are the selection of cases and the choice of controls . in this study , comparison between cases not selected for infertility did not show any effect of recent pa , whereas an inverse association between pa and risk of endometriosis was observed in studies comparing infertile cases and fertile or unselected controls . if cases are infertile , the use of fertile controls may have led to bias . for instance , in controls with a laparoscopic evaluation and no infertility , if the possible symptoms influenced the activity levels , then the protective effect may be due not to biological mechanisms but to impairment . on the other hand , the underlying causes of infertility in controls might influence the results . however , it must be considered that we have included crude results in the analysis of pa versus no pa , whereas in the original paper the adjusted rrs showed a modestly protective effect of pa on endometriosis risk . thus , it is of interest to understand the role of pa in the adolescents ( i.e. , probably before the onset of endometriosis ) or later in life . few studies have analyzed the association between pa early in life and subsequent endometriosis risk . the large previously reported french cohort study has suggested that walking 5 or more hours a week at age 8 to 15 years slightly increases the risk of endometriosis later in life . in that study , however , no association emerged with out - of - school pa . the nurses health study ii found an increased risk of endometriosis among women reporting strenuous pa at 12 to 13 years of age . however , also in this study , other types of activity and activity at any other adolescent age were unrelated to the risk . finally , no association emerged between any pa and risk of endometrioma at 12 to 21 years of age in a case control study including 77 cases of endometriosis , conducted in the united states ; in this study even high pa was not related with endometriosis risk . conversely , in an old study conducted by cramer et al , strenuous exercises started at age 15 years decreased endometriosis risk . a recent study showed a protective effect of pa at 15 to 19 years , but it did not suggest a dose effect relation between hours per week and risk reduction . in our estimate , pa in adolescent years was inversely related to endometriosis risk , though the ci includes 1 . whereas single studies showed inconsistent results , in our analysis pa level showed a modest dose effect relation , with no risk reduction for low moderate level of pa and 20% reduction ( although not significant ) for high - level pa . an inverse dose effect relation was retrieved in some studies ( in the comparison with fertile controls ) , but in the nurses health study ii , the rrs of endometriosis declined with increasing pa and then showed an irregular trend for the 2 highest levels : similar trends emerged in the comparison with fertile and infertile controls . it has been suggested that the risk factors ( as well as the pathogenesis ) of pelvic and deep endometriosis may differ . we could not analyze separately the effect of pa on the risk of endometriosis in different sites , given the small number of studies reporting this information . however , in the study by heilier et al , peritoneal endometriosis and deep endometriotic nodules were separately analyzed : the authors concluded that both forms of the disease share similar patterns of risk and protective factors . supporting healthy behavior is the main goal of health promotion , and healthy behavior is a result of a multidimensional approach that is influenced by several factors . healthy behavior is not only pa , but also a construct of mental , educational , and environmental situations that enables us to live a healthy life . in the situation of endometriosis and pain , or perception of pain , social factors and environment play an important role ; thus , the social and psychological support might be of further relevance . sedentary behavior and physical inactivity are risk factors for cancer , diabetes , and ischemic coronary heart disease . on the contrary , pa has been described as the real polypill : regular exercise reduces the risk of cardiovascular events and all - cause mortality , cardiovascular disease , type ii diabetes , stroke , metabolic syndrome . regular exercise has been compared to drug intervention ( hypoglycemic , lipid - lowering , antihypertensive , antithrombotic drugs ) , concluding that the overall risk reduction due to pa goes beyond reducing traditional cardiovascular risk factors . moreover , exercise , and especially the contracting muscle , is a source of several drug - like molecules with beneficial effects across all ages . in general , regular pa has preventive / therapeutic effects against most prevalent chronic diseases , and a dose - dependent effect is usually observed in the general population . as regards endometriosis , though the present meta - analysis suggests that pa may reduce the risk , it does not conclusively support the hypothesis . exercise probably has pleiotropic positive effects in almost every organ system potentially having myokine - mediated direct and indirect antiinflammatory effects in chronic inflammatory diseases . however , the results of this analysis seem also to depend on the study design and the choice of controls . whether these findings are really explained by the benefit of exercise at molecular and endocrine level or related to confounding mechanisms , including the fact that pa may improve pain , needs to be further investigated . in consideration of the fact that if we wish to analyze the role of pa in the development of the endometriosis , the exposure ( i.e. , moderate or intense pa ) should act in the early phases of the disease , interventional studies on endometriosis prevention are substantially not feasible . control studies on risk factors for endometriosis should focus on collecting a detailed history of pa at all ages , and investigating potential changes of lifestyle habits due to pelvic pain . on the contrary , randomized studies identifying whether regular exercise prevents the progression of the endometriosis are feasible . multicountry studies are further requested , in consideration of the fact that occupational or leisure pa is strongly related with other determinants of endometriosis , such as economic status , reproductive pattern , and menstrual pattern .

abstractbackground : the potential association between endometriosis and physical activity ( pa ) has been suggested in several epidemiological studies.we aimed to establish whether pa influences endometriosis risk.methods:medline and embase were searched using physical activity or exercise combined with endometriosis , in medical subject headings and free text . we selected original articles in english , published up to april 2016 , evaluating the association between endometriosis and recent or past pa ( case control or cohort studies ) . references of retrieved papers were reviewed . we computed summary odds ratios ( ors ) of endometriosis for recent and past pa.results:six case control and 3 cohort studies included 3355 cases for recent pa and 4600 cases for past pa . the summary or for endometriosis according to pa level , calculated by the random - effect model , was 0.85 [ 95% confidence interval ( ci ) 0.671.07 ] for any recent versus no pa . as compared to no recent pa , ors for low and moderate / high pa were 1.00 ( 95% ci : 0.681.28 ) and 0.75 ( 95% ci : 0.531.07 ) , respectively.conclusions:though it suggests that pa may reduce the risk of endometriosis , this meta - analysis does not conclusively support the hypothesis . whether our findings are really explained by the benefit of exercise at molecular and endocrine level , or related to confounding mechanisms , such as study design , choice of controls , and pa potentially improving pain , needs to be further investigated .

Introduction Methods Study eligibility Data sources Study selection Data abstraction Risk of bias assessment Data synthesis Subgroup analyses Results Discussion Main findings Strengths and limitations Conclusions

two major inclusions , that of consumer protection act and that of service tax definitions , have converted the physicians from nobel professionals to mere service providers . with such an outlook from law and society , entire medical fraternity is facing very tough time because of growing number of cases . this trend is disturbing doctors who want to practice honestly and ethically . since awareness of consumer rights has increased , and implementation of the consumer protection act became streamlined with several recent amendments , the litigations against doctors are increasing . there is probably increase and unregulated supply of some specialists in the medical field leading to growing competition and change in style of practice . over supply violence against doctors has seen new dimensions , and this encourages others to follow . laws against damage to property and personnel in health establishment are slow to come and get implemented . the electronic and print medial could really be utilized towards higher and precise message deliveries in health care very effectively . unethical and greedy attitude of some of our own colleagues has helped in deterioration of image of the medical profession in the society . merit no longer remains the only criteria for getting admission in medical courses , and the far - reaching social impacts of such capitation fee churned medical graduates from india and overseas will soon be witnessed . the scene in some consulting rooms , where criticism of another doctor in front of the patient is perceived as heroic achievement . at the same time , all of us are drifting towards poor communication skills and pathetic record keeping . the apex court has directed all registered medical practitioners to provide treatment to anyone who is brought in emergency medical condition . the lack of capacity to pay is never to be considered while stabilizing these emergency patients . some changes are on the horizon , and prominent amongst them is about the additional qualifications . it is known that prescription rights for ( allopathic ) medicines are available only to the person registered with a medial council or a dental council . further to this extending certain specialized treatments or surgical care is also restricted to specialists in possession of such approved qualifications . medical council of india might take some more time to come out with a list of treatments and procedure that can be carried out by a particular super - specialist , but the list of privileges by national accreditation board for hospitals for several specialty departments of accredited hospitals is a welcome first step in this direction . a recent supreme court judgement in the case of one miss . prabha manchanda ( http://www.indiankanoon.org/doc/438423/ ) has provided some guidelines to of medical professionals . here , samaira kohli , an unmarried woman of 44 years of age , visited the clinic of dr . manchanda carried out an examination and advised an ultrasound test be undertaken the same day . after examining the ultrasound , patient was asked to return the next day to undergo a laparoscopy under general anaesthesia , in order that a firm diagnosis can be arrived at . next day on may 10 , 1995 when patient arrived for the laparoscopy she was made to sign various forms giving doctor and the clinic the right to carry out the procedure . the admission card recorded that the patient had been admitted for diagnostic and operative laparoscopy . it was specified in the consent that a laparotomy may be needed. patient was put under general anaesthesia and subjected to a laparoscopic examination . during the patient was unconscious , one of the assistants met with the mother of the patient , who had accompanied her to the clinic . later the patient sought damages for the loss of her reproductive organs , for irreversible , permanent damage , for pain , suffering emotional stress and trauma . as per the judgement , where a patient 's consent is taken for a diagnostic procedure or surgery , such consent can not be categorized as permission to perform therapeutic surgery , whether conservative or radical , except in life - threatening situations . furthermore , where a patient 's consent is taken for a particular procedure , that consent can not be used for an additional procedure . in this case , the uterus removed on the ground that , it would be beneficial to her and was likely to avert future problems . as there was no imminent danger to the life or health of the patient consultant should have explained the benefits and risks of the procedure to the woman , the available alternatives to the recommended course of action , if any , and then taken informed consent . it is patient 's responsibility to ask about all details on the ailment and all possible modes of management . later read and understand each and every word of the consent document , because once patient signs it the patient acknowledges that he understood everything written therein . the patient does have the right to accept , reject , think or discuss further , if patient so desires . ideal contents of the written consent as pointed out by the aforesaid judgement and from other indicators must be arrived at after full and fair explanation of the management or procedure . all potential risks and discomforts must have been narrated to the patient , but not in exaggerated manners of either direction . it is wise to enter the estimated payment requirements in the consent document , which than becomes a binding commitment for the patient . privacy commitments may also be spelled along with their general and specific limits . such releasing information can specially mention usage of clinical and surgery photographs for academic purposes . withdrawal from pre - decided line of management and consequences thereof may be specified in consent document . international standards for a safe practice of anaesthesia have been referred to by indian courts when the question of equipment and personnel furnishing ever arises . it will be in the interest of all surgical specialists who own such setups , to make sure that these requirements and recommendations are followed properly . readers are reminded that current professional indemnity insurance instrument available from any of the four general insurance company only applies to claims arising out of bodily injury and or death . the claims caused by or alleged to have been caused by errors , omission or negligence in rendered professional service by insured or named and qualified assistants are currently refused by these indemnity instruments . another professional negligence - errors and omissions insurance policy is available for health care establishments and is usually sold as clubbed with policy for medical establishments of late now there are many private instruments available for covering professional indemnity . current professional indemnity instrument is directly copied from european instrument without any thought applied to it considering need of indian medical professionals and their clinical work load as well as litigation load . rates of premium decided by european precedence without ever looking at any primary indian data . even after several years of existence of this instrument for the readers of this very specialty , it is worth noting that in the indemnity instrument a major exclusion is for the claims arising from the performance of cosmetic plastic surgery , hair transplants , punch grafts , flap rotations , and the like . none the less all must have more than one indemnity insurances available . in such indemnity insurance , the ration of limit for one event and that of the annual limit must be kept to one only . it is also worth paying additional few hundred rupees for extra rider for unqualified employees . in addition indemnity instruments can be subscribing to any professional protection scheme run by a state indian medical association as well as national professional protection scheme managed by head quarter of indian medical association through kerala state branch . it is granted to foreigners who have sought preliminary medical advice from their country of residence and have been advised to go for specialized medical treatment . the indian missions abroad scrutinize the medical documents to satisfy themselves about the bona fide purpose for which medical treatment visa is being requested . the initial validity of medical visa is 1 year or the period of treatment , whichever is less . it can be extended for a further period of 1 year by the state governments or foreigners regional registration offices ( frros ) or foreigners registration offices ( fros ) on production of a medical certificate from reputable / recognised / specialised hospitals in india . further extensions can be granted by the ministry of home affairs on the recommendations of the state governments / frros / fros supported by appropriate medical documents . foreigners coming to india on the medical visa are required to get themselves registered with the concerned frros within 14 days from the date of their arrival in india . however , registration formalities for bangladeshi and pakistani nationals will be as per the provisions contained in para 106 of the visa manual in respect of bangladeshi national and para 118 of the visa manual in respect of pakistani nationals . a medical visa is given to those seeking medical treatment only in reputed / recognised specialised hospitals / treatment centres in india . up to two attendants who are blood relatives are allowed to accompany the applicant under separate medical attendant visas , and the medical attendant visa will have the same validity as the medical visa . although not exhaustive , the following list of ailments would be of primary consideration : serious ailments such as neuro - surgery ; ophthalmic disorders ; heart - related problems ; renal disorders ; organ transplantation ; congenital disorders ; gene - therapy ; radio - therapy ; plastic surgery ; joint replacement , etc . the initial duration of the visa is up to a year or the period of the treatment , whichever is less . the visa will be valid for a maximum of three entries during the 1 year . a foreign couple seeking surrogacy in india may apply for a medical visa and medical attendant visa . the egg donor may apply for a medical visa and the companion attending on the egg donor may apply for medical attendant visa . any visa type other than medical visa for surrogacy purposes is punishable under indian law . the foreign couple can be permitted to visit india on a reconnaissance trip on tourist visa , during which the notarised agreement between the couple and the prospective surrogate mother can be drafted , but no samples are to be given for surrogacy purposes to any clinic during such a preliminary visit . foreigners coming on medical visa will be required to get themselves registered mandatorily well within the period of 14 days of arrival with the concerned frros / fros .

the social impact of entire cadre of medical graduates admitted through donation and management seats is yet to arrive . what has arrived are the burdens of complying with various acts and facing legal challengesduring medical practice . this article deals with some recent legal requirements for catering to plastic and cosmetic surgery patients .

MEDICAL PRACTICE IN TODAY'S SCENARIO PATIENT'S RESPONSIBILITY CONSENT PROFESSIONAL INDEMNITY INSURANCE MEDICAL VISA (CHAPTER 3A CLAUSE 42A VISA MANUAL INDIA 2003)

according to american heart association , annually more than 448,000 patients underwent cardiothoracic surgery including coronary artery bypass grafting ( cabg ) , valve replacement or repair , or repair of structural defects . inserting chest tubes ( ct ) after cabg was aimed to maintain heart and lung functioning and essential to prevent from pleural effusion , pneumothorax and hemothorax . keeping cts in place , however , is associated with increased pain and discomfort for the patient , mechanical irritation of the heart and pericardium , and an increased incidence of infection . the chest tubes are typically removed within 24 - 48 hours after surgery or when the excess air , blood , or fluid has been properly drained . chest tubes removal ( ctr ) after surgery has been described as one of the worst experiences among these patients . studies showed that moderate to severe pain has been reported by patients who experienced ctr and unfortunately their pain was managed very poorly . unrelieved pain in addition to causing suffering , may be associated with the absence of sound breath , distress , decreased chest expansion , hyper - resonance on the injured side , impaired respiratory performance producing hypoxemia , increased sympathetic response provoking myocardial ischemia , and activation of a generalized stress response that can trigger tachycardia , increased cardiac output , and vasoconstriction . although analgesic drugs are the most effective tool available to nurses but there are many other ways to relieve pain . analgesics have some side effects and there are individual differences in their effects , so non - pharmacological methods may attract some attention . it has been utilized for years . regarding the activity of inflammatory enzymes rises with increasing temperatures . ice is believed to help control pain by inducing local anesthesia around the treatment area . investigators have also shown that it decreases edema , cellular metabolism , and local blood flow . the main beneficial effect of cold during recovery is the cold - related vasoconstriction that may limit vessel permeability and thus inflammatory processes , reducing muscle pain . based upon this framework , also , based on laboratory and clinical studies , cold decreases the nerve conduction velocity and increases the pain threshold . several studies have shown a decrease in peripheral blood flow caused by different methods of application of cold . the reasons put forward to explain this decrease in blood flow are vasoconstriction caused by the sympathetic nervous system reflex and the affinity caused by the cold of the postjunctional alpha-2 receptors of the vessel walls . the result of the two factors referred to above is a reduction in the activity of the noradrenaline enzymatic metabolites , an increase in blood viscosity , the activation of the platelet aggregates that release 5ht and thromboxane a2 . relaxation is another non - pharmacological technique in pain management keeping in mind that anxiety can cause pain and pain also can cause anxiety . relaxation is defined as the absence of physical , mental , emotional tension , and can assist in the management of pain both physiologically and psychologically . physiologically , relaxation leads to a reduction in or reversal of the sympathetic response to pain leading to a decrease in oxygen consumption , blood pressure , heart rate , and respiration . psychologically , distraction is a built - in component of relaxation and impacts pain management by decreasing the cognitive awareness of pain . considering the importance of pain management as the highest nursing priority , there is no consensus about controlling pain following ctr . while the usual way to pain management is prescription of analgesics but research there have been few studies about the effectiveness of cold application and relaxation , which achieved contradictory results . in addition , there is no research about comparing these methods on pain owing to ctr . therefore , this study aimed to examine the effectiveness of relaxation and cold therapy on the patient 's pain severity after ctr . based on aim of study the following research questions considered : is relaxation would be effective in pain reducation after ctr preoperative bypass surgery ? is cold therapy would be effective in pain reducation after ctr preoperative bypass surgery ? approval for the study obtained from the relevant ethics committee at the university of mazandaran , sari , iran . before the beginning of the study , this randomized , observer - blind , prospective experimental study was conducted during february - march 2013 in the mazandaran heart center . the sample size was determined based on a similar study with a 0.99% confidence coefficient . based on mean and standard deviation of pain intensity immediately after ctr in experimental and control groups , respectively , 3.85 1.75 , and 5.6 1.94 , the sample size was calculated 30 in each group ( intervention and control ) that according to effect size of 1.33 the samples increased to 40 in each group . data collection tools included a demographic questionnaire and visual analogue scale ( vas ) to evaluate pain . vas comprised a 100-mm baseline that is indicative a continuum with the ends marked 0 = no pain and 100 = unbearable pain . various researches have used this scale to rate pain severity in patients underwent cabg surgery . inclusion criteria included : willingness to participate , upper 18-years old , full consciousness , ability to understand visual analog pain scale , first - time experience with cabg and chest tube , bmi less than 30 kg / m and having two chest tubes for 24 hours at least ( one mediastinal tube and one left pleural ) . exclusion criteria included unwillingness to participate , oversensitivity to cold , received mechanical ventilation support , visual or auditory defects , received opioid analgesic during less than 4 hours before intervention and drug dependency . on the first day after operation , the researcher offered some explanation about the procedure to patients eligible to participate in study . patients randomly were assigned to groups by rand between function in excel software ( this function used to generate random numbers ) . as the participants in the study had two chest tubes , the act of assignment in intervention groups was done twice ( one assignment for each tube ) . the case group was divided to seven bulks comprising 6 cases and within each bulk 6 cards were divided to 1 - 2 then randomly selected ( three indicated by cod for left pleural cold therapy- mediastinal relaxation and three cod number considered for left pleural relaxation- mediastinal cold therapy ) . so each chest tube of patient assigned in one group and finally patients were divided randomly in the groups of cold therapy , relaxation , or control . after the first assignment , the subjects were taught to rate the pain intensity by using vas and got enough information about ctr procedure . in addition , we presented some information about cold application and relaxation for experimental groups that was repeated just before the ctr process . subjects all tight clothes were loosened , they were placed in semi - fowler position and a pillow was set below their head and knees in order to ensure their comfort . the usual intervention , as used for the control group , was nothing more than acetaminophen pills each 6 hours . all subjects received the intervention . in cold therapy group , cooling gel packs with 0c temperature ( made in iranian bespar javidan ghostar company ) was used to reduce the body temperature around the chest tube during undressing . the bandage was removed from chest area and body temperature measured and recorded by an infrared thermometer at the same time by non - contact infrared thermometers uni - t 912 ( hong kong ) then three cooling packs ( 8 10 cm ) twisted in gauze was placed around the tube so that it would locate in the center . the packs would remain in their position , after 10 minutes till the temperature reached 13c . at this moment , all packs were removed and the tube was exit according to the usual method . the temperature was recorded immediately and 15 minutes after extubation . according to therefore , 1 hour after cooling therapy and extubation - related tube , the next tube extubated while patients exposed to relaxation technique . in the relaxation group , patients were encouraged to breathe calmly and deeply . in this exercise , they should inhale calm and deep through their nose and exhale calm through semi - closed lips , all with closed eyes for 15 minutes . the tubes of the first patient were removed randomly with 1-hour intervals . then the procedure was repeated for all patients in the control group as routine . the chest tubes in all groups were removed by the same nurse and procedure lasted on 1 - 2 minutes . the pain intensity was recorded by a nurse who trained to record vas and was blind to the conducted different ctr procedure . the pain severity was recorded in three phases ( before , immediately , and 15 minutes after ctr ) . the analysis included all randomized participants for whom data were available ( n = 90 ) . to assess comparability of the study groups at baseline on sociodemographic and pain levels , we used t - test ( for continued and ordinal variables ) and chi - square ( for categorical variables ) . to compare the two study groups on the outcome and process measures overtime we fit multiple marginal linear regression analysis . since the self - reported pain was measured repeatedly overtime ( before intervention , immediately after removing and after 15 minutes ) , the generalized estimating equations method for longitudinal data was applied to adjust the standard errors of the regression coefficient estimates . generalized estimating equations ( gee ) employed to adjust for possible correlation over the assessment time points by controlling for baseline values of the dependent variable examined . the analysis included all randomized participants for whom data were available ( n = 90 ) . to assess comparability of the study groups at baseline on sociodemographic and pain levels , we used t - test ( for continued and ordinal variables ) and chi - square ( for categorical variables ) . to compare the two study groups on the outcome and process measures overtime we fit multiple marginal linear regression analysis . since the self - reported pain was measured repeatedly overtime ( before intervention , immediately after removing and after 15 minutes ) , the generalized estimating equations method for longitudinal data was applied to adjust the standard errors of the regression coefficient estimates . generalized estimating equations ( gee ) employed to adjust for possible correlation over the assessment time points by controlling for baseline values of the dependent variable examined . the subjects mean old age was 58.11 9.53 ( control group 58.48 9.78 and experimental group was 57.75 9.38 ) . results showed that the age variable had no considerable differences in subgroups ( p = 0.8 ) . the body mass index ( bmi ) kg / cm for the experimental group and it was 25.51 3.16 kg / cm in the control group , it was not significantly different in the groups ( p = 0.155 ) . tubes remaining time duration for the control group were 41.97 2.35 and for the experimental group was 42.17 2.35 . the groups had no significant differences with regard to holding duration ( p = 0 . table 1 displays other demographic data for each group . as it is presented , the groups had no differences related to these variables . comparing some demographic characteristics in experimental and control groups to investigate tube type ( left pleural , mediastinal ) effect on pain rating and to compare pain severity in control , cold therapy , and relaxation groups at tree phases ( before , during , and after extubation ) , we used gee model . wald chi - square test showed no significant difference in pain severity in the phases . figure 1 depicted pain severity rating of all groups in the three phases . comparing means related to pain severity between the three groups in three phases wald chi - square test showed that there were no significant differences between pain severity before ctr in the three groups ( p = 0.84 , df = 2 , f = 0.058 ) . this test also showed that the groups had a considerable difference in phases two ( just after ctr , p = 0.001 , df = 2 , f = 468.35 ) and three ( 15 minutes after ctr , p = 0.01 , df = , f = 93.3 ) . the difference of three groups at three time of assessment in bonferroni post - hoc test paired comparison results showed that cold application and relaxation group had a significant difference comparing with a control group in phase two ( just after ctr , p = 0.001 ) . the cold application and relaxation groups were not significantly different ( p = 0.4 ) . there was also a considerable difference between control group and cold therapy group in phase three ( 15 min after ctr , p = 0.01 ) , but this difference was not significant between relaxation and control groups ( p = 0.11 ) or between cold application and relaxation groups ( p = 0.6 ) . pain levels in the groups at three time frames ( before , immediately and after ctr ) showed in figure 1 pain is in the same condition before ctr in all groups although immediately after ctr there is considerable difference between the control and experiment a group so pain in lower in patients who were subjected for relaxation and cold therapy . they reported same pain level in two experimental groups ( cold therapy and relaxation ) and 15 minutes after ctr these differences sustained between groups . according to the results acquired from repeated measures analysis of variance also , there was a significant difference for within groups measures in all three phases ( p = 0.001 ) . multiple comparisons of bonferroni tests showed that the maximum difference was observed between immediately after ctr and after 15 minutes ( p = 0.001 ) . the results are consistent with mazloum , ertug and demir findings . according to our findings , pain severity of cold application group at phase 3 ( the results similarity could be due to full covering of ice packs into the tubes nearby areas . sauls , on the other hand , reported the cold application as a not very efficient method to relieve pain at just after and 15 minutes later phases . the shape of ice packs , cold therapy duration ( 10 minutes ) , or sample size could account for these differences . cold gel packs used in our study were flexible so that they cover around tubes easily and lead to effective cooling around the tissue . research showed that physiological effects of cold therapy appear when it continues for 20 minutes or temperature tube surrounding skin decreases to 13c or less . our results showed that pain severity in phase two ( just immediatly after ctr ) was considerably lower in relaxation group than control group . study the relaxation method was not recognized as an effective way to reduce ctr - related pain . apparently these contradictory results could be explained with shorter breathing exercise before ctr , and smaller sample size in houston 's work . we found no significant difference between relaxation and control groups in phase 3 ( 15 min after extubation ) regarding pain severity . we did not find any significant difference between relaxation and cold application groups at phase 3 . we could not find any published studies about relaxation or cold application effects on ctr induced pain after coronary artery bypass graft surgery , but there were some studies using these techniques to decrease pain after other surgeries such as muscular pain syndrome with delayed onset , labor pain , and blood injection for thalassemia patients . our results indicate a relatively equal effect of cold therapy and relaxation on ctr - related pain after coronary artery bypass grafting . as the relaxation requires any expense , it could be a preferred technique for managing pain in ctr patients . this study was done on a relatively small sample , so the findings could not be generalized without caution . repeating these findings with a bigger sample size and for the other patients experiencing any king of chest tubes could be useful in order to a comprehensive conclusion . comparing the other nonpharmacological ways of controlling pain could also develop our knowledge and may propose some cheaper and more effective ways of pain management .

background : usually the chest tube removal ( ctr ) has been described as one of the worst experiences by patients in the intensive care unit.aim:this study aimed to compare the effects of cold therapy and relaxation on pain of ctr among the patients undergoes coronary artery bypass graft surgery.materials and methods : this single - blinded clinical trial was done on 80 post - cardiac surgery patients in the heart hospital of sari - iran . the patients were assigned to three randomized groups that included cold therapy , relaxation , and control groups . data analysis was done by t - test , chi - square , generalized estimating equations and repeated measures analysis variance tests.results:the groups had no significant differences in pain intensity before ctr ( p = 0.84 ) , but immediately after ctr there was a significant difference between the treatment ( cold application and relaxation groups ) and control groups ( p = 0.001 ) . there was no significant difference between relaxation and cold therapy groups.conclusion:regarding the relaxation and cold application methods showed relatively equal effects on reducing the pain owing to ctr . thus , the use of relaxation because of economics , without side effects , easy to use and effective is recommended by the authors to the practitioners .

Introduction Materials and Methods Statistical analysis Results Discussion

we carried out a passive picture - viewing experiment to test the hypothesis that nonpolitical but affectively evocative images elicit brain responses that predict political ideology as assessed by a standard political ideology measure . healthy volunteers ( n = 83 ) were instructed to look at presented pictures while lying in the scanner , and , to control for attentiveness , we instructed them to press a button when a fixation cross appeared on the screen ( figure 1 ) . images were sampled from the international affective pictures database and included disgusting , threatening , pleasant , and neutral images ( see appendix s1 available online ) . after the fmri session , participants completed a behavioral rating session in which they rated all pictures they had seen in the scanner ( using a nine - point likert scale ) as disgusting , threatening , or pleasant . lastly , participants filled out computer - based questionnaires assessing their political attitudes , disgust sensitivity , and state / trait anxiety level . political ideology was summed from several survey items ( appendix s2 ) , including ideological position , partisan affiliation , and policy preferences ( e.g. , gun control and immigration , presented in the well - known wilson - patterson format ) . survey items on political ideology were normalized continuously from 0 ( extremely liberal ) to 1 ( extremely conservative ) ( see the supplemental experimental procedures ) . political attitudes and interest did not show a significant linear relationship [ r(81 ) = 0.148 , p = 0.182 ] , but instead showed a u - shaped curve ( figure s1a ) , indicating that greater political interest is associated with polarized political attitudes . when tested on a subset of participants , our measure of political attitudes shows excellent test - retest reliability ( test - retest pearson correlation coefficient = 0.952 ; figure 2b ) . to focus our analyses on polarized political groups , we divided participants into three groups based on their political ideology scores ( table s1 ) : liberal ( n = 28 ) , moderate ( n = 27 ) , and conservative ( n = 28 ) . as seen in figure 2c , groups did not significantly differ in subjective ratings of disgusting , threatening , or pleasant pictures ( also see table s2 ) . also , there were no significant group differences on self - report measures except that the conservative group had marginally higher disgust sensitivity than the liberal group [ t(54 ) = 1.711 , p = 0.093 ; figure s1b and table s1 ] . having characterized liberal and conservative groups behaviorally and confirmed blood - oxygen - level dependent ( bold ) responses to affective pictures ( figure s2 and table s3 ) , we used a machine - learning approach to predict individual differences in political orientation from the patterns of whole - brain bold responses . specifically , we applied a penalized regression method called the elastic net to our fmri data ( figures 2d and s3 and the supplemental experimental procedures ) . the elastic net algorithm offers several advantages for fmri data , including automatic variable selection ( i.e. , regression coefficients of unimportant variables [ voxels ] shrink to zero ) and model regularization , which increases the interpretability of the findings . the elastic net also enjoys a grouping effect , which clusters highly correlated predictors into a set of groups . the grouping effect is useful for fmri data because they contain many correlated predictors ( voxels ) due to its inherent nature ( i.e. , a brain region may consist of many voxels ) and spatial smoothing , which is a commonly used preprocessing step . previous studies demonstrated that the elastic net performs better than least absolute shrinkage and selection operator ( lasso ) , especially when the number of predictors is much higher than the number of observations . the elastic net is beginning to be applied to fmri data [ 19 , 20 ] and appears to be a promising tool for developing predictive models from neuroimaging ( and other types of ) data . using the elastic net algorithm ( penalized logistic regression analysis ) and contrast maps ( [ disgusting > neutral ] , [ threatening > neutral ] , or [ pleasant > neutral ] ) , we probed brain regions critical for cross - validated classification accuracy ( liberal versus conservative groups ; see the supplemental experimental procedures ) . figure 3a shows a network of brain regions predicting conservative and liberal group membership revealed by the machine - learning method with the [ disgusting > neutral ] contrast . separate tests for the out - of - sample performance confirmed the robustness of the findings ( figure 3b and the supplemental experimental procedures ) . red - to - yellow and blue - to - green regions indicate voxels predicting conservative and liberal groups , respectively . as seen in figure 3a , conservative group membership was predicted by increases in the basal ganglia ( peak mni = [ 16 , 8 , 8 ] , k = 234)/thalamus ( peak mni = [ 20 , 18 , 6])/periaqueductal gray ( pag ; peak mni = [ 10 , 24 , 12]/hippocampus ( peak mni = [ 14 , 4 , 14])/amygdala ( peak mni = [ 18 , 4 , 14 ] ) , dorsolateral prefrontal cortex ( dlpfc ; peak mni = [ 44 , 4 , 52 ] , k = 26 ) , middle / superior temporal gyrus ( mtg / stg ; peak mni = [ 60 , 44 , 6 ] , k = 33 ) , presupplementary motor area ( pre - sma ; peak mni = [ 4 , 8 , 56 ] , k = 56 ) , fusiform gyrus ( ffg ; peak mni = [ 42 , 52 , 10 ] , k = 24 in the left side and [ 42 , 60 , 10 ] , k = 16 in the right side ) , and inferior frontal gyrus ( ifg ; peak mni = [ 52 , 28 , 4 ] , k = 15 ) . the increase in the secondary somatosensory cortex ( s2)/posterior insula ( peak mni = [ 40 , 26 , 19])/inferior parietal lobule ( ipl ; peak mni = [ 48 , 40 , 36 ] , k = 125 in the left side and [ 48 , 52 , 54 ] , k = 17 in the right side ) , frontal insula ( mni = [ 40 , 16 , 12 ] , k = 19 ) , and precentral gyrus ( peak mni = [ 38 , 12 , 50 ] , k = 25 in the left sid and [ 40 , 12 , 52 ] , k = 13 in the right side ) predicted liberal group membership . note that the group differences using the traditional general linear modeling ( glm ) revealed similar findings with some differences ( figure s2d , table s4 , and the supplemental experimental procedures ) . the mean area under the curve ( auc ) of the receiver - operating characteristic ( roc ) curve was 0.981 ( sd = 0.043 ) . see the supplemental experimental procedures and figure s4 for more details and additional results using penalized linear regression across all participants . when we examined the prediction accuracy of each disgust subcondition ( core / contamination and animal reminder ) , only animal - reminder disgust ( e.g. , mutilated body ) was a strong predictor of political attitudes ( figure 3c ; mean auc = 0.998 , sd = 0.003 for animal reminder ; mean auc = 0.548 , sd = 0.125 for core / contamination ) . recent work suggests that bold time - series data from a single stimulus can categorically differentiate healthy individuals from those diagnosed with autism spectrum disorder ( unpublished data ) . applied a machine - learning approach to time - series data from a specific region of interest and demonstrated that single - stimulus brain responses to a specific kind of stimulus could be used to make accurate categorical predictions of disorder status . we tested the hypothesis that a single - stimulus measurement combined with a machine - learning approach may contain enough information to predict liberal and conservative group membership per individual participant . following lu et al . , we extracted the entire bold time - series response to the first disgusting picture . time - series data every 2 s were spatially averaged within each of two types of patterns shown in figure 3a : ( + ) voxels ( red - to - yellow regions predicting conservative group ) and ( ) voxels ( blue - to - green regions predicting liberal group ) ( see the supplemental experimental procedures ) . as seen in figure 4a , the single - stimulus presentation of the disgusting pictures reliably differentiated the conservative and liberal groups in the ( + ) voxels . the hemodynamic response of the conservative group had a steeper slope and a higher peak than that of the liberal group . the mean auc of the roc curve using the single - stimulus presentation was 0.845 ( sd = 0.009 ; figure 4b ) . when we used each region of interest within the ( + ) voxels for the same analysis ( figure 4c ) , the thalamus ( mean auc = 0.816 , sd = 0.023 ) and the dlpfc ( mean auc = 0.807 , sd = 0.018 ) were the strongest predictive regions , followed by the basal ganglia ( mean auc = 0.789 , sd = 0.005 ) , ffg ( mean auc = 0.764 , sd = 0.047 ) , pre - sma ( mean auc = 0.733 , sd = 0.044 ) , amygdala / hippocampus ( mean auc = 0.721 , sd = 0.079 ) , pag ( mean auc = 0.662 , sd = 0.100 ) , and mtg / stg ( mean auc = 0.654 , sd = 0.105 ) . while increase in the ( ) voxels predicted liberal group membership with full data , none of the bold time - series data from the ( ) voxels survived using the single - stimulus analysis . our results have important implications for the links between biology , emotions , political ideology , and human nature more fundamentally . while previous studies using skin conductance response [ 911 ] , neuroimaging [ 2124 ] , and questionnaire [ 25 , 26 ] measures suggested the role of emotions in political attitudes , to our knowledge , this is the first fmri study revealing multivariate patterns of brain activity that differ between liberals and conservatives during emotional processing of sensory stimuli . accumulating evidence suggests that cognition and emotion are deeply intertwined , and a view of segregating cognition and emotion is becoming obsolete . people tend to think that their political views are purely cognitive ( i.e. , rational ) . however , our results further support the notion that emotional processes are tightly coupled to complex and high - dimensional human belief systems , and such emotional processes might play a much larger role than we currently believe , possibly outside our awareness of its influence . despite growing evidence from various fields , including genetics , cognitive neuroscience , and psychology , many political scientists remain skeptical of research connecting biological factors with political ideology , arguing variously that biology is irrelevant to central political questions , that the theoretical basis for expecting biology to be relevant is weak and murky , that acknowledging a role for biology is reductionist , and that recognizing the relevance of biology to human beliefs and behaviors is potentially dangerous . we hope some of this skepticism can be alleviated from our demonstration that fmri data , even from a single stimulus , can serve as a strong predictor of political ideology . several groups have suggested that people are born with certain dispositions and traits that influence the formation of their political beliefs [ 3 , 4 ] . also , several studies have shown that life history ( e.g. , ) and traumatic experiences can affect political views . our results are consistent with the idea that political beliefs are connected to neurobiological composition . but both genetics and life history play an important role in establishing both connections between neuroanatomical regions and the propensity for these regions to respond to environmental stimuli . we have not isolated the distinct roles played by genetics and life history in the development of the brain responses that we measured . a wide range of brain regions contributed to the prediction of political ideology ( figure 3a ) , including those known from past work to be involved in the processing and interoception of disgust and other stimuli with negative affective valence , but also those involved in more basic aspects of attentive sensory processing : we found regions known to be involved in disgust recognition [ 17 , 3638 ] ( e.g. , insula , basal ganglia , and amygdala ) , perception of bodily signals ( e.g. , insula ) , the experience of physical / social pain or observing others in pain ( e.g. , s2 , insula , pag , and thalamus ) , and emotion regulation ( e.g. , dlpfc , insula , amygdala , and pre - sma ) , along with regions involved in information integration ( e.g. , thalamus and amygdala ) , attention [ 43 , 44 ] ( e.g. , amygdala , ipl , ffg , stg / mtg ) , memory retrieval [ 44 , 45 ] ( e.g. , hippocampus , amygdala , and ipl ) , and also inhibitory control ( e.g. , ifg , dlpfc , and pre - sma ) , perhaps to suppress innate responses . although our results suggest that disgusting pictures evoke very different emotional processing in conservatives and liberals , it will take a range of targeted studies in the future to tease apart the separate contribution of each brain circuit . we proposed that conservatives , compared to liberals , have greater negativity bias , which includes both disgusting and threatening conditions in our study . our finding that only disgusting pictures , especially in the animal - reminder category , differentiate conservatives from liberals might be indicative of a primacy for disgust in the pantheon of human aversions , but it is also possible that this result is due to the fact that , compared to threat , disgust is much easier to evoke with visual images on a computer screen . first , while political ideology has effects on many forms of behavior ( including , but not limited to , voting behavior ) , it is unknown whether it does so thanks to the neural differences in affective processing that we measured . second , and relatedly , it is important also to know how individual differences in the capacity to regulate emotion , and the neural bases of that capacity , are related to political ideology . a third set of questions concerns the bearing of the present study on the development of biological measures of political ideology . while it is of use in a variety of settings to measure political ideology ( political polls , for instance , typically include some measurement of it ) , it remains an open question whether biological measures could become more accurate , or more useful , than the tools ( such as self - report measures ) currently employed . determining the answer to that question would require answering a host of others : how would a machine - learning model based on data collected in one region ( e.g. , new york ) support predictions of people s political attitudes in another region ( e.g. , texas ) ? how fine - grained are the categories of affective response that are tied to political ideology ? although our results show greater differentiation in political ideology in cases of animal - reminder disgust than core / contamination disgust , what are the links between political ideology and other forms of disgust , such as moral disgust ? the more we learn about the sensitivity of political ideology to subtle differences in affective response and their neural bases , the more we will know about the feasibility of useful and portable tools for ideology s biological measurement . this would then raise a further and difficult ethical question about the circumstances , if any , in which it is appropriate to use such tools . and , finally , the present study raises important questions about the possibility of , and obstacles to , understanding and cooperation across divides in political ideology . would the recognition that those with different political beliefs from our own also exhibit different disgust responses from our own help us or hinder us in our ability to embrace them as coequals in democratic governance ? eighty - three healthy individuals ( males / females = 41/42 ; age = 1862 ; mean [ sd ] = 29.0 [ 11.3 ] years ) in roanoke and blacksburg , va , area were recruited from a large database maintained by the human neuroimaging laboratory between september 2012 and september 2013 . see the supplemental experimental procedures for inclusion / exclusion criteria for participants and demographic data . they were told to simply look at emotional pictures when they were presented but to press a button when they saw a fixation cross . it is a passive picture - viewing task presenting a total of 20 disgusting , 20 threatening , 20 pleasant , and 20 neutral pictures , the order of which was randomized for each participant . see appendix s1 for iaps picture numbers , description , and valence / arousal ratings of all pictures . table s2 summarizes the mean iaps valence and arousal ratings in each emotion condition . each picture was presented for 4 s. ten button - press ( fixation - cross ) trials were pseudorandomly mixed with emotional pictures to help participants stay fully awake and pay attention to visual stimuli . each trial was separated by a poisson - distributed variable interval ( mean = 10 s , sd = 10 s , minimum = 6 s , maximum = 17 s ) . the anatomical and functional imaging sessions were conducted on a 3.0 tesla siemens magnetom trio scanner at vtcri . we used spm8 ( http://www.fil.ion.ucl.ac.uk/spm/software/spm8/ ) for preprocessing and standard glm fmri analyses . for the elastic net analysis , we used the glmnet package for matlab ( http://web.stanford.edu/hastie/glmnet_matlab/ ) and r . see the supplemental experimental procedures for complete details . w .- y.a . , x.g . , t.l . , a.h . , j.r.a . , k.b.s . , j.r.h . , and p.r.m . conceived and designed the experiments ; w .- y.a . performed the research ; w .- y.a . and t.l .

summarypolitical ideologies summarize dimensions of life that define how a person organizes their public and private behavior , including their attitudes associated with sex , family , education , and personal autonomy [ 1 , 2 ] . despite the abstract nature of such sensibilities , fundamental features of political ideology have been found to be deeply connected to basic biological mechanisms [ 37 ] that may serve to defend against environmental challenges like contamination and physical threat [ 812 ] . these results invite the provocative claim that neural responses to nonpolitical stimuli ( like contaminated food or physical threats ) should be highly predictive of abstract political opinions ( like attitudes toward gun control and abortion ) [ 13 ] . we applied a machine - learning method to fmri data to test the hypotheses that brain responses to emotionally evocative images predict individual scores on a standard political ideology assay . disgusting images , especially those related to animal - reminder disgust ( e.g. , mutilated body ) , generate neural responses that are highly predictive of political orientation even though these neural predictors do not agree with participants conscious rating of the stimuli . images from other affective categories do not support such predictions . remarkably , brain responses to a single disgusting stimulus were sufficient to make accurate predictions about an individual subject s political ideology . these results provide strong support for the idea that fundamental neural processing differences that emerge under the challenge of emotionally evocative stimuli may serve to structure political beliefs in ways formerly unappreciated .

Results Discussion Experimental Procedures Author Contributions