Datasets:

LA1512

/

pubmed-val-1K

like 0

cardiovascular disease , resulting from atherosclerosis , is a leading cause of global morbidity and mortality . despite the tremendous gains made in decreasing the number of deaths due to cardiovascular disease genetic predisposition and classical environmental risk factors ( family history , hypercholesterolemia , cigarette smoking , hypertension , diabetes , obesity and excessive drinking all figures into the equation ) explain much of the attributable risk for cardiovascular events in populations , but other risk factors for the development and progression of atherosclerosis , which can be identified and modified , may be important therapeutic targets . in fact , many individuals who develop heart disease have normal cholesterol and blood pressure levels . this suggests that other less well - studied risk factors may also play a role . furthermore , exact knowledge regarding the mechanisms by which the various established risk factors contribute to the development and progression of lesions is incomplete . these facts have led investigators to pursue other possible etiologies and factors that may be involved in the etiology and pathogenesis of atherosclerosis and its complications . recently , research has intensified to identify the role of various infections in the pathogenesis of atherosclerosis and the complications , such as ischemic heart disease and stroke . examination of an atherosclerotic plaque reveals pools of cholesterol under a fibrous cap and the infiltration of monocytes and t cells at its margins . this concentration of white blood cells within the plaque is consistent with an ongoing inflammatory process , influenced by factors not yet fully understood . specific agents have been proposed as direct initiators or accelerators of atherosclerosis , while other infectious agents have been proposed as accelerators of atherosclerosis through nonspecific stimulation of the inflammatory cascade . recently , the total pathogen burden concept has suggested that while each specific infection contributes only slightly to the pathogenesis of atherosclerosis , the cumulative effects of infectious agents contribute greatly . now researchers are theorizing that infection may be responsible for at least some cases of heart disease . what they are talking about is not an overt , active attack as with a cold or the flu but rather a chronic , low - grade infection that may linger for years barely noticeable . the idea surfaced in 1988 when a study published in the british medical journal the lancet observed that the bacterium chlamydia pneumonia ( now chlamydophila pneumonia ) was frequently present in artery - clogging deposits . other studies found that men with gum disease and similar infections had a higher rate of heart attacks . no conclusive cause / effect relationship was proven then , nor has one been found since . nevertheless , a large number of studies over the past decades have found a strong correlation that requires further study . the second route by which infection may result in progression or initiation of an atherosclerotic lesion involves the dissemination of organisms from local sites of infection directly to the arterial wall itself . the organisms may traffic to the site within an infected monocyte , attach and then diapedesis through the endothelial cell layer , taking advantage of secondary host defense mechanisms to infect distal tissue . once at the site , the organisms could drive a local inflammatory process or , in addition , infect other cells within the arterial wall . in fact the hypothesis that infectious agents are causal agents in atherosclerosis originally was formulated in the first two decades of last century . however , this concept received little attention until the late 1970s , when fabricant et al . showed that chickens experimentally infected with an avian herpes virus developed florid vascular lesions similar to those of human atherosclerosis . subsequently , many investigators have reported observations implicating certain infectious agents in human atherosclerotic disease . two basic lines of evidence have been presented : ( 1 ) detection of the agent in atherosclerotic lesions by immunocytochemistry and molecular biology and ( 2 ) epidemiological evidence based on serological data implicating an association between atherosclerotic disease and positive serology [ 6 , 7 ] . actually microbes may potentially play a role in the development of chronic artery disease ( cad ) at several steps : ( i ) initial endothelial vascular injury via direct or indirect mechanisms that could initiate atherosclerosis ; ( ii ) acceleration of early atherosclerosis via local increase in ldl and oxidized ldl by cytokines stimulation or by predisposing to abnormal lipid profile ; ( iii ) precipitation of acute events by predisposing to vulnerable plaque or activation of the coagulation cascade . chlamydophia pneumoniae , an intracellular bacterium of the chlamydiaceae family , is a common respiratory pathogen causing community - acquired pneumonia , bronchitis , sinusitis , and upper respiratory tract symptoms . the infection is frequently mild and clinically unapparent , and its prevalence in the population with increasing age almost mirrors the prevalence and extent of atherosclerosis . this organism is spread easily through airborne droplets and can linger for years inside body cells without causing noticeable symptoms . c. pneumonia is an obligate , intracellular , gram - negative bacterium that is distinguished from other bacteria by a unique growth cycle . in this growth cycle there are 2 morphologically and functionally distinct cell types : the infectious elementary body ( eb ) and the reproductive reticulate body ( rb ) . upon entry into a host cell the elementary body undergoes a series of transformations that allow it ultimately to replicate . at this stage , it again reverts to an elementary body and is released from the host cell . if , however , host cell conditions are not favorable , chlamydia will not progress through cell division and instead moves into what has been referred to as a persistent state , appearing morphologically as a large , aberrant form . the outer envelope of the elementary body is composed of cysteine - rich structural proteins with molecular masses of 98 , 60-doublet , 39.5 , and 15.5 kda . c. pneumoniae infection is rare before 5 years of age , but by 20 years 50% of people have antibodies , and by 65 years more than 80% have been infected . outer membrane protein 2 ( omp2 ) is a second constituent of the chlamydial outer membrane complex ; it has a molecular mass of 60 kda . yet another 60-kda protein has been identified in c pneumoniae ; it is a homolog of c. trachomatis groel and a member of the heat shock protein family , hsp60 . c. pneumoniae strains are able to multiply within macrophages , where they persist for long periods without causing any damage until they are reactivated by immunosuppression or by coincidental infection with other organisms . in order to play a causative role in chronic disease , c. pneumoniae would need to persist within infected tissue for extended periods of time , thereby stimulating a chronic inflammatory response . c. pneumoniae has been shown to disseminate systemically from the lungs through infected peripheral blood mononuclear cells and to localize in arteries where it may infect endothelial cells , vascular smooth muscle cells , monocytes / macrophages and promote inflammatory atherogenous process . these infections and failures may be due to the establishment of a nonreplicating and noncultivable growth stage but viable state of chlamydiae resulting in a long - term relationship with the infected host cell . atherosclerotic disease progression is associated with higher levels of antibodies due to chronic infection , repeated infections , enhanced antigen presentation , or any combination . numerous studies have found evidence of c. pneumoniae in arterial plaques by several different techniques ( immunehistochemistry , in situ hybridization , pcr , electron microscopy , and cultures ) but rarely in normal arteries . the mean prevalence of c. pneumoniae in atherosclerotic plaques is about 4050% , and the presence of the organisms in cad or other arteries do not correlate with the standard antibodies measured in clinical trials [ 6 , 11 ] . hence recent randomized control trials ( rcts ) that determine inclusion of patients by antichlamydial antibodies or the assumption that most patients have chronic persistent c. pneumoniae infection are likely to be underpowered . animal experiments in rabbits have demonstrated that c. pneumoniae can initiate early atherosclerotic changes in the aorta without hyperlipidemia . however , the majority of animal experiments have demonstrated that c. pneumoniae and p. gingivalis can accelerate atherosclerosis in the presence of hyperlipidemia . although theoretically these microbes could lead to precipitation of acute cardiac events by destabilization of plaques through induction of metalloproteinases or gelatinase by macrophages [ 14 , 15 ] , or by inducing tissue factor to cause or precipitate acute thrombosis ( clot ) , no animal models have shown this effect . thus , the recent randomized clinical trials ( rcts ) were designed to prevent secondary cardiac events ( or precipitation by chronic c. pneumoniae infection ) which have never been demonstrated to occur in animal models . reported that in the rabbit model ( fed cholesterol enriched diet ) azithromycin could prevent acceleration or enhancement of atherosclerosis ( when treated immediately after infection ) , and delayed treatment has been shown to be ineffective in preventing artherosclerotic changes . furthermore , there is evidence that single agents ( such as azithromycin or ofloxacin ) can not eradicate c. pneumoniae in a chronic persistent state in either a continuous cell culture model or experimental murine pneumonitis model [ 19 , 20 ] . hence the antibiotics used in the recent rcts are not very effective in eradicating c. pneumoniae from tissues in animals or even within human monocytes . currently the best choice of agents to eradicate persistent chronic infection with c. pneumoniae is unknown but may be a combination with rifampin . other factors that could affect the outcome of these negative rcts include the fact that the majority of patients were already receiving optimal therapy , such as selective -blocker , antiplatelet drugs ( i.e. , aspirin ) and statins . thus making it extremely difficult for any additional therapy to show any difference above standard treatment . statins can inhibit c. pneumoniae in cell culture and suppress the inflammatory or cytokine response to this microbe that may be playing a role in atherogenesis . recent studies demonstrate that simvastatin reduces c. pneumoniae - mediated histone modification and gene expression in cultured endothelial cells , thus downregulating cytokine production that are important in initiating and accelerating atherosclerosis . furthermore in acute infection of swine with c. pneumoniae via the respiratory tract , there is impairment of the muscarinic and kinin - related reactivity of coronary circulation , which can be prevented by simvastatin . in addition , evidence that c. pneumoniae can either initiate or accelerate the atherosclerotic lesion has come from work with both mice ( nih / s , apoe - deficient , and ldl - receptor knockout strains ) and new zealand white rabbits . these animals generally need to consume a high cholesterol diet in order to develop observable changes , though it is possible , in one of the rabbit models , to observe effects without an atherogenic diet . in the ldl receptor knockout mouse , intranasal inoculation with the c. pneumoniae ar39 uninfected mice fed a high cholesterol diet had a lesion area index ( defined as the size of a digitized image of the lesion divided by the aorta luminal surface and multiplied by one hundred ) of 18 , while infected animals given a high cholesterol diet had an index of 42 . this 130 percent increase in lesion size suggests that infection with c. pneumoniae can accelerate the growth of an atherosclerotic plaque . there are limitations to the interpretation of animal models of atherosclerosis . in some of these models the atherosclerotic lesions observed are consistent with a very early pathologic process that does not mirror the lesions responsible for causing human disease . the atherosclerotic lesions in these models generally do not rupture or lead to clinical disease in the animal . while these data do support the potential for a contribution of c. pneumoniae to lipid accumulation at the site , they do not provide conclusive evidence that infection will lead to plaque rupture . seroepidemiological studies have shown an increasing prevalence of antichlamydial antibody with age , indicating the presence of acute c. pneumoniae infection beginning in childhood and extending to adulthood . the prevalence increases from ages 5 through 14 years , and by age 20 years , approximately 50% of persons have serum antibodies to c. pneumoniae . the data suggest that most people are infected and reinfected throughout life . since the initial study that identified an association between elevated c. pneumoniae antibody titers and the prevalence of coronary artery disease , over thirty additional studies have been performed . these studies used different antibody detection assays with different titer cutoffs , different case definitions of coronary artery disease , and were performed in different geographic regions . overall , it appears that elevated antibody titers to c. pneumoniae are associated with a threefold increase in the likelihood of having coronary artery disease . the association identified in seroepidemiological studies using titers to predict the incidence , distinct from the prevalence , of heart disease , however , only variably detects an association and , when positive , only in the range of a 2040 percent increased risk . while the implications of these different findings are being evaluated , the main value of these seroepidemiologic studies may be the attention they have brought to the potential for any association at all . most epidemiological studies of c. pneumonia antibodies and cad or cerebrovascular disease reviewed by danesh and colleagues that reported a 2-fold or larger odds ratio . potential shortcomings of these data are the different end points used to define seropositivity and the subjectivity of interpretation of the microimmunofluorescence assay . although some of the studies were small and may have had statistical biases for subgroups , in general the total of 2700 cases supported the existence of an association between c. pneumoniae and cad . since the review by danesh and colleagues , there have been several relatively small case - control series that have shown the same association [ 2832 ] . however , 3 recent studies warrant further mention . in a relatively large case - control study , the presence of antibodies to c. pneumonia was found to be associated with stroke or transient cerebral ischemia . a large prospective longitudinal study over 13 years showed independent correlation of iga antibodies , but not igg antibodies , to c. pneumonia with excess mortality from cad . a smaller prospective study over 12 years showed no correlation between c. pneumoniae igg seropositivity and future myocardial infarction or c - reactive protein ; there were no tests for iga . chronic c. pneumoniae infection itself may be associated with a serum lipid profile that predisposes to atherosclerosis . the next series of studies involve histopathologic examinations of the atheromatous plaque . in the first 15 studies reported in the literature which were conducted in the united states and europe , approximately 45 percent of the total of 574 samples examined was found to contain evidence of c. pneumoniae by either immunohistochemistry , electron microscopy , in situ polymerase chain reaction ( pcr ) or , rarely , culture . the primary criticism of these studies has focused on the lack of standardization of the assay techniques but , given the bulk of the observations from these and subsequent studies , it seems likely that this pathogen can be found in the plaque . because antibody titers merely suggest historical exposure to the pathogen , there has been a recent interest in the use of pcr to identify individuals that may have an active infection with c. pneumoniae . pcr has been used to assess both histopathologic specimens and circulating white blood cells . in four published papers , patients with a history of coronary artery disease were more likely than controls to have c. pneumoniae identified in circulating monocytes by pcr . in a fifth paper , the incidence was not significantly different but the c. pneumoniae rrna copy number was higher in patients with heart disease . of interest , the proportion of individuals with pcr positive cells in these studies ranged from 9 to 60 percent in the patients with heart disease and 2 to 46 percent in the controls . while this range of exposure may be explained by epidemiologic influences , technical concerns about assay methodologies when the technical concerns have been addressed , it will also be important to understand why otherwise normal individuals have evidence of this pathogen circulating in what should be a sterile space . c. pneumoniae is difficult to culture from atheromatous tissue and has been recovered on only a few occasions . the current theory for the difficulty in culturing the organism from atheromas is that it is residing in a latent , persistent state with low metabolic activity associated with preliminary trials of antibiotic therapy for secondary prevention of cardiovascular events suggested a benefit of newer macrolides after acute myocardial infarction or in unstable angina [ 39 , 40 ] . however , in the larger randomized study , the reduction in secondary events observed at 1 month after treatment was lost at 6 months ' followup . in another relatively small randomized study involving patients with cad ( previous myocardial infarction , coronary artery bypass surgery or more than 50% stenosis of one or more major coronary arteries ) who were seropositive for c. pneumoniae , no reduction in secondary cardiovascular events was present 6 months after a 3-month regimen with azithromycin ; however , there was reduction of a global rank sum score of 4 inflammatory markers ( c - reactive protein , interleukin-1 , interleukin-6 , and tnf- ) in the treated group . to further establish this relationship would need more specific and sensitive diagnostic blood tests that reflect chronic persistent infection and correlate well with the presence of c. pneumoniae in atheromatous plaques . one potential candidate for diagnosis of persistent c. pneumoniae infection is a recently developed enzyme immunoassay [ eia ] for quantification of chlamydial lps in serum . however , combined serological and pathological studies need to be performed to confirm the correlation of the clps and presence of the organisms in atheromatous plaques . another potential candidate diagnostic test is determination of chlamydial heat shock protein ( chsp ) antibody . however , only one small study to date has been performed to determine correlation with pathological evidence of c. pneumoniae in atheromas . commercialization of hsp-60 monoclonal antibody ( genway biotech ) has now paved the way for further larger histopathogical - serological studies by other centers . this is crucial before undertaking any further large prospective epidemiological cohort studies or rcts of any therapeutic agent . a key issue in the hypothesis of c. pneumoniae role in atherogenesis is the ability of this microbe to persist intracellularly as an aberrant body , which has been mainly described in chronic chlamydia trachomatis infections . these persistent aberrant forms are in an arrested state in development , nonculturable , and explain the low yield of culturing human atheromas for c. pneumoniae . in a recent study the presence of aberrant or persistent bodies of c. pneumoniae were demonstrated in human coronary atheromas by immunogold electron microscopy technique . to define the serological responses to c. pneumoniae antigens that are associated with persistent infection , another recent report described antibody patterns of sera from subjects with and without evidence for persistent c. pneumoniae ( determined by multiple pcr analysis at different times of peripheral blood mononuclear cells and vasculatory samples ) by using proteomics , combined with 2d gel immunoblotting . in this study a unique antibody response pattern ( by differential reactivity for 12 proteins ) were found which reflected persistent c. pneumoniae and was not predicted by the current gold standard for serodiagnosis ( the immunofluorescence test ) . the method used in this report , however , would be too expensive , time consuming , and cumbersome to be used for large multicenter population studies and clinical trials . thus application of this data to produce a simpler , easily performed test would be desirable for future investigation . the molecular mechanisms by which a chronic asymptomatic c. pneumoniae infection might contribute to atherogenesis and lesional complications remain obscure . since chlamydial organisms can infect and proliferate in cardiac tissues , a logical extension would be that chlamydia could also infect the tissues of the coronary arteries , such as the endothelial and smooth muscle cells of these vessels . systemic dissemination of c. pneumoniae from the respiratory tract to the cells of the vascular wall requires a cellular transport system because chlamydia replicate exclusively within their host cells . the elementary body , the metabolically inactive extracellular life stage of chlamydia , has never been found circulating free within the bloodstream . circulating monocytes , which are pivotal to the development of atherosclerosis , recent studies have described the in vitro infection of monocyte - derived macrophages with c. pneumoniae and the presence of chlamydial dna within peripheral blood mononuclear cells from patients with cad [ 47 , 48 ] . atherosclerosis and chlamydial diseases share some interesting similarities , including the fact that they are chronic , subclinical , and inflammatory in nature [ 49 , 50 ] , with macrophage activation playing a key role in the inflammatory process . formation of macrophage foam cells in the arterial intima is the hallmark of early lesions in atherosclerosis , and the pivotal step in foam cell formation is the uptake of excess cholesterol from ldl . c. pneumoniae was shown to induce macrophage foam cell formation in the presence of exogenous ldl , suggesting a causal role for the organism in atherogenesis . kalayoglu and byrne used the well - characterized murine macrophage cell line raw-264.7 to examine the role of c. pneumoniae in foam cell formation by macrophages and showed that lps is a c. pneumoniae component that induces macrophage foam cell formation in the presence of exogenous ldl and suggest that infected macrophages chronically exposed to c. pneumoniae lipopolysacharride ( clps ) may accumulate excess cholesterol to contribute to atheroma development . although endotoxin - mediated foam cell formation is not restricted to chlamydial lps , it is improbable that other gram - negative organisms can invade and survive within the arterial intima to provide a continual source of antigen necessary to induce chronic inflammation and foam cell formation ; unlike other gram - negative bacteria , c. pneumoniae has been detected within and isolated from atheromas [ 5557 ] , and it can survive and multiply within all cell types found in the atheroma . it should be noted that acute microbial infections are known to affect the lipid metabolism in both experimental animals and humans . profound changes in serum lipids are seen in acute pneumonia caused by c. pneumoniae ; triglyceride concentrations are clearly elevated and hdl cholesterol levels decreased compared with the values in patients with pneumonia caused by other bacteria or viruses . in a cross - sectional study , a significant association showed between the presence of c. pneumonia specific igg antibodies , elevated serum triglyceride , and lowered hdl cholesterol concentrations in a male population in northern finland . in another study , the serum triglyceride and total cholesterol concentrations were higher in the subjects with a chronic c. pneumoniae infection than in the subjects with no antibodies . the hdl cholesterol concentrations and the ratios of hdl cholesterol to total cholesterol were significantly decreased in the subjects with chronic infection . as it is noted before , chronic c. pneumoniae infection seems to be associated with a serum lipid profile considered to increase the risk of atherosclerosis . infections caused by other gram - negative bacteria have also been shown especially to affect triglyceride and hdl cholesterol levels . the phenomenon has been attributed to the action of lipopolysaccharide ( lps ) , an endotoxin that is a typical constituent of a gram - negative cell wall . lps is an efficient inducer of several cytokines , for example , tumor necrosis factor- ( tnf- ) . administration of lps , which mimics infection or tnf- in both primates and syrian hamsters , causes a decline of hdl cholesterol levels [ 60 , 61 ] , which could be attributed to a decrease in plasma lecithin : cholesterol acyltransferase activity [ 62 , 63 ] . furthermore , administration of tnf- or interleukin-1 ( il-1 ) results in a rapid elevation of serum triglyceride levels followed by a later rise in cholesterol levels [ 64 , 65 ] . the cytokine- and lps - induced alterations in lipid metabolisms can be considered to be part of the acute - phase response and thus also beneficial to the host . in addition , chlamydial lps is the possible candidates responsible for the induction of inducible factors in human umbilical vein endothelial cells ( huvec ) including , components of the bacterial outer membrane complex , and heat shock protein 60 ( hsp-60 ) , which are known to be highly immunogenic . hsp-60 has recently been shown to induce cytokine and adhesion molecule expression in huvec and has been found to colocalize with human hsp-60 in lesions of atherosclerosis . the induction of smooth muscle cell ( smc ) growth factor(s ) by c. pneumoniae - infected endothelial cells represents a novel mechanism by which this bacterium may contribute to the immunopathogenesis of atherosclerosis . so , the ability of c. pneumoniae to elicit an endothelial cell - derived soluble factor(s ) that stimulates smooth muscle cells proliferation may be important in the pathogenesis of atherosclerosis . several groups have demonstrated the ability of c. pneumonia to infect and replicate in cell types found within the atherosclerotic lesion , including endothelial cells , smc , and macrophages [ 68 , 69 ] . infection of these cell types has been shown to result in the production of proinflammatory cytokines which may be involved in atherogenesis . the ability of chlamydia to persist within host cells and produce antigens in the absence of replication may provide sustained immunogenic stimulation necessary for the development of chronic inflammatory diseases such as atherosclerosis . c. pneumoniae infection of endothelial cells has been shown to upregulate the expression of endothelial adhesion molecules and several inflammatory mediators , including monocyte chemoattractant protein 1 ( mcp-1 ) , interleukin 8 ( il-8 ) , and il-1b . during atherosclerosis , these cytokines are also upregulated and may potentiate the development of atheromatous lesions . during the usual infective cycle generating new infectious progeny , chlamydiae express basal levels of two major antigens : the major outer membrane protein ( momp ) and the heat shock protein 60 ( hsp 60 ) . heat shock proteins ( hsps ) belong to a family of approximately two dozen proteins whose amino acid sequences are highly homologous between widely divergent species , from bacteria to humans , and function to protect other proteins from denaturation . because of this high degree of homology , there is a risk of immunological cross - reactions between microorganisms and vascular autoantigens . hsps are subdivided into multimember families on the basis of the molecular weights of the proteins encoded ( e.g. , hsp10 , hsp60 , and hsp70 ) . hsps ( or chaperonins ) are generally considered to act intracellularly to preserve cellular protein stability in response to conditions such as heat shock , nutrient deprivation , infections , and inflammatory reactions . during chlamydial chronic , persistent infections , hsp 60 production increases substantially , microbial hsp 60 , abundantly produced during a chronic chlamydial infection of the vessel wall , might augment atherosclerosis and/or stimulate humoral and cellular immunity in atheroma . hsps have been implicated as antigens stimulating autoimmunity in atherogenesis [ 74 , 75 ] . in addition , bacterial hsp 60 , like another microbial product such as lps , may activate the innate immune system . because human atheroma contains both human and chlamydial hsp 60s and hsp 60s from different species share a substantial sequence similarity ( the homologic results between the amino acid sequence of the chlamydial hsp-60 fragment and the corresponding human hsp-60 fragment is about 50% . ) , chlamydial and human hsp 60s might have similar functions on human vascular cells . chronic infection with c. pneumoniae , through the expression of hsp 60 , might provoke an autoimmune reaction against human hsp 60 . indeed , patients with carotid atherosclerosis or coronary artery disease have high titers of antibodies against human hsp 60 [ 76 , 77 ] . human hsp 60 shares with the chlamydial protein have the ability to stimulate tnf- and mmp-9 production by macrophages . when endothelial cells or macrophages express hsp 60 on their surface and are exposed to antibodies against hsp 60 , they are susceptible to complement - mediated or antibodydependent cellular cytotoxicity [ 7880 ] . if this were the case in vivo , this mechanism of cell injury might contribute to the pathobiology of atherogenesis . a recent autopsy study showed greater frequency of chlamydial antigens in the cardiovascular tissue of patients who died of ischemic heart disease than in patients who died of noncardiac causes ( 64% versus 38% ) . demonstrated that chlamydial hsp 60 frequently produces in large amounts during chronic chlamydial infections and colocalizes with human hsp 60 in plaque macrophages in human atherosclerotic lesions . induction of such macrophage functions provides potential mechanisms by which chlamydial infections may promote atherogenesis and precipitate acute ischemic events . now , it is known that c. pneumoniae can infect human endothelial cells ( ecs ) , where it induces the expression of adhesion molecules like endothelial - leukocyte adhesion molecule-1 ( e selectin ) , intercellular adhesion molecule-1 ( icam-1 ) , and vascular cell adhesion molecule-1 ( vcam-1 ) . c. pneumoniae also infects human monocyte derived macrophages , stimulating the production of proinflammatory cytokines such as tnf- and interleukin-6 ( il-6 ) . the induction of adhesion molecules on infected endothelium might aid trafficking of monocytes and lymphocytes in atheroma [ 84 , 85 ] . the induction of proinflammatory cytokines such as tnf- or il-6 might promote plaque instability and thrombosis [ 86 , 87 ] . because hsps usually localize within cells , they require release into the extracellular space to activate vascular cells . in this regard , it is well known that chlamydia , during their life cycle , undergo both phases of chronic , persistent , nonlytic infection , in which they remain viable but do not replicate , and phases of lytic infection . during these lytic phases , the host cells release both their own hsp 60 , produced during the previous chronic phase of infection , and also the human hsp 60 , which has been produced in the host cell in response to the infection and to previous noninfectious stimuli , in addition , several observations support the occurrence of cell death within atheroma [ 90 , 91 ] , providing another pathway for release of hsps from cells . demonstrated that either chlamydial or human hsp 60 activates human vascular cell functions relevant to atherogenesis and lesional complications . these findings contribute to the understanding of the molecular mechanisms by which a chronic asymptomatic chlamydial infection might influence atherogenesis and trigger acute events . on the other hand , atheroma is an inflammatory site where a variety of cells , cell products , and lipoproteins interact to promote injury and disease . an important consequence of these interactions is the cellular oxidation of low - density lipoprotein ( ldl ) , which alters the lipoprotein to a highly atherogenic form [ 91 , 92 ] . a variety of cell types present in atherosclerotic lesions , including monocytes / macrophages , smooth muscle cells , and endothelial cells , can oxidize ldl . in turn , oxidized ldl promotes cell injury , smooth muscle cell proliferation , foam cell formation , chemotaxis of leukocytes , cellular secretion of inflammatory mediators , and other events that modulate atheroma biology [ 9396 ] . oxidized ldl has been detected in atheromas of rabbits and humans , and antioxidant therapy may decrease cardiovascular events and mortality [ 97 , 98 ] , perhaps by inhibiting the oxidation of lipoproteins . therefore , oxidation of ldl , a biologically plausible mechanism of ldl modification , may explain why high plasma levels of native ldl are a major risk factor for coronary artery disease . infectious agents serve as a link between high serum ldl levels and an event critical to the development of the atheroma , such as the cellular oxidation of ldl . oxidized ldl displays multiple atherogenic properties , including dysregulation of vascular tone , injury to the endothelium , promotion of leukocyte entry into the vessel wall , smooth muscle cell migration and proliferation , and foam cell formation [ 9597 , 99 , 100 ] . although serum antioxidants protect native ldl from oxidation in the macrovasculature , the atherosclerotic lesion contains oxidized ldl and may permit oxidation by acting as a sequestered microenvironment . although the mechanism by which chlamydiae inhibit the respiratory burst remains unclear , such inhibition clearly favors survival for an obligate intracellular pathogen . of interest , . this observation may be relevant to c. pneumonia - induced monocyte activation , as myeloperoxidase has been proposed to play an important role in the oxidation of ldl in vivo . other potential mechanisms for c. pneumoniae - mediated macrophage ldl oxidation include induction of lipoxygenase , nadph oxidase , thiol recycling , and transitional metal ions . monocyte - mediated ldl oxidation also may involve an increase in intracellular calcium and the activation of protein kinase c . chlamydiophila pneumoniae and macrophages are present in inflammatory tissue sites such as atherosclerotic lesions , where abnormal degradation of the extracellular matrix takes place . vehmaan - kreula et al . reported that production of 92 kda gelatinase by human macrophages is selectively upregulated by c. pneumonia , which suggests that these bacteria , when present in a macrophage - containing inflammatory environment , actively participate in the destruction of the extracellular matrix . matrix metalloproteinases ( mmps ) are structurally related and participate in the degradation of extracellular matrix components . besides participating in normal homeodynamics and developmental remodeling of connective tissues , the mmps appear to contribute significantly , by their proteolytic activity , to the tissue damage seen in chronic inflammatory diseases such as rheumatoid arthritis , osteoarthritis , and atherosclerosis . actually plaque rupture and increased thrombogenicity are prime mechanisms of acute coronary disease ( acd ) and chronic c. pneumonia infection is linked to the precipitation of acd . examined whether infections with a c. pneumoniae strain isolated from such a coronary plaque would increase the expression of prothrombotic proteins in vascular cells . in addition to an increased procoagulation protein expression , functional cytokines are expressed in human arteriosclerotic lesions . il-6 is highly expressed in arteriosclerotic lesions , implicated in plaque instability , and in the pathogenesis of acute myocardial infarction . c. pneumonia infection induced sustained cellular overexpression and secretion of il-6 . recruitment of mesenchymal and immunocompetent cells , proliferation , and migration of vsmcs are the consequences of cytokine overexpression in the arteriosclerotic plaque . the functional cooperation between products of the coagulation cascade and cytokine - mediated inflammatory response has been shown to transform a stable plaque into an unstable plaque . atherosclerosis develops as a response of the vessel wall to injury . careful review of epidemiological studies indicates that the classic risk factors , for example , hypercholesterolemia , cigarette smoking , and hypertension account for the majority but not the entirety of the etiology and pathogenesis of the clinical complications of atherosclerosis , including ischemic heart disease and acute myocardial infarction . many underlying mechanisms that infectious diseases cause atherosclerosis have been proposed ; most of them suggested that inflammatory process provoked by infectious diseases led to atherosclerosis . several clinical studies were also performed to examine whether treatment for infectious diseases could protect against atherosclerosis . given the burden that coronary artery disease imparts on the healthcare system and on society in general , efforts to both understand the role of infection in atherogenesis and to develop targeted intervention strategies should continue apace . the relationship between infectious diseases and atherosclerotic diseases and the effects of treatment for infectious diseases on atherosclerosis are still controversial ; there are both positive and negative reports .

more than a century ago , inflammation and infection were considered to have atherogenic effects . the old idea that coronary heart disease ( chd ) possibly has an infectious etiology has only reemerged in recent years . atherosclerosis is the main pathological process involved in chd and is , logically , the first place to look for infectious etiology . the process of atherosclerosis itself provides the first hints of potential infectious cause . smooth muscle proliferation , with subsequent intimal thickening , luminal narrowing , and endothelial degeneration , constitutes the natural history of atherosclerosis , being with the severity and speed of these changes . both viral and bacterial pathogens have been proposed to be associated with the inflammatory changes found in atherosclerosis . recently , chlamydophila pneumoniae ( c. pneumoniae ) has been implicated as a possible etiologic agent of coronary artery disease and atherosclerosis . new evidence which supports a role for c. pneumoniae in the pathogenesis of atherosclerosis has emerged . c. pneumoniae has been detected in atherosclerotic arteries by several techniques , and the organism has been isolated from both coronary and carotid atheromas . recent animal models have suggested that c. pneumoniae is capable of inducing atherosclerosis in both rabbit and mouse models of atherosclerosis . furthermore , human clinical treatment studies which examined the use of antichlamydial macrolide antibiotics in patients with coronary atherosclerosis have been carried out . the causal relationship has not yet been proven , but ongoing large intervention trials and research on pathogenetic mechanisms may lead to the use of antimicrobial agents in the treatment of chd in the future .

1. Introduction 2. Bacteriology 3. Seroepidemiological Studies 4. Histopathology 5. Polymerase Chain Reaction (PCR) 6. Culture 7. Conclusion

flank hernias are protrusions of abdominal visceral contents through weakened areas in the lateral abdominal wall . they are most commonly caused by trauma but can also be caused by previous surgery , after which the hernia would be considered incisional . flank hernias occur in 0.2% of blunt trauma patients but are also seen after abdominal and thoracic operations . as a part of this group , lateral intercostal herniation following a surgical procedure has been reported in only six cases in world literature . we present a rare case of an incisional flank hernia into the 11th and 12th intercostal space with strangulation of the large bowel . this case illustrates the clinical picture of a patient with emergent strangulated hernia and highlights the critical steps in the management of this catastrophe . a 79-year - old african american man was brought to the emergency department after being found unresponsive with labored breathing . he had a past medical history of mechanical mitral valve replacement at age 61 , hypertension , congestive heart failure , prior upper gastrointestinal bleed while on warfarin , stroke at age 74 , and an open right nephrectomy at age 63 for renal cell carcinoma . on admission , the patient was noted to be hypotensive with altered mental status and a glasgow coma scale of 12 ( eye : 4 , voice : 3 , motor : 5 ) . blood and serological examinations showed metabolic acidosis with ph 7.21 , lactate 6.8 mmol / l , base deficit 14.4 , leukocytosis ( white blood cell count 43.9 10 k / mcl ) , supra - therapeutic international normalized ratio ( inr ) 8.9 , elevated aspartate aminotransferase ( ast ) 3517 , and elevated alanine aminotransferase ( alt ) 1503 . computed tomography ( ct ) scan of the abdomen and pelvis without contrast showed herniation of the right colon through the right 11th and 12th ribs ( fig . the diagnosis of bowel obstruction versus strangulated bowel was suspected secondary to the clinical picture of abdominal distention , and serology showing metabolic acidosis , leukocytosis , and lactic acidosis . the patient was admitted to the surgical intensive care unit ( sicu ) for resuscitation and correction of his supra - therapeutic inr prior to surgical intervention . upon exploration of the abdomen , the hepatic flexure of the colon was prolapsed through a 2.5 cm defect in his right flank . a right hemi - colectomy followed by ileostomy with mucous fistula the posterior fascia was then closed over the hernia defect with interrupted polydioxanone ( pds ) suture . this patient had a complicated postoperative course secondary to multi - organ system failure and sepsis leading to progressive deterioration and death . a comprehensive search of the pubmed database was done using the search terms intercostal hernia , incisional hernia , and flank hernia . duplicates and non - human studies abdominal wall hernias have a prevalence of 1.7% for all ages and 4% for those older than 45 years of age . incisional hernias result from non - healing or late disruption of the fascial layers of the wound after previous surgical incision into the abdominal wall . protrusion of abdominal or chest contents through the area of weakened abdominal wall into the intercostal space is a rare possibility . incisional intercostal flank hernias are most commonly caused by trauma , but have also been reported as spontaneous . there are only six previously described cases of incisional intercostal flank herniation after a surgical procedure . contents of the hernia sac in previous reports include small bowel , large bowel , , , , and liver , while our patient had herniation of the right colon . the herniation was most commonly right sided and was left sided in two cases , . the indication for surgery was most commonly renal cell carcinoma , but other indications were angiomyolipoma , marsupialization of liver hydatid cyst , and abdominal aortic aneurysm repair . the location of herniation was most commonly 10th or 11th intercostal space but the 9th intercostal space was the location in one case . causes of intercostal herniation include penetration of the intercostal muscle , dislocation of the costo - transverse joint , paralysis of the thoracic muscle caused by intercostal nerve injury , injury to the costal cartilage , and excessive abdominal pressure which can be associated with obesity , ascites , and bowel obstruction , . the diagnosis can be made upon physical examination and ultrasonography . when these results are inconclusive , a definitive diagnosis of flank herniation can be made using ct , . operative correction is indicated in patients with symptomatic herniation , incarcerated / strangulated herniation , or asymptomatic herniation that directly affects the patient 's quality of life . once a hernia has become incarcerated , emergent surgical management is necessary to avoid strangulation and small bowel obstruction . this rate increases to 23.4 per 100,000 for all hernias with an associated mortality rate of 7% for patients over 60 years of age . the surgeon must pay close attention to the repair of intercostal incisional hernias due to an exceptionally high recurrence rate of 28.6% . urgent diagnosis and management in the setting of strangulation is paramount given the associated increase in morbidity and mortality . this patient had a complicated postoperative course secondary to multi - organ system failure and sepsis leading to progressive deterioration and the patient s untimely death . after an extensive two month long search for relatives of the deceased , we were unable to find any relatives .

highlightsurgent abdominal examination with palpation of the region is necessary in the diagnosis of strangulated hernias but may be misleading so further studies are necessary.serological testing of a patient with a strangulated hernia may show lactic acidosis and leukocytosis.operative management is necessary for strangulated hernias especially in patients with altered mental status and a clinical picture showing decline.intercostal incisional herniation following a previous surgical procedure is a rare entity which should be diagnosed and treated rapidly.this case highlights the clinical picture associated with an emergent strangulated hernia and highlights the critical steps in its management .

Introduction Presentation of case Methods Discussion Conclusion Conflict of interest Funding Ethical approval Consent Authors contributions Guarantor

aggression is defined as behaviors intended to hurt , harm , or injure another person ( 1 ) . it is rooted in an overall structure which could appear in the forms of anger , violence , physical , verbal , and relational aggression ( 2 , 3 ) . aggression could be a product of our interactions with individuals in our environment ( 4 ) which , its severity greatly differs across countries and cultures ( 5 ) . there are various studies indicating relations between aggressive behaviors and sex ( 6 - 11 ) , household income ( 8 - 11 ) , marital status ( 12 ) , and age ( 7 , 10 , 13 ) . aggression is by no means a new concern in human society , especially in youth . aggressive behaviors in the young people are complex , heterogeneous with diverse etiologies and consequences . so , no single term is adequate to capture all variegated and divers presentations of such behaviors in youth ( 14 ) . moreover , universities are among the institutions in which most of the members are young people ( 14 ) and because of facing with various personal and social stressors , the students usually experience high level of stress ( 15 ) . they are a particular group of people in a critical transitional period ( 17 ) . many reasons such as academic stress , new community relation , and changing in life conditions could increase possibility of the students aggressive behaviors ( 18 ) . it is also indicated that student aggression would be related with type of university ( 19 ) and level of education ( 20 ) . this study aimed to evaluate potential associations between students aggression and their personal , family , and social characteristics . this study aimed to determine aggression among university students and its association with their personal , family , and social characteristics . this analytic , cross - sectional study was conducted in gonabad , a collegiate city in eastern iran in 2012 . there are 3 universities in the city with more than 10000 students , as the research population . the inclusion criteria were the students willingness to participate in the study , having no obvious mental and physical disorders , and studying in the first semester of 2011 - 2012 academic year . we excluded any participants who failed to complete the questionnaire as well as those who were not willing to continue the study . using the following formula , a minimum size of 784 the participants was determined however , to gain a higher validity , in case of potential problems during the study process , the required sample size increased to 860 . where , p = 0.5 , q = 0.5 , z ( 1 - /2 ) = 1.96 , z ( 1 - ) = 0.84 , and d = 0.05 . the relevant official permits were issued to perform the sampling and accomplish the research . , the sampling frame was used . using probability proportional to size stratified sampling , we selected 860 students of gonabad university of medical sciences ( gmu ) ( n = 120 ) , islamic azad university ( gonabad branch ) ( n = 380 ) , and payame noor university ( gonabad branch ) ( 360 ) , based on their sex and marital status in each stratum . later , 51 participants were removed due to filling incomplete questionnaire we applied bass - parry aggression questionnaire ( 21 , 22 ) concentrating on physical aggression ( 9 items ) , verbal aggression ( 5 items ) , anger ( 7 items ) , and hostility ( 8 items ) . buss and perry reported a cronbach coefficient at 0.89 and test - retest reliability at 0.80 ( 21 ) . this is a bias free ( 23 ) , self - report questionnaire , which is used in most countries ( 24 ) and consisting of 29 sentences valued at a likert scale from 1 ( extremely uncharacteristic of me ) to 5 ( extremely characteristic of me ) . this questionnaire is validated in iran ( 2 ) via cronbach coefficient ( 0.89 ) . to collect the data , we first distributed the questionnaires among the participants we continued the process until collecting the required questionnaires . using spss ( version 18 ) , we analyzed the gathered data via t test , anova , and linear regression model . regarding the regression assumption , the distribution of aggression scores was independent . besides , the distribution of errors was normal and using durbin - watson , errors independency was acceptable . in this study , p this study was approved by student research committee of gonabad university of medical sciences . before starting the study furthermore , the participants were informed about the goals of the study . after receiving the participants verbal consent , this analytic , cross - sectional study was conducted in gonabad , a collegiate city in eastern iran in 2012 . there are 3 universities in the city with more than 10000 students , as the research population . the inclusion criteria were the students willingness to participate in the study , having no obvious mental and physical disorders , and studying in the first semester of 2011 - 2012 academic year . we excluded any participants who failed to complete the questionnaire as well as those who were not willing to continue the study . using the following formula , a minimum size of 784 the participants was determined . however , to gain a higher validity , in case of potential problems during the study process , the required sample size increased to 860 . where , p = 0.5 , q = 0.5 , z ( 1 - /2 ) = 1.96 , z ( 1 - ) = 0.84 , and d = 0.05 . the relevant official permits were issued to perform the sampling and accomplish the research . according to the performed coordination , the sampling frame was used . using probability proportional to size stratified sampling , we selected 860 students of gonabad university of medical sciences ( gmu ) ( n = 120 ) , islamic azad university ( gonabad branch ) ( n = 380 ) , and payame noor university ( gonabad branch ) ( 360 ) , based on their sex and marital status in each stratum . we applied bass - parry aggression questionnaire ( 21 , 22 ) concentrating on physical aggression ( 9 items ) , verbal aggression ( 5 items ) , anger ( 7 items ) , and hostility ( 8 items ) . buss and perry reported a cronbach coefficient at 0.89 and test - retest reliability at 0.80 ( 21 ) . this is a bias free ( 23 ) , self - report questionnaire , which is used in most countries ( 24 ) and consisting of 29 sentences valued at a likert scale from 1 ( extremely uncharacteristic of me ) to 5 ( extremely characteristic of me ) . this questionnaire is validated in iran ( 2 ) via cronbach coefficient ( 0.89 ) . to collect the data using spss ( version 18 ) , we analyzed the gathered data via t test , anova , and linear regression model . regarding the regression assumption , the distribution of aggression scores was independent . besides , the distribution of errors was normal and using durbin - watson , errors independency was acceptable . in this study , p this study was approved by student research committee of gonabad university of medical sciences . before starting the study , furthermore , the participants were informed about the goals of the study . after receiving the participants verbal consent , we analyzed the data of 809 fulfilled questionnaires out of 860 ( response rate : 94% ) . relations of the respondents aggression score and variables under study are seen in table 2 . according to the results , the mean score of aggression among students who lived in dormitory ( in - dorm ) was significantly higher than those students who lived out of dorm . since p value for age and sex was less than 0.200 , we entered these variables with residency status in a linear regression model , simultaneously . the results showed that , after controlling age and sex , there was no difference between mean aggression score of the students in terms of residency status . then , we evaluated mean score of aggression of the students in terms of residency status . the mean aggression score in male students who lived in dorm was significantly higher than female students residing in dorm . meanwhile , the mean score of aggression in gonabad medical university students who lived in dorm was significantly lower than in dorm students of other universities . there were no significant differences between aggression scores and the independent factors among out - of - dorm students . we can see in table 5 that a significant , inverse association exists between age of the students living in dorm and their aggression scores . according to the results , residency status can be considered as a confounder in this research . so , we should analyze the data in two separate levels in terms of residency status . as it is seen , there was no association between the mean aggression score of the respondents who lived out of the dorm and their sex , marital status , residency situation , university , and age . in contrast , there were significant association between aggression scores of the students lived in dorm and their sex , university , and age . this study aimed to evaluate the students aggression and its association with their personal and social characteristic . based on the study results , paying attention to aggressive behaviors among the students as well as recognizing some potential associations would be useful to control and diminish aggression among them . according to the results , there were significant relations between students aggression and their sex and residency status , while there were no such associations with the respondents sex , level of education , marital status , and residency condition . after controlling the potential confounding effect of residency status ( in - dorm , out - of - dorm ) , aggression score of those students who lived out of dorm had no significant relation with their characteristics . among in - dorm students , however , there were significant associations between their aggression score and sex , age , and university . our results indicated that mean score of aggression for in - dorm students was higher than those students who lived out of dorm . this finding is justifiable as these students usually live in a stressful condition and far from their home . so , they may have low tolerance threshold against stressors and could not mange well such conditions . besides , aggression would be a product of interactions with individuals in an environment ( 4 ) . therefore , living in dorm would increase aggressive behaviors among students because of personal contacts as well as maladaptive behaviors . there are various studies concentrating on aggressive behaviors and some of the causes among students who lived in dorm ( 25 ) . our results showed the aggression mean score of the male students was significantly higher than the female students who lived in dormitory which was comparable with many studies ( 26 - 28 ) , except anderson et al . results ( 29 ) . differences between the students age groups as well as using different tools to evaluate their aggression could probably be potential reasons for discrepancy of the results . we found an association between aggression and the students university ; mean score of students aggression who lived in dorms of gonabad medical university which is a state university , was significantly lower than those in - dorm students of the private universities ( i.e. islamic azad and payame noor universities ) . this may be because of controlling residency status , as a confounder , in our study . according to our results , there was a significant and inverse association between the in - dorm students age and their aggression score which was similar to swanson ( 12 ) findings . our result was not comparable with hess and hagen ( 30 ) as well as mousavi et al . we did not find any relation between the respondents education term and their aggression score . contrary to our finding , sharma ( 20 ) indicated that mean scores of master students in anger scale were significantly lower than those of bachelor students . one of the potential causes to this discrepancy would be the use different tools for evaluating aggression . swanson et al . ( 12 ) , however , showed that aggression score of married persons was significantly more than that of singles . surprisingly , grassi et al . ( 32 ) found that single individuals had more aggressive behaviors than married persons . although use of different tools to evaluate aggression as well as research on different study groups would be potential causes of these discrepancies , more studies to discover the potential associations are recommended . one of the limitations of this study is the method of gathering data which was self - report . the researchers , albeit , offered required comments when the questionnaires delivered to the respondents . besides , this study was conducted on university students ; so , our results could not be generalized to all young people . research on relevant sample size and sampling method as well as a separate analysis among in - dorm and out of dorm students are strong points of our study . indeed , one of the important points of our study was considering the living condition of students ( in - dorm , out of dorm ) as a confounding variable . according to our results , we recommend holding educational programs related to stress management for students as well as providing more facilities with respect to cultural and exercise activities for refreshing students , especially for in - dorm students . these activities would fill both their leisure time and reduce their stress affecting aggressive behaviors . increasing the number of day shift university students implicitly indicates the necessity of recognizing students characteristics and their relational problems as well as finding methods to diminish these difficulties . therefore , our results could be beneficial for policy makers as well as deans of the iran universities . in conclusion , this study showed that mean aggression score of in - dorm students was significantly higher than those students who lived out of dorm . besides , aggression score of the male students was higher than the female students . so , regarding the control of aggressive behaviors , paying attention to male , in - dorm students , especially younger ones has more priority . besides , relation between the participants aggression score and type of the university in terms of state and private would be a proxy of family , social , and economical discrepancies . one of the limitations of this study is the method of gathering data which was self - report . the researchers , albeit , offered required comments when the questionnaires delivered to the respondents . besides , this study was conducted on university students ; so , our results could not be generalized to all young people . to determine aggression condition between student and nonstudent youth , research on relevant sample size and sampling method as well as a separate analysis among in - dorm and out of dorm students are strong points of our study . indeed , one of the important points of our study was considering the living condition of students ( in - dorm , out of dorm ) as a confounding variable . according to our results , we recommend holding educational programs related to stress management for students as well as providing more facilities with respect to cultural and exercise activities for refreshing students , especially for in - dorm students . these activities would fill both their leisure time and reduce their stress affecting aggressive behaviors . increasing the number of day shift university students implicitly indicates the necessity of recognizing students characteristics and their relational problems as well as finding methods to diminish these difficulties . therefore , our results could be beneficial for policy makers as well as deans of the iran universities . in conclusion , this study showed that mean aggression score of in - dorm students was significantly higher than those students who lived out of dorm . besides , aggression score of the male students was higher than the female students . so , regarding the control of aggressive behaviors , paying attention to male , in - dorm students , especially younger ones has more priority . besides , relation between the participants aggression score and type of the university in terms of state and private would be a proxy of family , social , and economical discrepancies .

background : aggression is defined as behaviors intended to hurt , harm , or injure another person . aggression is by no means a new concern in human society , especially in youth . universities are among the institutions in which most of the members are young people and because of facing with various personal and social stressors , the students usually experience high level of stress.objectives:this study aimed to determine aggression among university students and its association with their personal , family , and social characteristics.materials and methods : this cross - sectional , analytic study was conducted on a representative sample ( n = 809 ) of university students ( 1 state university and 2 private universities ) locating in gonabad , iran in 2012 . using proportional to size stratified sampling , we selected the respondents and gathered the required data using a valid and reliable questionnaire . the data were entered into spss ( version 20 ) and analyzed through t test , anova , and regression model.results:a total of 381 ( 47.2% ) male and 428 ( 52.8% ) female students participated in the study . mean ( sd ) age of the respondents was 21.79 ( 2.86 ) years . overall mean aggression score ( sd ) in the students was 72.45 ( 15.49 ) and this score for in dorm and out of dorm students was 74.31 ( 15.59 ) and 70.93 ( 15.23 ) , respectively . there were significant associations between the mean aggression score of dormitory students and sex ( p = 0.004 ) , age ( p = 0.044 ) , and type of the university ( p = 0.039 ) . on the other hand , there was no significant association between all independent factors and mean aggression score of students living out of dorm.conclusions:regarding the control of aggressive behaviors , paying attention to male , young students living in dormitory , especially in non - governmental universities has the highest priority .

1. Background 2. Objectives 3. Materials and Methods 3.1. Design 3.2. Participants and Setting 3.3. Sampling and Data Collection 3.4. Measurement Tools 3.5. Data Analysis 3.6. Ethical Consideration 4. Results 5. Discussion 5.1. Limitations 5.2. Strong Points

the concept of addiction is not easy to define and the usage of the term addiction has been considered as controversial ; however , central to its definition is the dependence on a substance or activity . until recently , non - substance related behavioral addiction was listed in neither of the two internationally used diagnostic manuals of mental disorders , i.e. dsm - iv - tr ( diagnostic and statistical manual of mental disorders ) and icd-10 ( international classification of disease ) . contrary to the commonly held belief that holds addiction to be a particular kind of dependence on drugs and chemical substances such alcohol , nicotine and heroin , behavior science experts believe that any source which is capable of stimulating an individual , could become addictive . the change of behaviors such as gambling , drug abuse , computer gaming or chatting and internet browsing from habits into obligatory behavior , can be considered as the development of addiction . the idea that true addictions can exist even in the absence of psychotropic drugs ( behavioral addictions ) was popularized by peele . according to peele , addicted individuals are dependent on a particular set of experiences , of which the reactions to a specific chemical substance is only one example . building on peele 's notion , some authors have developed the idea that addiction does not necessarily have to involve the abuse of a chemical intoxicant or substance . for example , the term addiction has been used to refer to a range of excessive behaviors , such as gambling , video game playing , eating disorders , sports and physical exercise , media use , sex addiction , pathological working , and compulsive criminal behavior . although such behavioral addictions do not involve a chemical intoxicant or substance , a group of researchers have posed that some core indicators of behavioral addiction are similar to those of chemical or substance addiction . at present , researchers emphasize that in order to make a diagnosis of behavioral addiction , functional impairments must be present at work , in social relationships , or in other social situations . a number of experts believe that behavioral addictions can be passive ( e.g. television ) or active ( e.g. computer games ) , and usually contain inducing and reinforcing features which may contribute to the promotion of addictive tendencies . considering the importance of prior literature on behavioral addiction , the primary aim of this study was to review the major approaches expressed in this field . first , differences and similarities of different perspectives in the field of addiction as well as behavioral symptoms of addiction to various substances was obtained from scientific literature ( 1990 - 2009 ) . thereafter , the obtained data was coded and categorized and subjects were discussed and major issues were extracted . researchers concluded that there are similarities and differences between diagnostic symptoms of drug addiction and behavioral addiction . behavioral addictions such as gambling , overeating , television compulsion , and internet addiction are similar to drug addiction except that the individual is not addicted to a substance , but he / she is addicted to the behavior or the feeling experienced by acting out the behavior . goodman 's and griffiths criteria for behavioral addictions are presented below [ tables 1 and 2 ] . diagnostic criteria for behavioral addictions diagnostic criteria for behavioral addiction based on the views of peel and griffiths ( 1988 ) behavior addiction like drug addiction includes the following components : however , the physical signs of drug addiction are absent in behavioral addiction . one of the precursors of behavioral addiction is the presence of psychopathologies such as depression , substance dependence or withdrawal , and social anxiety as well as a lack of social support based on davis model , urzack believed that people who suffer from behavioral addictions , were tired , depressed , lonely , bashful , shy , and usually have other types of addiction . young ( 1998 ) stated that individuals with behavioral addiction have certain symptoms and will undergo the same consequences as those with alcohol and drug addiction and other obsessive behaviors . from a neurobiological point of view , behavioral addictions that only indirectly affect the neurotransmitter systems of the brain , can serve as reinforcers comparable to pharmacological substances that directly affect these systems ( e.g. , dopaminergic system ) . indeed , recent findings support the assumption of common mechanisms that underlie the development and maintenance of both behavioral and substance - related addiction . this leads to the assumption that excessively conducted behavioral addictions ( e.g. , excessive shopping / sport , pathological gambling / computer game - playing , internet browsing ) , which induce specific reward effects through biochemical processes in the body , do have an addictive potential as well . therefore , several authors have postulated that the criteria of behavioral addiction are comparable with those of substance - related addiction . patients suffering from behavioral addiction describe addiction - specific phenomena and diagnostic criteria such as craving , excessive behavior , psychological and physical withdrawal symptoms , loss of control , development of tolerance ( increased behavior range ) and inducing and perceiving expected psychotropic effects ( e.g. , pathological gamblers use several slot machines at the same time ) . in addition , the high comorbidity of behavioral addiction and substance - related addiction suggests comparable etiological mechanisms for their development . all in all , it seems appropriate to categorize excessively conducted behaviors which lead to suffering , as behavioral addictions . researchers concluded that there are similarities and differences between diagnostic symptoms of drug addiction and behavioral addiction . behavioral addictions such as gambling , overeating , television compulsion , and internet addiction are similar to drug addiction except that the individual is not addicted to a substance , but he / she is addicted to the behavior or the feeling experienced by acting out the behavior . goodman 's and griffiths criteria for behavioral addictions are presented below [ tables 1 and 2 ] . diagnostic criteria for behavioral addictions diagnostic criteria for behavioral addiction based on the views of peel and griffiths ( 1988 ) behavior addiction like drug addiction includes the following components : however , the physical signs of drug addiction are absent in behavioral addiction . one of the precursors of behavioral addiction is the presence of psychopathologies such as depression , substance dependence or withdrawal , and social anxiety as well as a lack of social support based on davis model , urzack believed that people who suffer from behavioral addictions , were tired , depressed , lonely , bashful , shy , and usually have other types of addiction . young ( 1998 ) stated that individuals with behavioral addiction have certain symptoms and will undergo the same consequences as those with alcohol and drug addiction and other obsessive behaviors . from a neurobiological point of view , behavioral addictions that only indirectly affect the neurotransmitter systems of the brain , can serve as reinforcers comparable to pharmacological substances that directly affect these systems ( e.g. , dopaminergic system ) . indeed , recent findings support the assumption of common mechanisms that underlie the development and maintenance of both behavioral and substance - related addiction . this leads to the assumption that excessively conducted behavioral addictions ( e.g. , excessive shopping / sport , pathological gambling / computer game - playing , internet browsing ) , which induce specific reward effects through biochemical processes in the body , do have an addictive potential as well . therefore , several authors have postulated that the criteria of behavioral addiction are comparable with those of substance - related addiction . patients suffering from behavioral addiction describe addiction - specific phenomena and diagnostic criteria such as craving , excessive behavior , psychological and physical withdrawal symptoms , loss of control , development of tolerance ( increased behavior range ) and inducing and perceiving expected psychotropic effects ( e.g. , pathological gamblers use several slot machines at the same time ) . in addition , the high comorbidity of behavioral addiction and substance - related addiction suggests comparable etiological mechanisms for their development . all in all , it seems appropriate to categorize excessively conducted behaviors which lead to suffering , as behavioral addictions . a number of experts such as brown have argued that the concept of addiction is meaningful and that is should not be restricted to the ingestion of substances . the six criteria of brown can be summarized as follows : salience : domination of a person 's life by the activityeuphoria : a buzz or a high is derived from the activitytolerance : the activity has to be undertaken to a progressively greater extent to achieve the same buzzwithdrawal symptoms : cessation of the activity leads to the occurrence of unpleasant emotions or physical effectsconflict : the activity leads to conflict with others or self - conflictrelapse and reinstatement : resumption of the activity with the same vigor subsequent to attempts to abstain , negative life consequences , and negligence of job , educational or career opportunities . high is derived from the activity tolerance : the activity has to be undertaken to a progressively greater extent to achieve the same buzz withdrawal symptoms : cessation of the activity leads to the occurrence of unpleasant emotions or physical effects conflict : the activity leads to conflict with others or self - conflict relapse and reinstatement : resumption of the activity with the same vigor subsequent to attempts to abstain , negative life consequences , and negligence of job , educational or career opportunities . from the psychological and psychiatric viewpoint , behavioral addictions include a collection of disorders , such as anxiety , depression , obsessive thoughts , withdrawal and isolationism , affective disorders , disturbances in social relationships , school problems such as educational failure and lack of interest in doing homework , occupational or interpersonal difficulties , isolation and negligence of friends and family or personal responsibilities , and mental or physical restlessness . in instances when the individual reduces or stops a specific behavior , excessive fatigue , lifestyle changes , significantly reduced physical activity , deprivation and changes in sleep patterns , impatience , sexual deviations , violence , eating disorder and withdrawal symptoms ensue . behavioral addiction risk factors have biological bases and some of them have been effectively treated by ssris . also , cognitive- behavioral therapy , which is the treatment of drug addiction disorders , emotional disorders and eating disorders could be useful . in the treatment of behaviors such as drug addiction , four fundamental aspects should be considered : 1 prior individual psychopathology 2 - differential reinforcement 3 maladaptive cognitions 4 - social support network . in this area psychiatrists and psychologists involved in the field of mental health should be aware of psychological problems caused by addictive behaviors , including symptoms such as anxiety , depression , aggression , and academic and career dissatisfaction . similar to substance abuse prevention programs aimed at addicted persons , specialized training can educate adolescents about the warning signs of online addiction in order to assist early detection . parents should inform their children about the negative consequences of overuse of the internet and its moral deviations , in order to prevent addiction.parents should monitor their children while using internet and teach them the useful and appropriate methods of internet use . this helps adolescents self - monitor their online use without abusing it.behavior science professionals might help adolescents understand the factors underlying their online habits and reintegrate former activities into their lifestyles and aid to prevent suspected cases of online abuse.it is important to know that prevention programs for online abuse can reduce the occurrence of future incidents and decrease risk of internet addiction.one of the important ways to prevent internet addiction , is to treat risk factors such as loneliness , stress , depression and anxiety , which may trigger the addiction to the internet and should be treated . mental health professionals should encourage individuals who overuse the internet , to seek treatment when problems emerge , and help them identify ways they may be using the internet to escape from real life.authorities and cultural institutions have a duty of providing healthy and proper usage of the internet to individuals , especially adolescents who are most vulnerable , via mass media education and training . therefore , the most important step in this field is education and informationwe should realize , however , that filtering is necessary and can limit the abuse of internet ( using pornographic sites , etc ) but it is temporary . in the current situation , the government must invest in immunization , strengthening of religious beliefs and improving the sprit . it seems that in such ways the correct usage of the internet in the community will be naturalized.much research must be done to show that educational training programs on internet addiction have proven effective in preventing new cases and improving the satisfaction and cohesion with internet using . parents should inform their children about the negative consequences of overuse of the internet and its moral deviations , in order to prevent addiction . parents should monitor their children while using internet and teach them the useful and appropriate methods of internet use . behavior science professionals might help adolescents understand the factors underlying their online habits and reintegrate former activities into their lifestyles and aid to prevent suspected cases of online abuse . it is important to know that prevention programs for online abuse can reduce the occurrence of future incidents and decrease risk of internet addiction . one of the important ways to prevent internet addiction , is to treat risk factors such as loneliness , stress , depression and anxiety , which may trigger the addiction to the internet and should be treated . mental health professionals should encourage individuals who overuse the internet , to seek treatment when problems emerge , and help them identify ways they may be using the internet to escape from real life . authorities and cultural institutions have a duty of providing healthy and proper usage of the internet to individuals , especially adolescents who are most vulnerable , via mass media education and training . therefore , the most important step in this field is education and information we should realize , however , that filtering is necessary and can limit the abuse of internet ( using pornographic sites , etc ) but it is temporary . in the current situation , the government must invest in immunization , strengthening of religious beliefs and improving the sprit . it seems that in such ways the correct usage of the internet in the community will be naturalized . much research must be done to show that educational training programs on internet addiction have proven effective in preventing new cases and improving the satisfaction and cohesion with internet using .

introduction : behavioral science experts believe that all entities capable of stimulating a person can be addictive ; and whenever a habit changes into an obligation , it can be considered as an addiction . researchers also believe that there are a number of similarities as well as some differences between drug addiction and behavioral addiction diagnostic symptoms . the purpose of this study is to consider different approaches in this field.methods:this is a descriptive research using content analysis method . first , differences and similarities of various perspectives on addiction and addiction behavior in different substances were obtained , thereafter , the data was coded and categorized , subjects were discussed and major issues were extracted.results:behavioral addiction such as internet addiction is similar to drug addiction except that in the former , the individual is not addicted to a substance but the behavior or the feeling brought about by the relevant action . in addition , the physical signs of drug addiction , are absent in behavioral addiction . others have stated that behaviorally addicted individuals have certain symptoms and will undergo the same consequences brought about by addiction to alcohol and drugs as well as other obsessive behaviors.conclusion:similar to substance abuse prevention , programs aimed at addicted individuals and specialized training can educate adolescents about the warning signs of online addiction , in order to assist the early detection of this disorder . for prevention of behavioral addiction ( such as internet addiction ) authorities , cultural institutions and parents should monitor the use of internet and teach to the adolescent and children , the useful and appropriate methods of internet use .

INTRODUCTION METHODS Findings DISCUSSION CONCLUSION

although most bladder cancer patients present with superficial disease , approximately 70% of cases experience disease recurrence and 10% to 20% experience progression to invasive disease . even though bladder transitional cell carcinoma is relatively chemotherapy - sensitive , the responses are usually transient and most responding diseases recur within the first year , with median survival ranging from 12 to 14 months . thus , during the past few decades , numerous trials have been conducted to develop new treatment regimens for advanced bladder cancer [ 1 - 4 ] . sunitinib malate ( sutent ; pfizer , new york , ny , usa ) is a multi - targeted receptor tyrosine kinase inhibitor that acts on vascular endothelial growth factor ( vegf ) receptor 1 , 2 , and 3 ; platelet - derived growth factor ( pdgf ) receptor ; stem cell receptor ( kit ) ; and fms - like tyrosine kinase-3 receptor ( flt3 ) , and its anti - tumor activity has been demonstrated in various tumors , including renal cell carcinoma ( rcc ) , gastrointestinal stromal tumor , non - small - cell lung cancer , and colorectal cancer [ 5 - 9 ] . the anti - tumor effect of sunitinib malate in rcc is tightly related to the vegf / pdgf signaling axis , distal effectors of the von hippel - lindau tumor suppressor . sunitinib malate exerts its anti - angiogenic and pro - apoptotic effect in rcc through the suppression of this axis signaling . according to this knowledge , in the present study we examined in vitro the anti - tumor effect and related mechanisms of sunitinib malate in human bladder cancer cells , one of the hypervascular tumors with high vegf expression [ 10 - 14 ] . we also explored the synergistic anti - tumor effect between sunitinib malate and conventional cytotoxic chemotherapy agents , gemcitabine and cisplatin , in bladder cancer cells . bladder cancer cell lines ( htb5 , htb9 , t24 , umuc14 , sw1710 , and j82 ) were purchased from the atcc ( manassas , va , usa ) and were maintained in rpmi ( t24 ) , dmem ( sw1710 , umuc14 , sw1710 , j82 ) , and mem ( htb5 ) supplemented with 10% fetal bovine serum ( mediatech , herndon , va , usa ) and 100 u / ml penicillin and 100 mg / l streptomycin ( gibco brl , grand island , ny , usa ) . , seoul , korea ) and gemcitabine was obtained from lilly ( lilly korea ltd . , the cck-8 assay was used to determine the anti - tumor effect of each drug . briefly , cells in 96-well plates were treated with escalating doses of sunitinib malate ( 0.313 - 20 m ) , cisplatin ( 0.039 - 40.0 g / ml ) , or gemcitabine ( 0.313 - 10.0 m ) for 24 , 48 , and 72 hours and then 10 l of cck-8 solution ( cell counting kit-8 , dojindo molecular technologies , inc . gaithersburg , md , usa ) was added to 100 l of media in each well and absorbance was determined at 450 nm after 4 hours of incubation . htb5 cells were exposed to sunitinib malate alone or simultaneously with cisplatin or gemcitabine and the synergistic effect between the two drugs was determined by the combination index ( ci ) by use of the chou and talalay method as described previously . the ci indicates a synergistic effect when < 1.0 , an antagonistic effect when > 1.0 , and an additive effect when equal to 1.0 . for the clonogenic assay , 210 htb5 cells were plated in 6 cm culture discs and treated with increasing doses of sunitinib malate ( 5 m , 10 m , and 20 m ) for 48 hours . the drug was then washed out with pbs and the cells were maintained for another 10 days before visualization of colonies formed with 0.4% crystal violet staining . only colonies larger than 0.2 mm in diameter were counted for quantitative analysis . htb5 cells exposed to a graded concentration of sunitinib malate ( 5 m , 10 m , and 20 m ) for 48 hours were harvested and incubated for 15 to 20 min in 200 l of ripa lysis buffer containing igepal ca630 , sodium lauryl sulphate , sodium chloride , tris - edta , deoxycholic acid , and protease inhibitor cocktail ( thermos scientific , rockford , il , usa ) . thirty micrograms of protein was fractionated by sds - page and transferred to polyvinylidene difluoride ( pvdf ) membranes ( millipore , billerica , ma , usa ) . after blocking with tbst containing 5% milk for 1 hour , the membranes were incubated overnight at 4 with the respective primary antibody [ cyclin d , cyclin b1 , phospho - akt ( p - akt ) , and total - akt ( t - akt ) from cell signaling technology , danvers , ma , usa , and bax and bad from santa cruz biotechnology inc . , santa cruz , ca , usa ] . the membranes were then incubated with secondary antibodies and protein expression was detected with an enhanced chemiluminescence western blot substrate kit ( pierce , rockford , il , usa ) . unless specified , the results were expressed as the meansd of the data collected from at least three independent experiments . statistical significance was determined by the two - sample t - test and p - values < 0.05 and 0.01 were considered as significant . bladder cancer cell lines ( htb5 , htb9 , t24 , umuc14 , sw1710 , and j82 ) were purchased from the atcc ( manassas , va , usa ) and were maintained in rpmi ( t24 ) , dmem ( sw1710 , umuc14 , sw1710 , j82 ) , and mem ( htb5 ) supplemented with 10% fetal bovine serum ( mediatech , herndon , va , usa ) and 100 u / ml penicillin and 100 mg / l streptomycin ( gibco brl , grand island , ny , usa ) . , seoul , korea ) and gemcitabine was obtained from lilly ( lilly korea ltd . , the cck-8 assay was used to determine the anti - tumor effect of each drug . briefly , cells in 96-well plates were treated with escalating doses of sunitinib malate ( 0.313 - 20 m ) , cisplatin ( 0.039 - 40.0 g / ml ) , or gemcitabine ( 0.313 - 10.0 m ) for 24 , 48 , and 72 hours and then 10 l of cck-8 solution ( cell counting kit-8 , dojindo molecular technologies , inc . gaithersburg , md , usa ) was added to 100 l of media in each well and absorbance was determined at 450 nm after 4 hours of incubation . htb5 cells were exposed to sunitinib malate alone or simultaneously with cisplatin or gemcitabine and the synergistic effect between the two drugs was determined by the combination index ( ci ) by use of the chou and talalay method as described previously . < 1.0 , an antagonistic effect when > 1.0 , and an additive effect when equal to 1.0 . for the clonogenic assay , 210 htb5 cells were plated in 6 cm culture discs and treated with increasing doses of sunitinib malate ( 5 m , 10 m , and 20 m ) for 48 hours . the drug was then washed out with pbs and the cells were maintained for another 10 days before visualization of colonies formed with 0.4% crystal violet staining . only colonies larger than 0.2 mm in diameter were counted for quantitative analysis . htb5 cells exposed to a graded concentration of sunitinib malate ( 5 m , 10 m , and 20 m ) for 48 hours were harvested and incubated for 15 to 20 min in 200 l of ripa lysis buffer containing igepal ca630 , sodium lauryl sulphate , sodium chloride , tris - edta , deoxycholic acid , and protease inhibitor cocktail ( thermos scientific , rockford , il , usa ) . thirty micrograms of protein was fractionated by sds - page and transferred to polyvinylidene difluoride ( pvdf ) membranes ( millipore , billerica , ma , usa ) . after blocking with tbst containing 5% milk for 1 hour , the membranes were incubated overnight at 4 with the respective primary antibody [ cyclin d , cyclin b1 , phospho - akt ( p - akt ) , and total - akt ( t - akt ) from cell signaling technology , danvers , ma , usa , and bax and bad from santa cruz biotechnology inc . , santa cruz , ca , usa ] . the membranes were then incubated with secondary antibodies and protein expression was detected with an enhanced chemiluminescence western blot substrate kit ( pierce , rockford , il , usa ) . unless specified , the results were expressed as the meansd of the data collected from at least three independent experiments . statistical significance was determined by the two - sample t - test and p - values < 0.05 and 0.01 were considered as significant . sunitinib malate showed a dose- and time - dependent anti - tumor effect in all cell lines tested except j82 , in which it exerted dose - dependent but not time - dependent activity ( fig . a 72-hour exposure to sunitinib malate suppressed the proliferation of htb5 ( 82.89.4% ) , htb9 ( 74.928.2% ) , umu14 ( 72.34.5% ) , and sw1710 ( 80.56.8% ) cells up to 70% or higher , whereas t24 ( 32.97.6% ) and j82 ( 28.70.7% ) showed only partial responses to sunitinib treatment ( fig . all cell lines were also exposed to graded doses of cisplatin ( 0.039 - 40.0 g / ml ) or gemcitabine ( 0.313 - 10.0 m ) for 48 to 72 hours to determine the sensitivity to each drug , and the results are summarized in table 1 . compared with moderately differentiated htb9 cells ( grade 2 ) , for which the ic50 values for 48-hour and 72-hour exposure were 5.231.0 m and 2.310.95 m , respectively , all other poorly differentiated cell lines ( grades 3 , 4 ) demonstrated relatively higher resistance to sunitinib ( ic50 5.340.67 m to 11.891.34 m ) depending on the exposure time . htb9 cells showed moderate sensitivity to either cisplatin or gemcitabine ( ic50 values for cisplatin and gemcitabine at 72 hours were 0.710.13 g / ml and 1.10.22 m , respectively ) . poorly differentiated htb5 ( grade 4 ) and t24 ( grade 3 ) cells showed the highest sensitivity to cisplatin ( ic50 0.410.6 to 1.330.7 g / ml ) , but exhibited relatively lower sensitivity to either sunitinib ( ic50 4.050.91 to 9.861.75 ) or gemcitabine ( ic50 9.598.7 to 142.49112.02 m ) . exposure to sunitinib caused a decreased expression of cyclin b1 in htb5 cells , whereas cyclin d expression increased ( fig . 2 ) . sunitinib treatment significantly suppressed both p - akt ( p<0.05 ) and t - akt ( p<0.01 ) expression in htb5 cells and also caused an increase in the expression of the pro - apoptotic bax and bad ( fig . poorly differentiated htb5 cells were exposed to sunitinib alone or in combination with gemcitabine . over a wide range of concentrations , sunitinib exerted a dose - dependent anti - tumor effect and its combination with gemcitabine yielded a significantly greater anti - tumor effect than that of either agent alone ( fig . these results were also confirmed by the clonogenic assay in which combination treatment of htb5 cells with sunitinib and gemcitabine showed significantly higher suppression of colony formation ( 4.52.9% of untreated control ) than single treatment with either 2.5 m of sunitinib malate ( 85.31.31% of untreated control , p=0.005 ) or 0.625 m of gemcitabine ( 88.113.6% of control , p=0.001 ) ( fig . 4 ) . because the sunitinib and gemcitabine combination indicated synergism , we performed a fixed ratio ( 1 to 1 ) combination treatment of htb5 cells to determine the combination index . the median effect doses ( dm = ic50 ) for sunitinib , gemcitabine , and their combination were 6.089 m , 198.635 m , and 4.522 m , respectively , indicating a more effective anti - tumor effect of the combination than of either agent alone . the median effect analysis showed cis<1 between fa=0.15 and 0.7 , which suggests a synergistic anti - tumor effect between the two drugs across the broad range of fraction affected ( 15 - 70% cell death ) ( fig . the dose - reduction index ( dri ) also showed that the sunitinib and gemcitabine combination produced favorable dose reduction along the wide fa range ( table 3 ) . no detectible synergistic anti - tumor effect was shown when htb5 cells were treated with sunitinib together with cisplatin . sunitinib malate showed a dose- and time - dependent anti - tumor effect in all cell lines tested except j82 , in which it exerted dose - dependent but not time - dependent activity ( fig . a 72-hour exposure to sunitinib malate suppressed the proliferation of htb5 ( 82.89.4% ) , htb9 ( 74.928.2% ) , umu14 ( 72.34.5% ) , and sw1710 ( 80.56.8% ) cells up to 70% or higher , whereas t24 ( 32.97.6% ) and j82 ( 28.70.7% ) showed only partial responses to sunitinib treatment ( fig . all cell lines were also exposed to graded doses of cisplatin ( 0.039 - 40.0 g / ml ) or gemcitabine ( 0.313 - 10.0 m ) for 48 to 72 hours to determine the sensitivity to each drug , and the results are summarized in table 1 . compared with moderately differentiated htb9 cells ( grade 2 ) , for which the ic50 values for 48-hour and 72-hour exposure were 5.231.0 m and 2.310.95 m , respectively , all other poorly differentiated cell lines ( grades 3 , 4 ) demonstrated relatively higher resistance to sunitinib ( ic50 5.340.67 m to 11.891.34 m ) depending on the exposure time . htb9 cells showed moderate sensitivity to either cisplatin or gemcitabine ( ic50 values for cisplatin and gemcitabine at 72 hours were 0.710.13 g / ml and 1.10.22 m , respectively ) . poorly differentiated htb5 ( grade 4 ) and t24 ( grade 3 ) cells showed the highest sensitivity to cisplatin ( ic50 0.410.6 to 1.330.7 g / ml ) , but exhibited relatively lower sensitivity to either sunitinib ( ic50 4.050.91 to 9.861.75 ) or gemcitabine ( ic50 9.598.7 to 142.49112.02 m ) . exposure to sunitinib caused a decreased expression of cyclin b1 in htb5 cells , whereas cyclin d expression increased ( fig . 2 ) . sunitinib treatment significantly suppressed both p - akt ( p<0.05 ) and t - akt ( p<0.01 ) expression in htb5 cells and also caused an increase in the expression of the pro - apoptotic bax and bad ( fig . to test the synergistic anti - tumor effect , poorly differentiated htb5 cells were exposed to sunitinib alone or in combination with gemcitabine . over a wide range of concentrations , sunitinib exerted a dose - dependent anti - tumor effect and its combination with gemcitabine yielded a significantly greater anti - tumor effect than that of either agent alone ( fig . these results were also confirmed by the clonogenic assay in which combination treatment of htb5 cells with sunitinib and gemcitabine showed significantly higher suppression of colony formation ( 4.52.9% of untreated control ) than single treatment with either 2.5 m of sunitinib malate ( 85.31.31% of untreated control , p=0.005 ) or 0.625 m of gemcitabine ( 88.113.6% of control , p=0.001 ) ( fig . 4 ) . because the sunitinib and gemcitabine combination indicated synergism , we performed a fixed ratio ( 1 to 1 ) combination treatment of htb5 cells to determine the combination index . the median effect doses ( dm = ic50 ) for sunitinib , gemcitabine , and their combination were 6.089 m , 198.635 m , and 4.522 m , respectively , indicating a more effective anti - tumor effect of the combination than of either agent alone . the median effect analysis showed cis<1 between fa=0.15 and 0.7 , which suggests a synergistic anti - tumor effect between the two drugs across the broad range of fraction affected ( 15 - 70% cell death ) ( fig . the dose - reduction index ( dri ) also showed that the sunitinib and gemcitabine combination produced favorable dose reduction along the wide fa range ( table 3 ) . no detectible synergistic anti - tumor effect was shown when htb5 cells were treated with sunitinib together with cisplatin . sunitinib malate is a small molecular multi - targeted tyrosine kinase inhibitor that directly inhibits vegfr , pdgfr , kit , and flt3 . the main anti - tumor mechanism of sunitinib malate is through its inhibition of angiogenesis and the induction of tumor apoptosis by inhibiting tyrosine kinases expressed by cancer . it is well reported that the vegf level is highly correlated with the clinical output of well vascularized tumors such as rcc and gist , and on the basis of the results of clinical trials , the use of sunitinib malate for patients with advanced rcc hrccand gastrointestinal stromal tumor was approved by the food and drug administration . high serum vegf levels are associated with high bladder cancer stage , grade , vascular invasion , and metastases . also , high vegf mrna expression in superficial bladder cancer is related to early tumor recurrence and progression to a more invasive phenotype [ 10,16 - 19 ] . these findings suggest the possible anti - tumor and anti - angiogenic effect of sunitinib malate in advanced bladder cancer . however , only a few sunitinib malate clinical trials for bladder cancer have been performed recently , with mixed initial results , and there have been only a few in vitro or in vivo studies of the anti - tumor effect and related mechanisms of sunitinib malate in bladder cancer . in this study , we explored in vitro the anti - tumor effect of sunitinib malate on human bladder cancer cell lines of various differentiation and analyzed the results compared with the conventional chemotherapeutic agents cisplatin and gemcitabine . all three drugs exhibited a dose- and time - dependent anti - tumor effect against bladder cancer cells . however , the sensitivity spectra of the drugs differed according to the bladder cancer cell lines tested . for example , umuc14 cells ( grade 4 ) showed relatively fair sensitivity to all three drugs ( ic50 4.690.59 m for sunitinib malate , 0.890.21 g / ml for cisplatin , and 0.10.03 m for gemcitabine with 72 hours of exposure ) , whereas htb5 ( grade 4 ) exhibited high sensitivity only to cisplatin treatment ( ic50 0.410.6 g / ml ) , exhibiting moderate and extremely low sensitivity to sunitinib malate ( ic50 4.051.6 m with 72 hours of exposure ) and gemcitabine ( 111.8988.54 m with 72 hours of exposure ) , respectively . these results show that the sensitivities of bladder cancer cell lines to sunitinib might be regulated by factors different from those determining sensitivity to cisplatin or gemcitabine . in other words , it is possible that sunitinib malate could be used as a first- or second - line therapy in selected patients with advanced bladder cancer regardless of the response to cisplatin- or gemcitabine - based chemotherapy . in our study , exposure of htb5 cells to sunitinib malate resulted in a marked suppression of cyclin b1 expression accompanied by increased expression of cyclin d. sunitinib malate also suppressed the expression of p - akt and t - akt . these findings indicate that the anti - tumor mechanism of sunitinib malate in bladder cancer is at least partly through g2 phase cell cycle arrest and suppression of the akt survival pathway . the sunitinib - mediated augmentation of pro - apoptotic bax and bad expression suggests the possible involvement of the mitochondrial apoptotic pathway in the anti - tumor action of sunitinib malate against bladder cancer cells . in tumors such as rcc , testicular germ cell tumors , breast cancer , and pancreatic cancer , sunitinib malate has been reported to have synergistic anti - tumor activity with various treatment modalities , including targeted agents , chemotherapy drugs , and even radiation therapy [ 22 - 28 ] . however , studies of the synergistic anti - tumor effect between sunitinib malate and conventional cytotoxic agents in bladder cancer are very rare . because cisplatin and gemcitabine are the active drugs and mainstay of chemotherapy regimens for advanced bladder cancer , in this study we analyzed the synergistic anti - tumor effect between sunitinib malate and these two drugs . concomitant treatment of htb5 cells with sunitinib malate and gemcitabine significantly enhanced the anti - tumor effect of both drugs along the fa value between 0.15 to 07 , indicating the optimal synergistic anti - tumor effect between the two drugs at the mid - range of combination doses . although sunitinib malate as a single agent caused dose - dependent suppression of colony formation of htb5 cells , the overall decrease in clonogenicity was significantly greater when htb5 cells were exposed to sunitinib malate and gemcitabine simultaneously . although combination of high - dose- range sunitinib malate and cisplatin showed a mild additive anti - tumor effect ( ci=1.23 ) , over a wide range of dose combinations , no significant synergistic enhancement in anti - tumor effect between sunitinib malate and gemcitabine against htb5 was shown . these results are compatible with those obtained by sonpavde et al , in which sunitinib malate and cisplatin showed a synergistic anti - tumor effect against human bladder cancer cell lines only in high - dose combinations . in summary , our findings suggest a synergistic anti - tumor effect between sunitinib malate and gemcitabine in bladder cancer cells , providing a rationale for the development of a sunitinib - based combination therapy regimen with a conventional chemotherapy agent such as gemcitabine for advanced bladder cancer . in the present study , sunitinib malate showed dose- and time - dependent anti - tumor activity against human bladder cancer cell lines of various differentiations . the sensitivity profile of sunitinib malate differed from the profiles identified for cisplatin and gemcitabine , indicating that no cross - sensitivity or resistance exists between sunitinib malate and cisplatin / gemcitabine . also , the combination treatment of sunitinib malate and gemcitabine was superior to either agent as a single treatment regarding anti - tumor potential . these findings suggest the possibility of clinical application of sunitinib - based single targeted therapy or combination treatment with conventional cytotoxic chemotherapy drugs for advanced bladder cancer . considering the extremely poor prognosis of patients with advanced bladder cancers , the development of sunitinib - based novel treatment regimens is of utmost clinical importance . because the ic50 of sunitinib malate in vitro is reported to be significantly higher than the low nanomolar free and active drug concentrations obtained in vivo , further studies are needed to confirm the synergistic anti - tumor effect of sunitinib - based combination treatment in vivo .

purposesunitinib malate ( sutent ; pfizer , new york , ny , usa ) is a highly selective multi - targeted agent and has been reported to have potent anti - tumor effects against various tumors , including renal cell carcinoma and gastrointestinal stromal tumors . in this study , we explored in vitro the anti - tumor effect and related molecular mechanisms of sunitinib malate against human bladder cancer cell lines . we also determined the synergistic anti - tumor effect between sunitinib and conventional cytotoxic drugs , cisplatin and gemcitabine , in bladder cancer cells.materials and methodssix human cancer cell lines ( htb5 , htb9 , t24 , umuc14 , sw1710 , and j82 ) were exposed to an escalating dose of sunitinib alone or in combination with cisplatin / gemcitabine , and the cytotoxic effect of the drugs was examined by cck-8 assay . the synergistic effect between sunitinib and cisplatin / gemcitabine was determined by the combination index ( ci ) and clonogenic assay . alterations in cell cycle ( cyclin d , b1 ) , survival ( p - akt , t - akt ) , and apoptosis ( bax , bad ) regulator expression were analyzed by western blotting.resultslike cisplatin and gemcitabine , sunitinib exerted a dose- and time - dependent anti - tumor effect in bladder cancer cells . however , sunitinib exhibited entirely different sensitivity profiles from cisplatin and gemcitabine . sunitinib suppressed the expression of cyclin b1 , p - akt , and t - akt while augmenting the expression of cyclin d and pro - apoptotic bax and bad in htb5 cells . analysis of the drug combination by the isobolic method and clonogenic assay revealed that sunitinib acts in synergy with gemcitabine in htb5 cells.conclusionsthese results indicate that sunitinib malate has a potent anti - tumor effect and may synergistically enhance the anti - tumor effect of gemcitabine in human bladder cancer cells .

INTRODUCTION MATERIALS AND METHODS 1. Cell lines and chemicals 2. Analysis of 3. Determination of synergistic anti-tumor effect between sunitinib malate and cisplatin/gemcitabine 4. Colony-forming assay 5. Analysis of cell cycle- and survival-related protein expression 6. Statistical analysis RESULTS 1. Anti-tumor effect of sunitinib malate on human bladder cancer cells 2. Sunitinib-induced alterations of cell cycle and survival regulator expression 3. Synergistic anti-tumor effect between sunitinib and gemcitabine against bladder cancer cells DISCUSSION CONCLUSIONS

dietary nitrate ( no3 ) supplementation , particularly in the form of beetroot juice , has become popular in light of recent studies documenting its ergogenic effects on exercise economy / efficiency and endurance performance [ reviewed in ( 15 ) ] . the effects of nitrate supplementation are believed to be the result of increased nitric oxide ( no ) bioavailability following a series of reductions ( no3 no2 no ) in the entero - salivary and peripheral circulatory systems [ reviewed in ( 21 ) ] . while the vasodilatory effects of no are well known ( 14 , 33 ) , no s ability to acutely reduce muscle atp utilization ( 2 ) and mitochondrial oxygen consumption ( 19 ) are remarkable because they challenge the tenet that the metabolic cost of steady - state exercise at a fixed work rate is largely invariant { reviewed in ( 25 ) ] . such a rapid and fundamental change in exercise metabolism may have an impact on daily training and implications for exercise prescription . to date , the majority of studies evaluating the ergogenic effects of dietary nitrate have focused on high - intensity , exhaustive efforts , including graded exercise , time - to - exhaustion , and time trial tests [ reviewed in ( 15 ) ] . a recent meta - analysis concluded that dietary nitrate supplementation was associated with small , but potentially meaningful , effects on high - intensity exercise performance ( 13 ) . while high - intensity efforts may simulate competitive events , daily exercise for training , fitness , or rehabilitation is generally prescribed at much lower intensity . dietary nitrate supplementation has been shown to reduce the oxygen cost of submaximal exercise at fixed work rates eliciting 4580% of peak oxygen consumption ( vo2peak ) ( 3 , 20 ) ; however , it is unknown if a similar effect would be observed if subjects were allowed to self - regulate their work rate to maintain a constant perceived intensity , as would be done during training sessions based on ratings of perceived exertion ( rpe ) . exercise at a constant rpe has been proposed as a model to evaluate performance ( 29 ) , yet few studies have used such rpe clamp protocols ( 24 , 30 ) . recent work from parfitt and colleagues , showed that 30 min of perceptually - regulated exercise at an intensity perceived as somewhat hard [ rpe of 13 out of 20 ( 6 ) ] improved fitness over eight weeks of training ( 24 ) . intrigued by these results , we reasoned that an rpe clamp protocol might be used to assess the effects of dietary nitrate supplementation on self - regulated , moderate - intensity exercise performance in two ways . first , by measuring total oxygen consumption ( vo2 ) across a fixed duration , we could test the hypothesis that dietary nitrate supplementation reduces the oxygen cost of exercise at a prescribed training intensity . alternatively , if supplementation altered subjects perception of effort and allowed them to exercise at a higher work rate ( 23 ) , subjects would perform more mechanical work across the duration of the test . in this study , we used an rpe clamp model to determine the effects of acute dietary nitrate supplementation - in the form of beetroot juice on self - regulated exercise performance using a double - blind , placebo - controlled , crossover design . based on an a priori power analysis using data from previous beetroot juice studies , a sample size of ten subjects was targeted . volunteers were recruited from classes at the university of colorado colorado springs ( uccs ) . from the pool of male and female volunteers , ten females ( age 25 3 years ; height 165 8 cm ; weight 59 11 kg ) were randomly selected . all subjects had resided at low altitude in the colorado springs metropolitan area ( 1800 to 2000 m ) for at least three months and participated in some form of regular exercise , but none were competitive cyclists . subjects were familiar with the cycle ergometry , metabolic measurements , and the 6 to 20 rpe scale ( 6 ) from previous exercise tests in the laboratory including incremental exercise tests to maximal exertion . this project was approved by the uccs institutional review board ( # 14 - 2014 ) and conducted in accordance with the declaration of helsinki . all testing was performed in the uccs human performance laboratory ( 1950 m , barometric pressure ~605 mmhg ) . subjects were asked to refrain from high - nitrate foods ( e.g. beets , spinach , celery , lettuce ) , antibacterial mouthwashes and gums know to blunt oral conversion of nitrate to nitrite ( 12 ) , alcohol , and strenuous exercise for 24 hours . subjects recorded their food and fluid intake and were asked to replicate their diet prior to the next trial . subjects ingested two 70-ml bottles of concentrated beetroot juice ( 12.9 mmol nitrate ) , or nitrate - depleted placebo ( beet it sport shot , james white drinks , ipswich , uk ) , 150 minutes prior to testing along with a light meal . subjects were then allowed to consume only water until the start of the experimental trial . subjects performed one practice and two experimental trials of an rpe clamp protocol to evaluate the effect of dietary nitrate supplementation using a randomized , double - blind , placebo - controlled , counter balanced , crossover design , with a seven day washout between trials . prior to exercise , subjects rested for ten min in a seated position with their backs , arms , and feet supported to assess resting blood pressure . after adjusting the ergometer ( dynafit velotron , racermate inc . , seattle , wa ) to standardize fit , subjects warmed up for five min at an rpe of 9 ( very light ) , then rode for 20 min at an rpe of 13 ( somewhat hard ) . subjects were blinded to all external feedback , except for elapsed time , and were instructed to adjust resistance and pedal cadence as needed to maintain the appropriate level of intensity . an rpe chart was placed one meter in front of the ergometer for visual reference . following the rpe 13 clamp protocol , cool down exercise was performed for five min at 75 watts to evaluate the effect of dietary nitrate on fixed work rate exercise . subjects resting systolic , diastolic and mean blood pressures were measured using an automated sphygmomanometer ( cbm-7000 , colin medical instruments , san antonio , tx ) . resting heart rate and arterial oxygen saturation were assessed by finger pulse oximetry ( nellcor n-200 , covidien , mansfield , ma ) . the average of two measurements obtained during the last five min of rest was used for statistical analysis . during exercise , metabolic measurements were assessed by indirect , open - circuit calorimetry ( parvomedics truemax 2400 , salt lake city , ut ) with subjects breathing through a two - way , non - rebreathing valve and mouthpiece . across the 20-min periods at rpe 13 , total vo2 ( l ) was calculated by summing 60 s averages of vo2 ( l / min ) . total work ( kj ) was calculated as the product of average power ( w ) and test duration ( 1200 s ) . for fixed work rate exercise at 75 w , vo2 ( l / min ) heart rate was integrated into the metabolic cart using a chest strap and telemetric receiver ( polar electro , lake success , ny ) . to evaluate the reliability of the rpe 13 clamp protocol , coefficients of variation ( cv ) and cronbach s alpha statistics for total vo2 and mechanical work accomplished during the protocol were calculated from a retrospective analysis of matched subjects who preformed three repeated trials on separate days without dietary nitrate supplementation ( uccs irb # 15 - 030 ) . to evaluate the effect of dietary nitrate supplementation on the rpe 13 clamp protocol , paired t - tests were used to test the hypotheses that beetroot juice would reduce total vo2 ( l ) , or alternatively , increase similarly , a paired t - test was used to test that hypothesis that nitrate supplementation would reduce the rate of vo2 ( l / min ) during exercise at a fixed work rate of 75 w. significance was inferred at p < 0.05 . based on an a priori power analysis using data from previous beetroot juice studies , a sample size of ten subjects was targeted . volunteers were recruited from classes at the university of colorado colorado springs ( uccs ) . from the pool of male and female volunteers , ten females ( age 25 3 years ; height 165 8 cm ; weight 59 11 kg ) were randomly selected . all subjects had resided at low altitude in the colorado springs metropolitan area ( 1800 to 2000 m ) for at least three months and participated in some form of regular exercise , but none were competitive cyclists . subjects were familiar with the cycle ergometry , metabolic measurements , and the 6 to 20 rpe scale ( 6 ) from previous exercise tests in the laboratory including incremental exercise tests to maximal exertion . this project was approved by the uccs institutional review board ( # 14 - 2014 ) and conducted in accordance with the declaration of helsinki . all testing was performed in the uccs human performance laboratory ( 1950 m , barometric pressure ~605 mmhg ) . subjects were asked to refrain from high - nitrate foods ( e.g. beets , spinach , celery , lettuce ) , antibacterial mouthwashes and gums know to blunt oral conversion of nitrate to nitrite ( 12 ) , alcohol , and strenuous exercise for 24 hours . subjects recorded their food and fluid intake and were asked to replicate their diet prior to the next trial . subjects ingested two 70-ml bottles of concentrated beetroot juice ( 12.9 mmol nitrate ) , or nitrate - depleted placebo ( beet it sport shot , james white drinks , ipswich , uk ) , 150 minutes prior to testing along with a light meal . subjects were then allowed to consume only water until the start of the experimental trial . subjects performed one practice and two experimental trials of an rpe clamp protocol to evaluate the effect of dietary nitrate supplementation using a randomized , double - blind , placebo - controlled , counter balanced , crossover design , with a seven day washout between trials . prior to exercise , subjects rested for ten min in a seated position with their backs , arms , and feet supported to assess resting blood pressure . after adjusting the ergometer ( dynafit velotron , racermate inc . , seattle , wa ) to standardize fit , subjects warmed up for five min at an rpe of 9 ( very light ) , then rode for 20 min at an rpe of 13 ( somewhat hard ) . subjects were blinded to all external feedback , except for elapsed time , and were instructed to adjust resistance and pedal cadence as needed to maintain the appropriate level of intensity . an rpe chart was placed one meter in front of the ergometer for visual reference . following the rpe 13 clamp protocol , cool down exercise was performed for five min at 75 watts to evaluate the effect of dietary nitrate on fixed work rate exercise . subjects resting systolic , diastolic and mean blood pressures were measured using an automated sphygmomanometer ( cbm-7000 , colin medical instruments , san antonio , tx ) . resting heart rate and arterial oxygen saturation were assessed by finger pulse oximetry ( nellcor n-200 , covidien , mansfield , ma ) . the average of two measurements obtained during the last five min of rest was used for statistical analysis . during exercise , metabolic measurements were assessed by indirect , open - circuit calorimetry ( parvomedics truemax 2400 , salt lake city , ut ) with subjects breathing through a two - way , non - rebreathing valve and mouthpiece . across the 20-min periods at rpe 13 , total vo2 ( l ) total work ( kj ) was calculated as the product of average power ( w ) and test duration ( 1200 s ) . for fixed work rate exercise at 75 w , vo2 ( l / min ) heart rate was integrated into the metabolic cart using a chest strap and telemetric receiver ( polar electro , lake success , ny ) . to evaluate the reliability of the rpe 13 clamp protocol , coefficients of variation ( cv ) and cronbach s alpha statistics for total vo2 and mechanical work accomplished during the protocol were calculated from a retrospective analysis of matched subjects who preformed three repeated trials on separate days without dietary nitrate supplementation ( uccs irb # 15 - 030 ) . to evaluate the effect of dietary nitrate supplementation on the rpe 13 clamp protocol , paired t - tests were used to test the hypotheses that beetroot juice would reduce total vo2 ( l ) , or alternatively , increase similarly , a paired t - test was used to test that hypothesis that nitrate supplementation would reduce the rate of vo2 ( l / min ) during exercise at a fixed work rate of 75 w. significance was inferred at p < 0.05 . all ten subjects completed the beetroot juice trials . due to a computer malfunction , one subject data for the remaining nine subjects ( age 24 3 years ; height 166 8 cm ; weight 60 11 kg ; vo2peak 36.1 4.7 ml / kg / min ) were analyzed . beetroot juice lowered resting systolic blood pressure relative to placebo prior to exercise ( 107 13 vs. 112 14 mmhg , p = 0.041 ; figure 1 ) , but did not affect resting diastolic ( 62 8 vs. 64 9 mmhg , p = 0.265 ) , or mean arterial pressures ( 77 9 vs. 80 10 mmhg , p = 0.147 ) . there were no differences in resting hr ( 65 14 vs. 69 7 bpm , p = 0.799 ) or spo2 ( 98 1 vs. 98 1% , p = 0.755 ) following beetroot juice consumption , relative to placebo . the cvs for total vo2 and mechanical work accomplished across repeated rpe 13 clamp trials were 8.2 3.5% and 9.5 3.7% , respectively ( table 1 ) . cronbach s alpha reliability coefficients for total vo2 and mechanical work accomplished were 0.90 and 0.88 , respectively . beetroot juice did not decrease total vo2 ( p = 0.352 ) or increase mechanical work ( p = 0.346 ) accomplished , relative to placebo ( table 2 , figure 2 ) . however , the rate of vo2 at a fixed work rate of 75 w was ~4% lower ( p = 0.048 ) following ingestion of beetroot juice compared to placebo ( table 3 , figure 3 ) . there were three main findings from this study : 1 ) total vo2 ( l ) and work accomplished ( kj ) over 20 min of cycling at a constant rpe of 13 provided reliable assessments of self - regulated , submaximal exercise performance . 2 ) while a single dose of beetroot juice ( 12.9 mmol nitrate ) reduced resting systolic blood pressure and vo2 ( l / min ) at a fixed work rate ( 75 w ) , 3 ) it did not improve performance measured during the rpe 13 clamp protocol . because the effects of beetroot juice were small , they may have been masked by daily variation in the metabolic response to self - regulated exercise . it is thus unlikely that acute consumption of beetroot juice has observable effects on daily exercise training . an ideal performance test must be valid and reliable . because training for a fixed duration at a specific rpe is a common paradigm for exercise prescription ( 1 ) and is effective at improving fitness ( 24 ) , the rpe 13 clamp protocol has inherent face validity . the calculated cvs indicate that metabolic and mechanical data obtained over 20 min of cycling at an rpe of 13 varies by < 10% from day to day . by comparison , cvs associated with the rpe clamp protocol were not as good as values typically reported for time trial efforts ( < 5% ) , but fell within the range of values reported for time to exhaustion tests ( < 26% ) , two commonly accepted laboratory measures of maximal cycling performance that have been positively affected by beetroot juice supplementation ( 3 , 7 , 8 , 18 , 28 ) . additionally , cronbach s alpha coefficients for the rpe clamp performance measures ranged from 0.88 to 0.90 , indicating a strong correlation across repeated trials and therefore high degree of reliability ( 9 ) . while the reliability of rpe during progressive intensity tests has been questioned ( 17 ) , our favorable results are in accordance with previous research on steady - state exercise at an rpe of 13 . eston and williams ( 10 ) also reported a high degree of reliability in vo2 measured after four min at rpe 13 across three trials . interestingly , they noted improvement in the strength of the correlation as subjects habituated to the protocol . we observed a similar effect in both performance measures , as the cvs between the second and third trials dropped below 7% ( table 1 ) . overall , since rpe 13 clamp protocol has a high level of face validity and comparable reliability to other accepted performance tests , total vo2 and mechanical work accomplished during the protocol appear to be suitable measurements to assess performance during submaximal , self - regulated efforts . contrary to our hypothesis , acute consumption of beetroot juice did not reduce total vo2 or increase work accomplished during the rpe 13 clamp protocol . it is possible that the single dose of beetroot juice was insufficient to elicit changes in these measures and that chronic supplementation ( > 5 days ) may have been more effective ( 31 ) . yet , there are several studies that have shown positive effects from single doses of beetroot juice , comparable to those used in our study ( 4 , 18 , 23 , 34 ) . specifically , we selected a dose ( 12.9 mmol nitrate ) based on evidence that acute consumption of 8 to 16 mmol nitrate reduced vo2 during submaximal exercise by 23% and increased time to exhaustion ( 35 ) . empirically , we are confident that a sufficient dose was given and maintained throughout the protocol because we saw evidence of efficacy before and after the rpe clamp protocol . before , we observed reductions in resting systolic blood pressure ( ~5 mmhg ) prior to exercise that were commensurate with previous studies [ reviewed in ( 27 ) ] . after , vo2 was reduced by ~4% during steady - state exercise immediately after the rpe 13 clamp protocol , which was again consistent with expected effects from nitrate supplementation ( 3 , 20 ) . these findings gave us confidence that the dose provided was sufficient during the experimental protocol . we believe that the small effect beetroot juice has on vo2 may have been masked by the ~8% daily variation in total vo2 across the trial discussed above , hence resulting in non - significant effects . additionally , because subjects varied their work rate to maintain an rpe of 13 , periods of steady - state vo2 were not observed . respiratory exchange ratios for each individual fluctuated throughout the protocol , with the majority of subjects ( seven of nine ) registering values over 1.00 for at least two min during the protocol . this variation may have reduced our statistical power and thus our ability to detect significance ( see limitations ) . also , while dietary nitrate supplementation has been shown to hasten oxygen kinetics during transitions from moderate- to severe - intensity exercise , and thereby prolong time to exhaustion , improvements in oxygen kinetics have not been seen at lower intensities ( 7 ) . it is thus possible that the continual , although slight , adjustments in work rate necessary to maintain moderate - intensity exercise precluded our ability to detect effects of dietary nitrate supplementation on total oxygen consumption and mechanical work accomplished . future work at a higher rpe , where dietary nitrate may improve oxygen kinetics during transitions in work rate , may therefore be warranted . this sampling bias resulted in a female - only sample . to the best of our knowledge , only one other study has been performed on an exclusively female population ( 5 ) and reported similar reductions in systolic blood pressure and vo2 at fixed submaximal work rates to those reported in this study and others with both male and female subjects . based on the literature to date , there does not seem to be a differential response to beetroot juice between sexes , but this remains to be rigorously tested . our subjects were recreationally active females with vo2peak values of ~35 ml / kg / min assessed at an elevation of 1950 m. to keep these values in perspective , it is important to note that at this altitude , vo2peak values underestimate sea level values by ~10% ( 11 ) . previous studies have suggested that dietary nitrate supplementation may be more effective at altitude where reduction of nitrite to no may facilitate matching of o2 availability to demand ( 16 , 22 , 32 ) . however , whether the added effects of dietary nitrate supplementation in acute hypoxia are sustained after acclimatization to altitude as in our subjects remains to be determined . although the sample size was sufficient to detect the effects of nitrate supplementation on resting blood pressure and vo2 at a fixed work rate , it may have been insufficient to detect effects during the rpe 13 clamp protocol . post hoc power analyses using calculated effect sizes for total vo2 and mechanical work accomplished ( 0.13 and 0.14 , respectively ) revealed that a sample size of at least 250 subjects would have been necessary to maintain a 70% chance of detecting a truly significant result . these results support our argument that effects of beetroot juice were small and likely masked by daily variation self - regulated exercise . although the main ergogenic effects have been seen in tests of exhaustive exercise capacity , reports of improved submaximal efficiency / economy imply that positive effects may also be seen during daily training sessions of moderate intensity . the rpe 13 clamp protocol was used to mimic a basic aerobic training session . because we found no effect of beetroot juice on this form of self - regulated , submaximal exercise it is unlikely acute dietary nitrate supplementation will affect the volume or quality of daily training . this argument is supported by a recent study showing that daily consumption of beetroot juice while training in hypoxia ( equivalent to 4000 m ) did not improve sea level vo2max or 30-min time trial performance over six weeks relative to a placebo ( 26 ) . we thus do not recommend the daily consumption of beetroot juice to increase performance during moderate - intensity aerobic training sessions .

dietary nitrate supplementation has been shown to reduce oxygen consumption at a fixed work rate . we questioned whether a similar effect would be observed during variable work rate exercise at a specific rating of perceived exertion ( rpe ) , as is commonly prescribed for aerobic training sessions . using a double - blind , placebo controlled , crossover design , ten females ( 25 3 years ; vo2peak 37.1 5.3 ml / kg / min ) performed two 20-min cycle ergometer trials at a constant rpe of 13 ( somewhat hard ) 2.5 hours following ingestion of 140 ml of concentrated beetroot juice ( 12.9 mmol nitrate ) , or nitrate - depleted placebo . performance was measured in terms of total vo2 ( l ) consumed and total mechanical work ( kj ) accomplished across each trial . following each experimental trial , subjects rode at 75w for an additional 5 min to determine the effect of beetroot juice on fixed work rate exercise . coefficients of variation in total vo2 ( l ) and work performed ( kj ) during the rpe 13 clamp trials were 8.2 and 9.5% , respectively . consumption of beetroot juice did not affect total vo2 or work performed during rpe 13 exercise , but lowered resting systolic blood pressure by ~5 mmhg ( p=0.041 ) and oxygen consumption at 75w by ~4% ( p=0.048 ) , relative to placebo . since the effect of beetroot juice on oxygen consumption is small and may be masked by daily variability during self - regulated exercise , it is unlikely to have a notable effect on daily training .

INTRODUCTION METHODS Participants Protocol Statistical Analysis RESULTS DISCUSSION

pemphigus vegetans ( pveg ) is a rare variant of pemphigus vulgaris ( pv ) and accounts for < 5% of pemphigus cases . . however , distinction of these 2 clinical forms as well as differentiation from pv is not always possible . the more frequent neumann type displays periorificial papillomatous vegetations , whereas the hallopeau type is characterized by pustules evolving into vegetations particularly affecting the intertriginous areas [ 1 , 2 ] . whether pveg is a distinct entity or just a special phenotype of pv is still controversial . unusual or atypical manifestations of pveg may pose a diagnostic challenge resulting in delayed diagnosis . a broad spectrum of differential diagnoses must be considered depending on the clinical manifestation and distribution of the lesions . as in pv , the diagnosis of pveg is confirmed via direct and indirect immunofluorescence ( if ) microscopy and detection of anti - desmoglein ( dsg ) 3 and/or anti - dsg1 antibodies . in addition , anti - desmocollin ( dsc ) 1 , 2 , and 3 antibodies were detected in some patients [ 3 , 4 , 5 , 6 ] . we here report a case of pveg with initially exclusive involvement of the ring finger 's tip of the right hand representing per se a diagnostic challenge that was associated with an unusual constellation of anti - dsg3 antibodies . to compare our patient 's antibody profile with autoimmunological findings of previously described patients suffering from pveg , we performed a literature research considering all cases of pveg published in the english - speaking literature . a 64-year - old caucasian man was referred with a 6-week history of a sharply bordered erythematous plaque affecting the ring finger 's tip of the right hand . despite antimicrobial treatment with several antibiotics ( cefuroxime , ampicillin , clindamycin , ciprofloxacin ) and anti - inflammatory topical treatment with betamethasone valerate , skin lesions progressed and finally led to loss of the nail . the patient had a medical history of perichondritis , an untreated arterial hypertension , as well as a panic disorder . physical examination revealed a plaque with overlying crusts and annular pustules on erythematous ground on the fourth right digit ( fig . bacterial swabs of the finger revealed colonization with enterococcus faecalis , escherichia coli , morganella morganii , and gram - positive cocci , while tests for fungal infections were negative . in addition to bacterial and fungal infections , differential diagnoses including vegetating herpes simplex infection , acrodermatitis continua suppurativa , pyoderma gangraenosum , bowen 's disease , and squamous cell carcinoma were considered and excluded . histopathology showed eosinophilic pustule formation in the epidermis in concert with acantholysis and a superficial eosinophil - rich lymphocytic infiltrate ( fig . finally , the diagnosis was confirmed by direct if microscopy of perilesional skin revealing intercellular deposits of igg antibodies in the epidermis ( fig . indirect if microscopy on monkey esophagus allowed detection of igg antibodies binding with an intercellular pattern . although mucous membranes were initially not involved , high levels of circulating anti - dsg3 antibodies ( 2,644 u / ml ; normal : > 20 u / ml ) but no anti - dsg1 antibodies were detected by elisa ( mesacup desmoglein 1 and 3 , mbl , nagoya , japan ) . in addition , indirect if using desmocollin ( dsc)-transfected hek293 cells as substrate revealed absence of circulating iga and igg autoantibodies against dsc1 , 2 , and 3 ( data not shown ) . a high - dose intravenous steroid pulse therapy ( 100 mg dexamethasone on 3 consecutive days ) was initiated and repeated after 2 weeks . having ensured normal thiopurine methyltransferase activity , azathioprine was started ( 1.4 mg / kg body weight per day ) but had to be discontinued due to drug - related liver toxicity . instead , mycophenolate mofetil ( mmf ) was administrated ( 2 g per day ) . two weeks after the second intravenous steroid pulse , anti - dsg3 antibody levels notably decreased to 237 u / ml ( fig . for the first time , the patient developed erosions of the oral mucosa going along with involvement of several fingers and aggravation of the vegetations in the perianal region . worsening of disease was reflected by an increase of serum autoantibody levels ( anti - dsg3 igg : 3,328 u / ml ; anti - dsg1 igg : 30 u / ml ) ( fig . in addition , the patient experienced several depressive episodes linked to his preexisting panic disorder . finally , therapy with rituximab , rituximab was administrated twice at a dose of 1 g in a 2-week interval while mmf was continued . unfortunately , clinical response could not be assessed as the patient was lost to follow - up . unusual or atypical manifestations of pveg are prone to be misdiagnosed or misinterpreted , which may result in delayed correct diagnosis . in case of solitary lesions or uncommon localization of pveg acrodermatitis continua suppurativa was considered , but neither the patient 's nor the family history or the clinical examination was remarkable for psoriasis . finally , the diagnosis of pveg of the hallopeau type was established by the results of histopathology , direct if microscopy , and serology . strikingly , the initial detection of anti - dsg3 antibodies in the absence of anti - dsg1 antibodies without mucosal involvement was puzzling . to compare our patient 's antibody profile with autoimmunological findings of previously described patients suffering from pveg , we reviewed the anglophone literature from december 1988 to january 2017 , considering all available full - text publications providing information on mucous membranes and/or skin involvement and autoantibody levels ( at least anti - dsg1 and/or anti - dsg3 reactivity ; table 1 ) [ 2 , 3 , 4 , 5 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31 , 32 , 33 , 34 ] . thirty - one publications reporting results of 52 patients were identified ( pveg , n = 48 ; pemphigoid vegetans ( bpveg)/pveg , n = 1 ; paraneoplastic pemphigus / pveg , n = 3 ) . in 35 patients , the provided information concerning clinical picture and immunological findings enabled us to correlate involvement of the skin and/or mucous membranes with anti - dsg1 and/or anti - dsg3 antibody levels . in 24 patients , ten patients suffered from skin lesions only [ 3 , 5 , 8 , 13 , 15 , 17 , 22 , 31 , 32 ] . notably , in 7 of these , as in our patient , anti - dsg3 antibodies were detected although mucous membranes were spared [ 8 , 13 , 15 , 17 , 22 , 31 , 32 ] . these findings are not consistent with the desmoglein compensation hypothesis that explains the tissue specificity of the autoantibody - induced loss of cell adhesion in pemphigus . according to this hypothesis in recent years our understanding of the pemphigus pathogenesis considerably increased and the monopathogenetic explanation has been questioned . while the compensation theory basically described acantholysis - introducing effects of anti - dsg antibodies , actually other pathogenic effects ( like induction of acanthosis or accumulation of neutrophils ) of anti - dsg antibodies there is evidence that , apart from dsg1 and dsg3 , additional organ - specific and non - organ - specific antigens are targeted by autoantibodies . besides dsg 14 , there are 3 other cadherins in the epidermal desmosomes , namely dsc1 , dsc2 , and dsc3 . anti - dsc3 igg antibodies have been detected in sera of patients with atypical variants of pemphigus such as pveg [ 3 , 5 , 6 ] . moreover , anti - dsc1 iga antibodies were found in patients suffering from subcorneal pustular dermatosis type of iga pemphigus . in the patient presented here , no anti - dsc1 , 2 or 3 antibodies were detected in the serum via if using dsc - transfected hek293 cells as substrate . however , it was recently shown that the sensitivity of novel elisas using recombinant , mammalian proteins was higher than that of if . as in our patient , unusual manifestations of pveg may mimic various skin diseases and pose a diagnostic challenge . notably , the detection of anti - dsg1 and anti - dsg3 antibodies does not necessarily correlate with the involvement of skin and/or mucous membranes . this might be due to more specific and complex antibody constellations in nonclassical or atypical pemphigus . the further development and implementation of new diagnostic approaches such as the detection of serum anti - dsc antibodies on a routine basis may clarify this observation . all authors declare that there are no conflicts of interest regarding the publication of this case report .

pemphigus vegetans ( pveg ) is a rare variant of pemphigus vulgaris characterized by pustules and/or papillomatous vegetations , preferentially affecting intertriginous and periorificial areas . exceptional manifestations may be misdiagnosed resulting in delayed diagnosis and treatment . diagnosis is confirmed by immunofluorescence and detection of anti - desmoglein ( dsg ) 3 and/or anti - dsg1 antibodies . we herein report an unusual manifestation of pveg . at the time of first presentation , lesions were restricted to the right ring finger 's tip . although mucous membranes were initially not affected , high levels of anti - dsg3 antibodies were detected while anti - dsg1 and anti - desmocollin ( dsc ) 1 , 2 , and 3 antibodies were absent . to compare our immunological findings with previous reports , all accessible anglophone literature published since december 1988 was evaluated . we identified 52 patients suffering from pveg , 7 of these showed anti - dsg3 antibodies without any mucous membrane involvement . notably , the detection of anti - dsg1 and anti - dsg3 antibodies does not necessarily correlate with the involvement of skin and/or mucous membranes . this might be due to more specific and complex antibody constellations in nonclassical or atypical pemphigus .

Introduction Case Report Review of the Literature and Discussion Statement of Ethics Disclosure Statement

a 67-year - old woman initially presented in 2009 for evaluation of left upper extremity and axial cervical pain . her past medical history was significant for stage iiib colon adenocarcinoma that had been in remission since 2007 . the patient was subsequently referred to our practice after failing to respond to 12 months of nonoperative treatment consisting of anti - inflammatory medications , physical therapy , neuromodulatory medications , and an epidural steroid injection , which gave the patient several weeks of moderate relief . upon our initial examination , the patient reported a history of continued left upper extremity pain , weakness , numbness , and tingling as well as several recent falls , changes in balance , and decreased fine motor coordination and dexterity . physical examination was notable for decreased strength graded as 4/5 in her left wrist flexors , biceps , intrinsics , and triceps . sensitivity to light touch was diminished in the radial aspect of the left forearm as well as thumb , index , and long finger consistent with c6 and c7 dermatomes . also notable from examination was unilateral left - sided hyperreflexia graded as 3 + at her biceps , triceps , and brachioradialis as well as a positive hoffman sign of the left upper extremity . no other abnormal upper motor neuron signs were present in the right upper extremity or bilateral lower extremities . imaging , including plain films and magnetic resonance imaging ( mri ) , were obtained demonstrating c5c6 and c6c7 spondylosis with corresponding central and neuroforaminal cervical stenosis . based on her history , physical examination , and imaging studies , her symptoms were recalcitrant to thorough nonoperative treatment , and she underwent surgical management with anterior cervical decompression and fusion at c5c6 and c6c7 . her radicular symptoms completely resolved and her myelopathic symptoms improved significantly in the immediate postoperative period . 3 ) . by her 3-month examination , the patient had complete resolution of axial , radicular , and myelopathic symptoms . left upper extremity examination demonstrated intact 5/5 strength in all muscle groups , intact sensation to light touch , and 2-point discrimination as well as a negative hoffman sign and symmetric reflexes . preoperative t2-weighted sagittal magnetic resonance imaging clearly demonstrating a large disk - osteophyte complex at the c5c6 level . preoperative t2-weighted axial magnetic resonance imaging demonstrating a left - sided disk herniation with resultant foraminal stenosis at c5c6 impinging upon the left c6 nerve root . postoperative lateral standing cervical radiograph demonstrating uncomplicated two - level anterior cervical decompression and fusion at the c5c6 , c6c7 level . at her 6-month evaluation , the patient presented stating that 3 weeks earlier , she began experiencing a severe exacerbation of radicular symptoms in her left upper extremity . upon examination 5 ) failed to demonstrate recurrent stenosis or pseudarthrosis and showed no evidence of adjacent - level changes . an electromyography test ( emg ) was ordered and the patient was scheduled for further follow - up exams . shortly after this examination , the patient developed an erythematous vesicular rash extending from the left shoulder to the first and second digits ( fig . 6 , fig . 7 ) and the emg was not performed due to the presence of this pathognomonic rash . she was diagnosed with herpes zoster ( hz ) in a left c6 nerve root distribution . she was started on valacyclovir and topical steroids , and she reported progressive reduction in symptoms . t2-weighted sagittal magnetic resonance imaging performed 6 months postoperatively after patient presented with recurrent symptoms . note that no persistent and/or recurrent stenosis apparent at the c5c6 , c6c7 level . t2-weighted axial magnetic resonance imaging at the c5c6 level confirming no persistent and/or recurrent stenosis impinging upon the affected left c6 nerve root . clinical photograph of patient 's proximal left upper extremity demonstrating early dermatitis herpetiformis vesicular rash with erythematous macular base in a c6 dermatome . clinical photograph demonstrating patient 's ventral left upper extremity , with late phase dermatitis herpetiformis lesions , characterized by scaled papules in a c6 dermatome . cervical spine surgery and despite several courses of antiviral medications , steroids , and 3,600 mg of gabapentin daily in divided doses , the patient has persistent symptoms of postherpetic neuralgia ( phn ) . due to her persistent symptoms , an emg was obtained at her 9-month follow - up that showed no active denervation or residual cervical radiculopathy in the c6 distribution . this case report is the first to discuss the development of late ( 6 months ) shingles outbreak after cervical nerve root decompression in a previously symptomatic dermatome . due to the absence of a clinically apparent rash at her 6-month evaluation , immediate evaluation for recurrent radicular symptoms focused on ruling out the presence of pseudarthrosis , implant failure , recurrent neuroforaminal stenosis , or infection . flexion / extension radiographs as well as mri failed to demonstrate instrumentation failure , lucency about the implants , adjacent level stenosis , recurrent neuroforaminal stenosis , or a discernible diskitis / infection . the varicella zoster virus ( vzv ) is the progenitor of both varicella ( chicken pox ) and hz ( shingles ) . typical symptoms include exudative pharyngitis , fever , myalgia , and a macular rash progressing to a diffuse vesicular rash . once the initial vzv has abated , the vzv remains dormant within the dorsal root ganglia . although the exact mechanism of activation is unknown , most outbreaks occur during periods of relative decrease in cell - mediated vsv immunity.1 identifiable risk factors include psychosocial stress , malignancy , recent illness , traumatic events , and surgery.2 hz has been shown in several studies to affect between 20 and 30% of the general population with most cases appearing after the fifth decade of life at a rate of 1% per year.3 4 immunocompromised patients see an increased risk of 80 to 90% over immunocompetent patients of like age.4 development of hz carries significant morbidity , and the literature has shown that one in five patients will develop long - term sequelae.5 clinical presentation of hz begins with neuropathic pain , itching , burning , and dysesthesias followed by the onset of a classic unilateral dermatomal rash . the rash is described as an erythematous base , initially maculopapular eruptions then progressing to vesicular eruptions that typically resolve within several weeks of prodromal symptoms . the development of chronic pain symptoms after hz is referred to as phn , and it carries the highest rate of postinfection morbidity and long - term sequelae . ocular involvement also conveys severe morbidity if not recognized and treated immediately . despite the presence of these sequelae , reactivation of hz after cervical spinal dermatomal involvement in hz outbreaks has been noted to be as high as 15%.6 trunk involvement , including one to three separate dermatomes of the thoracic or lumbar spine , make up 60% of spinal involvement . hata et al conducted a large cohort study and described 17 specific disease states in which there was a 1.8- to 8.4-fold increased risk of hz development compared with the general population.2 disk herniation was described in this study as an independent risk factor for primary activation or reactivation of vzv leading to hz . diagnosis of hz remains largely clinical in nature and depends on the observed identification of a clinically apparent rash as well as classic prodromal symptoms . in patients where the diagnosis of hz is unclear , hz may be detected through serum or cerebrospinal fluid polymerase chain reaction dna analysis in an acute idiopathic setting . limitations of polymerase chain reaction testing are based on the sometime chronic nature of vzv , which may produce false - positive results if the disease state has been present greater than 2 weeks . vesicular lesion biopsy may also be used to identify vzv through culture virus isolation or rapid direct fluorescent antibody testing . direct fluorescent antibody sensitivity and specificity are highly dependent on the presence of active lesions . a multimodal therapeutic approach is the recommended treatment including antivirals , oral and topical analgesics , as well as the addition of neuromodulatory medications . although frequently used , there are conflicting studies as to the role and effectiveness of oral corticosteroid use . consensus data suggests judicious , limited courses of oral corticosteroid.5 antiviral therapy is recommended in the patient with acute shingles , ideally initiated within 72 hours of initial symptom development . the 72-hour window remains optimal for treatment initiation , but in the case of an individual whom continues to actively produce new vesicular lesions , antiviral therapy is still indicated.7 several agents are commercially available in the united states including acyclovir , valacyclovir , and famciclovir . duration of treatment depends upon agent of choice ; however , most regimens last 5 to 7 days . it is hypothesized that early antiviral treatment decreases viral shedding , thus decreasing the duration and severity of the primary outbreak . unfortunately , antiviral treatment has not been shown to decrease the incidence of phn.5 7 low - dose gabapentin in conjunction with antiviral treatment has been shown to be effective in reducing acute neuropathic pain . it is noted in several sources that gabapentin is rarely initiated in conjunction with antiviral therapy unless the patient was initially treated by a dermatogist.5 tricyclic antidepressants such as amitriptyline have a limited role in treatment of hz but may be used in the setting of chronic phn . with the introduction of the vzv vaccination in 1995 , prevention appears to be the next step in reducing hz outbreaks as well as the morbidity associated with hz especially in the setting of phn . a large placebo - controlled , double - blinded clinical trial was published in the new england journal of medicine in 2005 , in which patients > 60 years of age were given placebo or zoster vaccination . the results of this study demonstrated a reduction in the incidence of hz by 51.3% among vaccinated patients compared with the placebo control . those who received the vaccination but still developed hz had a truncated clinical course and a greater than 60% reduction in the incidence of phn.7 although our patient had no prior history of hz , she had multiple risk factors predisposing her for a primary activation including age greater than 50 years , history of malignancy , and recent cervical surgery . it has been reported that a standard anterior cervical decompression has a direct affect upon the dorsal root ganglion ; however , the development of hz symptoms along the same dermatome suggests otherwise . several case reports from the otolaryngology literature described a primary hz activation after trigeminal nerve microvascular decompression as described by mansour et al,8 where they described a case of confirmed hz at postoperative day 3 , along the maxillary branch of the trigeminal nerve . this is the first case report of a patient who developed shingles in the same distribution of a decompressed nerve root late in the postoperative time course . the timing of our patient 's presentation appears unique in that hz symptoms developed 6 months after cervical nerve root decompression in a previously symptomatic dermatome . this case demonstrates the need to included hz on the differential diagnosis of recurrent cervical radiculitis in the extended period after anterior cervical decompression and fusion . commentary on : postoperative shingles mimicking recurrent radiculopathy after anterior cervical diskectomy and fusion ebsj wishes to thank the authors of the case report as well as the commentators for reminding us as clinicians of the complexities of our central nervous system and that radicular symptoms may indeed be multifactorial in origin . the article is very helpful in presenting our readership with recommended management in terms of diagnostic thinking as well as practical clinical care questions for postviral neuropathy , such as instituting antiviral therapy and short use of anti - inflammatory therapy as well as considering anticonvulsant medications . our commentators provided a very helpful perspective on differential diagnosis of radicular pain and emphasized the important of differentiating between various types of pain , with burning pain and mechanical allodynia being more typical for a postherpetic neuralgia and a radiculopathy having a more stabbing or electric quality . ebsj would add parsonage - turner syndrome ( or idiopathic neuralgic amyotrophy , historically also referred to as brachial plexus neuropathy ) to this discussion as a differential diagnosis . this condition most commonly affects a shoulder girdle distribution but may extend to other nerve groups as well and combines severe pain with a delayed onset of motor and sensory changes . mri of the affected brachial plexus with neurography and electromyography may assist in the diagnosis . especially needle emg can be very helpful in identifying the axonal disruption of this inflammatory process.1 in general , when spine patients with neurologic presentations fail to make expected recovery , and especially when they worsen despite our best intentions and applications of care , it seems advisable to proceed early on with a comprehensive and mindful reevaluation of affected patients to clear the air and then proceed with the most directed treatment pathway . presenting the patients and their families with realistic outlooks for recovery , which can range from weeks to years and in some cases may leave lasting deficits and symptoms for some of the mentioned conditions , in an open fashion would seem to be a helpful element of the care process as well .

study design case report and review of literature . objective to report the case of a 67-year - old woman who developed delayed onset ( 6 months ) of symptomatic shingles after cervical nerve root decompression in a previously symptomatic dermatome . methods the patient 's clinic course and outcomes were retrospectively reviewed . the study required no outside funding . the study authors have no financial interest in any of the products or techniques discussed . results the patient received definitive treatment for shingles once the zoster form rash manifested . the patient , however , developed postherpetic neuralgia and remained symptomatic at her 2-year postoperative visit . conclusions although shingles is a common disease state affecting patients in the fifth and sixth decades of life , it is rarely seen in the setting of cervical nerve root decompression . this case demonstrates the need to include shingles on the differential diagnosis of recurrent neurogenic pain after anterior cervical decompression and fusion .

Introduction Case Report Discussion Editorial Perspective

hereditary angioedema ( hae ) is a clinical disorder characterized by a deficiency of c1 esterase inhibitor ( c1-inh ) . the disorder results from mutations of the c1-inh gene located on chromosome 11.1,2 donaldson and evans first recognized that c1-inh was deficient in the plasma of patients with hae in 1963.3 unique among the inherited deficiencies of the complement system , hae types i and ii are inherited as an autosomal dominant disorder , with equal occurrence among men and women . low levels of both c1-inh proteins distinguish type i hae , which accounts for approximately 80% to 85% of all hae cases . type ii hae , which occurs in 15% to 20% of patients , results from decreased functional activity of the c1-inh gene , but with normal c1-inh levels.4,5 recently , a new subtype of hae , type iii , has been described in the literature . type iii is characterized by an x - linked dominant inheritance and initially observed exclusively in women and is associated with normal levels and function of c1-inh.6 most cases appeared to be estrogen induced;7 however , more recently males have been identified that appear to have type iii hae , but with normal levels of c4 , c1-inh - a and c1-inh - f . the role of c1-inh in regulation of the contact system activation , via inactivation of plasma kallikrein and factor xiia , was discovered during the 1970s and 1980s.8 c1-inh is the primary regulator of the classic complement pathway activation via inactivation of c1r and c1s.9 the low plasma concentration of functionally active c1-inh permits overactivation of the kallikrein - kinin system , the classical complement pathway , the fibrinolytic system and the coagulation system , with release of vasoactive peptides among which bradykinin is considered to be most important.1012 bradykinin is released by cleavage of kininogen by kallikrein and it is capable of inducing edema as a result of its effects on vasodilation and microvessel permeability.13,14 the exact prevalence of hae is not known , but it has been estimated to range from 1:10,000 to 1:150,000 in the general population . this suggests that there are 2000 to 30,000 affected patients in the united states ( us).14 patients with hae typically begin to swell in childhood and often experience increase symptoms beginning about the time of puberty.15 clinically , hae is characterized by episodic recurrent episodes of subcutaneous and sub - mucosal angioedema . swelling affects the hands and feet but also involves the genitalia , trunk , face , upper airways , larynx , and gastrointestinal tract.16 the disease is characterized by swelling , which is not associated with urticaria , that does not respond to antihistamines , corticosteroids or epinephrine and usually subsides spontaneously in 72 hours.17 in one study , abdominal attacks were reported in more than 93% of patients and composed almost 50% of all angioedema attacks.18 however , skin swellings appear to be the most frequent symptoms of hae.19 a positive family history of angioedema is present in most patients , although up to 25% of patients have negative family histories with a de novo c1 inhibitor mutations.18 thus , the absence of a family history in the presence of typical symptoms should not be a deterrent from making the diagnosis . even within families with the same genetic aberration symptoms vary considerably and it is not unusual for one family member to have severe recurrent attacks and another to be relatively free of symptoms . the first published manuscript on the treatment of hae with c1-inh was published in 1980 by gadek et al.20 during this study , the c1-inh protein was removed from pooled plasma via chromatography . they referred to 1 unit ( u ) of c1-inh as the amount of c1-inh found in 1 ml of plasma . administration of c1-inh during acute attacks was shown to reduce the severity and duration of symptoms and signs of the acute attack . however , because of the hiv crisis in the mid 1980s research into c1 esterase replacement in the us ceased . in europe research continued and c1-inh inhibitor was approved for treatment of acute attacks of hae . in 1989 , bork described a patient treated with prophylactic c1-inh . the patient required c1-inh concentrate every fourth or fifth day and showed clinical improvement with almost complete cessation of attacks . in addition , there were no side effects noted during the treatment time course.21 the first randomized double blind control trial of c1-inh used for prophylaxis was completed with purified and vapor heated plasma in 1996.22 a prophylactic group of 6 patients was evaluated in a cross - over study in which subjects were randomly assigned to receive c1-inh infusion every 3 days in two different 17-day treatment periods . disease activity was reduced 60% during the c1-inh treatment period . in a previous study by zuraw et al,23 subjects received c1-inh 1000 u twice weekly or placebo for 12 weeks and then randomized to the other arm . results demonstrated that subjects had fewer attacks during the c1-inh treatment period than the placebo period ( p < 0.0001).23 while on chronic replacement , as compared to when subjects were on placebo , subjects not only had fewer attacks , but when they had attacks , the attacks were less severe and shorter in duration . of the 22 patients , 2 worsened while on chronic replacement therapy and one had no change in attacks . c1-inh is a naturally occurring single chain glycoprotein in human blood consisting of 478 amino acids and a molecular weight of 105 kda . as a serine protease inhibitor , the biologic half - life of c1-inh in healthy subjects is 64 1.4 hours suggesting that treatment every 3 days is necessary to restore c1-inh levels24 ( figure 1a ) . waytes et al22 demonstrated an increase in the level of c1 inhibitor after the initial infusions of concentrate , to a mean of 85% of normal values . twenty - four hours after the infusion , the mean levels of c1 inhibitor were approximately 70% of normal . at 72 hours values fell to 48% of normal value which is still significantly above the baseline level . therefore , it was suggested that for prophylaxis , c-1-inh could be administered every 3 to 4 days given the level of c1-inh at the end of that timeframe . unlike c-1-inh , c4 levels do not have a sharp rise and fall within a 72-hour period , suggesting that the biologic half life of c1-inh may exceed the serum half life . c4 levels increase more slowly and after administration of c1 inhibitor every 3 to 4 days levels of c4 persist within the normal range.22 the pharmacokinetics of the human plasma - derived c1-inh cinryze were analyzed in a randomized , parallel group , open label pharmacokinetics study.25 the study was performed in patients with documented hae who were currently asymptomatic . the patients received either a single dose of 1000 u or 1000 u followed by a second 1000 u 60 minutes later . there have been no additional studies to date evaluating pharmacokinetics particularly in special patient populations . it is not known to what extent gender , race , age , disease severity or the presence of renal or hepatic impairment affects c1-inh levels when being replaced . in asymptomatic patients , the results showed that the drug has a long half life and slow clearance . the mean half - lives of cinryze were 56 hours ( range 11 to 108 hours ) for a single dose and 62 hours ( range 16 to 152 hours ) for the double dose , as shown in table 1 . administration of cinryze led to an increase in the concentrations of c1-inh and complement c4 over baseline values . . however , administration of a second dose 60 minutes after the first did not follow linear kinetics.25 as noted above , the safety and efficacy of cinryze used as prophylaxis therapy showed a reduction in the incidence , severity , and duration of hae attacks without any associated significant adverse events . these data from the single randomized , double blind , placebo controlled multi - center crossover study have not yet been published.25 the study consisted of 24 patients who were screened to confirm a diagnosis of hae and a history of at least two hae attacks per month . the patients with a mean age of 38.1 years ( age range 9 to 73 years ) were randomized to one of two treatment groups . the first group received cinryze prophylaxis for 12 weeks followed by 12 weeks of placebo prophylaxis . the other group was randomized to placebo prophylaxis for 12 weeks followed by 12 weeks of cinryze prophylaxis . an attack was defined as the subject - reported indication of swelling at any location following a report of no swelling on the previous day . efficacy was based on the number of attacks during the 12 week period while receiving cinryze compared to the number of attacks during the placebo treatment period . patients treated with cinryze had a 66% reduction in days of swelling ( p < 0.0001 ) , and decreases in the average severity of attacks ( p = 0.0006 ) and the average duration of attacks ( p = 0.0023 ) as shown in table 2.25 no studies to date have compared cinryze to other agents used to treat hae . cinryze is available in single - use vials that contain 500 u per vial and is supplied as a single glass vial of powder to be reconstituted with 5 ml sterile water for injection . the full dose of 1000 u ( reconstituted in 10 ml ) of cinryze is administered by intravenous injection at a rate of 1 ml per minute over 10 minutes.25 cinryze is classified as pregnancy category c. no animal data are available on use during pregnancy . no adequate and well - controlled studies were conducted in pregnant women during the initial trials . therefore , it is unknown whether cinryze can cause fetal harm when administered to a pregnant woman or can affect reproduction capacity . baker et al26 presented data on six pregnant women all of whom had normal healthy deliveries while on cinryze being used as prophylaxis . subjects received 1000 u of cinryze replacement 1 to 2 times per week with benefit . since then , another patient was reported who was in her second trimester and had no difficulties in regards to her pregnancy while on c1-inh replacement . the number of attacks and number of emergency medical visits were reduced by > 85% . no adverse events secondary to cinryze were reported and the therapy reportedly was tolerated well.26 at the present time , no data are available to suggest that c1-inh replacement is beneficial or harmful for the newborn or mother during lactation . it is suggested that caution should be exercised when administering cinryze to a nursing woman , but this is due to the lack of available data . the lack of data suggests that therapy should only be used during lactation when benefit outweighs risk and only after informed consent has been given by the patient . the safety and effectiveness of cinryze have not been established in neonates , infants , or children . previous data found that very high doses of c1-inh given to premature neonates without hae can predispose to hypercoagulation and thrombotic events.27 the only information suggesting the safety of c1-inh replacement is from three of the 24 subjects that completed the prophylaxis efficacy study who were under the age of 18 years . benefit and adverse events seemed to be similar to those over the age of 18 years of age . in addition , the study did not include sufficient numbers of subject 65 years of age and older to determine whether they respond differently from younger subjects . the most common drug related adverse reactions observed at a rate 5% were upper respiratory tract infections , sinusitis , rash , and headache.25 there were severe adverse reactions that were thought to be unrelated to the study drug . these included death due to non - catheter related foreign body embolus , pre - eclampsia resulting in emergency cesareansection , stroke , and exacerbation of hae attacks . thrombotic events were reported in association with other c1-inh products when used off - label at high doses . the thrombotic adverse events occurred during clinical trials for another indication and at doses of 4000 us given over approximately 5 hours ( an average dose of 57 u / kg ) and 9000 units given over a 7-day period.27 at least one case of a thrombotic event has been reported to the food and drug administration ( fda ) during the cinryze postmarketing period ; however , it is not clear whether the thrombosis was secondary to an indwelling catheter , c1-inh or the combination of both . in vitro and in vivo animal thrombogenicity studies with cinryze showed a potential for clot formation when administered at doses 14 times the recommended clinical dose ( greater than 200 u / kg ) . this is also supported by animal studies when given intravenous administration of other c1-inh products.28 because cinryze is derived from human plasma , there is an inherent risk of viral transmission with its use . donors are screened for infection with human immunodeficiency virus ( hiv-1/hiv-2 ) , hepatitis b virus , hepatitis c virus , and parvovirus b19 . in addition , to reduce the possibility of viral transmission the units of plasma are not released until the donor returns in 3 months and if at that time the serologies are negative the plasma is released for processing . this time interval helps assure that hiv is not missed since during the window phase of infection hiv may be present even though serologies are negative . the use of two independent viral reduction steps in the manufacturing of cinryze further reduces the possibility of viral transmission and includes pasteurization ( heat treatment at 60c for 10 hours in solution with stabilizers ) and nanofiltration through two sequential 15 nm planova filters.25 cinryze is contraindicated in patients with any known hypersensitivity reactions to any constituents . an interesting concern arises when trying to distinguish between an acute angioedema attack versus a hypersensitivity reaction and as with other products used to treat hae the occurrence of hypersensitivity may be over estimated secondary to hae attacks mimicking hypersensitivity reaction . the human plasma - derived c1-inh , cinryze , distributed by lev pharmaceuticals , was approved in october 2008 for the prevention of hae attacks based on the results of the phase iii clinical trial . the fda has requested that postmarketing studies be performed to address the following issues to include the optimal dose for prophylaxis in males and females , immunogenicity and long - term safety . currently , there are no submitted data on the safety profile of an intensified dose schedule of cinryze for routine prophylaxis . data for using cinryze to treat active hae attacks has been submitted to fda , but viropharma did not receive an approval for cinryze for acute attacks of hae . open label data were presented at the american college of allergy , asthma and immunology ( acaai ) annual meeting in 2008 for the treatment of acute attacks with cinryze . dr . bruce zuraw presented data titled : results of open - label administration of nanofiltered c1-inhibitor for the treatment of acute hae attacks.29 the study enrolled 88 subjects with documented hae . eligible subjects received open - label injections of cinryze for acute attacks of angioedema occurring at any anatomical site and could receive a second open - label injection of cinryze 60 minutes later if they had not improved . twenty - four subjects were followed for greater than one year . throughout the study , the primary locations of treated attacks were extremities , facial , gastrointestinal , genitourinary , and laryngeal . the median time to improvement was 30 minutes in the 447 attacks that occurred , and 93.4% of patients reported improvement in symptoms within 4 hours . none of the subjects in this study treated for laryngeal attacks required hospitalization or intubation . despite this positive data , the p value for the primary outcome did not reach significance and the drug was not approved in the us for use in acute attacks . the recommended dose for hae prophylaxis is 1000 units ( two 5 ml vials ) every 3 or 4 days . thus , a maximum of 10,000 u are considered medically necessary per 30 days for hae prophylaxis . the current wholesale price for cinryze the monthly cost of therapy would range from $ 36,562 to $ 48,750 per patient . this cost is a major burden on the patient even if the patient needs to pay a small co - pay . controversy exists on when to treat people with chronic replacement therapy , especially since medications such as androgens are effective , inexpensive and often tolerated well at low doses30 as shown in table 3 . it appears that patients with severe disease , those who fail to be controlled with androgens , or those with adverse events to androgens are good candidates for cinryze chronic replacement therapy . further studies need to be conducted for special populations including pediatric patients , geriatric patients , and women during pregnancy . also , dose escalation studies in those that are not controlled on approved doses of cinryze are needed and according to the clinical trials website are being conducted at the present time . safety when using higher doses is important because of the prior evidence of thrombotic events in neonates treated with high doses of c-1-inh . postmarketing surveillance will also be important especially since cinryze was approved for chronic replacement therapy based upon safety from a limited number of subjects . it appears that phase iii studies will need to be repeated before approval of cinryze for acute attacks . the use of cinryze on demand at the time of prodromal symptoms should be effective in preventing an acute attack , but this study still needs to be performed.31 in addition , short - term prophylaxis , such as treatment before dental work and surgery , need to be performed to confirm the efficacy and safety when using cinryze for short - term prophylaxis . in summary , cinryze provides replacement therapy in those that have deficiency of the protein and thus is a physiologic approach to therapy and hopefully will add significantly to the quality of life in patients that have hae . it is anticipated that the safety and tolerance will continue to be benign and acceptable . as other medications become available ( kalbitor berinert ) and still others are approved ( icatibant ) for use in the us it will be interesting to see how the use of cinryze evolves over the next 5 to 10 years ( table 4 ) .

hereditary angioedema ( hae ) is a clinical disorder characterized by a deficiency of c1 esterase inhibitor ( c1-inh ) . hae has traditionally been divided into two subtypes . unique among the inherited deficiencies of the complement system , hae types i and ii are inherited as an autosomal dominant disorder . the generation of an hae attack is caused by the depletion and/or consumption of c1-inhibitor manifested as subcutaneous or submucosal edema of the upper airway , face , extremities , or gastrointestinal tract . attacks can be severe and potentially life - threatening , particularly with laryngeal involvement . despite the availability of c1-inh for the treatment of hae since the 1980s in europe and other countries , hae treatment in the united states was limited to androgen therapy . the human plasma - derived c1 esterase inhibitor ( cinryze ) , distributed by lev pharmaceuticals , was approved in october 2008 for the prevention of hae attacks based on the results of a phase iii clinical trial . this review aims to describe the history of c1-inh replacement in hae as well as the pharmacology , efficacy and safety of c1-inh , concentrating on cinryze as the first approved chronic replacement treatment for the prophylaxis of hae attacks .

Introduction History of C1-INH use for prophylaxis in HAE Pharmacology and pharmacokinetics Dosing strategy Use in special populations Safety and tolerability FDA approval details Conclusions

the state of non - rem sleep ( nrem ) , or slow wave sleep , is associated with a synchronized eeg pattern in which specific electrographic events take place . these events are sleep spindles and/or k complexes and high - voltage slow wave activity ( swa ) within the delta frequency band ( between 0.5 and 4.0 hz ) that can be recorded over the entire cortical surface . in humans , nrem is subdivided into stages 2 and 34 depending on the proportions of each of these polygraphic events . stage 2 , with sleep spindles and k complexes and less than 20% of swa in the recording , corresponds , from the behavioral point of view , to a light sleep with a low - threshold to awakening . behaviorally , stage 34 , with swa occupying at least 20% of the recording , is a deeper sleep . recently , in the new sleep scoring classification of the aasm ( iber et al . , 2007 ) the former stage 34 is identified as only one stage , named n3 . in young adults stage 34 ( n3 ) is especially abundant in the first third of the night ( figure 1 ) . its proportions show notable stability in long and short sleepers , and it is the first stage to recover after sleep deprivation ; it is considered to be the main component of the core sleep necessary for normal physical and intellectual performance and behavior . recently , in a revision of the publications describing the anatomical connections and effects of lesions and electrical stimulation of specific brain structures on the sleep wakefulness cycle ( swc ) we outlined the brain structures located at practically all levels of the encephalon that participate in the organization of the nrem state ( reinoso - surez et al . , 2011 ; figure 2 ) . also , different findings have shown that impulses from peripheral nerves and spinal cord can modify brain electrical activity increasing eeg synchronization and producing swa , as occurs after stimulation of cutaneous nerves ( pompeiano and swett , 1962 ) , after repetitive visual stimuli or diffused and permanent illumination of the retina ( mancia et al . , 1959 ) , or after afferent volleys originating in the vagus nerve ( puizillout et al . conversely , decrease of swa in the eeg ( and therefore enhancement of desynchronized eeg ) takes place after suppression of trigeminal nerve afferents ( vies - morros , 1959 ) , and after lesion or blockage of the spinal cord , thus indicating that ascending synchronizing impulses can also be generated in the spinal cord ( hodes , 1964 ; de andrs et al . , 1976 ) . a parasagittal section of cat brain shows a shaded area representing the brain structures where lesion decreases nrem sleep and/or eeg synchronization or stimulation increases nrem sleep . the main connections between these structures and the structures responsible of the organization of wakefulness ( encompassed in red line ) or rem sleep ( blue lines ) with the exception of the efferent hypothalamic and midbrain connections and the brainstem connections from the basal forebrain are shown . the thalamus cerebral cortex complex or unit is darker to emphasize that these structures are necessary for the behavioral and bioelectric signs that characterize nrem sleep . ac , anterior commissure ; cc , corpus callosum ; dcn , deep cerebellar nuclei ; fo , fornix ; g7 , genu of the facial nerve ; ic , inferior colliculus ; io , inferior olive ; lv , lateral ventricle ; mrf ; midbrain reticular formation ; mt , medullary tegmentum ; och , optic chiasm ; pgs , periaqueductal gray substance ; rpc , caudal pontine reticular nucleus ; rpo , oral pontine reticular nucleus ; sc , superior colliculus ; sc and pn , spinal cord and peripheral nerves ; sn , solitary nucleus ; tb , trapezoid body . modified from reinoso - surez et al . ( 2011 ) . when the medulla and the caudal pons are separated from more cranially located brainstem structures , active and resting periods are still organized in a manner that can resemble very elemental waking and sleep states ( siegel et al . , but , in the absence of influence from higher brainstem structures , the medulla , and caudal pons are unable to generate true nrem or rem sleep signs since the full expression of these states does not occur in chronic medullary or midpontine cats ( reinoso - surez et al . , 2011 ) . however , lesion and stimulation experiments in our and other laboratories demonstrated that eeg synchronizing hypnogenic influences on the rostral brainstem and prosencephalon originate in the caudal pons and medulla at the level of the nucleus of the solitary tract ( magnes et al . reinoso - barbero and de andrs , 1995 ) and caudal pontine reticular nucleus ( batini et al . , 1958 ; cordeau and mancia , 1959 ; reinoso - surez et al . , 1962 ; rossi et al . , 1963 ; camacho - evangelista and reinoso - surez , 1964 ; zarranz and reinoso - surez , 1971 ; reinoso - surez and de andrs , 1976 ; garzn , 1996 ) these findings , together with the rostral projections of these lower brainstem structures ( reinoso - surez et al . , 1977 ) , support the assertion by moruzzi ( 1972 ) that the deactivating structures of the lower brainstem may inhibit the ascending reticular system and counteract its influence at the level of the diencephalon . our group reported that lesions in the long ascending tracts at the level of the oral pontine tegmentum produce eeg desynchronization ; bilateral desynchronization of the eeg also followed uni- or bilateral lesions in the superior cerebellar peduncle that destroyed the brachium conjunctivum tract ( camacho - evangelista and reinoso - surez , 1964 , 1965 ) . this led us to infer that these lesions suppressed ascendant hypnogenic synchronizing impulses from more caudal levels of the brainstem and the deep cerebellar nuclei . in the case of lesion to the brachium conjunctivum tract , the suppression of the synchronizing impulses was associated to a bilateral increase of desynchronized eeg but also to the generation of bursts of intermediate- to high - voltage theta band eeg activity recorded in cortical areas ( motor and parietal cortices ) that are targets of the thalamic nuclei where cerebellar projections end ( camacho - evangelista and reinoso - surez , 1965 ; reinoso - surez , 1992 , 1993 ) . in agreement with these results , unilateral lesions of the brachium conjunctivum in cats increased wakefulness and drowsiness while decreasing nrem and rem sleep ( de andrs and reinoso - surez , 1979 ) . sleep spindles and delta swa can not be observed in decerebrate animals in which the brainstem has been released from prosencephalic influences ( villablanca , 1966 ; de andrs and corpas , 1991 ) , even though , these preparations show the behavioral and bioelectric rem sleep signs . on the other hand , the isolated forebrain ( or cerveau isol preparation ) of cats transected at the intercollicular level , which lacks brainstem influences , is able to express the full bioelectric activity patterns of nrem sleep ( villablanca , 1965 ; corpas and de andrs , 1991 ) . in addition , when the third cranial nerves and nuclei are not affected by the transection in the cerveau isol preparation , the bioelectric eeg activities in the isolated forebrain are coupled to pupil size changes , that is , myosis during synchronized eeg and mydriasis during desynchronized eeg , that occur in intact cats during nrem sleep and wakefulness , respectively ( villablanca , 2004 ) . furthermore , prosencephalic mechanisms are sufficient for homeostatic regulation of nrem sleep : pharmacologic deprivation of this state in the cerveau isol preparation is followed as in intact animals by an nrem sleep rebound ( corpas and de andrs , 1991 ) . in addition , clinical , and lesion and stimulation experiments made it possible to describe a rostral nrem hypnogenic system that includes the basal forebrain , and preoptic and anterior hypothalamic regions ( von economo , 1930 ; hess , 1931 ; nauta , 1946 ; hernndez - pen , 1962 ; sterman and clemente , 1962 ; madoz and reinoso - surez , 1968 ; mcginty and sterman , 1968 ; szymusiak and mcginty , 1986 ) . the ventral lateral preoptic area and the median preoptic nucleus show a higher density of neurons with increased activity during nrem episodes than do other anterior hypothalamic regions ( szymusiak et al . , 1998 ) . also , lesion , stimulation , and clinical studies demonstrate that the thalamus is necessary to generate the electrophysiological and behavioral manifestations that characterize nrem sleep ( hess , 1931 , 1968 ; morrison and dempsey , 1942 ; villablanca , 1974 ; steriade et al . the chronic athalamic cat shows wakefulness and rem sleep but not typical nrem sleep ( villablanca , 2004 ) . also villablanca ( 1972 , 2004 ) affirmed that true nrem sleep is absent in chronic cats without telencephalon ( diencephalic cats ) because neither delta swa nor sleep spindles could be recorded in the thalamus . in summary , it appears that the thalamus and the cerebral cortex are absolutely necessary for the expression of the most significant bioelectric and behavioral events of nrem sleep . other structures like the basal forebrain , cerebellum and caudal brain stem , and impulses from the spinal cord and peripheral nerves modulate nrem sleep but are not required for the actual generation of the bioelectric and behavioral signs accompanying the expression of nrem sleep ( figure 2 ) . the cerebral cortex is the main afferent and efferent structure for the thalamus , and , in turn , the thalamus is the main subcortical afferent and efferent structure for the cerebral cortex ( reinoso - surez et al . , 2011 ; figures 3 and 4 ) . in both cases these connections are made of two types of projection neurons ( jones , 2001 ; rubio - garrido et al . , 2009 ; figures 3 and 4 ) : the thalamus sends projections from core- ( c ) and matrix- ( m ) type thalamocortical neurons and the cerebral cortex sends projections from layer vi and layer v neurons . thalamic nuclei , cell types , and thalamocortical relationships . the lower part of the figure represents a schematic coronal section of the primate diencephalon and the upper drawing depicts a schematic section of the primary and association cerebral cortices . thalamic lateral posterior ( lp ) and ventral posterior ( vp ) nuclei are represented as examples of high - order and first - order thalamic nuclei , respectively . c , core - type cells ; intr , thalamic intralaminar nuclei ; it , gabaergic interneurons ; m , matrix - type cells ; md , medial dorsal thalamic nucleus ; nr , thalamic reticular nucleus ; i vi , cortical layers . modified from reinoso - surez et al . the projection neurons , pyramidal neurons in layers ii iii , v , and vi , are represented in different colors according to their origin and targets . the two types of interneurons are represented in different colors : ( 1 ) the excitatory interneuron , a spiny stellate cell , is in pink ; and ( 2 ) the inhibitory interneurons are in light green . there are four specific examples of inhibitory interneuron : two dendrite - and tuft - targeting cells [ cajal - retzius ( c - r ) and martinotti ( m ) neurons ] , one dendrite targeting cell [ double bouquet ( db ) neuron ] , and one axon targeting cell [ chandelier ( c ) neuron ] . afferent fibers from cortical and subcortical origins are represented in different colors and specific distributions . the wide distributions of dopaminergic ( da ) , serotonergic ( 5-ht ) , noradrenergic ( na ) , histaminergic ( his ) , orexinergic ( orx ) , and gabaergic ( gaba ) fibers originating in brainstem , diencephalic , and basal prosencephalic structures are represented by their terminals , as is the topographically organized terminals of the basal forebrain cholinergic ( ach ) fibers . thalamocortical fibers targeting cortical layers i ( m - type ) and iv ( c - type ) are also shown . open triangles , excitatory terminals ; solid triangles , inhibitory terminals . from reinoso - surez et al . the axons of both types ( m and c ) of thalamocortical projection neurons provide collateral branches to the thalamic reticular nucleus when traversing it on their way to the cerebral cortex . the gabaergic thalamic reticular neurons that receive these collaterals project back , modulating both the thalamic projection neurons that provide the thalamocortical axons as well as the related interneurons ( figure 3 ) . thalamic innervation in cortical layer i is at least as heavy as that in layer iv ; every part of cortical layer i receives combined input from multiple thalamic nuclei ( rubio - garrido et al . , 2009 ) . since the 1980s , the thalamocortical and corticothalamic cellular bases of sleep spindles and delta swa generation have been extensively studied by steriade et al . these authors showed that the combination of the intrinsic electrophysiological properties of the thalamic and cortical neurons , together with their synaptic connections , is responsible for the generation of sleep spindles and delta swa oscillations in the eeg during nrem sleep ( for review see nez - molina and amzica , 2004 ; fuentealba and steriade , 2005 ) . thus , the eeg activities , which appear during stages 2 and 34 ( n3 ) of nrem sleep are essentially generated by the activity of neurons in the thalamic reticular nucleus , in the thalamocortical projecting nuclei , and in the cerebral cortex . 1985 ) proposed , early on , that the neurons of the thalamic reticular nucleus are pacemakers for sleep spindles , based on the absence of the sleep spindle oscillation in thalamocortical systems when they are disconnected from the thalamic reticular nucleus and the presence of spindle rhythmicity in the deafferentized reticular thalamic nucleus . bal and mccormick ( 1993 ) demonstrated that reticular nucleus neurons have an intrinsic rhythmic activity at spindle frequencies ( 712 hz ) in slice preparations . the thalamic reticular nucleus is a relatively thin sheet of neurons that surrounds the anterior , lateral and , to some extent , ventral surfaces of the dorsal thalamus , and it is entirely composed of gabaergic cells . because of its anatomical position the thalamic reticular nucleus is traversed by virtually all axons connecting the dorsal thalamus with the neocortex , giving the nucleus its reticulated appearance and name ; it also receives collateral branches from corticothalamic fibers originating in cortical layer vi ( figures 3 and 5 ) . thalamic reticular nucleus neurons do not project directly to the cortex although they widely project to the relay thalamic nuclei . simultaneous intracellular recordings in reticular , thalamocortical , and cortical neurons ( steriade and deschenes , 1988 ) indicated that sleep spindle generation was produced by a chain of events with three main consecutive steps : ( 1 ) repetitive spike - bursts at spindle frequency generated by gabaergic thalamic reticular nucleus neurons ; ( 2 ) transfer of this activity to relay thalamocortical nuclei producing rhythmic ( at spindle frequency ) inhibitory postsynaptic potentials ( ipsps ) in thalamocortical neurons ; and ( 3 ) transfer to the cerebral cortex of postinhibitory rebound spike - bursts of the thalamocortical cells producing excitatory postsynaptic potentials ( epsps ) in cortical cells at spindle frequency . the repetitive spike - bursts of the reticular nucleus neurons are na action potentials generated by low - threshold ca spikes at spindle frequency ( bal and mccormick , 1993 ) . since the reticular nucleus projection is gabaergic , the reticular nucleus activities are transmitted to the thalamocortical relay nuclei generating rhythmic ipsps in these cells . thalamocortical relay cells are able to generate ca spikes at membrane hyperpolarizing levels ( jahnsen and llins , 1984 ) , these ca spike makes it possible to generate na potentials in the re - polarizing phase of the ipsps that can reach the cerebral cortex and produce rhythmic epsps in cortical neurons at the sleep spindle frequencies ( steriade and deschenes , 1988 ) since the thalamic afferents to the cerebral cortex are glutamatergic ( figures 3 and 5 ) . finally , in relation with the cellular basis of the sleep spindles , it is noteworthy that spindle oscillations in the membrane potential of the reticular and thalamocortical neurons arise from sustained hyperpolarized membrane potential levels ( llins and steriade , 2006 ) , and that thalamocortical or corticothalamic collaterals to the thalamic reticular nucleus can reinforce the generation of sleep spindles . synaptic activation of the thalamic reticular nucleus neurons by stimulation of these afferents invariably determines the generation of a sequence of spindle waves crowned with spike - bursts . schematic representation of the anatomical bases for the sleep spindles of nrem sleep and the intermediate- to high - voltage theta eeg activity of drowsiness . from reinoso - surez et al . the recruiting responses are the neurophysiological activity that can be experimentally elicited in the cat cortex after low - frequency stimulation of the intralaminar and related nuclei ( morrison and dempsey , 1942 ) ; these responses resemble the eeg activity recorded in superficial layer i of the cortex during sleep spindles ( hess , 1968 ) . the frontal and posterior parietal cortices are the cortical regions that are the prime location for recruiting responses and spontaneous spindling in the cat ( morrison and dempsey , 1942 ; starzl and magoun , 1951 ; reinoso - surez , 1954 ) . the superficial thalamocortical projection system to layer i in the frontal and posterior parietal cortex of the cat does not arise from intralaminar nuclei but from the paralaminar region of ventral medial , ventral anterior , and ventral lateral nuclei ( oka et al . in addition , the m - type cells of these nuclei innervate wider zones of layer i of the cerebral hemisphere , as it also happens in rats ( rubio - garrido et al . , 2009 ) . consequently this layer i projection system to the frontal and posterior parietal cortices may be an important leading path for recruiting responses and spontaneous spindling activities ( oka et al . in relation with the possible thalamocortical route for sleep spindle generation , jimnez - castellanos and reinoso - surez ( 1985 ) , velayos et al . ( 1990 ) proposed a circuit that involves the thalamic reticular nucleus and its projection to the paralaminar ventral medial , ventral anterior , and ventral lateral nuclei ( figure 5 ) . the thalamic reticular nucleus gabaergic pacemaker neurons of the spindle oscillations would impose their rhythmicity on the paralaminar m - type neurons that project to layer i of the frontal and parietal cortices ( reinoso - surez et al . for this to occur , as happens in stage 2 of nrem sleep , it is necessary to decrease the brainstem activating system action on both the thalamic reticular nucleus neurons , which consequently fire at their intrinsic burst activity , and the paralaminar neurons , which then transfer the slow burst activity to the cortex . altogether this permits the thalamic paralaminar m - type neurons projecting to layer i of the cerebral cortex , in their turn , impose this activity on the cortex , which has also been released from the influence of the ascending activating system ( figure 5 ; reinoso - surez , 1992 , 1993 ; reinoso - surez et al . , 2011 ) . 2011 ) have concluded that spindle oscillation initiation depends on activity by cortical pyramidal neurons on thalamic reticular nucleus neurons , which would then fire synchronizing discharges . the intermediate phase would be the interaction of thalamic reticular nucleus neurons with the thalamic projection neurons as we have described above . spindle firing is terminated by the combination of ih current and corticothalamic input depolarizing actions . consequently corticothalamic activity is involved not only in the long - range synchronization of spindles but also in the initiation and termination of individual spindle sequences , and this controls spindle duration . ( 2011 ) have investigated human hippocampal functional connectivity with neocortex in wakefulness and during nrem sleep . they found that the strongest functional connectivity between the hippocampal formation and neocortex was observed in stage 2 sleep spindles . the hippocampal structure dominating functional connectivity to frontal neocortex regions during sleep stage 2 was the subiculum . this increased connectivity between the hippocampal formation and neocortical regions suggests an increased capacity for possibly global information transfer in sleep stage 2 and would support the hypothesis of sleep - dependent memory consolidation . cortical and thalamic mechanisms are also involved in the generation of eeg delta swa that appear in deep nrem sleep stage 34 . eeg with swa can be registered in the cortex of cats without thalamus ( villablanca , 1974 ) ; therefore , the cortex has classically been considered to be the structure that generates this activity . however , steriade et al . ( 1991 , 1993 ) showed that delta oscillations can also be generated in thalamocortical neurons . these cells express this property intrinsically when their membrane potential is at more strongly hyperpolarized levels than during sleep spindles . in thalamic cells , delta is an intrinsic oscillation consisting of low - threshold spikes alternating with post - hyperpolarizing potentials . action potentials at delta frequency that can be transferred to the cortex are generated in the depolarizing phase of the ca low - threshold spikes . therefore , there is a degree of incompatibility in simultaneously generating thalamic spindles and delta rhythms ; this may explain the distinct prevalences of these two types of oscillations during the different stages of nrem [ stages 2 and 34 ( n3 ) respectively ] with synchronization of the electroencephalogram ( nuez et al . in fact , the thalamus and the cerebral cortex are close structures and abundantly interconnected , and they form a non - divisible unit in brain functions . during nrem sleep oscillating cortical activities can be transferred to specific thalamic structures via cortical efferents from layer vi and v pyramidal neurons ; in turn , thalamic oscillating activities can reach cortical neurons principally through m - type , but also c - type , thalamocortical neurons , since the former innervate extensive zones of layer i of the cerebral cortex and can convey oscillatory information activity to the distal apical tufts of pyramidal neurons from layers ii , iii , and v , neurons which are source for corticocortical and subcortical connections . the different oscillatory activities and spike - bursting mode in thalamic and cortical neurons that we have just described are completely absent in wakefulness and/or rem where the associated eeg is desynchronized . during the later states , thalamic and cortical neurons are depolarized and show a tonic firing discharge pattern ( llins and steriade , 2006 ) . the level of the membrane potential of thalamic neurons is mainly controlled by cholinergic input and , in wakefulness by additional glutamatergic and aminergic inputs , from the mesopontine cholinergic , glutamatergic , and aminergic cell groups . stimulation of cholinergic mesopontine nuclei produces an opposite effect in thalamic cells to the effects of corticothalamic volleys , readily suppressing their slow oscillatory bursts due to the generation of excitatory depolarizing discharges that produce a tonic firing pattern of activity in thalamic neurons ( steriade et al . , 1991 ) . the firing rate of the cholinergic laterodorsal and pedunculopontine mesopontine nuclei neurons is increased during wakefulness and rem sleep in comparison with firing rate during nrem sleep ( steriade et al . , 1982 ) ; therefore , when the activity of the cholinergic mesopontine , hypothalamic and basal forebrain , and glutamatergic and aminergic mesopontine structures decreases during nrem , the membrane potential of thalamic and cortical cells is hyperpolarized . this allows the generation of oscillatory patterns in the thalamic and cortical neurons , leading to expression of the specific eeg events of the nrem stages ( steriade and mccarley , 1990 ) . finally , intracellular recording experiments of cortical and thalamic neurons during synchronized eeg states detected that delta membrane oscillations were accompanied by a slower < 1 hz membrane rhythm ( dossi et al . this oscillation consists of a depolarized ( up ) state in which neurons fire followed by a hyperpolarized ( down ) state with neuronal silence . there is a close temporal relationship between the > 1 hz cellular oscillation and the 1- to 4-hz delta eeg waves since the negative component of the eeg signal corresponds to the down state of the cortical neurons ( contreras and steriade , 1995 ) . the cortical origin of these slow < 1 hz rhythm waves was demonstrated by the presence of the oscillation in the cerebral cortex after thalamectomy ( steriade et al . , 1993 ) and its absence in the thalamus of decorticated animals ( timofeev and steriade , 1996 ) . the cortical slow < 1 hz activity is expressed synchronously in wide areas of the cerebral cortex ; disconnection of intracortical synaptic linkages does not abolish the < 1 hz activity , but it does determine the loss of its synchronization between the different cortical areas ( amzica and steriade , 1995 ) . these findings indicate a possible role for < 1 hz cortical activity in synchronous excitation of wide brain territories ( cortical and thalamic ) during nrem , which would allow the simultaneous expression of the same eeg activities in all territories ( nez - molina and amzica , 2004 ) . interestingly , the generation of k complexes during stage 2 of nrem sleep seems to be related with the < 1 hz rhythm of the cortical pyramidal cells as the k complexes can be generated by stimulation of a cortical area other than the one in which they are recorded . also , k complexes can be evoked by sensory stimuli arriving at the cerebral cortex ( nez - molina and amzica , 2004 ) . k complexes , during nrem stage 2 , are usually followed by a sleep spindle ; in these circumstances , it is possible that the < 1 hz cortical activity would be sufficient to induce thalamic reticular nucleus neuron oscillation at the sleep spindle frequencies , since , as we have indicated above , stimulation of corticothalamic afferents to the reticular nucleus is one the most efficient stimuli in evoking rhythmic activity in reticular thalamic cells at sleep spindle frequencies . beside thalamus and cerebral cortex , the preoptic region and the anterior hypothalamus are other prosencephalic regions involved in nrem mechanisms ( figure 2 ) . as we have mentioned before , von economo ( 1930 ) was the first to suggest that the anterior hypothalamus was a sleep - promoting structure ( reinoso - surez et al . , 2011 ) ; later on in the sixties , the importance of this region in the mechanisms for nrem generation was confirmed after behavioral sleep associated with synchronized eeg was obtained with electrical stimulation of the preoptic region and of the basal forebrain ( sterman and clemente , 1962 ) and by the insomnia that followed electrolytic or diathermocoagulation lesions in these areas ( madoz and reinoso - surez , 1968 ; mcginty and sterman , 1968 ) . also , selective neurotoxic lesions of the preoptic neurons induce insomnia ( szymusiak and mcginty , 1986 ) thus indicating that the loss of local neurons rather than of fibers of passage is critical for sleep control . single unit recordings have shown that the preoptic region as well as the basal forebrain there hold neurons whose discharge rate is higher during nrem than in w ; in addition , many preoptic- and diagonal band - sleep active neurons are also heat - sensitive ( alam et al . , 1995 ) . the same local thermal stimuli that activate preoptic heat - sensitive neurons produce a sleep propensity and nrem with delta swa ( see szymusiak et al . , 2007 for a review of the close interactions between sleep regulation and thermoregulation together with the numerous factors that modulate the activity of the sleep - sensitive neurons in the anterior hypothalamus ) . clusters of neurons exhibiting sleep - related c - fos protein immunostaining were found in the ventral lateral preoptic area and in the median preoptic nucleus ( sherin et al . , 1996 ) . neuronal density with increased activity during nrem episodes is higher in these regions than in other anterior hypothalamic sites ( szymusiak et al . , neurons of the ventral lateral preoptic area contain the inhibitory neuromodulator galanin and the inhibitory neurotransmitter gaba ( sherin et al . , 1998 ) ; gaba is also found in most cells in the median preoptic nucleus ( gong et al . , 2004 ) . anatomical tracer studies have shown that the ventral lateral preoptic area and the median preoptic nucleus project to arousal - related regions in the posterior hypothalamus and midbrain including the histaminergic tuberomammillary nucleus ( sherin et al . , 1998 ) , the hypocretinergic / orexinergic perifornical hypothalamic area ( uschakov et al . , 2006 ; yoshida et al . , 2006 ) , the serotonergic dorsal raphe , and the noradrenergic locus coeruleus ( steininger et al . , 2001 ) . all of these findings indicate that the preoptic area may promote sleep onset and maintenance by producing an inhibitory modulation of multiple arousal systems ( szymusiak et al . , 2007 ) . in fact , gaba - mediated inhibitory actions in histaminergic tuberomammillary neurons were demonstrated after electrical stimulation of the ventral lateral preoptic area ( yang and hatton , 1997 ) . also , local warming of the preoptic region ( a stimulus that as we have mentioned before activates preoptic warmth - sensitive neurons and generates nrem ) causes suppression of waking related firing in both dorsal presumedly serotonergic raphe nucleus neurons ( guzmn - marn et al . , 2000 ) and in hypothalamic perifornical neurons ( krilowicz et al . , 1994 ) . recently , it has been demonstrated that sleep - regulatory molecules like interleukin-1 , tumor necrosis factor , and growth hormone - releasing hormone , stimulate nrem sleep by acting on neurons in the preoptic region . in addition , nrem sleep - promoting actions also take place through interleukin-1 and tumor necrosis factor inhibitory actions on locus coeruleus neurons and by interleukin-1 action on serotonergic raphe cells . what is more , the facilitation of nrem sleep can occur when the lateral hypothalamic perifornical area is subject to a endogenous adenosinergic inhibition that restrains the wakefulness - generating hypocretinergic / orexinergic neurons ( krueger et al . anatomical studies have demonstrated that most of the posterior hypothalamic- and monoaminergic- arousal systems send feedback projections to the ventral lateral preoptic area ( chou et al . , 2002 ; reinoso - surez et al . , 2011 ) . in vitro experiments have indicated that the wake - promoting neurotransmitters serotonin , noradrenalin , and acetylcholine inhibit identified preoptic gaba neurons ( gallopin et al . , 2000 ) ; therefore , mutually inhibitory interactions between the sleep - promoting preoptic region and the arousal - related hypothalamic and midbrain structures may provide a substrate for a sleep wakefulness switch thus , activation of preoptic sleep - promoting cells could lead to sleep onset by inhibiting arousal structures ; in turn , activation of arousal hypothalamic and midbrain structures could suppress activity by preoptic nrem sleep - promoting cells as well as rem - promoting neurons ( reinoso - surez et al . , 2010 ) and facilitate the switch to wakefulness . finally , the involvement of the preoptic region in homeostatic sleep regulation has been reported in recent experiments examining the patterns of c - fos immunoreactivity in preoptic neurons following acute total sleep deprivation or selective rem sleep restriction ( gvilia et al . these studies indicate that the gabaergic ventral lateral preoptic neurons are more strongly activated in response to increasing sleep amounts during sleep rebound , whereas gabaergic cells of the median preoptic nucleus are more strongly activated in response to sleep pressure during sleep deprivation . thus , within the prosencephalon , the preoptic region seems to be deeply involved in homeostatic nrem and rem sleep mechanisms . prosencephalic mechanisms underlying sleep homeostasis have been indicated by the capacity of the isolated forebrain to present nrem sleep rebound after pharmacological deprivation ( corpas and de andrs , 1991 ) and the absence of rem rebound in rem sleep - deprived decerebrate animals ( de andrs and corpas , 1991 ; de andrs et al . as we have mentioned in the introduction , early work with brainstem transections or lesions below the oral pontine tegmentum indicated that sleep - generating structures were located in the lower brainstem . nrem with eeg synchronization could be obtained in behaving cats by low - frequency electrical stimulation of the medullary reticular formation at the level of the solitary tract nucleus ( magnes et al . , 1961 ) , but lesion and stimulation studies in the peripheral nerves , spinal cord , caudal pontine tegmentum , and deep cerebellar nuclei can also induce hypnogenic synchronizing impulses ( figure 2 ) . the solitary tract nucleus region in the dorsal medulla is thought to provide a link between visceral activities such as respiratory , cardiovascular and gastrointestinal functions , and the sleep wakefulness states . biochemically , the solitary tract nucleus is a rather heterogeneous region where most viscerosensory afferent fibers from the viith , ixth , and xth cranial nerves terminate ; therefore , this region has important roles in the central regulation of visceral functions , but it also influences sleep not only does electrical stimulation of the solitary tract nucleus result in behavioral sleep with slow - eeg waves , these responses have also been obtained after the local administration of a variety of substances including serotonin ( laguzzi et al . , 1984 ) , morphine and other opiates agonists of mu or delta opioid receptors ( reinoso - barbero and de andrs , 1995 ; figure 6 ) , and glutamate ( golanov and reis , 2001 ) . these latter findings indicate that it is the activation of intrinsic solitary tract nucleus neurons and not of passing fibers that is responsible for the sleep and eeg responses . unit activity studies have shown that there is a population of neurons in the solitary tract nucleus with an increased firing rate during nrem sleep ( eguchi and satoh , 1980 ) . the solitary tract nucleus does not directly project to the cerebral cortex ( saper , 1995 ) , although it does project to several brainstem , thalamic , and hypothalamic areas that innervate the cortex and can mediate eeg and sleep responses . these areas include : locus coeruleus , raphe and parabrachial nuclei , lateral hypothalamus , and nuclei of the midline thalamus . top : microphotographs illustrating the location of the saline and opioid microinjections in two cats injected in the medial nucleus ( arrow ) of the solitary tract ( sol ) . wakefulness states during the first hour of recordings in controls ( saline , 40 nl ) and after morphiceptin ( mu opioid agonist ) or dpdpe ( delta opioid agonist ) microinjections ( 2.4 nmol , 40 nl ) . respiratory rate ( triangles ) in breaths per minute and heart rate ( circles ) in beats per minute are also shown for each sleep wakefulness state during the first hour of recordings . note the decreased respiratory and heart rates in sleep states in comparison with values during wakefulness in the control saline experiments ; both opioid treatments produced a further decrease in both autonomic variables . w , wakefulness ; d , drowsiness ; nrem , non - rem sleep ; rem , rem sleep . results from our group s early work with lesions showed the existence of ascending eeg synchronizing influences arising from the rostral and intermediate parts of the nucleus reticularis pontis caudalis . lesions in these areas decreased swa in the cerebral cortex and the bioelectrical and behavioral signals of nrem and rem sleep ( figure 7 ; camacho - evangelista and reinoso - surez , 1964 ; zarranz and reinoso - surez , 1971 ; reinoso - surez and de andrs , 1976 ) . more recent experiments microinjecting small amounts of a carbachol solution in rostral and intermediate parts of the nucleus reticularis pontis caudalis produced a synchronized eeg pattern associated with some rem sleep signs such as isolated and/or clustered pgo waves ; the most rostral microinjections were also associated with muscular atonia ( garzn , 1996 ; reinoso - surez et al . power spectra analyses indicated that the synchronized eeg pattern obtained in these experiments did not consist of delta waves , instead , the high - voltage swa activity was produced by enhancement of theta and alpha band frequencies ( garzn , 1996 ) . therefore , this cortical electrical pattern does not correspond to fully developed nrem sleep ; instead , these electrical features are more similar to those expressed in the eeg during the transitional period between nrem and rem sleep ( gottesmann , 1996 ) . recently we have reported ( moreno - balandrn et al . , 2008 ) that low - doses and small carbachol microinjections delivered in the dorsal part of the oral pontine tegmentum in cats , at the level of the perilocus coeruleus alpha , produce a similar synchronized eeg without delta wave enhancement . these results indicate that not only is the pontine tegmentum the neural substrate for rem sleep and desynchronized eeg mechanisms , but that its caudal region especially the rostral and intermediate areas of the nucleus reticularis pontis caudalis ; together with the dorsal part of the oral region seems to be involved in generating the pattern of bioelectrical activity that announces rem onset from nrem sleep . activating and synchronizing eeg centers in the pontine tegmentum . ( a , c e ) show diagrams of the combined extent of lesions in the pontine tegmentum of cats producing either eeg activation ( diagonal dashed lines encircled by heavy dashed lines ) or eeg synchronization ( horizontal lines encircled by heavy solid lines ) . ( a ) parasagittal section 2 mm from the midline ; circled numbers indicate frontal plane levels on the reinoso - surez ( 1961 ) atlas corresponding to sections ( c e ) , respectively . ( b ) graph showing the percent of increase in activation ( dashed line ) and decrease in activation ( solid line ) relative to the pre - lesion control - based zero for each animal . note that lesions that produced eeg synchronization are located at the level of the oral pontine reticular nucleus and those that produced eeg activation are located caudal , dorsal , and lateral to this nucleus . bc , brachium conjunctivum ; bp , brachium pontis ; cp , colliculus inferior ; fp , fasciculus longitudinalis medialis ; lm , lemniscus medialis ; mv , tractus mesencephalicus nervi trigemini ; nll , nucleus lemnisci lateralis ; np , nuclei pontis ; nr , nucleus ruber ; nrv , nucleus reticularis ventralis ; ntr , nucleus corporis trapezoidei ; os , oliva superior ; p , tractus pyramidalis ; rpc , nucleus reticularis pontis caudalis ; rpo , nucleus reticularis pontis oralis ; scv , tractus spinocerebellaris anterior ; td , nucleus tegmenti dorsalis ; tr , corpus trapezoideum ; tf , tractus tectospinalis . from camacho - evangelista and reinoso - surez ( 1964 ) . the major role of the cerebellum in motor functions has undervalued its possible involvement in sleep regulation . cerebellar participation in sleep can be related to motor activities during sleep but also to intrinsic sleep mechanisms . the former activities involve postural adjustment and control of muscle tone and movements during sleep that , as in wakefulness , must be controlled by the cerebellum ; in fact , early experimental studies showed the existence of cerebellar components in muscle atonia and phasic activities of the eyes lateral rectus muscle during rem ( jouvet , 1962 ; guglielmino and strata , 1971 ; gadea - ciria and fuentes , 1976 ; cunchillos and de andrs , 1982 ) . together with these actions , the cerebellum has important influences on intrinsic sleep mechanisms as was first indicated by the changes observed in cortical and thalamic electrical activity that follow electrical stimulation and lesion of different cerebellar structures . moruzzi ( 1958 ) reported that diffuse eeg effects could be obtained through the efferent of the nucleus dentatus , this effect was also obtained with low - frequency electrical stimulation of the nucleus fatigius , while high frequency stimulation of this nucleus produced diffuse eeg activation ( fadiga et al . , 1968 ) . specific superficial thalamocortical responses ( surface negative - deep positive potentials ) in the frontal and parietal cortices were also produced by stimulation of the cerebellar nuclei ( sasaki et al . , 1976 ) . suppression of the impulses from the deep cerebellar nuclei through lesion of the brachium conjunctivum tract produce , together with a bilateral activation of the eeg , the appearance of synchronized bursts of intermediate- to high - voltage eeg activity in the theta band ( 713 hz , bigger of 250 mv ) that can be recorded in frontal and parietal cortical areas that are targets of the projections from the thalamic nuclei that receive cerebellar afferents ( camacho - evangelista and reinoso - surez , 1965 ; reinoso - surez , 1992 , 1993 ) . the bioelectrical features of these synchronized bursts are similar to the relaxation rhythms described in cats during periods of relaxed wakefulness or drowsiness ( ursin and sterman , 1981 ) . a similar eeg synchronization , most conspicuously recorded in the ipsilateral frontal and parietal cortices , appears especially after the lesion of the brachium conjunctivum tract at the level of the red nucleus ( reinoso - surez , 1954 ) . this intermediate- to high - voltage swa in the theta band can also be recorded in the thalamic paralaminar nuclei that receive afferents from the cerebellum ; it looks as if suppression of the cerebellar afferents releases these nuclei and allows them to fire at a possible intrinsic theta frequency , modulated by thalamic and other extrathalamic connections that , projecting to layer i , impose their bioelectrical activity on the frontal and parietal cortices ( figure 5 ; reinoso - surez , 1992 , 1993 ; reinoso - surez et al . , the two bioelectric phenomena after the lesion on the superior cerebellar peduncle ( increased eeg activation and synchronized bursts of eeg activity in the theta band ) are coherent with the swc modifications after lesion of the superior cerebellar peduncle that significantly increase wakefulness and drowsiness while decreasing rem and nrem sleep ( de andrs and reinoso - surez , 1979 ) . the sleep suppression was a consequence of the decrease in both the duration and the number of the nrem episodes ( figure 8) . all these studies point to an important participation by the cerebellum in swc mechanisms through a functional antagonism in the regulation of the proportions of sleep and wakefulness between cerebellar cortex and deep cerebellar nuclei ; that is , like the changes occurring after the brachium conjunctivum tract lesions , increased wakefulness , and decreased nrem and rem sleep were reported after bilateral lesions of the fastigial nuclei ( giannazzo et al . , 1968 ) . however , these effects were just the opposite after lesions in the middle cerebellar peduncle ( raffaele et al . , 1971 ) or in the cortex of vermis and cerebellar hemispheres that produced increased nrem and rem sleep ( de andrs and reinoso - surez , 1979 ; garca - ura et al . , 1980 ) . however and surprisingly , in spite of the severe neurological deficits produced by cerebellectomy , the quantitative alterations in the proportions of swc states in cerebellectomized animals are smaller than those produced by localized subcortical or cortical cerebellar lesions . in our experiments ( cunchillos and de andrs , 1982 ) with cerebellectomized cats , the main change after cerebellectomy was an increase in drowsiness that persisted during the entire survival time ( 5 weeks ) and that was associated with small decreases in both w and nrem sleep as well as an increase in rem sleep . these results confirm cerebellar involvement in mechanisms of synchronized eeg and support the hypothesis that the cerebellum , through dual opposite cortical and subcortical effects , would have an important regulatory action in the fine adjustments in the proportions of swc states for maintaining the sleep modifications in the total duration of wakefulness , drowsiness , nrem ( slow sleep ) , and rem ( paradoxical ) sleep , as well as their episode mean duration and number per recording after different cerebellar lesions . the cats with lesions in the brachium conjunctivum showed a significant decrease of nrem ( slow wave ) and rem ( paradoxical ) sleep . in contrast , the cats with lesions in the cerebellar cortex and white matter of the anterior vermis showed a significant decrease of drowsiness and a significant increase in rem sleep . modified from de andrs and reinoso - surez ( 1979 ) . a recent study ( dang - vu et al . , 2008 ) with functional magnetic resonance imaging has reported that the slow oscillation < 1 hz rhythm of nrem sleep is associated with significantly increased local activity in specific cerebral regions : the parahippocampal gyrus and cerebellum ( in both cerebellar hemispheres and vermis ) . on the basis of parallel changes that occur in forebrain and cerebellum during nrem sleep , andre and arrighi ( 2003 ) have proposed that forebrain and cerebellum may cooperate strongly in information processing during sleep . as yet no further studies have examined cerebellar participation at the cellular level in the generation of the slow < 1 hz nrem sleep rhythm , but the dang - vu et al . ( 2008 ) findings may be indicative of parallel operating capabilities in the cerebellum and hippocampal formation during nrem sleep . the growing data on hippocampal activation during nrem sleep after memory task training ( peigneux et al . , 2004 ; ji and wilson , 2007 ; rasch et al . , 2007 ) and recent compelling evidence that slow < 1 hz oscillations have a causal role in consolidating memories during nrem sleep ( marshall et al . , 2006 ) the current dominant theory in sleep research considers that the connections between structures putatively responsible for each of the three phases of the swc ( wakefulness , rem , and nrem sleep ) would provide the anatomical basis for the central organization of reciprocal interactions among these structures and result in the alternation of the different phases of the swc under the circadian control of the suprachiasmatic nucleus ( reinoso - surez et al . , 2001 ) . in addition , we would note that , in humans and other mammals , sleep is not only regulated by the circadian clock , but also by sleep homeostasis . humans are awake in the morning because sleep pressure is low after a night of rest ( mignot and huguenard , 2009 ) . throughout the day increased wakefulness - promoting signals , partly driven by the circadian clock , counter the growing sleep debt or sleep pressure , keeping the subject awake . sleep would be necessary to normalize the synapses to a basal condition that is sustainable and ensures cellular homeostasis ( cirelli and tononi , 2008 ) . nrem sleep homeostasis depends not only on the duration of prior wakefulness but also on intensity , and sleep intensity increases when wakefulness is associated with learning ( cirelli , 2009 ) . the metabolic factors that initiate sleep are molecules produced by neuronal activity during wakefulness and they increase proportionally with the duration and intensity of arousal . the accumulation of metabolites up to a critical level would be involved in the initiation of sleep specifically promoting nrem sleep . during the course of sleep metabolite levels would be reduced from the critical concentration to basal levels ( datta and maclean , 2007 ) . many molecules have been implicated in the processes of sleep regulation , but only a few meet the criteria for being considered nrem sleep - regulatory substances . among these substances are : adenosine , nitric oxide , prostaglandin d2 , interleukin-1 , tumor necrosis factor , and growth hormone - releasing hormone ( krueger et al . , 2008 ) . these molecules are involved in regulating the intensity and duration of nrem sleep and they act in biochemical cascades . neuronal activity during wakefulness increases the synthesis of nrem sleep regulating molecules ; this increase , as occurs with the effects of adenosine on the a1-receptor , leads to the inhibition of neuronal activity , thereby increasing sleep pressure , and finally nrem begins ( vassalli and dijk , 2009 ) . although nrem - promoting substances act on basal forebrain and hypothalamic nrem sleep regulating circuits ( gvilia et al . , 2006a , b ) , they can also act locally on the cerebral cortex and thalamus to change the electrical properties of thalamic and cortical neurons thus altering their input output relationships ( krueger et al . , these observations help explain the capacity of the isolated forebrain to exhibit nrem sleep rebound ( corpas and de andrs , 1991 ) . currently , nrem and rem sleep are considered behavioral states involving the whole organism and governed by central control mechanisms . although accepting this point of view , there is increasing evidence that nrem sleep ( and thus sleep ) might be a fundamental property of local neuronal networks since it can be initiated at small brain assemblies in response to their use , and only later on be consolidated by general central mechanisms ( krueger et al . , 2008 ; rector et al . , 2009 ) . one of the smallest sleep units could be the individual cortical columns in which sensory stimulation produces fluctuating high and low amplitude evoked responses depending on the behavioral state . in sleeping animals , the sleep - like response in cortical columns is characterized by evoked response potentials with a greater amplitude that the evoked responses during wakefulness ( rector et al . , 2005 ) . however , the sleep-/wake - like response also seems to be an intrinsic property of the individual cortical columns since , independently of the behavioral state of the whole - animal , the probability of finding a column in a sleep - like state depends on the length of time that column has previously spent in the wake - like state ( rector et al . , 2005 ) , suggesting that in different cortical regions cortical columns can be sleeping while others are awake during both whole - animal wakefulness and sleep . thus , these findings suggest that nrem sleep may be regulated at local neuronal assembly levels and this regulation appears to be a fundamental property of the neural networks and it depends on prior activity in each network ( krueger et al . , 2008 ) . the nrem sleep of each local cortical column can be initiated by metabolically driven changes derived from the manufacture of molecules of sleep - regulatory substances produced by neuronal activity during wakefulness - like activity . the process may involve increased electrical activity , blood flow , extracellular levels of atp and extra - and intracellular levels of adenosine , all of which would decrease the intracellular atp level , and this would drive individual columns to enter a sleep - like activity state . once a final sleep state was reached this process would be reversed : reduced electrical activity , blood flow , extracellular levels of atp and extra - and intracellular levels of adenosine would raise the intracellular atp level in individual local cortical columns , and thus , the cortical column would be prepared for wakefulness . the sleep or wakefulness states of individual cortical columns could be synchronized through humoral and electrical connections and therefore the sleep or wakefulness of the whole organism would occur as an emergent property of the interaction of individual networks ( krueger et al . , 2008 ) . nowadays there is an emerging understanding of the role of astrocytes as potential mediators of the known effect of adenosine in sleep regulation and this mediation would involve both neuroenergetic and synaptic plasticity roles ( jones , 2009 ) . the power of delta swa in the eeg is considered to be an indicator of nrem sleep intensity , and delta swa is homeostatically regulated since its power increases after wakefulness and returns to baseline during sleep . indeed , experiments have shown that the power of swa reflects the duration of prior wakefulness regardless of the circadian time . delta swa seems to reflect a form of restorative process for cortical local circuits : swa delta power is increased in cortical areas that have been most active during the day . also , imaging techniques have shown that there is a localized decrease in metabolic activity at night in areas that have been activated during the day ( mignot and huguenard , 2009 ) . 2004 ) have indicated that sleep homeostasis has a local component , one that can be triggered in specific human brain regions by a learning task ; these authors also showed that the local increase in swa after learning correlates with improved performance of the task after sleep . thus , sleep homeostasis can be induced on a local level and can improve performance . as we have indicated above delta eeg waves are synchronized in the different cortical areas in correlation with the neuronal events that express cyclic potential membrane fluctuations ( < 1 hz ) between hyperpolarized ( down ) and depolarized ( up ) periods in which neurons are respectively silent or active ( dossi et al . , 1992 ; contreras and steriade , 1995 ) . 2009 ) have shown that during nrem , barrel cortex multiunit activity expresses cyclic ( < 1 hz ) changes with silent periods ( off ) alternating with others ( on ) in which there is a sustained firing activity ; these on / off cortical multiunit activities closely resemble the neuronal membrane potential events of up / down states . ( 2009 ) also showed that the multiunit off periods in barrel cortical neurons are temporally correlated with the negative component of the eeg delta waves as are the down states that occur at cellular level ( contreras and steriade , 1995 ) . during the first nrem sleep after an uninterrupted waking period , neuronal barrel cortex population on periods are short and frequent , while neuronal silence periods ( down states ) are long and frequent . down states ( accompanied by an overall decrease in neuronal activity ) are a phenomenon that is thought to be associated with energy savings . after a sustained sleep period , which reduces the sleep debt , barrel cortex off periods decrease and the duration of the on periods increases . in addition , the changes in firing patterns in nrem sleep correlate positively with changes in swa intensity ( vyazovskiy et al . , 2009 ) . recent data ( jones et al . , 2008 ) indicate that sleep reduces the number of synaptic connections to a basic level that is augmented during waking experience that is , nrem sleep seems to ensure cell homeostasis ; simultaneously during sleep the expression of molecules involved in synaptic reorganization is increased . based on simple energy demands and since the cerebral cortex thalamus unit is a large part of the human and mammal brain , being awake for longer and longer periods of time seems to be very expensive , hence energy economy by the brain during nrem sleep is one of the prevalent hypotheses to explain nrem sleep pressure ( mignot and huguenard , 2009 ) . however , during nrem sleep neurons must down - fire in synchrony rather than simply stay silent ; for some authors this circumstance supports the need to transfer memory to different cortical areas , as has been demonstrated to occur between the hippocampus and visual cortex . to vyazovskiy et al . ( 2009 ) , wakefulness is associated with learning , and enhancing long - term potentiation strengthens glutamatergic synapses , a process with an unsustainable energy requirement , whereas during sleep only robust connections remain intact , reducing the energy requirements to the levels necessary for maintaining critical learned circuits . this reduction of synapses during sleep increases the signal to noise ratio for the remaining connections , improving performance ( mignot and huguenard , 2009 ; vyazovskiy et al . , 2009 ) . the close reciprocal connections between the thalamus and the cerebral cortex would force nrem sleep homeostatic processes to take place simultaneously in the two structures . the thalamus cerebral cortex is a strictly necessary unit in the expression of the most significant bioelectric and behavioral events of nrem sleep and the thalamus cerebral cortex unit is connected to subcortical nrem sleep - promoting structures and with all the subcortical structures involved in the organization of the other phases of swc ( reinoso - surez et al . , 2011 ) . the former connections would act on the thalamus cerebral cortex unit to facilitate the nrem sleep neurophysiological and homeostatic processes and also through neurophysiological and homeostatic mechanisms , the latter subcortical connections would inhibit the other phases of swc : rem sleep and wakefulness . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

the state of non - rem sleep ( nrem ) , or slow wave sleep , is associated with a synchronized eeg pattern in which sleep spindles and/or k complexes and high - voltage slow wave activity ( swa ) can be recorded over the entire cortical surface . in humans , nrem is subdivided into stages 2 and 34 ( presently named n3 ) depending on the proportions of each of these polygraphic events . nrem is necessary for normal physical and intellectual performance and behavior . an overview of the brain structures involved in nrem generation shows that the thalamus and the cerebral cortex are absolutely necessary for the most significant bioelectric and behavioral events of nrem to be expressed ; other structures like the basal forebrain , anterior hypothalamus , cerebellum , caudal brain stem , spinal cord and peripheral nerves contribute to nrem regulation and modulation . in nrem stage 2 , sustained hyperpolarized membrane potential levels resulting from interaction between thalamic reticular and projection neurons gives rise to spindle oscillations in the membrane potential ; the initiation and termination of individual spindle sequences depends on corticothalamic activities . cortical and thalamic mechanisms are also involved in the generation of eeg delta swa that appears in deep stage 34 ( n3 ) nrem ; the cortex has classically been considered to be the structure that generates this activity , but delta oscillations can also be generated in thalamocortical neurons . nrem is probably necessary to normalize synapses to a sustainable basal condition that can ensure cellular homeostasis . sleep homeostasis depends not only on the duration of prior wakefulness but also on its intensity , and sleep need increases when wakefulness is associated with learning . nrem seems to ensure cell homeostasis by reducing the number of synaptic connections to a basic level ; based on simple energy demands , cerebral energy economizing during nrem sleep is one of the prevalent hypotheses to explain nrem homeostasis .

Introduction Overview of the Brain Structures Involved in NREM Generation The Thalamus and the Cerebral Cortex Basal Forebrain Anterior Hypothalamic Structures Brainstem and Cerebellar Structures NREM Sleep Homeostasis Conflict of Interest Statement

the cytochrome p450 ( cyp ) enzymes are active in the metabolism of xenobiotics , as well as of endogenous compounds . in the human genome , 57 genes coding for active cyp enzymes and 58 pseudogenes have been identified . the cyp enzymes can be divided into two major classes : those that are active in the metabolism of exogenous chemicals , preferentially members of families 1 - 3 , and those that are mainly active in the metabolism of endogenous compounds , in particular steroids , fatty acids , cholesterol and cholesterol derivatives . many of the active genes are highly polymorphic , as summarised on the human cytochrome p450 allele nomenclature ( cyp - allele ) website http://www.cypalleles.ki.se/ , and several hundred different variants have been identified . the most polymorphic gene among cyps important for the metabolism of exogenous compounds is the cyp2d6 gene , for which about 80 different allelic variants have been described . other genes that are highly polymorphic in this gene family are cyp2c9 and cyp2c19 , while other genes with important functional polymorphisms are cyp1a2 , cyp1b1 , cyp2a6 , cyp2a13 , cyp2b6 , cyp2c8 , cyp2j2 , cyp2r1 , cyp2w1 , cyp3a4 , cyp3a5 , cyp3a7 , cyp4a22 , cyp4b1 , cyp4f2 , cyp5a1 , cyp8a1 , cyp19a1 , cyp21a2 and cyp26a1 . the highest number of variant alleles among the cytochromes p450 is seen in cyp21a2 , which encodes the steroid 21 hydroxylase , for which 119 rare variants have been identified . in addition to the cyps , nadph cytochrome p450 reductase ( por ) , the electron donor for cyp enzymes , has been shown to have important polymorphic variants http://www.cypalleles.ki.se/por.htm and , recently , the second electron donor , cytochrome b5 , has also been shown to exhibit functional polymorphisms , although functionally variant alleles are rare . in the field of pharmacogenetics , emphasis is put on the functionally important polymorphic cyp variants . this includes about 400 different alleles with non - synonymous mutations or important functional mutations ; 79 , 253 , 34 and 25 variants are present in gene families cyp1 , cyp2 , cyp3 and cyp4 , respectively http://www.cypalleles.ki.se . the majority of the mutations of functional importance cause stop codons , non - synonymous mutations and splice defects . the variant alleles have , to a large extent , been identified based on an altered in vivo phenotype within a specific individual . in addition , targeted sequence screening projects have been carried out to search for non - synonymous mutations that have been expressed in heterologous systems and characterised functionally . the cyp alleles known so far have generally not been identified through large genomic sequencing projects . results from such studies are expected to be published in the near future and to yield a high number of novel polymorphic loci . in the authors ' laboratory , for example , the korean genome has been aligned with the caucasian genome for identification of mutations in the cyp2c locus . it is evident that thousands of mutations are localised in introns and gene - flanking regions which are not present in the current databases ( frank nyln , unpublished observations ) . among the p450 genes , only 15 different alleles with intronic mutations causing functional alterations have been identified so far ( see table 1 ) . the majority are the result of sequencing efforts using genomic dna from individuals shown to have altered cyp activity in vivo . among these mutations , all intronic polymorphism of the cytochrome p450 genes and of nadph cytochrome p450 reductase ( por ) * a in translational start codon atg is denoted + 1 . * * the i2 splice variant is found in several different alleles among the mutations listed in table 1 , several occur in the cyp21a2 gene , are rare and have been found because of loss of gene function causing congenital adrenal hyperplasia ; however , intronic polymorphisms only account for 5 per cent of all functionally important mutations in this gene . intron mutations in the p450 genes encoding drug metabolising enzymes have been found in the cyp1a2 , cyp2d6 , cyp2c19 and cyp3a5 genes . the cyp1a2 * 7 allele , which has a mutation disrupting the splice donor site in intron 6 , has only been identified in one single individual and not been considered in the literature after the initial identification . the same is also true for cyp2c19 * 7 , which contains a single t > a nucleotide transversion in the invariant gt at the 5 ' donor splice site of intron 5 , causing no functional protein to be expressed . by contrast , the intron mutations in the cyp2d6 and cyp3a5 genes are much more important . the cyp2d6 * 4 allele was the first defective cyp2d6 variant allele to be identified ( in 1990 ) , and constitutes the main explanation for the poor metaboliser ( pm ) phenotype among caucasians . many of the other mutations present in this allele are also present in the partially defective cyp2d6 * 10 allele . the cyp2d6 * 10 allele is the most common cyp2d6 variant in many asian populations . it is likely that this intronic mutation was introduced into the cyp2d6 * 10 allele in the past 10,000 to 20,000 years . the cyp2d6 * 41 allele carries a 2988 g > a mutation in intron 6 , creating an alternate splice donor site . the cyp2d6 * 41 allele has a very high sequence homology with cyp2d6 * 2 , but early investigations regarding the functional properties of the cyp2d6 * 2 allele revealed heterogeneous activity . much later on , toscano and collaborators showed the functional properties of the cyp2d6 * 41 allele giving rise to reduced enzyme activity expressed heterologously in cos-1 and huh-7 cells . the extent of the decrease in activity caused by this allele is important , and carriers who are homozygous for cyp2d6 * 41 have a reduced activity similar in magnitude to those who are heterozygous for a defective cyp2d6 allele . in addition to the cyp2d6 * 41 allele , gaedigk et al . identified a similar rare variant , named cyp2d6 * 69 , carrying an additional non - synonymous mutation . the metabolism of clinically important drugs is primarily carried out by the cyp3a4 and cyp3a5 enzymes . the cyp3a4 gene is very well conserved , and no common functionally important variant allele has been identified . based on phenotype differences between individuals , kuehl and collaborators sequenced the cyp3a5 gene and identified the variant allele cyp3a5 * 3 with a 6986a > g mutation creating an alternate splice acceptor site in intron 3 . prior to identifying the real background for the defective cyp3a5 allele , several mutations in the 5'-region were thought to form the genetic basis for the reduced cyp3a5 expression . also the cyp3a5 * 5 allele with a 12952 t > c mutation that results in a disruption of the splice donor site in intron 5 was found in the chinese . interestingly , the cyp3a5 * 3 and cyp3a5 * 5 alleles are much less common in african populations , causing an overall higher capability for cyp3a - dependent hydroxylase activities . since cyp3a5 is also expressed in the foetal liver , this polymorphism additionally creates a higher detoxifying potential in foetuses of african origin . in conclusion , the intronic polymorphisms in the cyp genes account for only a small number of the important variant alleles . their discoveries have been based on phenotypic alterations within individuals in a population , and their identification has , in several cases , been difficult and taken a long time . as a result of the next - generation sequencing projects , it is anticipated that new , important information regarding the intron sequence variability among the cyp genes will be discovered , and that further alleles will be identified that can explain the hitherto unidentified genetic basis of inter - individual differences in cyp - mediated drug and steroid metabolism . the cyp2d6 * 4 allele was the first defective cyp2d6 variant allele to be identified ( in 1990 ) , and constitutes the main explanation for the poor metaboliser ( pm ) phenotype among caucasians . many of the other mutations present in this allele are also present in the partially defective cyp2d6 * 10 allele . the cyp2d6 * 10 allele is the most common cyp2d6 variant in many asian populations . it is likely that this intronic mutation was introduced into the cyp2d6 * 10 allele in the past 10,000 to 20,000 years . the cyp2d6 * 41 allele carries a 2988 g > a mutation in intron 6 , creating an alternate splice donor site . the cyp2d6 * 41 allele has a very high sequence homology with cyp2d6 * 2 , but early investigations regarding the functional properties of the cyp2d6 * 2 allele revealed heterogeneous activity . much later on , toscano and collaborators showed the functional properties of the cyp2d6 * 41 allele giving rise to reduced enzyme activity expressed heterologously in cos-1 and huh-7 cells . the extent of the decrease in activity caused by this allele is important , and carriers who are homozygous for cyp2d6 * 41 have a reduced activity similar in magnitude to those who are heterozygous for a defective cyp2d6 allele . in addition to the cyp2d6 * 41 allele , gaedigk et al . identified a similar rare variant , named cyp2d6 * 69 , carrying an additional non - synonymous mutation . the metabolism of clinically important drugs is primarily carried out by the cyp3a4 and cyp3a5 enzymes . the cyp3a4 gene is very well conserved , and no common functionally important variant allele has been identified . based on phenotype differences between individuals , kuehl and collaborators sequenced the cyp3a5 gene and identified the variant allele cyp3a5 * 3 with a 6986a > g mutation creating an alternate splice acceptor site in intron 3 . prior to identifying the real background for the defective cyp3a5 allele , several mutations in the 5'-region were thought to form the genetic basis for the reduced cyp3a5 expression . also the cyp3a5 * 5 allele with a 12952 t > c mutation that results in a disruption of the splice donor site in intron 5 was found in the chinese . interestingly , the cyp3a5 * 3 and cyp3a5 * 5 alleles are much less common in african populations , causing an overall higher capability for cyp3a - dependent hydroxylase activities . since cyp3a5 is also expressed in the foetal liver , this polymorphism additionally creates a higher detoxifying potential in foetuses of african origin . in conclusion , the intronic polymorphisms in the cyp genes account for only a small number of the important variant alleles . their discoveries have been based on phenotypic alterations within individuals in a population , and their identification has , in several cases , been difficult and taken a long time . as a result of the next - generation sequencing projects , it is anticipated that new , important information regarding the intron sequence variability among the cyp genes will be discovered , and that further alleles will be identified that can explain the hitherto unidentified genetic basis of inter - individual differences in cyp - mediated drug and steroid metabolism . the research in the author laboratory is supported by grants from the swedish research council , the swedish cancer fund and by vinnova .

the cytochrome p450 enzymes active in drug metabolism are highly polymorphic . most allelic variants have been described for enzymes encoded by the cytochrome p450 family 2 ( cyp2 ) gene family , which has 252 different alleles . the intronic polymorphisms in the cytochrome p450 genes account for only a small number of the important variant alleles ; however , the most important ones are cyp2d6 * 4 and cyp2d6 * 41 , which cause abolished and reduced cyp2d6 activity , respectively , and cyp3a5 * 3 and cyp3a5 * 5 , common in caucasian populations , which cause almost null activity . their discoveries have been based on phenotypic alterations within individuals in a population , and their identification has , in several cases , been difficult and taken a long time . in light of the next - generation sequencing projects , it is anticipated that further alleles with intronic mutations will be identified that can explain the hitherto unidentified genetic basis of inter - individual differences in cytochrome p450-mediated drug and steroid metabolism .

Introduction Intronic polymorphisms CYP2D6 CYP3A5 Acknowledgements

chronic lymphocytic leukemia ( cll ) is a cancer of elderly people since the average age of patients is over 60 years , although 10% to 15% of patients are under 50 . the neoplastic lymphocytes , mainly of lineage b , are characterized by the expression of at least one of the pan - b antigens ( most often cd19 ) that is co - expressed with the t - cell marker cd5 , the expression of cd23 , weak expression of cd20 and cd79b , as well as hardly detectable expression levels of surface immunoglobulins with one of the light chains or [ 2 , 3 ] . in clinical practice , two prognostic tools are used , based on rai s or binet s classifications , further extended by a recently suggested modified system . since the course of cll is heterogeneous , these classifications are of limited use and are insufficient to predict the disease outcome at the early stages of the cancer . in the last years , some new parameters have been introduced besides the so - called standard prognostic factors such as rai / binet s classifications , lymphocyte doubling time , atypical morphology , bone marrow infiltration , increase in 2-microglobulin concentration , soluble antigen cd23 ( scd23 ) and increased activity of thymidine kinase and lactic dehydrogenase [ 3 , 4 ] . among these parameters , the most important prognostic value is attached to the mutational status of immunoglobulin genes ( igv h ) , the expression of tyrosine kinase zap-70 and antigen cd38 , as well as cytogenetic aberrations in leukemic cells [ 59 ] . for a few years , somatic mutations of i igv h have been considered as a crucial factor determining the course of cll and the responsiveness to therapy [ 5 , 10 ] . it is widely accepted that neoplastic lymphocytes pass through the germinal centers where they mutate and enter the blood in the state of anergy . owing to these events , the mutated type of cll ( in which b lymphocytes show less than 98% similarity to the igv h genes in the germ line ) is characterized by a milder course , longer survival period and higher efficacy of therapy . on the other hand , a lack of mutations in igv h is related to faster progress of the disease , worse prognosis and chemoresistance [ 5 , 10 , 12 , 13 ] . nevertheless , it has been revealed that mutation of the igv h3 - 21 region does not confirm the correlation with favorable outcome and it is associated with an aggressive type of cll . in the assessment of cll prognosis , different sensitive techniques such as polymerase chain reaction ( pcr ) , fluorescence in situ hybridization ( fish ) and dna microarray are used . genetic aberrations are detected in more than 80% of patients with cll cases and these are mostly deletions of chromosomes 13 ( 13q14 ) , 11 ( 11q22 - 23 ) , 17 ( 17p ) and 7 ( 7q ) , as well as trisomy of chromosome 12 [ 4 , 9 , 15 ] . moreover , a significant prognostic value has been attached to the high expression of tyrosine kinase zap-70 ( zeta - associated protein-70 ) , a mediator of the t - cell receptor signaling pathway , and cd38 glycoprotein on the leukemic lymphocyte surface [ 6 , 7 ] . up - regulated expression of zap-70 and cd38 is related to cll cases with unmutated igv h [ 4 , 16 ] . the multi - factorial analyses ( igv h mutational status , cd38 and zap-70 ) of more than 1,000 patients with cll revealed that zap-70 expression had the strongest prognostic value , especially for the time when the therapy should be applied . in the course of cll , leukemic b - cells meet multiple interferences in the apoptotic signal transduction . in cll cells , the expression of proteins such as regulators of apoptosis , belonging mainly to the bcl-2 family , is different from that observed in normal b - cells . the prognostic significance of the bcl-2 proteins , and the polymorphisms of their genes , in cll patients have been recently reviewed in contemporary oncology . moreover , the expression profiles of small , non - coding rna microrna ( mir ) can be used to distinguish between normal and leukemic b - cells , and in cll prognosis , as well as in the evaluation of disease progression [ 1820 ] . researchers from carlo m. croce s laboratory published results indicating that the expression of 13 out of 190 analyzed mirs can be useful for differentiating aggressive from benign cll . importantly , their expression is in close relation with the mutational status of igv h and the level of zap-70 . mir-15a and mir-16 - 1 have been further characterized , and their genes are located on chromosome 13 ( 13q14.3 ) , which is the most often deleted ( in about 68% of cases ) in patients with cll . it is suggested that the deletion of chromosome 13 leads to the silencing of mir-15a and mir-16 - 1 expression , which causes an increase in the synthesis of anti - apoptotic protein bcl-2 . the alterations in lipid metabolism are observed in a large number of cancers that result from e.g. their increased hydrolysis . researchers attention has been drawn to lipolytic enzymes , whose activity can be a valuable marker in cll prognosis . lipoprotein lipase ( lpl ) is an enzyme belonging to the hydrolase class ( ec 3.1.1.34 ) that participates in lipid metabolism . the human lpl gene , which spans about 30 kbp , was identified on chromosome 8 ( 8p22 ) and contains 10 exons ( fig . 1a ) it has an intron : exon ratio 9 , characteristic for a mammalian gene . this enzyme hydrolyzes triglycerides ( tgs ) present in circulating lipoproteins , such as chylomicrons , very low density and intermediate density lipoproteins ( vldl and idl , respectively ) into free fatty acids ( ffa ) . their release supplies the cells with important energetic substrates [ 29 , 30 ] . to some extent , the aforementioned lipase functions also as phospholipase a1 . a low molecular weight apolipoprotein c - ii ( apo c - ii ) is a main activator of lipoprotein lipase , whereas its activity is inhibited by apolipoprotein c - iii ( apo c - iii ) . the amino - terminal domain ( amino acids from 1 to 310 ) , the carboxy - terminal domain ( amino acids from 311 to 448 ) , as well as the most significant functions of depicted fragments are shown in the picture ( based on [ 28 , 30 , 32 ] ) . lipoprotein lipase is synthesized mainly in the adipocytes and myocytes ( including cardiomyocytes ) , but its relatively high expression is also detected in macrophages , lactating mammary glands , pancreatic islets , several areas of the nervous system , spleen , testicles , ovaries , kidneys , lungs , liver and adrenal glands [ 28 , 29 , 3235 ] . after biosynthesis , the enzyme is secreted into the blood vessels where it anchors by binding to heparan sulfate residues , a component of the endothelial proteoglycans . in the presence of heparin , lpl can be released to the blood , where it exists mainly as inactive monomers metabolized by the liver [ 26 , 29 ] . the n - glycosylated homodimer is an active form of enzyme in which the subunits ( 55 kda each ) interact non - covalently . also the glycosylation of asparagine residues , asn and asn , takes place in the er , and the modification of asn is both necessary and sufficient for the activation and release of lpl from this cellular compartment . the process of folding an appropriate lpl conformation requires the participation of chaperone proteins ( calnexin and calreticulin ) , as well as ca ions , and begins from its n - terminal domain [ 32 , 33 ] . apart from the catalytic activity , the described enzyme contributes to lipoprotein uptake by the cell that is possible thanks to its participation in the interaction with the ldl receptor - like protein ( lrp ) or the proteoglycans of target cells . ldl receptor - like protein molecules can bind to either the active or inactive form of lipoprotein lipase . the binding site of lrp is situated in the c - terminal region of the lpl molecule ( fig . , there is a fragment of 24 amino acids ( from 415 to 438 ) that intermediates the binding between lpl and a lipid substrate , and is responsible for stabilization of the active homodimer . the analyses of gene expression in leukemic cells have revealed that many genes are expressed differentially when compared with the normal ones [ 18 , 21 , 22 , 3638 ] . in the described cases , these changes are in close relationship with the presence or lack of mutations in the igv h genes . in the so - called unmutated type of cll , the overexpression of at least several dozen genes that make leukemic cells similar to myocytes or adipocytes is claimed . lpl encoding lipoprotein lipase plays a pivotal role [ 21 , 36 , 37 ] . since 2005 , numerous studies on the expression of lipoprotein lipase in leukemic cells and the evaluation of this parameter as an independent prognostic marker in cll have been conducted . the patients who underwent the assessments formed a heterogeneous group with respect to the stage of the disease , age , gender , the presence of genetic aberrations and applied therapies . simultaneously , the correlation between the level of lpl and other prognostic factors ( e.g. zap-70 , cd38 ) , including mutations of igv h genes , was evaluated [ 2225 , 3845 ] . lipoprotein lipase as a new prognostic factor in chronic lymphocytic leukemia efs event - free survival , tfs treatment - free survival , os overall survival , ldt lymphocyte doubling time , ldh lactic dehydrogenase additionally , the index lpl / adam29 ( l / a index ) was determined . the lpl expression was evaluated at the mrna and protein levels ( in other studies lpl expression was measured only at the level of mrna ) . apart from mutations in igvh , for which a statistically significant correlation was found in each study ( except for ) . with few exceptions , patients with unmutated type of cll are characterized by significantly higher expression of the lpl gene measured at the mrna level that correlates with more complex course of the disease and worse prognosis . on the other hand , the expression of lpl at a lower level in patients with mutations in igv h genes this correlation was also confirmed at the level of intracellular protein , although this assay had a less significant differentiating value . the complex mechanisms of regulation of lpl gene expression and protein stability may underlie these observations . for that reason , estimation of mrna level seems to be a more informative analysis [ 22 , 44 ] . moreover , lpl expression on the cell surface does not correlate with its mrna level inside the cell . lipoprotein lipase can be not only an independent factor mirroring the stage of the disease , but also a valuable prognostic marker correlating with treatment - free survival ( tfs ) and overall survival ( os ) . a considerable number of published results indicate that high lpl expression is related to shorter tfs and os [ 22 , 24 , 25 , 3840 , 42 , 44 , 45 ] . so far , the application of a specific chemotherapy option has not caused an increase in os so the results obtained in the experiments with treated patients probably did not influence the association between lpl expression and os . furthermore , the expression of lpl mrna does not change significantly during the course of the disease so that the level of lpl relates both to possible cancer progression in low - risk patients and the patients with more advanced disease ( stage b and c according to the binet classification ) [ 23 , 38 ] . moreover , the high expression of lpl in patients with binet s stage a suggests the need for applying treatment and predicts a poor prognosis even in the case of presence of favorable prognostic parameters [ 24 , 25 ] . recently published results have also supported the pivotal role for lpl as a prognostic factor in patients with cancer remission , after application of therapy . it should be emphasized that lpl expression is not a differentiating parameter between patients with mutated type of cll ( with favorable prognosis ) and those who have mutated vh3 - 21 segments ( with poor prognosis ) . in both cases , for that reason , the assessment of zap-70 expression seems to be a better marker . more attention should be paid to the co - analyses of lipoprotein lipase expression and the product of adam29 ( disintegrin and metalloproteinase domain 29-containing protein ) gene expression . this gene is localized on chromosome 4 and codes the described enzyme that participates in the cell - cell interactions and between a cell and the extracellular matrix . it should be noted that adam29 is expressed in cll cells at different levels , with respect to mutational status of igv h , but it is not expressed in normal b lymphocytes . in patients with unmutated cll type , it seems that the lpl / adam29 ( l / a ) ratio is a more sensitive parameter that highly correlates with the mutations of igv h compared with the estimation of these factors separately . it was determined that , in comparison with zap-70 expression , the l / a ratio was the only one that positively correlated with event - free survival . nevertheless , according to nckel et al . , the evaluation of each of these enzymes can be an independent prognostic factor in the course of cll . recently published results have provided , apart from the usefulness ensured by the analysis of lpl expression , some practical advantages . firstly , the analysis can be performed using a quite easy and widely accessible technique , quantitative real - time polymerase chain reaction ( qrt - pcr ) [ 2225 , 3845 ] . secondly , the comparison of lpl expression in cll cells with its level in the peripheral blood mononuclear cells from healthy donors provided the information that lpl expression is highly specific for leukemic cells . in normal blood cells , lpl mrna was absent or very low , and the presence of monocytes that express lpl did not significantly influence the final results . for that reason , the lymphocyte isolation procedure can be omitted without affecting the reliability of the results . this method can be much more simplified because the whole blood lysates can be successfully used to maintain comparative results . taken together , the methodology of lpl identification predominates over the analysis of mutations in the igv h genes or zap-70 expression because the presence of other cells ( t lymphocytes , natural killers ) interferes significantly with the results among others due to high expression of kinase zap-70 in these cells [ 2225 , 3845 ] . the role of lpl in cll cells remains elusive , including the fact that normal b lymphocytes do not possess this enzyme . it seems pivotal to determine whether the expression of this lipolytic enzyme is the effect of the alterations in neoplastic cells or whether it is connected with cll pathogenesis . the results reported by pallasch et al . seem to support the second hypothesis . these researchers suggest that lpl expression in cll cells is a result of bcr ( b - cell receptor ) activation . the stimulation of cll cells in vitro , both with somatic mutations in the igv h genes and without them , resulted in lipoprotein lipase expression . taking into consideration the genesis of both cell types in two cll types , this mechanism could clarify the high lpl expression in the unmutated type of this leukemia . cll lymphocytes are more sensitive to bcr stimulation . treatment with a lipase inhibitor , orlistat ( tetrahydrolipstatin ) , resulted in the apoptotic death of leukemic cells , suggesting that changes in expression of lipases ( including lipoprotein lipase ) underlay this cancer development . interestingly , the cytotoxic effects of orlistat on primary cll cells was enhanced by their simultaneous exposure to fludarabine , a purine analog commonly used in cll treatment . it seems that both drugs used together acted synergistically in apoptosis induction in leukemic cells . accepting this point of view , lpl can be not only an important prognostic marker , but also a therapeutic target . the involvement of lpl in lipid metabolism suggests its role in supplying the neoplastic lymphocytes with high - energy substrates . in this context , it could be decisive for the well - being of leukemic cells , influencing their survival and proliferation . this is supported by studies that confirmed high activity of the fatty acid degradation pathway in cll cells . however , including the significant differences between lpl expression with respect to the mutated or unmutated type of cll , it can be presumed that the nature of these cells should be highly perceived . cll cells without mutations in the igv h genes are characterized by higher sensitivity to activation through surface receptors . for that reason , it is suggested that lpl can contribute to the creation of lipid rafts that participate in b lymphocyte activation . on the other hand , in the cll cells heparin sulfate is synthesized and contributes to stabilization of the described enzyme on the cell surface , and it may be involved in tumor cell migration . the role of the microenvironment of the lymphocytes in chronic lymphocytic leukemia development and progression is undeniable . interactions with appropriate factors and cells are indispensable in evasion of apoptosis by neoplastic b lymphocytes . bridge between other molecules supports its participation in the interaction with dendritic and stromal cells . supporting this , it was noted that surface lpl molecules in patients with unmutated type of cll had lower lipolytic activity although its expression level was higher . it provides a rationale that this enzymatic protein is involved in a process other than lipid metabolism . lipoprotein lipase is a promising candidate to be an important prognostic factor in chronic lymphocytic leukemia . owing to the feasibility of its detection , in the near future lpl is expected to become a substitute for dna sequencing in order to evaluate the presence or lack of mutations in the igv h genes , simultaneously providing the equivalent information . for the time being , lpl seems to be as good a prognostic marker as kinase zap-70 , or , according to some researchers , even better [ 24 , 39 ] . an open issue is to define the cut - off value and the standardization of the method used for the detection of lpl expression . the changes in the expression of genes involved in lipid metabolism are probably related to their participation in the development of chronic lymphocytic leukemia , and undoubtedly contribute to cll cell survival . uncovering the reason for lpl expression in leukemic lymphocytes , whilst lpl is absent in normal cells , would make this knowledge applicable for the new therapeutic options . the novel findings with the lipase inhibitor orlistat provide the rationale for this approach and allow one to speculate that drugs targeting lipid metabolism might be new compounds for the therapy of this leukemia .

the clinical course of patients with chronic lymphocytic leukemia ( cll ) is highly heterogeneous . gene expression analyses have revealed that leukemic cells with unmutated immunoglobulin heavy chain genes ( igv h ) differ from cll cells with mutated igv h in the expression level of some genes , i.e. encoding kinase zap-70 and antigen cd38 . recently , additional markers in cll , including the expression level of apoptosis - regulating genes / proteins ( bcl-2 , mcl-1 ) and micrornas , have been suggested . in this review , we attempt to provide data concerning the properties of lipoprotein lipase ( lpl ) , as well as to present its prognostic value in cll . lpl mrna expression level was able to predict mutational status in a high percentage of cll cases and high lpl expression was associated with shorter treatment - free survival . importantly , since lpl activity is low ( or absent ) in other blood cell types , its expression can be determined by pcr technique in peripheral blood mononuclear cells or in lysed blood samples .

Introduction Lipoprotein lipase Expression of lipoprotein lipase in CLL cells Summary None

the discovery of small noncoding mirnas uncovered an intriguing additional level to the fine - tuning of the transcriptome and proteome . since their discovery almost 20 years ago [ 1 , 2 ] , research has progressed considerably towards gaining a better understanding of the impact of the complex network of gene regulation by mirnas on health and disease . this is well documented in the cancer field , for instance , where mirnas are increasingly acknowledged as potential diagnostic and therapeutic agents [ 3 , 4 ] . like protein - coding genes , mirna genes are transcribed from the genome mainly from rna polymerase ii ( reviewed in ) . to date , more than 1000 mirna genes have been identified in humans and 750 in mice , some of which are specifically expressed in the brain [ 610 ] . in the cytoplasm , the endonuclease dicer cleaves mirna precursors ( approximately 70 nucleotides in length ) to generate mature ( approximately 21 nucleotides in length ) double - stranded rnas . these are loaded as single - stranded rnas into the rna - induced silencing complex ( risc ) , composed of argonaute ( ago ) proteins , to negatively regulate gene expression , albeit some exceptions have been documented [ 11 , 12 ] . this regulation is achieved through binding with imperfect complementarity mainly to the 3 untranslated region ( 3utr ) of target messenger rnas ( mrnas ) , leading to translation inhibition or degradation . both in vitro and in vivo studies have shown that alterations of a single mirna ( or mirna family ) could have profound effects on hundreds of target genes [ 13 , 14 ] , thus possibly implicating multiple biological pathways . abnormal phosphorylation and insoluble deposition of tau are observed in more than 20 neurodegenerative disorders , collectively known as tauopathies ( reviewed in ) . in alzheimer 's disease ( ad ) , the most common tauopathy , hyperphosphorylated tau accumulates in the somatodendritic compartment of neurons , aggregates , and finally forms neurofibrillary tangles ( nfts ) . other tauopathies include frontotemporal lobar degeneration ( ftld ) , pick 's disease , progressive supranuclear palsy ( psp ) , corticobasal degeneration ( cbd ) , and progressive aphasia , all of which are characterized by neuronal and/or glial tau inclusions . although the exact physiological role of tau remains under scrutiny , it is proposed to function to promote microtubule assembly , stabilization , spacing , and parallel - ordered organization , which are necessary for axonal transport and neurite outgrowth ( reviewed in ) . tau binds to several proteins ( reviewed in ) and therefore could participate in various other paradigms , including targeting the src kinase fyn to dendrites . in the central nervous system , tau is expressed as six isoforms , resulting from inclusion or exclusion of alternative exons 2 , 3 , and 10 ( reviewed in ) . mutations in or surrounding tau exon 10 , leading to an imbalance in tau isoforms with 3 or 4 microtubule - binding domains , can cause familial ftld-17 . changes in tau isoforms have also been observed in various other tauopathies , including psp and pick 's disease or myotonic dystrophy ( reviewed in ) ; however , the underlying mechanisms involved in abnormal tau splicing and neurodegeneration remain ill - defined . moreover , whether splicing abnormalities function upstream or concomitantly with tau hyperphosphorylation to promote neurodegeneration remains an open debate . to date , several groups have identified factors involved in the regulation of tau splicing . these include regulatory sequences ( cis - elements ) within or around tau exon 10 as well as specific regulatory proteins ( trans - acting factors ) ( reviewed in ) . similarly , a number of enzymes have been proposed to regulate tau phosphorylation ( reviewed in ) . although these studies have been insightful , they were mostly based on artificial and/or overexpression paradigms , which makes it difficult to extrapolate these observations to endogenous tau . in 2006 , . showed a remarkable enhancement of tau - mediated cell death in drosophila cells upon suppression of mirna maturation . specifically , the authors showed that retinal degeneration caused by the expression of normal or mutant ( r406w ) human tau in vivo was enhanced by loss of r3d1/loquacious , a double - stranded rna binding protein that is required for the activity of dcr-1 ( dicer homologue ) in mirna processing . interestingly , upregulation of bantam suppressed tau - induced degeneration , suggesting that this mirna could mitigate tau - induced neurotoxicity . however , as bantam is not conserved in humans , it is tempting to speculate that other mirnas play a similar role in the mammalian brain . more recently , a neuronal mirna , mir-128 , was shown to modulate the expression of bag2 , a cochaperone potentially involved in tau degradation and aggregation in cultured cos-7 cells and in primary neurons . our recently published data indicate that conditional knockout ( cko ) of dicer ( resulting in a global reduction in mirna production ) in the adult mouse brain results in disease - like hyperphosphorylation of endogenous tau . moreover , the dicer mutant mice display changes in tau exon 10 splicing , as seen in various tauopathies including psp and pick 's disease . in this paper , we highlight salient observations with regard to these studies and highlight outstanding questions related to mirna research in tauopathies . tau is a phosphoprotein that contains more than 80 potential phosphorylation sites ( reviewed in ) . it is generally well accepted that tau phosphorylation is important for microtubule binding , whereas phosphorylation causes tau to detach from microtubules . hyperphosphorylation , defined as increased phosphorylation of physiological sites and additional phosphorylation at pathological sites , characterizes insoluble aggregates of tau . however , in its unphosphorylated form , under thermal stress , tau localizes to the nucleus , where it protects dna from double - stranded dna damage . a phosphorylated pool of tau could also localize to somatodendritic compartment as well as the dendritic spine to modulate neuronal plasticity and glutamatergic transmission . tau phosphorylation is very sensitive to intrinsic and extrinsic changes ( e.g. , heat , cold , stress , and starvation ) [ 2932 ] . thus , any changes in the delicate balance between the tau kinases and phosphatases could have serious biological consequences , and the identification of these regulatory enzymes in vivo is of particular importance . it is noteworthy that some of those central key kinases also regulate indirectly tau splicing through phosphorylation of splicing factors [ 3336 ] . together , deregulation of kinase and/or phosphatase activity could be dually detrimental towards tau splicing and phosphorylation , which synergistically would promote tau aggregation . as general posttranslational regulation of gene expression , mirnas are potential modulators of kinase , phosphatase , and/or splicing factor expression . while studying the effects of dicer loss in the brain , we observed significant changes in endogenous tau phosphorylation and splicing . this was demonstrated at the rna and protein levels using , rt - pcr , 2d electrophoresis and tau phospho - specific antibodies . because of using the cre - loxp system , dicer inactivation was limited to neurons , and in particular postmitotic pyramidal neurons . it is noteworthy that only a few studies have documented changes in endogenous tau phosphorylation in vivo , as most biological models express exogenous and/or mutated human tau . remarkably , several phosphoepitopes related to disease , including serine 422 , were increased in the dicer mutant mice when compared with controls . unfortunately , given the rather quick lethality associated with dicer loss ( approximately 4 weeks ) , we could not determine whether tau hyperphosphorylation concurred before or after neurodegeneration . nevertheless , these results provide a proof of concept that mirna haploinsufficiency causes abnormal tau hyperphosphorylation and missplicing . as stated above , several tau kinases and phosphatases have been identified , some of which are believed to contribute significantly to tau hyperphosphorylation in vivo . in attempt to identify such enzymes in the dicer cko mice , we performed whole - genome microarrays and western blot analyses . these experiments led to the identification of erk1/mapk3 ( and possibly erk2/mapk1 ) as a major regulator of neuronal tau phosphorylation in vivo , at least in this model . in line with this observation , several other enzymes can potentially contribute to tau phosphorylation misregulation in this and other models , and in particular disease conditions in humans . in line with this hypothesis , a number of proposed tau kinases , including gsk3 and jnk / mapk8 , are prone to mirna regulation in various cell types [ 37 , 38 ] . nevertheless , it is interesting to observe that erk phosphorylation is increased in tau - positive neurons in ad and other tauopathies [ 3941 ] . in addition , erk is essential for brain development and involved in neuronal death [ 42 , 43 ] . specific gene knockout mouse models are required to assess the role of these proteins in the regulation of tau phosphorylation and neurodegeneration in vivo . although it is a conceptually crude experimental approach , the dicer cko mice provide a unique and unbiased model to study global mirna function in the brain . to identify mirnas involved in the regulation of erk1 ( and consequently tau phosphorylation ) , we used several prediction programs that are available online , including targetscan ( http://targetscan.org/ ) . this program identified a number of potential mirna - binding sites in the 3utr of erk1 . our functional assays provided the validation that several members of the mir-16 family ( mir-16 , -15 , -195 , -497 ) could directly modulate endogenous erk1 and tau phosphorylation in neuronal cells in vitro , including rat primary neurons . of mention , both endogenous mir-16 and tau are enriched in distal axons of sympathetic neurons . intriguingly , mir-15a and mir-15b are downregulated in ad brain and cerebrospinal fluid , respectively [ 25 , 45 , 46 ] , providing clinical relevance for these observations . moreover , mir-15 targets the proapoptotic protein bcl-2 , whose protein levels are increased in ad [ 4749 ] . in addition , mir-16 overexpression could regulate app expression in vivo in the mouse brain . taken together , these observations highlight the potential importance of the mir-16 family in ad development by regulating cell survival , amyloid production , and tau phosphorylation ( figure 1 ) . interestingly , targetscan predicts more than 1000 human target genes for mir-16 , several of which are associated with networks related to cell death , cellular organization , and molecular transport ( s. s. hbert , unpublished observations ) . notably , among the high - scoring predicted targets are mirna - processing regulators such as tnrc6b . it will be interesting to see whether loss of mir-16 family members in vivo recapitulates , at least in past , the observed effects on erk and , most importantly , tau phosphorylation in vivo . it is interesting to note that dicer deficiency in the adult brain is also associated with changes in tau splicing . using a similar strategy as above ( e.g. , bioinformatics , microarrays , literature search , western blot analysis , etc . ) , we identified mir-132 and the neuronal splicing regulator ptbp2 as potential regulators of endogenous tau exon 10 splicing in neurons . these results are consistent with previous findings linking tau exon 10 splicing regulation by ptbp1 in vitro . while not discussed in detail in our study , other mirnas , including mir-124 and mir-9 , could also regulate endogenous tau exon 10 splicing in neuronal cells by targeting specific regulatory and/or splicing factors . both mirnas are downregulated in ad [ 5658 ] , which could have important consequences for tau metabolism , at least in certain biological contexts ( figure 1 ) . for instance , downregulation of mir-9 is observed in the presence of exogenous a in mouse primary neurons . whether this or other mirnas function as intermediates between a peptides , tau missplicing and hyperphosphorylation remain an exciting possibility . interestingly , differential splicing of the tau transcript has also been reported in ad [ 60 , 61 ] . psp is a cause of late - onset atypical parkinsonism described by steele et al . . are mainly composed of tau with 4 microtubule - binding domains ( 4r - tau ) [ 13 , 15 ] . using psp as a model disease , we identified mir-132 to be selectively downregulated in pathological conditions . interestingly , ptbp2 protein ( but not mrna ) levels were increased in psp patients and correlated significantly with mir-132 expression . these experiments provide unprecedented molecular links among abnormal tau splicing , hyperphosphorylation , and sporadic tauopathies . interestingly , changes in ptbp1 and ptbp2 levels , and by extension alternative splicing patterns , have been documented in human diseases , including neurodegenerative disorders [ 63 , 64 ] . on the basis of these observations , it is tempting to speculate that mirnas could contribute significantly to several aspects of tau metabolism and neuronal dysfunction in various diseases . for instance , what are the biological and clinical significance of these findings ? are other mirnas involved in tau metabolism regulation ? can mirnas be used as diagnostic and possibly therapeutic agents for sporadic tauopathies ? without a doubt , these and other questions will require extensive followup studies in various models , from cells to animals to humans .

abnormal regulation of tau phosphorylation and/or alternative splicing is associated with the development of a large ( > 20 ) group of neurodegenerative disorders collectively known as tauopathies , the most common being alzheimer 's disease . despite intensive research , little is known about the molecular mechanisms that participate in the transcriptional and posttranscriptional regulation of endogenous tau , especially in neurons . recently , we showed that mice lacking dicer in the forebrain displayed progressive neurodegeneration accompanied by disease - like changes in tau phosphorylation and splicing . dicer is a key enzyme in the biogenesis of micrornas ( mirnas ) , small noncoding rnas that function as part of the rna - induced silencing complex ( risc ) to repress gene expression at the posttranscriptional level . we identified mir-16 and mir-132 as putative endogenous modulators of neuronal tau phosphorylation and tau exon 10 splicing , respectively . interestingly , these mirnas have been implicated in cell survival and function , whereas changes in mir-16/132 levels correlate with tau pathology in human neurodegenerative disorders . thus , understanding how mirna networks influence tau metabolism and possibly other biological systems might provide important clues into the molecular causes of tauopathies , particularly the more common but less understood sporadic forms .

1. Introduction 2. Tau Phosphorylation Regulation by the miR-15 Family 3. Tau Alternative Splicing Regulation by miR-132 4. Outstanding Questions

histopathologic classification of pancreatic endocrine neoplasms is complex and the recent world health organization ( who ) classification of tumors of the digestive system divides pancreatic endocrine tumors into three grades based on mitotic rate and proliferation index ( pi ) as determined by ki-67 immunohistochemical staining . the who classification is formulated for the evaluation of histologic specimens which are paraffin embedded and formalin fixed . the papanicolaou society of cytopathology ( psc ) has developed a set of guidelines for the investigation and diagnosis of pancreatic and biliary tract lesions . the neoplastic category is further sub - divided into neoplasm , benign , and pancreatic endocrine neoplasms are placed in either the neoplasm , other or malignant categories depending on cytologic features . several authors have applied the who recommendations for classification to formalin fixed paraffin - embedded cell block specimens obtained by fine needle aspiration ( fna ) . these studies have shown good correlation between results obtained from cell block specimens and subsequent surgical specimens . endoscopic ultrasound ( eus ) guided fna biopsies of pancreatic lesions do not invariably result in cell block material and may produce only smear preparations . such preparations may be stained by either the diff - quik or the papanicolaou methods , and if rapid on - site evaluation is utilized , a significant proportion of the resultant smears are diff - quik stained . this may result in the only material available for evaluation being air - dried diff - quik stained smears . little information exists as to criteria for separating cytologic specimens of pancreatic endocrine neoplasms into low- , intermediate- , and high - grade lesions corresponding to the who system . the psc guidelines recommend categorizing pancreatic endocrine neoplasms as high - grade lesions ( malignant , pancreatic endocrine carcinoma ) and low- or intermediate - grade lesions ( neoplasm , other , pancreatic endocrine tumor ) . while the high - grade malignant lesions are invariably aggressive neoplasms and require an aggressive therapeutic approach , neoplasms cytologically characterized as neoplasm , other ( pancreatic endocrine tumor ) have a variable biological behavior with some showing aggressive features including metastases while others have a more indolent behavior . malignant neuroendocrine carcinomas in the psc classification are histologically small cell and large cell neuroendocrine carcinomas with aggressive behavior . neoplasm , other into those likely to behave aggressively and those with a more indolent clinical course . prior studies have demonstrated the utility of cell block material for such separation but criteria for the analysis of smear preparations have not been published . we utilized a series of 36 pancreatic endocrine tumors including low- , intermediate- , and high - grade examples to develop a set of cytomorphologic criteria and a related scoring system to identify pancreatic endocrine neoplasms with a poor outcome in smear preparations . the present study was reviewed by the institutional review board and determined to be exempt . the case files of the department of pathology and anatomical sciences at the university of missouri and the department of pathology and laboratory medicine at the university of utah / arup laboratories were searched for all fna biopsies of pancreatic endocrine neoplasms performed between january 2008 and january 2014 . neoplasm , other , pancreatic endocrine neoplasm and four classified as malignant , pancreatic endocrine carcinoma were identified and the corresponding slides obtained . cases with biopsy or resection specimen were graded using the who recommendations and classified as neuroendocrine neoplasm grade 1 , neuroendocrine neoplasm ; grade 2 or neuroendocrine neoplasm ; grade 3 . the histologic grading was based on ki-67 index , mitotic counts , the presence or absence of necrosis , and the presence or absence of angioinvasion . histology , in some cases , was performed on only biopsy specimens while others were resection specimens . all cases had diff - quik stained smears , and these smears formed the basis of the present study . for each case , twenty morphologic features [ table 1 ] were independently evaluated by two raters . evaluations were made only on the basis of morphology as seen in diff - quik stained slide material . diff - quik material was used as this is the preparation type used for rapid on - site evaluation . raters were blinded to the original diagnoses and did not have access to clinical information . both raters were board - certified cytopathologists with 8 and 30 years of experience , respectively . chromatin stringing is defined as artifactual pulling of nuclear chromatinic material into long chords due to the smearing process . for cytologic evaluation , mitotic activity was graded as absent ( no mitotic figures seen ) or present ( one or more mitotic figures seen in the smear ) . poor outcomes included metastases , death , or high - grade lesions ( pancreatic endocrine carcinoma ) as determined by histologic evaluation of surgical specimens . inter - rater agreement statistics for morphologic features associations between morphologic features ( absent vs. present ) and outcomes ( poor vs. not poor ) were evaluated using hierarchical logistic regression . inter - rater agreement was assessed with absolute agreement and chance - corrected agreement ( kappa ) . discriminatory power was assessed using the area under the receiver operating characteristic ( auroc ) curve . statistical calculations ( kappa , logistic regression , roc analysis ) were performed using the stata 13 ( stata corporation , college station , tx , usa ) . recursive partitioning was conducted using the jpm 11.0 ( sas corporation , cary , nc , usa ) . absolute inter - rater agreement ranged from 51.4% to 97.1% across the 20 morphologic features [ table 1 ] . table 2 shows the corresponding histologic diagnoses and clinical outcome with the cytologic category as poor or not poor outcome . raters achieved kappa scores of at least 0.3 for seven morphologic features ( chromatin stringing , prominent nucleoli , irregular nuclear membranes , nuclear grooves , mitotic figures , necrosis , and 3-fold variation in nuclear size ) . tumor histologic grade , clinical follow - up , and cytologic risk for a poor outcome sensitivity and specificity both range from 4% to 100% [ table 3 ] . twelve of the twenty morphologic features showed statistically significant associations with poor outcomes [ table 4 ] . overall discriminatory power was highest for irregular nuclear membranes ( auroc = 0.76 ) , mitoses ( auroc = 0.71 ) , 3-fold variation in nuclear size ( auroc = 0.67 ) , and necrosis ( auroc = 0.65 ) . accuracy statistics for morphologic features , area under the receiver operating characteristic curve strength of association between morphologic features and poor outcomes many of the morphologic features had statistically significant associations [ table 5 ] . for example , chromatin stringing had a statistically significant correlation with mitotic figures ( r = 0.50 , p < 0.001 ) . irregular nuclear membranes had statistically significant correlations with nuclear grooves , mitotic figures , 3-fold variation in nuclear size , and the presence of necrosis . pairwise correlation matrix for selected morphologic features recursive partitioning analysis showed that mitotic figures had the highest discriminatory power [ figure 1 ] . all cases with mitotic figures were associated with poor outcomes ( specificity of mitoses = 100% ) . cases without mitoses could be further classified on the basis of irregular nuclear membranes and 3-fold variation in the nuclear size . there were no poor outcomes in cases , which lacked mitoses , irregular nuclear membranes , and a 3-fold or greater variation in nuclear size . we developed two different scoring systems based on odds ratios [ table 6 ] and recursive partitioning [ table 7 and figure 1 ] . for the odds ratio method , we use the relative odds ratio of three factors : classification and regression tree for morphological features . the tree splits the cases based on the features with the highest discriminatory power ( mitotic figures ) . then for each branch , the feature with the highest discriminatory power is selected scoring based on odds ratios scoring based on recursive portioning score = 4*l ( mitoses ) + 4*l ( irregular nuclear membranes ) + l ( 3-fold variation in nuclear size ) where l ( x ) is the indicator function and l ( x ) = 1 if feature x is present and l ( x ) = 0 if the feature x is absent [ table 5 ] . for the partitioning method , roc analysis showed that there was no statistically significant difference between the two scoring systems . an roc curve for the score based on odds ratios is presented in figure 2 . using the regression tree classification shown in figure 1 , cytologic features stratified malignancy risk between 0% and 100% [ table 1 ] . using a risk of malignancy of 60% for assigning a specimen to the poor risk category , cytology correctly assigned specimens to the poor outcome category in 9 of 12 cases ( 75% ) and when high - grade lesions were excluded , correct assignment to the poor outcome category occurred in 5 of 8 cases ( 62.5% ) . the scoring system correctly assigned a case to the favorable category ( risk 20% or below ) in 20 of 24 cases ( 83% ) . histologic grading using the who system correctly predicted aggressive behavior in 14 of 13 cases ( 37.7% ) and when high - grade lesions were excluded histologic grading failed to predict aggressive behavior in any case . figures 35 illustrate grade 1 ( risk of poor outcome 20% or less ) , grade 2 ( risk of poor outcome > 20 and 60% ) , and grade 3 ( risk of poor outcome 100% ) . receiver operating characteristic curved for scoring scheme based on odds ratio photomicrograph of low - grade neuroendocrine tumor . no mitotic figures were present ( diff - quik , 1000 ) photomicrograph of intermediate - grade neuroendocrine tumor . cells have smooth nuclear contours , but greater than a 3-fold variation in nuclear size ( diff - quik , 400 ) photomicrograph of high - grade ( small cell carcinoma ) neuroendocrine tumor . in 2010 , the who published a classification for pancreatic endocrine neoplasms addressing both staging and grading issues . they proposed a three - tiered categorization system based on mitotic rate and pi as determined by ki-67 staining . the who grading scheme is based on histopathologic material , and specific guidance was not given for the classification 's application to cytologic material . the psc developed guidelines for pancreatic and biliary tract cytology which include a categorization scheme with diagnostic criteria . in the psc guidelines , grade 1 and 2 neoplasms of the who recommendations are placed in the neoplasm , other category and further categorized as pancreatic endocrine neoplasms . who high - grade lesions are placed in the malignant category with further categorization as pancreatic neuroendocrine carcinoma , either small or large cell variants . the who grading system for pancreatic endocrine neoplasms is most appropriately performed on resection specimens and not small biopsies as the small biopsy may not be representative of the final resection specimen grade . this limitation on histologic grading may be a reason for the superior predictive value of the cytologic grade over the histologic grade obtained from small biopsy specimens in the present study . assignment of who low- and intermediate - grade pancreatic endocrine tumors to the neoplasm , other category of the psc guidelines is based on the desire to maximize therapeutic options for treating clinicians and their patients . thus , patients with histologically low- and intermediate - grade pancreatic neuroendocrine tumors could be followed if the patient 's clinical status made operative intervention undesirable . these lower grade neoplasms were not assigned to the malignant category because it was believed such an assignment would make it difficult to clinically follow patients with low- and intermediate - grade pancreatic endocrine neoplasms if such neoplasms were designated cytologically malignant . the psc guidelines made no attempt to distinguish between low- and intermediate - grade pancreatic endocrine tumors of the who classification and assigned both to a single category . a number of authors have recommended performing ki-67 immunohistochemical staining on formalin fixed paraffin - embedded cell block preparations to prognostically stratify pancreatic endocrine neoplasms and have shown good correlation between such cytologic stratification and subsequent histologic grading of surgical resections . this approach does require cell block preparations which may not always be obtained during eus - fna sampling . in some cases , only smear preparations are available for analysis and little data exists as to the possibility of and the methodology for stratifying pancreatic endocrine tumors in smear preparations . we analyzed a series of 36 pancreatic endocrine neoplasms of which 32 were designated as neoplasm , other ( pancreatic endocrine tumor ) and four were diagnosed as malignant : pancreatic endocrine carcinoma . we rated the diff - quik stained smear preparations for the presence or absence of 20 morphologic features and correlated these features with poor outcome ( development of metastatic disease , death or high - grade history morphology on resection ) . while several of the features analyzed are nuclear features and might be better evaluated on papanicolaou - stained preparations , the staining preparation generally used for rapid on - site assessment is air - dried diff - quik stained material . this preparation appears suitable for assessment of the features utilized in this study . using these correlations poor outcomes were unlikely ( < 20% ) if mitoses were not present and the cells demonstrated no nuclear membrane irregularity or 3-fold variation in nuclear size . cases that lacked mitotic figures on smear preparations but demonstrated nuclear membrane irregularity and a 3-fold variation in nuclear size had a 60% chance of a poor outcome . morphologic features in our study were highly correlated [ table 3 ] , so that it is difficult to build a predictive model . once a feature is selected , correlating other features adds relatively little information to the model . the scoring system developed by the odds ratio method utilized three morphologic factors as shown below : score = 4*l ( mitoses ) + 4*l ( irregular nuclear membranes ) + l ( 3-fold variation in nuclear size ) where l ( x ) is the indicator function and l ( x ) = 1 if the feature is present and 0 if the feature is absent [ table 6 ] . for the partitioning method , scores were based on the five categories shown in figure 1 [ table 7 ] . using recursive partitioning analysis , mitotic figures were shown to have the highest discriminatory power [ figure 1 ] . all cases which had mitotic figures were associated with a poor outcome and specificity for mitoses was 100% . cases lacking mitoses were further classified on the basis of irregular nuclear membranes and 3-fold variation in nuclear size . when mitotic figures , irregular nuclear membranes and 3-fold variation in nuclear size were absent , no poor outcomes were present . the evaluation of specimens for these three markers is a sensitive measure for poor outcome . roc analysis demonstrated that there was no statistically significant difference between the two scoring systems . the present study demonstrated that a simple scoring system utilizing the presence of mitotic figures , irregular nuclear membranes , and 3-fold or greater variation in nuclear size can subdivide pancreatic endocrine neoplasms into those with poor and those with a more favorable outcome . given the prominence of mitotic rate and pi ( ki-67 ) in the who classification , it is not surprising that the presence of any mitotic figures is a strong predictor of poor outcome in smear preparations . the proposed scoring system is applicable to diff - quik stained smear preparations and is useful for evaluating both of the psc categories neoplasm , other ( pancreatic endocrine neoplasm ) and malignant ( pancreatic endocrine carcinoma ) . the cytologic system had superior predictive value for poor outcome than did the who grading system which had an accuracy of classification of 69% ( 24 of 36 cases ) . the cytologic system is most useful when cell block preparations are not available for analysis . from the previously published data , cell block immunohistochemical staining for ki-67 appears to represent the optimal technique to evaluate grade in cytologic specimens obtained from pancreatic endocrine neoplasms . because our proposed cytologic scoring system yielded higher accuracy than histologic evaluation of small biopsy specimens , it might be considered as superior to evaluation by the who system for small samples . however , several studies have demonstrated the high reliability of cell blocks for grading , so we recommend their use when such material is available . when only smears are available for analysis , our scoring system appears to be a helpful alternative . lester j. layfield , m.d . developed the study concept and design , evaluated the specimens for data collection and wrote the draft article . robert l. schmidt m.d . , ph.d . performed the data analysis and helped prepare the draft article . jack campbell , ba collected the cases for analysis and prepared the data for analysis . the present study was reviewed by the institutional review board and determined to be exempt . eus - endoscopic ultrasound fna - fine needle aspiration pi - proliferation index psc - papanicolaou society of cytopathology who - world health organization to ensure the integrity and highest quality of cytojournal publications , the review process of this manuscript was conducted under a double - blind model ( authors are blinded for reviewers and vice versa ) through automatic online system .

background : papanicolaou society of cytopathology guidelines place low- and intermediate - grade pancreatic endocrine tumors into the neoplastic , other category whereas high - grade pancreatic endocrine tumors are placed in the malignant category . no attempt was made to stratify pancreatic endocrine tumors in the neoplastic , other category by likelihood for metastases . histologically , pancreatic endocrine tumors are divided into well , intermediate , and poorly differentiated examples based on mitotic count and ki-67 proliferation index ( pi ) . pi has been used in the evaluation of cytologic specimens utilizing cell block material . unfortunately , cell block material may not always be available for analysis , and little data exists as to cytomorphologic features in smear preparations which might distinguish between low- and intermediate - grade endocrine neoplasms and predict metastases.methods:we studied 36 cases of diff - quik stained smear preparations for 20 morphologic features to determine which best - classified cases into poor and not poor outcome categories . hierarchical logistic regression analysis was used to determine associations between the morphologic features and outcomes.results:absolute agreement between raters ranged from 51% to 97% across the 20 morphologic features . about 12 of the 20 morphologic features showed statistically significant associations with poor outcome . mitoses , irregular nuclear membranes , and 3-fold variation in nuclear size are the best discriminators between poor and not poor outcomes.conclusions:a scoring system was developed utilizing mitoses , irregular nuclear membranes , and 3-fold variation in nuclear size to divide smears of pancreatic endocrine tumors into poor and not poor outcome groups . the scoring system achieved 84% accuracy in separating cases into poor and not poor outcomes .

INTRODUCTION METHODS RESULTS DISCUSSION CONCLUSION COMPETING INTERESTS STATEMENT BY ALL AUTHORS AUTHORSHIP STATEMENT BY ALL AUTHORS ETHICS STATEMENT BY ALL AUTHORS LIST OF ABBREVIATIONS (In alphabetic order) EDITORIAL/PEER-REVIEW STATEMENT

s. granulatus , which belongs to the family of boletaceae , forms symbiotic ectomycorrhizas with pine tree roots , and has a brown sticky cap and lactating pored gills ( fig . the genets of s. granulatus in a p. strobus stand at the chungbuk national university in korea were investigated to divide into a , b , and c groups . the host trees were planted in a line at 4.8 m intervals 22 years ago , and their present mean height and diameter at breast height are 18 m and 28 cm , respectively . the stand area was 60 m 13 m , and its slope was 0 to 3. the underlying vegetation was comprised mainly of herbaceous plants , lawn grasses , clovers , dandelions , and foxtails . s. granulatus mushrooms fruited at approximately 0.6 to 4.5 m away from the host trees . the number of s. granulatus fruiting bodies was 56 in 2013 and 60 in 2014 , occurring mainly in late august ( fig . 2 ) . positions and distances of the fruiting bodies from the trees were measured , and these data were illustrated using autocad to identify the patterns of the fungal colonies . the dna of s. granulatus fruiting bodies was extracted using the higene genomic dna prep kit ( biofact , daejeon , korea ) . for the genet analysis , primers opa07 ( 5'-gaa acg ggt g-3 ' ) , opa11 ( 5'-caa tcg ccg t-3 ' ) , opa13 ( 5'-cag cac cca c-3 ' ) , opa16 ( 5'-agc cag cga a-3 ' ) , opb10 ( 5'-ctg ctg gga c-3 ' ) , and opb18 ( 5'-cca cag cag t-3 ' ) were used for the random amplification of fruit bodies genomic dna fragment . the bands corresponding to the amplified pcr products were subjected to cluster analysis using the unweighted pair group method with arithmetic mean . distribution of these mushrooms genets was assumed from match - delineated colony shapes , and was divided into genets based of rapd analysis . s. granulatus , which belongs to the family of boletaceae , forms symbiotic ectomycorrhizas with pine tree roots , and has a brown sticky cap and lactating pored gills ( fig . the genets of s. granulatus in a p. strobus stand at the chungbuk national university in korea were investigated to divide into a , b , and c groups . the host trees were planted in a line at 4.8 m intervals 22 years ago , and their present mean height and diameter at breast height are 18 m and 28 cm , respectively . the stand area was 60 m 13 m , and its slope was 0 to 3. the underlying vegetation was comprised mainly of herbaceous plants , lawn grasses , clovers , dandelions , and foxtails . s. granulatus mushrooms fruited at approximately 0.6 to 4.5 m away from the host trees . the number of s. granulatus fruiting bodies was 56 in 2013 and 60 in 2014 , occurring mainly in late august ( fig . 2 ) . positions and distances of the fruiting bodies from the trees were measured , and these data were illustrated using autocad to identify the patterns of the fungal colonies . the dna of s. granulatus fruiting bodies was extracted using the higene genomic dna prep kit ( biofact , daejeon , korea ) . for the genet analysis , primers opa07 ( 5'-gaa acg ggt g-3 ' ) , opa11 ( 5'-caa tcg ccg t-3 ' ) , opa13 ( 5'-cag cac cca c-3 ' ) , opa16 ( 5'-agc cag cga a-3 ' ) , opb10 ( 5'-ctg ctg gga c-3 ' ) , and opb18 ( 5'-cca cag cag t-3 ' ) were used for the random amplification of fruit bodies genomic dna fragment . the bands corresponding to the amplified pcr products were subjected to cluster analysis using the unweighted pair group method with arithmetic mean . distribution of these mushrooms genets was assumed from match - delineated colony shapes , and was divided into genets based of rapd analysis . the rapd primers opa07 , opa11 , opa13 , opa16 , opb10 , and opb18 yielded 9 , 9 , 11 , 14 , 12 , and 8 separate bands . the colonies of s. granulatus in the p. storbus stand were grouped into three locations a , b , and c , for genet analysis ( fig . s. granulatus mushrooms formed large , linear colonies at the stand , and the number of fruiting bodies was 56 from 25 genets in 2013 and 60 from 48 genets in 2014 , i.e. , a total of 116 fruiting bodies from 73 genets ( fig . 4 ) . among the 73 genets , 13 in 2013 and 41 in 2014 formed single fruiting bodies . the average fruiting body numbers per genet were 2.2 in 2013 , 1.25 in 2014 , and 1.57 over 2 yr . at location eight mushrooms that fruited in 2013 were delineated into four genets , one of which was represented by a single mushroom ( table 1 ) . in 2014 , another eight mushrooms fruited and were delineated into three genets , two of which were represented by a single mushroom ( table 1 ) . thus , the percentage of genets represented by a single mushroom was 43% at this location . the genet sizes varied from 0.20 m to 1.82 m ( table 1 , fig . 5 ) . at location b , 39 s. granulatus mushrooms fruited in 2013 and 37 in 2014 , and the colony shapes were partly circular and partly linear ( fig . the 39 mushrooms that fruited in 2013 were delineated into 18 genets , 8 of which were represented by a single mushroom ( table 2 ) . , the 37 mushrooms that fruited were delineated into 35 genets ( table 2 ) . thirty - three genets were represented by a single mushroom , which equates to about 94% of the genets . the percentage of genets represented by a single mushroom varied significantly from 44% to 94% over 2 yr . the average number of fruiting bodies per genet was 1.4 , and the largest genet length was 2.9 m. at location c , s. granulatus mushrooms fruited in fragments , in a complicated manner , or and in a line ( fig . eight mushrooms that fruited in 2013 were delineated into four genets ( table 3 ) . , the 16 mushrooms that fruited were delineated into 11 genets , 7 of which were represented by a single mushroom ( table 3 ) . in other words , 10 of the 15 ( 67% ) the average number of mushrooms per genet was 1.60 , and the longest genet was 2.79 m. ectomycorrhizal fungal colonies are grouped into three basic types : the fairy ring , irregular mat , and dispersed colony types . the fairy ring type grows as a distinctly dense , circular mycelial colony below the ground , and mushrooms forming this type of colonies belong to the genera cantharellus , tricholoma , and agaricus . mushrooms forming irregular mat type colonies include those from the genera cortinarius , sarcodon , and suillus . mushrooms forming dispersed colonies include those from the genera amanita , boletus , russula , and marasmius , as well as litterdecomposing mushrooms . although the width of below - ground mycelial colonies of t. matsutake are about 1 m , the front edge of the live hyphal portion of the colonies are only approximately 20 cm , and only the front continues to grow in length . organic matter decomposing fungi living in plant residues on the soil surface also grow out in all directions from the center . these mycelial colonies are from somatic cells with two nuclei , and thus , the mushrooms genets from the colonies should be the same . however , our molecular marker analysis showed that genets from the fruiting bodies in the colonies were different . in nature there are two types of processes that allow the formation of ectomycorrhizal fungal colonies : one is mating between two compatible monokaryotic ( haploid ) mycelia from spores , and the other is dikaryotic ( haploid ) mycelial growth . our study showed that the genets of fruiting bodies in the p. strobus stand that occurred very closely to each other in 2013 and 2014 were genetically different . this suggests that the genets of s. granulatus have been frequently changing due to the combination of the monokaryotic haploid hyphae from introduced sexual basidiospores ( fig . 8) and the existing dikaryotic haploid ectomycorrhizal mycelia below the ground ( fig . the percentage of genets represented by a single mushroom ranged from 44% to 94% of the total genets depending on the year of occurrence and locations , and the average numbers of mushrooms per genet were 1.2 to 2.3 . similarly , in the case of s. spraguei in a natural p. strobus stand , 42 out of 46 genets from 50 sporocarps sampled were represented by a single sporocarp , while the remaining 4 genets were represented by 2 sporocarps , resulting in an average number of sporocarps per genet of only 1.09 . in the late successional ectomycorrhizal species , r. brevipes , 33% to 50% of its genets the fruiting bodies that occurred in a limited space showed high genetic diversity , but the size of each genet did not exceed 1.0 m . in the case of a pioneer and early successional species , l. laccata , the genets tend to disappear within a few months after sporocarp formation , and the new genets that appeared from the spores were significantly smaller in size and larger in quantity and dispersed during the fruiting season . the high densities and annual renewal of laccaria genets indicated frequent turnover by sexual reproduction via spores . during its fruiting season , most genets of the l. laccata mushrooms were identical to the mycelial genets below the ground . however , nine months after the fruiting season , new genets were observed , and the genets from the previous year 's fruiting bodies were not detected in 60% of the plots . this means that , like in the case of the genets of s. granulatus in this study , the genets of l. laccata may have changed due to the combination of the dikaryotic ectomycorrhizal mycelia in the soil and the monokaryotic hyphae from new spores to change their genets and produced the fruiting bodies . for mushrooms to reproduce and propagate , the spores disperse from mushroom gills and germinate when the humidity , temperature and nutrition are appropriate . hyphae grown from germinated spores combine with hyphae from other spores to form a mycelial mat and develop primordial to mature mushrooms . meanwhile , in a stable ecosystem such as a fully grown forest , the new roots are surrounded by existing mycorrhizal roots , and therefore , the new spores have a rare chance to infect new roots . thus , soil disturbances that destroy the existing fungal colonies can provide a place for the settlement of new spores . in nature , early successional ectomycorrhizal fungi form mycorrhizal symbiosis with their host plant roots by spores , which are dispersed into the soil , and the mycorrhizas can be replaced by late successional fungal species as the hosts grow . on the other hand , if the vegetation is stable and early successional mycorrhizal species are persistent , then the transition of the spores becomes delayed . mushrooms that have a strong predisposition to form fairy - ring type colonies such as t. matsutake maintain their colony through existing mycelium in the soil rather than newly dispersed spores . however , our results suggest that the genets of ectomycorrhizal colonies may have been constantly diversifying as a result of fusion with hyphae from the basidiospores produced during fruiting season . this genetic diversification may contribute to the survival of the colonies under changing environmental conditions , such as the conditions of the host and soil and the weather . many studies have shown that the genet sizes of ectomycorrhizal fungi were very diverse , depending on the host species , host ages and habitats . the genet sizes were 300 m in s. pungens , 1 m or less in l. amethystina and russula cremoricolor , 12.5 m in laccaria bicolor , 2.27 to 7.65 m in s. spraguei , and 3.5 m in diameter in hebeloma cylindrosporum . the size of collybia fusipes genets in decomposing fallen leaves varied in size from very small to a few millimeter . on the other hand , genets of armillaria bulbosa , a root - disease pathogen in forest trees , can cover as much as 1 km . the genet densities of ectomycorrhizal mushroom populations were also considerably varied between 30 and 5,000 per ha . in this study , 44 to 94% of s. granulatus genets were represented by a single fruiting body , and the longest genet was approximately 2.9 m and composed of five fruiting bodies . in conclusion , the genets of s. granulates mushrooms were varied even though they occurred very closely and became more varied every year . this means that the below - ground mycelial mat of s. granulatus , composed of vegetative hyphal cells , can be renewed sexually by fusing with haploid hyphae from spores produced in the mushroom gills . the small stand area and the short 2-yr survey period limits the interpretation of the formation of new genets of s. granulatus . further studies will be needed to clarify the role of fusion between the hyphae from basiospores and the belowground ectomycorrhizal mycelia in genet variation of s. granulatus . ectomycorrhizal fungal colonies are grouped into three basic types : the fairy ring , irregular mat , and dispersed colony types . the fairy ring type grows as a distinctly dense , circular mycelial colony below the ground , and mushrooms forming this type of colonies belong to the genera cantharellus , tricholoma , and agaricus . mushrooms forming irregular mat type colonies include those from the genera cortinarius , sarcodon , and suillus . mushrooms forming dispersed colonies include those from the genera amanita , boletus , russula , and marasmius , as well as litterdecomposing mushrooms . although the width of below - ground mycelial colonies of t. matsutake are about 1 m , the front edge of the live hyphal portion of the colonies are only approximately 20 cm , and only the front continues to grow in length . organic matter decomposing fungi living in plant residues on the soil surface also grow out in all directions from the center . these mycelial colonies are from somatic cells with two nuclei , and thus , the mushrooms genets from the colonies should be the same . however , our molecular marker analysis showed that genets from the fruiting bodies in the colonies were different . in nature there are two types of processes that allow the formation of ectomycorrhizal fungal colonies : one is mating between two compatible monokaryotic ( haploid ) mycelia from spores , and the other is dikaryotic ( haploid ) mycelial growth . our study showed that the genets of fruiting bodies in the p. strobus stand that occurred very closely to each other in 2013 and 2014 were genetically different . this suggests that the genets of s. granulatus have been frequently changing due to the combination of the monokaryotic haploid hyphae from introduced sexual basidiospores ( fig . 8) and the existing dikaryotic haploid ectomycorrhizal mycelia below the ground ( fig . the percentage of genets represented by a single mushroom ranged from 44% to 94% of the total genets depending on the year of occurrence and locations , and the average numbers of mushrooms per genet were 1.2 to 2.3 . similarly , in the case of s. spraguei in a natural p. strobus stand , 42 out of 46 genets from 50 sporocarps sampled were represented by a single sporocarp , while the remaining 4 genets were represented by 2 sporocarps , resulting in an average number of sporocarps per genet of only 1.09 . in the late successional ectomycorrhizal species , r. brevipes , 33% to 50% of its genets were represented by a single fruiting body . in russula vinosa , the fruiting bodies that occurred in a limited space showed high genetic diversity , but the size of each genet did not exceed 1.0 m . in the case of a pioneer and early successional species , l. laccata , the genets tend to disappear within a few months after sporocarp formation , and the new genets that appeared from the spores were significantly smaller in size and larger in quantity and dispersed during the fruiting season . the high densities and annual renewal of laccaria genets indicated frequent turnover by sexual reproduction via spores . during its fruiting season , most genets of the l. laccata mushrooms were identical to the mycelial genets below the ground . however , nine months after the fruiting season , new genets were observed , and the genets from the previous year 's fruiting bodies were not detected in 60% of the plots . this means that , like in the case of the genets of s. granulatus in this study , the genets of l. laccata may have changed due to the combination of the dikaryotic ectomycorrhizal mycelia in the soil and the monokaryotic hyphae from new spores to change their genets and produced the fruiting bodies . for mushrooms to reproduce and propagate , the spores disperse from mushroom gills and germinate when the humidity , temperature and nutrition are appropriate . hyphae grown from germinated spores combine with hyphae from other spores to form a mycelial mat and develop primordial to mature mushrooms . meanwhile , in a stable ecosystem such as a fully grown forest , the new roots are surrounded by existing mycorrhizal roots , and therefore , the new spores have a rare chance to infect new roots . thus , soil disturbances that destroy the existing fungal colonies can provide a place for the settlement of new spores . in nature , early successional ectomycorrhizal fungi form mycorrhizal symbiosis with their host plant roots by spores , which are dispersed into the soil , and the mycorrhizas can be replaced by late successional fungal species as the hosts grow . on the other hand , if the vegetation is stable and early successional mycorrhizal species are persistent , then the transition of the spores becomes delayed . mushrooms that have a strong predisposition to form fairy - ring type colonies such as t. matsutake maintain their colony through existing mycelium in the soil rather than newly dispersed spores . however , our results suggest that the genets of ectomycorrhizal colonies may have been constantly diversifying as a result of fusion with hyphae from the basidiospores produced during fruiting season . this genetic diversification may contribute to the survival of the colonies under changing environmental conditions , such as the conditions of the host and soil and the weather . many studies have shown that the genet sizes of ectomycorrhizal fungi were very diverse , depending on the host species , host ages and habitats . the genet sizes were 300 m in s. pungens , 1 m or less in l. amethystina and russula cremoricolor , 12.5 m in laccaria bicolor , 2.27 to 7.65 m in s. spraguei , and 3.5 m in diameter in hebeloma cylindrosporum . the size of collybia fusipes genets in decomposing fallen leaves varied in size from very small to a few millimeter . on the other hand , genets of armillaria bulbosa , a root - disease pathogen in forest trees , can cover as much as 1 km . the genet densities of ectomycorrhizal mushroom populations were also considerably varied between 30 and 5,000 per ha . in this study , 44 to 94% of s. granulatus genets were represented by a single fruiting body , and the longest genet was approximately 2.9 m and composed of five fruiting bodies . in conclusion , the genets of s. granulates mushrooms were varied even though they occurred very closely and became more varied every year . this means that the below - ground mycelial mat of s. granulatus , composed of vegetative hyphal cells , can be renewed sexually by fusing with haploid hyphae from spores produced in the mushroom gills . the small stand area and the short 2-yr survey period limits the interpretation of the formation of new genets of s. granulatus . further studies will be needed to clarify the role of fusion between the hyphae from basiospores and the belowground ectomycorrhizal mycelia in genet variation of s. granulatus .

the genets of suillus granulatus in a pinus strobus stand ( 13 m 60 m ) were identified using random amplified polymorphic dna molecular markers and the dna of mushrooms that fruited for two years , and variations in genet size and distribution were analyzed . from a total of 116 mushrooms , 73 genets were identified and were grouped into three locations . the genets of mushrooms in close proximity differed from each other . the genet sizes varied at any of the three locations . the lengths of the identified genets in the pine stand ranged from 0.09 to 2.90 m. the average number of mushrooms per genet was 1.2 to 2.3 , and the percentage of genets that were represented by a single mushroom was 44% to 94% . this variation in the genets of mushrooms in close proximity suggests that the ectomycorrhizal mycelial bodies of s. granulatus propagated sexually by fusing haploid spores derived from the mushrooms gills with below - ground mycelia . therefore , it is necessary further to investigate the formation of new genets through spores in ectomycorrhizal fungal colonies .

MATERIALS AND METHODS Occurrence of Collection and genet analysis of RESULTS DISCUSSION Ectomycorrhizal fungal colonies, collective forms of fungal hyphae and roots Spores cause genet mutation Diversity in genet sizes

leptin ( lep ) , the obese ( ob ) gene product is thought to play a key role in the regulation of energy expenditure and body fat homeostasis . leptin exerts its pleiotropic actions directly through distinct receptors ( ob - r ) encoded by the diabetes ( db ) gene . in humans , the circulating leptin level is increased in obesity , and is positively correlated with the total body fat mass , suggesting that a hallmark of obesity is not leptin deficiency , but leptin resistance . it has been reported that leptin stimulate the proliferation of various cell types and is considered to be a new growth factor . moreover , hyperleptinemia is a common feature of obese women who have a risk of breast cancer higher than those with normal weight . the leptin receptor gene was found to encode at least five alternatively spliced forms , ob - ra , ob - rb , ob - rc , ob - rd , and ob - re . besides membrane - bound isoforms of the leptin receptor with varying cytoplasmic length , a soluble form of the leptin receptor ( sob - r ) has been demonstrated . sob - r consists entirely of the extracellular ligand - binding domain and lacks the transmembrane residues and intracellular domain responsible for signal transduction . in their study sinha they found the existence of circulating leptin - binding proteins and reported that the greater part of leptin circulated in the bound form in lean subjects , whereas in obese subjects , the greater part of leptin circulated as the free form . have reported that only free leptin was detectable in cerebrospinal fluid ( csf ) , suggesting that it was the biologically active form . observed that leptin - binding activity was correlated with levels of the sob - rand that sob - r was the major leptin - binding protein in the circulating human blood . leptin receptor has been found in the most tissue ; particularly in the central nervous system , pancreas , kidney , liver , skeletal muscle , adrenal , and hematopoietic structure . it has been reported that serum sob - r level is low in obese individuals . conflicting to the serum levels of leptin , the sob - r level increased after weight loss by a low - calorie diet or stomach surgery . in breast cancer tissue , it was shown that leptin and leptin receptor are both expressed and that they act to favor cancer proliferation and metastasis . controversial results have been reported regarding the detection of leptin levels in breast cancer patients . however , the most reports indicate that higher leptin serum levels are associated with advanced stage breast cancer . there are , however , few studies in iranian healthy controls or breast cancer cases concerning to the leptin receptor . therefore , the aim of this study was to investigate changes in sbo - r in breast cancer cases compared with controls , and to evaluate the relationship between sob - r level , leptin , lipid profile , and breast cancer . clinical information such as stage of the breast cancer , menopausal status at the time of onset , hormonal receptor status ( estrogen receptor [ er ] , progesterone receptor ) , tumor size , and body mass index ( bmi ) was obtained from the hospital records . the second group was composed of 100 unrelated age and bmi - matched women without any personal or family history of breast cancer or other malignancies to serve as controls . control subjects were selected randomly among the people whom admitted to the same hospital during the same period . all patients and subjects enrolled in the study informed about the study and consent was taken . this study was approved by the clinical research ethics committee of ahvaz jundishapur university of medical sciences . women with suspected breast cancer without histological confirmation and those that refused sample donation were excluded from the study . body mass index was calculated as body weight ( in kg ) divided by square height ( m ) . based on hospital records body weight and height of all the participant were measured by standard methods , while they wearing light clothing and not wearing shoes . a volume of 5 ml of blood samples were collected into without edta - treated tubes from all the participants . the serum samples were stored at 2 - 8c for not more than 24 h prior to lipid profile determination . a serum aliquot was stored frozen at 70c for serum leptin and sob - r measurement . total cholesterol , high density lipoprotein cholesterol ( hdl - c ) , low density lipoprotein cholesterol ( ldl - c ) , and triglycerides ( tg ) were determined using commercially available kits ( pars azmoon inc . , serum leptin concentration was measured by enzyme - linked immunosorbent assay ( elisa ) using a commercially available human leptin elisa kit ( mediagnost , reutlingen / germany , e07 ) . the inter- and intra - assay coefficients of variation were 6.8 and 2.55% , respectively . sob - r concentration was measured by elisa using a commercially available human sob - r elisa kit ( boster biological technology , ltd c. no . ek0439 ) composed of two monoclonal antibodies raised against the extracellular domain of sob - r . then , 100 l human leptin receptor standards and diluted samples were pipette into 96-well microtiter plates coated with antileptin receptor monoclonal antibody . after incubation at 37c for 90 min , the wells were washed 3 times and incubated at 37c for 30 min with the monoclonal antibody labeled with horseradish peroxidase . the wells were again washed 5 times and incubated at 37c in dark for 15 - 20 min with tetramethylbenzidine ( tmb ) regent . then , 100 l tmb stop solution was added to each well to stop the reaction , and finally , the absorbance at 450 nm is measured on a microtiter plate reader . the intensity of the color formed is directly proportional to the concentration of sob - r in the sample . a set of standards is used to plot a standard curve from which the amount of sob - r in patient samples and controls can be directly read . all the statistical analyses were performed using spss software for windows version 15.0 ( spss , inc . we used nonparametric test for the analysis , because the data were not normally distributed even after logarithmic transformation . thus , a significant difference among the serum levels of leptin , sob - r , anthropometric measurements and lipid profiles in breast cancer cases and control subjects were assessed by mann the association between breast cancer and serum levels of leptin , sob - r , anthropometric measurements and lipid profiles were determined as ors and 95% cis according to the unconditional logistic regression analysis . clinical information such as stage of the breast cancer , menopausal status at the time of onset , hormonal receptor status ( estrogen receptor [ er ] , progesterone receptor ) , tumor size , and body mass index ( bmi ) was obtained from the hospital records . the second group was composed of 100 unrelated age and bmi - matched women without any personal or family history of breast cancer or other malignancies to serve as controls . control subjects were selected randomly among the people whom admitted to the same hospital during the same period . all patients and subjects enrolled in the study informed about the study and consent was taken . this study was approved by the clinical research ethics committee of ahvaz jundishapur university of medical sciences . women with suspected breast cancer without histological confirmation and those that refused sample donation were excluded from the study . body mass index was calculated as body weight ( in kg ) divided by square height ( m ) . based on hospital records body weight and height of all the participant were measured by standard methods , while they wearing light clothing and not wearing shoes . a volume of 5 ml of blood samples were collected into without edta - treated tubes from all the participants . the serum samples were stored at 2 - 8c for not more than 24 h prior to lipid profile determination . a serum aliquot was stored frozen at 70c for serum leptin and sob - r measurement . total cholesterol , high density lipoprotein cholesterol ( hdl - c ) , low density lipoprotein cholesterol ( ldl - c ) , and triglycerides ( tg ) were determined using commercially available kits ( pars azmoon inc . , serum leptin concentration was measured by enzyme - linked immunosorbent assay ( elisa ) using a commercially available human leptin elisa kit ( mediagnost , reutlingen / germany , e07 ) . the inter- and intra - assay coefficients of variation were 6.8 and 2.55% , respectively . sob - r concentration was measured by elisa using a commercially available human sob - r elisa kit ( boster biological technology , ltd c. no . ek0439 ) composed of two monoclonal antibodies raised against the extracellular domain of sob - r . then , 100 l human leptin receptor standards and diluted samples were pipette into 96-well microtiter plates coated with antileptin receptor monoclonal antibody . after incubation at 37c for 90 min , the wells were washed 3 times and incubated at 37c for 30 min with the monoclonal antibody labeled with horseradish peroxidase . the wells were again washed 5 times and incubated at 37c in dark for 15 - 20 min with tetramethylbenzidine ( tmb ) regent . then , 100 l tmb stop solution was added to each well to stop the reaction , and finally , the absorbance at 450 nm is measured on a microtiter plate reader . the intensity of the color formed is directly proportional to the concentration of sob - r in the sample . a set of standards is used to plot a standard curve from which the amount of sob - r in patient samples and controls can be directly read . all the statistical analyses were performed using spss software for windows version 15.0 ( spss , inc . we used nonparametric test for the analysis , because the data were not normally distributed even after logarithmic transformation . thus , a significant difference among the serum levels of leptin , sob - r , anthropometric measurements and lipid profiles in breast cancer cases and control subjects were assessed by mann the association between breast cancer and serum levels of leptin , sob - r , anthropometric measurements and lipid profiles were determined as ors and 95% cis according to the unconditional logistic regression analysis . table 1 represents median , range , and 95% ci for age , anthropometric variables , sob - r , leptin and lipid profiles . leptin , hdl , and leptin / sob - r levels were significant higher , sob - r and tg levels were significant lower in breast cancer cases compared with the controls ( p < 0.02 and p < 0.001 , respectively ) . the levels of total cholesterol and ldl - c were not significantly difference between the two groups ( p > 0.05 , respectively ) . there were not significantly differences of age , and bmi in breast cancer cases compared with the controls ( p > 0.05 , respectively ) . medians , ranges and 95% ci of age , anthropometric , lep , sob - r , and lipid profiles in breast cancer cases and control subjects when we analyzed the whole study subjects combined [ table 2 ] , the serum sob - r level was negatively correlated with bmi , leptin and leptin / sob - r ratio ( p < 0.05 and p < 0.001 , respectively ) . on the other hand , the serum leptin level was positively correlated with bmi , and leptin / sob - r ratio ( p < 0.05 and p < 0.001 , respectively ) . in addition , serum leptin level was negatively correlated with tg and sob - r ( p < 0.05 and p < 0.001 , respectively ) . correlation coefficients of age , anthropometric , lep , sob - r , and lipid profiles in study subjects unconditional logistic regression models were used ( = 0.05 , = 0.1 ) to investigate the association between the risk of breast cancer and bmi , serum levels of leptin , sob - r and lipid profiles . results revealed that the high serum level of leptin , leptin / sob - r ratio , and hdl associated with breast cancer , and their corresponding odds ratios ( ors ) being 1.027(95% ci = 1.017 - 1.033 , p < 0.001 ) ; 1.028 ( 95% ci = 1.015 - 1.042 , p < 0.001 ) , and 1.063 ( 1.033 - 1.093 , p < 0.001 ) , respectively . an inverse association between serum level of sob - r and breast cancer was observed ( or = 0.983 , 95% however , bmi was not associated to breast cancer [ or = 0.945 , 95% ci = 0.886 - 1.0.09 , p = 0.090 ; table 3 ] . there were no significant association between any of the other variables including age , total cholesterol , ldl , and tg and breast cancer . association between breast cancer and serum levels of lep , sob - r and lipid profiles based on a case and control analysis table 1 represents median , range , and 95% ci for age , anthropometric variables , sob - r , leptin and lipid profiles . leptin , hdl , and leptin / sob - r levels were significant higher , sob - r and tg levels were significant lower in breast cancer cases compared with the controls ( p < 0.02 and p < 0.001 , respectively ) . the levels of total cholesterol and ldl - c were not significantly difference between the two groups ( p > 0.05 , respectively ) . there were not significantly differences of age , and bmi in breast cancer cases compared with the controls ( p > 0.05 , respectively ) . medians , ranges and 95% ci of age , anthropometric , lep , sob - r , and lipid profiles in breast cancer cases and control subjects when we analyzed the whole study subjects combined [ table 2 ] , the serum sob - r level was negatively correlated with bmi , leptin and leptin / sob - r ratio ( p < 0.05 and p < 0.001 , respectively ) . on the other hand , the serum leptin level was positively correlated with bmi , and leptin / sob - r ratio ( p < 0.05 and p < 0.001 , respectively ) . in addition , serum leptin level was negatively correlated with tg and sob - r ( p < 0.05 and p < 0.001 , respectively ) . correlation coefficients of age , anthropometric , lep , sob - r , and lipid profiles in study subjects unconditional logistic regression models were used ( = 0.05 , = 0.1 ) to investigate the association between the risk of breast cancer and bmi , serum levels of leptin , sob - r and lipid profiles . results revealed that the high serum level of leptin , leptin / sob - r ratio , and hdl associated with breast cancer , and their corresponding odds ratios ( ors ) being 1.027(95% ci = 1.017 - 1.033 , p < 0.001 ) ; 1.028 ( 95% ci = 1.015 - 1.042 , p < 0.001 ) , and 1.063 ( 1.033 - 1.093 , p an inverse association between serum level of sob - r and breast cancer was observed ( or = 0.983 , 95% ci = 0.969 - 0.997 , p = 0.015 ) . however , bmi was not associated to breast cancer [ or = 0.945 , 95% ci = 0.886 - 1.0.09 , p = 0.090 ; table 3 ] . there were no significant association between any of the other variables including age , total cholesterol , ldl , and tg and breast cancer . association between breast cancer and serum levels of lep , sob - r and lipid profiles based on a case and control analysis in this study , we observed a significant positive association between free leptin index ( fli ) and serum leptin levels with breast cancer risk . in addition , higher serum sob - r concentrations were found in healthy control subjects than the breast cancer cases . contrary , the serum level of leptin in breast cancer cases was significantly higher than those in healthy control subjects . we demonstrated relationships between serum level of sob - r and bmi , serum leptin and leptin / sob - r ratio . we found that the serum levels of leptin in breast cancer patients were significantly higher than those controls and leptin increased risk for breast cancer . these results were concordant with the findings of rahmati - yamchi et al . and niu et al . have reported that leptin increased risk for breast cancer in postmenopausal women , but had no relationship with onset of premenopausal breast cancer . in their study dieudonne et al . they found that mcf-7 cells expressed leptin receptor and leptin could influence the growth of human mammary cancer mcf-7 cells . okumura et al . investigated the effects of leptin on the mcf-7 line of human mammary cancer by evaluating cell doubling - up time , dna replication , levels of proteins associated to cell cycle and expression of protein kinase c isozyme , and reported that hyperleptinemia increased breast cancer cell proliferation through accelerated cell cycle progression . have reported that leptin stimulates the growth of breast cancer in the nude mice and promotes the proliferation and migration of mcf-7 human breast cancer cells through the extracellular - signal regulated kinase pathway . findings of several studies indicate that leptin is involved with different aspects of tumor pathology such as cell growth , angiogenesis and metastasis . a study of italian subjects documented that blood leptin levels in postmenopausal patients with er + breast cancer significantly correlated with pathological staging . similarly , a number of investigators observed higher blood leptin concentrations in breast cancer patients than in controls . in a study conducted by garofalo et al . , 92% of primary breast cancer cases and 83% of lymph node metastasis showed overexpression of leptin and ob - r , respectively in breast tumor tissues . in the same manner , jard et al . have reported significant overexpression leptin and ob - r in primary and metastatic breast cancer relative to noncancer tissues . they also observed that leptin positively correlated with ob - r in primary tumors and that the expression of both proteins was more abundant in high - grade tumors . in another study , mahabir et al . detected 85% and 75% overexpression of leptin and ob - r respectively in primary breast cancer cases , with the expression of leptin significantly correlated with that of ob - r . in addition , ob - r expression in cancer tissue was positively correlated with er status and tumor size . leptin provides its central and peripheral effects through binding to its receptor located on the cell surface . several isoforms of long- and short - forms of leptin receptors are expressed in humans . the long form of leptin receptor with the full length of intracellular domain is expressed primarily in the hypothalamus , and the short forms of leptin receptor ( ob - rs ) are typical for peripheral tissues . sob - r is an exceptional form , which includes exclusively of extracellular domain of membrane - bound leptin receptors . the function of sob - r is not completely understood , but believed to delays the clearance of leptin from the circulation and thus , increased leptin levels and bioavailability and as a consequence , potentiates its effect . on the other hand , the plasma levels of sob - rs one - way of characterizing the balance between leptin and sob - r is the fli , which is determined by calculating the ratio between the concentrations of leptin and sob - r . in obese children the levels of leptin are higher and the levels of sob - r are lower than in nonobese children . although originally , free leptin levels could be measured only by a gel filtration chromatography method , magni et al . reported that the ratio of circulating leptin to sob - r ( leptin / sob - r ) was strongly related to the percentage of body fat , and this ratio was thought to be an index of free leptin . in this study , moreover , to the best of our knowledge , this is the first report demonstrated leptin / sob - r ratio was positively correlated with leptin and hdl , and negatively correlated with tg , and sob - r levels in a sample of iranian subjects with breast cancer and controls . confirmed the existence of leptin - binding proteins and reported that in lean subjects the greater part of leptin circulated in the bound form , whereas in obese subjects , the greater part of leptin circulated as the free form . have reported that only free leptin was detectable in csf , suggesting that it was the biologically active form . observed that leptin - binding activity was correlated with levels of the sob - r and that sob - r was the major leptin - binding protein in the circulating human blood . to the best of our knowledge , ours is the first study to provide information about the association of serum levels of sob - r and leptin with breast cancer cases in a sample of iranian subjects . due to the limitations inherent in a case control study and low sample size , this study can not elucidate the mechanism or determine the direction of causality , further prospective studies with larger sample size are necessary to clarify the impact of fli and serum level of leptin on breast cancer risk . it is speculated that high fli and serum level of leptin rather than low serum level of sob - r was associated with the breast cancer in a sample of iranian population . ghorban mohammadzadeh coordinated the study , carried out the design , analyzed the data and prepared the manuscript . mohammad - ali ghaffari , provided assistance in the design of the study , coordinated all the experiments and participated in manuscript preparation . ahmad bafandeh , carried out the design , participated in most of the laboratory experiments and blood sampling . seyed - mohammad hosseini provided assistance for all experiments and participated in the patient 's selection for the study .

background : leptin plays a key role in the regulation of energy expenditure and is known to circulate in both free and bound forms . soluble leptin receptor ( sob - r ) is a unique circulating form of leptin receptor that can bind to leptin . leptin and leptin receptor have been implicated in processes leading to breast cancer initiation and progression . our study was aimed to investigate the relationship between serum levels of sob - r and leptin with breast cancer.materials and methods : serum leptin and sob - r levels were measured by enzyme - linked immunosorbent assay in 100 women with breast cancer cases compared with 100 age and body mass index ( bmi)-matched controls without cancer . lipid profiles were measured by enzymatic method.results:the median serum levels of sob - r in controls were significantly higher than that in breast cancer cases ( odds ratio [ or ] , 1.98 ; 95% confidence interval [ ci ] = 0.77 - 188.2 ) versus ( or , 0.140 ; 95% ci = 0.09 - 98.1 ) . conversely , the median serum level of leptin in breast cancer cases was significantly higher than that in controls ( or , 67.90 ; 95% ci = 2.77 - 129.9 ) vs. ( or , 28.30 ; 95% ci = 0.60 - 113.1 ) . breast cancer was significantly associated with higher serum level of leptin ( or = 1.027 , 95% ci = 1.017 - 1.038 ) . conversely , breast cancer was correlated with lower serum level of sob - r ( or = 0.983 , 95% ci = 0.969 - 0.997 ) . moreover , free leptin index ( fli ) ( leptin / sob - r ratio ) was associated with breast cancer ( or = 1.028 , 95% ci = 1.015 - 1.042 ) . the serum sob - r level was negatively associated with leptin , bmi , and high density lipoprotein ( r = 0.238 , 0.186 , and 0.168 , respectively).conclusion : our results suggested that fli and serum leptin level rather than serum level of sob - r was associated with the breast cancer .

INTRODUCTION MATERIALS AND METHODS Subjects Measurements Laboratory techniques Statistical analyses RESULTS Baseline characteristics Correlations between leptin, soluble leptin receptor, anthropometric and lipid profiles Correlations between leptin, soluble leptin receptor, and other measured variables and breast cancer DISCUSSION CONCLUSION AUTHORS CONTRIBUTION

to examine the relative cost - effectiveness of predictive genetic tests for familial breast and ovarian cancer provided by genetic services of western australia . the cost and outcomes of genetic testing was compared in first - degree relatives of known brca1/2 mutation - carriers who have a 50% risk of carrying the mutated gene ( intervention group ) to individuals with the same a priori risk but who do not undergo a genetic test ( control subjects ) . since genetic testing enables the restriction of intensive surveillance to individuals with an identified brca1/2 gene mutation , net savings in the period observed ( age 25 - 70 ) were $ 980-$1008 per woman in the ovarian intervention group and $ 1681-$1795 per woman in the breast intervention group , and delayed the onset of breast cancer ( 6mths brca1 , 3mths brca2 ) . compared to control subjects undergoing population surveillance , it was estimated the onset of breast cancer could be delayed at a total net cost of $ 3055 ( 5.1yrs ) to $ 3389 ( 3.2yrs ) for women in the breast intervention group with brca1/2 mutations . since population surveillance is not currently recommended for ovarian cancer , control subjects undergoing no surveillance were compared with the intervention group . the onset of ovarian cancer was delayed at a net cost of $ 1630 ( 3.5yrs ) to $ 2509 ( 1.2years ) for women with brca1/2 mutations . testing allows targeted high - level surveillance for gene mutation carriers , which ensures the cost - effective use of resources and reduces cancer - related morbidity if clinical recommendations for intervention are adopted .

aimto examine the relative cost - effectiveness of predictive genetic tests for familial breast and ovarian cancer provided by genetic services of western australia.methodsthe relative cost - effectiveness was assessed using a decision analytic model.resultsthe cost and outcomes of genetic testing was compared in first - degree relatives of known brca1/2 mutation - carriers who have a 50% risk of carrying the mutated gene ( intervention group ) to individuals with the same a priori risk but who do not undergo a genetic test ( control subjects).since genetic testing enables the restriction of intensive surveillance to individuals with an identified brca1/2 gene mutation , net savings in the period observed ( age 25 - 70 ) were $ 980-$1008 per woman in the ovarian intervention group and $ 1681-$1795 per woman in the breast intervention group , and delayed the onset of breast cancer ( 6mths brca1 , 3mths brca2).compared to control subjects undergoing population surveillance , it was estimated the onset of breast cancer could be delayed at a total net cost of $ 3055 ( 5.1yrs ) to $ 3389 ( 3.2yrs ) for women in the breast intervention group with brca1/2 mutations . since population surveillance is not currently recommended for ovarian cancer , control subjects undergoing no surveillance were compared with the intervention group . the onset of ovarian cancer was delayed at a net cost of $ 1630 ( 3.5yrs ) to $ 2509 ( 1.2years ) for women with brca1/2 mutations.conclusionstesting allows targeted high - level surveillance for gene mutation carriers , which ensures the cost - effective use of resources and reduces cancer - related morbidity if clinical recommendations for intervention are adopted .

Aim Methods Results Conclusions

recurrence and reflux are the 2 main postoperative remote complications of laparoscopic repair of the not - so - rare paraesophageal hernia ( peh ) . we concluded the same at a free paper presentation of a nonexhaustive nevertheless extensive narrative review of lap - peh repair at the semi - annual meeting ( 2004 ) of the ulster society of gastroenterology , a province - wide organization in northern ireland , uk . this study was carried out to determine the true incidence of recurrence after lap - peh repair . the paper search dates were from 1991 ( a year before the start of laparoscopic esophageal practice ) to february 2006 ( the time to collate the data ) . the national library of medicine ( nlm ) usa was indirectly accessed via its pubmed outlet . other search sources include embase , cochrane library , hand search , and personal communication . the key words used for database searches were laparoscopic , paraesophageal , hernia , recurrence in combinations . paper inclusion criteria included primary study , full text article , study involving lap - peh repair , n>25 ( learning curve estimated at 20 to 35 operations ) , > 6-month follow - up , recurrence addressed , and studies in the english language . studies describing repair of failed nissen fundoplication ( wrap migration ) alone , were excluded . no scoring system was used for quality grading ( due to the retrospective nature of the participating studies ) . section of the papers was considered only if directly explaining the original work . for multiple studies from the same institution , only the most recent study or the one with the highest sample power was used , as decided on the basis of consensus . the data were extracted on to summary sheets for instant access and then entered into microsoft excel 2003 . the chi - square test was used for pre- and post-2000 comparison , to calculate heterogeneity , and for alternate models ( p value accepted at 0.05 ) . all were retrospective case series ( level 4 evidence according to oxford centre for evidence - based medicine classification 2001 ) . the paper by wiechmann ( 2001 ) was counted as a pre-2000 study , because the evaluated data ranged from 1993 through 1997 . the critical appraisal revealed a general tendency among studies for lack of a clearly stated aim , selection bias ( underpowered ) , performance bias ( evolving technique over the decade ) , detection bias ( very high follow - up loss , deficiency of objective evidence like follow - up esophagogram or ct ) . there was no significant confounding due to extraneous factors like age , sex , race , and social class . summary of eligible trials * chi - square test for heterogeneity = 56.99 , df = 12 , p < 0.0001 . the overall incidence of recurrence from all patients ( n=965 ) was 10.2% ( mean of all studies=12.2% , median=9.4% , iqr=6.5 to18.1 ) , increasing to 14% ( mean of all eligible studies=16.8% , median=16.8% , iqr=8.5 to 21.18 ) among patients followed up ( n=658 ) . when only the patients with a follow - up esophagogram were considered ( n=301 ) , the true recurrence rate was 25.5% ( mean of all eligible studies=24.7% , median=27.1 , iqr=18.5 to 32.5 ) ( figure 1 ) . among pre-2000 studies , 26/305 recurrences ( 8.5% ) were seen compared with 73/ 660 ( 11% ) in post-2000 studies ( or=1.33 , rr=1.29 , p=0.2 ) ( table 2 ) . this suggests that the learning curve of the cumulative , all - inclusive experience over a decade is probably not the cause for the lack , or otherwise , of differences in the incidence of recurrence . detection of recurrence increases with the vigor of search from simple clinical follow - up to follow - up esophagogram ( 10.2% overall to 14% in simple follow - up to 25.5% in esophagogram cohort ) . comparison of recurrence rate in pre-2000 and post-2000 studies ( 8.52% vs 11% p = 0.27 ) , suggesting lack of improvement over a decade the plotted graphs revealed broad confidence intervals , touching the line of no - effect suggesting an increased chance factor . clinical heterogeneity existed among plotted individual studies shown by lack of overlap between dot - and - line results ( figure 2 ) . statistical heterogeneity was shown by chi - square=56.99 with degrees of freedom ( df)=12 ( p<0.0001 ) . for the outcome of interest ( ie , incidence of recurrence ) however , this heterogeneity has been ignored . visual heterogeneity is revealed by lack of overlap between lines . believed to be a combination of selection , performance , and detection bias . for sensitivity analysis , 2 alternate models were constructed . in the first ( table 3 ) , all patients who had esophageal lengthening ( added collis - nissen procedure ) were isolated and compared with those with conventional repair ( sac excision , cruroplasty , non - collis - nissen fundoplication ) . it revealed 816 conventional repairs with 99 recurrences ( 12% ) as opposed to 0/149 in the collisnissen group ( p<0.0001 ) . . recurrence rate for gastroplasty vs non - gastroplasty repairs within the given study ( p < 0.0001 ) in the second ( hypothetical ) model ( table 4 ) , the worst - case scenario ( wcs ) was applied in which all recurrences in a given study were attributed to the collis - nissen group . the collis - nissen group had an incidence of recurrence of 23/149 ( 15.4% ) ( or=1.77 , rr=1.65 , p=0.03 ) . sensitivity analysis of studies with esophageal lengthening ( collis or collis - nissen gastroplasty ) using a hypothetical worst case scenario ( wcs ) * recurrences in the given study were attributed to the gastroplasty and the recurrence rate determined for gastroplasty vs nongastroplasty repairs within the given study ( 9.3% vs 15.4% , p = 0.03 ) . however , for this single - issue metaanalysis , no randomized trials were available to address the knowledge gap about the incidence of arguably the most important outcome parameter of lap - peh repair . the methodological flaws in the participating studies were not sufficient to prevent insight into the recurrence rate . the initial studies dwelled on immediate outcome like injuries , conversion , mortality , and above all length of stay . the technique has evolved over the last decade of the 20th century , moving from simple reduction and cruroplasty to detailed sac excision , esophageal mobilization , and synthetic or biological mesh implants . recently ( since 1998 ) esophageal lengthening with procedures like collis gastroplasty coupled with nissen fundoplication have been used . even with low hierarchy evidence , we thought a meta - analysis was an appropriate means to explore the recurrence issue due to peh being uncommon if not rare . in the participating studies , the authors have concentrated on the hiatus repair by suture , synthetic mesh , and biological small intestinal submucosal ( sis ) patches . the recurrence has not been searched for specifically at the follow - up , and contrast esophagogram has been performed on a symptom - driven basis . because a majority of recurrence is believed to be asymptomatic , detection bias results from lack of specific imaging . the attrition rate ( loss of follow - up ) has been high among the studies , further contributing to this problem . unless the papers were appraised , it was difficult to determine whether the quoted recurrence rate is from the overall cohort or from the stringently followed up patients . some authors have used esophageal lengthening , and it appears to confer benefit to the repair . it is possible that the hiatoplasty may need to be coupled with an esophageal lengthening procedure . the most important outcome parameter for lap - peh repair has not been quantified thus far . mandatory ( protocol ) follow - up esophagogram at ( for example ) 1 year would provide a tool for detection of recurrence . in addition to conventional hiatoplasty , there may be an additional emphasis point in achieving a tension - free secure repair in the form of esophageal lengthening .

background : recurrence and reflux are 2 most important remote complications of lap - paraesophageal hernia ( peh ) repair . however , the extent of recurrence remains unknown . we sought to determine the true incidence of recurrence after lap - peh repair.methods:a meta - analysis was carried out . pubmed , embase , cochrane library , hand search , and personal communication were used to access and appraise studies . the inclusion criteria were full - text papers published from 1991 to date that describe lap - peh repair in > 25 patients , have at least a 6-month follow - up , and address the issue of recurrence . wrap migration papers were excluded . papers were appraised and the data were isolated on summary sheets . ms office excel 2003 was used to plot the results and represent it in graphs.results:thirteen studies were eligible ( all retrospective case series ) . a total of 965 patients with 99 recurrences were noted . the overall recurrence rate ( in all patients ) was 10.2% and was 14% if only the followed up patients ( n=658/965 ) were considered . however , when patients with objective evidence ( follow - up ba esophagogram ) were used ( 301/965 ) , the true recurrence rate was 25.5% ( ie , 1 in 4 recurred ) . the learning curve did not appear to be an issue ( p=0.27 ) . the studies revealed broad 95 ci and touched the line - of - no - effect , thereby increasing the chance factor . when an alternate model was applied , esophageal lengthening ( by collis - nissen gastroplasty ) revealed a significant protective influence ( p<0.0001).conclusion : the true incidence of lap - peh recurrence is 25.5% . the learning curve is not an adequate explanation . mandatory ( protocol ) follow - up esophagograms at 1 year are essential . two emphasis points in the repair have emerged : hiatoplasty and ( superadded ) esophageal lengthening .

INTRODUCTION METHODS RESULTS DISCUSSION CONCLUSION

mucoepidermoid carcinoma was first described as a separate entity in 1945 by stewart et al . and is most commonly found in the salivary gland[24 ] bronchi,[59 ] and liver . a total of seven cases have been reported , and we report herein the eighth case and review the literature on the previous cases . a 63-year - old woman was admitted to our hospital , following a 5-year history of left upper abdominal pain and abdominal distension ( the second affiliated hospital , school of medicine , zhejiang university , hangzhou , china , 2011 ) . computed tomography ( ct ) scan performed by a local physician 1 week before admission revealed suspected pancreatic cancer . she was then referred to our hospital for further examination and treatment . at the time of admission , she complained of loss of appetite and nausea , but no jaundice was found . the serum levels of carbohydrate antigen 19 - 9 ( ca19 - 9 ) was elevated at 500.1u / ml ( with normal range less than 37 u / ml ) . the serum level of carcinoembryonic antigen ( cea ) , squamous cell carcinoma antigen , alpha - fetoproteins , and neuron - specific enolase were not elevated . computed tomography scan revealed a solid mass , approximately 4.5 cm in diameter , located at the left upper abdomen . the tumor was irregular in shape , and appeared to arise from the distal pancreas [ figure 1a ] . the tumor was irregular in shape , and appeared to arise from the distal pancreas.(b)a splenic artery aneurysm existed near celiac trunk a laparotomy was performed and we found that the tumor arised from the pancreatic body and tail without breaking pancreatic capsule the distal pancreas , spleen , and its aneurysm were resected [ figures 2a and 2b ] . ( a ) the specimen removed from the pancreas , the tumor arised from the distal pancreas without breaking pancreatic capsule . ( b ) the specimen of the splenic artery aneurysm was near celiac trunk on pathologic examination , the size and the cut surface showed a milky - white solid and homogeneous tumor with a hard elastic consistency . the tumor consisted of three types of cells , the majority being poorly differentiated adenocarcinoma cells with mucin products in their cytoplasm , and some moderately differentiated adenocarcinoma with a tendency to form ducts . these epidermoid cells did not have definite intercellular bridges , keratohyaline , or keratin pearls . no differentiated squamous carcinoma cells were detected in any part of the tumor [ figure 3 ] . ( h and e , 100 ) the tumor consisted of three types of cells , the majority being poorly differentiated adenocarcinoma cells with mucin products in their cytoplasm , and some moderately differentiated adenocarcinoma with a tendency to form ducts . in addition , there were epidermoid cells and intermediate undifferentiated cells the cells of the tumor showed strong staining with antibodies to ck7 , ck5/6 , and cea , showed negative staining for ck20 , the proliferation index by ki-67 stain was above 30% . the postoperative course was uneventful and the patient was discharged 2 weeks after the surgery . gemcitabine was used once but the patient had severe gastrointestinal side - effects , then she underwent oral xeloda for five cycles . a laparotomy was performed and we found that the tumor arised from the pancreatic body and tail without breaking pancreatic capsule . the distal pancreas , spleen , and its aneurysm were resected [ figures 2a and 2b ] . ( a ) the specimen removed from the pancreas , the tumor arised from the distal pancreas without breaking pancreatic capsule . on pathologic examination , the size and the cut surface showed a milky - white solid and homogeneous tumor with a hard elastic consistency . the tumor consisted of three types of cells , the majority being poorly differentiated adenocarcinoma cells with mucin products in their cytoplasm , and some moderately differentiated adenocarcinoma with a tendency to form ducts . these epidermoid cells did not have definite intercellular bridges , keratohyaline , or keratin pearls . no differentiated squamous carcinoma cells were detected in any part of the tumor [ figure 3 ] . ( h and e , 100 ) the tumor consisted of three types of cells , the majority being poorly differentiated adenocarcinoma cells with mucin products in their cytoplasm , and some moderately differentiated adenocarcinoma with a tendency to form ducts . the cells of the tumor showed strong staining with antibodies to ck7 , ck5/6 , and cea , showed negative staining for ck20 , the proliferation index by ki-67 stain was above 30% . the postoperative course was uneventful and the patient was discharged 2 weeks after the surgery . gemcitabine was used once but the patient had severe gastrointestinal side - effects , then she underwent oral xeloda for five cycles . the first documented case of mucoepidermoid carcinoma of pancreas was reported in 1959 by franz . ohtsuki et al . suggested four hypotheses to account for the pathogenesis of the squamous component in pancreatic cancer , namely : ( 1 ) from pluripotent undifferentiated cells into mucin - producing cells and/or squamous cells ; ( 2 ) from ectopic squamous cells ; ( 3 ) from metaplastic squamous cells ; and ( 4 ) from the squamous metaplasia of underlying adenocarcinoma . in our report , the mucoepidermoid cells stained positively for ck7 , cea , and ck5/6 , but negatively for ck 20 . based on the ck immunoprofile , considering the present case , thus , a close follow - up is needed , to allow early treatment in case of recurrence . ct or us ( ultrasound ) imaging is hard to distinguish mucoepidermoid carcinoma from the other types of pancreatic tumors before operation . for our case , though the mass can be identified on the body and tail of pancreas , we can not judge the specific from the preoperative imaging . only seven cases of mucoepidermoid carcinoma of the pancreas have been reported , except that of our patient [ table 1 ] . the ages of the patients ranged from 48 to 69 years , with the median age of 60.5 years , and five were male and three female . the tumors were located at different sites of the pancreas ( two at the head , three at the body , two at the tail , and one at the body and tail ) and were all larger than 3.5 cm in diameter at the time of diagnosis . all cases were advanced and every tumor grew invasively except our case , with six of the eight cases showing metastatic lesions in the liver and/or lymph nodes . only one case was survival more than 11 months in previous cases and our patient merely survived for 12 months . based on the experience of this case , surgery seems to be only modality which brings the hope of cure if the mass is resectable . cases of mucoepidermoid carcinoma of the pancreas mucoepidermoid carcinoma is thought to be a subtype of adenosquamous carcinoma , histologically characterized by the presence of two components : an adenocarcinoma and a squamous carcinoma , but stewart et al . mucoepidermoid carcinoma is composed of three types of cells , including mucin - producing cells , epidermoid cells , and cells intermediate between basal cells and epidermoid cells , mixed in various proportions . as far as mucoepidermoid carcinoma of pancreas be concerned , ordinary tubular and/or papillary adenocarcinomatous structure would not be detected in the pancreatic lesion , and cancer cells can produce mucin . ultrastructural examination shows that some of the cancer cells possess intracytoplasmic lumina surrounded by bundles of tonofilaments , squamous , and undifferentiated cells with transitional forms . our case should be designated as mucoepidermoid carcinoma rather than adenosquamous carcinoma which are composed of mucin - producing cells , epidermoid cells , and cells intermediate between basal cells and epidermoid cells . in summary , mucoepidermoid carcinoma of pancreas can not be differentiated from pancreatic adenocarcinoma by the preoperative examination , and surgery is still the only effective treatment if the mass was resectable . due to limited cases of this disease reported , the effective diagnostic and therapeutic approach can not be figured out .

mucoepidermoid carcinoma of the pancreas is rare . here , a 63-year - old woman with left upper abdominal pain and abdominal distension is presented . her mucoepidermoid carcinoma was located at the left upper abdomen , arising from the pancreatic body and tail without invasion of pancreatic capsule . on pathologic examination , the tumor consisted of three types of cells , the majority being poorly differentiated adenocarcinoma cells with mucin products in their cytoplasm , and some moderately differentiated adenocarcinoma with a tendency to form ducts . in addition , there were epidermoid cells and intermediate undifferentiated cells . she survived for 12 months after surgery .

INTRODUCTION CASE REPORT Operative findings Pathologic examination Immunohistochemical findings DISCUSSION CONCLUSIONS

the managers of the brazilian public health system have implemented measures to strengthen primary health care in all regions of the country , because primary care is considered the gateway for brazilian users1 , 2 . the primary care policy mandates that health services expand their activities and improve the quality of life for individuals1 . to achieve this goal , primary care networks should promote health , prevent disease and injury , minimize the burdens of disease , and reduce the demands on secondary and tertiary care services1 , 3 . back pain , and especially lower back pain , has high global prevalence , and some cases may become chronic if not treated4 . this type of chronic pain can lead to work absenteeism , reduced productivity , and diminished quality of life and functionality , among other consequences5,6,7,8 . thus , chronic pain has become a costly public health problem with a negative impact on life , and it is important for the brazilian public health system to include in its primary care policy the means for preventing and treating chronic pain . back school is a program of health education that aims to reduce injury and improve the functionality and quality of life for individuals with chronic musculoskeletal pain , especially pain in the spine , through proper implementation of activities of daily living ( adl)9,10,11 . this program is compatible with the principles of the brazilian public health system . however , there are few reports that address back school in this system12 , and research has predominantly focused on secondary and tertiary care services from a biomedical perspective5,6,7,8 . moreover , current literature13 indicates that most research involving back school methodology used evaluation questionnaires for pain intensity , quality of life , and functionality to determine the impact of the program14 . few reports have considered the effects of back school on the performance of adl . therefore , this study investigated the effects of back school on the performance of adl , pain , and related aspects , as well as functionality in users with chronic musculoskeletal pain in a basic health unit ( bhu ) in porto alegre . with this information , a back school program , as proposed by forssell9 , this study was approved by the research ethics committee of the hospital de clinicas de porto alegre ( n. 100354 ) and complied with resolution 196/96 of the national health council . to set the sample size , the calculation used a confidence level of 95% , a maximum average estimated error of 5% ( 6.47 ) , and a standard deviation ( 1.06 ) of the primary variable ( evaluation of dynamic posture in adl ) obtained from the literature16 . thus , it was determined that a minimum of 41 subjects were required to fulfill the purposes of the present study . in anticipation of losses and refusals , the inclusion criteria were the presence of chronic musculoskeletal pain and a referral from a doctor in the bhu . the ages ranged from 35 to 75 years , and the mean age was 57.04 10.38 . most participants ( 38.6% ) were 6070 years old and had less education ; 50% had completed basic education , and 29.5% listed household or custodial services as their occupation . table 1table 1.pretreatment demographicspercentageage categories < 50 years ( n=10)22.7%5060 years ( n=13)29.5%6070 years ( n=17)38.6%>70 years ( n=4)9.2%schooling basic education ( n=21)50%middle education ( n=13)29.5%higher education ( n=9)20.5%occupationstanding activities ( n=6)13.6%sitting activities ( n=7)15.9%household or custodial services ( n=13)29.5%retirees ( n=10)22.7%housewife ( n=8)18.3% lists the characteristics of the subjects . to evaluate dynamic posture , two instruments were used : the layout for assessing dynamic posture ( lady)17 and the observational instrument for adl ( oi - adl ) through video18 . the lady was used to assess posture when the participants were lifting objects from the ground , sitting down to write , or sitting on a bench . the evaluation used a script that required the user to move around the room while performing the adl requested in their usual manner . the activity was recorded on a video camera ( sony dcr - dvd201 model ) and subsequently recorded on cds for analysis . each instrument used four to nine predefined criteria for evaluation of each adl , with a score of 0 if the task was performed or 1 if it was not . pre- and posttest assessments were conducted by a researcher in a healthcare field who was familiar with the instruments , and blinded as to whether the evaluation was performed before or after testing . anamnesis was used to collect personal data and other relevant information , including the duration of pain , the number of pain - related symptoms , and the main source of pain , which was defined in this study as the most intense and frequent pain . the anamnesis also included a body chart to assist users in correctly identifying the site of pain . pain intensity was measured using the visual analogue scale ( vas ) , which was presented as a straight , horizontal , 10-cm non - numeric line . the left end indicated no pain , and the right end indicated unbearable pain . functionality was evaluated with the oswestry disability index ( odi ) , a questionnaire validated for portuguese by vigatto et al19 . this questionnaire consists of 10 questions designed to identify the extent to which pain interferes with the performance of certain activities , such as walking and lifting , without focusing on the psychological consequences of pain . the questionnaire scores range from 0 , for no pain or disability , to 100 , for the worst possible pain and disability . the odi divides disability into five categories with a score ranging from 20100 points : minimal ( 120 ) , moderate ( 2140 ) , severe ( 4160 ) , crippling ( 6180 ) , and bed - bound ( 81100 ) . the evaluations were performed in a bhu in porto alegre . in each back school group , the following experimental design was developed for an eight - week program : in the first week prior to starting back school , users registered on the waiting list were called for initial assessment ( pretest ) . users who agreed to participate signed a consent form and were evaluated by anamnesis , odi , and adl filming . from the second to the seventh weeks , the back school intervention was conducted . finally , in the eighth week , after the conclusion of back school , all users were reassessed ( posttest ) using the same tools as in the pretest . back school consisted of five two - hour theoretical and practical meetings held once a week in groups of five to seven members . during the first hour , the mostly theoretical aspects related to posture were presented ; during each class , theoretical and experiential themes that addressed specific aspects related to posture and postural care were defined , and proper ways of performing the most common adl were presented . during the second hour , body awareness exercises were performed , including stretching , muscle strengthening , and relaxation , as well as massage activities and self - massage14 . statistical software package spss ( 20.0 ) for windows was used for statistical analysis . descriptive statistics were provided for absolute and relative frequencies , means , standard deviations , medians , and 25th and 75th percentiles ; inferential statistics used the paired t - test for parametric data and the wilcoxon test for non - parametric data . these analyses were done to compare the pre- and posttests for performance of adl , pain intensity , and functionality . with respect to duration , 76.7% had pain for a year or more , and the remainder ( 23.3% ) had pain for three months to a year , indicating that the entire sample had chronic musculoskeletal pain . most users had two ( 38.6% ) to three pain - related symptoms ( 36.4% ) . lumbar region pain was reported most often ( 75% ) by the study participants , but 90% of those users also complained of pain in another region of the body . the main pain , defined as the most frequent and intense , was also mostly located in the lumbar spine ( 50% ) , followed by the cervical spine ( 27.3% ) . table 2table 2.median and 25th and 75th percentiles of pre- and posttest adl scoresadl ( points)pretestposttestmedian ( 25th and 75th)median ( 25th and 75th)lifting objects from the ground ( 04)2 ( 1.253)3 ( 2.254 ) * sitting to write ( 08)2.5 ( 15)4 ( 2.255 ) * sitting posture ( 04)3 ( 34)3 ( 34)sitting on a bench ( 06)3 ( 35)4 ( 46 ) * total score ( 022)12 ( 914.75)15 ( 1217)**p<0.05 shows the medians and 25th and 75th percentile values of the pre- and posttest adl scores . a significant difference was observed for the performance of lifting objects from the ground , sitting down to write , and sitting on a bench . based on a total of 22 points , the user percentile score was 54.5 on the pretest and 68.1 on the posttest , which was obtained by summing the scores of the four adl tasks . the adl task of sitting down to write showed the lowest scores ( table 2 ) . there was also a significant decrease in the intensity of pain in the five body regions evaluated ( table 3table 3.mean and standard deviation , median , and 25th and 75th percentiles for pain intensity pre- and posttestbody regionpretestposttestmean sdmedian ( 25th and 75th)mean sdmedian ( 25th and 75th)cervical ( n=20)5.86 3.015.4 ( 4.058.5)3.15 2.42 * 3.55 ( 0.554.7)dorsal(n=10)7.19 2.567.45 ( 4.9710)1.21 1.69 * 0.25 ( 02.7)lumbar(n=33)5.37 3.055.1 ( 3.47.85)3.06 2.67 * 2.9 ( 0.554.85)upper limbs(n=14)6.4 2.56.8 ( 4.428)2.81 3.75 * 0.55 ( 08)lower limbs(n=21)6.3 2.937 ( 3.19.05)2.29 2.96 * 0.55 ( 08 ) parametric variables : paired t - test . . * p<0.05 table 4table 4.mean and standard deviation , median , and 25th and 75th percentiles for the odi pre- and posttestvariablepretestposttestmean sdmedian ( 25th and 75th)mean sdmedian ( 25th and 75th)odi26.14 11.3728 ( 2032)18.19 9.95 * 18 ( 1026 ) parametric variables : paired t - test . there was less functional disability reported on the odi questionnaire , and the average disability of the group improved from moderate to minimal . the results of this study indicate that the back school program was effective in teaching the proper performance of adl tasks of lifting objects from the ground , sitting down to write , and sitting on a bench . as described in the program , back school was only ineffective in teaching proper sitting posture . few studies have used instruments that analyzed adl performance to examine the impact of the back school program , and none was conducted in individuals with chronic musculoskeletal pain , making it difficult to compare studies . two studies used the oi - adl through video18 to verify the effect of back school in a population of schoolchildren . candotti et al.20 used the oi - adl through video to determine the influence of the back school program on adolescents , and found significant differences in all adl analyzed , including sitting posture . ritter et al.21 conducted a similar study with elementary school students and also found a significant difference in sitting posture . however , back school programs in these studies provided 12 and 20 lessons , respectively , and included healthy individuals , or patients with no chronic pain . the use of videos to assess dynamic posture is an appropriate strategy for determining whether there is improvement in the performance of adl in an intervention that aims to achieve healthy postural habits . the use of a questionnaire for the assessment of adl , despite being an important method due to its ability to systematically record subjective perceptions , its ease of use , and its low cost22 , may cause bias in the results because the responses are highly dependent on participant perceptions and cognitive levels . moreover , these questionnaires are not able to verify the incorporation of theoretical knowledge by the individual and how this knowledge is transferred to movement23 , which is possible by filming the dynamic posture24 , 25 . the posture adopted in the adl determines the amount and distribution of stress on the bone structure , muscles , tendons , ligaments , and joints , and can potentiate or ameliorate the burdens imposed on the vertebral column26 . for example , straker27 stated that use of improper posture to lift an object from the ground leads to increased shear forces on the spine , and ligament stress is 50% to 75% greater than with proper posture with knees and hips flexed . improper posture , with flexion of the trunk , tends to accentuate the harm resulting from prolonged and continuous sitting , resulting in pain , fatigue , and even degenerative processes , such as spinal disc herniation28 , 29 . thus , the findings of this study are relevant because of the numerous negative effects caused by incorrect adl postures . good postural habits are important for proper functioning of the musculoskeletal system30 , and poor postural behaviors may be a risk factor for nonspecific chronic back pain16 and postural changes28 . the proper use of body mechanics , simulated in the back school classes , allows for better adjustments of the musculoskeletal system through better balance and distribution of effort required to perform adl , and can mitigate pain and degenerative processes31 ; however , this mitigation depends on complex interactions between biomechanical and neuromuscular functions30 . postural habits are deeply embedded in the organization of movements and in the mind , and interventions that seek to change poor postural habits must create situations that allow reflection , as well as understanding of the postures and movements32 . it is also necessary to consider the psychological and cultural implications involved in acquiring a postural habit . for a habit to change , individuals must develop the ability to observe the sensations generated by their movements and to interpret them , which is the intent of back school intervention . this type of methodology allows for greater user autonomy in solving problems related to posture in daily life . essential educational activities , such as those in this study , aim to promote proper postures through habit change . these activities are an important means of promoting health , and should be offered in the form of programs that address lifestyles and behaviors that perpetuate or worsen health problems and can be modified by individuals32 . the findings of this study corroborate those of others that demonstrate the positive influence of back school interventions on pain intensity5 , 7 , 8 . however , these studies only assessed pain in the lumbar spine , probably because this methodology was created as a postural training method used in the treatment of lumbar pain patients9 . however , this limitation makes it difficult to compare the results with those for other body regions33 . chronic low back pain is a frequent complaint , and is the second most frequently reported chronic disease in brazil , according to the national household survey3 . in the present study , the lumbar region was the most frequently reported region of pain ; however , 90% of users also had pain in other regions of the body . thus , it is important to examine other types of pain , because the back school methodology also proved to be effective for reducing pain in regions other than the lumbar spine . the results also indicate that back school was effective for improving functionality , which corroborates the findings of other literature7 , 8 . according to morone et al.7 , participants in an educational program such as back school can learn to manage different daily tasks without developing pain , which can reduce the severity and recurrence of new episodes . the national primary care policy in brazil promotes program development and implementation of activities that focus on the most common health problems , as well as educational interventions for various diseases . these activities should focus on groups and behavioral risk factors , both dietary and environmental , to prevent disease and injury1 . thus , group programs such as back school , which can reduce public spending for individual treatment , and are geared toward problems prevalent in the population , should be encouraged in primary care . studies evaluating these programs are essential to verify their legitimacy in improving the health of users and to identify strategies that can be effective for chronic problems such as musculoskeletal pain . comparing results with a control group is important because it helps to eliminate bias in the results ( i.e. , the effectiveness of the program may be related to spontaneous improvement in the users ) , which is a limitation of the present study . another limitation was the lack of medium- and long - term follow - up . however , we chose to conduct the study without a control group because back school is held in a primary care setting ; the staff of the unit decided that it was not appropriate to deny the service to a user who was not a subject in the study . moreover , the entire sample was composed of users with chronic musculoskeletal pain ; the majority of users ( 76.7% ) had experienced pain for a year or more and had previously sought other treatment . further research is required to assess the effects of back school , both in comparison with usual care , and to assess the medium- and long - term results . the program improved the performance of adl and functionality in users with chronic musculoskeletal pain in a bhu in porto alegre . back school was only ineffective in reeducation for proper sitting posture , and new strategies are needed for this variable . programs such as back school should be developed in primary care , with a focus on solving problems prevalent in the population . group health education using easily applicable assessment instruments is important in reducing public spending on health , and can improve the health and well - being of the population .

[ purpose ] primary care is considered the gateway to the brazilian public health system and is responsible for managing the most prevalent problems in the population . in this study , the effects of back school on pain , functionality , and the performance of activities of daily living ( adl ) in users with chronic musculoskeletal pain were evaluated . [ subjects and methods ] forty - four users ( 33 females and 11 males ) participated in back school , with five two - hour theoretical and practical meetings held once a week . the assessment instruments used were as follows : ( a ) a circuit evaluation of posture dynamics recorded on video , ( b ) an observational instrument of adl using video , ( c ) anamnesis , ( d ) the visual analogue scale , and ( e ) the oswestry disability index . [ results ] the results showed decreased pain intensity , improved functionality , and the recovery of adl . [ conclusion ] the back school program is an effective health education strategy for users with chronic musculoskeletal pain .

INTRODUCTION SUBJECTS AND METHODS RESULTS DISCUSSION

significant systemic stress responses to pain and airway stimulation can occur during this period , including agitation and cough , which may cause hypertension , tachycardia , and increased intracranial hypertension.1 this not only greatly increases the discomfort of patients but it also increases the rates of angiocardiopathy and other side effects . gacouin et al2 evaluated 203 patients pain using a visual analog scale ( vas ) , and they found > 73% of patients experienced moderate or severe pain during extubation . traditionally , anesthetic withdrawal involves discontinuing both propofol and remifentanil , which can result in pain experienced by patients in an unawakened state and which can lead to a stress response induced by the tracheal catheter . this widely increases the probability of dysphoria and adverse reactions during the peri - extubation period . therefore , it is extremely important to identify a method to effectively reduce the stress response during peri - extubation . remifentanil is a new ultra - short - acting opioid -receptor stimulant , with rapid onset and offset activity , which can also be rapidly hydrolyzed in tissue and blood with no dependence on liver and kidney function.3 continuous infusion of remifentanil has no prolonged context - sensitive half - time or cumulative effects,4 which makes it easier to maintain a stable concentration at the effect site . therefore , remifentanil is widely used for clinical anesthesia.5 remifentanil not only has an anesthetic and analgesic effect but it can also reduce the incidence of respiratory depression and other adverse reactions . the use of a continuous infusion of remifentanil after total intravenous anesthesia has multiple advantages , as remifentanil can be used to control excessive stress responses.6 aouad et al7 showed that the use of a small dose of remifentanil did not prolong the time taken to wake up from anesthesia , and it decreased the occurrence of cough during the emergence phase . as a previous study showed , the use of remifentanil often results in postoperative discomfort and hyperalgesia.8 therefore , a long - acting postoperative analgesic is of urgent need to avoid postoperative hyperalgesia and pain caused by remifentanil . parecoxib is a new nonsteroidal anti - inflammatory drug ( nsaid ) that has selective cyclooxygenase-2 inhibitory activity , strong anti - inflammatory analgesic activity , long - term efficacy,8 and minimal cardiovascular risk.9 many studies have shown that nsaids can ameliorate the side effects caused by opioids , including respiratory depression , nausea , emesis , and somnolence,10 so parecoxib is often used as a postoperative analgesic . until now the stress response that occurs during major surgeries is not only related to the irritation caused by the endotracheal tube but also to the surgical stimulation of patients during the emergence phase . therefore , this study aimed to explore the combined effect of parecoxib with different doses of remifentanil on hemodynamic vital signs and stress responses to extubation . we obtained approval from the institutional review board of the first affiliated hospital of kunming medical university , people s republic of china , and written informed consent from the patients . a total of 120 patients with american society of anesthesiologists scores of i or ii , who were 2050 years old and weighed 4075 kg , were selected to take part in the study , which involved elective thyroidectomy with general anesthesia and tracheal intubation . patients with the following characteristics were excluded from the study : patients with an allergy to opioids or nsaids , hypertension , a history of ischemic heart disease , or a history of cerebrovascular disease . the included patients were randomly divided into four groups with 30 patients per group : control group , low - dose remifentanil group ( r1 ) , medium - dose remifentanil group ( r2 ) , and high - dose remifentanil group ( r3 ) . after entering the operating room , the blood pressure ( bp ) , heart rate ( hr ) , respiratory rate ( r ) , and peripheral arterial oxygen saturation ( spo2 ) of each patient were routinely monitored . the venous channel was opened and an isotonic saline solution ( 10 ml / kg / h ) was administered . after the patient reached a stable condition , anesthesia induction was performed . for the patients in all four groups , this involved the intravenous infusion of fentanyl ( 4 g / kg ) , rocuronium bromide ( 0.6 mg / kg ) , and propofol ( 2.5 mg / kg ) . then anesthesia was maintained using a venous perfusion of propofol ( 612 mg / kg / h ) and remifentanil ( 0.10.5 g / kg / min ) before the incision suture . when suturing the incision , the patients in all four groups received an intravenous infusion of parecoxib ( 40 mg ) and an intravenous drip of tropisetron ( 4 mg ) . the patients in the control group received an isotonic saline injection ( instead of propofol and remifentanil ) . in contrast , the patients in groups r1 , r2 , and r3 were treated with intravenous remifentanil at 0.1 g / kg / min , 0.2 g / kg / min , and 0.3 g / kg / min , respectively . after the operation , the patients responses to commands were monitored every 2 min . patients who could open their eyes on command and responded to commands were assessed as being conscious . extubation and discontinuation of remifentanil were initiated when the patients had the following conditions : response to commands , spontaneous respiration , deglutition reflex , tidal volume > 8 ml / kg , respiratory rate > 10 times / min , and spo2 > 95% . the bp , hr , r , and spo2 of each patient were monitored before anesthesia induction ( at baseline ) , and these indexes were also monitored when the patient was in a waking state , at extubation , and at 2 , 5 , 10 , and 15 min after extubation . the emergence time was defined as the time between discontinuation of propofol and the point at which the patient regained consciousness . anesthesia- , extubation- , and remifentanil - related adverse reactions were also recorded , which included intraoperative awareness , comfort level during extubation , cough , laryngospasm , encephalalgia , dizziness , nausea , emesis , uroschesis , and skin pruritus . furthermore , the sedation - agitation scale ( sas ; 1 = unarousable ; 7 = dangerous agitation)11 and the pain vas at 0 min ( i.e. , the time at which the patient regained consciousness ) , and 5 , 10 , and 15 min after recovery of consciousness , were recorded to evaluate the patients sedation levels . the qualitative data are presented as frequencies ( with percentages ) , and comparison among the groups was performed using chi - square tests with = 0.05 . the normally distributed data are presented as mean standard deviation , and comparison among the groups was performed using one - way analysis of variance ( anova ) . the non - normally distributed data are presented as medians ( with ranges ) , and comparison among the groups was performed using nonparametric tests . repeated - measures analyses of the effects of the different treatments and times on the sas and vas scores were performed using generalized estimating equations ( gees ) . we selected = 0.05 as the standard level of significance and so p < 0.05 was considered statistically significant . we obtained approval from the institutional review board of the first affiliated hospital of kunming medical university , people s republic of china , and written informed consent from the patients . a total of 120 patients with american society of anesthesiologists scores of i or ii , who were 2050 years old and weighed 4075 kg , were selected to take part in the study , which involved elective thyroidectomy with general anesthesia and tracheal intubation . patients with the following characteristics were excluded from the study : patients with an allergy to opioids or nsaids , hypertension , a history of ischemic heart disease , or a history of cerebrovascular disease . the included patients were randomly divided into four groups with 30 patients per group : control group , low - dose remifentanil group ( r1 ) , medium - dose remifentanil group ( r2 ) , and high - dose remifentanil group ( r3 ) . after entering the operating room , the blood pressure ( bp ) , heart rate ( hr ) , respiratory rate ( r ) , and peripheral arterial oxygen saturation ( spo2 ) of each patient were routinely monitored . the venous channel was opened and an isotonic saline solution ( 10 ml / kg / h ) was administered . after the patient reached a stable condition , anesthesia induction was performed . for the patients in all four groups , this involved the intravenous infusion of fentanyl ( 4 g / kg ) , rocuronium bromide ( 0.6 mg / kg ) , and propofol ( 2.5 mg / kg ) . then anesthesia was maintained using a venous perfusion of propofol ( 612 mg / kg / h ) and remifentanil ( 0.10.5 g / kg / min ) before the incision suture . when suturing the incision , the patients in all four groups received an intravenous infusion of parecoxib ( 40 mg ) and an intravenous drip of tropisetron ( 4 mg ) . the patients in the control group received an isotonic saline injection ( instead of propofol and remifentanil ) . in contrast , the patients in groups r1 , r2 , and r3 were treated with intravenous remifentanil at 0.1 g / kg / min , 0.2 g / kg / min , and 0.3 g / kg / min , respectively . patients who could open their eyes on command and responded to commands were assessed as being conscious . extubation and discontinuation of remifentanil were initiated when the patients had the following conditions : response to commands , spontaneous respiration , deglutition reflex , tidal volume > 8 ml / kg , respiratory rate > 10 times / min , and spo2 > 95% . the bp , hr , r , and spo2 of each patient were monitored before anesthesia induction ( at baseline ) , and these indexes were also monitored when the patient was in a waking state , at extubation , and at 2 , 5 , 10 , and 15 min after extubation . the emergence time was defined as the time between discontinuation of propofol and the point at which the patient regained consciousness . anesthesia- , extubation- , and remifentanil - related adverse reactions were also recorded , which included intraoperative awareness , comfort level during extubation , cough , laryngospasm , encephalalgia , dizziness , nausea , emesis , uroschesis , and skin pruritus . furthermore , the sedation - agitation scale ( sas ; 1 = unarousable ; 7 = dangerous agitation)11 and the pain vas at 0 min ( i.e. , the time at which the patient regained consciousness ) , and 5 , 10 , and 15 min after recovery of consciousness , were recorded to evaluate the patients sedation levels . the qualitative data are presented as frequencies ( with percentages ) , and comparison among the groups was performed using chi - square tests with = 0.05 . the normally distributed data are presented as mean standard deviation , and comparison among the groups was performed using one - way analysis of variance ( anova ) . the non - normally distributed data are presented as medians ( with ranges ) , and comparison among the groups was performed using nonparametric tests . repeated - measures analyses of the effects of the different treatments and times on the sas and vas scores were performed using generalized estimating equations ( gees ) . we selected = 0.05 as the standard level of significance and so p < 0.05 was considered statistically significant . in this study , 120 patients were selected and there were 30 patients in each group . as shown , gender , age , surgical time , nausea , emesis , dizziness , headache , intraoperative awareness , and uroschesis in the control , r1 , r2 , and r3 groups were not significantly different ( table 1 ) . the emergence and extubation times were different among the groups , with increases in remifentanil dose , and considerably longer times in group r2 ( remifentanil at 0.2 g / kg / min ) and group r3 ( remifentanil at 0.3 g / kg / min ) compared to the time in group r1 ( remifentanil at 0.1 g / kg / min ) and control group ( p < 0.05 ) . the number of patients with a cough in each group decreased with remifentanil dose , and the differences were significant ( 21 in the control group , 18 in group r1 , 8 in group r2 , and 3 in group r3 , p = 0.000 ) . the number of patients with respiratory depression was higher in the group with the highest dose of remifentanil ( 1 in groups r1 and r2 and 7 in group r3 , p = 0.002 ) . the number of patients in each group unknown about the extubation increased with the remifentanil dose , and all the patients in groups r2 and r3 knew about extubation ( 14 , 25 , 30 , and 30 in the control , r1 , r2 , and r3 groups , respectively , p = 0.000 ) . only 10% of patients in group r3 had bradycardia and 9% of patients in the control group experienced intolerable discomfort with extubation . a small number of patients in the control and low - dose remifentanil groups were aware but did not experience discomfort ( 13.3% ) or experienced tolerable discomfort ( 10% ) ( table 1 ) . these results indicated that continuous postoperative infusion of remifentanil can not only reduce coughing and discomfort responses to extubation but they can also increase respiratory depression and bradycardia . the sas and vas scores of the patients in each group were recorded at emergence time ( 0 min ) and at 5 , 10 , and 15 min after emergence . these data were analyzed using gees , and the results are shown in tables 25 , respectively . there were significant differences in the sas scores among the groups ( wald = 17.986 , p = 0.000 ) , and the odds ratios ( ors ) of groups r1 , r2 , and r3 were 0.163 , 0.246 , and 0.887 , respectively , compared with the control group , indicating that the sas score decreased with the remifentanil dose . the sas scores at different times were also statistically different ( wald = 74.983 , p = 0.000 ) , and the ors at 5 , 10 , and 15 min were 0.004 , 0.000 , and 0.000 , respectively , compared with at 0 min , indicating that the sas scores increased with time after emergence . furthermore , the vas score analysis showed that the vas score was associated with the remifentanil dose ( wald = 32.668 , p = 0.000 ) and time ( wald = 142.554 , p = 0.000 ) . the vas score was highest in group r1 ( or = 10.298 , 5.183 , and 5.844 in groups r1 , r2 , and r3 , respectively ) and it increased with time ( or = 0.031 , 0.007 , and 0.002 at 5 , 10 , and 15 min , respectively ) . the cardiovascular vital signs ( systolic and diastolic bp , hr , r , and spo2 ) of the patients in each group were monitored at baseline , emergence , extubation , and 2 , 5 , 10 , and 15 min after extubation . compared with baseline , the systolic and diastolic bp , hr , and spo2 in the control group all clearly increased at emergence , extubation , and after extubation ( p < 0.05 ) , but r was significantly reduced at emergence , extubation , and after extubation ( p < 0.05 ) . in the r1 group , the diastolic bp decreased only 5 min after extubation ( p < 0.05 ) and hr dramatically increased at extubation ( p < 0.05 ) . systolic and diastolic bp decreased at emergence in the r2 and r3 groups ( p < 0.05 ) . hr increased 5 min after extubation in the r2 group ( p < 0.05 ) , and it decreased at emergence but increased at 5 , 10 , and 15 min after extubation in the r3 group ( p < 0.05 ) . the r and spo2 decreased and increased , respectively , in the r1 , r2 , and r3 groups ( p < 0.05 ) . compared with the control group , the systolic and diastolic bp in the remifentanil groups was significantly lower at emergence , extubation , and 2 and 5 min after extubation ( p < 0.05 ) . the hr of the remifentanil groups greatly decreased at emergence , extubation , and 2 min after extubation ( p < 0.05 ) . these results suggest that postoperative remifentanil infusions can decrease the rise in systolic and diastolic bp , hr , and r at emergence and extubation , and they showed that the effect of a high dose of remifentanil on these variables was longer and better . many studies have been carried out to explore the methods that can effectively alleviate stress responses , agitation , and discomfort due to tracheal extubation during the emergence time from general anesthesia . vasoactive drugs , such as esmolol and ebrantil , can be used to inhibit cardiovascular responses to tracheal extubation . however , they can only improve tachycardia and hyperpiesia , and fail to inhibit the intense stimulation of the trachea by the tracheal catheter and to effectively stop the agitation and discomfort during the peri - extubation period.12 long - acting opioid analgesics , such as fentanyl , sufentanil , and dezocine , have been used during the peri - extubation period to inhibit stress responses and discomfort , and they have been shown to have some effect . however , the controllability of long - acting opioid analgesics is poor due to longer elimination half - life and prolonged context - sensitive half - life . the use of fentanyl can not only reduce stress responses but it can also induce respiratory depression and delay recovery.13 remifentanil is a new kind of ultra - short - acting opioid analgesic . it has many advantages such as rapid onset , shorter elimination half - life , no accumulation after long - term application , no effect caused by impaired hepatorenal function , and no prolonged context - sensitive half - life.14,15 therefore , remifentanil may be the most easily controllable opioid analgesic . in our study , continuous injection of remifentanil after surgery decreased the number of patients with coughs and increased the patients comfort during emergence from general anesthesia and extubation , though it also prolonged the emergence and extubation times . furthermore , the patients treated with remifentanil had no significant adverse effects such as nausea , emesis , dizziness , headache , or uroschesis . the occurrence rates of cough and discomfort were effectively reduced , and there was no obvious occurrence of respiratory depression or bradycardia among the patients treated with remifentanil at 0.2 g / kg / min after surgery . the fact that continuous injection of remifentanil after surgery can inhibit airway reflex and attenuate the stimulus of tracheal tube may account for the result.7,16 previous research has suggested that remifentanil does not cause a decrease in the bispectral index value,17 which may be inversely correlated with the level of analgesia.18 the sas and vas results in this study showed that the sedative and analgesic effects were enhanced by increased doses of remifentanil , indicating that continuous postoperative infusion of remifentanil can effectively relieve postoperative pain.19 in addition , the analysis of hemodynamic vital signs showed that continuous postoperative infusion of remifentanil inhibited the elevation of systolic and diastolic bp during the peri - extubation period and that using a high dose of remifentanil ( 0.3 g / kg / min ) delayed the rise in hr . this demonstrates that the postoperative use of a low dose of remifentanil can ameliorate any changes in bp and hr during the peri - extubation period , and it has beneficial effects on hemodynamic stability.20 however , the sedative and analgesic effects and hemodynamic stability were not only enhanced with the dose of remifentanil , but they also reduced with time , which suggests that the comfort of patients during the peri - extubation period was associated with the remifentanil dose21 and its short time of offset.22 moreover , the slight changes in bp and hr caused by remifentanil can return to their original levels within 510 min without treatment.23 in our study , we showed that continuous infusion of remifentanil during peri - extubation period can effectively suppress stress and coughing responses and improve patients comfort during the emergence phase . furthermore , use of remifentanil at 0.2 g / kg / min reduced the rate of side effects compared to that at 0.3 g / kg / min , and it may be appropriate for inhibiting stress responses to tracheal extubation under general anesthesia . therefore , continuous postoperative infusion of remifentanil at a dose of 0.2 g / kg / min may be safe and comfort for tracheal extubation .

purposethe study aimed to assess the combined effects of parecoxib with three different doses of remifentanil and its effect on the stress and cough responses following tracheal extubation under general anesthesia.methodsa total of 120 patients with american society of anesthesiologists ( asa ) scores of i or ii , undergoing selective thyroidectomy with total intravenous anesthesia ( propofol - remifentanil ) and tracheal intubation , were randomly allocated to be treated with an intravenous injection of parecoxib and a continuous infusion of remifentanil at 0.1 g / kg / min ( r1 ) , 0.2 g / kg / min ( r2 ) , 0.3 g / kg / min ( r3 ) , or an isotonic saline injection ( the control group ) . hemodynamic vital signs , emergence time , extubation time , sedation - agitation scale ( sas ) score , pain visual analog scale ( vas ) score , occurrence of coughing , and side effects were recorded before surgery and during the peri - extubation period . the vital signs included blood pressure ( bp ) , heart rate ( hr ) , respiratory rate ( r ) , and peripheral arterial oxygen saturation ( spo2).resultsbp , hr , the occurrence rate of coughing , and extubation awareness decreased with the dose of remifentanil , and the differences among the groups were significant ( p < 0.05 ) . emergence and extubation time increased with the dose of remifentanil , and the differences among the groups were significant ( p < 0.05 ) . the occurrence rates of respiratory depression and bradycardia in group r3 were significantly higher than those in other groups ( p < 0.05 ) . sas and vas were lowest in group r3 , and the differences among the groups were significant ( p < 0.05 ) . bp , hr , sas , and vas increased with time in the remifentanil groups.conclusionthe combined use of parecoxib and a moderate dose of remifentanil can effectively suppress the stress and coughing responses during the peri - extubation period . the appropriate quantity of remifentanil was found to be 0.2 g / kg / min , as this dosage caused no side effects .

Introduction Patients and methods Patients Procedure Observation indexes Statistical analysis Results Discussion Conclusion

diabetes mellitus ( dm ) as a chronic metabolic disease is one of the most prevalent causes of mortality in low - income and middle - income countries ( 1 ) . , it has been proven that oral cavity can act as a primary site for dissemination of microorganisms including candida species ( 2 ) . oral candidiasis is one of the most common opportunistic infections in patients with diabetes and immunodeficiency ( 3 ) . according to a report by mohammadi r , et al . in iran , from 855 yeast strains isolated from different clinical specimens , candida albicans was the predominant species ( 58.6% ) followed by c. parapsilosis ( 11.0% ) , c. glabrata ( 8.3% ) , c. tropicalis ( 7.0% ) , c. kefyr ( 5.8% ) , c. krusei ( 4.4% ) , c. orthopsilosis ( 2.1% ) and c. guilliermondii ( 0.6% ) . a few strains of c. lusitaniae , c. rugosa , c. intermedia , c. inconspicua , c. neoformans and s. cerevisiae were isolated ( 4 ) . although c. albicans is the most common cause of candidiasis , but 12 to 14 species of non - albicans candida are known to cause such infections . albicans candida species ( nacs ) such as c. tropicalis , c. parapsilosis , c. krusei and c. glabrata have repeatedly emerged as human pathogens ( 4 ) . candida species , especially c. albicans tend to colonize oral cavities , secrete hydrolytic enzymes and cause inflammation and hyperplasia of the gums and mouth , which can lead to discomfort , pain and disseminated infection in patients with impaired immune system . candida species secrete different lytic enzymes such as phospholipases , esterases and hemolysin factor which digest surface membrane of the host cells , facilitate binding and penetration of microorganisms into the host tissue and contribute to tissue invasion , thus play important roles in candida pathogenicity ( 5 ) . hemolysin of candida species is amidst the most frequently studied enzymes produced by fungi , which is released during iron acquisition and facilitates the hyphal invasion in disseminated candidiasis ( 6 ) . to our knowledge , secretion of hemolysin by candida isolates from patients with diabetes had not been studied before . detection of secretory enzymes in candida strains isolated from dm can be an important step for management of these patients . additionally , most previous researches focused on c. albicans . isolate , identify and compare enzymatic activities in candida species isolated from diabetic and non- diabetic patients referred to imam sajjad diabetes center evaluate enzymatic activity in both c. albicans and nacs , especially c. glabrata , c. tropicalis and c. krusei . ninety - five patients with diabetes mellitus ( 35 men and 60 women ) and 95 healthy volunteers ( 42 men and 53 women ) were included in the study and matched for age , sex , dental status and smoking habits . the study protocol was approved by the research ethics committee ( ahvaz jundishapur university of medical sciences ) . selected patients from local outpatient diabetes clinics aged 10 to 85 years . after getting informed consent , patients referred to imam sajjad diabetes center ( dehdasht - iran , 2013 ) were sampled using sterile swabs . swab samples were dispensed onto chromagar media ( chromagar tm candida , paris , france ) and incubated at 37c for 48 hours . candida species were determined by colony color on chromagar medium , germ tube test , growth at 45c and microscopic morphology after growing on corn meal agar medium . esterase activity was measured using the tween 80 opacity test medium , which was prepared with 10 g of bacteriological peptone ( merck , germany ) , 5 g of sodium chloride , 0.1 g of calcium chloride , 15 g of agar and 1000 ml of distilled water . after , the medium was autoclaved ; it was cooled to about 50c and was added 5 ml of autoclaved tween 80 ( merck , germany ) . the colony diameter ( a ) and the diameter of colony plus precipitation zone ( b ) were measured . the esterase activities were expressed as ez value ( a / b ) as described by price et al . hemolysin production was evaluated using a modification of the plate assay described by manns et al . , the isolates cultured on sabouraud glucose agar were spot inoculated on a sugar - enriched sheep blood agar medium to yield a circular inoculation site of about 5 mm in diameter . the latter medium was prepared by adding 5 - 7 ml of fresh sheep blood ( darvash co. iran ) to 100 ml of sabouraud glucose agar supplemented with 3% glucose ( merck , germany ) . the ratio of the diameter of the colony to that of the translucent zone of hemolysis ( in mm ) was used as the hemolytic index ( hz value ) ( 9 ) . ninety - five patients with diabetes mellitus ( 35 men and 60 women ) and 95 healthy volunteers ( 42 men and 53 women ) were included in the study and matched for age , sex , dental status and smoking habits . the study protocol was approved by the research ethics committee ( ahvaz jundishapur university of medical sciences ) . selected patients from local outpatient diabetes clinics aged 10 to 85 years . after getting informed consent , patients referred to imam sajjad diabetes center ( dehdasht - iran , 2013 ) were sampled using sterile swabs . swab samples were dispensed onto chromagar media ( chromagar tm candida , paris , france ) and incubated at 37c for 48 hours . candida species were determined by colony color on chromagar medium , germ tube test , growth at 45c and microscopic morphology after growing on corn meal agar medium . esterase activity was measured using the tween 80 opacity test medium , which was prepared with 10 g of bacteriological peptone ( merck , germany ) , 5 g of sodium chloride , 0.1 g of calcium chloride , 15 g of agar and 1000 ml of distilled water . after , the medium was autoclaved ; it was cooled to about 50c and was added 5 ml of autoclaved tween 80 ( merck , germany ) . all inoculations were performed in duplicate . the colony diameter ( a ) and the diameter of colony plus precipitation zone ( b ) were measured . the esterase activities were expressed as ez value ( a / b ) as described by price et al . hemolysin production was evaluated using a modification of the plate assay described by manns et al . , the isolates cultured on sabouraud glucose agar were spot inoculated on a sugar - enriched sheep blood agar medium to yield a circular inoculation site of about 5 mm in diameter . the latter medium was prepared by adding 5 - 7 ml of fresh sheep blood ( darvash co. iran ) to 100 ml of sabouraud glucose agar supplemented with 3% glucose ( merck , germany ) . the ratio of the diameter of the colony to that of the translucent zone of hemolysis ( in mm ) was used as the hemolytic index ( hz value ) ( 9 ) . candida spp . were isolated from 57 patients with diabetes ( 60% ) and 24 non - diabetic persons ( 25.5% ) . the oral carriage of c. albicans in the diabetic group ( n = 42 ; 66.7% ) was significantly greater than that in the control group ( n = 16 ; 57.1% ) ( chi - square test , p = 0.05 ) . other candida species isolated included c. glabrata ( 9 isolates from dm and four from control groups ) , c. dubliniensis ( eight isolates from dm and four from control groups ) , c. krusei ( four isolate from dm and the control group ) ( table 1 ) . hemolytic activity was detected in 100% and 52% of the isolates from diabetic and non - diabetic groups . although 75% of c. albicans isolates from non - diabetic group produced hemolysin , the total hemolysin activity of candida species was significantly higher in diabetic group than non - diabetic group ( table 2 ) . after grading esterase activity in various candida species , it was found that only c. glabrata and c. albicans were able to demonstrate esterase activity at + 3 level . in non - diabetic , 50% of c. glabrata and c. krusei produced esterase at + 1 level , although all of c. dubliniensis and 87.5% of c. albicans produced it at + 2 level ( figure 1 ) ( table 3 ) . score of esterase : + 1 = 0.7 - 0.99 ; + 2 = 0.4 - 0.69 ; + 3 = 0.1 - 0.39 . the purpose of this research was to identify and assess various species of candida in oral cavity of diabetic and non - diabetic individuals and to compare their virulence factors such as esterase and hemolysin enzymes with the assumption that virulence factors of candida species isolated from diabetic patients are higher than the control group . in this research , candida was isolated from 60% of diabetic patients versus 25.5% of normal subjects . in patients with dm , due to reduced salivary flow , increased blood glucose concentration and decreased saliva ph the possibility of adherence and colonization of candida is increased in mouth . the results of this study confirmed previous studies ( 2 , 10 , 11 ) . based on previous studies , the most common pathogen obtained in adults with oral mucosal was c. albicans ( 11 ) . the oral carriage of c. albicans in the diabetic group ( n = 42 ; 66.7% ) was significantly greater than the control group ( n = 16 ; 57.1 % ) ( chi - square test , p , 0.05 ) . manfredi et al . reported that candida grew out from the oral of diabetic subjects and non - diabetics by 60.5% and 57.3% , respectively ( 11 ) . the highest growth rates related to c. albicans from the oral cavity of diabetic subjects ( 83.3% ) and normal group ( 76.9% ) . in our study , the percentage of c. albicans isolates from both groups was lower than report of manfredi et al . ( 11 ) . these results may be due to lower average age of our subjects , living conditions and some host dietary habits . however , soysa et al . in a study on diabetic patients reported isolation of c. albicans between 18 - 80% , which is in accordance with our results ( 12 ) . in this research , isolated 18.2% c. dubliniensis from insulin - dependent diabetics ( 13 ) , while manfredi ( 11 ) , showed it 3.5% . previously , it was thought that this species of candida is only separated from patients with hiv . four c. glabrata isolates were isolated from each of the two groups of patients and controls . isolation of these species was higher in healthy subjects than patients with diabetes ( table 1 ) . hemolysin activity in our study was significantly higher in the diabetic group than the control group . hemolytic activity was assayed in c. albicans , c. dubliniensis , c. glabrata and c. krusei as 0.72 , 0.59 , 0.65 and 0.79 , respectively . hemolytic activity was detected in 100% of the candida species in diabetic group , while only 52% of candida isolates in non - diabetic group showed hemolytic activity . of course , 75% of c. the hemolytic activity of c. albicans was significantly higher than that of non - c . albicans candida isolates ( p = 0.0001 ) in control group , but was not in the diabetic group ( table 2 ) . albicans isolates in patients with diabetes may possess greater virulence potential than non - albicans species in the control group . found that c. albicans does not show any hemolytic activity when there is no glucose available in the medium . therefore , it can be predicted that increasing glucose concentrations in saliva would enhance hemolysin production , adhesion and colonization of candida species in oral cavity of diabetic subjects ( 8) . in this study , each of the candida species in diabetic group significantly showed higher hemolytic activity the same as normal subjects . shimizu et al . injected them into mice and examined the virulence of different strains and confirmed that production of extracellular enzymes by candida isolated from patients with diabetes is higher than normal individuals ( 14 ) . they showed the ability of candida species in production of one or both hemolysins , but there was no quantitative report regarding the hemolytic activity of candida species in patients with diabetes ( 15 ) and our research was the first in this regard . aktas et al . evaluated esterase activity in different species of candida qualitatively . in this study , almost all species produced sediment in tween 80 opacity test medium after 2 - 10 days ( 16 ) . this test is confirmed by other researchers , because it is convenient , economical and easy to perform ( 17 ) . qualitatively surveyed the esterase activity of candida species isolated from immunocompromised hosts ( 18 ) . slifkim believed that due to lack of esterase production on tween 80 opacity test medium by c. dubliniensis could identify c. dubliniensis from c. albicans , whereas in our study 100% of c. dubliniensis produced esterase . in our study , esterase activity was quantitatively evaluated . 21.6% of c. albicans strains and 33.3% of c. glabrata strains isolated from patients with diabetes produced esterase at level + 3 , whereas these two species in the control group showed esterase activity at levels + 1 and + 2 ( table 3 ) . it is concluded that esterase and hemolytic activities of candida in patients with diabetes are higher than healthy subjects , but some species such as c. glabrata act similar to c. albicans in diabetes .

background : diabetes mellitus as a chronic metabolic disease occurs in patients with partial or complete deficiency of insulin secretion or disorder in action of insulin on tissue . the disease is known to provide conditions for overgrowth of candida species . candida spp . cause candidiasis by many virulence factors such as esterase , hemolysin and phospholipase.objectives:this study aimed to compare esterase and hemolytic activity in various candida species isolated from oral cavity of diabetic and non - diabetic individuals.patients and methods : swab samples were taken from 95 patients with diabetes ( 35 men and 60 women ) and 95 normal persons ( 42 men and 53 women ) and cultured on sabouraud dextrose agar . identification of isolated yeasts was performed by germ tube test , morphology on chromagar candida medium , corn meal agar and ability to grow at 45c . hemolysin activity was evaluated using blood plate assay and esterase activity was determined using the tween 80 opacity test.results:different candida species were isolated from 57 ( 60% ) diabetic and 24 ( 25% ) non - diabetic individuals . esterase activity was detected in all candida isolates . only 21.6% of c. albicans from patients with diabetes had esterase activity as + 3 , while it ranged from + 1 to + 2 in others . hemolytic activity was determined in c. albicans , c. dubliniensis , c. glabrata and c. krusei as 0.79 , 0.58 , 0.66 and 0.74 , respectively . hemolytic activity was significantly different in the two groups of diabetics and non-diabetics.conclusions:oral carriage of c. albicans in the diabetic group ( n = 42 ; 66.7% ) was significantly greater than the control group ( n = 16 ; 57.1% ) . esterase activity of c. albicans in diabetic group was higher than non - diabetic group . although c. albicans remains the most frequently pathogenic yeast for human , but other species are increasing .

1. Background 2. Objectives 3. Patients and Methods 3.1. Patients 3.2. Candida Isolates 3.3. Esterase Assay 3.4. Hemolysin Assay 4. Results 5. Discussion

since the pathogenic association of antiphospholipid antibody ( apl ) with recurrent spontaneous abortions ( rsa ) was reported , the efficacy of anticoagulant therapy for patients that have undergone rsa and have positive apl has been investigated [ 14 ] . regarding test items of apls for rsa , an international consensus statement concerning the update of the classification criteria for definite antiphospholipid syndrome ( aps ) , published in february 2006 , specified only anticardiolipin antibody ( acl ) of igg and/or igm isotype in a medium or high titer ( over the 99th percentile ) , anticardiolipin-2 glycoprotein - i antibody ( a2gpi ) of igg and/or igm isotype ( over the 99th percentile ) , and lupus anticoagulant ( la ) . for these patients met with above laboratory criteria and clinical criteria for aps , a treatment combining oral aspirin with the subcutaneous injection of unfractionated heparin has been regarded as superior to aspirin alone [ 6 , 7 ] . however , various other apls , such as antiphosphatidylserine antibody ( aps ) , antiphosphatidylethanolamine antibody ( ape ) [ 9 , 10 ] , and others have been considered to be involved in the etiology of rsa , but these apls are not mentioned in these revised classification criteria . moreover , the relevance of isotypes , titer , or the number of positive apls in rsa has not been clarified . in fact , we see many rsa patients , not met the criteria for aps , but had one or more positive apl . in the meantime , as for the detection of apls , laboratory criteria are not always reproducible because of well - known inter- and/or intralaboratory variability . in japan , a few facilities are testing apls in their own laboratory and in many other facilities , apls are measured by commercial - based laboratory reporting the 95th percentile and more as positive result , so the interpretation of the result needs to be careful . on the other hand , almost all rsa patients with one or more positive apl ( the 95th percentile and more ) prefer actively to be introduced an anticoagulant therapy for their next pregnancy . given the above background , we examined ape and aps of igg and igm antibodies in addition to la , a2gpi , and acl described in the classification criteria for definite aps and investigated the impact of antibody titers by classifying them into weakly ( from the 95th to the 99th percentile ) and strongly ( over the 99th percentile ) , antibody isotypes of igg and igm , and the numbers of positive antibodies of single and multiple on reproductive outcome . we designed this retrospective cohort study , and our study focused on the incidence of various apls with rsa patients , measured by commercial - based laboratory and the impact of their profiles on reproductive outcomes with active anticoagulant therapy in order to develop individualization of treatment for patients with rsa , because the subcutaneous injection of heparin requires daily self - injection during the entire period of pregnancy , so this treatment is very stressful for patients . this retrospective cohort study was designed to evaluate the incidence of various apls , measured by commercial - based laboratory , in patients that had undergone rsa and to determine whether apl profiles affect reproductive outcomes with the anticoagulant therapy in order to develop individualization of treatment in these patients . records were evaluated for 327 patients that had undergone rsa who visited the outpatient infertility clinic in jikei university hospital between november 2005 and july 2009 . these patients had suffered 2 or more consecutive spontaneous abortions before the 12th week of gestation (= rsa patients ) and were examined by routine checkup for rsa . then , 64 patients were positive for routine checkup that included anatomical , endocrine , or chromosomal aberration , complications of sle , or other autoimmune diseases . of 263 patients negative for routine checkup , various apls were measured by commercial - based laboratory , defined 95th percentile and more as positive . then 132 patients were negative for any apls and 131 patients revealed positive for one or more apl . these 131 patients were treated with the anticoagulant therapy , following which , 82 patients conceived . of the 82 cases of conception , 74 maintained pregnancy successfully , and 8 cases had a miscarriage before the 12th week of pregnancy . among these miscarriages , therefore , with the exception of the case involving chromosomal aberration , a total of 81 cases were analyzed for reproductive outcomes with the anticoagulant therapy . pregnancy maintenance was defined as the pregnancy continuing beyond the 24th week and resulting in the delivery of a live - born neonate . figure 1 shows a summary of the patient groups and numbers investigated the incidences of apls and the reproductive outcomes with the anticoagulant therapy . peripheral blood was drawn from the patients with negative routine checkup for rsa and various apls in serum and plasma were measured . the test items concerning apls included la , a2gpi , acl - igg and -igm , ape - igg and -igm , and aps - igg and -igm . a commercial - based laboratory test company , srl laboratory ( tokyo , japan ) , measured all these apls . la was measured by the dilute russell 's viper venom time method using a kit from gradipore ltd . ( australia ) , and a control clotting time ratio ( control individual plasma clotting time / control pooled plasma clotting time ) corresponding to the 95th percentile of the value was defined as 1.12 , and almost the 99th percentile was 1.3 in normal japanese population ; therefore , the values were divided into two groups , from 1.12 to 1.3 as weakly positive and higher than 1.3 as strongly positive . a a2gpi was measured by elisa [ 14 , 15 ] using a kit from yamasa co. ( japan ) , and values from 1.9 ( the 95th percentile ) to 3.5 ( almost the 99th percentile ) u / ml were regarded as weakly positive and those higher than 3.5 u / ml as strongly positive . acl - igg was measured by elisa using a mesacup - igg kit ( mbl co. , ltd . , japan ) , and values from 10 u / ml corresponding to the 95th percentile to 20 u / ml ( almost the 99th percentile ) were regarded as weakly positive and those higher than 20 u / ml as strongly positive . ( japan ) , and values from 1.0 u / ml corresponding to the 95th percentile to 2.0 u / ml ( almost the 99th percentile ) were regarded as weakly positive and those higher than 2.0 u / ml as strongly positive . ape - igg , ape - igm , aps - igg , and aps - igm were measured as previously described [ 15 , 16 ] , and values from 0.300 , 0.450 , 1.0 , and 1.0 iu / ml , corresponding to the 95th percentile , respectively , calculated from 200 nonpregnant women , to 0.450 , 0.750 , 1.66 , and 1.66 u / ml ( almost the 99th percentile ) , were regarded as weakly positive [ 16 , 17 ] and those higher than the 99th percentile were regarded as strongly positive . so , in this study , if the test items are 95th percentile and more , the result is defined as positive and anticoagulant therapy was actively introduced . we performed anticoagulant therapy for all patients with one or more apls positive rsa women . a daily dose of 100 mg of aspirin was taken orally from prior to conception until the 32nd week of pregnancy , and subcutaneous self - injection of 5,000 units of unfractionated heparin calcium was administered twice a day , starting from the time when the presence of the gestational sac was confirmed in the uterus until the 37th week of pregnancy . written informed consent concerning the application of anticoagulant therapies was obtained and the choice between these two regimens was left to patients . differences between the two groups were analyzed for significance with the or fisher exact test . the incidence of various apl profiles in two hundreds and sixty - three rsa patients without anatomical , endocrine , or chromosomal aberration , complication of sle or other autoimmune diseases , was shown in table 1 . of these 263 patients , the mean age was 33.5 4.7 years , and the mean number of spontaneous abortions was 2.87 1.03 . concerning individual apl without regarding the titer ( weakly or strongly ) , the positive ( the 95th percentile and more ) rate of aps - igm ( 73/263 : 27.8% ) was the highest , followed by acl - igm ( 71/263 : 27.0% ) , la ( 47/263 : 17.9% ) , pe - igg and -igm ( 31/263 : 11.8% ) , acl - igg ( 23/263 : 8.7% ) , aps - igg ( 17/263 : 6.5% ) , and finally a2gpi ( 1/263 : 0.4% ) . as for the incidence of apls by isotype , in both acl and aps , igm - isotype was more frequent than igg - isotype and in ape , igm - isotype and igg - isotype have the same frequency . as for the incidence of apls by the titer , in the weakly positive group ( from the 95th to the 99th percentile ) , the positive rates of apl ranged from 0.4% ( 1/263 : a2gpi ) to 19.4% ( 51/263 : aps - igm ) , and in the strongly positive group ( over the 99th percentile ) , those of apl ranged from 0% ( 0/263 : a2gpi ) to 8.4% ( 22/263 : aps - igm ) . comparing the incidence between these two groups , a higher incidence was found in the weakly positive group in all species of apls naturally . the impact of various apl profiles on reproductive outcomes was shown in tables 2 and 3 . of the 131 patients treated with the active anticoagulant therapy by the method mentioned above , 82 cases led to conception . after the exclusion of one case with chromosomal aberration of aborted villi , 81 cases were finally analyzed for reproductive outcomes . for these 81 patients , the mean age was 33.8 4.0 years , and the mean number of spontaneous abortions was 2.8 0.9 . when the 81 patients were divided into 74 cases of successfully maintained pregnancy and 7 cases of abortion , the mean ages were 33.8 4.1 and 34.4 4.0 years , and the mean numbers of spontaneous abortions were 2.8 1.0 and 2.7 0.8 , respectively . no significant differences were found between these groups . concerning the variety of apls without titer , the rate of pregnancy maintenance of 88.1% ( 37/42 ) in aps - igm positive cases was the lowest among the various apls . for instance , the p value of the difference between acl - igg ( the highest rate of pregnancy maintenance : 100% ) and aps - igm ( the lowest rate of pregnancy maintenance : 88.1% ) was 0.176 , and that of acl - igg versus aps - igg was 0.277 . as for the impact of the titer of apls , comparing the rate of pregnancy maintenance in the weakly positive group with that in the strongly positive group for each apl , no significant difference was found among the six apls ( igg and igm of acl , ape , and aps ) , and la or a2gpi strongly positive case was not here . for instance , the lowest p value between weakly and strongly positive groups was 0.312 for ape - igg . as for the isotype ( igg or igm group ) and the number ( single positive or multiple positive group ) of positive apls , the impact of these on reproductive outcomes was investigated . the igm group contained 40 cases with only igm - positive results and the igg group contained 41 cases with at least one igg - positive result . the rate of pregnancy maintenance in the igm group was 90% ( 36/40 ) , and that in the igg group was 92.7% ( 37/41 ) , showing no significant difference between these two groups ( p value : 0.667 ) . as for the number of positive apls , the rate of pregnancy maintenance in the 34 cases with a single positive group , with only one positive apl , was 91.2% ( 31/34 ) and that in 47 cases with multiple positive group , with two or more positive apls , was 91.5% ( 43/47 ) , also showing no significant difference between these two groups ( p value : 0.961 ) . finally , we intended to identify a therapeutic principle for rsa patients with apl . table 4 showed how the two regimens of anticoagulant therapy , aspirin alone and aspirin plus heparin , impacted on the reproductive outcomes , showing the results for the isotype of positive apls or the number of positive apls . there was a tendency for the rate of pregnancy maintenance with aspirin alone to be lower than that with aspirin plus heparin in the igg group however , this did not constitute a significant difference ( p value : 0.077 ) . in igm , single positive and multiple positive group , there was no difference in pregnancy maintenance rate between these two regimens . in the field of obstetrics , aps has been mainly investigated with regard to its relationship with pregnancy loss , and therapy for apl - positive recurrent pregnancy loss has been studied . although many points concerning the mechanism of apl - induced pregnancy loss remain unclear , according to a systemic review of rct by empson et al . , the following results have been shown . ( 1 ) a treatment combining low - dose oral aspirin plus twice - a - day subcutaneous injections of unfractionated heparin is beneficial for patients with apl - positive recurrent pregnancy loss without other causes of infertility , although its efficacy for low - risk patient is not clear . ( 2 ) low - molecular - weight heparin is effective , although whether it exhibits an effect equivalent to that of unfractionated heparin is not clear ; the clarification of this issue will require a large - scale rct . ( 3 ) there is no evidence for the efficacy of other therapies such as immunoglobulin and steroid treatments . as a consequence , anticoagulant therapy mainly consisting of a combination of aspirin and unfractionated heparin has become a standard therapy for patients with apl - positive recurrent pregnancy loss , and currently many facilities perform this treatment as a standard therapy . however , it should be kept in mind that the clinical backgrounds of patients , the apl species investigated , and the criteria of antibody titers are not necessarily consistent among these reports . the laboratory criteria described in the classification criteria for aps are limited to acl of igg or igm isotype in a medium or higher titer , a2gpi of igg or igm isotype , and la . reported a higher frequency of ape in patients with recurrent pregnancy loss before the 10th week of gestation than in healthy women : the frequencies of ape - igg , ape - igm , and ape - iga were 20.1% , 12.2% , and 1.4% in the patients , respectively , which were significantly higher than those in healthy women . these findings suggested that ape is strongly associated with early pregnancy loss and that ape testing in addition to apl examinations of patients with infertility is advisable . detected aps at higher frequencies ( igg : 87% , igm : 40% ) than acl ( igg : 68% , igm : 36% ) in patients with idiopathic recurrent pregnancy loss , suggesting a strong association of aps with early pregnancy loss and indicating the importance of aps testing . pregnancy loss was considered to occur at a high frequency in pregnant women with la and high titers of acl - igg [ 18 , 19 ] , and the risks of pregnancy loss and obstetric complications in pregnant women with low titers of acl - igg and acl - igm were found to be similar to those in pregnant women negative for these antibodies , while low titers of apl were not found to be clinically significant . the clinical significance of the apl isotypes other than igg , such as igm and iga , including acl , is still unclear . matzner et al . investigated 6 species of apl including acl in 352 patients with recurrent pregnancy loss and detected apl in about 60% of the patients , but the antibodies were igm in 75% of patients , suggesting that the igm antibodies were also pathogenic . however , the rate of pregnancy loss due to acl - igm alone was found to be similar to that in apl - negative women . moreover , aoki et al . reported that fetal loss recurred in 27 cases ( 82% ) out of 33 igg apl - positive patients when testing ape , aps , antiphosphatidylinositol antibody ( api ) , and acl without treatment and in 2 cases ( 40% ) out of 5 igg apl - negative but igm apl - positive patients , and fetal loss recurred in all 21 patients that were apl - positive with two or more igg types . they concluded that the igg isotype of apls was more pathogenic than that of igm and two or more igg - positive cases were more at risk than one - igg - positive cases . in this study , concerning individual apl without regarding the titer , the positive rates of acl - igm and aps - igm exceeded 25% , while that of a2gpi was very low , only 0.4% . those of other apls were found to be between 6.5% ( aps - igg ) and 17.9% ( la ) . this high positive rate , regarded the 95th percentile and more as positive , for acl - igm and aps - igm in rsa women was five times as high as normal japanese population , and acl and aps may have had stronger association with rsa than a2gpi , consistent with previous reports [ 8 , 22 ] . with regard to the isotype of apl , the positive rates of acl - igm and aps - igm were very high , and those of cl - igg ( 8.7% ) and aps - igg ( 6.5% ) were lower than acl - igm and aps - igm , suggesting that the igm isotype of apls may also have been pathogenic for early rsa , and these antibodies are worth testing in rsa women . moreover , strongly positive case ( over the 99th percentile ) of la and a2gpi were more scarce than normal japanese population ( 0.8% and 0% , resp . ) , suggesting relatively high association with early rsa and igg or igm of acl , ape , and aps . with regard to the reproductive outcome of the anticoagulant therapy in patients that had undergone rsa and had any apls , the rate of pregnancy maintenance of 88.1% ( 37/42 ) in aps - igm - positive cases was the lowest , but there was no significant difference among the other eight apls in terms of the rate of pregnancy maintenance . there was no la and a2gpi for strongly positive conceived patient in this study , with regard to the titer of each apl , upon comparing the pregnancy maintenance rate of weakly positive with strongly positive groups for each apl , no significant differences were found for all 8 apls ( table 2 ) . as mentioned before [ 18 , 19 ] , pregnant women with la and/or high titer of acl - igg were thought to be high risk of rsa , but in fact , the rate of pregnancy maintenance of la weakly positive rsa patients is 93.8% and that of acl - igg strongly positive rsa patients is 100% . no significant difference due to apl species or titer in the pregnancy maintenance rate was identified in this study . active anticoagulant therapy enabled the normal maintenance of pregnancy regardless of the positive antibody species and titer , and normal pregnancy was maintained in 91.4% of cases on average . next , we investigated the impacts of the isotype of apls , namely , igg group or igm group , and the number of positive apls , namely , single or multiple , on reproductive outcomes . the rate of pregnancy maintenance in the igm group was 90.0% and that in the igg group was 92.7% , showing no significant difference . with regard to the number of positive apls , the rate of pregnancy maintenance in 34 cases with single apl was 91.2% and that in 47 cases with multiple apls was 91.5% , also showing no significant difference ( table 3 ) , so we concluded that active anticoagulant therapy for apl positive rsa patients will result in good pregnancy outcome regardless of the isotype and the number of positive apls . there was a tendency for the rate of pregnancy maintenance with aspirin alone to be lower than that with aspirin plus heparin in the igg group ; however , no significant difference was found ( p value : 0.077 ) , showing a benefit of combination therapy for igg group and higher pathogenicity in the igg than igm group . moreover , the rate of pregnancy maintenance did not differ between patients treated with aspirin alone and those with a combination of aspirin plus heparin in the igm group , so aspirin therapy alone is sufficient for the igm group because heparin therapy was very stressful for patients . as mentioned before [ 20 , 22 , 23 ] , the clinical significance of the apls isotype of igm was not clear , but igm isotype may have had some pathogenicity for early recurrent abortion and may have been weaker than that of igg . a limitation of this study may be the consideration of the pregnancy maintenance rate without control patients ( without anticoagulant therapy ) , including patient overlap for apl positivities and not rct but retrospective cohort study . this pregnancy maintenance rate is as high as normal japanese population after an intrauterine pregnancy has been seen by ultrasound , and this study may include normal population because we have resulted from the 95th to the 99th percentile as weakly positive . the interpretation of the result needs to be careful and the accumulation of additional cases and more detailed investigations may be necessary . because igg or igm of acl , ape , and aps were more frequent than lac or a2gpi in rsa patients , we have to test these apls for rsa patients checkup . the patients suffering from rsa with some apls and do not meet criteria for aps resulted in normal pregnancy outcome by active anticoagulant therapy regardless of the positive antibody species , titer , and the number . in terms of the pathogenicity of apls , igg isotype may be stronger than igm isotype , so we recommend combination therapy with aspirin and heparin for igg - positive rsa patients .

objective . to investigate the incidence of various antiphospholipid antibodies ( apls ) , measured by commercial - based laboratory , with recurrent spontaneous abortion ( rsa ) patients and the impact of the species , isotype , titer , and number of positive apls on reproductive outcome in japanese . method . in this retrospective cohort study , 263 patients with rsa without possible causes were investigated . of 131 patients with one or more positive apl , 82 pregnant women under anticoagulant therapy were evaluated . results . the incidence of various apls was almost consistent with previous report . overall , successful pregnancy rate with anticoagulant therapy was 91.4% regardless of apl profiles . there was no significant difference in the pregnancy maintenance rate between igg and igm groups or single positive and multiple positive groups , but there was a tendency for the rate with aspirin to be lower than with aspirin plus heparin in igg group . conclusion . apl profile did not affect the pregnancy maintenance rate when anticoagulant therapy was actively introduced , however in igg group , we recommend combination therapy with aspirin and heparin .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

retinitis pigmentosa ( rp ) is a genetically heterogeneous disease characterised by progressive retinal photoreceptor degeneration [ 1 , 2 ] . the worldwide population affected has been estimated to be over one million individuals , whereas the frequency is approximately 1/4000 [ 3 , 4 ] . although rp has several mutations and genetical patterns , the symptoms and histopathological findings are similar . common symptoms are nyctalopia , impairment of visual acuity , and restriction of peripheral visual field . characteristic findings by fundus examination include peripheral pigmented bone spicule - like lesions , retinal arteriolar attenuation , and optic disc pallor . diagnosis is often made through a combination of clinical investigation , visual field exams , and electrodiagnostic methods such as electroretinography ( erg ) . various histopathological studies of rp have demonstrated a reduction of rod and cone cells and thinning of the outer photoreceptor layer . secondary to the outer retinal thinning , the inner retinal structure degenerates through suspected transneuronal damage , vascular compromise , or axonal compression [ 79 ] . previously published reports by newman et al . demonstrated that patients of various retinal hereditary dystrophies , including rp , had ophthalmoscopically evident retinal nerve fiber defects . the optic coherence tomography ( oct ) is a noninvasive diagnostic tool for rapid scanning and imaging of the retinal structures with high axial resolution of almost 5 m , especially in spectral domain models . the oct scans give the clinician crucial information about the retinal nerve fiber layer ( rnfl ) , retinal pigment epithelium complex , and the junction of inner and outer segments of photoreceptors ( is - os line ) . the new therapeutic modalities in rp , such as gene therapy [ 1114 ] or retinal stem cell transplantation [ 15 , 16 ] , are limited because they only improve the outer retinal layers . the outcome of new therapies must focus on the pretreatment status of the inner retinal layers as well as the outer layers making oct a useful technique in the treatment prediction for such rp patients . in this study , we aimed to examine the peripapillary rnfl thickness and documented the changes in a group of rp patients . medical records of forty - four eyes of twenty - two rp patients who were followed up in okmeydan training and research hospital , department of retina , and forty - four eyes of twenty - two healthy subjects ( control ) were enrolled into this study . the diagnosis in all cases was made by retinal specialists using the following criteria : clinical history , fundus examination , visual field defects , and reduced amplitudes in erg . the exclusion criteria used in our study were high refractive errors ( 6 diopters sphere ; 3 diopters cylinder ) , low degree of central fixation , significant media opacities ( e.g. , posterior subcapsular cataract ) , diabetic retinopathy , glaucoma , or cystoid macular edema . all cases underwent a complete ocular examination , including best - corrected visual acuity ( bcva ) using snellen chart , slit lamp biomicroscopic examination , dilated fundus examination , and intraocular pressure measurement with goldmann applanation . average and four quadrants peripapillary rnfl thickness values which were scanned by spectral - domain oct ( cirrus , carl zeiss meditec , inc . , software 5.1.1.6 ) made by the same operator were analyzed . any rnfl layer thickness greater than 95th percentile was defined as thickening , whereas thickness lower than the 5th percentile was determined as thinning ( figure 1 ) . the mean age of the rp patients was 37.09 2.55 years ( range 1875 ) and the mean age of control group was 39 1.70 years ( range 1854 ) . the mean age , sex , and intraocular pressure of the two groups did not differ significantly . in the rp patients the peripapillary rnfl was evaluated and the mean thickness was observed to be 97.57 3.2 m . rnfl thickness in the 4 quadrants ( superior , temporal , nasal , and inferior ) was shown to be 119.18 4.47 m , 84.68 2.31 m , 75.09 3.34 , and 113.88 4.25 m , respectively . in 20 of the total 44 eyes ( 45% ) , rnfl thinning was found in at least one quadrant . in two eyes ( 4% ) thinning was determined in 3 quadrants , in 11 cases ( 25% ) in 2 quadrants , and in 7 eyes ( 15% ) in only one quadrant . regarding the rnfl thinning of quadrants , the thinning was diagnosed in 12 cases ( 27% ) in superior quadrant , in 9 eyes ( 20% ) in the nasal quadrant , and in 14 eyes ( 32% ) in inferior quadrant . temporal quadrant thinning was not found in any of the patients . in 21 ( 48% ) patients , five eyes ( 11% ) showed thickening in 3 quadrants , 2 ( 4% ) eyes in 2 quadrants , and 14 ( 31% ) eyes in only one quadrant . five patients ( 11% ) had thickness in the superior quadrant , 8 patients ( 18% ) were in the nasal , 19 eyes ( 43% ) were in the temporal , and only 1 patient ( 2% ) was in the inferior quadrant . in 8 patients , all 4 quadrants were found within the normal values . in 5 patients there was thinning and thickening of the rnfl layer in different quadrants . the thinning of the rnfl was most commonly observed in the inferior and moderately in the nasal and superior quadrants . temporal rnfl thinning was not determined in any patient , whereas the temporal region was the most commonly thickened rnfl area followed by the nasal , the superior , and finally the inferior quadrant . in control group the average rnfl thickness was 99.95 1.38 m . in the quadrant evaluation , the rnfl thickness in the superior , temporal , nasal , and inferior quadrants was 123.13 2.96 m , 66.75 2.02 m , 75.20 1.44 m , and 130.54 1.72 m , respectively . there was no significant difference in average , superior , and nasal thickness between two groups ( p = 0.497 ; 0.463 ; 0.975 , resp . ) . distribution of rnfl thickness between rp patients and control group is shown in figure 2 . in rp , the photoreceptor layer progressively degenerates , followed by global changes within the inner retinal structure . in particular , the rnfl develops thinning or thickening secondary to photoreceptor cell loss . morphometric and histological studies reported ganglion cell reduction in rp compared to the normal population [ 10 , 17 , 18 ] . other reports suggested that vascular compromise or direct genetic effect on the ganglion cells was the reason for inner retinal layer reduction [ 18 , 19 ] . regarding the in vivo studies , walia et al . reported using time - domain and fourier - domain oct to define rnfl thinning in 40% and 38% of rp patients [ 20 , 21 ] . a similar result was reported by anastasakis et al . which showed rnfl thinning in 38% of studied eyes , whereas oishi et al . found no significant difference between normal population and rp patient rnfl thickness using time - domain oct . in our study , 45% of eyes showed rnfl thinning , similar to walia and anastasakis ' study results . in the previously mentioned studies , the rnfl thickening we found that 48% of the studied eyes had peripapillary rnfl thickening , mostly in temporal quadrant . the exact mechanism underlying this rnfl thickening is not clear but it may result from glial tissue proliferation ( which is secondary to the nerve fiber layer atrophy ) or edema of the remnant rnfl [ 23 , 24 ] . in fact , hood et al . measured rnfl thickness in rp patients from peripheral retina and macular regions with fourier - domain oct and manual segmentation software . they found that the rnfl was significantly thicker , especially in the horizontal meridian compared to the normal values . in the same study , it was also suggested that the thickening might be a mechanical dysfunction , where the rnfl stretches to fill the empty space left by the photoreceptor degeneration . the peripapillary rnfl changes in the four quadrants vary between several studies . in histopathological examination of rp patients , flannery et al . found that the highest ratio of the photoreceptor loss was encountered in the inferonasal region , which may facilitate the rnfl thinning in this region . reported in their studies [ 20 , 21 ] that the nasal quadrant was the most thinned , followed by inferior and superior quadrants . observed the quadrants ' thinning sequence as inferior ( most common ) followed by the nasal and superior regions . in both xue 's et al . and hood 's et al . xue et al . found that all quadrants in their rp patient study were significantly thicker than the normal population , except the nasal quadrant , which was surprisingly thinner than the normal control group values . in our studies , the mostly thinned quadrant was the inferior followed by the superior and the nasal quadrants . regarding the thickening of the rnfl , in several studies [ 2022 , 24 , 27 ] , the most commonly thickened quadrant was the temporal . interestingly , no reports have observed thinning in temporal peripapillary area . similar to these reports , we found that the temporal quadrant was the most commonly thickened region with no observed rnfl thinning . this might be due to the retinal glial proliferation , which is most strongly seen between the temporal arcades . considering future therapeutic approaches , understanding the mechanism and progression of retinal degeneration in rp will be crucial to predicting proper patient treatment . high resolution sd - oct scans will be extremely helpful for the clinician in both aspects .

aim . to evaluate the peripapillary retinal nerve fiber layer ( rnfl ) changes in retinitis pigmentosa ( rp ) patients using spectral domain optic coherence tomography ( sd - oct ) . methods . we retrospectively examined medical records of forty - four eyes of twenty - two rp patients . the results were also compared with those of previously reported forty - four eyes of twenty - two normal subjects ( controls ) . records of average and four quadrants peripapillary rnfl thickness measurements using sd - oct were assessed . results . in rp patients the mean rnfl thickness was 97.57 3.21 m . the rnfl in the superior , temporal , nasal , and inferior quadrants was 119.18 4.47 m , 84.68 2.31 m , 75.09 3.34 m , and 113.88 4.25 m , respectively . while the thinning of rnfl was predominantly observed in the inferior quadrant , the thickening was mostly noted in temporal quadrant . the differences between mean , superior , and nasal quadrant rnfl thicknesses were not statistically significant when compared with control group . the rp patients had thinner inferior quadrant and thicker temporal quadrant than control group ( p < 0.05 ) . conclusion . sd - oct is highly sensitive and effective instrument to detect rnfl changes in rp patients . rnfl measurements can provide information about the progression of retinitis pigmentosa and may provide prognostic indices for future treatment modalities .

1. Introduction 2. Methods 3. Results 4. Discussion

the uncharacterized gal4 enhancer trap lines screened in this study were obtained from the getdb , a subdivision of the drosophila genetic resource center , kyoto institute of technology , japan . the following lines were obtained from the bloomington drosophila stock center : hh - lacz , ptc - gal4 , ptc - lacz , dpp - gal4 , dpp - lacz , and ok107-gal4 . other drivers used in this study : antp - gal4 ( s. cohen , temasek life sciences laboratory , singapore ) , cg - gal4 ( c. dearlolf , massachusetts general hospital , boston ) , dome - gal4 ( s. noselli , centre national de la recherche scientifique , nice , france ) , dot - gal4 ( d. kimbrell , university of california , davis ) , gcm - gal4 ( l. zipursky , university of california , los angeles ) , hand - gal4 ( z. han , university of michigan ) , hh - gal4 ( t. kornberg , university of california , san francisco ) , upd - gal4 ( y.h . sun , academia sinica , taiwan ) . approximately 2 kb of dna immediately upstream of the ubiquitin - p63e ( cg11624 ) open reading frame was pcr amplified as an ecori / kpni fragment from a previously cloned promoter region ( kindly provided by p. o'farrell , university of california , san francisco ) and cloned into the pcrii vector ( invitrogen ) . this ecori / kpni fragment was then subcloned into the drosophila transformation vector pstinger ( drosophila genomics resource center ) , which contains a multiple cloning site upstream of the nuclear egfp reading frame , containing a transcriptional termination sequence flanked by an inverted pair of frt recombination sites , was isolated as a kpni fragment from the construct d237 ( kindly provided by g. struhl , columbia university ) and subcloned into the kpni site that lies in between the ubi - p63e promoter and the egfp reading frame . transgenic flies were generated using the pubi-63e - stop - stinger vector and a commercial transformation service ( bestgene , inc . ) . a triple - recombinant chromosome was generated using uas - redstinger14 ( w ; p{uas - redstinger}4/cyo , bloomington drosophila stock center ) , uas - flp ( yw * ; p{uas - flp1.d}jd1 , bloomington drosophila stock center ) and pubi-63e - stop - stinger insert 9f6 and was balanced over cyo . the gal4-expressing lines were individually crossed on standard fly food at 25c . wandering third instar larvae were dissected in 1xpbs and tissues were fixed in 4% formaldehyde in 1xpbs for 30 min , followed by three washes ( 10 min each ) with 1xpbs/0.4% triton - x-100 ( fisher ) detergent ( pbst ) . during the second 1xpbst wash , to - pro3 iodide ( invitrogen ) tissues were mounted on slides in vectashield ( vector laboratories ) and imaged using a zeiss apotome or a biorad radiance 2000 confocal microscope with standard techniques . the uncharacterized gal4 enhancer trap lines screened in this study were obtained from the getdb , a subdivision of the drosophila genetic resource center , kyoto institute of technology , japan . the following lines were obtained from the bloomington drosophila stock center : hh - lacz , ptc - gal4 , ptc - lacz , dpp - gal4 , dpp - lacz , and ok107-gal4 . other drivers used in this study : antp - gal4 ( s. cohen , temasek life sciences laboratory , singapore ) , cg - gal4 ( c. dearlolf , massachusetts general hospital , boston ) , dome - gal4 ( s. noselli , centre national de la recherche scientifique , nice , france ) , dot - gal4 ( d. kimbrell , university of california , davis ) , gcm - gal4 ( l. zipursky , university of california , los angeles ) , hand - gal4 ( z. han , university of michigan ) , hh - gal4 ( t. kornberg , university of california , san francisco ) , upd - gal4 ( y.h . sun , academia sinica , taiwan ) . approximately 2 kb of dna immediately upstream of the ubiquitin - p63e ( cg11624 ) open reading frame was pcr amplified as an ecori / kpni fragment from a previously cloned promoter region ( kindly provided by p. o'farrell , university of california , san francisco ) and cloned into the pcrii vector ( invitrogen ) . this ecori / kpni fragment was then subcloned into the drosophila transformation vector pstinger ( drosophila genomics resource center ) , which contains a multiple cloning site upstream of the nuclear egfp reading frame . , containing a transcriptional termination sequence flanked by an inverted pair of frt recombination sites , was isolated as a kpni fragment from the construct d237 ( kindly provided by g. struhl , columbia university ) and subcloned into the kpni site that lies in between the ubi - p63e promoter and the egfp reading frame . transgenic flies were generated using the pubi-63e - stop - stinger vector and a commercial transformation service ( bestgene , inc . ) . a triple - recombinant chromosome was generated using uas - redstinger14 ( w ; p{uas - redstinger}4/cyo , bloomington drosophila stock center ) , uas - flp ( yw * ; p{uas - flp1.d}jd1 , bloomington drosophila stock center ) and pubi-63e - stop - stinger insert 9f6 and was balanced over cyo . the gal4-expressing lines were individually crossed on standard fly food at 25c . wandering third instar larvae were dissected in 1xpbs and tissues were fixed in 4% formaldehyde in 1xpbs for 30 min , followed by three washes ( 10 min each ) with 1xpbs/0.4% triton - x-100 ( fisher ) detergent ( pbst ) . during the second 1xpbst wash , to - pro3 iodide ( invitrogen ) tissues were mounted on slides in vectashield ( vector laboratories ) and imaged using a zeiss apotome or a biorad radiance 2000 confocal microscope with standard techniques .

we combine gal4/uas , flp / frt and fluorescent reporters to generate cell clones that provide spatial , temporal , and genetic information about the origins of individual cells in drosophila . we name this combination the gal4 technique for real - time and clonal expression ( g - trace ) . the approach should allow for screening and the identification of real - time and lineage - traced expression patterns on a genomic scale .

METHODS Drosophila lines Molecular cloning and the generation of the G-TRACE system Analysis of Gal4 expression patterns Supplementary Material

a 16-year - old adolescent male , a sikh by religion and educated up to 2 standard , belonging to a middle socio - economic status with non - vegetarian dietary habits was brought to our psychiatry outpatient department by parents with chief complaints of generalized tonic - clonic seizures since 2 years of age , low - intelligence since childhood and behavior problems like stubbornness and aggression since past 5 - 6 years . history of present illness revealed uneventful prenatal and perinatal course along with delayed motor , speech , and adaptive milestones . the patient had his first episode of grand - mal seizures at around 2 years of age and has been having them regularly since then but with variable frequency and duration . the patient started going to a school at around 6 years of age but discontinued studies after 2 years of age due to poor performance at school and being ridiculed by his peers for poor performance and for marks on his face . the patient would spend most of the time at his home playing with his younger siblings and occasionally playing with other younger children in his neighborhood . for the past 5 - 6 years the parents have noticed increasing behavior problems like stubbornness and not following parental instructions along with frequent episodes of verbal aggression and occasional episodes of physical aggression mostly directed towards parents and younger siblings generally when his wishes were thwarted or demands were not met . the patient had been shown to many doctors ever since his seizures started and his treatment prescriptions showed that for past 1 year he had been taking orally sodium valproate 500 mg twice daily , phenobarbital 60 mg twice daily , carbamazepine 200 mg thrice daily , and clonazepam 0.5 mg twice daily . the family reported only a small decrease in seizure frequency even after taking these medications . there was no history of any co - morbid medical and surgical illness in the patient or any history of similar features in any of the family members . general physical and systemic examination was within normal limits apart from the findings of facial angiofibromas [ figure 1 ] in the facial region . mental status examination was suggestive of low cognitive profile and did not reveal any other psychopathology . facial angiofibromas ( adenoma sebaceum ) computed tomography scan and magnetic resonance imaging of the patient displayed multiple subependymal nodules and small multifocal discreet lesions in bilateral cerebral hemispheres suggestive of cortical and sub - cortical tubers [ figures 2 and 3 ] . computed tomography scan findings of the patient showing sub - ependymal nodules magnetic resonance imaging revealing small multifocal discreet tubers in bilateral cerebral hemispheres management of the patient was carried out keeping in mind the following objectives : control of grand mal seizures through optimization of treatment regimeassessment of patient 's cognitive abilities and achievement of optimum level of adaptive functioning according to patient 's cognitive abilitiesbehavioral modification aimed at reduction of undesirable behaviors and promotion of adaptive and socially desirable behaviorsdetection and timely treatment of other manifestations of tuberous sclerosis to prevent complications . control of grand mal seizures through optimization of treatment regime assessment of patient 's cognitive abilities and achievement of optimum level of adaptive functioning according to patient 's cognitive abilities behavioral modification aimed at reduction of undesirable behaviors and promotion of adaptive and socially desirable behaviors detection and timely treatment of other manifestations of tuberous sclerosis to prevent complications . as part of the management plan , the patient 's medications were optimized and he was started on a single anti - epileptic drug sodium valproate at the dosage of 1000 mg / day ( 15 mg / kg / day ) . the rationale behind this step was that the patient 's current medications regime comprised of multiple anti - epileptics medications two of which were enzyme inducers , i.e. , carbamazepine and phenobarbital , which were reducing the effective dose of sodium valproate as well as carbamazepine resulting in reduced plasma levels . it was decided to subsequently adjust the dose of sodium valproate during subsequent follow - ups and to increase the dose gradually depending on the patient 's tolerability and response to a maximum of 60 mg / kg body weight . though , the patient 's seizure frequency decreased markedly on this dose but he was not completely seizure free . any effort to increase the dose of valproate resulted in intolerable gastrointestinal ( gi ) side - effects . therefore , clobazam 10 mg / day was added to valproate and this resulted in complete improvement of patient 's seizures . currently , he is seizure free for past 2 months . the patient 's cognitive assessment ( for intelligence quotient ( iq ) assessment first parents were interviewed for development behavior on vineland social maturity scale and then child was evaluated first on seguin form board test and then on colored progressive matrices . for cognitive assessment bender gestalt test and weschler memory scale were done ) revealed an iq of 45 , i.e. , moderate mental retardation and a mental age of approximately 7 years with relative strength in visual - spatial domain . parents and family members were psycho - educated regarding the patient 's limited cognitive abilities and to lower down their expectations from the patient to bring it in coherence with the patient 's cognitive abilities . behavior therapy was started to reduce the frequency and duration of undesirable behaviors and to promote desirable behaviors by using the principles of negative and positive re - enforcement . the patient was given remedial education and was started from his current level of knowledge . after 3 months of behavior therapy and remedial education , there was marked improvement in the patient 's behavior as evidenced by reduced frequency and duration of anger episodes and reduced need for help in daily routine activities . by the end of 3 months , the patient was able to read road signs in english and hindi and write his name in both the languages and was able to do simple addition and subtraction problems . the patient also underwent following investigations : complete hemogram , liver function tests , renal function tests , ultrasonogram whole abdomen , echocardiography , and ophthalmic examination including , retinal and fundus examination . this was carried out to detect any other systemic manifestations of tuberous sclerosis , which might need treatment . a dermatological consultation was also carried out for the treatment of cosmetically disfiguring facial angiofibromas since that was adding to the social embarrassment of the patient . the patient was started on tacrolimus 0.1% w / w ointment for topical application on the affected area . no major adverse effects were noted except transient burning sensation at the site of application . this case highlights the treatment challenges faced in the management of a patient suffering from tuberous sclerosis . it is evident that management of tuberous sclerosis requires a multi - disciplinary approach and an ongoing assessment for the timely management of complications that arise with increasing age . unfortunately , majority of such patients do not have access to such multi - disciplinary team at one place . however , a systematic approach to such patients can result in the optimum utilization of abilities of these patients and their integration in the mainstream society in a cost - effective way . it is clear that both pharmacological and non - pharmacological aspects of treatment like psycho - education and involving the family in the treatment process are important in the whole management plan . the goals of treatment for patients with tsc are providing the best possible quality of life with the fewest complications from the underlying disease process , fewest adverse treatment effects , and minimum number of drugs . the major complication of tsc requiring long - term medical treatment is epilepsy but no single drug gives satisfactory relief for most of the cases . a combination of drugs is frequently required . the choice of specific anti - epileptic drugs ( aed ) for treating seizures in patients with tsc is based on the patient 's seizure type ( s ) , epilepsy syndrome ( s ) , other involved organ systems , age of the patient , and aed side effect profiles and formulations available . though , vigabatrin is considered as the drug of choice for children with tsc and infantile spasms . benzodiazepines or barbiturates should be avoided as these drugs often aggravate underlying behavioral or cognitive problems . carbamazepine , oxcarbazepine , and phenytoin may cause exacerbation of seizures , particularly in younger children and infants , and these aeds can aggravate infantile spasms . in the present case , initially the combination of carbamazepine , phenobarbitone , valproate and clonazepam and later on , valproate alone were ineffective in controlling seizures . finally , the combination of valproate and clobazam was found to be effective in controlling seizures . rapamycin is a new immunosuppressant with a propensity to inhibit t - cell proliferation and has been approved for use in treating facial angiofibromas in tsc patients without significant adverse effects . there is need of formulation of optimum evidence - based guidelines for the management of such patients .

tuberous sclerosis complex is a multi - system disorder with autosomal dominant inheritance , which can affect the brain , heart , skin , kidneys , lungs , and retina . we hereby report therapeutic challenges faced in a case of an adolescent male suffering from tuberous sclerosis .

CASE REPORT DISCUSSION

loss of interdental papilla can lead to esthetic concerns , phonetic problems , and food impaction which promote periodontal disease . when the interdental papilla is lost as a result of periodontal disease , surgery , or trauma , its regenerative capacity is also limited compared to marginal or attached gingiva . normal marginal gingiva forms around dental implants placed in edentulous areas , whereas the regeneration of interdental papilla remains limited . hereditary and drug induced gingival overgrowth seems to manifest first at the interdental papilla and then spread to other parts of the gingiva . in spite of other factors that seem to limit the regenerative capacity of the interdental papilla , it is also possible that the interdental papilla has unique functional characteristics that are due to distinct cellular or molecular properties . walsh et al . have shown the presence of 51 integrin in interdental papilla of drug - induced gingival enlargement patients , which was neither found in oral epithelium of normal gingiva nor in periodontitis . this glycoprotein plays a number of important roles including providing structural support and signaling cues for cell survival , migration , differentiation , gene expression , growth factor signaling , and cell contractility . in addition to its cell - binding properties , fibronectin also binds other glycoproteins , including components of complement and coagulation systems . in early wound fibrin meshwork undergoes covalent cross - linking to stabilize clot and allow reparative cell migration . baum and wright demonstrated the presence of fibronectin in human gingival fibroblasts using indirect immunoflorecence . fibronectin derived from these cells possessed biological properties of agglutination and promotion of cell adhesion to a collagen substrate . reported fibronectin to have a stabilizing or proliferative effect on gingival soft tissue by promoting less postoperative gingival recession . csiszar et al . in 2007 found procollogen type i , fibronectin , and tenacin c to be higher in connective tissue of interdental papilla compared to that in marginal gingiva . they concluded that molecular composition of the interdental papilla is distinct from marginal gingiva . to assess molecular variations in different anatomical parts of gingiva , we conducted an investigation to evaluate the staining intensity of fibronectin in human marginal gingiva and interdental papilla by immunohistochemical staining . a prospective analytical experimental study was performed on 16 healthy subjects referred for crown lengthening surgery . all participants were medically healthy , non - smokers , with no medication intake , and a healthy periodontium . a professional scaling and root planning ( srp ) was performed and oral hygiene instructions were given . the procedure was explained and a written consent was obtained from patients . after 3 weeks , crown lengthening surgery was performed and facial / buccal marginal gingiva and interdental papilla were harvested separately . at least one section of 5-m thickness and four sections of 4-m thickness were made from each specimen . the 5-m section was stained with hematoxylin and eosin to assess the morphology of tissues and the presence of inflammation . according to the signs of inflammation , the specimens were categorized in four groups : normal ( without any sign of inflammation ) , mild ( initial ) , moderate ( early ) , and severe ( established ) . in histochemical staining , the presence of collagen fibers with fibroblasts was considered as normal tissue , degeneration of collagen fibers as acute inflammation , and the presence of collagen fibers with fibrocytes was considered as fibrosis . staining intensity was scored as 0=without staining intensity ; 1=weak ; 2=moderate ; 3=sever staining intensity . reticulin and elastic staining was performed ( merk , darmstadt , germany ) to evaluate the status of reticulin and elastic fibers , and determine their relation to tissue inflammation . following deparaffinization , the sections were heated at 60c for 30 min incubated for 5 min in clean xylene and thereafter incubated for 5 min in ethanol 70% , 96% , and 100% , respectively . primary anti - fibronectin ( novocastra , leica microsystems , united kingdom ) and proteinaz k ( p.k ) enzyme were used for immunostaining and antigen preparation , respectively . relative staining intensity of the immunohistochemical specimens was scored as follows : 0=no immunoreactivate staining intensity ; 1=weak , but visible ; 2=moderately ; and 3=strong staining intensity . the wilcoxon and spearman tests were used for comparison of staining intensity and to evaluate the correlation between inflammation and fibronectin staining intensity respectively . the 5-m section was stained with hematoxylin and eosin to assess the morphology of tissues and the presence of inflammation . according to the signs of inflammation , the specimens were categorized in four groups : normal ( without any sign of inflammation ) , mild ( initial ) , moderate ( early ) , and severe ( established ) . in histochemical staining , the presence of collagen fibers with fibroblasts was considered as normal tissue , degeneration of collagen fibers as acute inflammation , and the presence of collagen fibers with fibrocytes was considered as fibrosis . staining intensity was scored as 0=without staining intensity ; 1=weak ; 2=moderate ; 3=sever staining intensity . reticulin and elastic staining was performed ( merk , darmstadt , germany ) to evaluate the status of reticulin and elastic fibers , and determine their relation to tissue inflammation . following deparaffinization , the sections were heated at 60c for 30 min incubated for 5 min in clean xylene and thereafter incubated for 5 min in ethanol 70% , 96% , and 100% , respectively . primary anti - fibronectin ( novocastra , leica microsystems , united kingdom ) and proteinaz k ( p.k ) enzyme were used for immunostaining and antigen preparation , respectively . relative staining intensity of the immunohistochemical specimens was scored as follows : 0=no immunoreactivate staining intensity ; 1=weak , but visible ; 2=moderately ; and 3=strong staining intensity . the wilcoxon and spearman tests were used for comparison of staining intensity and to evaluate the correlation between inflammation and fibronectin staining intensity respectively . with respect to inflammation , of the total 32 interdental papilla and marginal gingiva tissues tested , 6 specimens were found to be normal , 15 specimens with mild inflammation , and the remaining 11 specimens had moderate to severe inflammation in some parts . lymphocytes were found to be the predominant cell infiltrate in most of the specimens while a 50% polymorphonuclear and 50% lymphocyte infiltration was observed in two specimens . in masson 's trichrome staining , collagen fibers appeared blue . tissue epithelium was not stained ( score 0 ) , collagen fibers showed weak staining in the region of inflammation ( score 1 ) , collagen fibers of papillary connective tissue were moderately stained ( score 2 ) , and collagen fibers of reticular connective tissue were intensely stained ( score 3 ) . in reticulin staining , reticulin fibers appeared black , dense and strongly stained near both oral and sulcular / junctionalepithelium ( s / je ) , particularly in the basement membrane . in elastic staining , elastic fibers were black and mostly found in inflamed tissues . due to different staining intensities in different parts of tissue , each section was divided into three areas [ tables 1 and 2 ] . frequency distribution of fibronectin staining intensity in different areas of marginal gingiva frequency distribution of fibronectin staining intensity in different areas of interdental papilla the wilcoxon test showed fibronectin staining intensities not to be significantly different between marginal gingiva and interdental papilla in connective tissue adjacent to oral epithelium ( oe ) , reticular connective tissue , and connective tissue adjacent to s/ je . mean staining intensity between marginal gingiva and interdental papilla was not statically significant . inflammation in interdental papilla and marginal gingiva was not significantly different but slight differences were observed at borderline . the spearman test revealed no statistically significant correlation between tissue inflammation and fibronectin staining intensity . considering other findings , it must be because of type 1 error ( in this study type 1 error rate or was set by statistical consultant as 0.05 ) . fibronectin showed more intensity of staining in the connective tissue adjacent to s / je compared to reticular connective tissue , and likewise more intense in reticular connective tissue than the connective tissue adjacent to oe . with respect to inflammation , of the total 32 interdental papilla and marginal gingiva tissues tested , 6 specimens were found to be normal , 15 specimens with mild inflammation , and the remaining 11 specimens had moderate to severe inflammation in some parts . lymphocytes were found to be the predominant cell infiltrate in most of the specimens while a 50% polymorphonuclear and 50% lymphocyte infiltration was observed in two specimens . tissue epithelium was not stained ( score 0 ) , collagen fibers showed weak staining in the region of inflammation ( score 1 ) , collagen fibers of papillary connective tissue were moderately stained ( score 2 ) , and collagen fibers of reticular connective tissue were intensely stained ( score 3 ) . in reticulin staining , reticulin fibers appeared black , dense and strongly stained near both oral and sulcular / junctionalepithelium ( s / je ) , particularly in the basement membrane . in elastic staining , elastic fibers were black and mostly found in inflamed tissues . due to different staining intensities in different parts of tissue , each section was divided into three areas [ tables 1 and 2 ] . frequency distribution of fibronectin staining intensity in different areas of marginal gingiva frequency distribution of fibronectin staining intensity in different areas of interdental papilla the wilcoxon test showed fibronectin staining intensities not to be significantly different between marginal gingiva and interdental papilla in connective tissue adjacent to oral epithelium ( oe ) , reticular connective tissue , and connective tissue adjacent to s/ je . mean staining intensity between marginal gingiva and interdental papilla was not statically significant . inflammation in interdental papilla and marginal gingiva was not significantly different but slight differences were observed at borderline . the spearman test revealed no statistically significant correlation between tissue inflammation and fibronectin staining intensity . considering other findings , it must be because of type 1 error ( in this study type 1 error rate or was set by statistical consultant as 0.05 ) . fibronectin showed more intensity of staining in the connective tissue adjacent to s / je compared to reticular connective tissue , and likewise more intense in reticular connective tissue than the connective tissue adjacent to oe . knowledge of the molecular composition of interdental papilla as a unique anatomical location may help in developing a procedure to regenerate this part of the gingiva . this study was undertaken to determine the relationship between fibronectin staining intensity and tissue inflammation on a histological level . but results of our study showed there is no correlation between inflammation and fibronectin staining intensity . this difference although not statistically significant was at borderline ( p=0.058 ) and may prove to be significant with a larger sample size . low daily use of interdental cleaning tools and difficulty in establishment of flossing habit for patients probably accounts for the higher level of inflammation found in the interdental papilla compared to that in the marginal gingiva . masson 's trichrome staining showed dense collagen fibers in laminapropria of specimens which degenerated in inflamed regions . the destruction of collagen from collagenase and other enzymes released by infiltrating and transmigrating neutrophils was shown in other studies . reticulin histochemical staining showed higher staining intensity subjacent to both oral and s / j epithelium , especially in the basement membrane than in reticular connective tissue . this finding was similar in all specimens either normal or inflamed tissues and was in accordance with lorencini et al . in our study , only small amount of elastic fibers were found mainly in the inflamed tissues which may be a sign of early fibrosis . similar findings were reported by bourke et al . unlike the findings of csiszar et al . , our study did not demonstrate any difference in fibronectin staining intensity between interdental papilla and marginal gingiva . they found fibronectin levels to be significantly higher in the connective tissue of interdental papilla . the staining of fibronectin was evaluated in three zones of connective tissue ( basement membrane zone , subepithelial connective tissue , and deep connective tissue ) but no comparison was made between these areas . the present study revealed statistically significant fibronectin staining intensity in the connective tissue adjacent to s / j epithelium [ tables 1 and 2 ] which may be due to the unique characteristics of junctional epithelium . the latter has a high rate of cell turnover , 50 - 100 times higher than oral epithelium . cell proliferation of junctional epithelium is localized to the basal layer adjacent to the gingival connective tissue . since fibronectin is responsible for cell differentiation and growth factor signaling , its high concentration near a region with high turnover rate may be explainable . the high concentration of fibronectin in junctional epithelium is due to the presence of fibronectin receptors ( integrins ) in this tissue . studies in this context were limited and further investigations are needed to clarify whether interdental papilla possess unique composition .

background : the differences between marginal gingiva and interdental papilla may be due to variation in the molecular composition of these two different anatomical structures . the aim of this study was to evaluate the staining intensity of fibronectin in human marginal gingiva and interdental papilla.materials and methods : in a prospective analytical study , 16 healthy subjects needing crown lengthening surgery were selected . all participants were medically healthy , non - smokers , with no medication intake , and a healthy periodontium . during surgery , facial / buccal marginal gingiva and interdental papilla were separately harvested . the specimens were subjected to hematoxylin and eosin , histochemical ( masson strichorom , reticulin , and elastic ) , and immunohistochemical staining for evaluation of morphology and inflammation ; assessment of connective tissue fibers ( collagen , reticulin , and elastic ) ; and determination of fibronectin staining intensity . the data were analyzed by spsssoftware , wilcoxon , and spearman tests . p<0.05 was considered to be statistically significant.results:from a total of 32 specimens , 21 specimens were found to be normal or having mild inflammation , while the remaining specimens had moderate to severe inflammation in some parts . collagen fibers were found to be dense in reticular connective tissue and degenerated in the region of inflammation . reticulin fibers strongly stained near epithelium . elastic fibers were sparsely found . mean fibronectin staining intensity between marginal gingiva and interdental papilla was not statically significant ( p=0.44 ) . there is no statistically significant correlation between tissue inflammation and fibronectin staining intensity ( p=0.76 for marginal gingival and p=0.20 for interdental papilla ) . considering all specimens , fibronectin staining intensity of connective tissue adjacent to sulcular / junctional epithelium was higher than reticular connective tissue ( p=0.003 ) and higher than connective tissue adjacent to oral epithelium ( p<0.001).conclusion : this study did not show any difference in interdental papilla and marginal gingival with respect to fibronectin composition . more studies in this context are needed .

INTRODUCTION MATERIALS AND METHODS Histological evaluation Histochemical staining Immunohistochemical staining Statistical analysis RESULTS Histological finding Histochemical finding Immunohistochemical findings DISCUSSION CONCLUSION

the dura mater is the outermost layer of the meningeal tissue . defects often arise from trauma or surgical procedures . the commonly accepted approach is surgical repair of the dural defect to restore tissue homeostasis and barrier functions . the repair must be fluid - tight to prevent , among others , postoperative cerebrospinal fluid ( csf ) fistula , infections , and pseudomeningocele . since the 1890s , several materials have been used as dural grafts . at this point , the most commonly used substitutes are autologous grafts , e.g. fascia lata and galea - pericranium , or synthetic meshes . acellular dermal matrices ( adm ) have been used in soft tissue reconstructions since 1995 , initially applied for treatment of burns . chaplin and colleagues presented an experimental study evaluating the use of a porcine adm ( xenoderm ; acelity , san antonio , tx ) in a porcine model . in 2000 , warren and colleagues were the first to report their experiences on human adm ( alloderm ; acelity , san antonio , tx ) as a dural substitute in humans . their experiences were promising and in accordance with a minor long - term study published later the same year . we present two cases of dural defect repair using strattice pliable ( acelity , san antonio , tx ) , a porcine adm . to our knowledge , this has not previously been reported from other institutions . a 60-year - old man with the birt hogg dub syndrome , and a history of five solid tumors , developed a malignant peripheral nerve sheath tumor in the sacral area . it was initially treated with excision and radiotherapy ( 66 gy in 33 fractions ) . however , two years later , the malignant tumor recurred . eighteen days postoperatively , magnetic resonance images ( mri ) revealed a csf accumulation superficial to the dura . a second repair with a fascia lata autograft and a synthetic mesh was done . a few days after the second surgery , a new csf accumulation formed . with assistance from the department of plastic surgery , a suitable piece of strattice pliable was placed over the defect and with single - sutures , through drill holes , fixed to the sacral bone and by running sutures to the adjacent muscles . after undermining the muscles superficial to the fascia , the soft tissue was closed layer by layer . three months later , a computed tomography of thorax , abdomen , and pelvis ( ct - tap ) revealed new entrant bone and lung metastasis , and the patient was offered palliative radiotherapy . the patient did not experience further csf - leakage and did unfortunately died two months later . a 29-year - old woman diagnosed with arnold chiari malformations had an occipitocervical decompression surgery , due to progressive headache , in 2013 . two years later , a second decompression surgery was done due to progressive ataxia and paraesthesia in her right arm . during the surgery , a titanium plate was attached to the remains of c1 , and a synthetic dural substitute was inserted . postoperatively two mri scans within a month revealed accumulation of csf superficial to the dural repair site . when the patient for the third time leaked csf from the wound , the leakage was sealed with porcine adm ( strattice pliable ) . a suitable piece of strattice pliable was placed over the leak site and sutured , see figure 1 . before closing a 60-year - old man with the birt hogg dub syndrome , and a history of five solid tumors , developed a malignant peripheral nerve sheath tumor in the sacral area . it was initially treated with excision and radiotherapy ( 66 gy in 33 fractions ) . however , two years later , the malignant tumor recurred . eighteen days postoperatively , magnetic resonance images ( mri ) revealed a csf accumulation superficial to the dura . a second repair with a fascia lata autograft and a synthetic mesh was done . a few days after the second surgery , a new csf accumulation formed . with assistance from the department of plastic surgery , a suitable piece of strattice pliable was placed over the defect and with single - sutures , through drill holes , fixed to the sacral bone and by running sutures to the adjacent muscles . after undermining the muscles superficial to the fascia , the soft tissue was closed layer by layer . three months later , a computed tomography of thorax , abdomen , and pelvis ( ct - tap ) revealed new entrant bone and lung metastasis , and the patient was offered palliative radiotherapy . the patient did not experience further csf - leakage and did unfortunately died two months later . a suitable piece of strattice pliable was placed over the defect and with single - sutures , through drill holes , fixed to the sacral bone and by running sutures to the adjacent muscles . after undermining the muscles superficial to the fascia , the soft tissue was closed layer by layer . three months later , a computed tomography of thorax , abdomen , and pelvis ( ct - tap ) revealed new entrant bone and lung metastasis , and the patient was offered palliative radiotherapy . the patient did not experience further csf - leakage and did unfortunately died two months later . a 29-year - old woman diagnosed with arnold chiari malformations had an occipitocervical decompression surgery , due to progressive headache , in 2013 . two years later , a second decompression surgery was done due to progressive ataxia and paraesthesia in her right arm . during the surgery , a titanium plate was attached to the remains of c1 , and a synthetic dural substitute was inserted . postoperatively two mri scans within a month revealed accumulation of csf superficial to the dural repair site . when the patient for the third time leaked csf from the wound , the leakage was sealed with porcine adm ( strattice pliable ) . a suitable piece of strattice pliable was placed over the leak site and sutured , see figure 1 . before closing a suitable piece of strattice pliable was placed over the leak site and sutured , see figure 1 . before closing despite more than a century of investigation and experimentation , research for the ideal substitute for dural repair continues . in spite of promising results using alloderm as a dural substitute , experiments with other adm products have , to our knowledge , not been reported . at our institution , we have great experience with porcine adm strattice for a wide range of reconstructive procedures , i.e. breast reconstructions , thoracic wall and abdominal wall reconstructions . in addition , the adm has also been used for static reconstructions after facial nerve paralysis . moreover , the porcine adm ( strattice ) was chosen as the other available bovine adm ( surgimend prs ; tei biosciences inc . , boston , ma ) strattice pliable is the porcine counterpart to alloderm and widely used in breast reconstructions . here it must be strong , be flexible , maintain structural integrity after suturing , be fluid - tight , be fully incorporative , not induce host response , not form adhesion to the underlying tissue , and act as a barrier to acute and chronic infections . , the matrix contains only collagen fibers , elastin , hyaluronic acid , fibronectin , proteoglycans , and releasable growth factors . all cellular components are removed in the process . among others , the properties of the adm strattice pliable is flexible but has been shown to be both stronger and stiffer compared to alloderm . when suturing strattice pliable , deformity may hardly be considerable . hence , a repair using strattice pliable will most likely be fluid - tight , if placed correctly . previously it has been questioned whether incorporation of non - human grafts into the human body would induce a stronger immunologic / inflammatory response compared to allografts . strattice pliable seems fully incorporated within six months . only during the first two weeks , moderate to significant inflammatory response consistent to normal wound healing hence , only the first two weeks seems critical in regard to undesirable adhesion to the underlying tissue . . however , warren and colleagues did not experience any cases of adhesion formation or rejection using alloderm . due to great similarity between allederm and strattice another favorable feature of strattice is the supposed protective effect to microbial penetration of staphylococcus aureus and staphylococcus pyogene , two very common skin bacteria . therefore , one may think that in case of infection , it does not necessarily lead to removal of the allograft , as it does not seem to get penetrated by bacteria . this could be due to the neoangiogenesis that ensure the presence of immune cells inside the adm . they managed to refrain from removing the adm , treating the infection with antibiotics only . the use of vacuum therapy is shown to significantly increase blood flow and decrease the rate of infection in the treated area . it can be hypothesized that combining vacuum therapy with implantation of an adm would decrease the incorporative process in a time perspective , due to higher infiltration rate . besides cost , and the above - mentioned requirements , autografts is not always available / obtainable opposite to allografts , and not to mention the absence of donor - site morbidity , e.g. pain , bleeding , and infection . in our two cases , strattice pliable was introduced after several attempts to repair a dural lesion using more traditional methods . despite this , but introducing adm at an earlier stage may however lower the total costs , by lowering the number of surgical interventions and days of admission . based on the published literature , strattice pliable seems to meet the requirements for an ideal dural substitute . in our experience ,

abstractthe use of acellular dermal matrices ( adm ) for dural repair is very scantily described in the literature . we report two cases of dural repair using porcine adm and a literature review . adm and especially stratticetm pliable may be a useful alternative to other dural substitutes . further evaluation would be favorable .

Introduction Case Report(s) Case 1 Surgical technique Case 2 Surgical technique Discussion Disclosure statement

a 48-year - old previously healthy woman visited our emergency department due to intractable substernal chest pain . laboratory tests showed elevated serum cardiac enzymes , which indicated non - st elevation myocardial infarction ( creatine kinase - mb=14.8 ng / ml , troponin i=3.44 ng / ml ) . she had no risk factors for coronary artery disease including a history of smoking , diabetes mellitus , hypertension , and dyslipidemia . she had visited another hospital due to chest pain 8 days before admission to our institution . a diagnosis of unstable angina was made and a coronary angiogram was performed , which revealed coronary artery lesions involving the left anterior descending ( lad ) , diagonal , and ramus intermedius coronary arteries ( fig . her intractable chest pain persisted despite medical treatment including aspirin and the continuous infusion of heparin and nitroglycerin by our emergency department . 1b ) and multiple luminal narrowings even in the left internal thoracic artery ( ita ) . because of the intractable chest pain associated with the rapidly progressing nature of the coronary lesions , the patient was referred for urgent myocardial revascularization . she underwent off - pump coronary artery bypass ( opcab ) using a skeletonized right ita graft as a blood source . the patient was given an initial dose of heparin ( 1.5 mg / kg ) and periodically received supplemental doses to maintain an activated clotting time longer than 250 seconds during opcab . because her skeletonized right ita was too short to reach the target left coronary arteries , a segment of the reversed saphenous vein was anastomosed to the end of the right ita in an i - fashion and grafted to the diagonal and lad coronary arteries , and the ramus intermedius using a sequential grafting technique . upon opening the coronary arteries , the lumen was almost completely filled with diffuse fresh thrombi . when the fresh thrombi were removed through the coronary arteriotomies , neither coronary artery dissection nor atherosclerotic plaque was found . the patient was heparinized in the intensive care unit to maintain an activated clotting time longer than 150 seconds , and anticoagulation therapy using warfarin and aspirin was started at 1 day postoperatively . laboratory markers such as lupus anticoagulant , anticardiolipin antibody , anti - beta2gp1 antibody , complement 3 , complement 4 , and fluorescent antinuclear antibody , were evaluated postoperatively . a 1-year postoperative angiogram was performed and demonstrated completely resolved lad lesions , a patent graft to the ramus intermedius and diagonal coronary arteries , and a competitive flow pattern in the graft to the lad coronary artery ( fig . 1d ) . a 36-year - old woman with a 6-month history of chest pain visited our hospital due to chest pain of increasing frequency . she had been diagnosed as having systemic lupus erythematosus ( sle ) at the age of 20 , and had been treated with corticosteroids . secondary aps manifested as recurrent abortion , an episode of acute pulmonary thromboembolism developed 2 years after the diagnosis of sle , and anticoagulation therapy was added . her family history included an acute myocardial infarction in her elder brother at the age of 34 years . her electrocardiogram and serum level of cardiac enzymes were normal ; however , she did have a positive treadmill test . a preoperative coronary angiogram demonstrated a completely occluded proximal lad coronary artery and multiple stenotic lesions in the obtuse marginal coronary artery ( fig . the right ita was divided at the proximal section and was anastomosed in a y - fashion to the side of the left ita . the left ita was anastomosed to the lad coronary artery , and the right ita was anastomosed to the diagonal and obtuse marginal coronary arteries in a sequential fashion . a 1-year postoperative angiogram was performed and demonstrated that all grafts remained patent ( fig . a 48-year - old previously healthy woman visited our emergency department due to intractable substernal chest pain . laboratory tests showed elevated serum cardiac enzymes , which indicated non - st elevation myocardial infarction ( creatine kinase - mb=14.8 ng / ml , troponin i=3.44 ng / ml ) . she had no risk factors for coronary artery disease including a history of smoking , diabetes mellitus , hypertension , and dyslipidemia . she had visited another hospital due to chest pain 8 days before admission to our institution . a diagnosis of unstable angina was made and a coronary angiogram was performed , which revealed coronary artery lesions involving the left anterior descending ( lad ) , diagonal , and ramus intermedius coronary arteries ( fig . her intractable chest pain persisted despite medical treatment including aspirin and the continuous infusion of heparin and nitroglycerin by our emergency department . 1b ) and multiple luminal narrowings even in the left internal thoracic artery ( ita ) . because of the intractable chest pain associated with the rapidly progressing nature of the coronary lesions , the patient was referred for urgent myocardial revascularization . she underwent off - pump coronary artery bypass ( opcab ) using a skeletonized right ita graft as a blood source . the patient was given an initial dose of heparin ( 1.5 mg / kg ) and periodically received supplemental doses to maintain an activated clotting time longer than 250 seconds during opcab . because her skeletonized right ita was too short to reach the target left coronary arteries , a segment of the reversed saphenous vein was anastomosed to the end of the right ita in an i - fashion and grafted to the diagonal and lad coronary arteries , and the ramus intermedius using a sequential grafting technique . upon opening the coronary arteries , the lumen was almost completely filled with diffuse fresh thrombi . when the fresh thrombi were removed through the coronary arteriotomies , neither coronary artery dissection nor atherosclerotic plaque was found . the patient was heparinized in the intensive care unit to maintain an activated clotting time longer than 150 seconds , and anticoagulation therapy using warfarin and aspirin was started at 1 day postoperatively . laboratory markers such as lupus anticoagulant , anticardiolipin antibody , anti - beta2gp1 antibody , complement 3 , complement 4 , and fluorescent antinuclear antibody , were evaluated postoperatively . a 1-year postoperative angiogram was performed and demonstrated completely resolved lad lesions , a patent graft to the ramus intermedius and diagonal coronary arteries , and a competitive flow pattern in the graft to the lad coronary artery ( fig . a 36-year - old woman with a 6-month history of chest pain visited our hospital due to chest pain of increasing frequency . she had been diagnosed as having systemic lupus erythematosus ( sle ) at the age of 20 , and had been treated with corticosteroids . secondary aps manifested as recurrent abortion , an episode of acute pulmonary thromboembolism developed 2 years after the diagnosis of sle , and anticoagulation therapy was added . her family history included an acute myocardial infarction in her elder brother at the age of 34 years . her electrocardiogram and serum level of cardiac enzymes were normal ; however , she did have a positive treadmill test . a preoperative coronary angiogram demonstrated a completely occluded proximal lad coronary artery and multiple stenotic lesions in the obtuse marginal coronary artery ( fig . the right ita was divided at the proximal section and was anastomosed in a y - fashion to the side of the left ita . the left ita was anastomosed to the lad coronary artery , and the right ita was anastomosed to the diagonal and obtuse marginal coronary arteries in a sequential fashion . a 1-year postoperative angiogram was performed and demonstrated that all grafts remained patent ( fig . aps is a clinical syndrome associated with antibodies against phospholipids , and it manifests as systemic thrombotic disorders including recurrent deep vein thrombosis , pulmonary thromboembolism , brain stroke , and recurrent fetal loss due to placental thrombosis . a diagnosis is made based on at least one of the clinical features -- vascular thrombosis and/or pregnancy morbidity , and one of the laboratory criteria , which are lupus anticoagulant and/or anticardiolipin antibody . coronary events have been reported to occur in approximately 5% of aps patients , particularly those under age 45 . they are usually associated with accelerated atherosclerosis resulting from long - term steroid therapy , dyslipidemia , and hypertension . in addition , the presence of antiphospholipid antibody is regarded as an independent risk factor for premature atherosclerosis . coronary events tend to occur secondary to other thrombotic events . in case 1 , the patient previously had neither risk factors of coronary artery disease nor clinical signs of aps . diffuse coronary thrombosis imitating atherosclerotic coronary artery disease allowed us to perform myocardial revascularization , like to a previous report of a patient with aps and coronary atherosclerosis . we diagnosed the case 1 patient with aps postoperatively from the intraoperative finding of diffuse coronary artery thrombosis and positive lupus anticoagulant activity on the other hand , the second patient was previously followed for secondary aps . severe atherosclerotic stenosis occurred in her left coronary artery territories despite long - term steroid and anticoagulation therapy . in addition to the effect of aps on progressive atherosclerosis , sle - induced myocardial microvasculopathy may have affected the pathogenesis of the case 2 patient .

we report on two women who underwent myocardial revascularization associated with antiphospholipid syndrome ( aps ) with different pathogenic patterns . the first woman presented with acute myocardial infarction , and preoperative angiograms demonstrated rapidly progressing coronary lesions , presumptive unstable plaque , and dissection . operative findings , however , showed fresh thrombi in the coronary arteries , and she was diagnosed postoperatively as having aps . her one - year angiogram demonstrated improved coronary lesions and a competitive flow pattern in the grafts . the second woman presented with unstable angina and had been treated for systemic lupus erythematosus and secondary aps for more than 14 years . she underwent myocardial revascularization due to accelerated coronary atherosclerosis . her one - year angiogram demonstrated patent grafts .

CASE REPORT 1) Case 1 2) Case 2 DISCUSSION

adolescence is a critical period for normal growth and development where there is a gradual transition between childhood and adulthood , and a period which marks puberty and physical maturation . sleep , in a complex association with many other processes , plays an important role in adolescents as dramatic maturational changes in sleep and its neurobiological regulation occurs in this period . the sleep patterns undergo substantial changes from childhood to adolescence characterized by a progressive delay in the sleep phase at the onset of puberty , as well as an endogenous preference for later bedtimes than children and adults . at the same time , societal demands such as school schedules or external factors frequently require earlier wake times and lead to shorter total sleep time in adolescents . studies done by carskadon shows that older adolescents may actually have a physiological need for more sleep than preadolescents . national sleep foundation , united states of america , 2006b , recommends 8.59.5 h of sleep per day for adolescents ages 13 to adult and 911 h of sleep for children from 5 to 12 years . longitudinal studies of sleep needs through puberty have demonstrated that adolescents need more than 9 h of sleep at night with some adolescents requiring additional sleep during the day , whereas laboratory studies showed that they require 9.25 h of sleep per night , with no difference in sleep duration of adolescents across different pubertal stages . but unfortunately , the typical adolescent sleeps one to one and a half hours less than the optimal amount per night . research shows that approximately 45% and 85% of 612 grade students report sleeping less than the recommended amount during school nights . many studies have shown that adolescents on an average obtains 7.58.5 h per night sleep with 26.6% getting less than 6.5 h of sleep per night and only 15% of them gets 8.5 h or more . a study reported 6.3 h of sleep for 10 through 12 graders in japan , and 5.4 h of school nights sleep among 11 and 12 graders and 6.6 h of sleep among 9 and 10 graders in korea . sleep deprivation is sleep less than the average and about 9 h of sleep per night for adolescents . sleep patterns refers to variations in sleep and waking patterns ( bed times and sleep duration ) measured on school and weekend nights . the sleep patterns of adolescents , in contrast to their childhood show a considerable delay on weekends when compared to weekdays , with a later sleep onset and offset during weekends . a cyclical sleep deprivation or sleep debt on school days , mitigated by a sleep on weekends and holidays is often shown by some children and adolescents , which makes them more difficult to fall asleep on subsequent school nights , producing an ongoing cycle of delayed sleep timing with impaired daytime functioning or causing impairment in quality of life . psychosocial factors like academic and social demands , physiological concomitants of puberty , and environmental factors like reduced parental influence on bedtimes , extracurricular activities , watching television , using internet and computer , and playing videogames causes a reduced sleep time . an average of 1 and 2 h of difference between weekend and school - night 's bedtimes is observed in older than younger adolescents . gender - based differences in sleep had been reported in many studies , but often showed inconsistent results . a hong kong study reported more sleep disturbances among female adolescent students . in some studies , girls found to wake up earlier than boys on weekdays , but accumulated higher sleep debt resulting in delayed wake up times on weekends than boys , without a change in their sleep length . these variations could be due to the differences in the measurement of sleep time or due to differences in the age group of participants in the study . sleep hygiene refers to a variety of different practices that are necessary to have normal , quality nighttime sleep and full daytime alertness . poor sleep hygiene practices impair cognitive and behavioral ability in children , and sleep - deprived habits established in adolescence can often lead to problems during subsequent college years . monitoring all adolescents and college - aged students for sleep insufficiency is imperative to improve both academic and emotional well - being . the adolescents in bahrain , especially those who are in higher grades have been observed to have late evening tuition classes that subsequently delay their sleep timing , unless they complete their routine academic sessions and home works earlier . the schools earlier start time at 7.30 am in most of the schools also tends to have an effect of inadequate sleep times among adolescents . however , no published studies regarding sleep duration or sleep hygiene behaviors among indian adolescents in bahrain are so far available to determine the extent of their sleep problems . thus , the aim of the present study is to examine the sleep patterns of adolescents on school days and weekends , to identify the sleep hygiene practices and the extent of parental monitoring among indian adolescents in bahrain and also to determine age and gender differences in sleep duration and sleep hygiene practices . indian adolescents studying in various schools of bahrain from grade 6 to 12 between 11 and 17 years were recruited to participate in the study using convenience sampling , by an informal method of approaching the churches and tuition centers . a written parental consent was taken for all participating adolescents . a letter to parents requesting permission for their adolescent children to participate in the study in addition , adolescent 's willingness to be a part of the study was obtained through the child assent form , as they have not attained the legal age for consent involved in research , which is 18 years . information was collected using a structured questionnaire , and was given to adolescents in the churches during sunday school classes to complete , and , to take it home to be filled for those from the tuition centers . out of 145 questionnaires distributed , the questionnaire consisted of two parts : the first part contained 28 items and included three questions related to demographic profile such as age , sex , and grade level . the remaining questions were related to sleep duration on school days and weekends , reasons for going to bed on school days and weekends at that time , the method of getting up from sleep on school days and weekends , questions related to exercises , and afternoon napping and parental influence while going to sleep and getting up from sleep . questions to assess sleep duration ( given on a 12-h format ) on school days included at what time do you go to bed on a typical school day ? and at what time do you get up from sleep on a typical school day ? the same were asked for sleep duration on weekends . the total sleep duration ( on school days and weekends ) = ( sleep duration on school days 5 ) + ( sleep duration on weekends 2)/7 . napping on school days and weekends and doing exercises were asked by yes or no questions . in addition , for those who answered yes were asked to indicate the duration of napping and the frequency of performing exercises . parental influence on sleep was assessed by questions like , does your parent influence the time of going to bed on school days ? and does your parent influence the time of getting up from bed on school days ? the same were asked to know the parental influence for going to bed and getting up from bed on weekends . the second part assessed the sleep hygiene behaviors through a 13-item questionnaire developed by mastin , bryson and corwyn , 2006 . the scale consisted of items to assess the presence of behavior comprising of sleep hygiene , and participants were asked to indicate how frequently they engage in specific behavior through a 5-point likert scale . the items summed up provided a global assessment of sleep hygiene , ranging from 13 to 65 , with higher scores indicative of more maladaptive sleep hygiene status . the scale has an internal consistency of cronbach 's 0.66 , and good test - retest reliability , 0.71 , p < 0.01 . among the total of 140 adolescents , 90 ( 64% ) were females and 50 ( 36% ) were males . majority ( 66% ) were middle adolescents in the age group of 1517 years and belonged to upper grade levels and the remaining ( 34% ) were younger adolescents from 11 to 14 years ( classified according to adolescent classification by american academy of pediatrics ) . when grouped according to grade levels , 32 adolescents ( 22.86% ) belonged to grade 12 , 25 ( 17.86% ) in grade 11 , 39 ( 27.9% ) in grade 10 , 22 ( 15.7% ) in grade 9 , 12 ( 8.57% ) in grade 8 and five each ( 3.57% ) in grade 6 and 7 , respectively . the time of going to bed and getting up from sleep for adolescents during a typical school day was 10.9 0.9 h and 5.5 0.5 h , respectively . the adolescents average sleep duration during school days was 06.5 1.0 h , much less than the average recommended sleep for this age group . the sleep debt on school days was 2.4 h , compared to the standard 9 h of sleep for this age group . the adolescents time of going to bed and wake times were delayed during weekends . on weekends , the time of going to bed was 12.2 1.5 h , 1.3 h later than school days . the wake time on weekends was 8.6 2.1 h. the sleep duration on a weekend was 8.4 2.7 h , i.e. 1.8 h more than during a school day indicating a more pronounced weekend oversleep among adolescents . the duration of sleep including both school days and weekends was 7.07 1.13 h. sleep duration by gender showed that male adolescents obtained slightly longer sleep duration on school days than female adolescents ( 6.7 h vs. 6.5 h , respectively ) . on weekends , female adolescents slept few minutes longer than male adolescents ( 8.4 h vs. 8.3 h , respectively ) . however , gender difference assessed using t - test for both school days and weekends for sleep duration showed that there is no statistically significant difference in sleep duration between male and female adolescents on school days and weekends since the p values 0.299 and 0.776 were at > 0.05 significance level [ tables 1 and 2 ] . influence of gender and grade level on sleep duration on school days influence of gender and grade level on sleep duration on weekends sleep duration of adolescents when grouped according to grade level on school days and weekends assessed using the kruskal wallis test showed a highly significant difference in sleep duration on school days and weekends between adolescents of various grade levels since the p values were < 0.001 and 0.001 , respectively [ tables 1 and 2 ] . the sleep duration of adolescents on higher grade levels were less when compared to sleep duration of adolescents on lower grade levels . majority of adolescents ( 52.1% ) reported that they take daytime naps during school days . twenty - eight of them ( 38.4% ) took daytime naps lasting for 12 h [ table 3 ] . during weekends , daytime napping with duration on school days and weekends only 62 adolescents ( 44.3% ) were involved in doing exercises regularly and the remaining 78 ( 55.7% ) were not involved in any kind of exercises . eighty - four adolescents ( 60.0% ) reported that their parents do not influence their bedtimes on school days and weekends and only 56 ( 40.0% ) adolescents parents influenced their bedtimes on school day . however , 60.7% adolescents parents influenced their time of getting up from bed on school days . during weekends , only 44 adolescents ( 31.4% ) reported that their parents influenced their rise times and the remaining 96 ( 68.6% ) reported that their parents did not monitor their rise times . a significant difference between parental monitoring at the time of getting up on school days and sleep duration was obtained ( p value 0.026 at 0.05 level of significance ) . whereas parental monitoring at the time of going to bed on school days , and that at the time of getting up and sleep duration on weekends was not statistically significant [ table 4 ] . relationship between parental monitoring and sleep duration the mean sleep hygiene score of adolescents was 31.0 5.9 . when grouped according to gender , the male adolescents obtained slightly higher sleep hygiene scores than female adolescents ( mean 31.3 6.2 vs. 30.8 5.8 , respectively ) . the highest score was obtained among grade 10 adolescents , followed by 7 graders and 12 graders , indicating poorer sleep hygiene practices among these adolescents ( mean 32.5 5.4 , 32.2 7.2 and 31.4 5.6 , respectively ) . however , the t - test and kruskal wallis test to find the influence of gender and grade level on sleep hygiene practices showed no significant difference as the p values 0.664 and 0.282 were > 0.05 level of significance . also , taking naps during school days and weekends and doing exercise do not show any significance with sleep hygiene practices as the p values 0.068 , 0.253 and 0.231 respectively were at > 0.05 level of significance [ table 5 ] . among the total of 140 adolescents , 90 ( 64% ) were females and 50 ( 36% ) were males . majority ( 66% ) were middle adolescents in the age group of 1517 years and belonged to upper grade levels and the remaining ( 34% ) were younger adolescents from 11 to 14 years ( classified according to adolescent classification by american academy of pediatrics ) . when grouped according to grade levels , 32 adolescents ( 22.86% ) belonged to grade 12 , 25 ( 17.86% ) in grade 11 , 39 ( 27.9% ) in grade 10 , 22 ( 15.7% ) in grade 9 , 12 ( 8.57% ) in grade 8 and five each ( 3.57% ) in grade 6 and 7 , respectively . the time of going to bed and getting up from sleep for adolescents during a typical school day was 10.9 0.9 h and 5.5 0.5 h , respectively . the adolescents average sleep duration during school days was 06.5 1.0 h , much less than the average recommended sleep for this age group . the sleep debt on school days was 2.4 h , compared to the standard 9 h of sleep for this age group . the adolescents time of going to bed and wake times were delayed during weekends . on weekends , the time of going to bed was 12.2 1.5 h , 1.3 h later than school days . the wake time on weekends was 8.6 2.1 h. the sleep duration on a weekend was 8.4 2.7 h , i.e. 1.8 h more than during a school day indicating a more pronounced weekend oversleep among adolescents . the duration of sleep including both school days and weekends was 7.07 1.13 h. sleep duration by gender showed that male adolescents obtained slightly longer sleep duration on school days than female adolescents ( 6.7 h vs. 6.5 h , respectively ) . on weekends , female adolescents slept few minutes longer than male adolescents ( 8.4 h vs. 8.3 h , respectively ) . however , gender difference assessed using t - test for both school days and weekends for sleep duration showed that there is no statistically significant difference in sleep duration between male and female adolescents on school days and weekends since the p values 0.299 and 0.776 were at > 0.05 significance level [ tables 1 and 2 ] . influence of gender and grade level on sleep duration on school days influence of gender and grade level on sleep duration on weekends sleep duration of adolescents when grouped according to grade level on school days and weekends assessed using the kruskal wallis test showed a highly significant difference in sleep duration on school days and weekends between adolescents of various grade levels since the p values were < 0.001 and 0.001 , respectively [ tables 1 and 2 ] . the sleep duration of adolescents on higher grade levels were less when compared to sleep duration of adolescents on lower grade levels . the time of going to bed and getting up from sleep for adolescents during a typical school day was 10.9 0.9 h and 5.5 0.5 h , respectively . the adolescents average sleep duration during school days was 06.5 1.0 h , much less than the average recommended sleep for this age group . the sleep debt on school days was 2.4 h , compared to the standard 9 h of sleep for this age group . the adolescents time of going to bed and wake times were delayed during weekends . on weekends , the time of going to bed was 12.2 1.5 h , 1.3 h later than school days . the wake time on weekends was 8.6 2.1 h. the sleep duration on a weekend was 8.4 2.7 h , i.e. 1.8 h more than during a school day indicating a more pronounced weekend oversleep among adolescents . sleep duration by gender showed that male adolescents obtained slightly longer sleep duration on school days than female adolescents ( 6.7 h vs. 6.5 h , respectively ) . on weekends , female adolescents slept few minutes longer than male adolescents ( 8.4 h vs. 8.3 h , respectively ) . however , gender difference assessed using t - test for both school days and weekends for sleep duration showed that there is no statistically significant difference in sleep duration between male and female adolescents on school days and weekends since the p values 0.299 and 0.776 were at > 0.05 significance level [ tables 1 and 2 ] . influence of gender and grade level on sleep duration on school days influence of gender and grade level on sleep duration on weekends sleep duration of adolescents when grouped according to grade level on school days and weekends assessed using the kruskal wallis test showed a highly significant difference in sleep duration on school days and weekends between adolescents of various grade levels since the p values were < 0.001 and 0.001 , respectively [ tables 1 and 2 ] . the sleep duration of adolescents on higher grade levels were less when compared to sleep duration of adolescents on lower grade levels . majority of adolescents ( 52.1% ) reported that they take daytime naps during school days . twenty - eight of them ( 38.4% ) took daytime naps lasting for 12 h [ table 3 ] . during weekends , daytime napping with duration on school days and weekends only 62 adolescents ( 44.3% ) were involved in doing exercises regularly and the remaining 78 ( 55.7% ) were not involved in any kind of exercises . eighty - four adolescents ( 60.0% ) reported that their parents do not influence their bedtimes on school days and weekends and only 56 ( 40.0% ) adolescents parents influenced their bedtimes on school day . however , 60.7% adolescents parents influenced their time of getting up from bed on school days . during weekends , only 44 adolescents ( 31.4% ) reported that their parents influenced their rise times and the remaining 96 ( 68.6% ) reported that their parents did not monitor their rise times . a significant difference between parental monitoring at the time of getting up on school days and sleep duration was obtained ( p value 0.026 at 0.05 level of significance ) . whereas parental monitoring at the time of going to bed on school days , and that at the time of getting up and sleep duration on weekends was not statistically significant [ table 4 ] . when grouped according to gender , the male adolescents obtained slightly higher sleep hygiene scores than female adolescents ( mean 31.3 6.2 vs. 30.8 5.8 , respectively ) . the highest score was obtained among grade 10 adolescents , followed by 7 graders and 12 graders , indicating poorer sleep hygiene practices among these adolescents ( mean 32.5 5.4 , 32.2 7.2 and 31.4 5.6 , respectively ) . however , the t - test and kruskal wallis test to find the influence of gender and grade level on sleep hygiene practices showed no significant difference as the p values 0.664 and 0.282 were > 0.05 level of significance . also , taking naps during school days and weekends and doing exercise do not show any significance with sleep hygiene practices as the p values 0.068 , 0.253 and 0.231 respectively were at > 0.05 level of significance [ table 5 ] . the present study investigated the sleep - wake patterns of indian adolescents studying in bahrain on school days and weekends , sleep duration , and the associations between sleep duration , sleep hygiene behaviors and parental monitoring . the adolescents in this study obtained less than the average recommended 9 h of sleep for their age group , i.e. 6.5 h on school days , 8.4 h on weekends and an average of 7.07 h total sleep including school days and weekends . the bedtime on school days was 10.9 h and on weekends it was delayed to 12.2 h. these findings were similar to those obtained in taiwan , where 54% of middle school and 74% of high school adolescents slept less than 68 h on school days , and in greece , where total nocturnal sleep duration among the high school adolescents were 6.58 h and 7.28 h with afternoon napping . also , 41.3% of south australian adolescents obtained less than 8 h of sleep and 78% reported discrepant school versus weekend morning out of bed timings . the adolescents in bahrain obtained less sleep than hong kong chinese adolescents on school nights , and a much shorter sleep than indian adolescents on school days and weekends . whereas a u.s . study showed that 23% of the adolescent respondents went to bed at 11.15 pm or later and slept fewer than the recommended 9 h of sleep . female adolescents in this study slept slightly less than male adolescents during school days ( 6.5 h vs. 6.7 h ) and the reverse was observed during weekends for girls and boys ( 8.4 h vs. 8.3 h , respectively ) . this weekday and weekend sleep were consistent with studies in spain and in usa . and in contrast with sleep reported among indian adolescents . a 36 min later rise time of females , with a sleep length of 9 h 45 min and an average rise time of 10:31 on weekends than boys is reported in another . however , gender differences were not significant in this study for sleep duration similar to studies in greece , florida , and india . whereas a significant difference between boys and girls in sleep duration was observed among german adolescents . the findings of this study indicated that a highly significant difference exists in total sleep duration between adolescents of various grade levels on both school days and weekends , where adolescents on higher grade slept less compared to adolescents on lower grade levels . adolescents in grade 12 obtained only 6.1 1.1 h of sleep in comparison to adolescents in grade 6 , who slept for 7.7 0.9 h. similar trends were observed in korea , where 1012 graders slept 5.78 1.3 h in comparison with 56 graders who slept for 7.95 1.05 h , and in taiwan . since 9 h is considered as the general requirement of adolescent sleep , all adolescents in this study were obtaining less than the required amount of sleep and thus are sleep - deprived . this could be explained by the fact that as the indian adolescents enter into higher grade levels , they spend considerable time in completing school works , assignments , and projects and in addition , go for private tutoring and thus reach late at home between 7 pm and 10 pm . they also prepare for the entrance exams for getting admission to professional courses after finishing the 12 grade to further pursue their career . these make them getting reduced hours of sleep and sleeping at late hours at night . however , majority of adolescents in bahrain took a daytime nap regularly on school days lasting 12 h as a method to compensate for their lost sleep similar to 60% of students in greece . but on weekends , the tendency of daytime napping was comparatively less among the adolescents and could be due to the long hours of sleep they obtain during weekends . majority of the adolescents in this study reported that parental monitoring was absent during school days and weekends for their bedtimes . but , most of the adolescents rise times on school days were influenced by parents , even though majority of the adolescents rise times on weekends were not monitored by them . parental monitoring showed significant difference with sleep duration on rise times of adolescents on school days . randler reports significant age differences in the setting of bedtimes of adolescents by parents , whereas 35% of adolescent bedtimes were set by parents on weekdays in contrast to 9% of parental setting of bedtimes on weekends . parental monitoring was absent by the age of 17 years and in those adolescents whose sleep was not monitored by parents went to bed later than those with parental monitoring . the sleep hygiene practices were worse among 10 graders followed by 7 and 12 graders , even though gender and grade levels were not statistically significant . it could be due to the influence of puberty , higher amounts of stress and poor sleep hygiene practices . this study also supports previous research findings about poor sleep hygiene practices : an irregular bed / stimulating mental activity before bedtime , staying up late to study or academic commitments and earlier wake up times are associated with sleep problems in adolescents . whereas better sleep hygiene practices were observed among italian adolescents than american adolescents . this study indicates that there is a high prevalence of short sleep in adolescents , which poses a risk by making them sleep deprived . accumulated sleep deprivation causes impairment in cognitive , vigilance and memory and mood disturbances among adolescents , which can be prevented by promoting good sleep hygiene and increasing their total sleep time . in addition , the biological , behavioral and social and environmental factors have to be addressed to develop regular sleep schedules and to entrain the circadian system since poor sleep seems to be a universal and prevalent problem in modern society . there were some limitations in this study . the study used a non - probability sampling method and the sample collection from informal centers might not be representative of the more general population of indian adolescents in bahrain . the use of a random sampling and inclusion of an equal proportion of female and male adolescents would have been valuable . also , the study used a cross - sectional method and the data was collected using a self - rated questionnaire . using longitudinal studies and more objective measures for sleep like actigraphy could provide better measures about variations in sleep across adolescent population . there is also evidence that sleep quality is a better measure for adequate sleep than sleep times which has to be investigated further . this will need to be addressed in subsequent research using interventional programs and strategies for better sleep practices in adolescents . even though these limitations are present , the findings of this research may be valuable in exploring the sleep patterns and could contribute to the sleep practices among indian adolescents in bahrain . the study investigated adolescents sleep patterns and its association with sleep hygiene behaviors and parental monitoring . the results suggest that there is a high prevalence of insufficient sleep and irregular bedtime schedule in adolescent students in bahrain which give an insight into promoting good sleep practices in adolescents . parents , teachers and researchers should be also taught about the importance of sleep in adolescents and the health consequences with lack of sleep . interventions to help adolescents with the sleep issues , promoting good sleep hygiene strategies along with time management skills to facilitate healthy sleep are required . future studies could consider the relationship of daytime sleepiness and the influence of sleep quality with sleep behaviors as well as the pubertal changes associated with sleep to further understand the sleep problems in adolescents .

introduction : sleep plays an important role in adolescent 's health and undergoes substantial changes with puberty and physical maturation with a preference for later bed times . evidence shows that many adolescents are not obtaining the required amounts of sleep which is 9.25 h , due to inadequate sleep practices , academic and societal demands . this study aims at describing the ( 1 ) sleep patterns of adolescents on school days and weekends , ( 2 ) sleep hygiene practices and the extent of parental monitoring and ( 3 ) gender and grade level differences in sleep duration and sleep hygiene practices among indian adolescents in bahrain.materials and methods : study used a descriptive correlational design . a total of 145 adolescents from 11 to 17 years from grade 6 to 12 were selected using convenience sampling . data was collected from november 2012 to march 2013 . a structured questionnaire for sleep patterns and mastin et al . 's sleep hygiene index for assessing sleep hygiene practices were used.results:the adolescents total sleep duration was 7.07 1.13 hours . a highly significant difference in sleep duration on school days and weekends between adolescents of various grade levels ( p < 0.001 and 0.001 , respectively ) and between parental monitoring at the time of getting up on school days and sleep duration ( p value 0.026 at 0.05 level of significance ) was found . gender was not significant with the sleep duration , and also with sleep hygiene index scores.conclusion:the results suggest that there is a high prevalence of insufficient sleep and irregular bed - time schedule among indian adolescents in bahrain . interventions directed toward improving sleep and promoting good sleep hygiene strategies are required to improve the physical and emotional health of adolescents .

Introduction Materials and Methods Results Profile of the respondents Sleep wake patterns and sleep duration of the respondents Sleep duration on school days and weekends Sleep duration by gender Sleep duration by grade levels Afternoon napping and exercises Parental monitoring and sleep Part B: Sleep hygiene index scores of respondents Discussion Conclusion

the genomes of eukaryotic organisms are characterized by a large number of repetitive dna segments . these sequences are identifiable by a high variability in their nucleotide composition , number of copies , function , distribution and organization in the genome ( wagner et al . , 1993 ; charlesworth et al . , generally , these sequences may be classified as coding sequences , represented by ribosomal and histone multigene families , and noncoding sequences , repeated in tandem or dispersed throughout the genome ( sumner , 2003 ; nagoda et al . , 2005 ) the repetitive nature of these sequences makes them ideal for the development of probes for use in fluorescence in situ hybridization ( fish ) . studies related to the organization and physical mapping of these types of sequences have enabled a better characterization of the biodiversity and karyoevolution of the ichthyofauna ( vicari et al . , 2010 ) . furthermore , these data have also helped advancing in the knowledge of the organization , diversification , evolution and possible role of repetitive dna sequences in the genome of vertebrates ( haff et al . , 1993 ; martins and galetti jr , 1999 ; gursel et al . , 2003 ) . however , the vast majority of mapping studies carried out on neotropical fishes were focused on the location of ribosomal sites , and there is still very little information regarding other types of sequences , such as histone genes and transposable elements ( tes ) . even though studies on physical mapping of histone genes and tes are few , interesting features about those sequences have been revealed , such as association with other repetitive families ( cioffi et al . , 2010 ; hashimoto et al . , 2011 , 2013 ; 2011a ) , and influences on karyotype diversification ( pansonato - alves et al . , 2013a ) . although known as a single taxonomic entity , s. marmoratus ( synbranchiformes , synbranchidae ) displays considerable cytogenetic diversity . as a result , there are distinct karyotype variants ( foresti et al . , 1992 ; melilo et al . , 1996 ; snchez and fenocchio , 1996 ; torres et al . , 2005 ) , resulting in five well - differentiated main karyomorphs ( unpublished data ) . individuals in karyomorph groups a and b have chromosome number 2n = 42 . in addition , a pericentric inversion in a submetacentric chromosome of karyomorph a is related to the origin of karyomorph b. in contrast , analyses of chromosome rearrangements can not definitively explain the origins of karyomorphs c ( 2n = 46 ) , d and e ( 2n = 46 ) , because the events responsible for their diploid chromosome numbers seem to originate from undependable and bidirectional events ( unpublished data ) . this study describes the cytogenetic mapping of the histone sequences h3 and h4 and of the transposable elements rex1 and rex3 in samples from three s. marmoratus karyomorphs . the purpose of this study was to investigate the distribution patterns of each element in this group . ( 1981 ) , from specimens of karyomorphs a , b and e , collected at different brazilian locations , as specified in table 1 and figure 1 . all samples were collected in accordance with the brazilian environmental law ( collection permission mma / ibama / sisbio - nr . 3245 ) , and the procedures for fish collection , maintenance and analysis were performed in compliance with the brazilian college of animal experimentation ( cobea ) and approved ( protocol nr . 503 ) by the bioscience institute / unesp ethics committee on use of animals ( ceua ) . after the analyses , the fishes were fixed in 10% formalin , conserved in 70% ethanol and deposited in the fish collection of the fish biology and genetics laboratory ( laboratrio de biologia e gentica de peixes ) - unesp , botucatu , so paulo , brazil . genomic dna of s. marmoratus ( karyomorph a ) was extracted using the wizard genomic dna purification kit ( promega ) . partial sequences of the histone genes h3 and h4 and the retrotransposable elements rex1 and rex3 were obtained by polymerase chain reaction ( pcr ) using previously described primers ( white et al . , 1990 ; the h3 and h4 histone sequences were labeled with biotin-16-dutp ( roche ) , and the rex1 and rex3 tes and 18s rdna with digoxigenin-11-dutp ( roche ) , by incorporating these modified nucleotides . slides were incubated with rnase ( 50 g / ml ) for1 h at 37c . then , the chromosomal dna was denatured in 70% formamide in 2 ssc for 5 min at 70 c . for each slide , 30 l of hybridization solution ( containing 200 ng of each labeled probe , 50% formamide , 2 ssc and 10% dextran sulphate ) were denatured for 10 min at 95 c , dropped onto the slides and hybridized overnight at 37 c in a 2 ssc moist chamber . after hybridization , the slides were washed in a 0.2 ssc solution with 15% formamide for 20 min at 42 c , followed by a second wash in 0.1 ssc for 15 min at 60 c , and a final wash in 4 ssc with 0.5% tween for 10 min at room temperature . probe detection was carried out with avidin - fitc ( sigma ) or anti - digoxigenin - rhodamine ( roche ) , the chromosomes were counterstained with dapi ( 4,6-diamidino-2-phenylindole , vector laboratories ) , and the fish images were captured by an optical photomicroscope ( olympus , bx61 ) with the image pro plus 6.0 software ( media cybernetics ) . ( 1981 ) , from specimens of karyomorphs a , b and e , collected at different brazilian locations , as specified in table 1 and figure 1 . all samples were collected in accordance with the brazilian environmental law ( collection permission mma / ibama / sisbio - nr . 3245 ) , and the procedures for fish collection , maintenance and analysis were performed in compliance with the brazilian college of animal experimentation ( cobea ) and approved ( protocol nr . 503 ) by the bioscience institute / unesp ethics committee on use of animals ( ceua ) . after the analyses , the fishes were fixed in 10% formalin , conserved in 70% ethanol and deposited in the fish collection of the fish biology and genetics laboratory ( laboratrio de biologia e gentica de peixes ) - unesp , botucatu , so paulo , brazil . genomic dna of s. marmoratus ( karyomorph a ) was extracted using the wizard genomic dna purification kit ( promega ) . partial sequences of the histone genes h3 and h4 and the retrotransposable elements rex1 and rex3 were obtained by polymerase chain reaction ( pcr ) using previously described primers ( white et al . , 1990 ; colgan et al . , 1998 the h3 and h4 histone sequences were labeled with biotin-16-dutp ( roche ) , and the rex1 and rex3 tes and 18s rdna with digoxigenin-11-dutp ( roche ) , by incorporating these modified nucleotides . slides were incubated with rnase ( 50 g / ml ) for1 h at 37c . then , the chromosomal dna was denatured in 70% formamide in 2 ssc for 5 min at 70 c . for each slide , 30 l of hybridization solution ( containing 200 ng of each labeled probe , 50% formamide , 2 ssc and 10% dextran sulphate ) were denatured for 10 min at 95 c , dropped onto the slides and hybridized overnight at 37 c in a 2 ssc moist chamber . after hybridization , the slides were washed in a 0.2 ssc solution with 15% formamide for 20 min at 42 c , followed by a second wash in 0.1 ssc for 15 min at 60 c , and a final wash in 4 ssc with 0.5% tween for 10 min at room temperature . probe detection was carried out with avidin - fitc ( sigma ) or anti - digoxigenin - rhodamine ( roche ) , the chromosomes were counterstained with dapi ( 4,6-diamidino-2-phenylindole , vector laboratories ) , and the fish images were captured by an optical photomicroscope ( olympus , bx61 ) with the image pro plus 6.0 software ( media cybernetics ) . both h3 and h4 histone sequences appeared to be clustered together and were distributed in a general pattern with dispersed signals on all chromosomes . additionally , both sequences were accumulated in one acrocentric pair ( figure 2a f ) . since the histone sites mapped until now in fishes were found in conspicuous blocks , we used the double - fish technique ( 18s rdna + h3 histone sequences ) , in order to compare the hybridization patterns of both probes and check the veracity of the dispersed signal pattern of the histone sequences . double - fish confirmed that , as expected , in synbranchus the histone sites are dispersed throughout the genome , while the 18s rdna sites are only present in one big cluster ( figure 3a d ) . similarly , the rex1 and rex3 tes are arranged in small clusters that are also dispersed throughout the genome ( figure 4a f ) . however , in the individuals belonging to karyomorph a collected at bataguassu , only the rex3 elements demonstrated significant accumulation in chromosome pair 3 ( figure 4d ) . both h3 and h4 histone sequences appeared to be clustered together and were distributed in a general pattern with dispersed signals on all chromosomes . additionally , both sequences were accumulated in one acrocentric pair ( figure 2a f ) . since the histone sites mapped until now in fishes were found in conspicuous blocks , we used the double - fish technique ( 18s rdna + h3 histone sequences ) , in order to compare the hybridization patterns of both probes and check the veracity of the dispersed signal pattern of the histone sequences . double - fish confirmed that , as expected , in synbranchus the histone sites are dispersed throughout the genome , while the 18s rdna sites are only present in one big cluster ( figure 3a d ) . similarly , the rex1 and rex3 tes are arranged in small clusters that are also dispersed throughout the genome ( figure 4a f ) . however , in the individuals belonging to karyomorph a collected at bataguassu , only the rex3 elements demonstrated significant accumulation in chromosome pair 3 ( figure 4d ) . histone genes constitute a complex multigene family and may show variations in copy number and organization within the genome ( kedes , 1979 ) . thus , some species may present up to a few thousand histone gene copies , usually organized into tandemly repeated copies , while in others these sequences may be dispersed throughout the genome in small groups of copies ( reviewed in rooney et al . , are restricted to eight species mapped for h1 genes ( pends et al . , 1994 ; hashimoto et al . , 2011 , 2013 ; 2012 ) and only five species with mapped h3 sites ( pansonato - alves et al . all of them presenting histone sequences as conspicuous blocks in chromosomes . despite the restricted sampling , these studies revealed some particular characteristics , such as differential dispersion of sites and association with 5s or 18s rdna ( hashimoto et al . more recent studies also showed that h1 , h3 and h4 histone genes are clustered at the same site in fishes of genus astyanax ( pansonato - alves et al . our present results show that h3 and h4 histone sequences appear to be linked to one another and that in synbranchus their dispersion occurs in small clusters throughout the genome . moreover , in some acrocentric chromosome pairs there may be a small accumulation of these sites , which may be considered the major histone clusters , characterizing a distinct mode of organization of these sequences in fish chromosomes . to date , the mapped sites of histone sequences in fishes of distinct orders such as characiformes ( hashimoto et al . , 2011 , pansonato - alves et al . , 2013 ; pansonato - alves et al . , 2013a ) and perciformes ( lima - filho et al . , 2012 ) are shown as large chromosomal blocks . the distinct organization and distribution of the h3 and h4 histone sites in s. marmoratus lead to the conclusion that , in this group , these sites are organised in small and abundant repetitions throughout the genome . this extensive distribution may be attributed to one of the following factors : ( i ) extensive occurrence of orphon genes derived from in - tandem repetitive families in eukaryotes , as already demonstrated for histone and ribosomal genes ( childs et al . , 1981 ; eirn - lpez et al . , 2004 ) and likely to be related to a birth - and - death evolutionary mechanism ( eirn - lpez et al . , 2004 ) ; or ( ii ) associations between histone sequences and transposable elements ( tes ) due to the similarity of their distribution patterns mapped in fishes ( ferreira et al . just as for histone sites , the physical mapping of tes in representatives of the neotropical ichthyofauna is restricted to a small number of species and to the non - ltr retrotransposons rex1 , rex3 and rex6 ( gross et al . , 2009 ; cioffi et al . , 2010 ; valente et al . , 2011 ; ferreira et al . the overlap of signals generated by fish among tes and other repetitive sequences raises questions about their role in the dispersion of repetitive dna sequences ( mandrioli et al . , 2001 ; mandrioli and manicardi , 2001 ; cioffi et al . , 2010 ) . in s. marmoratus , the rex1 and rex3 elements are found in small clusters dispersed over all chromosomes . notably , an accentuated accumulation of repetitions in the centromeric region of pair 3 was found in samples from bataguassu ( karyomorph a ) ; however , this seems to be only a local amplification because the individuals of karyomorph b , which is believed to be recently derived from karyomorph a ( unpublished data ) , did not present such blocks in this chromosome pair . it is further worth noting that these elements may present variable modes of chromosomal distribution in different species , but tend to be distributed in a similar manner in close groups . the rex1 , rex3 and rex6 elements , for example , are primarily compartmentalized in the pericentromeric heterochromatic regions in cichlid fishes ( teixeira et al . , 2009 ; valente et al . , 2011 ) and dispersed throughout the genome in loricariidae , bathydraconidae and artedidraconidae species ( ozouf - costaz et al . , 2004 ; ferreira et al . , 2011a ; pansonato - alves et al . . however , in characiform species , rex3 elements may also be compartmentalized ( cioffi et al . , 2010 ; pansonato - alves et al . , 2013b ; silva et al . , 2013 ) , indicating that those elements are highly dynamic and their type of genomic organization does not reflect phylogenetic relationships among species . although s. marmoratus presents a remarkable variation in karyotype macrostructure , the physical mapping of histone sequences and transposable elements revealed that these sequences are all dispersed in different karyomorphs , and this seems to be a conserved feature . thus , we stress the importance of further studies regarding the physical mapping of h1 , h3 and h4 histone genes and other repetitive dnas , which may be useful in determining the organization of these genes in eukaryote genomes . similarly , the mapping of transposable elements can bring new perspectives on the genomic organization , dispersion of genes and speciation driven by those sequences .

the fish species synbranchus marmoratus is widely distributed throughout the neotropical region and exhibits a significant karyotype differentiation . however , data concerning the organization and location of the repetitive dna sequences in the genomes of these karyomorphs are still lacking . in this study we made a physical mapping of the h3 and h4 histone multigene family and the transposable elements rex1 and rex3 in the genome of three known s. marmoratus karyomorphs . the results indicated that both histone sequences seem to be linked with one another and are scattered all over the chromosomes of the complement , with a little compartmentalization in one acrocentric pair , which is different from observations in other fish groups . likewise , the transposable elements rex1 and rex3 were also dispersed throughout the genome as small clusters . the data also showed that the histone sites are organized in a differentiated manner in the genomes of s. marmoratus , while the transposable elements rex1 and rex3 do not seem to be compartmentalized in this group .

Introduction Material and Methods Samples Isolation of repetitive DNA sequences and FISH Results Cytogenetic analysis Discussion

primary pulmonary histoplasmosis is a lung disease caused by the dimorphic fungus histoplasma capsulatum , with a worldwide incidence . it is endemic in certain areas of north america , and was first reported in china in 1958 ( 1 ) . the severity of this mycosis is dependent upon the number of inhaled fungal particles and the immune status of the host ( 2 ) . the morbidity and mortality rates of pulmonary histoplasmosis are low among immunocompetent patients . however , the morbidity and mortality rates of this mycosis are greater among immunocompromised individuals . in china , pulmonary histoplasmosis is sporadic . by 2015 , only 76 cases with complete clinical data had been reported in the literature ( 320 ) . clinical presentations may include protean symptoms of fevers , chills , malaise , weight loss , cough and wheezing , symptoms . the majority of affected individuals present clinically silent manifestations and display no apparent symptoms ( 3 ) . therefore , misdiagnosis of pulmonary histoplasmosis as other pulmonary diseases , including tuberculosis , is highly likely . misdiagnosis may delay the treatment , and the disease is fatal if left untreated ( 4 ) . therefore , the present study reports the case of a patient diagnosed with pulmonary histoplasmosis . the study aimed to increase the understanding on the disease characteristics in order to facilitate the diagnosis and treatment of pulmonary histoplasmosis . a 54-year - old male patient was admitted to the xiangya hospital ( changsha , china ) in june 2011 with a persistent cough that had appeared 1 week earlier due to contracting a cold . no signs of fever , sweating , chest pain , sputum , hemoptysis or other discomfort were noted . pulmonary computed tomography ( ct ) scans conducted 2 days prior to admission detected a lump with enhanced intensity in the upper right lung and a large mass of high intensity in the right middle lobe with a pattern of air bronchogram observed in the mass ( fig . physical examination indicated the following : body temperature , 36.5c ; heart rate , 76 beats / min ; blood pressure , 140/80 mmhg . in addition , no superficial lymphadenopathy was noted , while bilateral symmetry was observed in thoracic cage . laboratory examination was also performed and revealed the following results : white blood cell count , 9.410/l ( normal range , 41010/l ) ; red blood cell count , 4.510/l ( normal range , 3.55.510/l ) ; hemoglobin level , 134 g / l ) ; blood platelet count , 23710/l ( normal range , 10030010/l ) ; an elevated erythrocyte sedimentation rate , 70 mm / l ( normal range , < 20 mm / l ) ; and negativity for tuberculosis antibody . in addition , the result of a g - test ( for the detection of ( 1,3)--d - glucan , a fungal cell wall components ) was abnormal at 57.0 pg / ml ( normal range , < 20 pg / ml ) . bronchoscopy conducted 5 days after admission detected signs of inflammation of the bronchi , particularly the presence of severe inflammation in the right middle lobe . pathological examination under bronchoscopy revealed chronic mucosal inflammation in the branches of the right middle lobe . in combination with clinical data , the patient was preliminarily diagnosed with bacterial pneumonia . this diagnosis was made on the basis that lung infection is most commonly bacterial , whereas fungal infections often occur in immunodeficient patients and the present patient was an immunocompetent individual . furthermore , g - tests may produce false positive results .. the patient was treated with levofloxacin ( 0.6 g once daily , intravenously ; daiichi sankyo , tokyo , japan ) for 2 weeks , starting from day 1 after admission ; however , the symptoms were not alleviated . lung ct scans 12 days after admission revealed that the infectious lesions increased in number and in size , as shown in fig . subsequent pathological examination revealed signs of granulomatous inflammation in the right middle lung , as shown in fig . 3 . based on the findings of ct scans and hematoxylin - eosin staining , the patient was suspected with histoplasmosis . subsequently , the patient was diagnosed with pulmonary histoplasmosis , which was confirmed by the aforementioned imaging and pathological findings . following diagnosis , the patient was treated with itraconazole ( janssen pharmaceuticals , inc . , titusville , nj , usa ) for 2 weeks , starting from 15 days after admission . the dosage was 200 mg , by intravenous infusion , twice daily for the first 2 days and 200 mg once daily thereafter . subsequent lung ct scans conducted 4 weeks after admission revealed that the pulmonary infection was alleviated ( fig . 4 ) , and the symptom of cough disappeared ; thus , the patient was discharged from hospital . subsequent to discharge , the treatment was altered to oral administration of itraconazole only ( 200 mg , twice daily , orally ) . a further three rounds of lung ct scans performed in september 2011 , november 2011 and february 2012 demonstrated that the pulmonary lesions were gradually adsorbed , as illustrated in fig . 5a - c , respectively . a second ct examination scan in february 2012 , 10 days after the previous one , revealed that all the lesions in the lung had almost disappeared ( fig . primary pulmonary histoplasmosfis is a primary lung disease caused by infection with fungus histoplasma capsulatum . histoplasma capsulatum is a thermally dimorphic fungus , found in soil , caves and abandoned constructions that are enriched in bat or bird excrement . .infection with histoplasma capsulatum occurs by the inhalation of microconidia or mycelial fragments , which then settle in the host 's lungs and convert to yeast forms . if the patient has strong cellular immunity , then macrophages , epithelial cells and lymphocytes can eliminate the fungi . however , in immunocompromised individuals , histoplasma capsulatum disseminates to a variety of organs , including the bones , spleen , liver , adrenal glands and mucocutaneous membranes , resulting in progressive disseminated histoplasmosis ( 21 ) . in the present study , pulmonary histoplasmosis was selected as the keyword to search the literature for relevant studies published between 1990 and 2015 . the cnki , vip and wanfang databases were searched for relevant studies . in addition , the pubmed database was searched with pulmonary histoplasmosis and china as search terms . exclusion criteria were as follows : i ) cases who were repeatedly reported ; ii ) cases with pulmonary histoplasmosis evolving into disseminated histoplasmosis ; and iii ) cases with incomplete clinical data . in total , 18 eligible studies reporting 76 cases were identified and included for systematic review ( 320 ) . complete clinical data , including age , gender , risk factors , primary disease , clinical manifestation , misdiagnosis , confirmed diagnosis , treatment and prognosis were pooled and evaluated . exclusion criteria were as follows : i ) cases who were repeatedly reported ; ii ) cases with pulmonary histoplasmosis evolving into disseminated histoplasmosis ; and iii ) cases with incomplete clinical data . subsequent to case screening , a total of 76 patients , including 40 male and 36 female aged 2769 years , were eventually recruited for subsequent analysis . among these patients , 52 cases were found to present increased risk factors or primary diseases , 5 cases were treated with glucocorticoid therapy or chemotherapy , and 1 case was orally treated with immunosuppressive agents for an immunodeficiency disease . in total , 46 patients were complicated with alternative diseases or high risk factors , including diabetes mellitus , viral hepatitis , tuberculosis , history of surgery and contact with poultry . however , the case reported in the present study had seldom contacted with duck , swine , cattle and other poultry , and had no history of any systemic disorders or use of immunosuppressive drugs prior to onset . the environment in which the present patient worked was not likely to have caused infection with histoplasma capsulatum spore , suggesting that not all cases of pulmonary histoplasmosis have contact with the fungal spore or exposure to high risk factors . previous studies demonstrated that the symptoms of pulmonary histoplasmosis greatly vary , and ~95% of patients diagnosed with pulmonary histoplasmosis present with atypical clinical manifestations ( 315 ) . common symptoms observed in the eligible studies mainly included fever in 11 cases , chest pain in 6 cases and other respiratory symptoms in 13 cases . however , in the current report , the patient solely presented with cough without apparent pulmonary infection . the imaging manifestations of patients with pulmonary histoplasmosis are significantly diverse . among the 77 cases , which included the 76 previous cases ( 320 ) and the patient in the present study , nodular or lump lesions were noted in 50 patients ( 64.9% ) , pneumonia - like exudative lesions were noted in 19 patients ( 24.7% ) and different shapes of lung lesions were detected in 8 patients ( 10.4% ) ( 22 ) . based on the findings of the present literature review , the following lung ct manifestations can be summarized for cases of pulmonary histoplasmosis : i ) cases with a short medical history of the disease are predominantly manifested as multiple sporadic exudative lesions of varying sizes and indistinct boundary . by contrast , cases with a long history of pulmonary histoplasmosis present with nodular lesions with an explicit boundary or histoplasma capsulatum - infected tumors , or both ; ii ) sporadic or multiple lesions are frequently noted in the middle upper lobe of bilateral lungs ; iii ) pneumonia - like lesions , nodular lesions or both are observed ; iv ) exudates surround the pathological changes ; v ) the intensity enhancement is not evident ; vi ) pleural thickening is noted rather than pleural traction ; and vii ) the disease has a slow course . in the current study case report , the patient was found to have lump lesions in the right middle lung and exudates surrounding the lesions with insignificant enhancement . lung tissue biopsy and fungal culture have been widely recognized as the gold standards for diagnosing pulmonary histoplasmosis ( 23,24 ) . among the 77 cases enrolled in the present study , 74 cases were diagnosed by lung tissue biopsy , while the remaining 3 cases were diagnosed by fungal culture . however , the fungal culture endured for at least 3 weeks and the positive rate was not adequately high ; therefore , it has limited application in clinical practice ( 320 ) . similarly , the patient in the present case study was misdiagnosed with infectious pneumonia and showed no improvement following anti - infectious medication therapy . subsequently , ct - guided percutaneous lung aspiration biopsy was conducted , which confirmed the diagnosis of pulmonary histoplasmosis . consequently , bronchoscopy or ct - guided percutaneous lung aspiration biopsy is recommended to obtain histopathologic evidence and enhance the diagnostic accuracy when the diagnosis is ambiguous and undetermined . according to the practice guidelines for histoplasmosis updated by the infectious diseases society of america ( 25 ) following literature analysis , 45 patients with histoplasmosis were surgically treated , 20 were treated with antifungal medication , 4 received itraconazole , 3 received triazole and 1 received with amphotericin b. in the present study , the patient fully recovered following the use of levofloxacin combined with itraconazole for 2 weeks during hospitalization and oral liquid of itraconazole for 10 months after discharge . among the 77 cases , 38 patients were subject to follow - up for as long as > 20 years . the majority of these patients were successfully treated or improved , whereas a minority of cases progressed into disseminated histoplasmosis or succumbed to the disease . in the current study , the patient was followed - up for > 10 months and fully recovered following effective antifungal medication therapy . in conclusion , the present study reported a case of pulmonary histoplasmosis that was initially misdiagnosed as bacterial pneumonia , and later successfully treated with antifungal therapy . for suspicious cases based on medical history and imaging manifestations , bronchoscopy or ct - guided lung needle aspiration biopsy should be actively performed to facilitate the differential diagnosis of pulmonary infection . after the diagnosis is confirmed , effective and proper antifungal treatment should be timely delivered upon the individual situations , aiming to enhance the clinical efficacy .

in the present study , the case of a 54-year - old male patient diagnosed with pulmonary histoplasmosis is reported , with the aim to increase the understanding of the disease characteristics and thereby facilitate the diagnosis and treatment of pulmonary histoplasmosis . clinical manifestations , diagnosis , treatment and clinical outcomes of the present case of pulmonary histoplasmosis were described . in addition , 76 histoplasmosis patients with complete clinical data were reviewed by searching the literature for relevant studies published during 1990 and 2015 . the disease was mainly manifested as cough in the present case , while imaging examination detected a lump shadow in the right lung , accompanied by exudative lesions . initially , the patient was suspected to have bacterial pneumonia , but subsequently the diagnosis of pulmonary histoplasmosis was confirmed by lung biopsy . the symptoms were alleviated following itraconazole treatment . the patient was physically stable and had no recurrence during the subsequent follow - up period . in conclusion , pulmonary histoplasmosis is characterized by non - specific clinical and imaging manifestations , and lung tissue biopsy or respiratory pathogen culture are regarded as the diagnostic gold standards . individualized antifungal medication should be administered based upon the patients ' situation in terms of dosage and duration .

Introduction Case report Discussion

verrucous carcinoma ( vc ) is a slow - growing cancer type which has been reported in the esophagus , oropharynx , larynx , glans penis , scrotum , vulva , vagina , cervix , endometrium , urinary bladder , anus , and in the sole of the feet . the first 5 cases of esophageal vc ever described were reported by minielly at al . in 1967 . in total , vc is known to be associated with several medical conditions , such as chronic esophagitis , esophageal diverticular disease , gastroesophageal reflux disease , hiatal hernia , achalasia , and caustic injury . known risk factors include smoking and alcohol abuse [ 1 , 3 , 6 , 7 , 8 ] . vc occurs more frequently in males and has been reported at all ages from 36 to 76 years . the diagnosis is rare and often delayed since initial superficial biopsies usually show nonspecific chronic inflammation and candida infection but only rarely malignancy . the majority of cases follow a similar symptom pattern and have similar endoscopic and histological characteristics . the endoscopic appearance is often described as a shaggy , papillary mucosa with white plaques . , we diagnosed 2 male patients at the department of gastrointestinal surgery and the department of pathology , rigshospitalet , copenhagen . the 2 cases will be presented in the following to highlight the characteristics of this rare type of carcinoma . our first patient was a 67-year - old male with a medical history of diabetes mellitus type ii , hypertension , and benign polyps in the colon ( three polypectomies ) . the patient had a history of tobacco use during the last 50 years ; at the time of reference , he smoked 10 cigarettes daily . when referred , the patient had suffered from dysphagia for 2 months , and he only consumed fluids . besides a weight loss of 8 kg ( weight at referral 83 kg , weight loss corresponding to 9% of initial body weight ) , the first physical examination was unremarkable , as were the initial blood tests . the primary endoscopy revealed a mucosa covered with white plaques spreading from 30 to 40 cm from the incisors . in the distal part of the affected area , the mucosa protruded and covered almost 2/3 of the lumen and involved the entire circumference ( fig . biopsies showed severe acute inflammation with reactive changes but without dysplasia or malignancy . a computed tomography ( ct ) scan showed a thickened wall in the distal part of the esophagus . since no malignancy was found , four months later , the patient was referred again due to a further massive weight loss of 25 kg ; at this time he weighed only 58 kg ( weight loss corresponding to 36% of initial body weight ) . gastroscopy and blood test were performed again , and human immunodeficiency virus , herpes , and hpv infection were ruled out . to rule out achalasia of the esophagus and gastroesophageal junction , a high - resolution impedance manometry examination was performed followed by a positron emission tomography ( pet)-ct scan , but neither could explain the condition the patient suffered from . during this period of approximately 4 months six months after the first visit , another gastroscopy was performed showing ulceration and a process protruding into the lumen . the biopsy revealed a squamous cell papilloma . in view of the severe weight loss and the poor condition of the patient , he was a heavy smoker ( 1015 cigarettes daily since 18 years of age ) and had a history of previous alcohol abuse of > 168 g pure alcohol per week during a period of 10 years . in addition , he had a hiatal hernia and barrett 's esophagus for which he was treated with a proton pump inhibitor ( pantoprazole 40 mg daily ) . the initial symptom was dysphagia which he had suffered from intermittently during the last one and a half years . an area of a 10-cm , white , irregular mucosa with a 1-cm large polyp - like process was observed at gastroscopy ( fig . 3 ) . biopsies revealed acute and chronic inflammation as well as infection with nonhemolytic streptococcus , escherichia coli , and a few fungal hyphae . the patient underwent a series of gastroscopies without malignant findings , just as the initial ct scan was without suspicion of malignant disease . three months later , a biopsy from the esophagus showed a squamous cell papilloma . the following pet - ct scan performed 6 months after the initial visit found tumor growth and a suspicion of malignancy , stage t2n0m0 . an endoscopic ultrasonography - guided fine - needle aspiration found no malignant cells . during this period , the patient suffered from dysphagia but had no weight loss , nor was he hospitalized . despite the lack of malignant findings , the patient was offered an esophagectomy and underwent surgery . nine months after the first visit , the pathology report of the resected specimen showed a hyperplastic mucosa with a low - grade vc , a mostly exophytic papillary tumor . the tumor was highly parakeratinized with no dissemination into the lymph nodes or other organs . after a minor pneumonia , for which he received antibiotic treatment , in our 2 cases , as in almost all cases previously described , there has been a considerable delay of diagnosis . for our patients this seems to be a consistent pattern for this group of patients , including the presence of dysphagia , occasionally a massive weight loss , and a typical endoscopic picture . the mucosa in our 2 cases was white and covered with plaques and wart - like polyps . furthermore , the mucosa is often described as exophytic , and the description a multilobular polypoid mass has also been used . the only strategy to identify and , moreover , to diagnose and treat this limited group of patients is to be familiar with this typical white , wart - like mucosa and to initiate aggressive treatment already after a few endoscopic examinations . even if all biopsies are without malignancy , a suspicion of vc should be present just based on the macroscopic appearance . a german study including 15 patients with vc in the esophagus from 1999 to 2011 and an american study including 11 patients from 1995 to 2010 have been published . how many underdiagnosed cases of vc exist remains unknown , but an awareness of this type of carcinoma is certainly desirable in a worldwide context . the resected specimen often shows a relatively low - grade tumor and rarely dissemination into the lymph nodes or other organs , which indicates a generally good prognosis . unfortunately , the patients often suffer from a long period of undiagnosed illness and may , as a consequence , be in such a poor condition that curative treatment is no longer an option . the etiology of this carcinoma is still unknown , but different causes , such as chronic inflammatory conditions , have been proposed . however , neither of our patients had an hpv infection in the mucosa . in the literature , the carcinoma is often localized in the distal part of the esophagus , which was also the case in our patients . the endoscopic appearance was very similar to the typical findings described earlier a white , irregular , exophytic mucosa covered with plaques and wart - like polyps , and all biopsies taken from the area were without malignancy . due to the exophytic nature of the vc and the bland appearance of the epithelial cells , it is extremely difficult to obtain biopsies that are sufficiently deep to visualize the invasive part of the tumor . therefore , biopsies are often false - negative and only show nonspecific inflammatory changes or changes compatible with squamous cell papilloma . in conclusion , vc has a very characteristic pattern of symptoms but also a typical endoscopic appearance . thus , when clinical suspicion is raised and disseminated disease has been ruled out , the patient should be considered a candidate for potential curative treatment despite negative biopsies . furthermore , the diagnosis and treatment require a close collaboration between specialists including pathologists , radiologists , and surgeons . as corresponding author i certify that all authors have participated sufficiently in the planning of the study , intellectual content , and the writing of the work to take public responsibility for it .

verrucous carcinoma is a rare , slow - growing type of squamous cell cancer . fewer than 50 patients with verrucous carcinoma in the esophagus have been described worldwide . in 2014 , two male patients were diagnosed with verrucous carcinoma in the distal part of the esophagus . the endoscopic examinations showed a similar wart - like , white , irregular mucosa in both cases . the diagnosis was difficult to make since all biopsies taken from the affected area showed no malignancy . this cancer type has a relatively good prognosis when the diagnosis is finally obtained . both our patients presented with dysphagia , weight loss , and an endoscopically malignant tumor , but surgery was not performed until after 9 and 10 months , respectively , and then in order to get a diagnosis . at the last follow - up , both patients were without any recurrence of the disease .

Introduction Case 1 Case 2 Discussion Statement of Ethics Disclosure Statement

the incidence of primary cardiac tumors is very low , less than 0.3% of autopsies . primary sarcomas of the heart are very rare and constitute less than 25% of primary cardiac tumors , among which rhabdomyosarcomas are the rarest.1 clinical presentation , such as arrhythmia , precordial pain , and pericardial effusion , is not specific and depends on the location of the tumor and intracavitary obstruction to blood flow . patients are sometimes asymptomatic until the appearance of metastasis , which leads to diagnosis.2 despite different treatments ( surgery , chemotherapy , or radiotherapy ) , the survival period for patients with cardiac sarcomas is limited from six months to two years . we present a case of cardiac rhabdomyosarcoma , which was incorrectly presented as a mediastinal tumor by computed tomography ( ct ) . the final diagnosis was conducted via endoscopic ultrasonography ( eus ) , which identified the lesion as a cardiac tumor . the diagnosis was further confirmed histologically by eus - fine needle aspiration ( fna ) . a 76-year - old woman was admitted to our institution because of a reported mediastinal tumor . chest radiography and ct scan revealed a bulky mediastinal tumor , with a size of 77 mm 44 mm 40 mm ( figure 1 ) . moreover , ct scan showed small cervical lymph nodes ( less than 10 mm ) but did not find hepatic or lung metastasis . eus ( fg 36x , pentax , japan ) found a large mass above the cardia and revealed that the tumor developed from the left atrium ( figure 2 ) , which explained the rhythm dysfunction . we performed a trans - esophageal puncture with a 19-g needle ( echotip , cook corporation , limerick , ireland ) during examination ( figure 3 ) . histological and immunohistochemical analyses of the sample revealed a cardiac rhabomyosarcoma ( positive vimentin and anti - myoglobin antibodies ) . the patient underwent chemotherapy ( doxorubicin 50 mg / m every 3 wk ) and achieved a partial response ( 43% decrease in the tumor ) after 8 cycles . eus image showing the tumor that ( t ) developed from the left atrium ( la ) , below the pulmonary artery ( pa ) . eus image showing the puncturing of the left atrium 's tumor with a 19 g needle ( cook ) . she is still alive and without any arrhythmia 17 months after the discovery of the tumor . cardiac rhabdomyosarcomas are very rare tumors ( overall incidence less than 0.07%),3 representing less than 25% of all primary malignant neoplasms of the heart.4 the tumor produces a large variety of symptoms , such as arrhythmia and pericardial effusions , among others.5 its prognosis is very poor.1 the diagnosis is primarily performed via trans - esophageal echocardiography and less frequently via ct scan,6 but final diagnosis is obtained during surgery or autopsy . two - dimensional , doppler , and standard transesophageal echocardiography can only describe the tumor 's location and size , movements , ventricular function , and hemodynamic disorders.7 however , difficulties arise in accessing the tumor extension in mediastinal structures to distinguish between a primary cardiac tumor and a mediastinal tumor infiltrating the heart or differentiate the tumor from a thrombus . ct scan or magnetic resonance imaging ( mri ) can precisely locate the tumor , but not in our case report . t2- weighted sequence mri and/or the injection of contrast could only allow suggestions toward the histological nature in rare cases , such as lipomatous tumors . however , this method does not permit distinguishing between malignancy and benignity and the diagnosis.1 the main advantage of eus and eus - fna is their ability to obtain , during the same procedure , a precise location and a histological characterization of the tumor . although no similar case has been reported , the overall accuracy of eus - fna for mediastinal masses or lymph nodes is 90% to 95% . in our case report , we obtained histological samples , which permitted immunohistochemical studies , i.e. , the vimentin and the anti - myoglobin antibodies . eus - fna of heart tumors is possible without any complication and can prevent the morbidity and mortality of a diagnostic thoracotomy.2 an unusual indication of eus resulted in a more precise diagnosis than ct scan that indicates the presence of a cardiac , but not a mediastinal , tumor . in addition , a histological diagnosis via eus - fna without need for surgery allows the patient to benefit from a fast and optimal medical treatment .

we report a case of cardiac rhabdomyosarcoma , with initial clinical features of atrial rhythmic dysfunction , which was concluded as a mediastinal tumor by computed tomography ( ct ) scan . endoscopic ultrasonography ( eus ) and eus - fna ( fine needle aspiration ) were initially conducted to diagnose the isolated mediastinal mass . in this case , eus re - assessed the previous diagnosis as a cardiac tumor , and the patient eventually achieved a 17-month survival rate after chemotherapy . in this paper , eus findings obtained in our case are described and a review of literatures is briefly discussed . we also describe the advantages and limitations of this technique compared with other image diagnosis alternatives .

Introduction Case report Discussion Conclusion

the association of childhood excess weight or childhood obesity with dyslipidemia was well documented ( 1 ) . it is suggested that some metabolic disorders start early in life and can be further agrevated by other factors in the external environment . researchers believe that genetic factors are important determinants of plasma lipid levels in adults ; although , it is less clear in children and adolescents . one of the main proteins involved in lipoprotein metabolism is cholesterol ester transfer protein ( cetp ) . however , according to evidence cetp has atherogenic roles naturally , which function depending on the metabolic settings . thus , plasma cetp acts as an important protein in the lipid and lipoprotein metabolism and its polymorphisms may affect dyslipidemia and cvd ( 2 ) . several single nucleotide polymorphisms ( snp ) have been identified within cetp ; they influence enzymatic activity or gene expression level . two common polymorphisms of cetp gene are taq1b ( rs708272 ) and a373p ( rs5880 ) . taq1b is a polymorphism at 277 nucleotide in the first intron of cetp and has a restriction site for the endonuclease taq1 . taq1b polymorphism may affect the plasma cetp activity and its concentrations , as well as hdl - c levels . a373p polymorphism is a guanine to cytosine mutation at codon 373 in exon 12 of cetp gene that is one of the most common snps , found in 15 % of asians and europeans . it is shown that these polymorphisms are associated with lipid and lipoprotein metabolism in different populations ( 3 ) . however , to our knowledge , no data exist on the interaction of cetp polymorphisms and weight or birth weight and the risk of dyslipidemia in children and adolescents . given the tracking of atherosclerotic cvd risk factors including dyslipidemia from childhood to adulthood , it is important to determine the predisposing factors of these risk factors in early life . this study aims to investigate joint association between cetp polymorphisms and bmi or birth weight with the risk of dyslipidemia in iranian children and adolescents . this study was conducted as a sub - study of the school - based nationwide health survey , which was the third survey of the school - based surveillance system entitled childhood and adolescence surveillance and prevention of adult non communicable disease ( caspian - iii ) study . the main survey included 5528 students aged 1018 years who were recruited by multistage random cluster sampling from urban and rural areas of 27 provincial counties in iran . details of data collection and sampling were published previously ( 4 ) . for the current study , we randomly selected 750 samples from the whole blood samples kept frozen at -70 c . the current survey was approved by the ethical committee of isfahan university of medical sciences . written informed consent was obtained from parents and oral assent from children and adolescents . bmi was calculated as the weight ( kg ) divided by the height squared ( m ) . world health organization ( who ) defines , normal weight as bmi - z score between -2 and 1 , wasting as bmi - z score between -2 and -3 , risk of overweight as bmi - z score between 1 and 2 , overweight as bmi - z score between 2 and 3 , and obesity as bmi - z score more than 3 ( 5 ) . birth weight was categorized as low birth weight ( less than 2500 g ) , normal ( 25004000 g ) and high birth weight ( more than 4000 g ) . waist circumference was measured at the smallest point of circumference between the iliac crest and the rib cage . for assessing lipid profile , fasting venous blood was taken and lipid profile variables including total cholesterol ( tc ) , hdl - c , ldl - c , and triglyceride ( tg ) were examined . cut - off points for abnormal levels of lipids included : tc 200 mg / dl , ldl - c 130 mg / dl , hdl - c < 35 mg / dl , and tg 130 mg / dl ( 6 ) . we used the questionnaire of the world health organization - global school - based student health survey ( who - gshs ) to assess physical activity . to evaluate the pattern of physical activity , three indicators were used including : hours of physical education at school , hours of screening time , and hours spent on sports club training . to evaluate the family s socioeconomic status ( ses ) , we included questions about the following socioeconomic indicators : ( i ) parental level of education ( illiterate : score 1 , less than high school : score 2 , high school graduate : score 3 , academic education : score 4 ) ; ( ii ) parental occupational status ( unemployed : score 1 , worker / farmer : score 2 , governmental employee : score 3 , self - employed : score 4 ) ; and ( iii ) number of household members , and ( iv ) possessing a family private car ( yes / no ) . of note for parental occupational status and level of education , i.e. questions ( i ) and ( ii ) , only data on the parent with the higher occupational status or education was considered . for assessing dietary habits , we used questions about the type of bread ( i.e. white or whole grain ) and the type of fat consumed in meals at home . food items were grouped into the following categories : carbohydrates ( rice , bread , pasta , and potato ) , vegetables ( potato and french fries not included ) , fruit ( fresh , dried , juice ) , dairy products ( milk , cheese , yogurt ) , proteins , including both animal ( red meat , poultry , fish , egg ) and plant ( beans , soy , nuts ) , fast foods ( pizza , hamburgers , sausages , etc . ) , as well as salty / high fat snacks and sweets / candies . dna was extracted using the qiaamp dna blood mini kit ( qiagen , germany ) according to the manufacturer s protocol from peripheral blood . real - time pcr and high resolution melt ( hrm ) analysis were performed in the corbett rotor - gene 6000 instrument ( corbett research pty ltd , sydney , australia ) . primers were designed by beacon designer 7.91 to flank the genomic regions ( premier biosoft international , usa ) and were synthesized by tib molbiol ( germany ) . amplicons from all genes were generated under the following conditions using the type - it hrm kit ( qiagen , germany ) : one cycle at 95c for 15 min ; 40 cycles at 95 c for 15 sec , 60.0 c for 15 sec , 72 c for 15 sec ; one cycle at 95 c for 15 min ; 40 cycles at 95 c for 15 sec , 60.0 c for 15 sec , 72 c for 15 sec ; one cycle of 95 c for 1 sec , 72 c for 90 sec and a melt from 70 to 95 c rising at 0.1 c per second . the amplification mixture of a total volume of 25 l included 12.5 l of hrm pcr master mix , 1.75 l of 10 m primer mix , 2 l of genomic dna as template , and 8.25 l of rnase - free water . for each genotype reaction , we included sequence - proven major and minor allele homozygote and heterozygote controls . the hrm analysis was performed by instrument software , which allows clustering of the samples into groups based on a difference plot obtained by analyzing the differences in melting curve shape between known controls and samples . primer sequence used for cetp taqib rs708272 was f : gtatagggattt - gtgtttgtct , r : cctaacctggctcagatc and for cetp a373p rs5880 it was f : tctccccaggatatc - gtgactac , r : gcagcacatactggaaatccaaga . the statistical analyses were performed using statistical package for the social sciences ( ver 20.0 ) software ( chicago , il , usa ) . the student s t - test or mann - whitney test , as appropriate , were used to determine differences in continuous variables . categorical variables are presented as percentage . the pearson s chi - square test or fisher s exact test , as appropriate , were used to determine the differences in categorical variables . the multivariate logistic regression analyses was performed to determine how the association of cetp gene polymorphisms with the risk of dyslipidemia after controlling for blocks of covariates related to patient demographics ( age , sex ) , anthropometric characteristics ( bmi and waist circumference ) , and the patient s usual physical characteristics ( e.g. , physical activity , fasting blood sugar , diastolic blood pressure , and systolic blood pressure ) . exploratory interaction analyses based on cetp polymorphisms and bmi / birth weight were also run using generalized linear model , with and without confounder adjustment ( age , sex , physical activity , waist circumference , socioeconomic status , healthy , and unhealthy food intake ) . this study was conducted as a sub - study of the school - based nationwide health survey , which was the third survey of the school - based surveillance system entitled childhood and adolescence surveillance and prevention of adult non communicable disease ( caspian - iii ) study . the main survey included 5528 students aged 1018 years who were recruited by multistage random cluster sampling from urban and rural areas of 27 provincial counties in iran . details of data collection and sampling were published previously ( 4 ) . for the current study , we randomly selected 750 samples from the whole blood samples kept frozen at -70 c . the current survey was approved by the ethical committee of isfahan university of medical sciences . written informed consent was obtained from parents and oral assent from children and adolescents . bmi was calculated as the weight ( kg ) divided by the height squared ( m ) . world health organization ( who ) defines , normal weight as bmi - z score between -2 and 1 , wasting as bmi - z score between -2 and -3 , risk of overweight as bmi - z score between 1 and 2 , overweight as bmi - z score between 2 and 3 , and obesity as bmi - z score more than 3 ( 5 ) . birth weight was categorized as low birth weight ( less than 2500 g ) , normal ( 25004000 g ) and high birth weight ( more than 4000 g ) . waist circumference was measured at the smallest point of circumference between the iliac crest and the rib cage . for assessing lipid profile , fasting venous blood was taken and lipid profile variables including total cholesterol ( tc ) , hdl - c , ldl - c , and triglyceride ( tg ) were examined . cut - off points for abnormal levels of lipids included : tc 200 mg / dl , ldl - c 130 mg / dl , hdl - c < 35 mg / dl , and tg 130 mg / dl ( 6 ) . we used the questionnaire of the world health organization - global school - based student health survey ( who - gshs ) to assess physical activity . to evaluate the pattern of physical activity , three indicators were used including : hours of physical education at school , hours of screening time , and hours spent on sports club training . to evaluate the family s socioeconomic status ( ses ) , we included questions about the following socioeconomic indicators : ( i ) parental level of education ( illiterate : score 1 , less than high school : score 2 , high school graduate : score 3 , academic education : score 4 ) ; ( ii ) parental occupational status ( unemployed : score 1 , worker / farmer : score 2 , governmental employee : score 3 , self - employed : score 4 ) ; and ( iii ) number of household members , and ( iv ) possessing a family private car ( yes / no ) . of note for parental occupational status and level of education , i.e. questions ( i ) and ( ii ) , only data on the parent with the higher occupational status or education was considered . for assessing dietary habits , we used questions about the type of bread ( i.e. white or whole grain ) and the type of fat consumed in meals at home . food items were grouped into the following categories : carbohydrates ( rice , bread , pasta , and potato ) , vegetables ( potato and french fries not included ) , fruit ( fresh , dried , juice ) , dairy products ( milk , cheese , yogurt ) , proteins , including both animal ( red meat , poultry , fish , egg ) and plant ( beans , soy , nuts ) , fast foods ( pizza , hamburgers , sausages , etc . ) , as well as salty / high fat snacks and sweets / candies . dna was extracted using the qiaamp dna blood mini kit ( qiagen , germany ) according to the manufacturer s protocol from peripheral blood . real - time pcr and high resolution melt ( hrm ) analysis were performed in the corbett rotor - gene 6000 instrument ( corbett research pty ltd , sydney , australia ) . primers were designed by beacon designer 7.91 to flank the genomic regions ( premier biosoft international , usa ) and were synthesized by tib molbiol ( germany ) . amplicons from all genes were generated under the following conditions using the type - it hrm kit ( qiagen , germany ) : one cycle at 95c for 15 min ; 40 cycles at 95 c for 15 sec , 60.0 c for 15 sec , 72 c for 15 sec ; one cycle at 95 c for 15 min ; 40 cycles at 95 c for 15 sec , 60.0 c for 15 sec , 72 c for 15 sec ; one cycle of 95 c for 1 sec , 72 c for 90 sec and a melt from 70 to 95 c rising at 0.1 c per second . the amplification mixture of a total volume of 25 l included 12.5 l of hrm pcr master mix , 1.75 l of 10 m primer mix , 2 l of genomic dna as template , and 8.25 l of rnase - free water . for each genotype reaction , we included sequence - proven major and minor allele homozygote and heterozygote controls . the hrm analysis was performed by instrument software , which allows clustering of the samples into groups based on a difference plot obtained by analyzing the differences in melting curve shape between known controls and samples . primer sequence used for cetp taqib rs708272 was f : gtatagggattt - gtgtttgtct , r : cctaacctggctcagatc and for cetp a373p rs5880 it was f : tctccccaggatatc - gtgactac , r : gcagcacatactggaaatccaaga . the statistical analyses were performed using statistical package for the social sciences ( ver 20.0 ) software ( chicago , il , usa ) . the student s t - test or mann - whitney test , as appropriate , were used to determine differences in continuous variables . categorical variables are presented as percentage . the pearson s chi - square test or fisher s exact test , as appropriate , were used to determine the differences in categorical variables . the multivariate logistic regression analyses was performed to determine how the association of cetp gene polymorphisms with the risk of dyslipidemia after controlling for blocks of covariates related to patient demographics ( age , sex ) , anthropometric characteristics ( bmi and waist circumference ) , and the patient s usual physical characteristics ( e.g. , physical activity , fasting blood sugar , diastolic blood pressure , and systolic blood pressure ) . exploratory interaction analyses based on cetp polymorphisms and bmi / birth weight were also run using generalized linear model , with and without confounder adjustment ( age , sex , physical activity , waist circumference , socioeconomic status , healthy , and unhealthy food intake ) . this study was conducted as a sub - study of the school - based nationwide health survey , which was the third survey of the school - based surveillance system entitled childhood and adolescence surveillance and prevention of adult non communicable disease ( caspian - iii ) study . the main survey included 5528 students aged 1018 years who were recruited by multistage random cluster sampling from urban and rural areas of 27 provincial counties in iran . details of data collection and sampling were published previously ( 4 ) . for the current study , we randomly selected 750 samples from the whole blood samples kept frozen at -70 c . the current survey was approved by the ethical committee of isfahan university of medical sciences . written informed consent was obtained from parents and oral assent from children and adolescents . bmi was calculated as the weight ( kg ) divided by the height squared ( m ) . world health organization ( who ) defines , normal weight as bmi - z score between -2 and 1 , wasting as bmi - z score between -2 and -3 , risk of overweight as bmi - z score between 1 and 2 , overweight as bmi - z score between 2 and 3 , and obesity as bmi - z score more than 3 ( 5 ) . birth weight was categorized as low birth weight ( less than 2500 g ) , normal ( 25004000 g ) and high birth weight ( more than 4000 g ) . waist circumference was measured at the smallest point of circumference between the iliac crest and the rib cage . for assessing lipid profile , fasting venous blood was taken and lipid profile variables including total cholesterol ( tc ) , hdl - c , ldl - c , and triglyceride ( tg ) were examined . cut - off points for abnormal levels of lipids included : tc 200 mg / dl , ldl - c 130 mg / dl , hdl - c < 35 mg / dl , and tg 130 mg / dl ( 6 ) . we used the questionnaire of the world health organization - global school - based student health survey ( who - gshs ) to assess physical activity . to evaluate the pattern of physical activity , three indicators were used including : hours of physical education at school , hours of screening time , and hours spent on sports club training . to evaluate the family s socioeconomic status ( ses ) , we included questions about the following socioeconomic indicators : ( i ) parental level of education ( illiterate : score 1 , less than high school : score 2 , high school graduate : score 3 , academic education : score 4 ) ; ( ii ) parental occupational status ( unemployed : score 1 , worker / farmer : score 2 , governmental employee : score 3 , self - employed : score 4 ) ; and ( iii ) number of household members , and ( iv ) possessing a family private car ( yes / no ) . of note for parental occupational status and level of education , i.e. questions ( i ) and ( ii ) , only data on the parent with the higher occupational status or education was considered . for assessing dietary habits , we used questions about the type of bread ( i.e. white or whole grain ) and the type of fat consumed in meals at home . food items were grouped into the following categories : carbohydrates ( rice , bread , pasta , and potato ) , vegetables ( potato and french fries not included ) , fruit ( fresh , dried , juice ) , dairy products ( milk , cheese , yogurt ) , proteins , including both animal ( red meat , poultry , fish , egg ) and plant ( beans , soy , nuts ) , fast foods ( pizza , hamburgers , sausages , etc . ) , as well as salty / high fat snacks and sweets / candies . dna was extracted using the qiaamp dna blood mini kit ( qiagen , germany ) according to the manufacturer s protocol from peripheral blood . real - time pcr and high resolution melt ( hrm ) analysis were performed in the corbett rotor - gene 6000 instrument ( corbett research pty ltd , sydney , australia ) . primers were designed by beacon designer 7.91 to flank the genomic regions ( premier biosoft international , usa ) and were synthesized by tib molbiol ( germany ) . amplicons from all genes were generated under the following conditions using the type - it hrm kit ( qiagen , germany ) : one cycle at 95c for 15 min ; 40 cycles at 95 c for 15 sec , 60.0 c for 15 sec , 72 c for 15 sec ; one cycle at 95 c for 15 min ; 40 cycles at 95 c for 15 sec , 60.0 c for 15 sec , 72 c for 15 sec ; one cycle of 95 c for 1 sec , 72 c for 90 sec and a melt from 70 to 95 c rising at 0.1 c per second . the amplification mixture of a total volume of 25 l included 12.5 l of hrm pcr master mix , 1.75 l of 10 m primer mix , 2 l of genomic dna as template , and 8.25 l of rnase - free water . for each genotype reaction , we included sequence - proven major and minor allele homozygote and heterozygote controls . the hrm analysis was performed by instrument software , which allows clustering of the samples into groups based on a difference plot obtained by analyzing the differences in melting curve shape between known controls and samples . primer sequence used for cetp taqib rs708272 was f : gtatagggattt - gtgtttgtct , r : cctaacctggctcagatc and for cetp a373p rs5880 it was f : tctccccaggatatc - gtgactac , r : gcagcacatactggaaatccaaga . the statistical analyses were performed using statistical package for the social sciences ( ver 20.0 ) software ( chicago , il , usa ) . the data for continuous variables is expressed as meansd . the student s t - test or mann - whitney test , as appropriate , categorical variables are presented as percentage . the pearson s chi - square test or fisher s exact test , as appropriate , the multivariate logistic regression analyses was performed to determine how the association of cetp gene polymorphisms with the risk of dyslipidemia after controlling for blocks of covariates related to patient demographics ( age , sex ) , anthropometric characteristics ( bmi and waist circumference ) , and the patient s usual physical characteristics ( e.g. , physical activity , fasting blood sugar , diastolic blood pressure , and systolic blood pressure ) . exploratory interaction analyses based on cetp polymorphisms and bmi / birth weight were also run using generalized linear model , with and without confounder adjustment ( age , sex , physical activity , waist circumference , socioeconomic status , healthy , and unhealthy food intake ) . p - value of hardy - weinberg expectations was 0.073 for taq1b polymorphism and 0.75 for a373p polymorphism . characteristics of the study population across the cholesterol ester transfer protein gene polymorphisms : the caspian - iii study wc = waist circumference , fbs = fasting blood sugar , dbp = diastolic blood pressure , sbp = systolic blood pressure , ldl - c = low - density lipoprotein , hdl - c = high - density lipoprotein , tg = triglyceride , bmi = body mass index , bw = birth weight the multivariate logistic regression analysis showed a protective effect of ct / tt genotype on dyslipidemia in the crude and adjusted models . g allele of a373p polymorphism increased the risk of dyslipidemia with an or of 4.12 ( 95% ci : 2.57 - 6.62 , p - value < 0.001 ) in the crude and adjusted models ( table 2 ) . multivariate logistic regression analysis of cholesterol ester transfer protein gene polymorphisms associated with dyslipidemia model 1 : adjusted with age , sex , physical activity , bmi , waist circumference model 2 : adjusted with model 1 and fasting blood sugar , diastolic blood pressure , systolic blood pressure we evaluated the joint effect of the taq1b polymorphism or a373p polymorphism and bmi for the risk of dyslipidemia ( table 3 ) . we observed interactive effects of cetp gene polymorphisms and bmi on dyslipidemia ( p - interaction < 0.05 ) . on joint analysis , combination of carrying the t allele with bmi was inversely associated with dyslipidemia . in the crude analysis , we observed a decreased risk of dyslipidemia for the subjects with ct / tt genotypes of the taq1b polymorphism as well as persons with a bmi in underweight or normal categories , with an or of 0.13 ( 95% ci : 0.06 - 0.27 ) and 0.18 ( 95% ci : 0.09 - 0.33 ) , respectively . adjustment for the covariates did not change the statistical significance ( p - value<0.05 ) . among individuals with a bmi in underweight or normal categories , carrying cg / gg was positively associated with dyslipidemia and carrying the g allele increased the risk of dyslipidemia ( or=3.27 , 95% ci : 1.29 - 8.29 and or=5.65 , 95% ci : 2.90 , 11.02 , respectively ) . adjustment for the covariates did not change the statistical significance ( p - value<0.05 ) . combined association of cetp polymorphisms and bmi or birth weight with dyslipidemia cetp= cholesterol ester transfer protein , bmi= body mass index , bw= birth weight adjusted for age , sex , physical activity , waist circumference , birth weight , socioeconomic status , healthy and unhealthy food intake adjusted for age , sex , physical activity , waist circumference , bmi , socioeconomic status , healthy and unhealthy food intake the results for the joint effects of the taq1b polymorphism or a373p polymorphism with birth weight on dyslipidemia and p - interaction are presented in table 3 . we observed interactive effects of cetp gene polymorphisms and birth weight on dyslipidemia ( p - interaction < 0.05 ) . in crude and adjusted analysis , exposure to both the ct / tt genotypes for the taq1b polymorphism and the birth weight in each category posed a decreased risk for the dyslipidemia ( p - value < 0.05 ) . in the crude analysis , among persons with normal birth weight , carrying cg / gg for a373p polymorphism was positively associated with dyslipidemia and carrying the g allele increased the risk of dyslipidemia ( or=2.58 , 95% ci : 1.27 , 5.24 ) . although the risk of dyslipidemia in younger populations has been increasing over the last few decades , much less effort has been made in understanding the gene - environmental interaction in lipid metabolism in younger populations , especially in the young iranian population . the additive effect of the interaction between genetic and environmental factors is greater than the contribution of either risk factor ( 7 ) . the present study suggested the association between the cetp polymorphisms and dyslipidemia in iranian children and adolescents . taq1b polymorphism had protective effect on dyslipidemia . however , a373p polymorphism had adverse effect on dyslipidemia . furthermore , combined effects were observed between the cetp polymorphisms and bmi or birth weight on the risk of dyslipidemia . genome wide association studies ( gwas ) identified strong associations between cetp and plasma lipid concentrations in adults ( 8) . however , the role of genetic factors in the plasma lipid levels is less clear in children ( 2 ) . there is still a huge controversy over the association of taq1b polymorphism with risk of cvd . our results showed taq1b polymorphism improved serum lipid levels and decreased the risk of dyslipidemia . although various previous studies ( 9 , 10 ) have shown a lower cetp activity , higher hdl - c levels , lower postprandial triglyceride , lower risk of cvd and atheroprotective effect in t allele carriers in taq1b polymorphism . others suggested that the t allele had no protective effect or even increased cvd risk in adults ( 11 , 12 ) . in addition , the association of the t allele with higher hdl - c levels was observed in children ( 2 ) . taq1b polymorphism changes the activity of cetp and affects hdl - c concentrations and probably does not affect protein folding . this association may be population specific and is influenced by environmental factors , such as bmi ( 13 ) . our findings showed the a373p polymorphism had deleterious effects on lipid profile levels and approximately increased fourfold the risk of dyslipidemia in children and adolescents . agerholm - larsen et al ( 14 ) reported the a373p polymorphism in cetp associated with decrease in hdl - c levels in both genders . two studies ( 15 , 16 ) found a373p polymorphisms were associated with increasing relative risk of subclinical cardiovascular disease ( relative risk = 1.22 , p = 0.018 ) and 12.2% higher triglyceride concentration ( p = 0.03 ) . they showed that the a373p polymorphism was associated with higher cetp activity and concentration , lower hdl - c levels and atherogenic effects . the copenhagen city heart study reported that a373p polymorphism reduced levels of hdl - c ( 14 ) . however , when 1,236 french and irish subjects were examined , there was no change in cetp activity and hdl - c levels in a373p polymorphism ( 17 ) . the substitution of c for g at amino acid 373 leads to the a373p polymorphism and increases in mass . adverse effect of the a373p polymorphism can be explained by increasing plasma cetp activity and its concentration . effect of this snp on serum lipids is due to chance or indicates a functional effect on cetp gene expression and needs to be assessed by further studies ( 18 ) . gene - environment interactions are common in the pathogenesis of prevalent complex disorders such as dyslipidemia . in our study combined association analyses showed that the taq1b polymorphism had a protective effect and the a373p polymorphism had an adverse effect on dyslipidemia only in underweight and normal weight subjects in both crude and adjusted models . findings showed the relationship between the taq1b polymorphism and hdl - c levels was modified by environmental factors such as obesity ( 19 ) . it is reported that the association between taq1b genotype and hdl - c levels was attenuated by obesity ( 20 ) . however , vohl et al ( 22 ) showed taq1b polymorphism was not associated with higher hdl - c levels in men with hyperinsulinemia and obesity . in this study , we observed that dyslipidemia was not associated with the taq1b or a373p polymorphisms in obese subjects . this has been supported by others who found no association between some lipid profiles such as hdl - c concentrations and taq1b among subjects in the highest bmi tertile ( 26.240.4 kg / m ) . however , they reported this association in the lowest bmi tertile similar to our findings ( 20 , 23 ) . study showed that obesity was able to decrease the protective cardiovascular effect of the t allele in taq1b polymorphism ( 24 ) . findings showed higher cetp activity in obese subjects significantly in comparison with controls ( 25 ) . a similar finding our findings showed that taq1b polymorphism had a protective effect on dyslipidemia in all categories of birth weight , and the a373p polymorphism only in normal birth weight category had a significantly adverse effect on dyslipidemia . according to previous studies low birth weight correlated with higher risk for metabolic syndrome and lipid metabolism disorders in young adults . however , the evidence on the correlation between birth weight and the lipid levels is less in agreement ( 27 ) . british birth cohort showed inverse associations between birth weight and total cholesterol , ldl - c and triglyceride levels ( 28 ) . researchers supposed genetic factors and their interactions could potentially affect associations between birth weight and lipid levels ( 28 , 29 ) . intrauterine environment , including nutritional status and fetal exposure to stress may lead to impaired fetal growth , structural changes in the liver and permanent changes in lipid metabolism ( 27 ) . the main limitation of this study is the cross - sectional nature of the associations . the strengths of the present study are its novelty in the pediatric age group and a relatively large number of population - based samples . the present study showed that taq1b polymorphism had a protective effect and a373p polymorphism had a deleterious effect on dyslipidemia in iranian children and adolescents . more investigation is needed to assess the gene - environment interaction in children and adolescents .

objective(s):this study aims to investigate joint association between cholesterol ester transfer protein ( cetp ) polymorphisms and body mass index ( bmi ) or birth weight with the risk of dyslipidemia in iranian children and adolescents.materials and methods : this study was conducted as a sub - study of the school - based nationwide health survey ( caspian - iii ) . we randomly selected 750 samples from the whole blood samples . real - time pcr and high resolution melt ( hrm ) analysis were performed to determine taq1b ( rs708272 ) and a373p ( rs5880 ) polymorphisms.results:taq1b polymorphism increased hdl - c , and total cholesterol ( tc ) as well as decreased triglyceride and ldl - c concentrations . ldl - c and triglyceride levels were significantly higher and hdl - c and tc levels were significantly lower among those with a373p polymorphism . ct / tt genotype in taq1b polymorphism showed a protective effect on dyslipidemia ( or= 0.12 , 95% ci : 0.07 - 0.20 ) . g allele of a373p polymorphism increased the risk of dyslipidemia ( or=4.10 , 95% ci : 2.14 , 7.83 ) after adjusting the confounders . we observed interactive effects of cetp gene polymorphisms and bmi or birth weight on dyslipidemia.conclusion:findings showed taq1b polymorphism might have a protective effect and a373p polymorphism had deleterious effect on dyslipidemia in iranian children and adolescents . these associations interacted with bmi and birth weight .

Introduction Materials and Methods None Study population Physical examination and biochemical measurements Assessment of physical activity, diet and socioeconomic status DNA extraction Statistical analysis Results Discussion Conclusion

this diarrheal disease is caused by the vibrio cholerae bacteria , but it is the cholera toxin ( ct ) it produces that is the actual pathogenic species . the toxin attaches itself to the intestinal cell wall where it is subsequently internalized and the a - subunit of this ab5 toxin1 subsequently initiates the disease by raising the cellular cyclic adenosine monophosphate ( camp ) concentration followed by fluid efflux into the intestines.2 the initial attachment of the toxin to the intestinal cell surface is caused by the five b - subunits ( ctb5 ) that surround the a - subunit . while a single b binding site already binds with nanomolar affinities to a gm1-oligosaccharide ( gm1os ) , simultaneous binding of more than one b - subunit of the toxin can greatly enhance its affinity ( figure 1 ) . blocking the initial attachment of the toxin to the cell surface has the potential to block the disease . considering the fact that the toxin itself takes advantage of multivalency3,4 in its binding to the cell surface , it was clear that , in order to interfere effectively , a multivalent ligand system would have to be designed . a ) x - ray structure of the cholera toxin b - subunit ( ctb ) bound to gm1os ( pdb i d : 3chb ) ; b , c ) general architecture of the tetravalent ( b ) and pentavalent ( c ) ligands described here . several evaluated multivalent systems have been designed based on dendrimers,5,6 polymers7,8 peptides,9 and also pentavalent scaffolds1012 and have clearly shown the promise of the multivalency approach.1316 in one such approach we attached the gm1os to dendritic scaffolds of varying valencies . especially effective were the tetra- and octavalent systems , which were able to inhibit ctb5 at subnanomolar concentrations and with potency enhancements orders of magnitude larger than the corresponding monovalent ligand.17 subsequent studies with the close relative of the cholera toxin , the heat labile enterotoxin of e. coli ( lt ) , showed that the multivalent ligands , when mixed with the toxin , would lead to aggregates involving many toxin molecules.18 this was shown by analytical ultracentrifuge experiments as well as by atomic force microscopy . the observed aggregation was attributed to the mismatch in valency between the multivalent ligand ( four or eight ) and the multisubunit toxin ( five ) . in fact , it was considered a possibility that the enormous potency enhancements observed in the inhibition assay with the cholera toxin could be due to the mismatch and the subsequent aggregation that the multivalent ligands initiated . on the other hand , there were reports in the literature , which described symmetrical pentavalent ct or lt ligands that were shown to be potent toxin inhibitors that clearly formed a 1:1 complex with the toxin , as judged by dynamic light scattering ( dls ) experiments.10 based on the 1:1 design , several pentavalent ct inhibitors were reported , and it was suggested that this design was beneficial to the inhibition.11,12 this also included a modified version of the cholera toxin that can no longer bind gm1 and was outfitted with 5 gm1os ligands.19 the related shiga - like toxin has also seen a potent inhibitor with five arms for each subunit.20 potent inhibition was seen , although the binding mode , involving two toxins , was not as expected , as the two ligands per arm engaged two separate toxins rather than two binding sites per toxin subunit . however , so far , no experiments were undertaken that compared a matching pentavalent ct inhibitor with inhibitors of nonmatching valencies based on closely related scaffolds . therefore , it remains very much unclear which of the two approaches1:1 design or mismatch - aggregation is the best . we now address this question and report on the synthesis and evaluation in the same assay of tetra- and pentavalent gm1-based ligand systems for ct inhibition . the synthesis started with the preparation of the scaffold for the tetravalent inhibitor 5 , which was subsequently used for the preparation of the scaffold for the pentavalent inhibitor 8 ( scheme 1 ) . the overall design of the tetravalent inhibitor was kept close to the previous version ( inhibitor 11)17 although there were differences in the spacer arms due to the availability and use of a different gm1os building block , that is , 6 in this case . the length of the spacer arm was almost the same as before , with the present one just measuring two atoms longer . furthermore , the previous partly hydrophobic and partly hydrophilic spacer arm was now replaced by one consisting almost entirely of hydrophilic ethylene glycol units . the boxes show the core structure ( left ) and the oligosaccharide ( x , right ) . reagents and conditions ; a ) 2 , bop , dipea , dmf , rt , o / n , 40 % ; b ) tfa , ch2cl2 , rt , 3 h ; c ) 4 , hatu , dipea , dmf , rt , o / n , 60 % ; d ) 6 , cuso45 h2o , na ascorbate , dmf / h2o 1:1 , microwave , 80 c , 20 min , 30 % ; e ) dioxane / meoh/4 n naoh 30:9:1 , rt until hydrolyzed ; f ) 9 , bop , dipea , dmf , rt , o / n , 51 % ; g ) 6 , cuso45 h2o , na ascorbate , dmf / h2o 1:1 , microwave , 80 c , 20 min , 41 % . the synthesis started with the elongation of the four arms of 1 as previously described.5 the spacer 221 was coupled to the dendritic scaffold 1 by the action of benzotriazol-1-yloxytris(dimethylamino)-phosphonium hexafluorophosphate ( bop ) and n , n - diisopropylethylamine ( dipea ) , which resulted in 3 in 50 % yield . after that , trifluoroacetic acid ( tfa ) was used to remove the boc protecting group from the amino groups of 3 , and a coupling reaction between 3 and 422 using 1-[bis(dimethylamino)methylene]-1h-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate ( hatu ) and dipea afforded the tetrameric full length scaffold 5 in 60 % yield over two steps . alkyne cycloaddition ( cuaac ) was subsequently used to conjugate the gm1os derivative 6 to the scaffold 5 , which efficiently yielded the tetravalent gm1 derivative 7 . the tetravalent scaffold 5 formed the starting point for the synthesis of the pentavalent version ( scheme 1 , steps e the resulting carboxylic acid was coupled to the commercially available spacer 9 using bop and dipea , which successfully gave 8 as the pentavalent scaffold in 51 % yield over two steps . subsequently , a microwave - assisted cuaac conjugation reaction was employed on 8 and 6 leading to the formation of the pentavalent gm1 derivative 10 , which was purified by preparative hplc . the compounds were evaluated as ctb5 inhibitors using an assay similar to an enzyme - linked immunosorbent assay ( elisa ) , as previously described.17 a 96-well elisa plate was coated by the natural bovine brain gm1 ganglioside . horseradish peroxidase ( hrp)-conjugated ctb5 was incubated with varying concentrations of the tested inhibitors for 2 h at room temperature . after that , the remaining activity of ctb5 was measured upon addition of the solutions to the wells and incubation for 30 min at room temperature to allow for binding of the remaining toxin . after incubation and washing , the amount of bound toxin was quantified by using a chromogenic substrate for hrp . the previously reported17 tetravalent gm1 compound 11 was used here as a reference in inhibitory potency evaluation . in the present assay , 11 showed an ic50 of 190 pm , a value close to the previously reported one ( 230 pm ) ( table 1 ) . the new tetravalent gm1 compound 7 exhibited a very similar inhibitory potency , with an ic50 of 160 pm . this result shows that a slightly different spacer length and considerably different spacer polarity did not lead to significantly different inhibitory properties . the pentavalent gm1 derivative 10 exhibited an ic50 of 260 pm , which is in the same range as the values found for both of the tetravalent ligands . this indicates that in our assay , the potency of the ligand of matching valency does not essentially differ from the potencies of its nonmatching analogues . potency of the inhibitors[a ] [ a ] determined in an elisa - like assay with ctb5hrp ( 40 ng / ml ) and wells coated with gm1 . in order to learn whether the pentavalent geometry of 10 leads to a different , possibly less aggregative , binding mode , sv - auc23,24 experiments were undertaken . it contained a single species with a sedimentation coefficient of 4.4 s corresponding to a mass of 58 kda for the protein pentamer . sisu et al.18 previously used sv - auc to test the tetrameric gm1os dendrimer 11 with ltb5 , and it was found to strongly aggregate the protein while no discrete oligomers were observed . in the present experiments , tetravalent inhibitor 7 , which is structurally similar to 11 , was added to ctb5 at a pentamer concentration of 50 m . with the addition of 0.21.0 equivalents , a dramatic reduction in the overall signal was observed , as had previously been shown for 11 and ltb5 , indicating rapid sedimentation of aggregating large particles ( figure 2 , see also supporting information ) . however , with inhibitor 7 , the emergence of a peak at 7.20.2 s was seen with a predicted mass of approximately 110 kda , which corresponds to a dimer of ctb pentamers . with increasing amounts of inhibitor up to 10 equivalents , the amount of the dimer species increased , and the emergence of some stable ctb pentamers was also observed . excess and unbound inhibitor was observed as a peak at 0.90.1 s corresponding to a mass of 8 kda . sedimentation velocity analytical ultracentrifugation profiles of tetravalent 7 ( a ) and pentavalent 10 ( b ) , recorded with increasing amounts of multivalent ligand ( legend for both graphs ) . pentavalent inhibitor 10 matched the number of ligand groups to the number of binding sites of ctb5 and so it was expected that this inhibitor should form stable 1:1 complexes . however , the auc results were very similar to those observed for tetravalent ligand 7 . a reduction in signal indicated large scale aggregation , and some dimerization of ctb pentamers was observed . again , at higher equivalents of inhibitor , some ctb pentamers were seen but with no significant difference to the tetravalent inhibitor . the synthesis started with the preparation of the scaffold for the tetravalent inhibitor 5 , which was subsequently used for the preparation of the scaffold for the pentavalent inhibitor 8 ( scheme 1 ) . the overall design of the tetravalent inhibitor was kept close to the previous version ( inhibitor 11)17 although there were differences in the spacer arms due to the availability and use of a different gm1os building block , that is , 6 in this case . the length of the spacer arm was almost the same as before , with the present one just measuring two atoms longer . furthermore , the previous partly hydrophobic and partly hydrophilic spacer arm was now replaced by one consisting almost entirely of hydrophilic ethylene glycol units . the boxes show the core structure ( left ) and the oligosaccharide ( x , right ) . reagents and conditions ; a ) 2 , bop , dipea , dmf , rt , o / n , 40 % ; b ) tfa , ch2cl2 , rt , 3 h ; c ) 4 , hatu , dipea , dmf , rt , o / n , 60 % ; d ) 6 , cuso45 h2o , na ascorbate , dmf / h2o 1:1 , microwave , 80 c , 20 min , 30 % ; e ) dioxane / meoh/4 n naoh 30:9:1 , rt until hydrolyzed ; f ) 9 , bop , dipea , dmf , rt , o / n , 51 % ; g ) 6 , cuso45 h2o , na ascorbate , dmf / h2o 1:1 , microwave , 80 c , 20 min , 41 % . the synthesis started with the elongation of the four arms of 1 as previously described.5 the spacer 221 was coupled to the dendritic scaffold 1 by the action of benzotriazol-1-yloxytris(dimethylamino)-phosphonium hexafluorophosphate ( bop ) and n , n - diisopropylethylamine ( dipea ) , which resulted in 3 in 50 % yield . after that , trifluoroacetic acid ( tfa ) was used to remove the boc protecting group from the amino groups of 3 , and a coupling reaction between 3 and 422 using 1-[bis(dimethylamino)methylene]-1h-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate ( hatu ) and dipea afforded the tetrameric full length scaffold 5 in 60 % yield over two steps . alkyne cycloaddition ( cuaac ) was subsequently used to conjugate the gm1os derivative 6 to the scaffold 5 , which efficiently yielded the tetravalent gm1 derivative 7 . the tetravalent scaffold 5 formed the starting point for the synthesis of the pentavalent version ( scheme 1 , steps e the resulting carboxylic acid was coupled to the commercially available spacer 9 using bop and dipea , which successfully gave 8 as the pentavalent scaffold in 51 % yield over two steps . subsequently , a microwave - assisted cuaac conjugation reaction was employed on 8 and 6 leading to the formation of the pentavalent gm1 derivative 10 , which was purified by preparative hplc . the compounds were evaluated as ctb5 inhibitors using an assay similar to an enzyme - linked immunosorbent assay ( elisa ) , as previously described.17 a 96-well elisa plate was coated by the natural bovine brain gm1 ganglioside . horseradish peroxidase ( hrp)-conjugated ctb5 was incubated with varying concentrations of the tested inhibitors for 2 h at room temperature . after that , the remaining activity of ctb5 was measured upon addition of the solutions to the wells and incubation for 30 min at room temperature to allow for binding of the remaining toxin . after incubation and washing , the amount of bound toxin was quantified by using a chromogenic substrate for hrp . the previously reported17 tetravalent gm1 compound 11 was used here as a reference in inhibitory potency evaluation . in the present assay , 11 showed an ic50 of 190 pm , a value close to the previously reported one ( 230 pm ) ( table 1 ) . the new tetravalent gm1 compound 7 exhibited a very similar inhibitory potency , with an ic50 of 160 pm . this result shows that a slightly different spacer length and considerably different spacer polarity did not lead to significantly different inhibitory properties . the pentavalent gm1 derivative 10 exhibited an ic50 of 260 pm , which is in the same range as the values found for both of the tetravalent ligands . this indicates that in our assay , the potency of the ligand of matching valency does not essentially differ from the potencies of its nonmatching analogues . potency of the inhibitors[a ] [ a ] determined in an elisa - like assay with ctb5hrp ( 40 ng / ml ) and wells coated with gm1 . in order to learn whether the pentavalent geometry of 10 leads to a different , possibly less aggregative , binding mode , sv - auc23,24 experiments were undertaken . first a sample with just ctb5 was measured . it contained a single species with a sedimentation coefficient of 4.4 s corresponding to a mass of 58 kda for the protein pentamer . sisu et al.18 previously used sv - auc to test the tetrameric gm1os dendrimer 11 with ltb5 , and it was found to strongly aggregate the protein while no discrete oligomers were observed . in the present experiments , tetravalent inhibitor 7 , which is structurally similar to 11 , was added to ctb5 at a pentamer concentration of 50 m . with the addition of 0.21.0 equivalents , a dramatic reduction in the overall signal was observed , as had previously been shown for 11 and ltb5 , indicating rapid sedimentation of aggregating large particles ( figure 2 , see also supporting information ) . however , with inhibitor 7 , the emergence of a peak at 7.20.2 s was seen with a predicted mass of approximately 110 kda , which corresponds to a dimer of ctb pentamers . with increasing amounts of inhibitor up to 10 equivalents , the amount of the dimer species increased , and the emergence of some stable ctb pentamers was also observed . excess and unbound inhibitor was observed as a peak at 0.90.1 s corresponding to a mass of 8 kda . sedimentation velocity analytical ultracentrifugation profiles of tetravalent 7 ( a ) and pentavalent 10 ( b ) , recorded with increasing amounts of multivalent ligand ( legend for both graphs ) . pentavalent inhibitor 10 matched the number of ligand groups to the number of binding sites of ctb5 and so it was expected that this inhibitor should form stable 1:1 complexes . however , the auc results were very similar to those observed for tetravalent ligand 7 . a reduction in signal indicated large scale aggregation , and some dimerization of ctb pentamers was observed . again , at higher equivalents of inhibitor , some ctb pentamers were seen but with no significant difference to the tetravalent inhibitor . for the first time , penta- and tetravalent cholera toxin inhibitors based on the same scaffold were compared . the structures contained arms of sufficient length to simultaneously bridge all binding sites ( see supporting information ) . cleary , the pentavalent geometry of 10 did not yield major benefits over the tetravalent 7 ; in fact , it was a little worse . however , it was still a strong inhibitor , so major steric clashes did not occur in the binding of 10 to the toxin . nevertheless one can argue that the potency per arm is significantly reduced by a factor of about two . both 7 and as noted before for 11 , aggregation occurs upon toxin binding , resulting in higher order structures , while only minor amounts of bound pentamer ( or its dimer ) could be detected . the arms of the systems described here are designed in agreement with the concept that their while the fifth arm is slightly shorter than the other four , it should be kept in mind that it is easily capable of bridging the fifth site , and that is attached to a different site of the scaffold . it is of interest to compare our results to related pentavalent systems in the literature . even though inhibition assay results can not be directly compared , it is a fact that the same assay is used in these studies . one pentavalent gm1 system , based on a corranulene scaffold , exhibited an ic50 of 5 nm , presumably not living up to its full potential due to self - association of the scaffold.12 a related calixarene - based system showed higher potency with an ic50 of 450 pm.11 neither of these systems showed a compelling argument in favor of a pentavalent system , consistent with our results . ctb5 , whose binding sites were disabled , was recently used as a scaffold for the display of five gm1 units . this construct showed an ic50 of 104 pm and was shown to form a 1:1 complex with the toxin . while impressive , it is not very different from the 160 pm observed here , nor the 50 pm value for our previously reported octavalent gm1 structure . it seems that a preorganized system can indeed bind in a 1:1 fashion with ctb5;19 however , systems which can adopt more geometries , such as those described here , can be equally potent , and this may possibly be due to their ability to form higher - order structures or simply due to more statistical options for binding . bundle and kitov provided theoretical support for the latter to explain the enhancements in the inhibition of ab5 toxins.25 their model emphasized the importance of a statistical term that describes in how many ways a multivalent ligand can bind to multiple binding sites this was called avidity entropy . this was used to explain why an octavalent system was a better shiga - like toxin inhibitor than the matched pentavalent one . general remarks : unless stated otherwise , chemicals were obtained from commercial sources and used without further purification . microwave reactions were carried out in a dedicated microwave oven : the biotage initiator ( uppsala , sweden ) . analytical hplc runs were performed on a shimadzu automated hplc system ( kyoto , japan ) with a reversed - phase column ( reprospher 100 , c8 , 5 m , 250x4.6 mm , dr . maisch gmbh , ammerbuch - entringen , germany ) , equipped with an evaporative light - scattering detector , plels 1000 ( polymer laboratories , now varian , inc . , palo alto , usa ) and a shimadzu spd-10a vp uv / vis detector operating at 220 and 254 nm . preparative hplc runs were performed on an applied biosystems workstation ( waltham , usa ) . elution was performed using a gradient of 5 % ch3cn and 0.1 % tfa in h2o to 5 % h2o and 0.1 % tfa in ch3cn . h nmr ( 400 mhz ) and c nmr ( 100 mhz ) spectra were recorded on an agilent 400-mr spectrometer ( santa clara , usa ) . heteronuclear single quantum coherence ( hsqc ) spectroscopy and total correlated spectroscopy ( tocsy ) nmr ( 500 mhz ) measurements were performed on a varian inova-500 ( palo alto , usa ) . electrospray ionization mass spectrometry ( esi - ms ) experiments were performed on a shimadzu lcms qp-8000 . high resolution quadrupole time - of - flight mass spectrometry ( hrms - qtof ) analysis was recorded using bruker esi - q - tof ii ( billerica , usa ) . the proton numbering scheme of all compounds can be found in the supporting information and is used in the assignments of the signals in the nmr spectra here . ctb5 inhibition assay : a 96-well plate was coated with a solution of gm1 ( 100 l , 2 g ml ) in phosphate buffered saline ( pbs ) . unattached ganglioside was removed by washing with pbs twice , and the remaining binding sites of the surface were blocked with bsa ( 1 % ) , which was followed by washing with pbs three times . peroxidase conjugate ( final concentration of 40 ng / ml ctb - hrp , sigma ) and inhibitor ( final concentration of 1010 m ) in pbs with bsa ( 0.1 % ) /tween-20 ( 0.05 % ) were incubated at rt for 2 h and were then transferred to the gm1-coated plate . after 30 min of incubation , the solution was removed and the wells were washed three times with pbs with bsa ( 0.1 % ) /tween-20 ( 0.05 % ) . to identify toxin binding to surface - bound gm1 , the wells were treated with a freshly prepared solution of o - phenylenediamine / h2o2 in citrate buffer ( ph 4.5 , 100 l ) for 15 min . after being quenched with h2so4 ( 2.5 m , 50 l ) , inhibition data from three experiments were averaged and fitted in graphpad prism 5.0 ( la jolla , usa ) . analytical ultracentrifugation experiments : mixtures of ctb5 with various amounts of inhibitors were prepared within 1 h before analysis was carried out . samples ( 0.4 ml ) were centrifuged in 12 mm pathlength 2-sector al - centerpiece cells with sapphire windows in a an60ti analytical rotor running in an optima xl - i or optima xl - a analytical ultracentrifuge ( beckman instruments , inc . , palo alto , usa ) at 60 krpm and at 25 c . changes in solute concentration were detected by 300 absorbance scans measured at 280 nm over a period of 56 h. analysis and fitting of the data was performed using the software sedfit v.14.3.26 a continuous c ( s ) distribution model was fitted to the data , taking every 2 scan . the resolution was set at 200 over a sedimentation coefficient range of 0.015.0 s. parameters were set for the partial specific volume as 0.73654 ml g , the buffer density of 1.04910 g ml , and the buffer viscosity at 0.00141 pa s , as calculated using sednterp v.2.0 for 0.1 m pbs . the frictional coefficient , the baseline , and the raw data noise were floated in the fitting . the meniscus and bottom of the cell path were also floated after initial estimations from the raw data . compound 3 : to a solution of tetraamine 15 ( 443 mg , 0.82 mmol ) and spacer 221 ( 1.7 g , 3.90 mmol ) in dry dimethylformamide ( dmf , 15 ml ) , bop ( 2.56 g , 5.79 mmol ) and dipea ( 1.48 g 11.48 mmol ) were added . the residue was purified by silica gel chromatography to afford 3 ( 780 mg , 50 % ) . h and c nmr were consistent with ref . 5 ms ( esi ) m / z [ m+2h2boc ] calcd for c105h174n14o40:1086.58 , found 1086.75 . compound 5 : compound 3 ( 780 mg , 0.33 mmol ) was treated with tfa in ch2cl2 ( 1:1 , 20 ml ) for 3 h at rt , after which the volatiles were removed under reduced pressure , and the residue was dried under high vacuum . meanwhile , compound 4 was prepared following the literature procedure.22 the obtained amine tfa salt of 3 and the spacer 4 ( 670 mg , 2.30 mmol ) were dissolved in anhydrous dmf ( 15 ml ) , then hatu ( 875 mg , 2.30 mmol ) and dipea ( 892 mg , 6.90 mmol ) were added . the residue was purified by silica gel chromatography to afford 5 ( 600 mg , 60 % ) ; h nmr ( 400 mhz , cdcl3 ) : =7.70 , 7.58 , 7.40 , 6.81 ( 14 h , 4br t , j=5 hz , c(o)nh ) , 7.15 ( 2 h , s , ch , aryl-2 , aryl-6 ) , 6.99 ( 4 h , s , ch , 2aryl-2 , 2aryl-6 ) , 6.70 ( 1 h , s , ch , aryl-4 ) , 6.54 ( 2 h , s , ch , 2aryl-4 ) , 4.17 , 4.06 ( 12 h , 2br t , j=5 hz , och2ch2nh ) , 4.02 , 3.99 ( 28 h , 2s , och2c(o ) ) , 3.86 ( 3 h , s , c(o)och3 ) , 3.823.75 ( 4 h , m , och2ch2nh ) , 3.723.43 ( 120 h , m , och2 , och2ch2nh ) , 3.403.32 ( 16 h , m , och2ch2n3 , ch2nhc(o ) ) , 3.323.24 ( 8 h , m , ch2nhc(o ) ) , 2.42 ( 8 h , t , j=5 hz , c(o)ch2ch2o ) , 1.821.66 ppm ( 16 h , m , och2ch2ch2nh ) ; c nmr ( 100 mhz , cdcl3 ) : =171.16 , 169.52 , 168.85 , 167.51 ( c(o)nh ) , 166.68 ( c(o)och3 ) , 159.84 , 159.70 ( c , aryl ) , 136.69 ( c , aryl ) , 132.14 ( c , aryl ) , 108.31 ( ch , aryl-2 , aryl-6 ) , 106.76 ( ch , aryl-4 ) , 106.41 ( ch , aryl-2 , aryl-6 ) , 104.70 ( ch , aryl-4 ) , 71.02 ( och2c(o ) ) , 70.7269.35 ( och2 ) , 67.35 ( och2 ) , 66.89 , 66.62 ( och2ch2nh ) , 52.40 ( c(o)och3 ) , 50.74 ( och2ch2n3 ) , 39.72 , 38.46 ( och2ch2nh ) , 37.22 , 37.04 ( ch2nhc(o ) ) , 36.81 ( c(o)ch2ch2o ) , 29.38 , 29.14 ppm ( och2ch2ch2nh ) ; ms ( esi ) m / z [ m+3 h]calcd for c134h226n26o54 : 1022.12 , found 1022.40 ; hrms ( qtof ) m / z [ m+3 h]calcd for c134h226n26o54 : 1022.5257 , found 1022.5348 . compound 7 : a solution of tetravalent 5 ( 7 mg , 2.28 mol ) , 6 ( 14.8 mg , 13.4 mol ) , sodium ascorbate ( 8.1 mg , 41.1 mol ) , and cuso45h2o ( 5.1 mg , 20.6 mol ) in dmf / h2o ( 1:1 , 2 ml ) was prepared and heated under microwave irradiation at 80 c for 20 min . after cooling down to rt , the filtrate was then concentrated in vacuo , and the residue was purified by preparative hplc and obtained by freeze - drying as an off - white powder ( 5 mg , 30 % ) ; h nmr ( 500 mhz , d2o ) : =8.06 , 7.96 ( 4 h , 2s , ch , triazole ) , 7.15 ( 2 h , s , ch , aryl-2 , aryl-6 ) , 6.83 ( 5 h , s , ch , 2aryl-2 , 2aryl-6 , aryl-4 ) , 6.68 ( 2 h , s , ch , 2aryl-4 ) , 5.64 , 5.15 ( 4 h , 2d , j1,2=8 hz , j1,2=8 hz , hglc-1 ) , 4.79 ( 4 h , hgalnac-1 ) , 4.664.51 ( 24 h , m , nch2ctriazole , ch2ntriazole , hgal-1 , hgal-1 ) , 4.274.07 ( 12 h , m , och2ch2nh ) , 4.10 , 4.04 ( 28 h , 2s , och2c(o ) ) , 3.86 ( 3 h , s , c(o)och3 ) , 3.773.65 ( 12 h , m , och2ch2nh ) , 3.653.45 ( 112 h , m , och2 ) , 3.41 ( 4 h , t , j2,3=j2,4=9 hz , hgal-2 ) , 3.313.17 ( 16 h , m , ch2nhc(o ) ) , 2.69 ( 4 h , dd , j3a,3b=13.5 hz , j3a,4=4 hz , hneuac-3 ) , 2.48 ( 8 h , t , j=6 hz , c(o)ch2ch2o ) , 2.25 ( 12 h , s , nc(o)ch3 ) , 2.04 , 2.02 ( 212 h , 2s , nhc(o)ch3 ) , 1.96 ( 4 h , t , j3b,3a = j3b,4=11.5 hz , hneuac-3 ) , 1.781.67 ppm ( 16 h , m , och2ch2ch2nh ) ; c nmr ( 125 mhz , d2o ) : =175.54 , 175.27 , 174.64 , 174.24 , 171.71 ( cooh , c(o)nh ) , 164.71 ( c(o)och3 ) , 160.05 ( c , aryl ) , 145.38 ( c , triazole ) , 132.49 ( c , aryl ) , 125.67 , 125.42 ( ch , triazole ) , 109.43 ( ch , aryl-2 , aryl-6 ) , 106.94 ( ch , aryl-2 , aryl-6 , aryl-4 ) , 105.55 ( ch , aryl-4 ) , 105.35 ( cgal-1 ) , 103.21 ( cgal-1 ) , 103.05 ( cgalnac-1 ) , 102.22 ( cneuac-2 ) , 87.49 , 82.91 ( cglc-1 ) , 80.79 ( cgalnac-3 ) , 78.65 ( cglc-4 ) , 77.41 ( cglc-5 ) , 77.30 ( cgal-3 ) , 75.50 ( cgal-5 ) , 75.11 ( cgal-4 ) , 75.07 ( cgalnac-5 ) , 75.06 ( cgal-5 ) , 73.62 ( cneuac-6 ) , 73.07 ( cgal-3 ) , 72.54 ( cneuac-8 ) , 71.28 ( cgal-2 ) , 70.60 ( cgal-4 ) , 70.54 ( och2c(o ) ) , 70.50 ( cneuac-7 , cgal-2 ) , 70.49 ( och2c(o ) ) , 70.12 ( och2 ) , 70.02 ( och2 ) , 69.99 ( och2 ) , 69.25 ( cgalnac-4 ) , 69.02 ( cneuac-4 ) , 68.96 ( och2 ) , 68.49 ( cglc-3 ) , 67.49 ( och2ch2nh ) , 67.38 ( cglc-2 ) , 67.25 ( och2ch2nh ) , 63.48 ( cneuac-9 ) , 61.55 ( cgalnac-6 , cgal-6 ) , 61.05 ( cgal-6 ) , 60.66 ( cglc-6 ) , 53.39 ( c(o)och3 ) , 52.15 ( cneuac-5 ) , 51.86 ( cgalnac-2 ) , 50.71 ( ch2ntriazole ) , 40.36 , 39.05 ( och2ch2nh ) , 37.73 ( cneuac-3 ) , 36.93 ( ch2nhc(o ) ) , 36.75 ( nch2ctriazole ) , 36.66 ( c(o)ch2ch2o ) , 28.85 ( och2ch2ch2nh ) , 23.10 ( cgalnac - nhc(o)ch3 ) , 22.61 ( cneuac - nhc(o)ch3 ) , 21.76 ppm ( cglc-1-nc(o)ch3 ) ; hrms ( qtof ) m / z [ m3 h ] calcd for c302h486d8n38o170 : 2460.7688 , found 2460.4179 . compound 8 : the obtained tetramer 5 ( 305 mg , 0.10 mmol ) was treated with tessers base22 ( dioxane / meoh/4 n naoh 30:9:1 , 5 ml ) . after that , the reaction was quenched by adding 1 n khso4 , and the mixture was concentrated in vacuo . the residue was redissolved in ch2cl2 ( 20 ml ) and washed with 1 n khso4 ( 10 ml ) , h2o ( 10 ml ) , and brine ( 10 ml ) , dried on na2so4 , and concentrated in vacuo . the resulting acid was used for the next step without further purification . to a solution of this acid and amine spacer 9 ( o-(2-aminoethyl)-o-(2-azidoethyl)heptaethylene glycol , 70 mg , 0.16 mmol , sigma aldrich ) in dried dmf ( 10 ml ) , bop ( 60 mg , 0.13 mmol ) and dipea ( 40 mg , 0.31 mmol ) were added . the residue was suspend into ch2cl2 ( 30 ml ) and washed with 1 n khso4 ( 15 ml ) , 1 n nahco3 ( 15 ml ) , h2o ( 15 ml ) , and brine ( 15 ml ) . after concentration , the resulting material was purified by silica gel chromatography to afford 8 as a colorless oil ( 175 mg , 0.05 mmol , 51 % over two steps ) ; h nmr ( 400 mhz , cdcl3 ) : =7.76 , 7.67 , 7.58 , 7.47 , 6.87 ( 15 h , 5br t , j=5 hz , c(o)nh ) , 7.02 ( 2 h , s , ch , aryl-2 , aryl-6 ) , 6.96 ( 4 h , s , ch , 2aryl-2 , 2aryl-6 ) , 6.63 ( 1 h , s , ch , aryl-4 ) , 6.52 ( 2 h , s , ch , 2aryl-4 ) , 4.17 , 4.05 ( 12 h , 2b t , j=5 hz , och2ch2nh ) , 4.02 , 3.98 ( 28 h , 2s , och2c(o ) ) , 3.803.72 ( 4 h , m , och2ch2nh ) , 3.713.44 ( 152 h , m , och2 , och2ch2nh ) , 3.403.31 ( 20 h , m , och2ch2n3 , ch2nhc(o ) ) , 3.313.23 ( 8 h , m , ch2nhc(o ) ) , 2.42 ( 8 h , t , j=5 hz , c(o)ch2ch2o ) , 1.801.68 ppm ( 16 h , m , och2ch2ch2nh ) ; c nmr ( 100 mhz , cdcl3 ) : =171.69 , 169.56 , 168.91 , 167.56 , 167.29 ( c(o)nh ) , 159.97 , 159.70 ( c , aryl ) , 136.82 ( c , aryl ) , 136.69 ( c , aryl ) , 106.48 ( ch , aryl-2 , aryl-6 ) , 106.35 ( ch , aryl-2 , aryl-6 ) , 104.81 ( ch , aryl-4 ) , 104.72 ( ch , aryl-4 ) , 71.02 ( och2c(o ) ) , 70.7369.36 ( och2 ) , 67.38 ( och2 ) , 66.75 , 66.62 ( och2ch2nh ) , 50.75 ( och2ch2n3 ) , 40.01 , 39.75 , 38.49 ( och2ch2nh ) , 37.22 ( ch2nhc(o ) ) , 36.93 ( c(o)ch2ch2o ) , 29.39 , 29.18 ppm ( och2ch2ch2nh ) ; ms ( esi ) m / z [ m+3 h]calcd for c151h260n30o61 : 1157.61 , found 1157.65 , [ m+2 h ] calcd for 1736.91 , found 1736.65 ; hrms ( qtof ) m / z [ m+3 h]calcd for c151h260n30o61 : 1157.6055 , found 1157.9647 . compound 10 : a solution of pentavalent scaffold 8 ( 8.4 mg , 2.42 mol ) , 6 ( 16 mg , 14.55 mol ) , sodium ascorbate ( 6.92 mg , 35 mol ) , and cuso45 h2o ( 4.35 mg , 17.4 mol ) in dmf / h2o ( 1:1 , 2 ml ) was prepared and heated under microwave irradiation at 80 c for 20 min . after cooling down to rt , the filtrate was then concentrated in vacuo , and the residue was purified by preparative hplc and obtained by freeze - drying as an off - white powder ( 8.7 mg , 41 % ) ; h nmr ( 500 mhz , d2o ) : =8.07 , 7.96 ( 5 h , 2s , ch , triazole ) , 7.02 ( 2 h , s , ch , aryl-2 , aryl-6 ) , 6.85 , 6.80 ( 5 h , 2s , ch , 2aryl-2 , 2aryl-6 , aryl-4 ) , 6.70 ( 2 h , s , ch , 2aryl-4 ) , 5.64 , 5.15 ( 5 h , 2d , j1,2=8.5 hz , j1,2=8.5 hz , hglc-1 ) , 4.78 ( 5 h , hgalnac-1 ) , 4.674.52 ( 30 h , m , nch2ctriazole , ch2ntriazole , hgal-1 , hgal-1 ) , 4.274.09 ( 12 h , m , och2ch2nh ) , 4.11 , 4.05 ( 28 h , 2s , och2c(o ) ) , 3.763.65 ( 12 h , m , och2ch2nh ) , 3.683.45 ( 146 h , m , och2 , ch2nhc(o ) ) , 3.40 ( 5 h , t , j2,3=j3,4=9 hz , hgal-2 ) , 3.293.19 ( 16 h , m , ch2nhc(o ) ) , 2.69 ( 5 h , dd , j3a,3b=13 hz , j3a,4=4 hz , hneuac-3 ) , 2.49 ( 8 h , t , j=6 hz , c(o)ch2ch2o ) , 2.26 ( 15 h , s , nc(o)ch3 ) , 2.04 , 2.02 ( 215 h , 2s , nhc(o)ch3 ) , 1.96 ( 5 h , t , j3b,3a = j3b,4=11 hz , hneuac-3 ) , 1.801.69 ppm ( 16 h , m , och2ch2ch2nh ) ; c nmr ( 125 mhz , d2o ) : =175.54 , 175.28 , 174.29 , 174.14 , 172.33 , 171.75 ( cooh , c(o)nh ) , 160.07 ( c , aryl ) , 145.47 ( c , triazole ) , 136.36 ( c , aryl ) , 125.41 , 125.39 ( ch , triazole ) , 107.40 ( ch , aryl-2 , aryl-6 ) , 106.89 ( ch , aryl-2 , aryl-6 ) , 106.01 ( ch , aryl-4 ) , 105.51 ( ch , aryl-4 ) , 105.28 ( cgal-1 ) , 103.16 ( cgal-1 ) , 103.01 ( cgalnac-1 ) , 101.76 ( cneuac-2 ) , 87.38 , 82.87 ( cglc-1 ) , 80.77 ( cgalnac-3 ) , 78.59 ( cglc-4 ) , 77.38 ( cgal-3 ) , 77.32 ( cglc-5 ) , 75.45 ( cgal-5 ) , 75.03 ( cgalnac-5 ) , 74.98 ( cgal-4 ) , 74.73 ( cgal-5 ) , 73.64 ( cneuac-6 ) , 73.04 ( cgal-3 ) , 72.56 ( cneuac-8 ) , 71.16 ( cgal-2 ) , 70.59 ( cneuac-7 , cgal-2 ) , 70.44 ( och2c(o ) ) , 70.37 ( och2c(o ) ) , 70.16 ( cgal-4 ) , 70.10 ( och2 ) , 70.09 ( och2 ) , 70.03 ( och2 ) , 69.14 ( cgalnac-4 ) , 68.97 ( cneuac-4 ) , 68.94 ( och2 ) , 68.43 ( cglc-3 ) , 67.41 ( och2ch2nh ) , 67.32 ( cglc-2 ) , 67.26 ( och2ch2nh ) , 63.41 ( cneuac-9 ) , 61.49 ( cgalnac-6 , cgal-6 ) , 60.88 ( cgal-6 ) , 60.61 ( cglc-6 ) , 52.10 ( cneuac-5 ) , 51.76 ( cgalnac-2 ) , 50.60 ( ch2ntriazole ) , 40.19 , 40.17 , 39.01 ( och2ch2nh ) , 37.61 ( cneuac-3 ) , 36.83 ( ch2nhc(o ) ) , 36.70 ( nch2ctriazole ) , 36.59 ( c(o)ch2ch2o ) , 28.78 ( och2ch2ch2nh ) , 23.08 ( cgalnac - nhc(o)ch3 ) , 22.58 ( cneuac - nhc(o)ch3 ) , 21.68 ppm ( cglc-1-nc(o)ch3 ) ; hrms ( qtof ) m / z [ m+5 h+nh4]calcd for c361h591d4n45o206 : 1481.1261 , found 1481.4361 . as a service to our authors and readers , this journal provides supporting information supplied by the authors . such materials are peer reviewed and may be re - organized for online delivery , but are not copy - edited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors .

the five b - subunits ( ctb5 ) of the vibrio cholerae ( cholera ) toxin can bind to the intestinal cell surface so the entire ab5 toxin can enter the cell . simultaneous binding can occur on more than one of the monosialotetrahexosylganglioside ( gm1 ) units present on the cell surface . such simultaneous binding arising from the toxins multivalency is believed to enhance its affinity . thus , blocking the initial attachment of the toxin to the cell surface using inhibitors with gm1 subunits has the potential to stop the disease . previously we showed that tetravalent gm1 molecules were sub - nanomolar inhibitors of ctb5 . in this study , we synthesized a pentavalent version and compared the binding and potency of penta- and tetravalent cholera toxin inhibitors , based on the same scaffold , for the first time . the pentavalent geometry did not yield major benefits over the tetravalent species , but it was still a strong inhibitor , and no major steric clashes occurred when binding the toxin . thus , systems which can adopt more geometries , such as those described here , can be equally potent , and this may possibly be due to their ability to form higher - order structures or simply due to more statistical options for binding .

Introduction Results and Discussion Synthesis Inhibition Sedimentation velocity analytical ultracentrifugation (SV-AUC) Conclusions Experimental Section Supporting Information

ammonium dichromate is an odorless , bright orange to red , crystalline powder used in pyrotechnics , fireworks , photography , and in dyes used for screen and color printing . skin manifestations after industrial exposure of chromate salts are well - known , but little is known about systemic toxicity and its treatment . a 25-year - old female patient presented with history of vomiting and oliguria for 10 days . patient had taken a handful of orange red crystals with suicidal intent 10 days earlier while working in a printing press [ figure 1 ] . she was taken to a local hospital where stomach wash was given and managed conservatively . ammonium dichromate crystals on examination , patient was dehydrated with blood pressure of 130/80 mm of hg and pulse of 98/min . her investigations showed hemoglobin 7.2 g / dl , urea 650 mg / dl , creatinine 19 mg / dl , sodium 122 meq / l , potassium 7.9 meq / l , calcium 6.7 mg / dl , phosphorus 5.6 mg / dl , bilirubin 0.8 mg / dl , albumin 4.1 g / dl , total protein 7.2 g / dl , alanine transaminase 28 iu / l , aspartate transaminase 106 iu / l , alkaline phosphatase 66 iu / l , lactate dehydrogenase 124 iu / l , and creatine kinase 67 her arterial blood gas analysis showed severe metabolic acidosis with ph of 7.01 , pco2of 23 mm of hg and bicarbonate of 6 meq / l . her electrocardiogram showed tall peaked t waves with prolongation of pr interval and qrs duration . patient urine output improved gradually and she was discharged with creatinine of 1.3 mg / dl . her serum creatinine during the last follow - up was 1.1 mg / dl . hexavalent chromium salts have been recognized as occupational health hazards for more than two centuries . chromium compounds can exist in a variety of valence states , of which chromium ( iii ) appears to be the most stable and important form . chromium ( iii ) will form stable organic complexes with proteins , and amino acids . being a strong corrosive agent , dermal contact with chromium ( vi ) compounds can cause allergic dermatitis or sensitization . after ingestion , ammonium dichromate causes corrosive injury to the oral mucosa , esophagus , and stomach . the systemic manifestations include intravascular hemolysis , acute respiratory distress syndrome , toxic hepatitis , acute kidney injury , thrombocytopenia , and encephalopathy . chemical analysis of the stomach aspirate is often not useful as ammonium dichromate is highly dissociable compound . various treatment modalities tried are exchange transfusion , ascorbic acid , n - acetylcysteine , chelation with dimercaprol and dialysis . ascorbic acid has reducing property and in large doses accelerates the rate of reduction of chromium vi to chromium iii leading to the formation of chromium protein complex , which is nontoxic and excreted in the urine . though exact dose and duration of ascorbic acid is not known , large doses of ascorbic acid ( 1 g ) has been successfully used to prevent renal failure . hemodialysis can effectively remove chromium ( vi ) though the reports on its efficacy in clinical settings are conflicting . meert et al . , report the death of a child following a 1 g ingestion of ammonium dichromate . hassan reported a case of 24-year - old female who presented with multiorgan failure after ammonium dichromate ingestion . she was treated with hemodialysis and ascorbic acid ( 500 mg / day ) after which she improved . the cause of renal failure in our patient is probably acute tubular necrosis secondary to both emesis related hypovolemia and direct tubular toxicity of chromium compound . renal biopsy was not done as her urine output started improving during 2 week of admission . our patient presented 10 days after the ingestion with severe renal failure without features of any other organ involvement . since she presented very late , we did not treat her with ascorbic acid and chelating agents . screen - printing and coloring work is becoming more and more popular in india and the availability of these compounds is much easier now . the health care professionals should be aware of the manifestations of chromate poisoning and benefits of early management , especially with large doses of ascorbic acid .

ammonium dichromate is an inorganic compound frequently used in screen and color printing . being a strong oxidizing agent , it causes oxygen free radical injury resulting in organ failure . we report a 25-year - old female who presented with acute kidney injury after consumption of ammonium dichromate . she was managed successfully with hemodialysis and supportive measures . this case is reported to highlight the toxicity of ammonium dichromate .

Introduction Case Report Discussion Conclusion

healthcare workers are considered to be at particular risk of developing ageist attitudes because they are exposed to a disproportionate percentage of ill or dependent older people . research demonstrates that many factors have influence on healthcare workers ' attitudes towards older people , including age , gender [ 13 ] , education [ 46 ] , exposure to well older people [ 710 ] , area of practice [ 1114 ] , and professional socialization . an attitude is an evaluation of something or someone on a continuum of like to dislike or favourable to unfavourable . ageism has been defined as a systematic stereotyping of discrimination against people because they are old . ageism is perpetuated by the portrayal of older people as frail , ill , suffering mental deterioration , poor and dependent , and the alternative portrayal of living affluent life styles and scrounging off the welfare state . in addition , budget constraints in the uk and ireland which currently pitch health services against social services over costs for supportive care packages negate against timely discharge from hospital and reinforce an overreliance on family careers for support . these consequences are likely to further reinforce the portrayal of older people as a burden on society . stereotypes such as these are in contrast with the reality that the majority of older people lead fit and independent lives . older people consider that inadequate housing , low income , enforced retirement , and deficiencies in nursing home care are evidence of ageism . in addition , the national council of ageing and older people study undertaken in 2005 in the republic of ireland concluded that indirect discrimination , such as barriers to access of services , inadequate transportation , excessive waiting in accident and emergency and outpatient departments , and underfunded community services , is widespread and frequent . internationally , older people care services have difficulty in attracting and retaining staff [ 22 , 23 ] . the status afforded by health care workers to older people in their care has received attention from researchers [ 20 , 24 , 25 ] . provided evidence of older people being neglected or treated as unimportant , and more recently mitchell and mccance indicated that older people perceive that they are commonly denied an active role in making decisions about their health and lives . reports of elder abuse cases in care homes in the republic of ireland , mortality rates and neglect of older patients in a uk nhs hospital , and substandard care of patients with dementia have indicated inadequate training , poor communication and management , and insufficient access to specialist services and rehabilitation therapy as contributing factors . the o neill report of systematic abuse of residents in the leas cross nursing home in the republic of ireland highlighted that managers and clinical leaders did not recognise the care required to meet the needs of their residents . in addition , o neill identified failures at area health board , the health service executive ( hse ) , and government levels for the quality of care the residents received . it was contended that the low priority afforded by these public organisations to the needs of older people and their failure to provide adequate policy and legislation had direct consequences for care standards . the quality of care that older people receive in health services reflects the innate nature of ageism within society . indeed , chronic underfunding and low priority given to the development of services for older people is considered to profoundly influence how healthcare workers think about working with older people [ 12 , 26 ] . the republic of ireland has a population of 4,203,200 , and the proportion of its population aged 65 years and above is 11.0% . initiatives in 2005 to counter ageism and elder abuse in ireland included a rise in the state old age pension to reduce the poverty risk in its older population from 27% to 20% and an annual say no to ageism week . the health service executive in 2008 introduced mandatory training on recognising and responding to elder abuse in residential care setting , which focused on discrimination in general , but particularly ageism . the fair deal legislation introduced in 2009 espouses principles of equality and fairness in access to services but acknowledges that independent financial resources continue to have significant influence on personal choice and timely supportive services . ageing demographics is a global phenomenon , and the republic of ireland is anticipating a 25% increase in its population aged 65 years and over , from year 2004 to 2026 . given the rising percentage of older people using hospital and community services , and almost weekly accounts in the media of substandard care of older people , it is important that the attitudes of healthcare workers towards older people are re - examined . our study was undertaken in a rural county , where common to other rural counties of ireland work outside the home , and the migration of younger family members to urban areas to seek work is challenging care services for older people . in this county , health care is managed through one acute regional hospital , nine community hospitals , two community nursing units , and approximately 58 public health nurses . older people in receipt of nursing care will encounter ward managers , registered staff nurses , healthcare assistants , public health nurses , community - registered nurses , and student nurses , and the decision was taken to include all these groups in a survey of attitudes towards older people . the aim of this study was to explore the attitudes held by these health care workers towards older people in this rural population . to measure , using kogan 's attitudes towards older people scale [ kop ] , the attitudes of health care workers towards older people . to compare scores on kop across groups of health care workers categorised by role title , length of service in current role , and across work place setting . to explore the relationship between highest education attainment and kop scores . to make recommendations to inform education , research , and practice . the design of the study was a survey of attitudes of healthcare workers towards older people . attitudes towards older people were measured using the kogan 's attitudes towards older people scale [ kop ] , developed by kogan in 1961 . in developing the scale , kogan assigned older people the status of a minority group , and the items in the scale originated within ethnic minority stereotype research . the kop is a 34-item likert type scale with 17 matched positive and negative statements ; an example of negative - positive item pair is most older people tend to let their homes become shabby and unattractive and most old people can generally be counted on to maintain a clean , attractive home . it must be acknowledged that the kogan scale was developed in the early 1960s , and it has been subject to criticism . mclafferty has suggested that the scale measures societal attitudes but does not take into account the particular context in which nurses meet older people , and iwasaki and jones highlight the diverse nature of older life and that neither positive nor negative images can reveal the ambiguous nature of people 's attitudes , views , and experiences of ageing . however , the scale has been used extensively to measure attitudes towards older people across a range of professional groups [ 3 , 6 , 8 , 10 , 11 ] . kogan investigated the scale 's reliability and reported spearman - brown reliability coefficients ranging from 0.66 , to 0.83 , and interscale item correlations ranging from 0.46 to 0.52 . in addition , kogan contended concurrent validity by the use of measures of antiauthoritarian and antiminority attitudes . the reliability of kop has since been confirmed by other researchers [ 3 , 6 , 8 , 10 , 11 ] . the kop in our study was scored on a 6-point likert scale : 6 : highly positive , 5 : positive , 4 : slightly positive , 3 : slightly negative , 2 : negative , and 1 : highly negative . the negative statements were reverse scored , so that higher scores were attributed to more positive attitudes . the minimum score possible was 34 , and the maximum score possible was 204 . section 1 was designed to capture biographical and contextual data such as gender , job title , length of time in current role , work setting and highest education qualification , and completion of a healthcare / carers course and care of older people course . section 2 comprised the a participant information letter was provided , and the voluntary nature of completion was stated . consenting participants completed the questionnaire , sealed it in the envelope provided , and placed it in a marked container in the practice setting office for collection . the number of staff on duty during the designated 24hour data collection period in year 2009 was ascertained from service managers and duty rosters to establish the questionnaire response rate . the participants were employed within health service executive sectors as ward managers , registered nurses , public health nurses , healthcare assistants , and student nurses . the sampling strategy adopted was a convenience sample of health care workers in the work settings of an acute regional hospital , community hospitals , nursing units , and in the community . in the regional hospital , the sample comprised of all these healthcare workers from the three general medical wards and two surgical wards and its one rehabilitation ward . in the community , the sample was comprised of all healthcare workers rostered to work in the county 's nine community hospitals and its two nursing units during the 24-hour data collection period . directors of nursing and managers agreed to distribute the questionnaires during the collection period in 2009 . owing to the large geographical nature of the county , a random sample of twenty public health nurses were sent the questionnaire by post , with a stamped addressed envelope for response . the researcher received approval to proceed with the study from the university of ulster 's research ethics committee and the ethics committee in the regional hospital . the regional hospital has responsibility for both hospital and community nursing services in the county . the main ethical implications of this research were informed consent , confidentiality , and anonymity of participants . the service managers for the acute hospital , the community nursing services , the community hospitals , and nursing units were contacted and requested in writing for permission to distribute questionnaires to their health care workers , which was granted . there was a minimal amount of risk associated with this research , as the participants were staff employed by the health service executive . it was anticipated that the research would help to identify those categories of healthcare workers who may express ageist attitudes . whilst there is a link between attitude and predicted behaviour , expressing ageist attitudes does not mean that a group of staff do not give high - quality care . if ageist attitudes were expressed , then recommendations for education interventions for these staff would be proposed . the questionnaires were coded jointly by the first and second author to ensure consistency of analysis , and standard schemes were used to compute the scores for kop . data was analysed using spss for windows v.17 ( spss inc . , chicago , il ) . the kop was computed by using a 6-point likert approach , in which the more positive attitudes towards older people achieved a higher score . the kop was totalled , and cross - referenced to the returned questionnaires to address any errors or missed data coding . missing data on spss was replaced with the midpoint number 3.5 , a strategy supported by palliant . descriptive statistics were used to explore the characteristics of the sample . for statistical tests , the level of significance considered appropriate for this study was a value for p of .05 . one - way analysis of variance with post hoc comparisons were conducted to examine whether attitudes were significantly different between groups of health care workers . a total of 303 questionnaires were distributed to health care workers , and 190 returned the completed questionnaires . the study had an overall response rate of 62.2% , which is comparable to response rates in similar studies of 57% and 69% . three questionnaires with five or more missing item data out of a total of 34 were withdrawn from the study . five returned questionnaires had some missing data in section 1 , which requested information on occupation and qualifications ; these were not excluded from the kop analysis and the missing data remained . the prevalence of health care worker occupations were registered staff nurses 85 ( 45.5% ) , health care assistants 49 ( 26.2% ) , ward managers 21 ( 11.2% ) , student nurses 19 ( 10.2% ) , and public health nurses 11 ( 5.9% ) . the prevalence rate of highest educational attainment was ascertained as outlined in table 1 , and it was observed that 33.7% of nurses were university graduates having attained a nursing degree , higher diploma , or msc . in addition , 83% of the healthcare assistants in this survey had either undertaken a healthcare / carers course , a care of older people course , or both . kolmogorov - smirnov statistic equal to 0.200 was a nonsignificant result , and visual inspection of the distribution of scores indicated normality ( table 2 ) . the measure was found to be reliable on the basis of the data obtained in the questionnaires ( cronback a = 0.751 ) . the variation of intensity of attitudes was illustrated by dividing the potential range of scores into six equal categories , and this showed that health care workers held positive attitudes towards older people ; indeed 97.3% of scores fell into the an independent sample t - test was used to compare kop mean attitude scores between males ( n = 19 ) and females ( n = 167 ) . participants were then categorised in 5 groups according to their job titles : ward manager , registered nurse , public health nurse , student nurse , and healthcare assistant . a one - way between - groups analysis of variance levene statistic was 0.202 , indicating that we had not violated the assumption of homogeneity of variance . although ward managers and public health nurses held more positive attitudes ( figure 1 ) , post - hoc comparisons performed using the tukey hsd test failed to detect a significant difference in kop scores between the groups ( p = .135 ) . a one - way between - groups analysis of variance was conducted to explore the attitudes of participants categorised into 7 groups by length of service in current role : those who had worked 5 years ; 610 years ; 1115 years ; 1620 years ; 2125 years ; 2630 years ; 31 years . levene statistic was 0.953 , indicating that we had not violated the assumption of homogeneity of variance . kop scores between these groups were not significantly different [ f(6,179 ) = 1.8 , p = .106 ] . an independent sample t - test was conducted to explore attitudes between health care workers who worked in acute care settings and those who worked in the community / community hospital settings and mean attitudes were not significantly different between these two groups ( p = .248 ) . an independent sample t - test was conducted to compare kop scores for those who had attained a university degree , higher diploma , or msc and those who had not attained qualifications at university . there was a significant difference in scores for university graduates ( m = 149.34 , sd = 15.4 ) , compared to those who had not attained university qualifications [ m = 144.88 , sd = 12.45 ; t(161 ) = 2.02 , p = .044 ] . this study set out to explore the attitudes held by groups of health care workers towards older people in a rural population . it was reassuring to find that health care workers in this rural county in the republic of ireland generally held positive attitudes towards older people . our study did not detect significant differences in attitude scores measured by kop across gender , job title , length of service in current role , and work place setting . in contrast , our study did detect a significant difference in scores for university graduates , when compared to those who had not attained a university qualification , with university study associated with more positive attitudes . research indicates that health care workers may hold negative attitudes towards the structural context of work and the restrictive practices that can pervade in older people care settings . research which supports this context dimension [ 12 , 13 ] suggests that attitudes can be negatively influenced by the underresourced care environments experienced when working with older people . our study did not detect a significant difference in kop scores between health care workers who worked in acute care services and those in community , community hospital settings , or nursing units . hope and later mclafferty and morrison reported that health care workers in care settings for older people had more positive attitudes towards older people than those working in more acute care settings . however , more recently , and similar to our findings , gallagher et al . 's research did not detect a significant difference in attitudes across work setting . organisational change , health service reform , early supported discharge and ageing demographics in the last two decades , and mediating towards a higher prevalence of older people in acute care wards mean that in almost all care settings , health care workers are increasingly working with older people , and perhaps this explains the similar favourable attitudes . over 83% of the healthcare assistants in our study healthcare / carers course , a care of older people course , or both . healthcare assistants provide much of the face to face care with older people , but their attitudes towards older people have received only scanty attention from researchers [ 4 , 6 ] . in our study , no significant kop score differences were found between staff nurses and healthcare assistants , which contrasts with previous research that reported that healthcare assistants held more negative attitudes towards older people than registered nurses . perhaps the recent irish government initiatives to combat ageism and the high uptake of healthcare / carers courses and care of older people courses by healthcare assistants have led towards the more positive attitudes . it is perhaps significant that 33.7% of participants were university graduates having obtained a degree , higher diploma , or a master 's degree . health care workers are a stable workforce in this rural county , and full - time job vacancies can be rare . individual staff may consider that university academic attainment affords them greater opportunities for career progression than others without university qualifications . education has been identified in previous studies as a predictor for attitudes towards older people [ 5 , 37 ] . our finding that staff who attained a university qualification had significantly higher mean kop scores than those health care workers who had not attained university qualifications is particularly interesting in light of the shift towards nursing becoming an all - graduate profession . the research evidence relating to education and attitudes towards older people is complex , and perhaps this is not surprising , when educational attainment is not a guarantee that individuals have received sufficient education and training in the needs of and care required by those who are older . nurses who work with older people are critical of both staff in acute care sectors and educators of nursing students , for not fully addressing the needs of older people in education programmes [ 13 , 14 ] . in addition , there has been criticism that nurse educators fail to counter negative perceptions of working with older people as a future career option of nursing students . indeed , stevens and crouch considered that nurse educators perpetuated the view that acute care was more demanding of skill and knowledge . criticisms of nurse education has been reinforced by the recent alzheimer 's society survey of 1100 nurses in the uk which reported that 80% of participants felt they had been inadequately trained to work with people with dementia . our findings suggest that public health nurses hold more positive attitudes towards older people than registered nurses , nursing assistants , and students , although it must be noted that differences across role title were not significant . in the republic of ireland , public health nurses commonly hold three professional qualifications : general nursing , midwifery , and public health nursing . public health nurses are community based , and their work is with all levels of that community , working with individuals , families , and groups . they are autonomous practitioners who prioritise their workloads , in their roles as managers , clinicians , and health promoters . it is conceivable that in this rural county , the public health nurses know the older person they are working with , not only as an older person but possibly as a neighbour , distant relative , or friend . in addition , as they are embedded in the community , the person being supported is real and likely to be perceived as living independently . this community embedded knowing the person might be very different from the experience of some of the healthcare workers who primarily work in hospitals , which may partly explain why public health workers hold the most positive attitudes . however , ward managers working in both acute hospital settings and the community nursing units also generally held more positive attitudes than registered nurses and health care assistants . it is likely that as 61.9% of ward managers had studied to degree , higher diploma , or masters , that higher education attainment is also a factor that links ward managers and public health nurses in terms of more positive attitudes . there are a number of limitations in this study that would need to be addressed if this study was to be undertaken again . is one of the significant influencing factors on attitudes , it would have been pertinent to see if that finding was replicated in this study . however , the attitude scores of participants categorised by length of service in current role were scrutinised , and significant differences were not detected . a six - point likert scale was chosen , similar to lookinland and anson and haight et al . . however the authors of this study suggest that missing data could be managed more simply , by using a whole midpoint number , such as in a 5-point likert scale used by ryan et al . . these points indicate the importance of undertaking a pilot study with all questionnaire tools , which would have given the researcher the opportunity to make informed amendments . our study has shown that the vast majority of the participants which included nurses , nursing assistants , and students hold positive attitudes , towards older people . in addition , we found that study to a higher level at university appears to mitigate towards holding more positive attitudes and this is an important finding in light of the shift towards nursing as an all - graduate profession . as previously stated , the study was undertaken in a rural county in the republic of ireland , with a generally stable nursing workforce , and it is possible that healthcare workers are regularly caring for older people they have come to know as individuals . with the global trend towards an increasingly ageing population , it is clear that nurses need to be equipped with the knowledge and skills to fulfil significant roles in responding to future health and support needs . the recent initiatives in the republic of ireland to counter ageism and elder abuse [ 3032 ] are commendable , and in addition the high update of carers and care of older people courses by nursing assistants may be promoting more positive attitudes . budget constraints in the uk and ireland currently pitch health services against social services and stall the development of supportive care packages , with resultant delays in discharge from acute hospital care and overreliance on family carers . these consequences are likely in the future to further reinforce the portrayal of older people as a burden on society . the current reports of elder abuse , neglect , and substandard care receiving media coverage are also in danger of undermining those healthcare workers who are attempting to provide quality care in challenging times . despite this context , it is reassuring that in our study , nurses and nursing assistants hold positive attitudes towards older people .

with the global trend towards an increasingly ageing population , it is clear that nurses need to be equipped with the knowledge and skills to fulfil significant roles in responding to future health and support needs . this paper reports the results of a survey that aimed to identify and evaluate the attitudes of nurses , healthcare assistants , and nursing students towards older people . the survey was undertaken in a rural county in the republic of ireland . it is reassuring that in our study , we found that these healthcare workers hold positive attitudes towards older people . in addition , we found that study to a higher level at university appears to mitigate towards holding more positive attitudes , and this is an important finding in light of the shift towards nursing as an all - graduate profession .

1. Introduction 2. Material and Methods 3. Sampling and Ethical Considerations 4. Data Analysis 5. Results 6. Discussion 7. Conclusions

for details of the experimental conditions and characterization data for the compounds reported , see the supporting information . as a service to our authors and readers , this journal provides supporting information supplied by the authors . such materials are peer reviewed and may be reorganized for online delivery , but are not copyedited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors .

abstractenterotoxigenic escherichia coli ( etec ) like the o139 strain are mostly responsible for traveler 's diarrhea and causes diseases in pigs , cattle , and poultry . a convenient synthetic strategy was developed for the synthesis of the heptasaccharide repeating unit of the cell wall lipopolysaccharide of the e. coli o139 strain . the pmethoxybenzyl ( pmb ) group was used as a temporary protecting group which was removed in situ under the glycosylation conditions by changing the reaction temperature during the synthesis of the target compound . all glycosylation steps gave high yields with good stereoselectivity . a ( 2,2,6,6tetramethylpiperidin1yl)oxyl ( tempo)mediated selective oxidation of the primary hydroxyl group was carried out using a biphasic reaction condition at the late stage of the synthesis . such synthetic oligosaccharides could later be effectively conjugated with proteins to prepare glycoconjugate derivatives as vaccine candidates .

Experimental Section Supporting information

complementary and alternative medicine ( cam ) is an additional health care system , comprising mind / body practices and natural products that are not regarded as part of conventional medicine12 ) . conventional medicine is used together when complementary medicine is applied , and alternative medicine is employed instead of conventional medicine1 ) . most patients who try to take non - prevailing approaches use them together with conventional treatments1 ) . natural products include herbs , minerals , vitamins , and probiotics , and mind / body practices include acupuncture , massage therapy , meditation , movement therapies , relaxation techniques , spinal manipulation , and others1 ) . neurologic diseases in children often tend to have a chronic course and require long - term management . children with chronic health conditions use cam more frequently3 ) , but it was found that only around 30% of patients with epilepsy and 50% of children with chronic health conditions who use cam reported this behavior to their physicians456 ) . physicians should be aware of their patients ' use of cam and provide accurate information about cam to enable patients to make the right decisions . this review aims to investigate the characteristics of the use of cam in children with neurologic diseases such as epilepsy , migraine , cerebral palsy , and congenital malformations in order to improve management through analysis of several studies of cam use in children with chronic neurologic conditions2678910 ) . further , this review will discuss the differences in the use of cam between children and adults with neurologic diseases , and between patients with neurologic and nonneurologic conditions . barnes et al.9 ) reported that approximately 12% of children ( total sample size [ n]=9,417 ) used cam in the united states ( us ) , and mccann and newell3 ) reported that 12% of healthy children ( n=25 ) used cam in the united kingdom ( uk ) . they also reported that 40% ( n=75 ) of children with chronic health conditions used cam in the uk , and this proportion is much higher than that in healthy children3 ) . in the study by barnes et al.9 ) , the most common modalities used were natural products ( neither vitamin nor mineral ) and osteopathic or chiropractic manipulation . regarding significant factors , parental use of cam was associated with cam use in children compared to children whose parents did not use cam ( 24% vs. 5% ) . parental use of cam was also found to be a strongly associated factor in a study by birdee et al.11 ) . additionally , for both adults and children , worry about cost was found to be one of the factors related to the use of cam and delaying using conventional medicine , and patients were more likely to use cam when expenses were a concern than when expenses were not a problem for conventional medicine9 ) . other factors significantly associated with pediatric use of cam , in the study of birdee et al.11 ) , were adolescent age rather than that of toddler or infant , parent with a college education , more frequent use of prescription medication , stress or anxiety , musculoskeletal conditions , dermatologic conditions , and sinus infection . in a recent study on patterns of cam use in pediatric patients with common neurologic conditions ( headaches , migraines , seizures ) , pediatric patients with common neurological conditions were found to use cam significantly more compared to children without these conditions ( 24% [ n=586 ] vs.13% [ n=7,083])7 ) . pediatric patients with neurologic conditions used biological therapies with a similar frequency and mind / body practices with a significantly higher frequency compared to other pediatric patients using cam . among mind / body practices , deep breathing was used most commonly ( 33% ) , meditation was used in 15% , and progressive relaxation was employed in 10%7 ) . in another study in 2010 in north jordan , 56% of children ( n=176 ) with neurologic illnesses used cam for their care2 ) . regarding the most commonly used methods , prayer / reciting the quran was used in 77% , massage with olive oil in 32% , religious healers in 30% , and consumption of honey products in 29% . among the reasons provided for the use of cam , religious beliefs were the most common ( 68% ) , and no patients described distrust in conventional medicine2 ) . other significant factors connected to the use of cam included belief in its effects , speech delay , father 's age greater than 30 years , and mother 's education less than high school2 ) . additionally , parents ' experience or hearing of successful cases from acquaintances or mass media was found to be other reasons for using cam8 ) . side effects were rare8 ) . in a study by soo et al.8 ) regarding the use of cam in a pediatric neurology clinic , 44% of patients ( n=105 ) were found to use cam . in regard to the most commonly used cam modalities , chiropractic manipulation was used in 15% , dietary therapy was used in 12% , and homeopathy , herbal remedies , and prayer healing were each used in 8% . the difference in this study compared to other studies is that the parents ' sociodemographic characteristics were not significantly associated with the use of cam . pediatric health - related quality of life was also not a significant factor8 ) . in total , 59% of patients who used cam experienced benefits . the total median cost of cam compared with conventional medicines was not different ( $ 31.70 vs. $ 50.00 per month)8 ) . in a study on cam use in pediatric neurology , the overall rates of cam use at two centers were 78% ( n=151 ) and 48% ( n=55 ) , respectively6 ) . as for the most commonly used cam products , multivitamins were used in 84% , vitamin c was used in 37% , homeopathic remedies were used in 24% , and fish oil / omega-3s were employed in 22%6 ) . regarding the most commonly used cam practices , massage was used in 47% , and 37% used chiropractic methods , 18% used faith - healing , and aromatherapy , homeopathy , and relaxation were each used in 16%6 ) . over half of patients disclosed to their physicians their use of cam in addition to conventional medicine6 ) . in a study examining the use of traditional herbal medicines in korean elementary school children , 65% ( n=905 ) of children were found to be taking herbal medicines12 ) . in a 2008 study in korea , 65 of 378 children ( 17% ) with epilepsy were found to be taking herbal medicines4 ) . in our study in 2014 , 19% ( n=398 ) of children with epilepsy used traditional korean medicine ( tkm ) ( acupuncture , moxibustion , herbal medicine)10 ) . these results suggest that tkm is not the favored method for attaining seizure control and that patients are careful about using tkm to treat epilepsy . in addition , 60% of children with epilepsy were receiving other types of cam10 ) . according to a study by lee et al.4 ) , patients with psychosomatic disorders used herbal medicine significantly more frequently , whereas in a study by kim et al.13 ) , neurologically normal patients used it slightly more frequently ; however , the difference did not have statistical significance . in our study , among receivers of combination treatments besides tkm , tkm was used more frequently in those receiving language , music , or art therapy than in those undergoing physiotherapy or other combination therapies10 ) . this finding suggests that the use of tkm is associated more with the purpose of treatment of cognitive function than motor functions , and parents of children with epilepsy may believe that tkm has an effect on the former rather than the latter10 ) . additionally , regarding significant factors , in the group of patients using a greater number of antiepileptic drugs and having low seizure - free rates , the use of tkm was more frequent10 ) . regarding the effect of cam on epilepsy , inconsistent results had been reported in previous studies . recent cochrane reviews show that some studies on the use of acupuncture and chinese traditional herbal medicine did not succeed in providing clear evidence proving the effects of acupuncture and herbal medicine for epilepsy patients1415 ) . according to the study by lee et al.4 ) , 18% of respondents using herbal medicine reported its effectiveness for seizure control , but the rest of the respondents reported no effectiveness or even worsening of symptoms , although many patients ( 33% ) agreed with using herbal medicine . it was also reported that most patients did not feel that cam was superior to general epilepsy treatments , although 32% of them continued using cam16 ) . it is presumed that this persistent usage is due to people 's beliefs that herbal medicines are safe ( not dangerous ) and help to improve health and enhance cognitive function10 ) . in spite of these beliefs , however , according to the report of kuan et al.16 ) , the most frequent adverse effect of cam was aggravated seizures . it is presumed that this is due to the effects of seizure - inducing materials of herbal medicine or drug - drug interactions . regarding the frequency of cam use for epileptic patients in various countries , 49% ( n=403 ) of taiwanese were found to use cam , 44% used it in arizona , 37% ( n=265 ) of nigerians used cam , and 32% ( n=1,000 ) in india and 24% ( n=92 ) in ohio used cam516171819 ) . regarding commonly used forms of cam for treatment of epileptic patients , prayer and stress relief were used in the west , whereas traditional herbal medicines were employed both in the east and in africa516171819 ) . in us , the preferred modalities were biological therapies and mind - body practices7 ) . in canada , the commonly used methods were chiropractic manipulations , dietary therapy , multivitamins , and massage68 ) . however , in north jordan , prayer / reciting the quran was the most commonly used modality2 ) . in korea these differences in use of cam between countries may be owing to their different cultures , religions , and traditions10 ) . the characteristics of the use of cam in children with neurologic diseases are summarized in table 2 . according to the study by barnes et al.9 ) , almost 40% ( n=23,393 ) of us adults used cam in 2007 and the most commonly used modalities were natural products ( neither vitamin nor mineral ) ( 18% ) and deep breathing exercises ( 13% . ) . cam was used more frequently in american adults with common neurological conditions ( migraines , regular headaches , strokes , back pain with sciatica , seizures , dementia or memory loss ) than in those without such conditions ( 44% [ n=6,587 ] vs. 33% [ n=16,806])20 ) . the frequency of use of each cam modality was higher in adults with common neurological conditions than in those without20 ) . the most common modalities were mind / body therapies , and the least common were alternative medical systems20 ) . the reasons why those with common neurological conditions used cam more frequently than those without such conditions included provider 's recommendations or little effect achieved with conventional medicine or a cost that was too high20 ) . about 50% of adults with common neurological conditions did not report their use of cam to their doctors20 ) . factors that significantly influenced the use of cam in those with common neurological conditions included higher educational level than high school education , positive history of anxiety , living in a western area , being a former smoker , and drinking alcohol lightly20 ) . in the previous studies on the use of cam in various neurologic conditions , compared to the frequency of use of cam in children with common neurologic diseases , the frequency of use in adults with neurologic diseases was similar267810 ) . for korean adults with other diseases , several studies showed the following findings regarding cam use : 60%70% of patients with stroke used cam , 53% of those with cancer used it and 53% of patients with asthma and preferred modalities of cam use in children and adults had diverse features , and these results may be influenced by individuals ' different cultures and traditions of use of cam . the factor most commonly related to use of cam in children with neurologic conditions was parental cam use , and it could be presumed that the use of cam in children may be due to such usage running in the family , as well as belief in or experience with the efficacy of cam . in adults with neurologic conditions , increased educational level was the most common factor associated with use of cam202123 ) , and this result may relate to economic level . characteristics of the use of cam in adults with neurologic diseases are summarized in table 3 . in a systematic review on the use of cam in pediatric cancer patients , the prevalence of use of cam ( since the diagnosis of cancer ) the most common cam modalities were herbal medicines , diets / nutrition , and faith - healing28 ) . the frequent reasons given for the use of cam were to help cure or fight the child 's cancer , relief of symptom , and support of ongoing use of conventional medicine28 ) . there were few factors related to patients ' sociodemographic characteristics associated with use of cam , and this result was different from the results of several other studies28 ) . according to the study by barnes et al.9 ) , for pediatric patients with specific diseases , the proportions were 2% in insomnia , 3% in attention deficit hyperactivity disorder ( adhd ) , 5% in other musculoskeletal diseases , 5% in stress or anxiety , 7% in head or chest colds , and 7% in back or neck pain9 ) . from these results , it is presumed that patients in these cases use cam to manage symptoms , to maintain and manage health , or to prevent illness , rather than to treat specific diseases28 ) . many studies , however , reported a higher frequency of cam use in pediatric patients with chronic diseases , such as asthma , autism , adhd , cancer , and sickle cell anemia . medical symptoms such as nausea and abdominal pain rather than certain medical diagnoses were found to be some of the factors associated with the use of cam28 ) . in the study by oshikoya et al.29 ) , the researchers interviewed parents of children with epilepsy ( n=122 ) , asthma ( n=78 ) , or sickle cell anemia ( n=118 ) . three hundred three types of cam were used by 99 patients ( 31% ) ( epilepsy , 38% ; sickle cell anemia , 36% ; asthma , 25% ) . the most commonly used cams were biological products ( 58% ) , while alternative medical systems ( 27% ) as well as mind / body interventions ( 14% ) were also employed . eighty - five parents ( 86% ) were going to report the use of cam to their physicians , but had not yet done so . in 7% of the patients , levy and hyman30 ) investigated the use of cam for children with autistic spectrum disorder ( asd ) . about 50%75% ( n=50112 ) of children with autism were found to use cam31 ) . patients with comorbid intellectual disability may have a higher frequency of use of cam . in the study by levy et al.32 ) , one - third of children requested for examination of asd were found to have already used cam , even before diagnosis . the most frequently used form of cam for children with asd were mind / body practices30 ) . in children with inflammatory bowel disease , adverse effect was the significant predictor of cam use33 ) . in cases of children with asthma , the significant predictors of use of cam were older age and worse control of symptoms . also , more medications and more medical visits as well as more side effects were significant predictors in using cam34 ) a study in italy showed that the most common reason for the use of cam was a fear of side effects of conventional therapy for routine illness35 ) . in the study by hanson et al.36 ) , 75% of parents of children with asd chose the use of cam because they felt cam was perceived to be safe and it did not have side effect or they experienced side effects of conventional therapy previously . the purposes of the use of cam in children with asd are treatment of major symptoms of asd , improvement of attention , enhancement of relaxation , treatment of gastrointestinal symptoms , regulation of sleep and promotion of general health31 ) . the characteristics of the use of cam in children with other chronic diseases are summarized in table 4 . in a recent study on patterns of cam use in pediatric patients with common neurologic conditions ( headaches , migraines , seizures ) , pediatric patients with common neurological conditions were found to use cam significantly more compared to children without these conditions ( 24% [ n=586 ] vs.13% [ n=7,083])7 ) . pediatric patients with neurologic conditions used biological therapies with a similar frequency and mind / body practices with a significantly higher frequency compared to other pediatric patients using cam . among mind / body practices , deep breathing was used most commonly ( 33% ) , meditation was used in 15% , and progressive relaxation was employed in 10%7 ) . in another study in 2010 in north jordan , 56% of children ( n=176 ) with neurologic illnesses used cam for their care2 ) . regarding the most commonly used methods , prayer / reciting the quran was used in 77% , massage with olive oil in 32% , religious healers in 30% , and consumption of honey products in 29% . among the reasons provided for the use of cam , religious beliefs were the most common ( 68% ) , and no patients described distrust in conventional medicine2 ) . other significant factors connected to the use of cam included belief in its effects , speech delay , father 's age greater than 30 years , and mother 's education less than high school2 ) . additionally , parents ' experience or hearing of successful cases from acquaintances or mass media was found to be other reasons for using cam8 ) . side effects were rare8 ) . in a study by soo et al.8 ) regarding the use of cam in a pediatric neurology clinic , 44% of patients ( n=105 ) were found to use cam . in regard to the most commonly used cam modalities , chiropractic manipulation was used in 15% , dietary therapy was used in 12% , and homeopathy , herbal remedies , and prayer healing were each used in 8% . the difference in this study compared to other studies is that the parents ' sociodemographic characteristics were not significantly associated with the use of cam . pediatric health - related quality of life was also not a significant factor8 ) . in total , 59% of patients who used cam experienced benefits . the total median cost of cam compared with conventional medicines was not different ( $ 31.70 vs. $ 50.00 per month)8 ) . in a study on cam use in pediatric neurology , the overall rates of cam use at two centers were 78% ( n=151 ) and 48% ( n=55 ) , respectively6 ) . as for the most commonly used cam products , multivitamins were used in 84% , vitamin c was used in 37% , homeopathic remedies were used in 24% , and fish oil / omega-3s were employed in 22%6 ) . regarding the most commonly used cam practices , massage was used in 47% , and 37% used chiropractic methods , 18% used faith - healing , and aromatherapy , homeopathy , and relaxation were each used in 16%6 ) . over half of patients disclosed to their physicians their use of cam in addition to conventional medicine6 ) . in a study examining the use of traditional herbal medicines in korean elementary school children , 65% ( n=905 ) of children were found to be taking herbal medicines12 ) . in a 2008 study in korea , 65 of 378 children ( 17% ) with epilepsy were found to be taking herbal medicines4 ) . in our study in 2014 , 19% ( n=398 ) of children with epilepsy used traditional korean medicine ( tkm ) ( acupuncture , moxibustion , herbal medicine)10 ) . these results suggest that tkm is not the favored method for attaining seizure control and that patients are careful about using tkm to treat epilepsy . in addition , 60% of children with epilepsy were receiving other types of cam10 ) . according to a study by lee et al.4 ) , patients with psychosomatic disorders used herbal medicine significantly more frequently , whereas in a study by kim et al.13 ) , neurologically normal patients used it slightly more frequently ; however , the difference did not have statistical significance . in our study , among receivers of combination treatments besides tkm , tkm was used more frequently in those receiving language , music , or art therapy than in those undergoing physiotherapy or other combination therapies10 ) . this finding suggests that the use of tkm is associated more with the purpose of treatment of cognitive function than motor functions , and parents of children with epilepsy may believe that tkm has an effect on the former rather than the latter10 ) . additionally , regarding significant factors , in the group of patients using a greater number of antiepileptic drugs and having low seizure - free rates , the use of tkm was more frequent10 ) . regarding the effect of cam on epilepsy , inconsistent results had been reported in previous studies . recent cochrane reviews show that some studies on the use of acupuncture and chinese traditional herbal medicine did not succeed in providing clear evidence proving the effects of acupuncture and herbal medicine for epilepsy patients1415 ) . according to the study by lee et al.4 ) , 18% of respondents using herbal medicine reported its effectiveness for seizure control , but the rest of the respondents reported no effectiveness or even worsening of symptoms , although many patients ( 33% ) agreed with using herbal medicine . it was also reported that most patients did not feel that cam was superior to general epilepsy treatments , although 32% of them continued using cam16 ) . it is presumed that this persistent usage is due to people 's beliefs that herbal medicines are safe ( not dangerous ) and help to improve health and enhance cognitive function10 ) . in spite of these beliefs , however , according to the report of kuan et al.16 ) , the most frequent adverse effect of cam was aggravated seizures . it is presumed that this is due to the effects of seizure - inducing materials of herbal medicine or drug - drug interactions . regarding the frequency of cam use for epileptic patients in various countries , 49% ( n=403 ) of taiwanese were found to use cam , 44% used it in arizona , 37% ( n=265 ) of nigerians used cam , and 32% ( n=1,000 ) in india and 24% ( n=92 ) in ohio used cam516171819 ) . regarding commonly used forms of cam for treatment of epileptic patients , prayer and stress relief were used in the west , whereas traditional herbal medicines were employed both in the east and in africa516171819 ) . in us , the preferred modalities were biological therapies and mind - body practices7 ) . in canada , the commonly used methods were chiropractic manipulations , dietary therapy , multivitamins , and massage68 ) . however , in north jordan , prayer / reciting the quran was the most commonly used modality2 ) . in korea these differences in use of cam between countries may be owing to their different cultures , religions , and traditions10 ) . the characteristics of the use of cam in children with neurologic diseases are summarized in table 2 . according to the study by barnes et al.9 ) , almost 40% ( n=23,393 ) of us adults used cam in 2007 and the most commonly used modalities were natural products ( neither vitamin nor mineral ) ( 18% ) and deep breathing exercises ( 13% . ) . cam was used more frequently in american adults with common neurological conditions ( migraines , regular headaches , strokes , back pain with sciatica , seizures , dementia or memory loss ) than in those without such conditions ( 44% [ n=6,587 ] vs. 33% [ n=16,806])20 ) . the frequency of use of each cam modality was higher in adults with common neurological conditions than in those without20 ) . the most common modalities were mind / body therapies , and the least common were alternative medical systems20 ) . the reasons why those with common neurological conditions used cam more frequently than those without such conditions included provider 's recommendations or little effect achieved with conventional medicine or a cost that was too high20 ) . about 50% of adults with common neurological conditions did not report their use of cam to their doctors20 ) . factors that significantly influenced the use of cam in those with common neurological conditions included higher educational level than high school education , positive history of anxiety , living in a western area , being a former smoker , and drinking alcohol lightly20 ) . in the previous studies on the use of cam in various neurologic conditions , the prevalence of use of cam ranged from 19% to 43%212223 ) . compared to the frequency of use of cam in children with common neurologic diseases , the frequency of use in adults with neurologic diseases was similar267810 ) . for korean adults with other diseases , several studies showed the following findings regarding cam use : 60%70% of patients with stroke used cam , 53% of those with cancer used it and 53% of patients with asthma and 48% of patients with psychiatric disorders used herbal medicines24252627 ) . preferred modalities of cam use in children and adults had diverse features , and these results may be influenced by individuals ' different cultures and traditions of use of cam . the factor most commonly related to use of cam in children with neurologic conditions was parental cam use , and it could be presumed that the use of cam in children may be due to such usage running in the family , as well as belief in or experience with the efficacy of cam . in adults with neurologic conditions , increased educational level was the most common factor associated with use of cam202123 ) , and this result may relate to economic level . characteristics of the use of cam in adults with neurologic diseases are summarized in table 3 . in a systematic review on the use of cam in pediatric cancer patients , the prevalence of use of cam ( since the diagnosis of cancer ) ranged from 6% to 91% ( n=2,871 ) . the most common cam modalities were herbal medicines , diets / nutrition , and faith - healing28 ) . the frequent reasons given for the use of cam were to help cure or fight the child 's cancer , relief of symptom , and support of ongoing use of conventional medicine28 ) . there were few factors related to patients ' sociodemographic characteristics associated with use of cam , and this result was different from the results of several other studies28 ) . according to the study by barnes et al.9 ) , for pediatric patients with specific diseases , the use of cam was not highly prevalent . the proportions were 2% in insomnia , 3% in attention deficit hyperactivity disorder ( adhd ) , 5% in other musculoskeletal diseases , 5% in stress or anxiety , 7% in head or chest colds , and 7% in back or neck pain9 ) . from these results , it is presumed that patients in these cases use cam to manage symptoms , to maintain and manage health , or to prevent illness , rather than to treat specific diseases28 ) . many studies , however , reported a higher frequency of cam use in pediatric patients with chronic diseases , such as asthma , autism , adhd , cancer , and sickle cell anemia . medical symptoms such as nausea and abdominal pain rather than certain medical diagnoses were found to be some of the factors associated with the use of cam28 ) . in the study by oshikoya et al.29 ) , the researchers interviewed parents of children with epilepsy ( n=122 ) , asthma ( n=78 ) , or sickle cell anemia ( n=118 ) . three hundred three types of cam were used by 99 patients ( 31% ) ( epilepsy , 38% ; sickle cell anemia , 36% ; asthma , 25% ) . the most commonly used cams were biological products ( 58% ) , while alternative medical systems ( 27% ) as well as mind / body interventions ( 14% ) were also employed . eighty - five parents ( 86% ) were going to report the use of cam to their physicians , but had not yet done so . in 7% of the patients , levy and hyman30 ) investigated the use of cam for children with autistic spectrum disorder ( asd ) . about 50%75% ( n=50112 ) of children with autism were found to use cam31 ) . patients with comorbid intellectual disability may have a higher frequency of use of cam . in the study by levy et al.32 ) , one - third of children requested for examination of asd were found to have already used cam , even before diagnosis . the most frequently used form of cam for children with asd were mind / body practices30 ) . in children with inflammatory bowel disease , adverse effect was the significant predictor of cam use33 ) . in cases of children with asthma , the significant predictors of use of cam were older age and worse control of symptoms . also , more medications and more medical visits as well as more side effects were significant predictors in using cam34 ) . a study in italy showed that the most common reason for the use of cam was a fear of side effects of conventional therapy for routine illness35 ) . in the study by hanson et al.36 ) , 75% of parents of children with asd chose the use of cam because they felt cam was perceived to be safe and it did not have side effect or they experienced side effects of conventional therapy previously . the purposes of the use of cam in children with asd are treatment of major symptoms of asd , improvement of attention , enhancement of relaxation , treatment of gastrointestinal symptoms , regulation of sleep and promotion of general health31 ) . the characteristics of the use of cam in children with other chronic diseases are summarized in table 4 . the use of cam in children with neurologic diseases is common , ranging from 24%78% and it is more frequent than the use in healthy children . preferred modalities of cam differed according to patients ' country of residence and due to their different cultures and traditions , with examples such as prayer / reciting the quran in jordan , biologic therapies , and mind / body therapies in the us , and tkm in korea . the most common factor significantly associated with the use of cam was parental cam use in most studies . the reasons for using cam included religious beliefs , parents ' personal experience , or exposure to success stories from the media and acquaintances . the frequency of cam use in children and adults with neurologic diseases is higher than that in those without these conditions . preferred modalities of cam in adults with common neurological conditions were diverse , including megavitamins and mind / body therapy ( prayer and chiropractic care ) . the most common factor significantly associated with use of cam in adults with neurologic diseases was higher educational level . among children and adults with neurologic diseases , less than half of patients who used cam told their physicians about this usage . thus , physicians need to ask patients about their use of cam to allow further careful treatment . additionally , further study is needed to determine the evidence - based efficacy of the use of cam in children with common neurologic diseases .

complementary and alternative medicine ( cam ) is a phrase used to describe additional health care methods such as mind / body practices and natural products not regarded as treatments by conventional medicine . the use of cam in children with common neurologic diseases is more frequent than its use in healthy children ( 24%78% vs. 12% ) . however , less than half of patients report such use to their physicians . the preferred modalities of cam vary in different countries due to their different cultures and traditions . the most common factor significantly associated with the use of cam is parental cam use in most studies . the frequency of the use of cam in children and adults with neurologic diseases is similar , and both rates are higher than the rates in those without these conditions . the preferred modalities of cam in adults are diverse , and megavitamins and mind / body therapy ( prayer and chiropractic care ) are included . the most common factor significantly associated with the use of cam in adults with neurologic diseases is high educational level . physicians need to be concerned with patients ' use of cam and provide correct information about cam so that patients may make the right decisions . further study is needed to determine the evidence - based efficacy of cam use in children with common neurologic diseases .

Introduction Characteristics of the use of CAM 1. Characteristics of the use of CAM in children with neurologic diseases 2. Characteristics of the use of CAM in adults with common neurologic conditions 3. The use of CAM in children with other chronic diseases Conclusions

alport syndrome ( as ) was first described in 1927 as a hereditary disorder characterized by a combination of nephritis and deafness1 . this syndrome is a basement membrane ( bm ) disease affecting approximately 1 in every 5,000 people7 . the disease manifests with juvenile to adult onset progressive glomerulonephritis usually associated with a high - frequency - specific sensorineural hearing loss , dot and fleck retinopathy , and lens abnormalities12 . the dominant x - linked form owing to mutations of locus col4a5 and the recessive autosomal form resulting from mutations to loci col4a3 or col4a43 . although approximately 85% of the cases are x - linked dominant form there is also a recessive autosomal form for about 15% . the mutation presented in as produces defects in chains 3 , 4 , and 5(iv ) . type iv collagen damage , owing to mutation , breaks the epithelial bonds and leads to an organ defect14 . these defects in chains result in entanglement and incorrect set - up of monomers which are quickly degraded . these mutations interrupt the normal replacement of the embryonic development and cause persistence of chains 1.1 2(iv ) in renal basal membranes , cochlea and capsule of lenses . the main structural and fibrilar component of the human gingival connective tissue is collagen , which accounts for about 60% of the total tissue protein . previous biochemical studies have demonstrated that type iv collagen accounts for less than 1% of the total collagenous component of the healthy human gingival connective tissue20 . type iv collagen is presented at the bm of the human gingiva , which separates the connective tissue from the epithelium . the clinical presentation of the syndrome emerges with signs such as ; hematuria , progressive renal failure , sensorineural hearing loss ( snhl ) ( variable intensity , bilateral , symmetrical and progressive ; present in approximately 55% of men and 45% of women ) , ocular affections , ( anterior lenticonus , ocular stains and cataracts4 ) , macro - thrombocytopenia23 and leiomyomatosis27 . hearing loss is one of the initial and most common sign in a patient with hematuria . snhl in high frequencies suggests as even in the absence of renal biopsy or family history of renal failure . it is generally accepted that the initial approach to a patient with clinical features and positive family history of as is skin biopsy and the presence of 5 collagen chain in the skin leads to renal biopsy16 . careful follow - up of the hearing loss is a relevant factor of the prognosis of the renal disease progression . men with hearing loss in the first two decades of life have more severe renal diseases11 . ocular abnormalities in these patients hinder visual clues which are essential for the communication with the patient who has severe hearing loss . dialysis and renal transplantation are indicated in this group of patients with as and end - stage renal failure12,17 . immunosuppressant drugs , cyclosporin - a ( csa ) and corticoids are administered to patients who undergo renal transplantation . the prognosis improves with renal transplantation increasing longevity of the patient with as and renal failure12 . the aims of this case report are to show the changes in the gingival tissues in a patient with as under therapy with cyclosporin - a after renal transplantation and to discuss the possible role of type iv collagen in gingival basal lamina as an alternative approach for the diagnosis of as . in 2003 , a 20-year - old male patient was referred to the baskent university , faculty of dentistry , department of periodontology , ankara , turkey for treatment of severe gingival hyperplasia . the patient 's persistent microhematuria was discovered when he was 3 years old during a routine pediatric examination . while he had temporary bilateral hearing loss , no abnormalities were seen in the optical media , specifically no cataract or lenticonus . he had a renal biopsy at the university of heidelberg in germany and he was diagnosed as having as . review of medical history revealed that at the age of 16 , the patient started a regular hemodialysis regimen due to the end - stage renal disease . he was scheduled for renal transplantation and was put under an immunosuppressive protocol in the meantime . the patient received a kidney from his mother and , after the transplantation , immunosuppressant drugs - cyclosporin - a ( 5 mg / kg / day ) , prednisolone ( 15 mg / kg / day ) and azathioprine ( 2 mg / kg / day ) - were prescribed for prevention of transplant rejection . his postoperative healing period was uneventful and he had a good renal function with creatinine levels ranging from 0.9 to 2.9 mg / dl at present . he had progressive and symmetrical snhl hearing loss , mainly affecting high frequency ranges ( > 2,000 hz ) . he had bilateral cochlear implants for the rehabilitation of hearing function . at the age of 22 , bilateral visual failure began because of a large myopic shift . on the ophthalmologic examination , his visual acuity was 20/100 with -4.00 ( -4.50 * 120 ) in the right eye and 20/70 with - 4.25 ( -2.50 * 170 ) in the left eye . after the surgery , visual acuity increased to 20/30 with + 0.50(-2.00 * 10 ) in right eye . one year after renal transplantation , the patient started complaining of gingival enlargement affecting both buccal and lingual / palatal surfaces of all teeth ( figure 1 ) . first gingivectomy surgery was performed at the anterior regions of both maxilla and mandible with antibiotic prophylaxis ( 2 g amoxicillin/30 min before surgery ) , to recover esthetic . four months later , however , recurrence of gingival enlargement was observed at all gingival sites . gingival biopsy was taken for histopathological analysis by light microscopy and immunohistochemistry and examination by transmission electron microscopy ( tem ) . for histopathological analysis , gingival biopsies were done and the specimens were fixed in 10% formalin solution and embedded in paraffin blocks after routine processing . then , 4 - 5-m - thick sections were obtained and stained with hematoxylin and eosin ( he ) . serial sections were immunostained with a biotin - streptavidin complex system ( ace+ substrate chromogene ready to use , k3469 , dako , denmark ) for type iv collagen ( clone civ 22 , nr . m 0785 usa ) and the basal membrane under the squamous epithelium was observed on some sites with discontinuity ( figure 4 ) . for tem analysis , the gingival specimens were fixed in phosphate - buffered saline containing 2.5% glutaraldehyde for 2 - 3 h , post - fixed in 1% osmium tetroxide and dehydrated in a series of increasing ethanol concentrations ( 25% , 50% , 75% , 95% , and absolute alcohol ) . after passing through propylene oxide , the specimens were embedded in quick - setting epoxy resin ( araldite cy 212 , ciba - geigy , basel , switzerland ) ddsa ( 2-dodecenyl succinic anhydride ) , bdma ( benzyldimethylamine ) and dibutylphtalate . semithin sections were obtained and stained with blue toluidin and examined with a light microscope . ultrathin sections were stained with uranyl acetate and lead citrate and examined with leo 906e em transmission electron microscope ( zeiss , jena , germany ) . the lamina densa was disrupted in several regions ( figures 6 and 7 ) and hemidesmosoms remained intact ( figure 8) . dense bundles of thick collagen fibers were organized around and under the bm ( figure 9 ) . in order to protect the patient from the side effects of csa therapy on the gingiva tissues , the patient was referred to the nephrology department for consultation . however , the nephrologist pointed out that the patient had an aggressive course of as and that , since control of the disease was accomplished successfully with csa , he was not willing to change the medication . the excessive and fibrous gingival enlargements resulted in migration of the anterior teeth , but no alveolar bone loss occurred ( figure 3 ) . in 2003 , a 20-year - old male patient was referred to the baskent university , faculty of dentistry , department of periodontology , ankara , turkey for treatment of severe gingival hyperplasia . the patient 's persistent microhematuria was discovered when he was 3 years old during a routine pediatric examination . while he had temporary bilateral hearing loss , no abnormalities were seen in the optical media , specifically no cataract or lenticonus . he had a renal biopsy at the university of heidelberg in germany and he was diagnosed as having as . review of medical history revealed that at the age of 16 , the patient started a regular hemodialysis regimen due to the end - stage renal disease . he was scheduled for renal transplantation and was put under an immunosuppressive protocol in the meantime . the patient received a kidney from his mother and , after the transplantation , immunosuppressant drugs - cyclosporin - a ( 5 mg / kg / day ) , prednisolone ( 15 mg / kg / day ) and azathioprine ( 2 mg / kg / day ) - were prescribed for prevention of transplant rejection . his postoperative healing period was uneventful and he had a good renal function with creatinine levels ranging from 0.9 to 2.9 mg / dl at present . he had progressive and symmetrical snhl hearing loss , mainly affecting high frequency ranges ( > 2,000 hz ) . he had bilateral cochlear implants for the rehabilitation of hearing function . at the age of 22 , bilateral visual failure began because of a large myopic shift . on the ophthalmologic examination , his visual acuity was 20/100 with -4.00 ( -4.50 * 120 ) in the right eye and 20/70 with - 4.25 ( -2.50 * 170 ) in the left eye . after the surgery , visual acuity increased to 20/30 with + 0.50(-2.00 * 10 ) in right eye . one year after renal transplantation , the patient started complaining of gingival enlargement affecting both buccal and lingual / palatal surfaces of all teeth ( figure 1 ) . first gingivectomy surgery was performed at the anterior regions of both maxilla and mandible with antibiotic prophylaxis ( 2 g amoxicillin/30 min before surgery ) , to recover esthetic . four months later , however , recurrence of gingival enlargement was observed at all gingival sites . gingival biopsy was taken for histopathological analysis by light microscopy and immunohistochemistry and examination by transmission electron microscopy ( tem ) . for histopathological analysis , gingival biopsies were done and the specimens were fixed in 10% formalin solution and embedded in paraffin blocks after routine processing . then , 4 - 5-m - thick sections were obtained and stained with hematoxylin and eosin ( he ) . serial sections were immunostained with a biotin - streptavidin complex system ( ace+ substrate chromogene ready to use , k3469 , dako , denmark ) for type iv collagen ( clone civ 22 , nr . m 0785 usa ) and the basal membrane under the squamous epithelium was observed on some sites with discontinuity ( figure 4 ) . for tem analysis , the gingival specimens were fixed in phosphate - buffered saline containing 2.5% glutaraldehyde for 2 - 3 h , post - fixed in 1% osmium tetroxide and dehydrated in a series of increasing ethanol concentrations ( 25% , 50% , 75% , 95% , and absolute alcohol ) . after passing through propylene oxide , the specimens were embedded in quick - setting epoxy resin ( araldite cy 212 , ciba - geigy , basel , switzerland ) ddsa ( 2-dodecenyl succinic anhydride ) , bdma ( benzyldimethylamine ) and dibutylphtalate . semithin sections were obtained and stained with blue toluidin and examined with a light microscope . ultrathin sections were stained with uranyl acetate and lead citrate and examined with leo 906e em transmission electron microscope ( zeiss , jena , germany ) . the lamina densa was disrupted in several regions ( figures 6 and 7 ) and hemidesmosoms remained intact ( figure 8) . dense bundles of thick collagen fibers were organized around and under the bm ( figure 9 ) . in order to protect the patient from the side effects of csa therapy on the gingiva tissues , the patient was referred to the nephrology department for consultation . however , the nephrologist pointed out that the patient had an aggressive course of as and that , since control of the disease was accomplished successfully with csa , he was not willing to change the medication . the excessive and fibrous gingival enlargements resulted in migration of the anterior teeth , but no alveolar bone loss occurred ( figure 3 ) . as is a hereditary disorder characterized by hematuric nephritis leading to an end - stage renal disease , sensoryneural deafness and ocular abnormalities . as have been attributed to the production of a defective type iv collagen21 . type iv collagen is the main component of the glomerular bm and composed of six genetically distinct chains , namely 1(iv ) - 6(iv ) , encoded by gene pairs located on three different chromosomes10,20,26 . renal transplantation has proven to be the best treatment for patients with an end - stage renal disease18,24 . it is generally successful in patients with as but in cases where graft loss occurs , re - transplantation usually fails . csa has been shown to be effective at halting the progression of renal failure in as2 . csa is a cyclic polypeptide with potent and selective immunosuppressive activity , acting primarily by inhibiting interleukin-2 gene transcription in cd4 + lymphocytes6 . csa treatment is associated with side effects including chronic nephrotoxicity30 , hepatotoxicity9 and neurotoxicity3 , hypertention27,28 and gingival overgrowth5 . the patient of this case received a kidney from his mother and was put in an immunosuppressive drug regimen with csa ( 5 mg / kg / d ) , prednisolone ( 15 mg / kg / d ) , and azathioprine ( 2 mg / kg / d ) . the prednisolone dose was gradually reduced to 10 mg / kg / d . the relationship between csa and the development of gingival overgrowth is well established in humans as well as in animal experimental models5,8 . gingival enlargement , occurring in a range of 25 - 81% of the patients , is a severe pathology that interferes with normal oral functions such as mastication and speech , and causes profound psychological problems to the patients8 . hyland , et al.15 ( 2003 ) recently suggested that since less 50% of the patients taking csa develop gingival overgrowth , a genetic predisposing may explain the different responses of gingival fibroblasts in collagen turnover regulation after csa treatment and may play a major role in the pathogenesis of csa - induced overgrowth . other factors such as the influence of different pre - existing gingival conditions ( e.g. gingival inflammation ) and the different host 's capacity to deal metabolically with csa should also be considered as they might affect csa - induced pathogenesis8 . the basal lamina , which is largely composed of glycoproteins ( laminin and nidogen ) , collagen type iv , and proteoglycans , underlies the oral epithelium and forms a barrier between the epithelium and the connective tissue . interactions between epithelial cells and fibroblasts stimulate type iv collagen and laminin expression in epithelial cells in vitro 25 . these molecules are important in epithelium formation and they establish the junctional seal separating the oral cavity from the interstitial environment . a breakdown of this seal is a significant factor in periodontal disease development and its reformation is required for successful periodontal treatment or periodontal regeneration21 . as is caused by defects in type iv collagen , which is the major component of bm . it is generally accepted that the initial approach for patients with the clinical features and a sustaining family history of as is skin biopsy . in the presence of the 5 collagen chain in the skin , the typically thin glomerular bm thickens over time into multilamellations surrounding lucent areas that often contain granules of varying densities13 . the diagnostic value of skin biopsy has first described in 1986 since a kidney biopsy could be risky in cases of renal failure22 . skin biopsy is especially useful if a kidney biopsy poses an excessive risk , as in the patients with an end - stage renal disease . while the 5 chain of type iv collagen is also expressed in epidermis , an immunofluorescence examination of skin biopsy specimen can be used to establish the diagnosis . approximately 80% of male patients and 60% of female patients with x - linked as have no 5(iv ) collagen in epidermal bm . in addition , most individuals with autosomal recessive as do not express 3(iv ) , 4(iv ) , or 5(iv ) collagens in skin . healthy individuals and patients with thin - membrane disease have normal expression of 5(iv ) in the skin . hamiwka , et al.13 ( 2007 ) suggested that when a kidney biopsy is considered necessary in a female patient with persistent hematuria but without a clear family history of as or proteinuria , renal biopsy alone may not be enough to exclude as carrier status . a skin biopsy obtained at the time of the kidney biopsy should not pose any further risk for the patient but can provide some additional information . could gingiva , which has type iv collagen in it is bm be valuable for the diagnosis of as ? in this report , immunohistochemical analysis revealed disrupted areas on the bm . these findings were supported by tem analysis , which showed that the lamina densa was disrupted in several regions of the bm . in the gingival tissue , the basal lamina is largely composed by collagen type iv . the reason of these irregularities and disruptions might have been arisen from type iv collagen . gingival biopsy is easily done under local anesthesia , and tissue specimens that are obtained from the intraoral region do not cause esthetic problems . in addition to having as , our patient was an organ transplant recipient and under immunosuppressive therapy with csa . the effects of csa on gingiva have been recognized but not many studies have discussed the effects of csa on type iv collagen are available . mondella , et al.19 ( 1994 ) evaluated the bm changes in a group of patients with psoriasis and consuming csa . in the patients with discontinuous staining of type iv collagen , evident and continuous staining of type iv collagen within the bm the results of the present case indicates that when the effect of csa on the repair of the continuity of type iv collagen in the bm is considered , despite the csa therapy , the continuing irregularity and discontinuity in the basal lamina increases the possibility of gingival type iv collagen defects in the patients with as . there is no evidence about the possible changes that as causes in the gingival tissues . therefore the precise evaluation of the effects of csa on the gingival tissues of the patients with as is not possible . future studies should evaluate the effects of as on type iv collagen in gingiva and the influence of csa , which has an important role in as both pre and post - transplantation , on the gingival collagen . patients with as and renal failure have their prognosis improved and their longevity increased with renal transplantation . therefore , the follow up , rehabilitation , and investigation of the progression of hearing loss and ophthalmological problems become important in the quality of life of these patients . maintenance of good oral hygiene with regular visits to the dentist can limit gingival hyperplasia . as in all patients under immunosuppressive treatment , prevention of infection is also very important for patients with as . csa has a determinant role before and after renal transplantation as well as on the treatment of as , and the side effects of this drug on gingiva are increased in the presence of infection . if untreated , this condition can compromise the patients ' dental and gingival esthetics and cause nutrition problems , and periodontal or dental infections . in order to prolong the lifetime , alongside with regular nephrological , ocular and hearing evaluations , periodical examinations of the oral tissues are consequent for these patients with a low quality of life . the possible role of gingival biopsy , which is easier and less risky than renal or skin biopsies , on the early diagnosis and evaluations of the treatment results of as should be investigated .

alport syndrome ( as ) is an important hereditary disorder affecting the glomerular basement membrane . diagnosis of as is based on the presence of hematuric nephropathy , renal failure , hearing loss , ocular abnormalities and changes in the glomerular basement membrane of the lamina densa . the aims of this case report were to show the changes in the gingival tissues in a patient with as under therapy with cyclosporin - a after renal transplantation and to discuss the possible role of type iv collagen in gingival basal lamina as an alternative approach for the diagnosis of as . a 20-year - old male patient with as underwent periodontal therapy including a series of gingivectomy surgeries . gingival samples obtained during the second surgery were examined histopathologically and by transmission electron microscopy for further pathological examination . gingivectomy procedures have been performed every 6 months over the last 4 years . the excessive and fibrous gingival enlargements resulted in migration of the anterior teeth , but no alveolar bone loss occurred . this is the first report to demonstrate the possible changes in the gingival tissues caused by as . it is suggested that gingival biopsy can be an initial diagnostic tool instead of renal or skin biopsies . proper dental and periodontal care and regular visits to the dentist could provide limited gingival hyperplasia to patients with as .

INTRODUCTION CASE REPORT Case Description and Gingival Surgery DISCUSSION

a twenty - year - old male patient presented to our clinic with pain of the right wrist and the long finger mp joint . after injury , he did not received any evaluation or treatment , but he felt a snapping of the ulnar side of the wrist in forearm rotation and dorsal side of the long finger mp joint in mp flexion . at that time , the symptoms improved spontaneously after several weeks without specific treatment , three months earlier , after heavy lifting , he had persistent symptoms despite the conservative treatment including short arm splint for 4 weeks . a physical examination revealed painful ecu dislocation in forearm rotation and painful extensor tendon subluxation at the long finger mp joint in mp flexion . he showed generalized ligament laxity according to the beighton and horan criteria but did not have any symptoms in the contralateral hand.1 ) plane radiography did not reveal any fracture or abnormality . ultrasonography and magnetic resonance imaging ( mri ) were performed to confirm the subluxation and identification of the associated pathology . in dynamic ultrasonography , the sagittal band ( sb ) was subluxated ulnarly as the long finger mp joint was flexed more than 70. in addition , the ecu was subluxated volarly in forearm supination with tendon attrition at the level of the ulnar styloid process where the ecu groove exists . mri revealed longitudinal splitting approximately 5 cm at the level of the ulnocarpal joint and dislocation of volar half slip of the ecu tendon on t2 axial plane image ( fig . the redundant radial sb was augmented using a cross - stitch with a 6 - 0 prolene suture ( fig . this effectively prevented any additional slippage of the extensor tendon of the long finger . with an approximately 4 cm longitudinal incision in the ulnar styloid area , the ecu sheath on the ecu groove was approached protecting the dorsal ulnar nerve sensory branch . neither the ecu sheath nor extensor retinaculum was ruptured but the space within the ecu tendon compartment was dilated because of its redundancy at the ulnar styloid process . an ecu tendon dislocation in an ulnar and palmar direction was confirmed with the forearm in supination and the wrist in palmar flexion . the fibro - osseous sheath of the ecu groove was incised at the ulnar border and elevated radially . , naple , fl , usa ) suture anchors were inserted at the ulnar border of the ecu groove just proximal to ulnar styloid and 1 cm apart proximally . the overlying ecu sheath was advanced to the underlying periosteum reducing the enlarged sheath volume with a horizontal mattress tie ( fig . a long arm splint with mp extension at neutral forearm rotation was applied for 4 weeks and the wrist motion was allowed thereafter . vigorous activities were restricted for an additional three months . at the 1-year follow - up , the long finger mp joint , wrist and forearm showed normal motion with no pain ( fig . he returned to his previous activities without a recurrent dislocation of the ecu tendon and long finger extensor tendon . the ecu tendon is encased by a fibro - osseous sheath deep to the extensor retinaculum as described by spinner and kaplan , which contributes to distal radioulnar stability at the distal ulnar groove . a classification of the different possible lesions of the ecu tendon and osteofibrous sheath was reported on previously published series.2,3 ) in this case , the ecu sheath is stripped from the periosteum but remains in continuity , forming a false pouch , and the ecu tendon itself has tendinopathy and several longitudinal splits ( tables 1 and 2 ) . classically described maneuver for the evaluation of ecu tendonitis has some disadvantages to identify ecu problem . ecu synergy test helps to identify chronic dorsal ulna - sided wrist pain and has high diagnostic accuracy . in our case imaging studies , such as mri for the diagnosis of the ecu subluxation are nonspecific except for the tenosynovitis but dynamic ultrasonography is useful for identifying the ecu dislocation in the forearm rotation with ulnar deviation and palmar flexion.4 ) in this case , dynamic ultrasonography also showed a signal void about 70% at the distal ulnar ecu groove . in addition , mri showed longitudinal splitting with a dislocation of the volar half of the ecu tendon , which suggests static dislocation of the volar half of the ecu tendon in neutral forearm rotation . therefore , a decrease in the ecu tendon volume with a longitudinal tear within the ecu groove might be a diagnostic clue of ecu volar subluxation ( fig . recently , this incidence of injury has increased , particularly in athletes and the active young population . surgical treatments include direct repair and reconstruction of the ecu sheath with extensor retinaculum flap or fascial patch . the anatomic ecu tendon sheath reconstruction technique using suture anchor has shown good outcomes in 21 patients.5 ) this case had concomitant extensor tendon subluxation at the long finger mp joint . the patient had symptoms in the absence of any definitive tear of ecu sheath or sb . therefore , patients with generalized ligament laxity , as in this case , should be treated carefully and warned at the initial trauma event of recurrent dislocation . when the wrist joint moved to ulnar deviation and palmar flexion with active contraction of the ecu , the ecu tendon has translational stress to be forced out of the groove to the volar - ulnar side in terms of the ecu muscle force vector traversing the wrist joint . the ulnar styloid process serves as a pulley around which the ecu tendon changes direction to transmit the force to the 5th metacarpal base . an ultrasound imaging study of the ecu tendons of 40 symptom - free wrists of healthy volunteers showed that the mean ecu tendon displacement was greatest in the supinated forearm position followed by the neutral position and was least in the pronated position to a mean of 1.46 mm ( sd , 2.03 ) beyond the apex of the ulnar border of the ulnar groove.6 ) on the other hand , the dorsal edge of the ecu tendon was never dislocated over the ulnar border of the groove despite asymptomatic physiologic subluxation . the forearm rotation is believed to change the gliding resistance of the ecu tendon or potential compartment volume within the ecu compartment . for the extensor digiti minimi tendon , the gliding resistance in pronation was higher than that in neutral or supination.7 ) therefore , the forearm supination might increase the potential volume of the ecu compartment , resulting in a decrease in gliding resistance of the ecu tendon . if the ecu sheath is attenuated , the ecu tendon does not maintain its normal position . the other possible explanation for the ecu subluxation is the ulnar variance depending on forearm rotation . if the ulnar styloid , as a pulley for the ecu tendon , is shortened relative to the distal radius , the ecu tendon distal to the ulnar styloid might have subluxation tendency volar to the ulnar groove because soft tissue pulley is not as strong as bony pulley . acute closed sb injury might be treated conservatively , such as digital splinting , but surgical treatment might be necessary in a chronic sb injury . many surgical techniques have been described depending on the sb deficiency.8,9 ) in this case , the radial sb has a laxity without a definitive rupture . we consider that repetitive use causes chronic pain and it is not related with initial trauma . therefore , neither additional reinforcement nor reconstruction is needed except for a cross - stitch suture only for redundant radial sb . the ultrasound findings of a ruptured sb showed focal hypoechoic thickening of the sb at the side of the extensor tendons , even though the normal thickness of the sb has a wide range of values.10 ) the disappearance of the normal architecture of the sb as well as the extensor tendon subluxation to the contralateral side is also noticed.11 ) patients with generalized ligamentous laxity might experience suboptimal results of the ligament stabilizing procedure because of the inherent connective tissue extensibility as well as laxity of the secondary restraints caused by the composition of the connective tissue and the orientation of the various soft - tissue structures . on the other hand , in this case , the patient 's symptoms were relieved by a retinaculum augmentation procedure using his own tissue . therefore , retinaculum augmentation should be considered primarily for recurrent ecu subluxation and extensor tendon subluxation , even though the patients show generalized ligamentous laxity .

a twenty - year - old male visited our clinic with wrist and long finger metacarpophalangeal ( mp ) joint pain . dynamic ultrasonography revealed sagittal band ( sb ) ulnar subluxation and extensor carpi ulnaris ( ecu ) volar subluxation . magnetic resonance imaging showed longitudinal splitting and dislocation of the volar half slip of the ecu tendon . the redundant radial sb was augmented and ecu sheath was advanced to the periosteum using suture anchors . he was able to perform his previous activities at the last follow - up . we encountered a case of " simulateous " ecu dislocation with extensor tendon subluxation of the long finger at the mp joint . therefore , we report this case with a review of the relevant literature .

CASE REPORT DISCUSSION

in various autopsy series , renal involvement is reported in 30 - 50% of patients with lymphoma . a 60-year - old male with type 2 diabetes mellitus of 5 years duration , on oral hypoglycemic drugs with good control of blood sugars and documented coronary artery disease with a baseline serum creatinine of 1.2 mg / dl , presented with intermittent fever , weight loss and anorexia of 2-month duration . there was no alteration in bowel habits , ecchymosis , purpura , chronic cough , long - standing headache and pain abdomen . on examination , he was hemodynamically stable , pallor was present and there was no edema or lymphadenopathy . per - abdomen , cardiovascular and respiratory system examinations were unremarkable . on evaluation , he had hemoglobin of 8 g / dl and peripheral smear showed normocytic and normocytic picture . alanine transaminase , aspartate transaminase , serum albumin , total bilirubin and alkaline phosphatase were 28 u / l , 16 u / l , 4 g / dl , 0.4 mg / dl and 97 u / l , respectively . renal functions were deranged with serum creatinine and blood urea nitrogen of 8.5 mg / dl and 235 mg / dl , respectively . however , his urine output was adequate . serum uric acid was high ( 13 mg / dl ) and lactate dehydrogenase was elevated ( 1400 iu / dl ) . urine analysis showed 1 + albumin and no red blood corpuscles or white blood cells . ultrasound of kidney ureter bladder showed right kidney of 12.3 cm and left kidney of 12.4 cm with echogenic contents suggestive of calculi . antinuclear antibody ( by immunofluorescence ) , anti - neutrophilic cytoplasmic antibodies ( by immunofluorescence and elisa ) were negative . complement factor 3 and 4 were 108 mg / dl and 44 mg / dl , respectively . hepatitis b surface antigen , human immunodeficiency virus - i / ii and anti - hepatitis c viral serology were negative . with a provisional diagnosis of rapidly progressive renal failure ( rprf ) , kidney biopsy was done . histopathological examination revealed [ figure 1a ] diffuse interstitial infiltration with lymphomatous cells with morphology suggestive of high - grade non - hodgkin 's lymphoma ( nhl ) and immunohistochemistry showed [ figure 1b ] cd20 positivity of the lymphomatous cells , suggestive of diffuse large b - cell , non - hodgkin 's lymphoma ( dlbcl ) . to further characterize the disease , positron emission tomography - computed tomography ( pet - ct ) was done , which demonstrated avid flurodeoxy glucose ( fdg ) uptake in enlarged left and right kidneys with standardized uptake value ( suv ) max of 18.5 and 9.5 , respectively . avid fdg uptake was also seen in multiple hypodense areas in both lobes of liver ( suv max 13.8 ) , largest being 7.9 cm 5.5 cm in the left lobe [ figure 2 ] and intense patchy uptake in the bone marrow of multiple bones in axial and appendicular skeleton . patient was diagnosed as extranodal nhl , in the form of prl with rprf and secondary hepatic involvement . his disease was staged as iv be according to ann arbor staging system and his international prognostic index score was 5/5 . chemotherapy was initiated with rituximab , cyclophosphamide , hydroxydaunorubicin , vincristine and prednisolone ( r - chop ) regimen . twenty days post - chemotherapy , patient 's well - being improved ; he became afebrile and his serum creatinine came down to 1.2 mg / dl from 8.5 mg / dl . ( a ) diffuse interstitial infiltration by lymphomatous cells ( h and e , 200 ) , ( b ) immunohistochemistry showing diffuse membranous positivity for cd20 of the lymphomatous cells positron emission tomography - computed tomography imaging . ( a ) increased flurodeoxy glucose ( fdg ) uptake ( standardized uptake value [ suv ] max 9.5 ) is noted in the right kidney with regular margins . increased fdg uptake note is made of 9 mm calculus in left kidney lower calyx with mild hydronephrosis . ( b ) avid fdg uptake is noted in multiple lesions in liver with largest lesion ( 7.9 cm 5.9 cm , suv max 13.8 ) in left lobe renal involvement of the lymphoma can occur in various ways . in almost all cases , it appears to be a secondary process , either by direct extension from a retroperitoneal mass or via hematogenous spread in the setting of a disseminated disease . by definition , the term prl is applied to patients with disease localized to the kidney without any sign of other organ involvement or in whom renal involvement is the presenting manifestation . kandel et al . had shown that out of 17 cases of prl who underwent autopsy , all the patients had evidence of extra - renal disease . interpretation of these data had led to the conclusion that primary lymphoma of the kidney does not exist . however , okuno et al . reviewed 176 cases of nhl with renal involvement and were able to identify 5 cases that met the criteria for prl . there is still debate on whether tumor invades the renal parenchyma from adjacent lymph nodes or whether the lymphomatous process originates within the kidney . hematological malignancies presenting with acute kidney injury ( aki ) include plasma cell dyscrasia ( most common being multiple myeloma ) , chronic myeloid leukemia with blast crises , chronic myelomonocytic leukemia with leukemic infiltration and acute myelogenous leukemia . our patient had prl , as there was no lymph nodal involvement on imaging and despite radiological evidence of hepatic and bone marrow involvement patient did not have hepatic dysfunction or marrow involvement of lymphoma on bone marrow examination . there are several mechanisms of renal failure in patients with lymphoma , which include ureteral obstruction , hypertension from compression of renal vessels , urate nephropathy , hypercalcemia , sepsis , volume depletion , paraproteinemia and immunologically mediated glomerular injury . in the present case , hypercalcemia , volume depletion , sepsis and paraproteinemia induced aki as patient 's serum calcium level was normal ( 9.2 mg / dl ) . on clinical examination , there was no evidence of volume depletion ( central venous pressure was 10 cm of normal saline ) and sepsis ( leukocyte count was 6900 ) , and serum electrophoresis did not reveal any monoclonal protein and the light chain assay was normal adjusted to renal failure ( : = 2 ) . immunofluorescence on the kidney biopsy specimen did not reveal any evidence of immunologically mediated disease . however , renal failure due to infiltration of the kidneys by dlbcl is an unusual manifestation and also a rare presenting symptom of a hematological malignancy . until now our patient presented with rprf due to infiltration by lymphomatous cells , which was proved on histopathological examination . the most common imaging appearance of renal lymphoma is that of multiple parenchymal masses of variable size . other patterns include solitary renal mass , bilateral renal enlargement , and peri - renal soft tissue masses . both contrast - enhanced ct and mr imaging are superior to ultrasonography in detecting the presence of disease as well as the number of renal lesions and the presence of extra - renal tumors . combined pet - ct allows precise localization and potential earlier detection of additional tumor foci . in our patient , pet - ct showed activity in kidneys , liver and bone marrow of axial and appendicular skeleton . despite this , there was no malignant cells detected on bone marrow examination and there was no hepatic dysfunction . systemic chemotherapy with or without radiotherapy is a widely used treatment for prl , as well as the option of surgery in the case of prl affecting one kidney . this approach could preserve the organ function , but generally the prognosis is poor . because of the low incidence of this disease , randomized studies aiming to compare different therapy approaches have not been reported . mentioned that out of 34 cases with bilateral renal involvement by lymphoma , only 11 patients achieved remission and the remaining died . the present report is limited by short - term follow - up of the patient . in conclusion , prl is one of the rare causes of rprf and the renal dysfunction would reverse on prompt management with appropriate chemotherapy .

a 60-year male was admitted with advanced renal failure and bilaterally enlarged kidneys . kidney biopsy revealed diffuse interstitial infiltration by cd20 + lymphomatous cells suggestive of diffuse large b - cell , non - hodgkin 's lymphoma . bone marrow examination was negative for malignant cells . positron emission tomography - computed tomography showed uniformly diffuse and avid flurodeoxy glucose uptake in both kidneys , multiple hypodense areas of both lobes of liver , and axial and appendicular skeleton . patient was treated with rituximab , cyclophosphamide , hydroxydaunorubicin , vincristine and prednisolone , became afebrile and serum creatinine normalized .

Introduction Case Report Discussion

predicting the level of functional recovery expected in patients with post - stroke hemiplegia is highly important when making an overall treatment plan . rehabilitation therapies may be more effective if they are tailored to the intact anatomical and physiological structures of each individual patient . thus , many clinicians have made an effort to precisely and objectively evaluate post - stroke brain injury and its prognosis . the corticospinal tract ( cst ) is the primary motor pathway in the central nervous system , and many studies indicate that cst preservation is essential for good recovery of impaired motor function in patients following stroke . motor - evoked potentials ( meps ) , which can be obtained by transcranial magnetic stimulation ( tms ) of the motor cortex , are used to study various central nervous system disorders . the absence or low amplitude of tms responses suggests loss of neurons or axons in the cst , which can be used as an early stage prognostic indicator of motor and functional recovery in patients with stroke [ 4 - 7 ] . diffusion tensor imaging ( dti ) is a method for visualizing anisotropic water molecule diffusion characteristics in the white matter of the brain . more specifically , dti visualizes the diffusion of water molecules along axonal tracts within high - density white matter nerve fibers . diffusion tensor tractography ( dtt ) is a method that produces a three - dimensional representation of cst structure ( or integrity ) , which is derived from dti . several studies have demonstrated that dtt is useful for predicting motor outcome in patients with stroke [ 10 - 12 ] . an increase in ipsilateral connectivity has a positive correlation with slower walking speeds , higher asymmetrical fractional anisotropy values , and is associated with greater walking impairments in dti analysis . alterations in the balance of corticomotor excitability in lower limbs at the chronic stage of stroke are related to poor motor recovery after stroke . tibialis anterior muscle meps registered in the subacute phase of stroke may provide important prognostic information for lower extremity motor recovery and ambulatory function . although several recent studies have compared the usefulness of tms and dtt in predicting upper extremity motor outcome in patients with stroke , there have been limited studies combining both mep and cst data to predict lower extremity motor and ambulatory function . in the present study , we examined the usefulness of combining tms and dtt to evaluate cst integrity and subsequently predict ambulatory and lower extremity functional recovery after middle cerebral artery ( mca ) stroke . patients with first stroke episodes who were admitted for rehabilitation to konkuk university medical center from november 2010 to december 2013 were recruited . tms and dti were performed at the same time , 3 - 8 weeks after stroke onset . the mean age of patients was 62.812.3 years , and the average time between stroke onset and combined tms and dti procedures was 38.815.8 days . patient exclusion criteria for this study included the following : ( 1 ) previous history of a stroke ; ( 2 ) inability to walk before stroke onset ; ( 3 ) medication use , such as sedatives , anticonvulsants , or muscle relaxants ; ( 4 ) a diagnosis of diabetes or other peripheral neuropathy ; ( 5 ) low - level consciousness ; ( 6 ) contraindication to magnetic resonance imaging ; or ( 7 ) refusal of dti . the fugl - meyer assessment ( fma ) , functional ambulation category ( fac ) , and korean modified barthel index ( k - mbi ) were used to assess motor function , walking ability , and functional status in all patients at the time of admission and after 4 weeks of rehabilitation . the fma is an index for evaluating motor function and is comprised of five domains : joint movement and pain , sensation , balance , upper limb motor function , and lower limb motor function . these five domains are further divided into subcategories , each of which is graded on a three - point scale : 0 , complete inability to perform the task ; 1 , partial ability to perform the task ; and 2 , perfect ability to complete the task . the fac is based on characterizing the level of assistance required during a 15 m walk . the six fac scores are as follows : 0 , the patient can not walk at all or requires physical assistance from two persons ; 1 , a need for continuous manual contact of one person to support body weight ; 2 , a need for intermittent light touch from one person to assist balance ; 3 , a need for verbal cuing or ambulation on level surfaces without manual contact ; 4 , independent on level surfaces ; 5 , can walk independently anywhere . we divided the patients into three groups according to the fac scores ; nonfunctional ambulation ( fac score : 0 ) , dependent ambulation ( fac score : 1 - 3 ) , independent ambulation ( fac score : 4 - 5 ) . after 4 weeks of rehabilitation treatment , evaluation of clinical scales ( fma , fac , k - mbi ) was carried out in all patients . cerebral tms was performed using a magstim 200 stimulator ( the magstim company limited , wales , uk ) with a 9 cm mean diameter circular coil , while patients remained comfortably seated . the resting motor threshold was defined ( according to the international standard ) as follows : the minimum stimulation strength required to produce an amplitude of 50 v or more for at least 5 out of 10 consecutive tms attempts . each site was stimulated 5 times at 10-second minimum intervals , from which the shortest latency and the largest peak - to - peak amplitudes were adopted . all imaging was performed on a 3.0 tesla magnetic resonance imaging system ( signa hdxt , ge medical systems , milwaukee , wisconsin , usa ) with a standard eight - channel phase array head coil . for each of the 15 noncollinear and noncoplanar diffusion - sensitizing gradients , approximately 70 contiguous slices , parallel to the anterior commissure - posterior commissure line , were acquired . imaging parameters were defined as follows : matrix=120120 matrix , field of view=240240 mm , te ( echo time)=84 ms , tr ( repetition time)=16,000 ms , b=800 mm s , and slice thickness=2 mm . in addition to dti , conventional t2 fluid - attenuated inversion recovery images were obtained . all dti images were corrected for eddy - current - induced image distortions using fsl software ( the image analysis group , fmrib , oxford , uk , http://www.fmrib.ox.ac.uk/fsl ) . dti analyses were performed by an experienced rehabilitation medicine doctor using dti studio software ( www.mristudio.org , johns hopkins medical institute , baltimore , md ) . all parameters were measured twice , and the results were averaged . to reconstruct the cst , the first region of interest was freehand - drawn in the upper pons , through which motor fibers descend , and the second region of interest was drawn in the basis pontis of the lower pons , using the and operation . tract fibers passing through both regions of interest were designated as final tracts of interest . patients were divided into four groups according to the presence of meps in affected tibialis anterior muscles and observed cst integrity , as measured by dti . groups were defined according to the following classifications : group 1 , dtt(+ ) and mep(+ ) ; group 2 , dtt(- ) and mep(+ ) ; group 3 , dtt(+ ) and mep(- ) ; group 4 , dtt(- ) and mep(- ) ( figure 1 ) . lesion volumes were calculated by adding the individual section lesion areas multiplied by section separation using the mricro software package . the kruskal - wallis test , a non - parametric signed rank test , was used to analyze motor impairment and functional status between groups . analysis of covariance was performed to determine the prognostic factor of ambulatory function after 4 weeks . the initial fma score was used as the covariate in order to adjust the motor impairment and initial lesion volume at the time of admission . patients with first stroke episodes who were admitted for rehabilitation to konkuk university medical center from november 2010 to december 2013 were recruited . tms and dti were performed at the same time , 3 - 8 weeks after stroke onset . the mean age of patients was 62.812.3 years , and the average time between stroke onset and combined tms and dti procedures was 38.815.8 days . patient exclusion criteria for this study included the following : ( 1 ) previous history of a stroke ; ( 2 ) inability to walk before stroke onset ; ( 3 ) medication use , such as sedatives , anticonvulsants , or muscle relaxants ; ( 4 ) a diagnosis of diabetes or other peripheral neuropathy ; ( 5 ) low - level consciousness ; ( 6 ) contraindication to magnetic resonance imaging ; or ( 7 ) refusal of dti . the fugl - meyer assessment ( fma ) , functional ambulation category ( fac ) , and korean modified barthel index ( k - mbi ) were used to assess motor function , walking ability , and functional status in all patients at the time of admission and after 4 weeks of rehabilitation . the fma is an index for evaluating motor function and is comprised of five domains : joint movement and pain , sensation , balance , upper limb motor function , and lower limb motor function . these five domains are further divided into subcategories , each of which is graded on a three - point scale : 0 , complete inability to perform the task ; 1 , partial ability to perform the task ; and 2 , perfect ability to complete the task . the fac is based on characterizing the level of assistance required during a 15 m walk . the six fac scores are as follows : 0 , the patient can not walk at all or requires physical assistance from two persons ; 1 , a need for continuous manual contact of one person to support body weight ; 2 , a need for intermittent light touch from one person to assist balance ; 3 , a need for verbal cuing or ambulation on level surfaces without manual contact ; 4 , independent on level surfaces ; 5 , can walk independently anywhere . we divided the patients into three groups according to the fac scores ; nonfunctional ambulation ( fac score : 0 ) , dependent ambulation ( fac score : 1 - 3 ) , independent ambulation ( fac score : 4 - 5 ) . after 4 weeks of rehabilitation treatment , evaluation of clinical scales ( fma , fac , k - mbi ) was carried out in all patients . cerebral tms was performed using a magstim 200 stimulator ( the magstim company limited , wales , uk ) with a 9 cm mean diameter circular coil , while patients remained comfortably seated . the resting motor threshold was defined ( according to the international standard ) as follows : the minimum stimulation strength required to produce an amplitude of 50 v or more for at least 5 out of 10 consecutive tms attempts . each site was stimulated 5 times at 10-second minimum intervals , from which the shortest latency and the largest peak - to - peak amplitudes were adopted . all imaging was performed on a 3.0 tesla magnetic resonance imaging system ( signa hdxt , ge medical systems , milwaukee , wisconsin , usa ) with a standard eight - channel phase array head coil . for each of the 15 noncollinear and noncoplanar diffusion - sensitizing gradients , approximately 70 contiguous slices , parallel to the anterior commissure - posterior commissure line , were acquired . imaging parameters were defined as follows : matrix=120120 matrix , field of view=240240 mm , te ( echo time)=84 ms , tr ( repetition time)=16,000 ms , b=800 mm s , and slice thickness=2 mm . in addition to dti , conventional t2 fluid - attenuated inversion recovery images were obtained . all dti images were corrected for eddy - current - induced image distortions using fsl software ( the image analysis group , fmrib , oxford , uk , http://www.fmrib.ox.ac.uk/fsl ) . dti analyses were performed by an experienced rehabilitation medicine doctor using dti studio software ( www.mristudio.org , johns hopkins medical institute , baltimore , md ) . all parameters were measured twice , and the results were averaged . to reconstruct the cst , the first region of interest was freehand - drawn in the upper pons , through which motor fibers descend , and the second region of interest was drawn in the basis pontis of the lower pons , using the and operation . tract fibers passing through both regions of interest were designated as final tracts of interest . patients were divided into four groups according to the presence of meps in affected tibialis anterior muscles and observed cst integrity , as measured by dti . groups were defined according to the following classifications : group 1 , dtt(+ ) and mep(+ ) ; group 2 , dtt(- ) and mep(+ ) ; group 3 , dtt(+ ) and mep(- ) ; group 4 , dtt(- ) and mep(- ) ( figure 1 ) . lesion volumes were calculated by adding the individual section lesion areas multiplied by section separation using the mricro software package . the kruskal - wallis test , a non - parametric signed rank test , was used to analyze motor impairment and functional status between groups . analysis of covariance was performed to determine the prognostic factor of ambulatory function after 4 weeks . the initial fma score was used as the covariate in order to adjust the motor impairment and initial lesion volume at the time of admission . data analyses were performed using spss version 17.0 software ( spss inc . , chicago , il , usa ) . forty - three patients ( 23 males and 20 females , with a mean age of 62.812.3 years ) were recruited , with 24 , 9 , 0 , and 10 patients in groups 1 , 2 , 3 , and 4 , respectively ( figure 1 ) . there were no differences in age , sex , lesion side , or number of days from onset between any of the groups . however , a higher hemorrhage rate and increase lesion volume were observed in group 4 ( table 1 ) . patients with the presence of both undisrupted csts and detectable meps ( group 1 ) showed higher fac , fma ( of lower extremities ) , and k - mbi scores than other groups at all time points ( p<0.05 , compared with all groups ) . among the patients with detected meps ( groups 1 and 2 ) , patients with preserved csts showed better motor function of paretic lower extremities and ambulatory function ( p<0.05 ; table 2 ) . there were significant differences in fac and k - mbi scores at the 4-week follow - up between groups after incorporating the adjusted lesion volume and initial fma score of lower extremities ( table 3 ) . in group 1 , dtt(+ ) and mep(+ ) , 16.66% of patients had a nonfunctional ambulation status at admission , and 45.83% of patients achieved independent ambulation at discharge . however , in group 4 , dtt(- ) and mep(- ) , 60% of patients had a nonfunctional ambulation status at admission , and no patients achieved independent ambulation at discharge ( table 4 ) . in the current study , we investigated whether tms and dtt measures of cst status during the subacute stage of mca stroke can predict lower extremity motor outcomes and ambulatory function at discharge . we found that outcomes for lower extremity and ambulatory function among patients exhibiting both meps and preserved csts were superior to the patients who did not exhibit preservation of adjusted lesion volume and initial motor impairment of lower extremities , even though all patients participated in a 4 week rehabilitation program . in the first 3 months after stroke , various degrees of motor recovery are observed , with the most significant recovery occurring within the first 4 weeks . the severity of muscle weakness at the time of stroke is considered a poor prognostic indicator compared to other factors , such as history of previous stroke , sphincter incontinence , cognitive function , or impaired functional status during hospitalization . it has been reported that good recovery rates were as rare as 15%-27% in patients with severe , post - stroke upper extremity paralysis [ 28 - 30 ] . the present study found that initial motor impairment influenced ambulation function 4 weeks after stroke , and that results from tms and dtt were useful in predicting ambulation recovery even after being adjusted for initial motor impairment . clinicians use various assessment tools to evaluate brain damage in patients with stroke , including clinical rating scales , diagnostic radiology , or neurophysiological tests . in general , clinical rating scales for stroke are divided into two assessment methods : evaluation of brain damage in patients with acute stroke , and measurement of brain damage induced motor impairment in patients with subacute stroke . there are several diagnostic radiology methods used to assess brain damage , these include : ( 1 ) computed tomography or magnetic resonance imaging to detect the location and size of the lesion , ( 2 ) single - photon emission computed tomography or positron emission tomography scans to evaluate brain metabolism , ( 3 ) dti to evaluate white matter tract integrity [ 10 - 12 ] , and ( 4 ) measuring meps to monitor changes in motor system function . meps induced by tms of the motor cortex is a widely used method to investigate central nervous system disorders . the absence of low amplitude meps in patients with stroke suggests loss of motor neurons or axons . thus , this method is used to predict patient prognosis in the early post - stroke period . several studies have focused on using tms to predict prognosis of motor recovery . among patients with acute ischemic stroke , those with measurable meps showed better motor and functional recovery than those without meps . moreover , among the patients with measurable meps , those who had delayed central conduction time showed poor recovery . thus , measurement of meps could be an early prognostic indicator to evaluate motor function and functional recovery . furthermore , it was reported that mep measurement was also useful in predicting prognoses during various follow - up periods between 1 and 6 months post - stroke . dtt is a radiological analysis used to evaluate cst integrity and tms efficacy . in various studies evaluating prognosis of stroke recovery using dtt , upper extremity functional outcomes can be predicted through differentiation of distinct cst integrity types among patients with lacunar infarction and thalamic hemorrhage . when we compared post - stroke walking impairment to cst integrity , patients with relatively greater ipsilateral connectivity between the contralesional motor cortex and paretic lower limb were more behaviorally impaired , and more structural damage was present in the ipsilesional hemisphere cst . recently , many studies have attempted to understand the correlation between different rating scales and how to more accurately predict prognoses after stroke [ 38 - 40 ] . in a cst - analysis study using tms and dtt , kwon et al . measured affected - side , upper extremity meps ; using this method , tms showed higher positive predictability , whereas dtt showed higher negative predictability for determining upper extremity motor outcomes in patients with corona radiata infarction . previous studies have reported recovery outcomes for both upper extremity and ambulatory function based on upper extremity mep measurements and cst integrity evaluated by dtt ; however , in these studies , lower extremity , rather than upper extremity , meps were used to evaluate ambulatory function . researchers have hypothesized that the predictive power of lower extremity evaluations would be higher than that of upper extremities . thus , in the present study , we evaluated the correlation between meps and cst integrity , as well as that of lower extremity and ambulatory function . we found that the prognosis of both lower extremity and ambulatory function among patients with detectable lower extremity meps was superior to that of patients without detectable meps . moreover , prognosis of patients presenting with both meps and preserved csts was superior to that of patients presenting with only meps and impaired csts . however , this study has several limitations , which stem mostly from its small sample size , making it difficult to predict overall outcome in stroke patients . moreover , there is a limitation in predicting ambulatory function at a particular time point due to the inconsistency in timing of tms and dtt , ranging from 3 - 8 weeks after stroke onset . in the future , we plan to replicate this study with a larger sample size and a longer follow - up period in a more controlled study design . among the methods used in this study , dtt was highly useful in predicting detailed prognoses among stroke patients with detectable meps . tms was also useful in predicting detailed prognoses among stroke patients with completely disrupted csts . in conclusion , the combined evaluation of cst integrity by tms and dtt offers an advantage in predicting motor and ambulation recovery in patients with mca stroke .

background and purposewe aimed to investigate the usefulness of combining transcranial magnetic stimulation ( tms ) and diffusion tensor tractography ( dtt ) to evaluate corticospinal tract ( cst ) integrity and subsequently predict ambulatory function after middle cerebral artery ( mca ) stroke.methodsforty-three patients with first mca stroke underwent tms and dtt to evaluate cst integrity . patients were classified into four groups according to the presence of motor - evoked potentials ( meps ) obtained from the tibialis anterior muscle and cst integrity . motor impairment and functional status were assessed using the fugl - meyer assessment , functional ambulation category , and korean modified barthel index , both at the time of admission and after 4 weeks of rehabilitation.resultspatients with the presence of both measurable meps and a preserved cst showed better motor recovery and ambulatory function than other groups at the 4-week follow - up . intact csts were not visualized in patients without detectable meps . among the patients displaying meps , those with preserved csts showed better recovery of paretic lower extremities.conclusionscombined assessment using tms and dtt to evaluate cst integrity confers advantages in predicting motor and ambulation recovery in patients with mca stroke .

Introduction Methods Subjects Transcranial magnetic stimulation DTI data acquisition and analysis Statistical analysis Results Discussion Conclusions

intrathecal ( it ) antibiotics have been increasingly utilized for neurosurgical patients with ventriculitis and meningitis . the indication for such use of antibiotics often occurs in the setting of inability to sterilize cerebrospinal fluid ( csf ) despite treatment with systemic therapy . the efficacy and safety of such antibiotic administration have been well described over the years , especially in the cases of vancomycin and gentamicin.1 however , the use and safety profile of newer generation antibiotics via an it route remains relatively uncertain . here , we present a case of a 32-year - old female patient with enterococcus faecalis ventriculitis who was successfully treated with it linezolid in addition to systemic antibiotic therapy . in august 2014 , a 31-year - old female patient was originally diagnosed with glioblastoma and subsequently underwent surgical resection via a left frontal craniotomy . the initial antibiotic regimen included vancomycin for which the patient developed a severe allergic reaction . during this time period , the patient underwent multiple wound washouts and revisions though she repeatedly presented back to the hospital with fever and drainage from her cranial incision . eventually , after developing hydrocephalus , the patient had an external ventricular drain ( evd ) placed in april 2015 . shortly thereafter , she was started on therapy with intravenous aztreonam for csf cultures growing klebsiella pneumoniae . repeat cultures additionally grew candida albicans for which intravenous voriconazole was added to the antimicrobial regimen . despite this , the patient continued to have surgical site drainage and intermittent fevers . weeks later , further repeat cultures grew extended spectrum -lactamase producing klebsiella and nonvancomycin - resistant e. faecalis as aztreonam was switched to imipenem for appropriate coverage based on sensitivity profiles of the above microbes . again , despite the above therapy , the patient continued to experience marked confusion with fevers and purulent drainage from the surgical site . in addition , the hospital was experiencing a shortage in imipenem for which the patient was transitioned to meropenem . of note , oral linezolid 600 mg twice daily was also added to the regimen to provide further coverage for the e. faecalis considering the lower efficacy of meropenem ( vs. imipenem ) and the patient 's history of severe allergic reaction to vancomycin and cephalosporins . over the next week , the patient had minimal clinical change as csf cultures drawn every 48 hours failed to show clearance of the e. faecalis , despite ventricular catheter exchange . considering the persistence of infection , the decision to add it linezolid was made given that sensitivities demonstrated antibiotic resistance to gentamycin . it linezolid was thus started and administered via the evd at 10 mg daily at a concentration of 2 mg / ml . after 6 days of adding it linezolid , the patient showed sterilization of her csf . from a clinical perspective , 10 days into her course of it linezolid , the patient began to regain some physical and mental function , prompting removal of the evd and ventriculoperitoneal shunt placement . at this time , the it linezolid was discontinued ( after receiving 15 days of total it therapy ) though the systemic antibiotics remained . postoperatively , the patient continued to show stability and improvement , and she was discharged to a rehabilitation facility without complication . the patient remained stable and was doing well until 3 months later when she returned to the hospital with worsening confusion and recurrent tonic clonic seizures . workup at that time revealed intracranial hemorrhage associated with significant recurrent tumor burden and midline shift . considering the degree of the patient 's symptoms and overall poor prognosis , the patient was made comfort care at that time and discharged home under the guidance of hospice . it antibiotics have increasingly been shown to be an effective and safe method of drug delivery in neurosurgical cases , especially in those involving antibiotics that do not achieve good central nervous system penetration and in cases wherein csf sterilization proves to be difficult . our case here presents the use of it linezolid , which has not been previously well described . linezolid is often considered as a therapeutic option in cases of methicillin - resistant staphylococcus aureus and vancomycin - resistant e. faecalis ( vre ) , where other antibiotics may not be tolerated based on side - effect profiles . situations of vre meningitis have previously been described in multiple case reports and include treatment via both systemic options ( primarily with linezolid or daptomycin ) and it options ( quinupristin - dalfopristin , chloramphenicol , daptomycin).2 3 4 despite this , there is a paucity of data regarding the use of it linezolid . earlier reports of central nervous system ( cns ) penetrance of linezolid are widely variable , ranging from 28 to 70%.5 6 a better understanding of the drug 's action in the cns following systemic administration is necessary to elucidate benefits of administering the drug it . as presented in our case , a patient with multiple antibiotic allergies and an evd - related e. faecalis csf infection that does not clear with prolonged use of systemic linezolid ( 8 days ) , demonstrating antibiotic resistance to gentamycin , and despite ventricular catheter exchange ( excluding the possibility of bacterial colonization ) , may serve as a good candidate for the use of it linezolid . here , the use of it linezolid did show rapid clearance of e. faecalis and sterilization of the csf within 6 days of initiation . from a clinical perspective , there were no immediately apparent adverse reactions to the it linezolid , as the patient was believed to have cleared her infection . however , considering the patient 's intracranial bleed associated with tumor progression / recurrence and death 3 months later ; it is difficult to fully evaluate the true impact and efficacy of this treatment . despite this difficult outcome , we hope this case presents an example of the use of it linezolid and how it may be dosed and serve as a mechanism for csf sterilization in difficult neurosurgical infections in the future .

background the use of intrathecal antibiotic therapy for the treatment of ventriculitis and/or meningitis has demonstrated efficacy especially when sterilization of the cerebrospinal fluid is not possible with intravenous antibiotics alone . case description we describe the successful treatment of enterococcus faecalis ventriculitis utilizing intrathecal linezolid in a 32-year - old female patient with severe allergy to vancomycin , prohibitive bacterial susceptibilities , and failure of previous attempts to sterilize the cerebrospinal fluid despite multimodal treatment . conclusion intrathecal linezolid is a useful treatment in the setting of multidrug - resistant bacterial ventriculitis . we present a useful dosing regimen for the administration of intrathecal linezolid .

Introduction Case Report Discussion

a woman 's preconception and pregnancy experience with the two most prevalent diseases of the mouth periodontal disease and dental caries not only influences her own oral health status but also may increase her risk of other diseases such as atherosclerosis [ 14 ] , rheumatoid arthritis , and diabetes , impact pregnancy outcome [ 79 ] , and her offspring 's risk of developing early and severe dental caries [ 1013 ] . although largely preventable through evidence - based interventions , both periodontal disease and caries in women of childbearing age are highly prevalent , particularly among low - income women and members of racial and ethnic minority groups . in addition , both periodontal disease and caries are typically asymptomatic for long periods of time with only intermittent painful exacerbations . the combination of high prevalence , insufficient treatment rates , missed preventive opportunities , and intermittent symptoms led the us surgeon general to publish a report in 2001 on oral health in america characterizing dental and oral disease as a silent epidemic . socioeconomic factors , lack of resources to pay for care , barriers to access to care , and lack of public understanding of the importance of oral health and effective self - care practices all represent underlying reasons cited for observed inadequacies in oral health . periodontal disease is a destructive inflammatory condition of the gingiva and bone that supports teeth . it is most commonly associated with a gram - negative anaerobic infection of these structures . fluid that bathes the tooth at the gingival margin , known as gingival crevicular fluid , often contains inflammatory mediators and oral pathogens associated with periodontal disease . the mechanisms underlying this destructive process involve both direct tissue damage resulting from plaque bacterial products , and indirect damage through bacterial induction of the host inflammatory and immune responses . destructive periodontal disease affects up to 15% of the population of childbearing age , with a relatively high proportion of pregnant women demonstrating some degree of periodontal disease [ 7 , 8 , 16 ] . advancing age , smoking , and diabetes are risk factors for the development of periodontal disease . whereas periodontal disease is a chronic , local oral infection , systemic inflammation may also occur . the second oral disease important to women of childbearing age because of its maternal - child health associations is dental caries . dental caries is the pathologic process by which teeth decay and develop cavities . it occurs when acid is produced at the tooth surface by cariogenic bacteria in the dental plaque that metabolize dietary carbohydrates . acquisition of these cariogenic bacteria , dietary practices that govern the caries process , use of fluorides that dampen the caries process , and utilization of dental care all link mothers and children 's experience with tooth decay through biological , behavioral , and social pathways . preterm birth , delivery at less than 37 weeks gestation , occurs in approximately 12% of all births [ 18 , 19 ] . prematurity is the leading cause of neonatal morbidity and mortality in non - anomalous infants . there are numerous and heterogeneous factors associated with preterm birth , such as low maternal body mass index , maternal smoking , and maternal infections . in 1996 , offenbacher and colleagues first reported a potential association between maternal periodontal disease and delivery of a preterm / low birthweight infant . in a case - control study of 124 pregnant women , they observed that women who delivered at less than 37 weeks gestation or an infant the adjusted odds ratio for delivery of a preterm , low birth weight infant was 7 ; these data led the authors to conclude that periodontal disease may represent a previously unrecognized and clinically significant risk factor for delivery of a preterm low birth weight infant . extrapolation from these data suggested that 18% of the preterm , low birth weight infants born annually might be attributable to periodontal disease , and thus account for a significant proportion of the $ 5.5 billion annual hospital costs associated with the care of preterm / low birthweight infants . in a subsequent case - control study , dasanayake et al . women in both of these case - control studies were examined at the end of pregnancy or after delivery , which does not convincingly prove an antecedent exposure and thus causality . despite this limitation , these early studies led to the hypothesis that periodontopathic bacteria , primarily gram - negative anaerobes , may serve as a source for endotoxin and lipopolysaccharides , which then increases local inflammatory mediators including pge2 , and cytokines , and that this increases systemic inflammatory mediators that can then lead to preterm birth . examined the relationship between maternal periodontal disease and spontaneous preterm birth among 1313 pregnant women , and found that moderate / severe maternal periodontal disease identified early in pregnancy was associated with an increased risk for spontaneous preterm birth , independent of other traditional risk factors . despite these compelling data , it is important to recognize that other studies have failed to demonstrate any association between maternal periodontal disease and preterm birth . in a case control study conducted in london , examined 236 infants born at < 37 weeks gestation or < 2500 g and compared them to a random sample of 507 control infants born at 38 weeks gestation and weighing 2500 g. the authors found no evidence for an association between delivery of a preterm , low birth weight infant and periodontal disease and somewhat surprisingly , found that deeper mean tooth pocket depths at delivery was associated with a reduction in the risk of delivery of a preterm , low birth weight infant . the authors surmised that these discrepant findings might be due at least in part to racial differences in study populations . in a follow - up longitudinal study of 3738 women , moore et al however , there was an increase in second trimester fetal loss rates among women with periodontal disease . in an effort to better understand the possible mechanism behind the association between periodontal disease and preterm delivery , offenbacher and colleagues measured gingival crevicular levels of pge2 and il-1 in 48 mothers who delivered preterm , low birth weight infants compared to control women and discovered that gingival crevicular fluid levels of pge2 were significantly higher in case compared to control women . furthermore , among the primiparous women delivering preterm , low birth weight infants , a significant inverse association was demonstrated between birthweight and gestational age and gingival crevicular pge2 levels . it is not yet clear whether the relationship between periodontal disease and adverse pregnancy outcomes is causal or is a surrogate for another maternal factor . as further evidence to support the concept that maternal oral health is important for normal pregnancy outcome , other investigators have examined the effect of antepartum treatment of periodontal disease on preterm birth risk . three published studies of antepartum versus delayed ( postpartum ) treatment of maternal periodontal disease demonstrate promise for this intervention for preterm birth prevention . the effect of periodontal interventions on pregnancy outcome was assessed in a prospective study designed to examine the relationship between periodontal disease and preterm low birthweight infants in a cohort of young , minority , pregnant and postpartum women . of 164 women for whom birth outcome data were available , 74 were subjected to oral prophylaxis during pregnancy , and 90 received no periodontal treatment . the preterm / low birthweight rate was lower among women who received periodontal treatment compared to those who did not ( 13.5% vs. 18.9% ) . conducted a randomized clinical trial to assess the impact of periodontal treatment initiated during pregnancy versus delayed until postpartum on preterm low birthweight infant rates . the incidence of preterm / low birthweight infants in the antepartum treatment group was 1.8% ( 3/163 ) and in the delayed / postpartum group was 10.1% ( 19/188 ) , ( odds ratio [ or ] 5.5 , 95% confidence interval [ ci ] 1.718.2 , p=0.001 ) . multivariable logistic regression analysis showed that periodontal disease was the strongest factor related to delivery of a preterm / low birthweight infant ( or 4.7 , 95% ci 1.317.1 ) . the data from these two studies suggest that treatment of periodontal disease during pregnancy could reduce preterm / low birthweight infant rates [ 26 , 27 ] . in a pilot intervention trial designed to assess the feasibility of conducting a trial to determine whether treatment of periodontal disease reduces the risk of spontaneous preterm birth , jeffcoat et al . found that among women at high risk for preterm birth and presence of periodontal disease , scaling and root planning therapy initiated during pregnancy is tolerated by pregnant women and may reduce spontaneous preterm birth preeclampsia is a hypertensive disorder of pregnancy responsible for significant , maternal and fetal morbidity and mortality . some investigators have hypothesized a potential role for maternal periodontal disease as a risk factor for preeclampsia . in a retrospective analysis of data collected as part of the oral conditions and pregnancy study , boggess et al . reported that women were at higher risk for preeclampsia if they had severe periodontal disease at delivery ( adjusted odds ratio 2.4 , 95% confidence interval 1.1 , 5.3 ) , or if they had periodontal disease progression during pregnancy ( adjusted odds ratio 2.1 , 95% confidence interval 1.0 , 4.4 ) . in a case - control study , canakci et al . found that pre - eclamptic patients were 3.5 ( 95% ci=1.111.9 ) times more likely to have periodontal disease than normotensive patients [ p < 0.01 ) . in a study of 30 pregnant women , significantly higher periodontal probing depth and clinical attachment level scores gingival crevicular fluid levels of pge2 , tnf- , and il-1 levels were all significantly higher in the preeclamptic group . further study on the maternal and fetal inflammatory responses to chronic oral infection and on placental pathology in women with periodontal disease is needed to determine whether the relationship between periodontal disease and preeclampsia is causal or simply associative . if the relationship between maternal periodontal disease and preeclampsia risk proves causal in nature , then prevention of periodontal disease before pregnancy or treatment of periodontal disease during pregnancy may represent a novel approachs to the prevention of preeclampsia . preterm birth , delivery at less than 37 weeks gestation , occurs in approximately 12% of all births [ 18 , 19 ] . prematurity is the leading cause of neonatal morbidity and mortality in non - anomalous infants . there are numerous and heterogeneous factors associated with preterm birth , such as low maternal body mass index , maternal smoking , and maternal infections . in 1996 , offenbacher and colleagues first reported a potential association between maternal periodontal disease and delivery of a preterm / low birthweight infant . in a case - control study of 124 pregnant women , they observed that women who delivered at less than 37 weeks gestation or an infant the adjusted odds ratio for delivery of a preterm , low birth weight infant was 7 ; these data led the authors to conclude that periodontal disease may represent a previously unrecognized and clinically significant risk factor for delivery of a preterm low birth weight infant . extrapolation from these data suggested that 18% of the preterm , low birth weight infants born annually might be attributable to periodontal disease , and thus account for a significant proportion of the $ 5.5 billion annual hospital costs associated with the care of preterm / low birthweight infants . in a subsequent case - control study , dasanayake et al . women in both of these case - control studies were examined at the end of pregnancy or after delivery , which does not convincingly prove an antecedent exposure and thus causality . despite this limitation , these early studies led to the hypothesis that periodontopathic bacteria , primarily gram - negative anaerobes , may serve as a source for endotoxin and lipopolysaccharides , which then increases local inflammatory mediators including pge2 , and cytokines , and that this increases systemic inflammatory mediators that can then lead to preterm birth . examined the relationship between maternal periodontal disease and spontaneous preterm birth among 1313 pregnant women , and found that moderate / severe maternal periodontal disease identified early in pregnancy was associated with an increased risk for spontaneous preterm birth , independent of other traditional risk factors . despite these compelling data , it is important to recognize that other studies have failed to demonstrate any association between maternal periodontal disease and preterm birth . in a case control study conducted in london , examined 236 infants born at < 37 weeks gestation or < 2500 g and compared them to a random sample of 507 control infants born at 38 weeks gestation and weighing 2500 g. the authors found no evidence for an association between delivery of a preterm , low birth weight infant and periodontal disease and somewhat surprisingly , found that deeper mean tooth pocket depths at delivery was associated with a reduction in the risk of delivery of a preterm , low birth weight infant . the authors surmised that these discrepant findings might be due at least in part to racial differences in study populations . in a follow - up longitudinal study of 3738 women , moore et al however , there was an increase in second trimester fetal loss rates among women with periodontal disease . in an effort to better understand the possible mechanism behind the association between periodontal disease and preterm delivery , offenbacher and colleagues measured gingival crevicular levels of pge2 and il-1 in 48 mothers who delivered preterm , low birth weight infants compared to control women and discovered that gingival crevicular fluid levels of pge2 were significantly higher in case compared to control women . furthermore , among the primiparous women delivering preterm , low birth weight infants , a significant inverse association was demonstrated between birthweight and gestational age and gingival crevicular pge2 levels . it is not yet clear whether the relationship between periodontal disease and adverse pregnancy outcomes is causal or is a surrogate for another maternal factor . as further evidence to support the concept that maternal oral health is important for normal pregnancy outcome , other investigators have examined the effect of antepartum treatment of periodontal disease on preterm birth risk . three published studies of antepartum versus delayed ( postpartum ) treatment of maternal periodontal disease demonstrate promise for this intervention for preterm birth prevention . the effect of periodontal interventions on pregnancy outcome was assessed in a prospective study designed to examine the relationship between periodontal disease and preterm low birthweight infants in a cohort of young , minority , pregnant and postpartum women . of 164 women for whom birth outcome data were available , 74 were subjected to oral prophylaxis during pregnancy , and 90 received no periodontal treatment . the preterm / low birthweight rate was lower among women who received periodontal treatment compared to those who did not ( 13.5% vs. 18.9% ) . conducted a randomized clinical trial to assess the impact of periodontal treatment initiated during pregnancy versus delayed until postpartum on preterm low birthweight infant rates . the incidence of preterm / low birthweight infants in the antepartum treatment group was 1.8% ( 3/163 ) and in the delayed / postpartum group was 10.1% ( 19/188 ) , ( odds ratio [ or ] 5.5 , 95% confidence interval [ ci ] 1.718.2 , p=0.001 ) . multivariable logistic regression analysis showed that periodontal disease was the strongest factor related to delivery of a preterm / low birthweight infant ( or 4.7 , 95% ci 1.317.1 ) . the data from these two studies suggest that treatment of periodontal disease during pregnancy could reduce preterm / low birthweight infant rates [ 26 , 27 ] . in a pilot intervention trial designed to assess the feasibility of conducting a trial to determine whether treatment of periodontal disease reduces the risk of spontaneous preterm birth , jeffcoat et al . found that among women at high risk for preterm birth and presence of periodontal disease , scaling and root planning therapy initiated during pregnancy is tolerated by pregnant women and may reduce spontaneous preterm birth preeclampsia is a hypertensive disorder of pregnancy responsible for significant , maternal and fetal morbidity and mortality . some investigators have hypothesized a potential role for maternal periodontal disease as a risk factor for preeclampsia . in a retrospective analysis of data collected as part of the oral conditions and pregnancy study , boggess et al . reported that women were at higher risk for preeclampsia if they had severe periodontal disease at delivery ( adjusted odds ratio 2.4 , 95% confidence interval 1.1 , 5.3 ) , or if they had periodontal disease progression during pregnancy ( adjusted odds ratio 2.1 , 95% confidence interval 1.0 , 4.4 ) . in a case - control study , found that pre - eclamptic patients were 3.5 ( 95% ci=1.111.9 ) times more likely to have periodontal disease than normotensive patients [ p < 0.01 ) . in a study of 30 pregnant women , significantly higher periodontal probing depth and clinical attachment level scores were found among preeclamptic women compared with non - preeclamptic women . were all significantly higher in the preeclamptic group . further study on the maternal and fetal inflammatory responses to chronic oral infection and on placental pathology in women with periodontal disease is needed to determine whether the relationship between periodontal disease and preeclampsia is causal or simply associative . if the relationship between maternal periodontal disease and preeclampsia risk proves causal in nature , then prevention of periodontal disease before pregnancy or treatment of periodontal disease during pregnancy may represent a novel approachs to the prevention of preeclampsia . cariogenic bacteria are typically acquired by young children through direct salivary transmission from their mothers . factors influencing transmission are the levels of these bacteria in maternal salivary reservoirs , frequency and efficiency of transmission , and the child 's receptivity to implantation , which is largely diet dependent . additional factors include timing of transmission , which is affected by the window of infectivity and the age of the child , and the composition and flow of the child 's saliva . the earlier the transmission and the more caries - supportive the diet , the earlier and more substantial the transfer will be . for this reason , mothers who have themselves experienced extensive tooth decay and therefore most likely harbor high titers of mutans streptococci in their saliva will more effectively transmit this infection vertically , thereby putting their young children at elevated risk for early childhood caries . although maternal cariogenic bacteria can be isolated in the pre - dentate infant 's mouth , these organisms become established in the dental plaque on the tooth surface only after teeth first appear at around six months of age . because oral flora tends to remain stable over time , a woman 's cariogenic flora before and during pregnancy anticipates her flora during the child 's first years of life as well as the likelihood of transmitting infection early to her offspring . the lag time between infection and expression of a discernable cavity in a tooth depends upon additional factors , including the frequency of simple carbohydrate exposure in a child 's diet , oral hygiene , and exposure to fluorides . the evidence that caries is frequently established as a pathologic process in the mouths of very young children is strong , as 28% of us children , over 4 million toddlers and preschoolers , experience one or more frank cavities by ages 25 years . given the biological and behavioral pathways that govern intergenerational transmission of caries activity , disease management , and use of dental care , it is not surprising that disparities in dental caries among adults are mimicked among their children . as with adults , children of color and children of low - income families experience substantially more extensive and severe disease and less treatment than their peers without these risk factors . fortunately , despite the high prevalence of caries in women and children , this disease is readily preventable or manageable though early and regular dental care , exposure to fluoridated water , use of appropriate topical fluorides including those in toothpastes , application of sealants to primary teeth , and adoption of a health - promoting diet like that suggested in the dietary guidelines for americans . it is intriguing to consider preconception , pregnancy , or intrapartum treatment of oral health conditions as a mechanism to improve women 's oral and general health , pregnancy outcomes , and their children 's dental health . evidence is currently weakest for interventions that seek to reduce the incidence of preterm low birth weight through oral care . the mechanism of periodontal disease - associated adverse pregnancy outcomes is as yet unclear , and althoughit is hypothesized that if the insult occurs early ( either at conception or implantation ) the risk is greater , no direct evidence to confirms that this is the case . however , given the strong relationship between oral health conditions and periodontal disease and general health and well - being , oral health care should be a goal in its own right for all individuals . if treatment of periodontal disease is going to impact pregnancy outcomes , then it is likely that the therapy will be of greatest benefit before or in very early pregnancy . the science supporting interventions before , during , and after pregnancy to reduce caries transmission is much stronger . educational and behavioral interventions that reduce caries activity through appropriate use of fluorides , dietary guidelines , chlorhexidine gels and varnishes , and xylitol , can reduce a woman 's caries activity and salivary cariogenic flora , thereby improving her own oral health and , at the same time , also reducing the risk of transmission to her offspring . in two landmark swedish studies [ 12 , 13 ] , children of mothers who had their cariogenic oral flora suppressed were less likely to experience cavities , more likely to develop cavities later if they were affected , and had fewer cavities than children of control mothers . pregnancy is itself often regarded as an opportune time for anticipatory guidance and oral health education , and is a suitable time , particularly during the second trimester , for dental repair . the cdc 's pregnancy risk assessment monitoring system ( prams ) reported that only 2343% of pregnant women received dental care during their pregnancies [ 36 , 37]a rate only half to two - thirds of us women 's overall use of dental services ( 67% ) ( 14 ) . the prams data revealed that overall , pregnant women covered by medicaid were 24%53% less likely to obtain a dental visit during pregnancy than women who are privately insured . similarly , women who initiated prenatal care later than the first trimester , who did not intend the pregnancy , and who were poor were also less likely to obtain care . in contrast , the behavioral risk factor surveillance system ( brfss ) revealed that 70% of pregnant women in the years 1999 and 2002 had received a dental visit in the prior 12 months . one possible explanation for the higher level reported by brfss is that it includes three or more months of pre - pregnancy time , during which dental care utilization would be expected to reflect the national norm for women . however , in contrast to recognized disparities in dental care utilization , race and ethnicity were not significantly associated with dental care during pregnancy in the brfss study . the authors suggest that , the prevalence of dental visits probably reflects factors such as prevailing attitudes toward dental care , provider availability and practice norms , and salient features of medical and dental care delivery within the state . overall , women covered by medicaid were 24%53% less likely to obtain a dental visit during pregnancy than women who are privately insured . similarly , women who initiated prenatal care later than the first trimester , who did not intend the pregnancy , and who were poor were also less likely to obtain care . an important additional consideration is that dentists are reportedly reluctant to provide care to pregnant women because of concern about possible risks . current practice typically limits non - urgent dental treatment of pregnant women to the second trimester , as there is concern about possible teratogenic consequences during the first trimester and about the woman 's comfort in the dental chair during the third trimester . a single study relating antepartum dental radiography with full term low birth weight raised concern about the safety of dental care during pregnancy , but was criticized for its methodology . neither professional associations nor government agencies have promulgated any authoritative guidance regarding dental care of pregnant women , although multi - center nih clinical trials are underway that will determine the impact of dental care for periodontal disease during pregnancy on preterm low birth weight outcomes . guidelines for prenatal care , oral health , and child health professionals that promotes routine use of dental care during pregnancy . independent of pregnancy , the presence and source of dental insurance coverage is an important predictor of dental care utilization with publicly insured adults experiencing higher levels of oral diseases but less access to dental care . medicaid is particularly significant to dental care of pregnant women as this program covers approximately 1/3rd of births in the us . however , states vary widely in adult medicaid dental coverage , and at present only 7 jurisdictions providing comprehensive care to eligible adults . in contrast , low income pregnant women seeking dental services find themselves with no coverage in 8 states , coverage for only relief of pain or infection in 18 states or eligible for a limited range of services in 18 states . three states ( ut , la , ca ) have recently expanded dental benefits specifically to pregnant women in anticipation of reduced rates of unfavorable pregnancy outcomes . pregnancy may be the only time that some low - income woman can readily obtain dental care as some state medicaid programs provide adult dental coverage only to pregnant women or enhanced coverage during pregnancy . the cdc 's pregnancy risk assessment monitoring system ( prams ) reported that only 2343% of pregnant women received dental care during their pregnancies [ 36 , 37]a rate only half to two - thirds of us women 's overall use of dental services ( 67% ) ( 14 ) . the prams data revealed that overall , pregnant women covered by medicaid were 24%53% less likely to obtain a dental visit during pregnancy than women who are privately insured . similarly , women who initiated prenatal care later than the first trimester , who did not intend the pregnancy , and who were poor were also less likely to obtain care . in contrast , the behavioral risk factor surveillance system ( brfss ) revealed that 70% of pregnant women in the years 1999 and 2002 had received a dental visit in the prior 12 months . one possible explanation for the higher level reported by brfss is that it includes three or more months of pre - pregnancy time , during which dental care utilization would be expected to reflect the national norm for women . however , in contrast to recognized disparities in dental care utilization , race and ethnicity were not significantly associated with dental care during pregnancy in the brfss study . the authors suggest that , the prevalence of dental visits probably reflects factors such as prevailing attitudes toward dental care , provider availability and practice norms , and salient features of medical and dental care delivery within the state . overall , women covered by medicaid were 24%53% less likely to obtain a dental visit during pregnancy than women who are privately insured . similarly , women who initiated prenatal care later than the first trimester , who did not intend the pregnancy , and who were poor were also less likely to obtain care . an important additional consideration is that dentists are reportedly reluctant to provide care to pregnant women because of concern about possible risks . current practice typically limits non - urgent dental treatment of pregnant women to the second trimester , as there is concern about possible teratogenic consequences during the first trimester and about the woman 's comfort in the dental chair during the third trimester . a single study relating antepartum dental radiography with full term low birth weight raised concern about the safety of dental care during pregnancy , but was criticized for its methodology . neither professional associations nor government agencies have promulgated any authoritative guidance regarding dental care of pregnant women , although multi - center nih clinical trials are underway that will determine the impact of dental care for periodontal disease during pregnancy on preterm low birth weight outcomes . guidelines for prenatal care , oral health , and child health professionals that promotes routine use of dental care during pregnancy . independent of pregnancy , the presence and source of dental insurance coverage is an important predictor of dental care utilization with publicly insured adults experiencing higher levels of oral diseases but less access to dental care . medicaid is particularly significant to dental care of pregnant women as this program covers approximately 1/3rd of births in the us . however , states vary widely in adult medicaid dental coverage , and at present only 7 jurisdictions providing comprehensive care to eligible adults . in contrast , low income pregnant women seeking dental services find themselves with no coverage in 8 states , coverage for only relief of pain or infection in 18 states or eligible for a limited range of services in 18 states . three states ( ut , la , ca ) have recently expanded dental benefits specifically to pregnant women in anticipation of reduced rates of unfavorable pregnancy outcomes . pregnancy may be the only time that some low - income woman can readily obtain dental care as some state medicaid programs provide adult dental coverage only to pregnant women or enhanced coverage during pregnancy . data are emerging to support a role for maternal periodontal disease as an infectious risk factor for preterm birth and other adverse outcomes of pregnancy . the prevalence of periodontal disease and the possibility of preterm birth prevention by treatment of oral infection make this a novel approach to improve the health and well being of our mothers and their soon - to - be born children . further studies to better understand the mechanism of periodontal disease - associated preterm birth will enable us to tailor treatment to those women who might benefit the most . data on the relationship between maternal and child experience with dental caries is well established . therefore , regardless of the potential for improved oral health to improve pregnancy outcomes , public policies that support comprehensive dental services for vulnerable women of childbearing age should be expanded , so not only their own oral and general health is safeguarded but also so that their children 's risk of caries is reduced . particularly if nih trials confirm that treating pregnant women for periodontal disease reduces the incidence of unfavorable birth outcomes , the centers for medicare and medicaid services should build on its september 2004 coverage expansions for pregnant women by stimulating the states to similarly expand oral health services for pregnant women . the power of prevention needs to be brought to bear , as both periodontal disease and caries are overwhelmingly preventable through well recognized strategies including regular and effective home care for periodontal disease and use of fluorides and sealants for caries . to the degree teachable moment in self - care and future child - care , prenatal education should universally adopt an oral health component . this educational intervention should prioritize those mothers who have suffered significantly from dental caries so that they can learn to effectively prevent transfer of this disease to their children . to be effective , oral health promotion must first seek to educate women and their health care providers about the importance of oral health and must promote an understanding of their ability to prevent and manage both periodontal disease and caries and to thereby limit the personal and intergenerational consequences of both conditions .

the mouth is an obvious portal of entry to the body , and oral health reflects and influences general health and well being . maternal oral health has significant implications for birth outcomes and infant oral health . maternal periodontal disease , that is , a chronic infection of the gingiva and supporting tooth structures , has been associated with preterm birth , development of preeclampsia , and delivery of a small - for - gestational age infant . maternal oral flora is transmitted to the newborn infant , and increased cariogenic flora in the mother predisposes the infant to the development of caries . it is intriguing to consider preconception , pregnancy , or intrapartum treatment of oral health conditions as a mechanism to improve women 's oral and general health , pregnancy outcomes , and their children 's dental health . however , given the relationship between oral health and general health , oral health care should be a goal in its own right for all individuals . regardless of the potential for improved oral health to improve pregnancy outcomes , public policies that support comprehensive dental services for vulnerable women of childbearing age should be expanded so that their own oral and general health is safeguarded and their children 's risk of caries is reduced . oral health promotion should include education of women and their health care providers ways to prevent oral disease from occurring , and referral for dental services when disease is present .

Introduction Is maternal oral health linked to pregnancy outcome? Preterm birth Other adverse pregnancy outcomes Is maternal oral health linked to children's experience with tooth decay? Is preconception preventive oral health care the answer? Access to oral health care during pregnancy Conclusions and future directions

the ability to concentrate or extract micro / nanoparticles , such as cells , viruses , bacteria , and dna , from the background matrix is essential to many biomedical applications . the form of these particles in high concentration facilitates the subsequent analytical and processing steps . for example , current methods in microbial analysis of water quality require subpopulations ( e.g.e . coli ) sampled in detectable levels of concentration . in the process of gene hybridization , rates can be accelerated by concentration of single - stranded dna . the sensitivity of fluorescence - based bioassays is greatly improved with pre - concentrated labeled targets . in recent years , more and more biological and chemical assays are conducted in microscale devices with the rapid development of micrototal analysis systems ( -tas ) . traditional methods of concentrating samples by centrifuging and subsequently removing the supernatant are not amenable to the format of microchips . a number of methods have been reported concerning on - chip microfluidic concentration and manipulation of micro / nanoparticles such as dielectrophoresis [ 3 - 5 ] , optical tweezers , and ultrasonic wave . they are readily integrated into microdevices by patterning micro / nanometal electrodes ( in the case of dielectrophoresis ) or using remote manipulation with laser or ultrasound . we report here a direct current dielectrophoresis - based method for rapid concentration of nanoparticles in a microfluidic device . dielectrophoresis ( dep ) is the motion of a particle in a non - uniform electric field due to the unbalanced electrostatic forces on the particle s induced dipole . this phenomenon has been widely used for concentration , manipulation , separation , sorting , and transport of particles such as beads , bacteria , and cells [ 3 - 5,9 - 12 ] . the majority of these applications employ ac electric fields generated by closely spaced microelectrode arrays that are generally constructed with mems - based microfabrication techniques . ac fields promote lower electrode polarization and electrophoretic effects . however , ac dep faces certain issues that limit its applications , such as electrode fouling and electric field decay above the microelectrodes . an alternative to ac dielectrophoresis is the insulator - based dep ( idep ) or dc dep , in which no metal microelectrodes are embedded in the chip and dc electric fields are applied from an external electrode pair . effects such as electrochemical reactions and electrolysis observed in ac dep are less likely to occur in idep . cummings and singh observed two flow regimes in insulator - based dep : ( 1 ) streaming dep where streams of highly concentrated and rarified particles were created between the insulating posts at relatively low voltages and ( 2 ) trapping dep where particles were trapped around the insulating posts at higher voltages . these observations lead to potential applications , for example , streaming dep can be used to focus and transport particles , and trapping dep can be used for particle concentration and filtration . the mechanics behind the phenomenon is the competition between electrokinetic ( electrophoresis and electroosmosis ) and dielectrophoretic forces . the former is linearly proportional to the electric field , while the latter is proportional to the field squared . at low voltages , electrokinetic flow is dominant over dep and diffusion , resulting in the regime of streaming dep . at higher voltages , this letter describes an insulating microstructure that is designed to highly focus and thus amplify the electric field . upon the application of voltage , the generated electric field is focused in the direction of fluid flow . trapping dep first occurs at these field - focused areas located at the downstream , while streaming dep occurs upstream and continuously transports and delivers the particles . the described setup is capable of rapidly concentrating and collecting nanoparticles from continuous flow that is driven by electroosmosis . in the case of dc dep , the non - uniformity of electric field is generally created by embedded obstacles such as a specifically arranged array of insulators . delicately designed insulators lead to useful distribution of the electric field as well as the resulting electrostatic forces that are associated with the field , such as dep , electrophoretic , and electro - osmotic forces . the proposed microdevice is composed of a delicate insulating structure constructed in a channel for the purpose of field focusing ( fig . 1 ) . a simple and effective field - focusing insulator structure is shown in fig . 1a , which is formed by an array of circular posts spaced by different distances ( d1 < d2 ) . an electric field is generally applied externally from the two electrodes ( anode and cathode , respectively ) located at opposite ends of the channel . upon the application of the field , a non - uniform distribution is generated along the insulators , as indicated by the field lines . depending on the patterns of the insulators , the field is relatively concentrated in certain areas . field - focused areas are of higher non - uniformity compared to the unfocused areas and therefore are more preferable for trapping dep . derived from the design in fig . the tree system enables multilevel - focusing operations in the direction of flow ( from the left to the right ) at consecutive regions ( as indicated with numbers 14 ) . from the entry on the left to the exit on the right this results in interesting movement of particles carried by the fluid flow due to the combined effects of various forces . b an insulating tree structure for rapid electric field focusing suspended particles in the electric field experience a number of significant forces including dep , electrophoretic , and electro - osmotic effects . the resulting motion of the particle is determined by the superposed electrokinetic velocity where ek , eo , and ep are the electrokinetic , electroosmotic , and electrophoretic mobility , respectively . equation 1 indicates that the electrokinetic motion of the particles is linearly proportional to the local electric field . under ideal electrokinetic flow , particles flow along the electric field lines , and no concentration of particles occurs . on the other hand , dielectrophoretic velocity , udep , which is induced by the dielectrophoretic force in a non - uniform field , is proportional to the gradient of the electric field where dep is the dielectrophoretic mobility . in contrast to electrokinetic flow , dielectrophoretic motion is along the electric field gradient , and the transport can result in concentration , focusing , or trapping of particles in non - uniform fields . such field gradients are readily produced either by embedded metal electrodes in the case of ac dielectrophoresis or by insulating posts within the channel exposed to an external electric field . dependent on the polarizability of the particles and suspended medium , positive dep ( drawing particles to field maximum ) or negative dep ( repelling particles from field maximum ) takes place . the above equations imply that the resulting particle movement depends on the relative strengths of electrokinetic and dielectrophoretic effects . as discussed in ref . , above a threshold electric field , dep becomes dominant over electrokinetic and diffusion effects . particles will be trapped and concentrated dielectrophoretically , and this regime is called trapping dep. in this work , we proposed a field - focusing structure ( fig . trapping dep. electrokinetic flow is responsible for particle transport , while dielectrophoresis is responsible for local particle trapping . the microfluidic device containing the insulating microelectrodes was fabricated using conventional microfabrication techniques ( fig . 2 ) . the pdms ( polydimethylsiloxane)-insulating microstructures were manufactured by casting from a microfabricated silicon master . to fabricate the master , a 10 m thick layer of photoresist ( az9260 , clariant , somerville , nj ) was spun and patterned on a 4-inch wafer with a photolithography process ( fig . the patterned photoresist served as the mask for the subsequent process of deep reactive ion etching ( drie ) . to form the complementary patterns in the master , an icp ( inductively coupled plasma ) deep rie process was applied ( surface technology systems plc , newport , uk ) . the etching rate was about 3 m / min with a gas recipe of 115-sccm sf6 + 13-sccm 150 o2 + 100-sccm c4f8 at a cycling of 8 s passivation and 13 s etching . the passivation reduced the adhesion of pdms to the master surface and in turn facilitated the subsequent pdms peeling - off step . pdms mixture was then poured onto the master and incubated at room temperature overnight ( fig . the cured pdms film was peeled off from the master , and the insulating microstructures were formed on the pdms film ( fig . 2e ) . to construct an enclosed microfluidic device containing the microstructures and microchannels , the pdms film was then bonded to a glass slide ( fig . diagrams illustrating the fabrication of the microfluidic device containing pdms - insulating microstructures figure 3a depicts a photograph of the pdms - insulating microstructure fabricated with the process depicted in fig . microchannels formed by the pdms guide the eof - driven flow from the left to the right . in the flow direction , the microchannels merge into subsequent microchannels , terminating in a single outlet at the very right . in the proposed structure , four trapping regions ( indicated as these regions have been designed to effectively concentrate particles at various conditions by focusing the electric field . figure 3b shows a top view of the completed microfluidic chip containing the microfabricated insulators and the inlet / outlet reservoirs . to generate the electric field , two pt electrodes were vertically placed in the outlet and inlet reservoirs , respectively . in experiments , the motion of particles was imaged using an epifluorescent microscope ( nikon te2000-s ) . a photograph of the pdms - insulating microstructure for concentrating of particles . b diagram showing the microfluidic chip and experimental setup composed of microfabricated insulators , inlet / outlet reservoirs , two electrodes , and a fluorescence microscope in the case of dc dep , the non - uniformity of electric field is generally created by embedded obstacles such as a specifically arranged array of insulators . delicately designed insulators lead to useful distribution of the electric field as well as the resulting electrostatic forces that are associated with the field , such as dep , electrophoretic , and electro - osmotic forces . the proposed microdevice is composed of a delicate insulating structure constructed in a channel for the purpose of field focusing ( fig . 1 ) . a simple and effective field - focusing insulator structure is shown in fig . 1a , which is formed by an array of circular posts spaced by different distances ( d1 < d2 ) . an electric field is generally applied externally from the two electrodes ( anode and cathode , respectively ) located at opposite ends of the channel . upon the application of the field , a non - uniform distribution is generated along the insulators , as indicated by the field lines . depending on the patterns of the insulators , the field is relatively concentrated in certain areas . field - focused areas are of higher non - uniformity compared to the unfocused areas and therefore are more preferable for trapping dep . derived from the design in fig . the tree system enables multilevel - focusing operations in the direction of flow ( from the left to the right ) at consecutive regions ( as indicated with numbers 14 ) . from the entry on the left to the exit on the right this results in interesting movement of particles carried by the fluid flow due to the combined effects of various forces . suspended particles in the electric field experience a number of significant forces including dep , electrophoretic , and electro - osmotic effects . the resulting motion of the particle is determined by the superposed electrokinetic velocity where ek , eo , and ep are the electrokinetic , electroosmotic , and electrophoretic mobility , respectively . equation 1 indicates that the electrokinetic motion of the particles is linearly proportional to the local electric field . under ideal electrokinetic flow , particles flow along the electric field lines , and no concentration of particles occurs . on the other hand , dielectrophoretic velocity , udep , which is induced by the dielectrophoretic force in a non - uniform field , is proportional to the gradient of the electric field where dep is the dielectrophoretic mobility . in contrast to electrokinetic flow , dielectrophoretic motion is along the electric field gradient , and the transport can result in concentration , focusing , or trapping of particles in non - uniform fields . such field gradients are readily produced either by embedded metal electrodes in the case of ac dielectrophoresis or by insulating posts within the channel exposed to an external electric field . dependent on the polarizability of the particles and suspended medium , positive dep ( drawing particles to field maximum ) or negative dep ( repelling particles from field maximum ) takes place . the above equations imply that the resulting particle movement depends on the relative strengths of electrokinetic and dielectrophoretic effects . as discussed in ref . , above a threshold electric field , dep becomes dominant over electrokinetic and diffusion effects . particles will be trapped and concentrated dielectrophoretically , and this regime is called trapping dep. in this work , we proposed a field - focusing structure ( fig . 1b ) in which rapid electric field gradients are generated to readily induce trapping dep. electrokinetic flow is responsible for particle transport , while dielectrophoresis is responsible for local particle trapping . the microfluidic device containing the insulating microelectrodes was fabricated using conventional microfabrication techniques ( fig . 2 ) . the pdms ( polydimethylsiloxane)-insulating microstructures were manufactured by casting from a microfabricated silicon master . to fabricate the master , a 10 m thick layer of photoresist ( az9260 , clariant , somerville , nj ) was spun and patterned on a 4-inch wafer with a photolithography process ( fig . the patterned photoresist served as the mask for the subsequent process of deep reactive ion etching ( drie ) . to form the complementary patterns in the master , an icp ( inductively coupled plasma ) deep rie process was applied ( surface technology systems plc , newport , uk ) . the etching rate was about 3 m / min with a gas recipe of 115-sccm sf6 + 13-sccm 150 o2 + 100-sccm c4f8 at a cycling of 8 s passivation and 13 s etching . the passivation reduced the adhesion of pdms to the master surface and in turn facilitated the subsequent pdms peeling - off step . pdms mixture was then poured onto the master and incubated at room temperature overnight ( fig . the cured pdms film was peeled off from the master , and the insulating microstructures were formed on the pdms film ( fig . to construct an enclosed microfluidic device containing the microstructures and microchannels , the pdms film was then bonded to a glass slide ( fig . diagrams illustrating the fabrication of the microfluidic device containing pdms - insulating microstructures figure 3a depicts a photograph of the pdms - insulating microstructure fabricated with the process depicted in fig . microchannels formed by the pdms guide the eof - driven flow from the left to the right . in the flow direction , the microchannels merge into subsequent microchannels , terminating in a single outlet at the very right . in the proposed structure , four these regions have been designed to effectively concentrate particles at various conditions by focusing the electric field . figure 3b shows a top view of the completed microfluidic chip containing the microfabricated insulators and the inlet / outlet reservoirs . to generate the electric field , two pt electrodes were vertically placed in the outlet and inlet reservoirs , respectively . in experiments , the motion of particles was imaged using an epifluorescent microscope ( nikon te2000-s ) . a photograph of the pdms - insulating microstructure for concentrating of particles . b diagram showing the microfluidic chip and experimental setup composed of microfabricated insulators , inlet / outlet reservoirs , two electrodes , and a fluorescence microscope to investigate how the electric field is focused within the tree system , the field distribution was simulated with a finite element software ( femlab 3.2 , comsol inc . , burlington , ma , usa ) . in the simulation , the dc electric field was defined to apply from both the ends of the main channel . the simulated non - dimensional electric field ( e ) distribution the insulating concentrator was designed in this way to focus the electric field in the direction of the fluid flow ( from the left to the right ) . the electric field is applied from the ends of the main channel the performance of the microfluidic concentrator was tested with green fluorescent polystyrene microspheres of diameter of 930 nm ( duke scientific co. , ca , usa ) . the microspheres emit green light ( 508 nm ) when they are excited by blue light ( 468 nm ) . before use , the particles were re - suspended at low concentration in deionized water , and the conductivity of the medium was adjusted by adding phosphate buffer solution ( pbs , fisher scientific , nj ) . the conductivity was measured using a conductivity meter with graphite sensor electrodes ( dist3wp , hanna instruments inc . , a suspension of fluorescent microspheres was injected into the inlet reservoir of the microfluidic chip with a pipette . to generate the electric field , a dc voltage was applied to the platinum wire electrodes placed in the two reservoirs at the ends of the channel . to investigate the effect of electric field strength on the particle motion , the applied voltage on the two electrodes was increased incrementally from 50 to 1,000 v with a high - voltage power supply ( ps350 , stanford research ) . figure 5 shows the observed particle behavior within the microchannels of the insulating structure for increasing electric fields . dark areas are the solid insulators and bright areas are the microchannels filled with flowing fluorescent particles . at low electric field of 40 v / cm , streaming dielectrophoresis was observed ( fig . particles entered from the left of the channels , traversed the whole structure , and then exited at the right outlet . no obvious concentration of particles was observed in this regime ( streaming dep ) . in the low electric field regime , drag forces on the particles from electrokinetic flow dominated the attractive effects of positive dep and thus resulted in the streaming movement along the microchannels . as the electric field increased to 120 v / cm , trapping of particles began to occur at the right ( region 1 ) of the concentrator ( fig . the dep force began high enough to overcome the electrokinetic effects , resulting in the trapping of particles in this region . because of the trapping , fewer particles exited the outlet . on the other hand , streaming dep still occurred in the other regions ( the left part of the concentrator ) . the co - existence of both streaming dep and trapping dep highly improved the concentration efficiency : the streaming dep was responsible for continuously transporting of the particles from the left to the right , while trapping dep was responsible for trapping the delivered particles . as the applied field further increased to 160 v / cm , the loss of particles at the outlet disappeared , meaning that the concentrator trapped all the incoming particles delivered by the flow ( fig . region 4 , respectively , as the applied field increased to 240 v / cm or higher ( fig . the concentrator trapped all the particles entered from the inlet and packed them into a dense format within the microchannels . to collect the concentrated particles , the residual solution in the reservoirs the applied voltage was then turned off , and a pressure source ( generated with a syringe ) was applied from the inlet to propel the particles to the outlet reservoir . the solution collected from the concentrator we also carried out experiments with particles of diameter of 500 nm ( not shown ) . e depicts the concentration at different regions as the applied voltage increased.dark areas are the pdms structures , and bright ( green ) areas are the microchannels formed by the pdms . the concentrator is composed of a series of microchannels formed by pdms - insulating microstructures . streaming dep occurred at low electric fields , and trapping dep occurred at higher electric fields . as the electric field increased , concentration of nanoparticles began to occur at different regions . the concentration was very rapid and efficient as the streaming dep delivered particles and trapping dep trapped the delivered particles . the proposed concentrator design can be re - configured into a format with more or less trapping regions , depending on the applications . furthermore , the microfluidic concentrator can be implemented in applications where concentration of targets are needed , such as the concentration of cells for sample preparation and the concentration of molecular biomarkers for biological assays .

we report a microfluidic device for rapid and efficient concentration of micro / nanoparticles with direct current dielectrophoresis ( dc dep ) . the concentrator is composed of a series of microchannels constructed with pdms - insulating microstructures for efficiently focusing the electric field in the flow direction to provide high field strength and gradient . the location of the trapped and concentrated particles depends on the strength of the electric field applied . both streaming dep and trapping dep simultaneously take place within the concentrator at different regions . the former occurs upstream and is responsible for continuous transport of the particles , whereas the latter occurs downstream and rapidly traps the particles delivered from upstream . the performance of the device is demonstrated by successfully concentrating fluorescent nanoparticles . the described microfluidic concentrator can be implemented in applications where rapid concentration of targets is needed such as concentrating cells for sample preparation and concentrating molecular biomarkers for detection .

Introduction Materials and Methods The Microstructure for Field Focusing Theoretical Microfabrication and Experimental Setup Results and Discussions Summary

obesity is an epidemic in the united states ( us ) and affects more than one third of the population . among americans 20 years of age and older 78.4 million have a body mass index ( bmi ) of 30 kg / m and greater . obesity is a risk factor for gastroesophageal reflux disease ( gerd ) and is associated with increased risk of esophageal adenocarcinoma ( ea ) . the incidence of ea is currently increasing faster than any other malignancy in the us , with an estimated incidence of 18,170 in 2014 . bariatric surgery is recognized as durable treatment for obesity and its comorbid conditions . given the increasing incidence of ea and the utilization of bariatric surgery as a treatment for morbid obesity , one might infer that patients undergoing bariatric surgery are at risk for developing ea . there is a paucity of data regarding esophagectomy after roux - en - y gastric bypass ( rygb ) for malignancy or definitive guidelines for preoperative endoscopy prior to bariatric surgery . we present two cases of esophageal adenocarcinoma discovered at the time of laparoscopic rygb . additionally , we describe the surgical management with laparoscopic transhiatal esophagectomy , a technique that has not yet been described in the literature following bariatric surgery . the first patient was a 66 year old male with a bmi of 48 his obesity related comorbidities included obstructive sleep apnea ( osa ) , diabetes mellitus ( dm ) , hypertension ( htn ) , dyslipidemia , non - alcoholic fatty liver disease and degenerative joint disease . he did not have a history of gerd and was not on acid suppressive therapy . he was a former cigarette smoker who quit 13 years prior to evaluation for bariatric surgery . his risk factors for ea included age , gender , body mass index ( bmi ) and history of tobacco use . he underwent a laparoscopic rygb with routine completion intraoperative endoscopy for anastomotic surveillance and leak testing . a mass , concerning for ea , was identified at 33 cm from the incisors ( fig . a biopsy was obtained and intra - operative endoscopic ultrasound ( eus ) was performed . pathology demonstrated a well to moderately differentiated invasive adenocarcinoma arising in a background of barrett s esophagus ( be ) with high grade dysplasia . her-2-neu was not amplified . a post operative a positron emission tomography - computed tomography ( pet - ct ) the second patient was a 49 year old male with a preoperative bmi of 45 kg / m . his obesity related comorbidities included hypertension , diabetes mellitus , dyslipidemia , coronary artery disease and gerd . he was a former smokeless tobacco and cigarette user and quit 33 years and 2 years prior to evaluation for bariatric surgery . his risk factors for ea included age , gender , bmi , gerd and history of tobacco use . he also underwent a laparoscopic rygb with completion endoscopy during which a mass was identified at 38 cm from the incisors ( fig . the post operative staging work up included endoscopic ultrasound ( eus ) and pet - ct . a fine needle aspiration ( fna ) of an abnormal lymph node confirmed the presence of malignant cells . he completed neoadjuvant treatment with carboplatin , paclitaxel and total radiation dose of 5040cgy . after completing neoadjuvant therapy he was restaged with eus and pet - ct ; the lesion had regressed by eus and there was decreasing fluorodeoxyglucose ( fdg ) activity at the tumor site . our group performs a standardized laparoscopic rygb in an antecolic and antegastric fashion with a stapled linear anastomosis between the gastric pouch and roux limb . both patients subsequently underwent a laparoscopic transhiatal esophagectomy using the gastric remnant as a conduit . once laparoscopic access was obtained , the pars flaccida was divided and the phrenoesophageal membrane was divided . the esophagus was circumferentially mobilized using a combination of blunt dissection and an ultrasonic energy device . the roux limb was mobilized by dividing the roux limb with a linear stapler just distal to the gastrojejunal ( gj ) anastomosis . the gastric remnant was mobilized along the greater curve with preservation of the right gastroepiploic artery . the left gastric vessels were then divided with a linear stapler to complete the mobilization of the gastric remnant conduit . the biliopancreatic ( bp ) limb was divided proximal to the jejunojejunostomy ( jj ) with a linear stapler . the distal end of the bp limb was then anastomosed to the proximal roux limb to re - establish continuity and complete the jejunal reconstruction . a left neck dissection was performed and the esophagus was identified and encircled with a penrose drain . dissection was carried down into the mediastinum bluntly with care to avoid injury to the trachea . a large vein stripper was secured to the divided esophagus to complete the mediastinal dissection . an umbilical tape was secured to the divided esophagus and this was pulled through the mediastinum into the abdomen . the umbilical tape was then removed from the specimen and secured to the gastric remnant and used to pull the conduit into the neck . intra - operative frozen sections obtained on the proximal and distal margins were negative in both cases . the esophagogastrostomy was hand sewn and created in and end ( esophagus ) to side ( gastric conduit ) fashion . our group performs a standardized laparoscopic rygb in an antecolic and antegastric fashion with a stapled linear anastomosis between the gastric pouch and roux limb . both patients subsequently underwent a laparoscopic transhiatal esophagectomy using the gastric remnant as a conduit . once laparoscopic access was obtained , the pars flaccida was divided and the phrenoesophageal membrane was divided . the esophagus was circumferentially mobilized using a combination of blunt dissection and an ultrasonic energy device . the roux limb was mobilized by dividing the roux limb with a linear stapler just distal to the gastrojejunal ( gj ) anastomosis . the gastric remnant was mobilized along the greater curve with preservation of the right gastroepiploic artery . the left gastric vessels were then divided with a linear stapler to complete the mobilization of the gastric remnant conduit . the biliopancreatic ( bp ) limb was divided proximal to the jejunojejunostomy ( jj ) with a linear stapler . the distal end of the bp limb was then anastomosed to the proximal roux limb to re - establish continuity and complete the jejunal reconstruction . a left neck dissection was performed and the esophagus was identified and encircled with a penrose drain . dissection was carried down into the mediastinum bluntly with care to avoid injury to the trachea . a large vein stripper was secured to the divided esophagus to complete the mediastinal dissection . an umbilical tape was secured to the divided esophagus and this was pulled through the mediastinum into the abdomen . the umbilical tape was then removed from the specimen and secured to the gastric remnant and used to pull the conduit into the neck . intra - operative frozen sections obtained on the proximal and distal margins were negative in both cases . the esophagogastrostomy was hand sewn and created in and end ( esophagus ) to side ( gastric conduit ) fashion . the first patient had a 13 week interval between the bariatric surgery and definitive esophagectomy . during the interval time period the patient lost 57 pounds . the patient s bmi at the time of lthe was 37 kg / m . the second patient lost 73 pounds in the five month interval between laparoscopic rygb and lthe with a bmi of 32 kg / m . following lthe the first patient s post - operative course was complicated by a transient recurrent laryngeal nerve palsy which resolved . the final pathologic evaluation revealed a focal high - grade dysplasia arising in barrett 's esophagus . he experienced an anastomotic stricture at 10 weeks and had serial upper endoscopy with dilation performed . a follow up pet - ct noted to have a hypermetabolic mass adjacent to the right thyroid lobe at 22 months post laparoscopic rygb and 19 months post lthe . the patient underwent adjuvant therapy with herceptin and folfox and a total radiation dose of 2500 cgy . a restaging pet - ct after completion of his treatment 27 months after lthe demonstrated low activity . on last follow up the final histologic examination of the specimen revealed barrett s esophagus with focal low grade dysplasia . there was no evidence of disease at time of last follow up , 36 months post laparoscopic rygb , 30 months post lthe and thelast bmi was 37.03 kg / m . esophageal cancer is the eighth most common cancer worldwide yet comprises 1% of all cancers diagnosed in the us . it is estimated 18,170 new cases of esophageal adenocarcinoma will be diagnosed in the us in 2014 with 15,450 deaths due to disease , . the incidence of esophageal cancer and gastroesophageal tumors however is increasing faster than any other malignancy in the united states , . known risk factors for this disease include age , male gender , gerd , barrett s esophagus , tobacco , alcohol and obesity . data in the us have demonstrated an association between increasing bmi and existence of gerd . a bmi greater than 30 kg / m is associated with an increased risk for symptomatic gerd with an odds ratio ( or ) of 1.94 . obesity has been reported to increase the odds of ea by 2.4 in men and 2.1 in women . gerd is a risk factor for developing be and occurs in approximately 10% to 15% of patients with long standing gerd . barrett s esophagitis is the most important etiologic factor in developing adenocarcinoma of the esophagus . the incidence of cancer in be has increased from 4 to 23 cases per million . a bmi of 30 kg / m increases the odds of having be by 1.35 times . it remains unclear if bmi is associated with progression of metaplasia to dysplasia or if the increased risk of be is confounded by symptomatic gerd . with the increasing incidence in obesity over the same time period the proportion of laparoscopic bariatric procedures increased from 20.1% to 90.2% . there is controversy regarding the role of pre - operative upper endoscopy in patients undergoing bariatric surgery , . some authors advocate that all patients with upper gastrointestinal symptoms have upper endoscopy prior to undergoing bariatric surgery . the rationale for this routine practice is that pathology may be identified which should be treated prior to surgery or may alter the planned procedure . report a series of 371 patients who underwent routine pre - operative upper endoscopy prior to gastric band placement . one patient underwent minimally invasive esophagectomy ( the technique is not further described ) for a pt1n0m0 lesion ; one patient who was not fit for esophagectomy had endoscopic mucosal resection ( emr ) followed by gastric band placement . despite the detection of these two cases of malignancy the authors concede that pathology identified at routine pre - operative endoscopy did not significantly alter planned patient management . the cost of routine preoperative screening endoscopy , particularly in an era where there is a high volume of bariatric surgical procedures being performed is poorly defined . in addition , while the risk of preoperative upper endoscopy is low with an incidence of 019% the procedure is still associated with some risk . the american society for gastrointestinal endoscopy ( asge ) standards of practice committee issued a guideline in 2015 . the guidelines support the decision to perform upper endoscopy on the presence of upper gastrointestinal symptoms such as reflux and dysphagia . an upper endoscopy should be performed in all patients with upper - gi - tract symptoms who are to undergo bariatric surgery ( level 2c ) . upper endoscopy should be considered in patients undergoing a sleeve gastrectomy to evaluate for hiatal hernia to prevent de novo gastroesophageal reflux and to evaluate for pre - existing esophagitis . the asge also recommends non - invasive h. pylori testing preoperatively for asymptomatic patients who are not having endoscopy prior to bariatric surgery . some authors propose further studies are necessary to assess the cost effectiveness of routine preoperative screening endoscopy because the incidence of detection of premalignant and malignant pathology is low . in our center however , the detection of these two cases and review of the literature has lowered our threshold to perform a preoperative endoscopy in patients with long standing gerd or significant foregut symptoms . he therefore would not have been identified as a candidate for preoperative endoscopy by the criteria proposed in the asge guidelines . in the series reported by melstrom all three patients who developed esophageal cancer after rygb had symptomatic reflux . our group has performed over 4000 bariatric procedures with routine intra - operative endoscopy and have detected only the two cases of esophageal adenocarcinoma presented . a recent review of the literature was completed in 2013 and reported only 11 cases of esophageal cancer detected after bariatric surgery . there are less than 25 reported cases of esophageal cancer developing after bariatric surgery with an incidence of less than 0.1% , . proponents of preoperative endoscopy argue that findings may alter surgical management in bariatric patients . in a series of 448 patients undergoing preoperative endoscopy a positive finding altered medical management in 18% of patients . however , the findings only led to a change in the timing of surgery or a change in surgical technique in less than 1% of patients . it is our opinion that low rate of positive findings that alter surgical management do not justify the cost of routine screening endoscopy prior to bariatric surgery . further prospective studies are necessary to assess the cost effectiveness and complication rates of routine preoperative endoscopy in asymptomatic patients . the technique of laparoscopic transhiatal esophagectomy has not previously been reported in post rygb patients with esophageal cancer . prior published reports on minimally invasive approaches after bariatric surgery included a combined laparoscopic and thoracoscopic ivor lewis esophagogastrectomy in a patient who previously had undergone gastric bypass . a second case described an abdominal approach to mobilize the gastric pouch followed by right thoracotomy for esophageal mobilization . described their technique of resection of ea after rygb with an ivor lewis esophagogastrectomy via an open approach with a bilateral subcostal incision . the reconstruction described in prior reports is similar to our technique except that in our cases the reconstruction was performed laparoscopically . it was not necessary to resect the roux limb between the gastrojejunostomy ( gj ) and jejunojejunostomy . the margins were not compromised and preservation of intestinal length may have the additional benefit of avoiding malnutrition . while there is additional anastomosis required to reconstruct the normal anatomy it is our opinion that this does not lead to an increased risk of leak when completed by experienced surgeons . although open approaches for esophagectomy have been more common in patients with a history of bariatric surgery , minimally invasive esophagectomy is an option . there is a paucity of data regarding long term outcomes for the laparoscopic approach and the role of laparoscopic esophagectomy as a surgical treatment option for all patients continues to evolve . a recent meta - analysis comparing oncologic outcomes between minimally invasive and open esophagectomy techniques found no statistically significant staging or survival differences ; lymph node yield was statistically significantly higher in the minimally invasive group . with regard to surgical technique for esophagectomy a as ea in the post bariatric surgery population continues to be recognized it is important to report different technical approaches to resection and reconstruction . over the past several decades in the united states rates of obesity , and gerd and have increased . this is in parallel to the increase in the number of bariatric surgical procedures performed . despite the low incidence of esophageal adenocarcinoma in bariatric patients there the surgical management of esophageal cancer after bariatric surgery presents a unique challenge to surgeons not familiar with the altered anatomy . additionally , the selection criteria for patients who may benefit from routine preoperative upper endoscopy needs to be further defined to maximize cost containment while providing optimal surgical care . the present case series is the first to describe not only detection of esophageal cancer at laparoscopic rygb but also the first described technique of laparoscopic transhiatal esophagectomy post laparoscopic rygb . i have obtained written consent from the patients and that you can provide this should the editor ask to see it .

highlightspreoperative endoscopy is indicated bariatric patients with history of gastroesophageal reflux.laparoscopic transhiatal esophagectomy can be safely performed in patient with history of roux - en - y gastric bypass.the gastric remnant provides a good conduit for reconstruction following esophagectomy in patients with a previous roux - en - y gastric bypass .

Introduction Materials and methods Surgical technique Results Discussion Conclusion Conflict of interest Funding Ethical approval Consent Author contribution Guarantor

while for millennia handwashing has been practiced not only in an attempt to remove physical contamination but also to rid oneself of guilt and evil , it was only some 200 years ago that , thanks to the insights of physicians such as alexander gordon , oliver wendell holmes and ignaz philipp semmelweis and to semmelweis ability to draw the right conclusions , that people became aware of the fact that diseases could be spread via the hands and , vice versa , that this pathway could be interrupted through hand hygiene . today , hand hygiene is seen as the most important measure to protect against the spread of nosocomial infections , but is it being practiced such that it does justice to its assigned role ? evidence of shortcomings here came to light in the middle of the past century , giving rise to scientific research , which in turn meant a sharp increase over the past 50 years in the body of knowledge relating to effective methods for removal from the hands or killing and inactivation of pathogens which were not even discovered 200 years ago and of which many more are still not known . this has been made possible above all thanks to the development of in vitro und in vivo laboratory test methods for evaluation of the effect of hand hygiene methods . the german society of hygiene and microbiology ( dghm ) published already back in 1958 the first guidelines for testing chemical disinfectants and included only those hand disinfection products on its list of tested chemical disinfectants found to be effective ( e.g. ) that had been tested as per the methods cited in the guidelines . somewhat later the american society of testing and materials ( today : astm international ) published the first test protocols for hand disinfection products , which in 1974 were adopted by the us food and drug agency as guidelines in a tentative final monograph ( tfm ) and in 1994 , having revised it to incorporate new insights , it was published once again . besides , astm international has also published other standards of relevance to hand disinfectants : e 2276 ( bacteria - eliminating effectiveness of hygiene handwash and handrub agents using the fingerpads of adult subjects),e 1838 ( virus - eliminating effectiveness of liquid hygienic handwash and handrub agents using the fingerpads of adult volunteers),e 2011 ( handwashing formulations for virus - eliminating activity using the entire hand ) unde 1115 ( evaluation of surgical hand scrub formulations ) . e 2276 ( bacteria - eliminating effectiveness of hygiene handwash and handrub agents using the fingerpads of adult subjects ) , e 1838 ( virus - eliminating effectiveness of liquid hygienic handwash and handrub agents using the fingerpads of adult volunteers ) , e 2011 ( handwashing formulations for virus - eliminating activity using the entire hand ) und e 1115 ( evaluation of surgical hand scrub formulations ) . where the user is concerned , guidelines for hand disinfection containing information on indication and implementation are of course more important than methods dealing with efficacy testing of products . such guidelines are therefore being compiled increasingly more commonly within the hospitals by the infection control teams set up during the 1970s . formal , written guidelines were ultimately also published by several relevant healthcare institutions , scientific societies and associations . these include for example those of the centers for disease control ( cdc 1975 , 1986 and 2002 ) , of the association for professionals in infection control ( apic 1988 und 1995 ) or of the hospital infection control practices advisory committee ( hicpac 1995 , 1996 ) . the who guidelines for hand hygiene in healthcare settings , formulated under the direction of didier pittet , within the framework of the who world alliance for patient safety , proved to be the most successful of the attempts undertaken at global level to enhance hand hygiene . these guidelines contain detailed information and recommendations on hand hygiene , while also taking account of facilities available in developing countries . the most remarkable changes to hand hygiene strategies in recent years were no doubt the efforts aimed at improving compliance among medical personnel and the increasing international acceptance of hand disinfection by using alcohols in the form of rubs ; whether this will be with lotions or gels remains to be seen . chairman of the clinical institute for hygiene and medical microbiology of the university of vienna . after successfully ending his study of medicine at the university of vienna in 1965 manfred rotter became assistant doctor at the hygiene institute there . he gets a further diploma in bacteriology at the london university and habilitated at the university of vienna for the subject of hygiene and microbiology in 1976 . in 1984 and 1987 he took on a visiting professorship in south africa and became head of the clinical department for clinical microbiology of the hygiene institute at the vienna general hospital , one of the biggest in europe , in 1991 . additionally he was appointed chairman of the clinical institute for hygiene and medicinal microbiology of the university of vienna in 1995 . more than 400 publications and numerous scientific honours do not only document his expertise but also the absolute acknowledgment thereof . tongue in cheek but nevertheless meant seriously he is often being called the direct successor of semmelweis . chairman of the clinical institute for hygiene and medical microbiology of the university of vienna . after successfully ending his study of medicine at the university of vienna in 1965 manfred rotter became assistant doctor at the hygiene institute there . he gets a further diploma in bacteriology at the london university and habilitated at the university of vienna for the subject of hygiene and microbiology in 1976 . in 1984 and 1987 he took on a visiting professorship in south africa and became head of the clinical department for clinical microbiology of the hygiene institute at the vienna general hospital , one of the biggest in europe , in 1991 . additionally he was appointed chairman of the clinical institute for hygiene and medicinal microbiology of the university of vienna in 1995 . more than 400 publications and numerous scientific honours do not only document his expertise but also the absolute acknowledgment thereof . tongue in cheek but nevertheless meant seriously he is often being called the direct successor of semmelweis .

hand hygiene is the most important measure to protect against the spread of nosocomial infections . with the development of in vitro und in vivo test methods for evaluation of the effect of hand hygiene , there has been a sharp increase over the past 50 years in the body of knowledge relating to effective methods for removal from the hands or killing and inactivation of pathogens . in 1958 the german society of hygiene and microbiology ( dghm ) published a first guidelines for testing chemical disinfectants and included only those hand disinfection products on its list of tested chemical disinfectants found to be effective that had been tested as per the methods cited in the guidelines . the american society of testing and materials ( today : astm international ) was next , with the first test protocols for hand disinfection products , which in 1974 were adopted by the us food and drug agency as guidelines in a tentative final monograph ( tfm ) and in 1994 , having revised it to incorporate new insights , it was published once again . where the user is concerned , guidelines for hand disinfection containing information on indication and implementation are of course more important than methods dealing with efficacy testing of products . such guidelines are compiled within the hospitals by the infection control teams set up during the 1970s . written guidelines were also published by several healthcare institutions , scientific societies and associations . the guidelines formulated by the world health organisation ( who ) , in an expert committee under the direction of didier pittet , proved to be the most successful of the attempts undertaken at global level to enhance hand hygiene . the most remarkable changes appear to be the efforts aimed at improving compliance among medical personnel and the increasing international acceptance of hand disinfection by using alcohols in the form of rubs ; whether this will be with lotions or gels remains to be seen .

Text Curriculum Vitae Univ. Prof. Dr. med. habil Manfred Rotter

several techniques can be performed to improve the defination of the nasal tip such as cartilaginous resection , tip grafts , or suture placement . resection techniques have gradually been replaced by maneuvers that are more effective in preserving the nasal tip support mechanisms1 2 3 4 5 6 7 8 9 10 . the aim of study is evaluate the outcome of lateral intercrural suture at the lower lateral cartilage ( llc ) of the caucasian nose through endonasal rhinoplasty using a basic technique without delivery to decrease the angle of domal divergence and improve the definition of the nasal tip . the present study was carried out between the years of 2008 and 2009 at the parana institute for otorhinolaryngology ( ipo ) hospital in the city of curitiba . from a 100-patient sample , we excluded those who had a history of nasal surgery , previous nasal trauma , and a non - caucasian nose . sixty - four patients participated of the study , including 43 males and 21 females that were between 16 and 59 years old ( m = 37.5 ) . all of the patients had knowledge of the study and signed a free informed term of consent ( fitc ) form in compliance with the brazilian federal ruling of national concill of health ( cns ) 196/96 . we used the converse - diamond 1 , which is a classic rhinoseptoplasty surgical technique . the nasal tip was accessed through septocolumelar and intercartilaginous incisions . in all cases , la garde 's maneuver was performed without resection of the cephalic border of the llc ( the mcindoe technique ) . the lateral intercrural suture must be performed on the cephalic border of llc through the intecartilaginous incision , on the junction between the dome and lateral crus ( figure 1 ) , and its grip must be gradual and progressive , thus allowing for adjustments to achieve the most appropriate tip ( figure 2 ) . surgical anatomy of the nasal tip . the lateral intercrural suture must be done after the septocolumelar suture and before the intercartilaginous suture , using colorless polydioxanone 4'0 ' ( pds ) with a sharp , curved needle . performing the intercrural stitch at the end of the surgery avoids excessive manipulation of the tip and possible enlargement of the interdomal distance ( the angle of domal divergence ) . it is considered normal to have an angle of domal divergence that is less than 30 ( figure 3)4 10 . a normal angle of domal divergence . lateral intercrural suture steps : subsequent to the displacement of the skin of the llc using la garde 's maneuver and the dislocation of the cartilage from the skin of the vestibule , introduce the pds to the junction between the dome and the lateral crus ( about 3 mm from the llc - cephalic border ) . the thread must be introduced through the cephalic to the caudal margin ( figure 4 ; step 1 ) . move the thread to the contralateral nostril through the transfixant incision ( figure 5 ; step 2 ) . perform step 1 on the contralateral nostril through the caudal to the cephalic margin , and avoid crossing the threads ( figure 6 ; step 3 ) . return the needle to the nostril in which the stitch was initiated and gradually grip the suture . the lateral intercural suture was performed on 64 patients with caucasian noses through endonasal rhinoseptoplasty using a basic technique without delivery . pre- and postoperative pictures were evaluated after a 6-month evolution period . in all of the cases , an improved nasal tip definition was achieved with results that were satisfactory to both the patients and the surgeon ( qualitative , observational , and subjective assessment ) . the present work was approved by the institution 's ethics committee ( protocol number 004/2008 ) . the replacement of cartilaginous resection techniques with suture techniques to improve nasal tip definition is a global trend5 . the report regarding sutures that were applied to the nasal tip was originally published by bahman guyuron and ramin a. behmand in 20036 . our results were evaluated 6 months postoperatively and had success that was similar to that of the work that was published by nassif et al11 . the final result of the suture technique is primarily influenced by factors such as the intrisic force of the cartilage , the degree of tightening of the suture , and the limitation imposed by the soft tissues ( ligaments , subcutaneous tissue , and skin ) . skin thickness is another determining factor in the effectiveness of the lateral intercrural suture . in patients with thin skin and sparse subcutaneous tissue however , in patients with thicker skin and excessive subcutaneous tissue , the lateral intercrural suture may be ineffective , thus requiring a reduction of the angle of domal divergence and of the domal definition by using other techniques , such as the goldman technique , transdomal suture , interdomal or medial crus suture , or a lateral spanning - type surgery ( which compromises more of the lateral crus)6 . there are some details concerning the lateral intercrural suture technique that must be observed : slight nasal tip projection , diverging from the results described in the literature2 . the more laterally that the suture is placed on the lateral crus , the better the resulting nasal tip projections and definition . discrete pinching of the supra - alar region , especially in patients with very thin skin and weak supra - alar cartilage , when performed at a distance superior to 2 - 3 mm from de nasal dome . asymmetry of the tip can be observed if the stitches are not placed at corresponding levels . the suture can be held in place using long - term absorbable threads ( monocryl or pds ) or with non - absorbable threads , with consideration given to the tensile strength and level of absorption of each material . in all of the cases that were described in this work , non - absorbable threads were used , and there were no cases of extrusion or other complications that are described in the literature ( abscess , extrusion , asymmetry , or pinching of the tip)2 . lateral intercrural suture is an effective method to improve nasal tip definition in the caucasian nose and can be performed through endonasal rhinoplasty without delivery . this technique had already being reported in the literature through opened and closed access with delivery , but not through closed access with intercartilaginous and septocolumelar incisions . this suture is easy to perform , predictable , controlled , and extremely useful to the surgeon dedicated to tip surgery . this stitch allows for better management of the tip through basic rhinoseptoplasty , therby minimizing the requirement of surgery procedures through delivery or the open procedure . the present study evaluated the improvement of nasal tip definition on the angle of domal divergence using simple suture of the cephalic board and lateral crus of the llc . we emphasize that each suture has its own precise indication , and the individual surgeon is responsible for assessing and choosing the suture that best fits the needs of the patient .

summary introduction : several techniques can be performed to improve nasal tip definition such as cartilage resection , tip grafts , or sutures . objctive : to evaluate the outcome of lateral intercrural suture at the lower lateral cartilage by endonasal rhinoplasty with a basic technique without delivery in decreasing the angle of domal divergence and improving the nasal tip definition . method : this prospective study was performed in 64 patients in which a suture was made on the board head of the lower lateral cartilage in the joint between the dome and lateral crus , using polydioxanone ( pds ) with sharp , curved needle . results : in all of the cases , better definition of the nasal tip was achieved by intercrural suturing for at least 6 months postoperatively . conclusion : lateral intercrural suture of the lower lateral cartilage provides improved nasal tip definition and can be performed by endonasal rhinoplasty without delivery in the caucasian nose .

Introduction Method Results Discussion Conclusion

nitric oxide ( no ) is a diatomic free radical synthesized from the conversion of l - arginine to l - citrulline by nitric oxide synthase ( nos ) . no is relatively unstable in the presence of oxygen and quickly auto - oxidized to produce nitrogen oxides . because of no s reactivity and short - life , direct measurements of no in cells and tissues are very difficult . although no metabolites have a very short life , nitrate and nitrite are the relatively stable end products of no oxidation . the total levels of nitrite and nitrate in biological fluids are generally used for adequate monitoring of the no synthesis . traditional diagnostic procedures for periodontal diseases are limited for evaluation of current disease status . in order to improve clinical management of periodontal patients , there is a need for the development of new diagnostic tests that can detect the presence of active disease , future disease progression , and evaluate the response to periodontal therapy . advances in oral and periodontal diagnostic research are moving toward methods by which periodontal risk can be identified and quantified by objective measures such as biomarkers . biomarkers of disease play an important role in diagnosis , assessing the treatment outcomes , and drug discovery . in order to understand their role in routine practice , their relation to the mechanism of disease progression and therapeutic intervention must be understood . gingival crevicular fluid ( gcf ) is an exudate originating from serum and can be collected from the gingival sulcus surrounding natural teeth . the flow of this biological fluid is an important determinant for the status of periodontal tissues , which reflects the cellular response in the periodontium by the constituents of serum and contributions from the gingival crevice [ 10 - 12 ] . inducible no synthase ( inos ) is produced by immune system cells such as macrophages infected with bacteria and is involved in the regulation of inflammatory reactions . no has beneficial and harmful effects and it is involved in the regulation of many physiological issues including platelet aggregation , immune regulation and vascular relaxation . the activation of inos , inflammatory mediators in cells and nitrosative stress are reported to be increased in inflammatory periodontal tissues . it has been shown that no takes part in the etiopathogenesis of many diseases , including periodontal disease [ 18 - 20 ] . obtained gingival tissue from patients with moderate periodontitis and from healthy controls in their study and they reported that no production is increased in inflamed periodontal tissue . in another study , it has been suggested that the expression of inos from macrophages in high levels may damage the periodontal tissues . inos activity in macrophages was reported to have the potential to inhibit leukocyte recruitment by acting on leukocytes that increase the inflammation in localized aggressive periodontitis ( lap ) patients . however , conflicting results of no metabolites , either decreased or increased in saliva from patients with periodontitis have also been reported [ 23 - 26 ] . in a recent study by andrukhov et al . evaluation of nitrite and nitrate concentrations which are produced by the biochemical events in immunological response during host - pathogen interaction will play an important role in understanding the etiopathogenesis of periodontal disease . in recent years , exponential data on the involvement of no and nitrosative stress in chronic periodontitis has emphasised the need to improve diagnostic parameters . the localization and effects of nitrosative stress may be assessed by an analysis of nitrosative damage biomarkers isolated from tissues and biological fluids . the aim of this study was to measure nitrite and nitrate levels in total saliva and gingival crevicular fluid in patients with gingivitis and chronic periodontitis and to assess the value of these nitrosative stress parameters of periodontal disease . the study protocol was approved by the institutional review board of the hacettepe university in accordance with the helsinki declaration of 1975 , as revised in 2000 . all voluntary participants were informed about the outline , purpose of the study and signed an informed consent form . when necessary , periodontal treatment was performed by periodontists ( aot and kbs ) after sampling . the present study was conducted in the department of periodontology between february 2011 and january 2012 . a total of 60 individuals , which included , 20 chronic periodontitis and 20 gingivitis patients and 20 periodontally healthy controls participated in the present study . clinical periodontal status was determined by assessing the probing depth ( pd ) , clinical attachment level ( cal ) , gingival index ( gi ) , , gingival bleeding time index ( gbti ) and plaque index ( pi ) scores . full - mouth recordings was performed by one examiner ( aot ) during the first visit and assigned one of the following study groups . the existence of gingival inflammation ( gi values > 0 ) , with pd values < 3 mm and cal 2 mm at more than or equal to 90% of teeth and no radiographic signs of alveolar bone loss due to periodontal disease ( i.e. , distance between the cemento - enamel junction and bone crest at > 90% of the proximal tooth sites 3 mm ) . chronic periodontitis group subjects with presence of sites presenting cal values 3 mm and gi values > 0 and pd of 6 mm in multiple sites in all four quadrants of the mouth and moderate - to - severe alveolar bone loss ( more than 3 mm ) present in radiographs . clinically healthy periodontal status , that is , gi values of 0 , pd 3 mm , no gingival recession and cal 2 mm at more than or equal to 90% of the measured tooth sites as well as bleeding on probing in less than 10 % of the probing sites at examination and no radiographic evidence of alveolar bone loss in these subjects ( i.e. , distance between the cemento - enamel junction and bone crest 3 mm at > 90% of the proximal tooth sites ) . in addition to the general periodontal status of the subjects , individual periodontal status of the sampled teeth was also considered . exclusion criteria included the following : pregnant or lactating women ; subjects used any antibiotics or received periodontal treatment within the last 6 months ; subjects on anti - inflammatory therapy , or vitamin / nutritional supplements ; and subjects with systemic diseases such as diabetes mellitus , hypertension , renal disease , rheumatoid arthritis , periapical infection of any tooth , or any other form of systemic inflammatory involvement . saliva and gcf sampling maxillary teeth including first molars , second premolars , canines and central incisors ( eight teeth of each subject ) were selected to avoid possible saliva contamination during sampling . all the samples were collected by one blind examiner ( kbs ) , 48 hours following the clinical measurements in the morning ( between 10 a.m. - 11 a.m. ) following an overnight fast . the participants were told not to eat or drink anything or chew gum that morning before sampling . they were asked whether they followed these instructions or not , before collection of the samples . subjects were asked not to swallow any saliva for the duration of the collection to allow saliva to pool in the bottom of the mouth and collection tube was used to drain when necessary . saliva samples were then placed in sterile eppendorf tubes and stored at -80 c until the laboratory analysis . gcf samples were obtained after saliva sampling , according to the method described by rdin and colleagues , using standardized commercial paper strips ( oraflow inc . , following the isolation of the sampling area with sterile cotton rolls , supragingival plaque was removed and experimental site was gently air dried to reduce any possible contamination with saliva . paper strips were placed at a standardized depth of 1 mm at each sampling site independent from pd measurements and were left there for 30 seconds for each sampling . samples with evidence of bleeding were excluded and sampling was replicated from another site of the natural tooth that was not sampled . to eliminate the risk of evaporation , paper strips with gcf were immediately transported to previously calibrated , periotron 8000 ( oraflow inc . , the periotron 8000 was switched on and allowed to warm up before a blank paper strip was placed in the device and the reading dial was set to zero . the calibration of the device was checked with periodic intervals and performed by triplicate readings as previously described . the gcf was measured electronically in periotron units , which were converted to micro liters ( l ) by mcconvrt software ( software version 2.52 , oraflow inc . , gcf samples were then placed in sterile eppendorf tubes and stored at -80 c until the day of laboratory analysis . determination of nitrite / nitrate level of saliva and gcf the stable end products of no , nitrite , and nitrate were analyzed by griess reagent as described by grisham et al . saliva samples were centrifuged for 5 minutes at 10000 x g at 4 c to remove any particulate matter . to each gcf sample in the eppendorf tube , 130 ml of distilled water was added . for the determination of nitrite levels , 100 ml of the extract was mixed with 0,5 ml of freshly prepared griess reagent , using a micro plate . after 10 minutes of incubation at room temperature , the absorption of each sample in microplate wells was determined at 540 nm . a standard curve was prepared using sodium nitrite to calculate nitrite and nitrate concentration in saliva and gcf . categorical variables were evaluated by chi - square and extension of fisher s exact test to 3 x 3 table . parametric data were expressed as mean and standard deviation ( m [ sd ] ) . non - parametric kruskal- wallis test was used to compare the differences among healthy , gingivitis and periodontitis groups for continuous variables . age , gender , number of teeth present in mouth and smoking habit variables are listed on table 1 . gender , number of teeth present in mouth and smoking habits did not differ significantly between the groups . on the other hand , mean age of the chronic periodontitis group was significantly higher than periodontally healthy controls ( 42.65 [ 8.04 ] years and 29.9 [ 2.17 ] years ) ( p data regarding age , gender , number of teeth present and smoking habits statistically significant , dunn test . clinical periodontal parameters data regarding full - mouth pd and cal measurements and gi , gbti , pi scores for the study groups are given at table 2 . the differences in pd , cal and gi between all groups were significant ( p < 0.001 ) . gbti and pi scores were significantly higher in periodontitis ( 2.69 [ 0.53 ] and 1.19 [ 0.4 ] ) and gingivitis ( 2.33 [ 0.7 ] and 0.92 [ 0.39 ] ) groups than the control group ( 0.14 [ 0.13 ] and 0.1 [ 0.05 ] ) ( p < 0.001 ) . difference for these parameters did not reach to a significant level between periodontitis and gingivitis groups ( p > 0.05 ) . data regarding full - mouth probing depth ( pd ) , clinical attachment level ( cal ) measurements ( mm ) , gingival index ( gi ) , gingival bleeding time index ( gbti ) , plaque index ( pi ) scores , and saliva nitrite and nitrate level ( m ) for healthy ( 1 ) , gingivitis ( 2 ) and periodontitis ( 3 ) group statistically significant , dunn test . sd = standard deviation ; n / a = not available ; kw = kruskal - wallis test . table 3 provides information on the descriptive data for clinical parameters , gcf volume and nitrite / nitrate levels regarding individual evaluation of the sampled teeth . the differences regarding all clinical measurements and gcf volume differed significantly between all groups ( p < 0.001 ) . clinical parameters , including the gcf volumes , demonstrated gradual increases with the presence of gingival inflammation . data regarding individual probing depth ( pd ) , clinical attachment level ( cal ) measurements ( mm ) , gingival index ( gi ) , gingival bleeding time index ( gbti ) , plaque index ( pi ) scores , gcf volume ( l ) and total nitrate and nitrate level ( nmol ) of the sampled teeth statistically significant , dunn test . nitrite / nitrate levels in saliva and gcf salivary nitrite / nitrate levels ( m ) for the study groups are given at table 2 . total nitrite levels in gcf were higher in periodontitis and gingivitis ( 1.08 [ 0.59 ] nmol and 1.07 [ 0.62 ] ) groups than the control group ( 0.83 [ 0.31 ] nmol ) ( p < 0.001 ) . the difference in gcf nitrite level did not reach to a significant level between gingivitis and periodontitis groups ( p > 0.05 ) . gcf nitrate level did not differ significantly among the control , gingivitis and periodontitis groups ( 7.7 [ 2.71 ] nmol , 7.51 [ 4.16 ] nmol and 7.38 [ 1.91 ] nmol ) ( p > 0.05 ) . analysis of nitrate / nitrite ratio in saliva and gcf in the present study , nitrate / nitrite ratios in saliva and gcf were also evaluated ; the ratio was calculated with the division of nitrate by nitrite . saliva nitrate / nitrite ratios were higher in periodontitis and gingivitis groups ( 2.91 and 3.32 ) than the control group . on the other hand , gcf nitrate / nitrite ratio demonstrated a gradual decrease with the presence of inflammation . the indirect effects involve the actions of no metabolites ; reactive nitrogen species ( rns ) . an excess of reactive oxygen species ( ros ) and depletion of anti - oxidant levels in tissues results with oxidative stress . the indirect effects need no , activated by superoxide ( o2- ) or oxygen to form rns , then undergo consecutive reactions with their related biological targets . nitrosative stress also involves intermediates , produced from nitrosated thiol , hydroxy , and amine groups . oxidative and nitrosative stress are involved in many diseases and medical conditions , such as cancer , diabetes , atherosclerosis , congestive heart failure , myocardial infarction , metabolic syndrome and periodontitis [ 39 - 41 ] . a recent study has demonstrated the involvement of nitrosative stress in the aggravation of periodontitis under a diabetic condition , suggesting that nitrosative stress plays a crucial role in the development of diabetic - associated periodontitis . in another recent study , subantimicrobial dose doxycycline ( sdd ) therapy was used as an adjunct to srp treatment against nitrosative stress in chronic periodontitis . adjunctive sdd therapy was useful against inflammatory response by reducing the generation of nitrosative stress via inhibiting inos . although excessive production of no may be associated with bone loss in some inflammatory conditions , no also mediates beneficial effects of estrogen on bone by the no / cyclic guanosine monophosphate pathway . knockout mice deficient in endothelial nos exhibit osteoporosis as a result of a defect in bone formation . increased bone mineral density has been reported in mice deficient in all three isoforms of nos . on the other hand , in response to inflammation , inos is expressed , resulting in higher amounts of no production . increased numbers of inos positive cells have been demonstrated in periodontally diseased tissues [ 47 - 49 ] . another previous study has demonstrated that enhanced formation of no , increased inos production and consequent nitrosative stress play a significant role in the pathogenesis of periodontitis . in the present study , we evaluated nitrite and nitrate levels in gcf and saliva from patients with generalized gingivitis and chronic periodontitis . the level of nitrite in gcf of 147 healthy , 183 gingivitis and 150 chronic periodontitis sites were analyzed . in accordance with the literature [ 50 - 52 ] , the findings of this study demonstrated that gcf volumes exhibited clear increases at diseased sites compared to healthy sites . also the present study shows that inflammatory conditions increases gcf nitrite level significantly in comparison with control subjects . they studied nitrite and myeloperoxidase metabolism in both gcf and peri - implant sulcular fluid , and demonstrated a tendency to increase in these ingredients with the presence of gingival / peri - implant inflammation . on the other hand , in the present study , nitrate levels did not differ significantly among study groups . in order to evaluate the change in levels of nitrite and nitrate according to each other , nitrate / nitrite ratio was calculated . the gradual decrease in nitrate / nitrite ratio with the presence of inflammation and higher nitrite level in inflamed groups emphasizes that role of the nitrite in periodontal disease pathogenesis is more pronounced than nitrate . it might be speculated that nitrite may be a more beneficial indicator than nitrate . no production in saliva was also measured using the level of nitrite / nitrate in saliva of 20 gingivitis and 20 chronic periodontitis and 20 control subjects . almost equal nitrate levels in inflammatory groups may be due to quite similar values for the presence / extent of gingival inflammation and plaque accumulation detected in full mouth recording of gingivitis and chronic periodontitis groups or large overlap between study groups . based on the previously demonstrated discrepancy between concentration and total activity modes of data presentation for gcf , were not completely correlated . with respect to total activity level , this contrast between 2 modes of data presentation suggests the volume - dependent nature of the concentration expression . as the available gcf volume in a given site affects concentration expression , it may be suggested that gcf share similar volumetric features with respect to the appropriate mode of data presentation . in the present study , two biological fluids , gcf and saliva , although the results may shed light on the diagnostic potential of gcf , the results regarding saliva no level still remain controversial . nitrite and nitrate levels did not demonstrate any significant correlation between these two biological fluids . the broad similarity of clinical parameters , in particular with regard to pd , could explain the non - significant results between gingivitis and periodontitis sites concerning nitrite / nitrate levels . on the other hand , qualitative and quantitative evaluation of gcf is more specific for periodontal disease pathogenesis than saliva . it can be suggested that certain amount of no is derived from gcf to the saliva . further studies on this to evaluate and compare the components of saliva and gcf , especially with respect to the inflammatory process , no and nitrosative stress , are needed to increase our understanding of the role of each component and the diagnostic potential of these parameters and pathogenesis of periodontal disease . in the limits of the present study it can be suggested that gingival crevicular fluid seems to have a better diagnostic potential than saliva . this study is supported by hacettepe university , scientific research projects coordination unit , ankara , turkey .

abstractobjectivesnitrosative stress plays an essential role in the pathogenesis of periodontal disease . the aim of this study is to analyze the gingival crevicular fluid and saliva nitrite and nitrate levels in periodontally healthy and diseased sites.material and methodsa total of 60 individuals including , 20 chronic periodontitis and 20 gingivitis patients and 20 periodontally healthy controls participated in the present study . probing depth , clinical attachment level , bleeding on probing , gingival index and plaque index were assessed , gingival crevicular fluid ( gcf ) and saliva samples were obtained from the subjects , including 480 gcf samples and 60 unstimulated whole saliva samples . nitrite and nitrate were analyzed by griess reagent.resultstotal gcf nitrite levels were higher in gingivitis and periodontitis groups ( 1.07 [ sd 0.62 ] nmol and 1.08 [ sd 0.59 ] nmol ) than the control group ( 0.83 [ sd 0.31 ] nmol ) ( p < 0.05 ) but did not differ significantly between gingivitis and periodontitis groups ( p > 0.05 ) . the difference in gcf nitrate level was not significant among the control , gingivitis and periodontitis groups ( 7.7 [ sd 2.71 ] nmol , 7.51 [ sd 4.16 ] nmol and 7.38 [ sd 1.91 ] nmol ) . saliva nitrite and nitrate levels did not differ significantly among three study groups . saliva nitrate / nitrite ratios were higher in periodontitis and gingivitis groups than the control group . a gradual decrease in nitrate / nitrite ratio in gcf was detected with the presence of inflammation.conclusionsit may be suggested that nitrite in gingival crevicular fluid is a better periodontal disease marker than nitrate and may be used as an early detection marker of periodontal inflammation , and that local nitrosative stress markers do nt show significant difference between the initial and advanced stages of periodontal disease .

INTRODUCTION MATERIAL AND METHODS RESULTS DISCUSSION CONCLUSIONS ACKNOWLEDGMENTS AND DISCLOSURE STATEMENTS

myasthenia gravis ( mg ) is an autoimmune syndrome caused by a failure of neuromuscular transmission , which results in variable muscle weakness and is exacerbated by exercise ( 1 ) . autoantibodies against the muscle nicotinic acetylcholine receptor ( achr ) can be detected in approximately 80 - 85% of all patients with generalized mg ( 2,3 ) and in approximately 40% of anti - achr seronegative mg patients who have antibodies against muscle - specific kinase ( musk ) ( 3,4 ) . recently , the novel antigen , the low - density lipoprotein receptor - related protein 4 ( lrp4 ) , has been identified as a target for the autoantibodies in mg ( 5 ) , and anti - lrp4 antibodies were detected in the serum of approximately 2 - 46% of double seronegative mg ( dsmg ) patients ( 3,5 - 7 ) . in this report , we present a case of undiagnosed mg with an acute onset of respiratory insufficiency without either ocular or limb involvement . our study highlights the fact that making an early diagnosis of such cases can be very difficult . a 72-year - old japanese man was admitted to our department presenting with an 18-month history of dropped head . a neurological examination revealed mild neck extensor weakness ( mmt 4/5 ) , but there were no signs of weakness in the ocular , tongue , facial or limb muscles . the results of routine blood tests , including those for thyroid function and muscle enzymes , were normal . an arterial blood gas analysis of room air was paco2 55.9 mmhg and % vc ( vital capacity ) was 63.7% in spirometry , and he needed noninvasive positive - pressure ventilation ( nppv ) . a chest computer tomography ( ct ) scan showed no definite evidence of either pneumonia or pulmonary thromboembolism . no abnormalities were observed on magnetic resonance imaging ( mri ) of the brain and cervical spine and cerebrospinal fluid examination . repetitive nerve stimulation ( rns ) studies of the trapezius muscle showed about a 20% decrease in his compound muscle action potential , although rns studies in the orbicularis oculi and abductor digiti minimi muscles were normal . needle electromyography of the sternocleidomastoid and cervical paraspinal muscles showed a mild , low amplitude of the motor unit potentials . a muscle biopsy from the left biceps brachii muscles showed no significant lesions . the administration of an oral cholinesterase inhibitor ( pyridostigmine bromide , 60 mg three times daily ) or an intravenous immunoglobulin ( ivig , 400 mg / kg 5 days ) did not alleviate his respiratory symptoms . two months after admission , steroid pulse therapy ( methyl prednisolone 1,000 mg 3 days ) was started , and his respiratory and neck symptoms and hypercapnia thereafter markedly improved ( figure ) . we performed the steroid pulse therapy every week for three times , which allowed him to gradually withdraw from the nppv . subsequently , he was administered tacrolimus ( 3.0 mg / day ) , and he has since remained symptom - free for over 8 months . the patient s clinical course is shown we present the case of a dsmg patient with anti - lrp4 antibodies without a common phenotype . to the best of our knowledge , this is the first clinical report of mg with seropositivity for only anti - lrp4 antibodies showing predominantly respiratory symptoms . several reports have described the clinical features of mg patients with anti - lrp4 antibodies . one patient presented with isolated neck extensor weakness and the other showed ocular , bulbar and cervical symptoms . reported the clinical presentation of three dsmg patients with anti - lrp4 antibodies who showed isolated ocular symptoms and a good response to treatment with cholinesterase inhibitor and/or corticosteroids ( 9 ) . also described a case of mg presenting with bulbar symptoms and double seropositivity for anti - achr and anti - lrp4 antibodies ; this patient responded to cholinesterase inhibitor and corticosteroids ( 7 ) . all of these reported cases showed mild symptoms and a good response to the conventional treatments of mg . however , the typical clinical symptoms of mg patients with anti - lrp4 antibodies remain unclear because the number of detailed clinical reports is too small . our case suggests that mg patients with anti - lrp4 antibodies could show a dropped head as an initial symptom at presentation . studied the clinical data of over 800 mg patients and reported that the majority of dsmg patients with anti - lrp4 antibodies presented with ocular or mild generalized symptoms . they showed a positive response to cholinesterase inhibitors or corticosteroids , which was similar to the clinical features of mg patients with anti - achr antibodies ( 10 ) . it was also reported that 6.6% of mg patients with anti - lrp4 antibodies demonstrated myasthenic crisis , and that double seropositive mg patients ( especially anti - musk and anti - lrp4 antibodies ) had more severe symptoms , such as myasthenic crisis ( 10 ) . our case suggests that seropositivity for anti - lrp4 antibodies alone ( without anti - achr and/or anti - musk antibodies ) can induce respiratory symptoms . in our case , corticosteroid therapy elicited a good response , which was similar to that of the previously reported cases ( 7,9 ) . on the other hand , . indicated , 9.6% of mg patients with anti - lrp4 antibodies did not respond to treatment with cholinesterase inhibitors ( 10 ) . moreover , in our case , ivig was ineffective , whereas tacrolimus was effective and prevented the recurrence of myasthenic symptoms . . showed that 10 out of 32 mg patients with anti - lrp4 antibodies were treated with ivig , and 12 out of 28 patients were treated with azathioprine ; however , the outcome of these therapies was not described in the paper ( 10 ) . further accumulation of clinical data is therefore necessary to understand the effect of ivig and immunosuppressants on mg patients with anti - lrp4 antibodies . lrp4 is a member of the low - density lipoprotein receptor family and is known to bind directly to neural agrin ( 11 ) , which is necessary for the nmj ( neuromuscular junction ) formation and neural agrin - induced activation of musk and achr clustering ( 11 - 13 ) . higuchi et al . showed that anti - lrp4 sera from mg inhibited the interaction between lrp4 and neural agrin ( 5 ) . shen et al . reported that anti - lrp4 sera decreased cell surface lrp4 levels and inhibited both agrin - induced musk activation and achr clustering ( 14 ) . they also demonstrated that immunization with the extracellular domain of lrp4 causes muscle weakness in mice ( 14 ) . moreover , recent studies in mice show that the loss of muscle lrp4 alone is sufficient to cause myasthenic symptoms ( 15 ) . on the other hand , because it has been also recently reported that anti - lrp4 antibodies are present in the serum and cerebrospinal fluid of patients with amyotrophic lateral sclerosis ( als ) ( 16 ) , the specificity of the anti - lrp4 antibodies for mg remains controversial ( 17 ) . acute neuromuscular respiratory failure is caused not only by mg , but also by other diseases , such as guillain - barr syndrome , myopathies and als ( 18 ) . it is often challenging to diagnose mg at an early phase because it rarely presents as isolated respiratory muscle weakness ( 19 ) . this presentation suggests that neurologists should consider mg with anti - lrp4 antibodies in the differential diagnosis of patients presenting with unexplained dyspnea .

we herein report the case of a 72-year - old man demonstrating myasthenia gravis ( mg ) with a dropped head and acute respiratory insufficiency . there was no ocular , bulbar , or limb involvement . the patient was seronegative for anti - acetylcholine receptor ( achr ) antibodies and anti - muscle - specific tyrosine kinase ( musk ) antibodies . subsequent tests showed seropositivity for anti - low - density lipoprotein receptor - related protein 4 ( lrp4 ) antibodies . the addition of steroid pulse therapy resulted in a full remission of his respiratory symptoms . this presentation suggests that lrp4-positive mg should be considered in the differential diagnosis of patients presenting with acute respiratory insufficiency without either cranial or limb involvement .

Introduction Case Report Discussion The authors state that they have no Conflict of Interest (COI).

multiple myeloma ( mm ) is a human b - cell neoplasm characterized by the clonal expansion of malignant plasma cells in the bone marrow . the cause of this disease is only partially understood , but the production of soluble factors by the myeloma cells is likely to be involved . the most important complications are hypercalcemia associated with rapid skeletal dissolution , acute or chronic renal insufficiency , and infection . all these , along with less common complications such as the hyperviscosity syndrome , hyperuricemia , and neurologic involvement , must be recognized and managed appropriately to achieve optimal results from primary therapy . the serum hyperviscosity syndrome has been described clinically as the triad of bleeding , visual signs and symptoms , and neurologic manifestations ( 1 , 2 ) . this oncologic emergency occurs in patients with igm , igg , and iga monoclonal gammopathies as well as in some patients with polyclonal immunoglobulin disorders ( 3 ) . we reported a patient with hyperviscosity - induced cerebral infarction as the first sign of igg multiple myeloma based on clinical , laboratory , brain mri , and bone marrow biopsy . a 68-yr - old right - handed woman was admitted to chonnam national university hospital on 6 march , 2002 due to hypesthesia and monoplegia in the left leg . other neurological examinations were normal except monoplegia , hypesthesia , increased deep tendon reflex ( 3 + ) with ankle jerks , and up - going babinski in the left leg . diffusion- and t2-weighted mri revealed a hyperintense lesion in the callosomarginal territory of the right anterior cerebral artery , and mr angiography did not show significant stenosis on the intra- and extracranial artery ( fig . laboratory data were as follows : hematocrit 26.6% ( normal , 37 - 52 ) , hemoglobin 8.2 g / dl ( normal , 12 - 18 ) , erythrocyte sedimentation rate 127 mm / hr ( normal , below 20 ) , leukocyte 4.610/l ( normal , 4.3 - 10.8 ) and platelet counts 19010/l ( normal , 130 - 400 ) . the prothrombin time was 80.8% ( 13.3/80.8/1.13 ; sec/%/inr ) of that of control ; partial thromboplastin time was 27.1 sec ( normal , 26.5 - 41 ) . the plasma level of protein c and s activity were in the normal range . serum creatinine was 0.6 mg / dl ( normal , 0.6 - 1.5 ) , serum sodium 137 meq / l ( normal , 135 - 153 ) , potassium 4.1 meq / l ( normal , 3 - 5 ) , total calcium 7.1 mg / dl ( normal , 8.6 - 10.6 ) , ionized calcium 2.4 meq / l ( normal , 2.0 - 2.4 ) , and uric acid 1.5 mg / dl ( normal , 2.4 - 7 ) . the total serum protein concentration was 9.6 g / dl ( normal , 6.0 - 8.0 ) , albumin was 1.8 g / dl ( normal , 3.5 - 5.5 ) , and globulins were 7.8 g / dl . serum protein electrophoresis ( spep ) revealed hyperproteinemia , hypoalbuminemia and a prominent spike at the gamma - globulin region ( fig . 2 ) . levels of immuno - globunins were as follows : igg 6,060 mg / dl ( normal , 700 - 1,600 ) , iga 23.1 mg / dl ( normal , 70 - 400 ) , igm 55.4 mg / dl ( normal , 40 - 230 ) , ige 17.8 mg / dl ( normal , 0.0 - 100 ) and 2-microglobulin 1.08 mg / l ( normal , 0.7 - 3.4 ) . her relative serum viscosity at 37 was 5.2 ( normal , 1.4 to 1.8 ) . random urine protein was 23 mg / dl ( normal , 1.0 - 14.0 ) , but bence - jones protein was negative in urine . roentgenograms revealed multiple lytic lesions of the skull and right 6th rib , and compression fracture of 9th thoracic vertebrae body . she was treated by chemotherapy ( cyclophosphamide 200 mg / m per day ) with steroid pulse and then prednisone ( 70 mg / day ) for 5 days , where and she remained on intermittent chemotherapy . every four weeks , routine blood tests and levels of immunoglobulins were performed . at 3 months , there was no recurrence of hyperviscosity syndrome or stroke during the follow - up of 25 months . the typical features of multiple myeloma include bone pain , weakness , fatigue , fever and infection . neurologic symptoms occur in a minority of patients with multiple myeloma : hypercalcemia may produce lethargy , weakness , depression , and confusion ; bony damage and collapse may lead to spinal cord compression , radicular pain , and loss of bowel and bladder control ; a bulky cranial multiple myeloma invading cerebrum may result in quadriparesis and headache ( 4 ) ; infiltration of peripheral nerves by amyloid can be a cause of carpal tunnel syndrome and other sensorimotor mono- and polyneuropathies ; hyperviscosity may lead to headache , fatigue , visual disturbances , retinopathy , dementia ( 5 , 6 ) , and cerebral infarction ( 7 , 8) . however , one bears in mind that multiple myeloma may be present with a neurological disease . hyperviscosity is defined on the basis of the relative viscosity of serum as compared with water . whereas normal relative serum viscosity is 1.8 , symptoms of hyerviscosity occur at a level of 5 to 6 , a level usually reached at paraprotein concentrations of approximately 40 g / l for igm , 50 g / l for igg3 , and 70 hyperviscosity occurs relatively infrequently in patients with multiple myeloma , but one study reported an incidence of 4.2% among patients with igg protein ( 10 ) . its occurrence has been ascribed to the presence in the serum of high molecular weight polymers of the igg proteins . in our case , major neurologic deficits occur in more than 25% of patients with myeloma and hyperviscosity syndrome ( 10 - 12 ) . lethargy , hemiparesis , seizures , coma , and acute confusional states are most frequently cited . we reported a 68-yr - old patient who developed monoplegia of the left leg as the first manifestation of multiple myeloma with hyperviscosity . this case was rare in that it involved plasma cell leukemia with cerebral infarction associated with serum hyperviscosity . we searched for cases of multiple myeloma with hyperviscosity presenting with cerebral infarction , and found only 2 reports ( 13 , 14 ) . clinical conditions in which this possible role of hyperviscosity in cerebral infarction could be demonstrated have not been reported so far . in another reported cases of cerebral infarction in multiple myeloma , our case had no significant atherosclerotic lesion on intra- and extracranial vessels , and no risk factors of stroke except old age . therefore , we suggest that hyperviscosity plays a key role in the pathogenesis of stroke in her with multiple myeloma , our case then , is consistent with the hypothesis that chronic blood hyperviscosity antedates the onset of symptomatic cerebrovascular disease . thus , in patients with multiple myeloma , the monitoring of plasma viscosity was of major importance in order to evaluate the risk of cerebral infarction and decide the management for the prevention of stroke . we believe that our patient represents a rare case of igg multiple myeloma associated with blood hyperviscosity and cerebral infarction . based on our case study , and a review of the literature , we suggest that markedly elevated level of serum globulin in a patient with cerebral infarction requires measurement of blood viscosity , especially in patients with multiple myeloma .

cerebral infarction is an uncommon complication in multiple myeloma with hyperviscosity . serum hyperviscosity may cause a variety of clinical manifestations including bleeding from mucosal membranes , congestive heart failure , retinopathy , and various neurologic deficits . these manifestations have been attributed to the presence of large quantities of asymmetrical molecules of high molecular weight in the serum . we recently experienced a case of multiple myeloma with acute cerebral infarction , which caused by hyperviscosity , as an initial manifestation in igg multiple myeloma , and reviewed the relevant literature of myeloma presenting with the stroke . a 68-yr - old woman abruptly developed hypesthesia and monoplegia in the left leg . the stroke confirmed by the brain mri and mr angiography , which revealed acute infarction at the right anterior cerebral artery territory . on admission , routine blood tests showed a slight decrease in hemoglobin and a marked increase in erythrocyte sedimentation rate . peripheral blood smear , serum protein electrophoresis , serum visocity , and bone marrow aspiration showed that she had igg multiple myeloma with hyperviscosity . she was treated by chemotherapy with cyclophosphamide and discharged with the improved clinical condition .

INTRODUCTION CASE REPORT DISCUSSION

cardiovascular disease ( cvd ) is a global health problem and one of the leading causes of hospitalization and death . influenza virus , types a and b , are the common causes of highly contagious acute respiratory illnesses . for most people , the illness usually resolves after about one week , but severe illness can occasionally lead to death. cvd patients are at higher risk than the general population for developing serious complications from influenza infection , which may also increase the risk of cardiovascular complications. in addition , the association between influenza infection and acute myocardial infarction ( ami ) has been documented in several studies . acute influenza infection may cause high fever , tachycardia or dehydration , increasing the myocardial oxygen demand and precipitating the ami . additionally , there is evidence supporting the role of influenza virus in the initiation of atherosclerotic plaque transformation to the plaque causing acute coronary syndrome. furthermore , the benefits of influenza vaccination in the reduction of cardiovascular events have been shown in randomized , controlled trials. international guidelines strongly recommend annual influenza vaccination in persons with coronary and other atherosclerotic vascular disease . , there are numerous barriers to influenza vaccination including the lack of awareness of its benefits by both patients and physicians , the common belief that vaccination is unnecessary , or that vaccination itself causes illness , and concerns about the possible adverse effects of vaccination in patients taking antiplatelet or anticoagulants. before the introduction of intradermal influenza vaccine , all influenza vaccines were administered through subcutaneous , or intramuscular routes . , after evidence showing strong immune response against influenza by intradermal vaccination , , the micro - needle injection system for intradermal influenza vaccine was developed . , furthermore , in the elderly population where the immune response to influenza vaccine is lower than in the younger one , 15 g intradermal vaccine provided comparable , or superior immunogenicity to intramuscular vaccine. however , there are no data regarding the safety and tolerability in cvd patients . therefore , this study was conducted to assess the safety , side effect profile , and tolerability of influenza vaccine in these patients . this was an observational study in patients who had undergone vaccination against seasonal influenza with intradermal vaccination . the study was approved by the chiang mai university ethics committee and was done in accordance with the helsinki declaration and good clinical practice . the present study enrolled patients aged 18 years , who had been regularly followed at the cardiology clinic of maharaj nakorn chiang mai hospital and received intradermal influenza vaccination . subjects who had hypersensitivity to egg or chicken proteins , neomycin , formaldehyde or octoxinol-9 , or had febrile illness , or acute infection were excluded . intradermal influenza vaccine 9 g and 15 g were given to patients who were younger , and older , than 60 years , respectively . all eligible individuals were asked for participation sequentially as they presented for vaccination to reduce selection bias . data were collected using a self - administered , written questionnaire completed by the patient just after seasonal influenza vaccination with intradermal influenza vaccine . the questionnaires captured the data of baseline characteristics , history of influenza vaccine injection , perceived risk of contracting influenza ; motivation for seeking vaccination , the patients ' acceptability of intradermal influenza vaccine and the willingness to receive the vaccine the following year . the pain rating scale ( range from 0 to 10 for no pain to the most intense pain sensation ) was used to assess the pain quality . patients ' medical history including cvd , co - morbidities and current medications were retrieved from medical records . eight days after vaccination , patients were contacted by telephone to inquire about any medical safety issues , side effects of intradermal vaccination and the patients ' intentions for the next influenza season . the patients were then followed up by telephone every month for the symptoms of upper respiratory tract infection , hospitalization for respiratory tract infection , unplanned hospitalization for cvd , including acute coronary syndrome or heart failure . data were presented as mean sd for continuous variables and as percentage for categorical data . all statistical analyses were performed using spss ( spss statistic 17.0 , chicago , spss inc . ) . the present study enrolled patients aged 18 years , who had been regularly followed at the cardiology clinic of maharaj nakorn chiang mai hospital and received intradermal influenza vaccination . subjects who had hypersensitivity to egg or chicken proteins , neomycin , formaldehyde or octoxinol-9 , or had febrile illness , or acute infection were excluded . intradermal influenza vaccine 9 g and 15 g were given to patients who were younger , and older , than 60 years , respectively . all eligible individuals were asked for participation sequentially as they presented for vaccination to reduce selection bias . data were collected using a self - administered , written questionnaire completed by the patient just after seasonal influenza vaccination with intradermal influenza vaccine . the questionnaires captured the data of baseline characteristics , history of influenza vaccine injection , perceived risk of contracting influenza ; motivation for seeking vaccination , the patients ' acceptability of intradermal influenza vaccine and the willingness to receive the vaccine the following year . the pain rating scale ( range from 0 to 10 for no pain to the most intense pain sensation ) was used to assess the pain quality . patients ' medical history including cvd , co - morbidities and current medications were retrieved from medical records . eight days after vaccination , patients were contacted by telephone to inquire about any medical safety issues , side effects of intradermal vaccination and the patients ' intentions for the next influenza season . the patients were then followed up by telephone every month for the symptoms of upper respiratory tract infection , hospitalization for respiratory tract infection , unplanned hospitalization for cvd , including acute coronary syndrome or heart failure . data were presented as mean sd for continuous variables and as percentage for categorical data . all statistical analyses were performed using spss ( spss statistic 17.0 , chicago , spss inc . ) . from 225 vaccinated patients in cardiology clinic , 169 patients were recruited into the study . the mean age of the study population was 63 12 years and 52.1% were women . established cvd comprised stable coronary artery disease in 88 ( 52.1% ) patients ; recent acute coronary syndrome 33 ( 19.5% ) ; valvular heart disease 37 ( 21.9% ) and dilated cardiomyopathy 8 ( 4.7% ) . reported co - morbidities included hypertension 101 ( 59.8% ) , diabetes 49 ( 29.0% ) , dyslipidemia 99 ( 58.6% ) and chronic kidney disease 21 ( 12.4% ) . most of the patients received antithrombotic agents which included aspirin 79 ( 46.7% ) , clopidogrel 6 ( 3.6% ) , dual antiplatelets 23 ( 13.6% ) , warfarin 43 ( 25.4% ) and warfarin with single antiplatelet agent 2 ( 1.1% ) . most of the patients [ 159 ( 94.1% ) patients ] considered that they were at risk for influenza infection due to chronic illness ( table 1 ) and 141 ( 83.4% ) patients were vaccinated upon the advice of their doctors . two - thirds of the patients ( 107 patients , 63.3% ) never received influenza vaccination , while 31 ( 18.3% ) received influenza vaccination every year , 18 ( 10.7% ) every two years and 13 ( 7.7% ) less often than every two years . reasons cited for not being vaccinated against influenza in the past year included not being encouraged 71 ( 71.9% ) , the perception that they were not at risk 4 ( 3.7% ) , the fear that they would contact influenza after vaccination 13 ( 12.1% ) and the concern of local adverse effects of injection 13 ( 12.1% ) , ( table 1 ) . to be vaccinated in the future , the main convincing factors for patients were the annual advice from the physician and the postcard , or e - mail from the hospital in 136 ( 80.5% ) and 22 ( 13.0% ) , respectively ( table 2 ) . among 62 patients that had previously received intramuscular influenza vaccination , 59 ( 95.2% ) preferred the intradermal vaccination in the following year . immediately post vaccination , the pain score ( range 010 ) was 0 , 1 or 2 in 76 ( 45% ) , 25 ( 14.8% ) , and 48 ( 28.4% ) patients , respectively ( figure 1 ) . there was only one ( 0.6% ) patient had a pain score more than five . at day 8 after vaccination , 159 patients ( 94.1% ) were contacted by telephone ; only 32 ( 20.1% ) developed symptoms in the vaccinated area . the most common symptoms were itching 19 ( 11.9% ) , swelling 9 ( 5.7% ) , and hive 6 ( 3.8% ) ( table 3 ) . the common systemic symptoms were fatigue and subjective symptoms of fever in 9 ( 5.7% ) and 6 ( 3.8% ) , respectively . one hundred and fifty - six patients ( 98.1% ) would prefer to have intradermal vaccination in the following year . during 12 months , of 169 patients , 17 ( 10.7% ) patients experienced symptoms of upper respiratory tract infection , but none was hospitalized for respiratory tract infection . four ( 2.4% ) patients were hospitalized due to acute coronary syndrome and 12 ( 7.5% ) patients were hospitalized due to heart failure . the causes of death included myocardial infarction ( 1 ) , heart failure ( 1 ) , sudden cardiac death ( 1 ) , stroke ( 1 ) , renal failure ( 1 ) and sepsis ( 1 ) . most of the patients [ 159 ( 94.1% ) patients ] considered that they were at risk for influenza infection due to chronic illness ( table 1 ) and 141 ( 83.4% ) patients were vaccinated upon the advice of their doctors . two - thirds of the patients ( 107 patients , 63.3% ) never received influenza vaccination , while 31 ( 18.3% ) received influenza vaccination every year , 18 ( 10.7% ) every two years and 13 ( 7.7% ) less often than every two years . reasons cited for not being vaccinated against influenza in the past year included not being encouraged 71 ( 71.9% ) , the perception that they were not at risk 4 ( 3.7% ) , the fear that they would contact influenza after vaccination 13 ( 12.1% ) and the concern of local adverse effects of injection 13 ( 12.1% ) , ( table 1 ) . to be vaccinated in the future , the main convincing factors for patients were the annual advice from the physician and the postcard , or e - mail from the hospital in 136 ( 80.5% ) and 22 ( 13.0% ) , respectively ( table 2 ) . among 62 patients that had previously received intramuscular influenza vaccination , 59 ( 95.2% ) preferred the intradermal vaccination in the following year . immediately post vaccination , the pain score ( range 010 ) was 0 , 1 or 2 in 76 ( 45% ) , 25 ( 14.8% ) , and 48 ( 28.4% ) patients , respectively ( figure 1 ) . there was only one ( 0.6% ) patient had a pain score more than five . at day 8 after vaccination , 159 patients ( 94.1% ) were contacted by telephone ; only 32 ( 20.1% ) developed symptoms in the vaccinated area . the most common symptoms were itching 19 ( 11.9% ) , swelling 9 ( 5.7% ) , and hive 6 ( 3.8% ) ( table 3 ) . the common systemic symptoms were fatigue and subjective symptoms of fever in 9 ( 5.7% ) and 6 ( 3.8% ) , respectively . one hundred and fifty - six patients ( 98.1% ) would prefer to have intradermal vaccination in the following year . during 12 months , of 169 patients , 17 ( 10.7% ) patients experienced symptoms of upper respiratory tract infection , but none was hospitalized for respiratory tract infection . four ( 2.4% ) patients were hospitalized due to acute coronary syndrome and 12 ( 7.5% ) patients were hospitalized due to heart failure . the causes of death included myocardial infarction ( 1 ) , heart failure ( 1 ) , sudden cardiac death ( 1 ) , stroke ( 1 ) , renal failure ( 1 ) and sepsis ( 1 ) . this observational study was the first study of intradermal influenza vaccination acceptability in cvd patients . the intradermal influenza vaccination was safe and well tolerated in cvd patients , including patients taking antithrombotic agents . the benefits of influenza vaccination have been established in patients with coronary artery disease leading to the recommendation as a secondary prevention. , nevertheless , the vaccine coverage rate is still low . , there are several barriers cited by patients and physicians to vaccination . in this study , the lack of encouragement from physician , lack of patients ' awareness of being at risk and concern for contracting influenza after vaccination were the important objections , which are similar to the findings of other studies . the awareness of physician and health care team to educate the patients about the benefit and risk of vaccination , as well as encouraging patients to receive the vaccine , should be the main tools to expand vaccine coverage . the safety of intramuscular injection has been demonstrated in patients with coagulopathy , and patients taking oral anticoagulation . intramuscular influenza vaccination in patients taking warfarin has also been shown to be safe in a prospective cross - over study . the mean prothrombin times , expressed as the international normalized ratio ( inr ) warfarin weekly dose , and time in therapeutic range were similar after receiving the vaccine or placebo with no major bleeding events . nevertheless , concerns about bleeding complications from influenza vaccination in cvd patients taking antiplatelets and anticoagulants could be an important physicians ' barrier to vaccination . in our study therefore , the micro - needle injection system for intradermal vaccination offers comparable immunogenicity to intramuscular influenza vaccine , but higher acceptability and greater preference especially in the elderly could be a useful tool to improve vaccine coverage . first , this is an observational study , and therefore , characterized by less stringency as opposed to randomized , prospective , blinded research . however , this study provides the real life practice regarding safety of intradermal influenza vaccine . the intradermal influenza vaccination was safe and well tolerated with high rates of satisfaction in cvd patients . first , this is an observational study , and therefore , characterized by less stringency as opposed to randomized , prospective , blinded research . . however , this study provides the real life practice regarding safety of intradermal influenza vaccine . the intradermal influenza vaccination was safe and well tolerated with high rates of satisfaction in cvd patients .

backgroundit is well - established that influenza vaccination reduces adverse cardiovascular outcomes in patients with cardiovascular diseases ( cvd ) , however , the vaccine coverage rate in most countries remains low . the concern about the local adverse effects of intramuscular injection , particularly in cvd patients receiving antithrombotic therapy , is one of the important impediments . this study was conducted to assess the safety , side effects and tolerability of intradermal influenza vaccine in cvd patients.methodsthis was an observational study in adult cvd patients who had undergone vaccination against seasonal influenza by intradermal vaccination between may 16th and may 30th , 2012 at maharaj nakorn chiang mai hospital . the medical history , patients ' acceptability and adverse effects were collected using a written questionnaire completed by the patient immediately following vaccination and by a telephone survey eight days later.resultsamong 169 patients , 52.1% were women and the mean age was 63 12 years . coronary artery disease , valvular heart disease and dilated cardiomyopathy were present in 121 ( 71.6% ) , 40 ( 23.7% ) and 8 ( 4.7% ) , respectively . antithrombotics were used in 89.3% . after vaccination , the pain score was 0 , 1 or 2 ( out of 10 ) in 44.4% , 15.1% , and 27.6% of the patients , respectively . eight days after vaccination , the common adverse reactions were itching 19 ( 11.9% ) , swelling 9 ( 5.7% ) and fatigue ( 4.7% ) . no hematoma or bruising was reported.conclusionsthe intradermal influenza vaccination is safe and well tolerates with high rates of satisfaction in cvd patients . this technique should be useful in expanding influenza vaccine coverage .

Introduction Methods Population Data collection Statistical analysis Results Vaccination history and opinions Safety and tolerability Discussion Study limitations Conclusions

the main objective of combined antiretroviral therapy ( cart ) is to fully and permanently suppress the human immunodeficiency virus ( hiv ) replication and to achieve a plasma viral load ( vl ) level below the limit of detection by ultra- sensitive techniques ( in general < 20 - 50 copies of hiv rna per ml of plasma ) . the immediate consequence is a self recovery of the immune system enough to dramatically reduce the incidence of new aids and non - aids associated events and the overall mortality . this is feasible in almost 100% of nave patients complying with the prescribed medications . in the real world , however , the virologic failure rate at 48 weeks is about 5 - 10% and even higher when studies are prolonged up to 96 - 144 weeks or longer . the hiv is wild type in about 30 - 50% of failing patients ( failures due to lack of adherence to the prescribed regimen ) . resistance associated mutations ( to one or more components of the cart ) can be detected in the remaining 50 - 70% of failing patients ( less frequently when the initial regimen contains a ritonavir boosted protease inhibitor ) . the resistance profile after failure to first cart is relatively predictable and the response to a second line regimen is usually high even when resistance tests are not available and the salvage regimen are selected exclusively on the basis of best clinical judgment . conversely , after two or more consecutive failing regimens most patients have accumulated a variety of resistance mutations ( some of them only detectable under pharmacologic pressure if the usual bulk sequencing methodology is used ) . in these circumstances , and just a few years ago , response rate ( measured as percentage of patients below 50 copies / ml at 48 weeks ) was very low ( < 20 - 30% ) even when the new optimized cart was guided by the results of resistance tests ( genotypic or phenotypic ) . the " modern " era of salvage cart started with the introduction of enfuvirtide ( a new class of drugs without cross resistance to already existing classes ) followed by tipranavir , darunavir and etravirine [ 10 - 13 ] ( already existing classes but higher genetic barrier to resistance and only partial cross resistance to older members of the same class ) and later on by raltegravir , elvitegravir ( still in development ) and maraviroc ( newer classes and no cross resistance with drugs of other classes ) . as a consequence , the emerging paradigm in the field of salvage therapy was to achieve a viral load below limit of detection in almost all patients . pretty soon it became apparent that this was feasible in more than 70 - 90% of patients as long as : 1 ) at least 3 active drugs could be included in the optimized regimen ; 2 ) the optimization was guided by the results of a resistance test ( genotypic or phenotypic ) and eventually by the co - receptors tropism determination when maraviroc was considered and 3 ) the patient complied with the prescribed medications . raltegravir ( the first approved hiv-1 integrase inhibitor ) is able to block the strand transfer step of the hiv proviral dna integration process into the cellular host dna . the ic95 in human t lymphoid cell cultures is around 30 nmol and its " potency " after 10 days of monotherapy in antiretroviral nave patients is approximately 2 log10 hiv-1 rna copies / ml of plasma . rapidly absorbed after oral administration has a terminal half life of 7 - 12 h ( being a potential qd drug ) . however , the selected dosage for the pivotal phase iii studies ( subsequently approved by the regulatory agencies ) was 400 mg bid by oral route with or without food . raltegravir is primarily metabolized by glucuronidation ( ugt1a1 enzyme ) with a weak effect ( either inhibition or induction ) on the hepatic cytochrone p450 activity . there is no need of dose adjustments in renal insufficiency or in mild - to - moderate hepatic impairment . no clinically relevant interactions have been reported between raltegravir and other antiretrovirals except a moderate increase in raltegravir concentrations ( 25 - 95% depending on the parameter measured ) when combined with atazanavir and somewhat less evident when atazanavir was boosted with ritonavir . rifampin substantially reduces the levels of raltegravir but with raltegravir doses of 400 - 800 mg bid therapeutic levels may still be achievable . the 005 phase ii protocol was a multicentric randomized study including 179 patients with a plasma viral load above 5000 copies / ml and resistance to at least one nrti , one nnrti and one pi ( table 1 ) . patients were assigned to an optimized background therapy ( obt ) based on the results of the resistance tests plus raltegravir ( 200 , 400 or 600 mg bid ) or a placebo . the randomization was stratified by the concomitant utilization of atazanavir ( that is able to increase the exposition to raltegravir ) and also by the concomitant utilization of enfuvirtide . the main end - point was the viral load drop at 24 weeks but at 16 weeks open label utilization raltegravir was allowed if virologic response was not detected . at 24 weeks the proportion of patients with a plasma viral load < 50 copies / ml was similar in the three raltegravir arms and ranged between 56% and 66% and was only 13% in the placebo arm . after week 24 the dose of raltegravir was 400 mg bid in all patients on raltegravir ( this is the dose selected for phase iii studies on the basis of the 005 and other studies and subsequently approved by the regulatory authorities ) . there are plans to continue the study up to 144 weeks . the response rate ( < 50 copies / ml ) for all pooled raltegravir arms at weeks 48 and 96 were 55% and 48% respectively ( very similar to the 56 - 66% at 24 weeks ) . most of the patients assigned to a raltegravir arm with lack of virologic response , or failure after responding , were receiving a functional monotherapy with raltegravir ( none of the components of the obt were fully active according to the resistance score ) . a genotypic resistance test could be performed in 38 of these patients of whom 35 selected resistance mutations in the integrase gene following the n155h or the q148h / r / k path almost always associated with one additional mutation . the n155h or the q148h / r / k alone are associated with high or intermediate levels of resistance that became of very high level when additional mutations are selected . consequently , raltegravir is a very potent and durable drug but with a low - intermediate genetic barrier . tolerance up to week 96 was very good ( only 4% discontinuations due to adverse events ) and similar to the tolerance of placebo up to weeks 16 - 24 . the benchmrk i and ii studies ( also known as 018 and 019 protocols ) ( table 1 ) have been the pivotal phase iii studies leading to raltegravir approval for salvage therapy . despite the main end - point was the percentage of patients below 400 copies / ml at 16 weeks we now have data of the pooled analysis of both studies at 48 and 96 weeks measured as percentage of patients < 50 copies / ml . there was a 2:1 randomization with 462 patients assigned to raltegravir ( 400 mg bid ) and 237 to placebo . inclusion criteria required a virological failure ( > 1000 copies / ml ) and resistance to at least one member of the nrti , nnrti and pi families . all commercially available drugs were allowed in the optimized background including darunavir / r or tipranavir / r ( both of them in expanded access or compassionate use at that moment ) . in the pooled analysis ( itt , nc = f ) at 48 weeks the response rate ( < 50 copies / ml ) was 62% in the raltegravir and 33% in the placebo arm ( p < 0.001 ) ( figure 1 ) . the response rates at 96 weeks were similar ( 57% and 26% in the raltegravir and placebo arms respectively ) . cd4 response was also significantly better in the raltegravir arm ( 109 cells/l vs 45 cells/l ) . side effects potentially related with study medication were rare and similar in both arms with less than 1% interruptions due to intolerance in both arms ( around 3 per 100 person - years ) . the superiority of raltegravir vs placebo was still significant after adjusting for the baseline characteristics of the patients ( demographic , viral load , cd4 + t cell count and genotypic and phenotypic score ) . of note , near 50% of the raltegravir patients vs almost none ( 3% ) of the placebo recipients were below 50 copies / ml at 48 weeks despite a baseline resistance ( genotypic or phenotipic score ) of zero ( functional monotherapy with raltegravir ) , suggesting both that the genetic barrier of raltegravir is not so low and that some components of the obt retained some level of activity despite a theoretical score of zero . conversely , when the obt contains two or event more active drugs the raltegravir still contributes with additional activity ( 70% response vs 40 - 60% respectively ) . moreover , the response rate is near 90% when raltegravir was used with darunavir / r and enfuvirtide in patients never exposed to these drugs ( figure 2 ) . overall , by week 96 resistance tests were available for 112 raltegravir treated patients of whom 73% had integrase mutations at one of the three positions ( y143c / h / r , q148h / k / r n155h ) almost always in combination with at least one other mutation . most resistance mutations were observed by week 24 and in only 7 cases after week 48 . virologic outcome in the bencmrk studies stratifying by previously exposure to darunavir / ritonavir and enfuvirtide . nothe a near 90% response rate among first time users of raltegravir , darunavir / ritonavir and enfuvirtide . the french trio trial ( anrs139 ) further reinforces that a high level response rate is achievable in salvage therapy when 3 fully active drugs are included in the regimen . they included 103 failing patients ( vl > 1000 copies / ml ) nave to raltegravir , darunavir / r and etravirine and susceptible to these drugs . they received a cart with these three drugs and the response rate ( < 50 copies / ml ) was 90% at 24 weeks and 86% at 48 weeks . these results were duplicated in a smaller ( 32 patients ) but similar trial with a response rate of 94% ( < 50 copies / ml ) at 24 weeks . in virologically suppressed patients switching from enfuvirtide to raltegravir has been tested in at least one randomized study and in two open studies . in the french randomized easier study ( anrs138 ) 85 patients were assigned to continue with enfuvirtide and 85 patients to switch from enfuvirtide to raltegravir while the remaining drugs were maintained . in both arms at 24 weeks near 90% of the patients had a plasma viral load below 50 copies / ml . at this time point the patients on enfuvirtude were switched to raltegravir . at 48 weeks again near 90% patients in both arms remained below 50 copies / ml of plasma . similar results were obtained in two open lable studies including 52 and 35 patients respectively . consequently , the option of switching from enfuvirtide to raltegravir in suppressed patients never exposed to raltegravir con be accepted as an effective and safe alternative . the switchmrk studies 1 and 2 ( protocols 032 and 033 ) included 702 virologicaly suppressed patients randomized to continue on lopinavir / r containing regimen or to switch from lopinavir / r to raltegravir . the co - primary end points were lipid changes at week 12 , virologic response at week 24 ( non - inferiority hypothesis with 12% margin ) and safety and tolerability . while lipid changes were significantly better in the experimental raltegravir arm none of the two studies were able to demonstrate non - inferiority of the raltegravir arm ( 87% vs 81% in the 032 protocol and 94% vs 88% in the 033 protocol ; lower limit of the 95% ci of -14 , 4 and -12 , 2 respectively . most likely explanation for the excess of virological failures in the raltegravir arms were presence of archived mutations to the background antiretrovirals due to previous virological failures and consequently these patients were exposed to functional raltegravir monotherapy . once again the switchmrk studies underlined the relatively low genetic barrier of raltegravir as compared with a ritonavir boosted protease inhibitor like lopinavir / r . the possibility of switching from ritonavir boosted pi to raltegravir is probably save as long as the patients have not archived resistance mutations to the background drugs and this hypothesis is being tested in the spanish spiral switch study . the possibility of eradicating the hiv-1 in virologicaly suppressed patients ( < 50 copies / ml ) intensifying the regimen by adding raltegravir or alternatively efavirenz , lopinavir / r or atazanavir / were not able to reduce the residual viremia when an ultra sensitive single - copy assay was used . this data are in favor of the hypothesis that residual viremia is not due to ongoing level replication as opposed to cellular release ( by latently infected cells ) of replicative competent viral particles .

raltegravir , the first approved hiv-1 integrase inhibitor , is able to block the strand transfer step of the hiv proviral dna integration process into the cellular host dna . the selected dosage for the pivotal phase iii studies ( subsequently approved by the regulatory agencies ) was 400 mg bid by oral route with or without food . raltegravir has a week effect ( either inhibition or induction ) on the hepatic cytochrone p450 activity . there is not need of dose adjustments in renal insufficiency or in mild - to - moderate hepatic impairment.the emerging paradigm in the field of salvage therapy was to achieve a viral load below limit of detection in almost all patients . pretty soon it became apparent that this was feasible in more than 70 - 90% of patients.raltegravir proved to be pivotal for this new paradigm . raltegravir vs placebo both with an optimized background therapy has been tested for salvage therapy in the 005 and in the benchmrk studies ( 018 and 019 ) . in all three studies proved to be superior to the placebo at 24 , 48 and 96 weeks . tolerance was remarkably good and virological failure was often associated with selection of integrase gene resistance mutations following the y143c / h / r , q148h / k / r o less frequently the ni55h paths.finally , in the two switchmrk studies non - inferiority vs lopinavir / r could not be demonstrated in virogically suppressed patients with an stable cart containing lopinavir / r . most likely explanation was the presence of archived resistance mutationts to background therapy leading to a functional monotherapy with raltegravir .

1. Background 2. Raltegravir 3. Raltegravir in Experienced Patients: Salvage Therapy 4. Raltegravir in Experienced Patients: Switching Studies in Virologically Suppressed Patients 5. Raltegravir in Experienced Patients: Intensification Studies

more leisure time for hobbies , hiking , and trekking has led to more mushroom exposures . increased demands for uncultivated food or gastronomic delights have contributed to more mushroom poisoning . although severe mushroom poisonings and fatalities remain infrequent , the proportions of fatal mushroom poisonings among confirmed mushroom ingestions seems to be increasing ( 1 ) . in addition to increasing poisoning of known toxic mushroom , new mushroom syndromes have been described ( 23 ) . the severe patient with r. subnigricans mushroom poisoning was reported to present with rhabdomyolysis , severe electrolyte disturbance ( hyperkalemia , hypocalcemia ) , acute renal failure , respiratory failure , pulmonary edema , ventricular tachycardia , and circulatory shock ( 45 ) . in this case report , we present a patient poisoned by r. subnigricans mushroom complicated with rhabdomyolysis , acute kidney injury ( aki ) , severe hypocalcemia , respiratory failure , ventricular tachycardia , and cardiogenic shock , leading to death . a 51-year old man had a breakfast cooked with wild mushrooms that he had gathered one day earlier during summer vacation in august , 2010 at the jujak mountain located on the province of jeollanam - do , the southern area of korea . he had no particular past medical or social history other than the occasional ingestion of wild mushrooms during recreational hiking . he did not have a history of trauma , infection , other known underlying cause , or medication use that could explain the occurrence of rhabdomyolysis . he shared the meal with his wife and son who did not eat any more mushrooms due to nausea after ingesting a single piece of mushroom . six hours later , he began to complain of vomiting , diarrhea , and myalgia . he visited a local hospital where his general condition worsened and systolic bp fell to 60 mmhg requiring dopamine treatment and endotracheal intubation . twenty - eight hours after ingestion of the mushrooms , he was transferred to the intensive care unit of our hospital . at the time of admission , he was alert , but acute ill - looking . blood pressure was 80/56 mmhg , heart rate 121/min , respiratory rate 25/min , and body temperature 36.3c . laboratory tests showed the following : hemoglobin 15.9 g / dl , hematocrit 45.9% , leukocyte count 20,740/l with neutrophil 89.6% , platelet 253,000/l , c - reactive protein ( crp ) 8.36 mg / dl , blood urea nitrogen ( bun ) 38.5 mg / dl , serum creatinine 2.84 mg / dl , serum osmolarity 314 mosm / kg , sodium 140 meq / l , potassium 4.7 meq / l , chloride 100 meq / l , ionized calcium 0.75 mmol / l , glucose 187 mg / dl , cholesterol 221 mg / dl , albumin 4.0 g / dl , aspartate aminotransferase ( ast ) 1,214 u / l , alanine aminotransferase ( alt ) 343 u / l , total bilirubin 0.51 mg / dl , alkaline phosphatase 92 iu / l , creatine kinase ( ck ) 69,121 u / l , ck - mb > 500 ng / ml , lactate dehydrogenase ( ldh ) 2,196 u / l , troponin i 1.86 ng / ml , n - terminal pro brain natriuretic peptide ( nt - pro bnp ) 7,414 pg / ml , amylase 1,930 u / l , lipase 18 u / l , prothrombin time ( pt ) 10.2 seconds . ( inr 0.86 ) , activated partial thromboplastin time ( aptt ) 28.2 seconds , urine osmolarity 341 mosm / kg , sodium 22 meq / l , potassium 59.2 meq / l , chloride 14 meq / l , creatinine 123.8 mg / dl , myoglobin 51.7 ng / ml , and fractional excretion of sodium 0.36% . urine analysis showed ph 5.0 , specific gravity 1.020 , protein 2 + , ketone 2 + , blood 4 + , rbc 5 - 9/high - power field , and wbc 0 - 1/high - power field . arterial blood gas analysis was ph 7.04 , paco2 69 mmhg , pao2 172 mmhg , and hco3 18.7 mmol / l . the enlarged left ventricle ( lv ) , severe lv systolic dysfunction ( ejection fraction 30% ) , and akinesia of lv mid to apex wall suggesting stress induced cardiomyopathy were noted on echocardiography . he received ventilator support , hemodynamic monitoring , continuous venovenous hemodiafiltration , and conservative care including intravenous fluid and electrolyte repletion . seventy hours after ingestion of the mushrooms , bun 41.9 mg / dl , serum creatinine 3.46 mg / dl , ast 3,271 u / l , alt 1,254 u / l , total bilirubin 1.55 mg / dl , ck 121,397 u / l , ck - mb > 500 ng / ml , ldh 6,102 u / l , troponin i 11.77 ng / ml , amylase 2,779 u / l , lipase 601 u / l , pt 42.1 seconds . ventricular tachycardia developed , and he died due to cardiogenic shock 72 hours after ingestion of the mushrooms . the leftover samples of the mushrooms that he had ingested were sent to agricultural microbiology division , national academy of agricultural science , rural development administration , suwon , korea . those were identified as r. subnigricans by their gross morphology ( fig . the worldwide incidence of mushroom poisoning appears to be increasing due to increased human demands for uncultivated food or hallucinogenic mushrooms . the proportion of severe and fatal mushroom poisonings among confirmed mushroom ingestions has demonstrated statistically significant increases . deaths , although rare , occurred most commonly from the ingestion of amanita species , primarily amanita phalloides , in adult amateur mushroom hunters ( 16 ) . in addition to increasing poisons following ingestions of known species , formerly edible or new mushroom species are causing newly recognized syndromes from mushroom poisonings . several new syndromes in mushroom poisoning have been described since the early 1990s ( 123 ) : accelerated nephrotoxicity ( non - orellanine - induced renal failure ) , erythromelalgia , rhabdomyolysis , and delayed neurotoxicity ( convulsive or non - convulsive encephalopathy ) . rhabdomyolysis is a new type of mushroom poisoning caused by ingestion of tricholoma equestre ( 1347 ) . some of these cases with rhabdomyolysis are associated not only with renal dysfunction and electrolyte disturbance ( hyperkalemia , hypocalcemia ) , but also with respiratory and cardiac complications ( arrhythmia , cardiovascular collapse ) leading to death ( 4 ) . an outbreak of russula subnigricans poisoning with rhabdomyolysis occurred in taiwan ( 5 ) . the most severely ill patient presented with rhabdomyolysis , severe electrolyte disturbance ( hyperkalemia , hypocalcemia ) , respiratory failure , acute renal failure , pulmonary edema , ventricular tachycardia , and circulatory shock . japan has also experienced several cases of fatal poisoning with rhabdomyolysis caused by ingestion of this mushroom ( 311 ) . r. eccentrica , r. nigricans and r. subnigricans have been recorded in korea ( 12 ) . poisonous r. subnigricans can be mistaken with non - poisonous , edible r. eccentrica and r. nigricans . r. subnigricans can be found associated with broad - leaved evergreen tree habitat which is present and restricted to the southern area of korean peninsula . this report of our case represents the first record of r. subnigricans poisoning with rhabdomyolysis in korea . rhabdomyolysis , the dissolution of skeletal muscle , is a rare but potentially fatal condition . the common causes of rhabdomyolysis are trauma , exertion , muscle hypoxia , infections , body temperature changes , metabolic and electrolyte disorders , drug and toxins , and genetic defects . the incidence of rhabdomyolysis in acute poisonings was the highest in poisonings with opiates , pesticides , neuroleptics , anticonvulsants , and ethyl alcohol ( 1314 ) . in our case , severe rhabdomyolysis with aki , severe hypocalcemia , respiratory failure , ventricular tachycardia , and cardiogenic shock were noted throughout the clinical course . there was no history of trauma , strenuous exercise , seizures , and loss of consciousness . the possible cause of rhabdomyolysis after ingestion of the mushroom may be the mushroom toxin , such as cycloprop-2-ene carboxylic acid , isolated from r. subnigricans . this compound may be responsible for fatal rhabdomyolysis as a toxic trigger for some biochemical reactions ( 1011 ) . the mechanism involved in the pathogenesis of rhabdomyolysis is depletion of atp within the myocyte , leading to an unregulated increase in intracellular calcium , resulting in disintegration of the myocyte . it usually results from calcium entering the damaged myocyte and from the precipitation of calcium phosphate in necrotic muscle . intrarenal vasoconstriction , direct and ischemic tubular injury , and tubular obstruction all may play a role in myoglobin - induced aki ( 13 ) . cardiogenic shock due to severe lv systolic dysfunction might be caused by the mushroom toxin ( 451516 ) . general management of mushroom poisoning is fluid resuscitation , early gastric decontamination by both gastric lavage and multiple dose activated charcoal , and baseline laboratory assessment . since mushroom - poisoned patients often experience vomiting and diarrhea , emetics and cathartics are rarely indicated . treatment should be directed by the patient 's clinical manifestation ( 117 ) . the mushroom poisoning with rhabdomyolysis is usually associated with volume depletion that is due to the sequestration of water in damaged muscles . therefore , the early , aggressive repletion of fluids is the main step of management . , early hypocalcemia should not be treated unless it is symptomatic or unless severe hyperkalemia is present , since the calcium load could increase the precipitation of calcium phosphate in necrotic muscle ( 13 ) . continuous venovenous hemofiltration or hemodiafiltration has shown some efficacy in removing myoglobin ( 18 ) . however , the evidence is from case reports , and the effect on outcomes is unknown . if renal or hepatic function is worsening , patients should be transferred to the hospital equipped for hemodialysis and kidney or liver transplantation ( 1 ) . intra - aortic balloon counterpulsation can be considered as a final treatment option in the mushroom poisoning with cardiogenic shock ( 15 ) . correct categorization and better understanding are essential for the safe and healthy consumption of mushrooms ( 19 ) . since mushroom toxicity may be dose - related , overconsuming mushrooms should be avoided ( 1 ) . furthermore , r. subnigricans should be considered in the mushroom poisoning with rhabdomyolysis . to confirm the exact diagnosis , leftover raw or cooked mushrooms should be collected and sent to a mycologist for gross and spore identification .

mushroom exposures are increasing worldwide . the incidence and fatality of mushroom poisoning are reported to be increasing . several new syndromes in mushroom poisoning have been described . rhabdomyolytic mushroom poisoning is one of new syndromes . russula subnigricans mushroom can cause delayed - onset rhabdomyolysis with acute kidney injury in the severely poisoned patient . there are few reports on the toxicity of r. subnigricans . this report represents the first record of r. subnigricans poisoning with rhabdomyolysis in korea , describing a 51-year - old man who suffered from rhabdomyolysis , acute kidney injury , severe hypocalcemia , respiratory failure , ventricular tachycardia , cardiogenic shock , and death . mushroom poisoning should be considered in the evaluation of rhabdomyolysis of unknown cause . furthermore , r. subnigricans should be considered in the mushroom poisoning with rhabdomyolysis .

INTRODUCTION CASE DESCRIPTION DISCUSSION

ameloblastic fibro - odontoma ( afo ) is a benign , slow growing , expansile epithelial odontogenic tumor with odontogenic mesenchyme . it may inhibit tooth eruption or displace involved teeth although teeth in the affected area are vital [ 13 ] . radiography shows a well - defined , radiolucent area containing various amounts of radiopaque material of irregular size and form [ 4 , 5 ] . the lesions are usually diagnosed during the first and second decades of life [ 46 ] . it occurs with equal frequency in the maxilla and the mandible and with equal frequency in males and females . microscopically , the lesion is composed of strands , cords , and islands of odontogenic epithelium embedded in a cell - rich primitive ectomesenchyme , resembling the dental papilla . many authors reported that afo is not aggressive and can be treated adequately through a surgical curettage to the lesion without removal of the adjacent teeth [ 1 , 4 , 5 , 7 , 8 ] . an 11-year - old girl presented to our department on referral from another dentist to have a second opinion about a lesion involving the left mandible . she had radiographic examinations , including panoramic , helical , and cone - beam computed tomography . these examinations were accompanied by a presumptive radiographic differential diagnosis of odontoameloblastoma : complex odontoma and afo . the medical , social and family histories were unremarkable , as were the results of a review of systems and a physical examination . the clinical examination did not display any sign of pain or swelling in the left mandible . the initial panoramic radiography revealed a well - defined radiolucent region , which contained an irregular radiopaque mass 3 cm in diameter . this lesion occupied a zone from the lower left second molar area to the left ramus . helical and cone - beam computed tomography showed an expansile well - circumscribed lesion containing at the interior a calcified mass compatible with odontogenic tissue ( figures 2 and 3 ) . considering the clinical and radiographic examinations , our presumptive diagnosis was complex odontoma . the patient underwent enucleation of the lesion and careful curettage of the surgical cavity under general anesthesia . the surgical specimen was fixed in neutral buffered 10% formalin and subjected to pathological analysis . light microscopic examination of sections stained with hematoxylin and eosin revealed strands and islands of odontogenic epithelium showing peripheral palisading and loosely arranged central cells , identical to stellate reticulum , embedded in a myxoid cell - rich stroma resembling the dental papilla ( figure 4 ) . in the present case , the patient presented to our department with previous examinations , including panoramic , helical and cone - beam computed tomography . while these radiographic examintions were given a presumptive diagnosis of odontoameloblastoma by the examinaing radiologists , we believed that the findings were more common in this region . odontoameloblastoma , also known as ameloblastic odontoma , has a more aggressive behavior , similar to an ameloblastoma rather than an odontoma . afo is a benign tumor that exhibits the same benign biologic behavior as that of ameloblastic fibroma , showing inductive changes that lead to the formation of both dentin and enamel . conversely , the term odontoameloblastoma ( or ameloblastic odontoma ) refers to tumors representing a histological combination of ameloblastoma and complex odontoma , which behave in the invasive manner of classic ameloblastoma . according to the revised world health organization ( who ) classification , ameloblastic fibroma and afo cahn and blum postulated that ameloblastic fibroma ( the histologically least differentiated tumor ) develops first into a moderately differentiated form , following afo and eventually into a complex odontoma.however , the concept that these lesions represent a continuum of differentiation is not widely accepted , with other researchers suggesting that they are separate pathologic entities [ 1215 ] . in some studies , the term afo represents a histological combination of ameloblastic fibroma and complex odontoma [ 12 , 16 ] . the majority now agrees that afo exists as a distinct entity , but it can be histologically indistinguishable from immature complex odontoma . the arrangement of the soft tissues and the development stage of the involved tooth are useful criteria for diagnosis . despite numerous efforts , however , there is still considerable confusion concerning the nature of these lesions . afo is relatively rare , with the prevalence among oral biopsies being about 1% and its frequency among odontogenic tumors being reported at 1% to 3% [ 3 , 18 ] . this lesion usually occurs in people less than 20 years old , and age is thus an important characteristic in the differential diagnosis . this lesion is usually found in the molar area [ 6 , 12 ] , and the distribution is roughly equal between the maxilla and mandible [ 6 , 12 ] . many authors reported that afo can be treated adequately through a surgical curettage without removal of the adjacent teeth [ 1 , 4 , 5 , 7 , 8 ] . as noted in the literature , not all lesions previously classified as afo are , in fact , aggressive lesions . if there is a recurrence accompanied by a change of the histological pattern toward a more unorganized fibrous stroma with displacement of the epithelial component , then more extensive treatment procedures appear to be indicated . long - term follow up with short intervals should be maintained in the management of afo .

an 11-year - old girl presented to our department to have a second opinion regarding a lesion involving her left mandible . she had previously undergone several radiographic exams including panoramic , helical , and cone - beam computed tomography . radiographic examinations revealed a well - defined radiolucent region , which contained an irregular radiopaque mass of 3 cm in diameter , localized to the left angle of the mandible . our presumptive diagnosis was complex odontoma . excisional biopsy was performed , and microscopic features showed strands and islands of odontogenic epithelium showing peripheral palisading and loosely arranged central cells , identical to stellate reticulum , embedded in a myxoid cell - rich stroma resembling the dental papilla . dentin and enamel were also presented . the diagnosis was ameloblastic fibro - odontoma , which is a rare mixed odontogenic tumor , derived from epithelial and ectomesenchymal elements that form the dental tissues .

1. Introduction 2. Case Description 3. Discussion

endometrial stromal sarcomas ( ess ) are uncommon mesenchymal tumors of the uterus which are composed of cells closely resembling normal proliferative endometrial stromal tissue . traditionally , ess were classified into low - grade and high - grade ess based on mitotic rate . high - grade tumors however , have little resemblance to original endometrial stroma . therefore , high - grade tumors are presently classified as undifferentiated endometrial or uterine sarcoma . in this classification the differentiation between low - grade and undifferentiated tumors is not made on mitotic count but on the presence of nuclear pleomorphism and necrosis . standard treatment for ess is total abdominal hysterectomy and bilateral salpingo - oophorectomy . when there is extra - uterine spread complete debulking of all tumor is recommended . we present a patient presenting with rectal bleeding , based on a very late recurrence of a formerly misdiagnosed low grade ess metastasized to the colon . a 78 year old woman presented with rectal bleeding and recurrent lower urinary tract infections in july 2009 . her medical history showed a total abdominal hysterectomy and bilateral salpingo - oophorectomy because of a uterus myomatosus with severe blood loss in 1983 and a laparotomy with excision of a retroperitoneal cyst in 1992 . our patient underwent a colonoscopy which revealed a malignant circumferential obstructing tumor 28 cm from the anal verge ( fig . computed tomography showed a suspicious tumor of 8 cm , at the site of the sigmoid , closely related to the urinary bladder . urine analysis revealed some atypical cells , but no signs for urinary tract infection or malignant cells . a hartmann 's resection was performed with a partial cystectomy which was closed primarily and the patient received a urinary catheter for one week . one month postoperative she underwent intraperitoneal stomal revision , because of a retracted necrotizing colostomy . pathologic examination showed a submucosal low grade ess of 8 cm in diameter arising from the colon with nodular invasion of the mesocolon and three lymph nodes which all contained metastases of ess ( figs . 2 and 3 ) . resection margins were free from tumor . in the context of this finding revision of the original resections of the retroperitoneal cyst and the uterus and adnexa this revision revealed , both histomorphological as well as immunophenotypical , an equivalent aspect as the newly resected colon tumor . final pathologic diagnosis therefore , was a very late colonic recurrence of a low grade uterine ess . endometrial stromal sarcomas are rare tumors , contributing for 0.2% of all uterine malignancies and 715% of all uterine sarcomas . initially , histological classification consisted of carcinosarcomas ( 40% ) , leiomyosarcomas ( 40% ) , ess ( 15% ) and undifferentiated sarcomas ( 5% ) . currently , the carcinosarcomas have been reclassified as a differentiated or metaplastic form of endometrial carcinoma according to the international federation of gynaecology and obstetrics ( figo ) classification . ess are difficult to diagnose because of close resemblance to normal proliferative endometrial cells , and because of the rarity of the condition . prior to surgical resection ess are often misdiagnosed as leiomyoma or other uterine benign diseases and after resection also histological examination frequently misses the diagnosis . incidence peaks occur in premenopausal women between 40 and 55 years of age who are asymptomatic or present with vaginal bleeding or pelvic or abdominal pain . ess can occur in patients with endometriosis and in patients with a prolonged exposure to estrogens , e.g. patients with polycystic ovarian disease , or after estrogen use or tamoxifen therapy . it is thought that the exposure to estrogens causes a proliferative effect on the endometrial stroma . patients with stage i ii tumors have a 5-year overall survival of 89.3% compared to 50.3% in patients with stage iii iv tumors . tumor behaviour is apprehensive for a tendency of late recurrence . in patients with stage i disease , the median time to recurrence is 65 months compared to 9 months in patients with stage iii recurrences occur in 3656% of patients , most frequently in the pelvic cavity or the lungs . metastatic spread to the cerebrum and bones and invasion in the great vessels have also been described . recurrences arising in the small bowel and colon are intimately associated with endometriosis . as the rectosigmoid has the highest incidence of intestinal endometriosis , ess arising within endometriosis our patient developed a very late recurrence in the rectosigmoid , although she had no history of endometriosis . pathologic revision did not reveal any signs of endometriosis , but the presence of a small endometriosis spot as an origin for the metastasis can not be excluded . standard treatment for ess is total abdominal hysterectomy with bilateral salpingo - oophorectomy , even at premenopausal ages . they are often sensitive to hormones and it is presumed that patients preserving their ovaries have a higher risk of recurrence and poorer overall outcome . some studies advocate considering re - exploration for removal of ovaries while others state that ovarian preservation has no effect on recurrences or overall survival . in premenopausal women ovaries are frequently preserved , which does not affect the risk of recurrence in stage i patients . lymph node metastases have been found in 7% of patients with low - grade ess . performing a lymph node dissection , regardless of the finding of any microscopic positive nodes , five - year survival is 85.7% in lymph node positive patients compared to 95.2% in lymph node negative patients . post - operative radiotherapy decreases the risk of local recurrence , especially in grade ii postoperative treatment with chemotherapy could might be an option in patients with hormone - unresponsive tumors and for inoperable patients . hormonal therapy can be an important treatment because of the hormonal sensitivity of the tumor . adjuvant progestagens should be considered in patients with ess . in patients with completely resected low - grade ess tamoxifen and estrogens are contraindicated because of the possible stimulative effect on disseminated endometrial stromal cells . our patient underwent a hysterectomy in 1983 because of a uterus myomatosus accompanied with severe blood loss and excision of a retroperitoneal cyst in 1992 . that means our patient probably had stage i ess in 1983 , which was initially not recognized as ess , but was probably regarded as a cell rich variant of leiomyoma . after nine years she developed the first retroperitoneal recurrence . at this time the tumor was detected as a malignant mesenchymal tumor , but was not recognized as ess . a recurrent ess localized in the submucosa of the colon , in the absence of endometriosis , with fixation to the urinary bladder is a very rare finding . the accompanying lymphogenic spread is uncommon . during the first surgery , at 52 years of age , our patient underwent a hysterectomy for a uterus myomatosus with bilateral oophorectomy . she never took hormonal replacement therapy except for local estrogens for a few weeks and she was not familiar with endometriosis . prior to her third surgery in 2009 , she was diagnosed with recurrent lower urinary tract infections . urine analysis revealed some atypical cells , presumably due to tumor invasion in the urinary bladder . final pathologic examination of the operatively removed tumor however , could not confirm spread of tumor into the bladder wall , since no urinary bladder wall was recognized in the specimen . patient was discussed in our multidisciplinary oncology panel and because of the controversy about adjuvant therapy in the treatment of ess , in combination with the radical surgery and the long disease free period after the primary presentation and the first recurrence , no additional treatment was advised and follow up will take place on a regular base once a year . tumor behaviour is apprehensive for a tendency of late recurrence . in patients with stage i disease , the median time to recurrence is 65 months compared to 9 months in patients with stage iii recurrences occur in 3656% of patients , most frequently in the pelvic cavity or the lungs . metastatic spread to the cerebrum and bones and invasion in the great vessels have also been described . recurrences arising in the small bowel and colon are intimately associated with endometriosis . as the rectosigmoid has the highest incidence of intestinal endometriosis , ess arising within endometriosis our patient developed a very late recurrence in the rectosigmoid , although she had no history of endometriosis . pathologic revision did not reveal any signs of endometriosis , but the presence of a small endometriosis spot as an origin for the metastasis can not be excluded . standard treatment for ess is total abdominal hysterectomy with bilateral salpingo - oophorectomy , even at premenopausal ages . they are often sensitive to hormones and it is presumed that patients preserving their ovaries have a higher risk of recurrence and poorer overall outcome . some studies advocate considering re - exploration for removal of ovaries while others state that ovarian preservation has no effect on recurrences or overall survival . in premenopausal women ovaries are frequently preserved , which does not affect the risk of recurrence in stage i patients . lymph node metastases have been found in 7% of patients with low - grade ess . performing a lymph node dissection , regardless of the finding of any microscopic positive nodes , five - year survival is 85.7% in lymph node positive patients compared to 95.2% in lymph node negative patients . post - operative radiotherapy decreases the risk of local recurrence , especially in grade ii postoperative treatment with chemotherapy could might be an option in patients with hormone - unresponsive tumors and for inoperable patients . hormonal therapy can be an important treatment because of the hormonal sensitivity of the tumor . adjuvant progestagens should be considered in patients with ess . in patients with completely resected low - grade ess tamoxifen and estrogens are contraindicated because of the possible stimulative effect on disseminated endometrial stromal cells . our patient underwent a hysterectomy in 1983 because of a uterus myomatosus accompanied with severe blood loss and excision of a retroperitoneal cyst in 1992 . that means our patient probably had stage i ess in 1983 , which was initially not recognized as ess , but was probably regarded as a cell rich variant of leiomyoma . after nine years she developed the first retroperitoneal recurrence . at this time the tumor was detected as a malignant mesenchymal tumor , but was not recognized as ess . a recurrent ess localized in the submucosa of the colon , in the absence of endometriosis , with fixation to the urinary bladder is a very rare finding . the accompanying lymphogenic spread is uncommon . during the first surgery , at 52 years of age she never took hormonal replacement therapy except for local estrogens for a few weeks and she was not familiar with endometriosis . prior to her third surgery in 2009 , she was diagnosed with recurrent lower urinary tract infections . urine analysis revealed some atypical cells , presumably due to tumor invasion in the urinary bladder . final pathologic examination of the operatively removed tumor however , could not confirm spread of tumor into the bladder wall , since no urinary bladder wall was recognized in the specimen . patient was discussed in our multidisciplinary oncology panel and because of the controversy about adjuvant therapy in the treatment of ess , in combination with the radical surgery and the long disease free period after the primary presentation and the first recurrence , no additional treatment was advised and follow up will take place on a regular base once a year . in conclusion , low - grade ess are uncommon tumors of the uterus with an indolent clinical course and favourable prognosis . total abdominal hysterectomy with bilateral salpingo - oophorectomy is the treatment of choice . in patients with a history known for ess , a recurrence if recurrence occurs , radical surgery should be performed and adjuvant hormonal therapy may be considered . there was no financial support for the conduct of the study and the writing of the manuscript . written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request .

introductionendometrial stromal sarcomas are rare mesenchymal neoplasms of the uterus with an indolent clinical course but a high risk of recurrence.presentation of casewe report a case of a 78 year old woman who presented with rectal bleeding and recurrent urinary tract infections , caused by a very late recurrence of a formerly misdiagnosed low grade endometrial stromal sarcoma , metastasized to the colon.discussionendometrial stromal sarcomas are difficult to diagnose , both due to the rarity of the tumor and because of the close resemblance of the tumor to normal stromal tissue . these tumors are known for a high tendency of recurrence , therefore long term follow up is required in patients with endometrial stromal sarcoma.conclusionin patients with a history known for endometrial stromal sarcoma recurrence should always be considered .

Introduction Presentation of a case Discussion Recurrence Treatment Conclusion Conflict of interest Funding Ethical approval Author contributions

systemic sclerosis ( ssc ) is an autoimmune disease of unknown etiology that is characterized by vascular dysfunction and cutaneous and visceral fibrosis . women are more frequently affected than men at a ratio of 4 : 11 , and the peak incidence occurs in the fourth and fifth decades of life . the prevalence appears to be increasing due to improved survival in recent decades . the symptoms with greater prognostic impact that are the main causes of death in ssc patients are pulmonary fibrosis ( pf ) and pulmonary arterial hypertension ( pah ) . although the pathogenesis of ssc remains unclear , genetic factors are thought to contribute to the disease . the hla ( human leukocyte antigen ) genes have been implicated in the susceptibility to ssc and in its clinical and serological manifestations [ 410 ] . class i ( hla a , b , and c ) and class ii ( hla dr , dq , and dp ) molecules are expressed on the cell surface and participate in antigen presentation and t lymphocyte activation . class i molecules also activate natural killer ( nk ) cell receptors , and class ii molecules appear to stimulate the secretion of il-6 and monocyte chemotactic protein ( mcp-1 ) by fibroblasts , especially in antibody antitopoisomerase ( ata ) associated clinical forms . susceptibility to the disease was found to be associated with the hla - dqa1 * 0501 and dqb1 * 0301 alleles in all ethnic groups . the drb1 * 1104 allele was associated with ssc in caucasian and hispanic patients , whereas drb1 * 0804 was correlated with the disease in african americans and drb1 * 1502 with japanese and koreans . hla - drb1 * 01 and drb1 * 11 ( mainly drb1 * 1101 and drb1 * 1104 ) were also associated with ssc . a multicenter study ( gwas , genome wide association study ) established hla - dqb1 as the main allele related to susceptibility . zhou et al . found an association of hla - dpb1 and dpb2 with increased susceptibility to the disease , primarily associated with ata . hla - a*30 , a*32 , b*57 , cw14 , drb1 * 0701 , dqa1 * 0201 , dqb1 * 0202 , and drb1 * 1501 were identified as protectors [ 4 , 13 ] . however , much stronger correlations have been demonstrated between certain hla alleles and each of the ssc - specific autoantibodies , which may be clinically relevant because each autoantibody subset of scleroderma is associated with certain disease features and has different prognostic implications [ 14 , 1822 ] . ata antibodies have a higher frequency of the hla - drb1 * 1104 , dqa1 * 0501 , dqb1 * 0301 , and dpb1 * 1301 alleles . caucasian patients were associated with hla - dr5 [ 2325 ] , corresponding to drb1 * 05 , and japanese patients were associated with hla - dr2 , drb1 * 15 , or drb1 * 16 in the current nomenclature . the anticentromere antibody ( aca ) was related to the hla - drb1 * 01 , drb1 * 04 , dqa1 * 0101 , and dqb1 * 0501 alleles [ 7 , 12 , 13 , 23 ] . considering the clinical features , the hla - drb1 allele has been associated with the limited cutaneous form ( lcssc ) and b*62 , drb1 * 11 ( drb1 * 1104 ) , and drb1 * 07 with the diffuse cutaneous form ( dcssc ) [ 4 , 9 ] . some previous studies reported a correlation of the internal organ involvement of ssc and autoimmune patterns with different specific serological hla statuses , and these associations appeared to differ according to ethnicity [ 7 , 13 ] . a high frequency of the drw6 and drb3 alleles related to pah has been described by langevitz et al . some class i alleles were also related , such as a*30 , b*13 , b*65 , and b*35 , which appear to play a role in the production of endothelin-1 ( et-1 ) in ssc [ 27 , 28 ] . * 01 , drb1 * 03 , and dqb1 * 0501 were also related to pah and aca [ 29 , 30 ] . similarly , the dr52a and cw*0602 alleles were found more frequently in ssc with pf [ 4 , 26 ] . other alleles described for pf in the presence of ata are drb1 * 11 ( drb1 * 1104 ) [ 10 , 31 ] , dpb1 * 1301 , and dqb1 * 0301 [ 29 , 30 ] . in brazil , a south american country with a multiethnic population , there has been no study concerning hla and ssc . the aims of this study were to evaluate hla involvement in the disease expression and to correlate the hla alleles with the poor prognostic clinical features in patients diagnosed with ssc at a university referral hospital in the city of campinas , state of sao paulo , brazil . we evaluated patients diagnosed with ssc who were followed for a period of 3 years ( 20082011 ) in the rheumatology department at the university of campinas teaching hospital , a tertiary referral hospital located in the state of so paulo , brazil . the clinical data on the patients , who were all unrelated ethnically , were obtained through a records review . the ssc diagnosis was based on the american college of rheumatology ( acr ) criteria for ssc . all patients were evaluated for gender , visceral involvement , and laboratory test results and underwent a routine rheumatology examination . they were classified according to cutaneous involvement as having the diffuse , limited , or sine scleroderma forms . gastrointestinal ( gi ) involvement , pf , and pah were the visceral involvements that were considered . limited disease was defined as definite skin thickening confined to the distal extremities , whereas diffuse disease showed the additional involvement of the skin proximal to the knees and elbows . the sine scleroderma form was defined according to established criteria [ 32 , 33 ] . the presence and pattern of the antinuclear antibody ( ana ) were also evaluated . gi tract involvement was confirmed by imaging studies ( contrast radiography , esophageal emptying scintillography , and intestinal transit ) and upper gastrointestinal endoscopy . pah was defined when the right ventricular pressure was higher than 40 mmhg by doppler echocardiogram . the alteration in the systolic pulmonary artery , as it is an examiner - dependent result , was confirmed with another echocardiogram after a minimum interval of two months . when possible , these patients underwent confirmatory cardiac catheterism ( medium pulmonary arterial pressure 25 mmhg ) . pf was investigated by pulmonary function testing and high resolution computed tomography ( hrct ) and was diagnosed when the forced vital capacity or total lung capacity ( tlc ) was less than 70% of the predicted value . the main ct findings were hyperdense pulmonary nodules , ground glass , reticular opacities , and traction bronchiectasis . dna was extracted from whole blood using a commercial kit ( illustra blood genomic prep mini spin kit / ge healthcare bio - sciences ab , buckinghamshire , uk ) . hla classes i and ii genotyping was performed by the polymerase chain reaction amplification ( pcr ) technique using specific primer sequences ( one lambda inc / generic class i and generic class ii , ca , usa ) . the association among the hla alleles , different clinical features , and gender was investigated using fisher 's exact test and pearson 's corrected chi - square test . p values 0.05 were considered significant after correction for the number of alleles with a frequency higher than 5% ( nonrare allele ) . the delta method was used to calculate the confidence interval ( variance ) of the prevalence ratio ( pr ) . this series included 141 patients , with 120 ( 85.1% ) women and 21 ( 14.9% ) men . regarding the clinical form , 47 ( 33.3% ) had dcssc , 88 ( 62.4% ) had lcssc , and 6 ( 4.3% ) had sine scleroderma ssc . we also classified patients based on the main antinuclear antibody ( ana ) patterns . the centromeric pattern was present in 25 patients ( 17.7% ) , nucleolar in 23 ( 16.3% ) , and other patterns in 61 ( 43.3% ) . there was no evidence of an association between gender and any of the features considered ( clinical forms , visceral involvement , or ana and hla alleles ) . we found no association of the hla alleles with the clinical forms of the disease ( diffuse , limited , and sine scleroderma ) or with the main patterns of ana that were considered ( centromeric and nucleolar ) . concerning the clinical manifestations , evidence of an association was found between pf and pah ( p = 0.017 ) . , there was an association with class i hla - a*30 ( p = 0.020 ) and class ii drb1 * 01 ( p = 0.004 ) , dqb1 * 05 ( p < 0.001 ) , and dqb1 * 04 ( p = 0.019 ) . the a*30 and dqb1 * 04 alleles were more frequent in patients with pf than in patients without pf . the presence of these two alleles was related to a higher risk for interstitial lung disease ( pr = 1.86 and pr = 1.70 , resp . ) . however , the hla - drb1 * 01 and dqb1 * 05 alleles appeared to be protective ( pr = 0.38 and pr = 0.41 , resp . ) ( tables 2 , 3 , and 4 ) . pulmonary arterial hypertension was related only to class i b*35 ( p = 0.035 ) , c*03 ( p = 0.044 ) , and c*04 ( p = 0.015 ) alleles . the hla - b*35 and c*04 alleles were more frequent , resulting in a greater predisposition to this feature ( pr = 2.58 and pr = 2.71 , resp . ) . the c*03 allele was less frequent in these patients and was negatively correlated with this feature ( pr = 0.13 ) ( tables 2 , 3 , 4 and 5 ) . our study investigated the frequencies of hla class i and ii alleles in ethnically unrelated brazilian patients with ssc and the relationships of these alleles with the main clinical manifestations . studies involving hla and ssc are important from an etiopathogenic point of view , especially the clinical perspective , as an attempt to identify patients with more severe disease . in our series , there was no evidence of an association between the clinical forms of the disease and the hla alleles . our results did not support the previous reports of a higher skin score in the presence of the hla - b*62 , drb1 * 11 , and drb1 * 07 alleles [ 4 , 9 ] . concerning the clinical manifestations , there are few reports about the relationship between gi tract involvement and the hla alleles . we did not find any predisposing allele , which may be due to the high frequency of this feature , found in almost 80% of the patients . we found evidence of an association between pf and pah , which are both determinants of poor prognosis . regarding pah , we found a higher risk in the presence of hla - b*35 and c*04 . the association with hla - b*35 had already been described , and this allele appears to be involved in the upregulation of et-1 and the pathogenesis of pah [ 27 , 28 ] . gladman et al . found a significant association between pah and the hla - a*30 , b*13 , b*65 , and drb1 * 03 alleles . the frequency of these alleles in our sample was 15.8% for a*30 , 5.3% for b*13 , 21% for drb1 * 03 , and 0% for b*65 . in this analysis , c*03 was noted as a protective allele , being absent in all patients with pah . we emphasize that c*04 and c*03 were not previously described to be related to pah . moreover , the alleles associated with an increased risk for pah , b*35 and c*04 , are often interrelated . the previously described associations between pf and hla alleles were usually linked to ata [ 10 , 2931 ] , but we did not consider the autoantibody profiles . the cw*0602 and dr52a alleles were associated with pf [ 4 , 26 ] , but we did not identify these alleles as risk factors in our study . both hla - a*30 and dqb1 * 04 played a role in the susceptibility to this manifestation . an interesting finding was a*30 as a risk factor in pf but not in pah as described by gladman et al . . in addition , the presence of the drb1 * 01 and dqb1 * 05 alleles was negatively related to pf and , therefore , considered protective . the delta method was chosen due to the study design , a cross - sectional in contrast to case - controlled study , where the odds ratio should be more suitable . the technique used for hla typing ( pcr - based sequence analysis using specific primers ) does not always provide the gene subtype . our current study documents the association of some class i and ii hla alleles with the most severe clinical manifestations in a multiethnic case series . based on these and previous results , there are clearly multiple genetic patterns in ssc , and various hla alleles were associated with different clinical and serological aspects of this disease . in conclusion , new descriptive and multicentric genetic studies are necessary for a better comprehension and definition of the disease expression in brazil .

objectives . the aim of this study was to evaluate human leukocyte antigen ( hla ) involvement in the disease expression and poor prognostic clinical features ( pulmonary fibrosis and pulmonary arterial hypertension ) in patients diagnosed with systemic sclerosis ( ssc ) in a multiethnic population . methods . ssc patients followed up between 2008 and 2011 were included , and clinical data were obtained through records review . molecular hla typing was performed ( polymerase chain reaction amplification technique using specific primer sequences ) . the statistical analysis involved fisher 's exact test and pearson 's corrected chi - square test . p values 0.05 were considered significant . the delta method was used to estimate the variance of the prevalence ratio ( pr ) . results . a total of 141 patients ( 120 women and 21 men ) with ssc were studied , including 33.3% with diffuse cutaneous ssc ( dcssc ) , 62.4% with limited cutaneous ssc ( lcssc ) , and 4.3% with sine scleroderma . pulmonary fibrosis was present in 61 patients ( 43.3% ) , and the hla - a30 and dqb104 alleles were related to susceptibility . in contrast , the hla - drb101 and dqb105 alleles were protective . pulmonary arterial hypertension was diagnosed in 19 patients ( 13.5% ) and was associated with hla - b35 and c04 ; in contrast , c03 seemed to be protective . conclusions . our current study documents the association of some classes i and ii hla alleles with the most severe clinical manifestations in a multiethnic case series . our findings differed slightly from the previous data in other populations .

1. Introduction 2. Subjects and Methods 3. Statistical Analysis 4. Results 5. Discussion

the number of opioid prescriptions in the usa has risen dramatically over the past 25 years , increasing from 76 million in 1991 to 259 million in 2012.1 with the rise in opioid prescriptions , the abuse and diversion of prescription opioids has increased,2 and prescribers face the challenge of balancing the risks and potential benefits of these medications.3 as more than 40% of opioid prescriptions are written by general or family practitioners,4 the opioid prescribing patterns of this group of health care professionals have an important influence on the general public health of us residents . a majority of primary care providers prescribe opioids for pain.59 however , many primary care providers find opioid prescribing a significant challenge . for example , many report that their formal training about opioid prescribing was inadequate.5,6,1012 furthermore , they report concerns about medication side effects , regulatory scrutiny , addiction , and opioid misuse.7,8,10,1216 a recent systematic review found that most physicians do not follow all recommendations regarding safe opioid prescribing , and significant knowledge gaps were identified.17 primary care providers who have received pain management education after formal training reported the greatest level of confidence with prescribing opioids for chronic pain.18 few surveys exist that assess the knowledge of nonpain specialty providers about the management of chronic pain . the knowpain-50 survey was developed specifically to assess pain management education among physicians.19 while the survey covers a broad range of chronic pain topics frequently encountered in the primary care setting , at least one - third of the test specifically addresses opioid prescribing . thus , the purpose of this study was to assess the knowledge about prescribing opioids for chronic pain among nonpain specialty providers seeking pain - focused continuing medical education ( cme ) . the participants in this study were health care providers with prescription privileges seeking cme about pain management . all providers were nonpain specialists attending a course entitled pain medicine for the non - pain specialist . a total of 219 health care providers attended the cme course and 131 ( 60% ) completed the knowpain-50 survey . three surveys were excluded due to missing data , and the final cohort comprised 128 surveys . following submission to mayo foundation institutional review board ( irb ) for ethics approval , it was determined that the research activity did not require irb review in accordance with the code of federal regulations ( 45 cfr 46).20 the mayo foundation institutional review board did not require written informed consent be obtained from the study participants because all data was de - identified and participation was voluntary . the cme conference was held in march 2013 at a conference center over the course of 3 days ; 30-minute lectures were delivered from 8 am to 12:30 pm . each lecturer presented information using slides projected on a centrally located screen , and participants were allowed to ask questions after each lecture . the conference was sponsored by a tertiary referral medical center s cme department . upon commencement of the conference the knowpain-50 survey was administer in paper format , and all attendees were given adequate time to complete the survey . participants were asked to report basic demographic data , including age , sex , years of practice , and professional training ( eg , physician , physician assistant / nurse practitioner ) . the knowpain-50 survey comprised 50 questions.19 eighteen of the 50 questions were related to opioid management and the remaining 32 questions were related to general knowledge about pain medicine . the focus of each opioid question was further categorized as either medicolegal ( n=7 ) or clinical ( n=11 ) . all medicolegal questions contained the words or phrases investigated , illegal , not lawful the survey was scored according to the approach described by harris et al.19 five questions used a multiple - choice single response format ; correct single responses were awarded 5 points and incorrect single responses were awarded 0 points . one of the five multiple - choice questions was a clinical question about opioids ( by far the most common adverse side effect of opioid therapy is : ) . the remaining 45 questions were answered using a likert scale ranging from 1 to 6 , where 1= strongly agree ; 2= agree ; 3= somewhat agree ; 4= somewhat disagree ; 5= disagree ; 6= strongly disagree . the correct response for 25 of the likert questions was the negative ( strongly disagree , disagree , somewhat disagree ) , and the correct response for the remaining 20 likert questions was the affirmative ( strongly agree , agree , somewhat agree ) . all responses to the likert questions were converted to a 0- to 5-point scale , where the strongly agree or correct responses were awarded 5 points , and all other responses were awarded a sequentially diminishing number of points . for example , for questions where the correct response was the negative , 5 points were awarded for the response , 3 points were awarded for the response 3= somewhat disagree , and so on until 0 points were awarded for the response alternatively , for questions where the correct response was the affirmative , 5 points were awarded for the response , 3 points were awarded for the response 3= somewhat agree , and so on until 0 points were awarded for the response the maximum possible points for the 50-item survey were 250 . the mean and standard deviation ( ) ( age , years in practice ) , or proportion ( sex ) were reported for the demographic and practice characteristics . for the likert questions , test responses awarded 35 points were categorized as correct responses and test responses awarded 02 points were categorized as incorrect . the proportion of correct responses for the 32 nonopioid questions and 18 opioid questions were compared using the chi - square ( ) test . the proportion of correct responses for the eleven clinical opioid questions and seven medicolegal opioid questions were compared in a similar manner . the correlations between the demographic ( age , sex ) and practice characteristics ( years in practice ) and the proportion of correct responses to the entire 50-item survey , 32 nonopioid questions , and 18 opioid questions were assessed using spearman s correlation coefficient ( ) . two - sided tests were used in all analyses , and the level of significance for all statistical tests was set at 0.05 . statistical analyses were carried out using the ibm spss statistics ( version 21.0 , ibm corporation , armonk , ny , usa ) . the participants in this study were health care providers with prescription privileges seeking cme about pain management . all providers were nonpain specialists attending a course entitled pain medicine for the non - pain specialist . a total of 219 health care providers attended the cme course and 131 ( 60% ) completed the knowpain-50 survey . three surveys were excluded due to missing data , and the final cohort comprised 128 surveys . following submission to mayo foundation institutional review board ( irb ) for ethics approval , it was determined that the research activity did not require irb review in accordance with the code of federal regulations ( 45 cfr 46).20 the mayo foundation institutional review board did not require written informed consent be obtained from the study participants because all data was de - identified and participation was voluntary . the cme conference was held in march 2013 at a conference center over the course of 3 days ; 30-minute lectures were delivered from 8 am to 12:30 pm . each lecturer presented information using slides projected on a centrally located screen , and participants were allowed to ask questions after each lecture . the conference was sponsored by a tertiary referral medical center s cme department . upon commencement of the conference , the knowpain-50 survey was administer in paper format , and all attendees were given adequate time to complete the survey . participants were asked to report basic demographic data , including age , sex , years of practice , and professional training ( eg , physician , physician assistant / nurse practitioner ) . the knowpain-50 survey comprised 50 questions.19 eighteen of the 50 questions were related to opioid management and the remaining 32 questions were related to general knowledge about pain medicine . the focus of each opioid question was further categorized as either medicolegal ( n=7 ) or clinical ( n=11 ) . all medicolegal questions contained the words or phrases investigated , illegal , not lawful , state and federal requirements , or the survey was scored according to the approach described by harris et al.19 five questions used a multiple - choice single response format ; correct single responses were awarded 5 points and incorrect single responses were awarded 0 points . one of the five multiple - choice questions was a clinical question about opioids ( by far the most common adverse side effect of opioid therapy is : ) . the remaining 45 questions were answered using a likert scale ranging from 1 to 6 , where 1= strongly agree ; 2= agree ; 3= somewhat agree ; 4= somewhat disagree ; 5= disagree ; 6= strongly disagree . the correct response for 25 of the likert questions was the negative ( strongly disagree , disagree , somewhat disagree ) , and the correct response for the remaining 20 likert questions was the affirmative ( strongly agree , agree , somewhat agree ) . all responses to the likert questions were converted to a 0- to 5-point scale , where the strongly agree or strongly disagree correct responses were awarded 5 points , and all other responses were awarded a sequentially diminishing number of points . for example , for questions where the correct response was the negative , 5 points were awarded for the response , 3 points were awarded for the response 3= somewhat disagree , and so on until 0 points were awarded for the response alternatively , for questions where the correct response was the affirmative , 5 points were awarded for the response 1= strongly agree , 4 points were awarded for the response 5= agree , 3 points were awarded for the response 3= somewhat agree , and so on until 0 points were awarded for the response participants were asked to report basic demographic data , including age , sex , years of practice , and professional training ( eg , physician , physician assistant / nurse practitioner ) . the knowpain-50 survey comprised 50 questions.19 eighteen of the 50 questions were related to opioid management and the remaining 32 questions were related to general knowledge about pain medicine . the focus of each opioid question was further categorized as either medicolegal ( n=7 ) or clinical ( n=11 ) . all medicolegal questions contained the words or phrases investigated , illegal , not lawful the survey was scored according to the approach described by harris et al.19 five questions used a multiple - choice single response format ; correct single responses were awarded 5 points and incorrect single responses were awarded 0 points . one of the five multiple - choice questions was a clinical question about opioids ( by far the most common adverse side effect of opioid therapy is : ) . the remaining 45 questions were answered using a likert scale ranging from 1 to 6 , where 1= strongly agree ; 2= agree ; 3= somewhat agree ; 4= somewhat disagree ; 5= disagree ; 6= strongly disagree . the correct response for 25 of the likert questions was the negative ( strongly disagree , disagree , somewhat disagree ) , and the correct response for the remaining 20 likert questions was the affirmative ( strongly agree , agree , somewhat agree ) . all responses to the likert questions were converted to a 0- to 5-point scale , where the strongly agree or correct responses were awarded 5 points , and all other responses were awarded a sequentially diminishing number of points . for example , for questions where the correct response was the negative , 5 points were awarded for the response , 3 points were awarded for the response 3= somewhat disagree , and so on until 0 points were awarded for the response alternatively , for questions where the correct response was the affirmative , 5 points were awarded for the response , 3 points were awarded for the response 3= somewhat agree , and so on until 0 points were awarded for the response the mean and standard deviation ( ) ( age , years in practice ) , or proportion ( sex ) were reported for the demographic and practice characteristics . for the likert questions , test responses awarded 35 points were categorized as correct responses and test responses awarded 02 points were categorized as incorrect . the proportion of correct responses for the 32 nonopioid questions and 18 opioid questions were compared using the chi - square ( ) test . the proportion of correct responses for the eleven clinical opioid questions and seven medicolegal opioid questions were compared in a similar manner . the correlations between the demographic ( age , sex ) and practice characteristics ( years in practice ) and the proportion of correct responses to the entire 50-item survey , 32 nonopioid questions , and 18 opioid questions were assessed using spearman s correlation coefficient ( ) . two - sided tests were used in all analyses , and the level of significance for all statistical tests was set at 0.05 . statistical analyses were carried out using the ibm spss statistics ( version 21.0 , ibm corporation , armonk , ny , usa ) . physicians were predominantly male ( 68% ) , whereas nonphysicians were predominantly female ( 80% ) . physicians were also older ( 51.811.4 years ) compared with nonphysicians ( 39.610.3 years ) ( p<0.001 ) . table 3 shows the frequency of responses to the seven medicolegal and eleven clinical opioid questions . the proportion of correct responses to the 32 nonopioid questions was 74% , and the proportion of correct responses to the 18 opioid questions was 69% ( =13.5 , p<0.001 ) . similarly , the proportion of correct responses to the seven medicolegal opioid questions was 74% , and the proportion of correct responses to the eleven clinical opioid questions was 67% ( =12.1 , p<0.001 ) . no significant correlations were found between the demographic ( age , sex ) or practice characteristics ( years in practice ) and the proportion of correct responses to the entire 50-item survey , the 33 nonopioid questions , or the 17 opioid questions ( all spearman s <13.0 ; all p>0.1 ) . physicians were predominantly male ( 68% ) , whereas nonphysicians were predominantly female ( 80% ) . physicians were also older ( 51.811.4 years ) compared with nonphysicians ( 39.610.3 years ) ( p<0.001 ) . table 3 shows the frequency of responses to the seven medicolegal and eleven clinical opioid questions . the proportion of correct responses to the 32 nonopioid questions was 74% , and the proportion of correct responses to the 18 opioid questions was 69% ( =13.5 , p<0.001 ) . similarly , the proportion of correct responses to the seven medicolegal opioid questions was 74% , and the proportion of correct responses to the eleven clinical opioid questions was 67% ( =12.1 , p<0.001 ) . no significant correlations were found between the demographic ( age , sex ) or practice characteristics ( years in practice ) and the proportion of correct responses to the entire 50-item survey , the 33 nonopioid questions , or the 17 opioid questions ( all spearman s <13.0 ; all p>0.1 ) . one of the main findings of this study was that nonpain specialists seeking cme content about pain medicine scored significantly lower on questions about opioids compared with nonopioid - related questions . when the focus of the opioid questions was further categorized as either medicolegal or clinical , the respondents scored significantly lower on the clinical compared with the medicolegal opioid questions . the majority of respondents were confident in their ability to pass an investigation of their opioid prescribing practices and in their ability to find and understand state and federal requirements related to prescribing opioids . this is similar to findings by wolfert et al,16 who reported that 59% of wisconsin physicians were not concerned about their opioid prescribing practices being investigated . however , over 40% of these physicians responded , do not know to specific questions about state and federal requirements , demonstrating poor applied knowledge about these requirements . in a separate survey of family medicine physicians , the levels of concern about addiction , diversion , dependence , regulatory scrutiny , and side effects due to opioid use were investigated.8 in this group of physicians , the responses varied widely , although they tended to have less concerns for regulatory scrutiny and diversion compared with physical dependence and tolerance.8 on the knowpain-50 survey , participants scored significantly lower on questions about opioids compared with nonopioid - related questions . more specifically , the proportion of correct scores ranged from 45% to 55% on several key clinically related opioid questions , including morphine - induced sedation is only a transient problem and will usually clear with continued use , the presence of a physiologic basis for pain should be the primary factor when deciding to prescribe opiates , ceiling to the dosage of pure agonist opioids [ ] that can be used to control a patient s pain , and i believe that analgesic tolerance to opioids usually limits long - term use . in a study by i do not know how to prescribe the correct dose as a reason they hesitated to prescribe opioids . a similar study of canadian family medicine physicians found that respondents scored higher than 40% on only two of nine knowledge - based questions about the use of prescription opioids.13 a 2005 study of west virginia family medicine physicians showed similar results in that respondents scored higher than 60% on only six of ten questions.10 likewise , a small study of primary care providers showed gaps in knowledge related to opioid prescribing where only 69% of questions were correctly answered.12 these research findings are consistent with our current findings and support our previous observations15 that knowledge about chronic pain has not been consistently associated with knowledge about the use of prescription opioids.5,7,8 while there have been few studies using objective tools to evaluate providers knowledge before and after an educational intervention , recognized knowledge gaps6,10,12,13,16,17,21 could be amenable to provider education . the observations from our survey study suggest that the educational interventions should be aimed toward enhancing knowledge about the clinical use of opioids compared with the medicolegal aspects of this form of pain therapy . this is particularly important as primary care providers consistently report low satisfaction with their formal training related to opioid management,5,1012 and rate their clinical knowledge in this area as low.6 a 2007 study of primary care providers by ororke et al18 found that physicians who were most comfortable managing chronic pain had received training after residency . this was recently confirmed by lalonde et al22 who reported that hours of cme focused on chronic pain were associated with higher scores on the knowpain-50 . these studies suggest that the postgraduate educational interventions may prove particularly effective for primary care providers who manage chronic pain . this supposition is supported by the findings of a recent prospective longitudinal study where primary care practitioners received education about the clinical management of chronic pain including management of patients receiving long - term opioid therapy.23 compared with baseline , practitioners at 1-year follow - up reported improvements in feeling sufficiently trained to manage patients receiving long - term opioid therapy , improved perceived confidence in prescribing opioids , and improvements in identifying patients at risk for opioid misuse.23 study participants were seeking cme regarding the management of chronic pain , and were potentially highly motivated to improve their knowledge about the management of chronic pain . thus , selection bias could influence the generalization of the study observations to other populations of nonpain specialty providers . we did not differentiate by professional degree ; thus , differences in professional training could have influenced the study findings . recent advances in knowledge since publication of the knowpain-50 suggests that the designated correct response to the question chronic opioid therapy has high risk of addiction in adults older than 40 years of age without history of substance abuse may not be entirely accurate.2426 lower scores on clinically based questions may indicate an opportunity to provide focused educational content about this important area of clinical practice . the key observations from this study could be useful in designing future educational modules for nonpain specialty providers .

introductionalthough the majority of opioids in the us are prescribed by nonpain specialists , these providers often report inadequate training in chronic pain management and opioid prescribing . the extent of health care providers knowledge of opioid prescribing for chronic pain has not been well established . the purpose of this study was to assess knowledge about the use of opioids for chronic pain among health care providers seeking pain - focused continuing medical education.materials and methodsthe study participants ( n=131 ) were recruited at a pain - focused continuing medical education conference for nonpain specialists . upon commencement of the conference , the knowpain-50 survey was completed . the survey comprised 50 questions , and 18 questions were related to opioid management . the focus of each opioid question was further categorized as either medicolegal ( n=7 ) or clinical ( n=11).resultsthe majority of study participants were male physicians with a mean age of 51.8 years . the proportion of correct responses to the 50-item survey was 72% . the proportion of correct responses to the 32 nonopioid questions was 74% , and the proportion of correct responses to the 18 opioid questions was 69% ( p<0.001 ) . similarly , the proportion of correct responses to the seven medicolegal opioid questions was 74% , and the proportion of correct responses to the eleven clinical opioid questions was 67% ( p<0.001).conclusionhealth care providers demonstrated gaps in knowledge about the use of opioids for chronic pain . lower scores on clinically based opioid questions may indicate an opportunity to provide focused educational content about this area of practice . this information could be helpful in designing future educational modules for nonpain providers .

Introduction Methods Study participants Study setting Data collection Demographics and practice characteristics KnowPain-50 Statistical analysis Results Demographic and practice characteristics KnowPain-50 responses Discussion Limitations Conclusion

we retrospectively reviewed all medical records . at each follow - up , each patient underwent best - corrected visual acuity ( bcva ; snellen chart ) testing ; quantification of the extent of metamorphopsia using m - charts , and oct ( stratus , carl zeiss meditec inc . , dublin , ca ) . patients who had intraocular diseases other than csc , or who had any systemic disease that could affect vision , were excluded from the study . we converted bcva values from snellen visual acuity figures to logarithm of the minimum angle of resolution ( logmar ) scores ; this allowed us to explore any statistical correlation of the values with metamorphopsia ( m - charts ) scores . each patient was examined at 1 , 2 , 3 , and 6 months after the first visit . bcva examination , oct , and m - charts evaluation , were performed at each follow - up visit . m - charts quantifies the degree of metamorphopsia in terms of the size of the visual angle . if a straight line is shown to a patient with metamorphopsia , that line , projected onto the retina , is perceived as irregular or curved . if an ophthalmologist next presents dotted ( thus not solid ) lines to the patient , and changes the dot interval from fine to coarse , line distortion gradually decreases , and finally disappears . the m - charts test exploits the chart contains 19 types of dotted lines ; the dot intervals range from 0.2 to 2.0 of visual angle . when m - charts is to be employed , refractive error is first corrected ; visual acuity is optimized at a distance of 30 cm ; and a vertical straight line ( thus of angle 0 ) is next presented , with the patient being asked to fixate on the center of the line . if a patient recognizes the straight line as being in fact straight , the m - charts score is 0 . if a patient considers that the straight line is irregular or curved , dotted lines , featuring dot interval changes from coarse to fine , are next presented to that patient . as the visual angle widens , the extent of metamorphopsia decreases ; when the patient recognizes a dotted line as straight , the visual angle of that line is taken as the m - charts score . after examination of vertical lines , the m - charts presentation is rotated through 90 , and the same test procedure is repeated using horizontal lines . the extent of metamorphopsia ( the m - score ) is the sum of the horizontal and vertical m - charts scores . matsumoto et al . , previously found that the m - score was 0 in all normal eyes and that intra - individual m - score variation in erm patients was within one line ( 0.1 in terms of score ) . therefore , we considered that metamorphopsia was present if the sum of the horizontal and vertical m - charts scores was 0.3 or over . we first investigated , at each follow - up , whether a correlation existed between the m - score ( indicating the extent of metamorphopsia ) and the bcva value . the 33 consecutive csc patients were divided into two groups , one of which was the metamorphopsia group ( with m - scores of 0.3 or over ) whereas the other was the non - metamorphopsia group ( with m - scores of 0.2 or below ) . we classified oct - specific features into four categories : ( 1 ) focal retinal ped ; ( 2 ) high - level reflectivity of the photoreceptor layer ; ( 3 ) posterior clumping in the photoreceptor layer ; and , ( 4 ) large areas of sensory retinal layer detachment that exceeded one retinal thickness in extent . focal ped was defined as irregularity of the retinal pigment epithelial layer , as revealed by oct . posterior clumping in the photoreceptor layer was considered present when rounded clumps were evident in that layer . serous sensory retinal detachment was defined as detachment associated with the presence of srf to a depth that was over twice the full thickness of the retina [ fig . 1 ] . ( b ) the yellow arrow indicates a region of the photoreceptor layer exhibiting high reflectivity . ( c ) a large expanse of sensory retinal layer detachment , more than one retinal level in thickness , is evident . ( d ) white arrows show posterior clumping in the photoreceptor layer statistical analysis employed the mann whitney test , fisher 's exact test , and pearson correlation analysis . the frequency of occurrence of each specific oct finding in the metamorphopsia and non - metamorphopsia groups was statistically analyzed using fisher 's exact test . all tests were performed using spss version 18.0 ( spss inc . , chicago , il ) and a p value of less than 0.05 was considered to be statistically significant . the 33 eyes of the 33 patients examined in the present study were those of 26 men ( 80.6% ) and 7 women ( 19.4% ) . all patients visited the retina clinic with at least 6 month follow - up . on initial examination , 15 of the 33 patients had metamorphopsia ( the metamorphopsia group ) ; all 15 yielded m - scores of over 0.3 . the other patients formed the non - metamorphopsia group , with a mean m - score of 0 . the mean age of the metamorphopsia group patients was 45.7 8.3 years ( range : 37 - 64 years ) ; the figure was 45.2 6.4 years in the non - metamorphopsia group ( range : 36 - 56 years ) . symptom duration was 9.6 11.8 weeks ( range : 1 - 48 weeks ) , and 10.2 12.1 weeks ( range , 1 to 48 weeks ) , respectively . the non - metamorphopsia group exhibited somewhat longer symptom duration , but this did not differ with statistical significance from that of the metamorphopsia group . at the first visit , bcva ( logmar ) was 0.28 0.24 in the metamorphopsia group and 0.25 0.28 in the non - metamorphopsia group ; this difference was not clinically significant [ table 1 ] . baseline characteristics of the metamorphopsia and non - metamorphopsia groups all 15 patients in the metamorphopsia group had m - scores of over 0.3 ; we sought a correlation between these scores and bvca data ( logmar values ) . no statistically significant correlation was evident ( pearson correlation analysis , p = 0.492 ) [ fig . 2 ] . at the 3-month follow - up , srf had disappeared in all instances , as had metamorphopsia ; the m - scores of all patients were 0 . no significant correlation was evident between these two parameters ( pearson correlation analysis ; p = 0.492 ) we explored the frequencies of the specific oct findings described above in the metamorphopsia and non - metamorphopsia groups [ table 1 ] . six eyes ( 40% ) in the metamorphopsia group and one ( 5.5% ) in the non - metamorphopsia group exhibited focal retinal ped ; this was significantly more common in the metamorphopsia group ( p = 0.03 ) . six of 15 eyes ( 40% ) in the metamorphopsia group and 5 of 18 ( 27% ) in the non - metamorphopsia group showed severe srf accumulation ( associated with a large area of sensory retinal layer detachment that was greater than one retinal thickness in extent ) ; the difference between the two groups was not statistically significant ( p = 0.48 ) . when the presence of metamorphopsia was analyzed in terms of high - level reflectivity of the photoreceptor layer ( as revealed by oct ) , 5 of 15 eyes ( 33% ) in the metamorphopsia group and 6 of 18 ( 33% ) in the non - metamorphopsia group showed high - level reflectivity ; the difference between the two groups was not statistically significant ( p = 1.00 ) . the m - scores of the five eyes in the metamorphopsia group ranged from 0.4 to 1.8 . the level of reflectivity as revealed by oct was reduced in all patients at the times of final visits . two of 15 eyes ( 13.3% ) in the metamorphopsia group and three of 18 ( 16.6% ) in the non - metamorphopsia group showed posterior clumping in the photoreceptor layer ; no clinically significant difference was evident between the two groups ( p = 1.00 ) . in one of the two eyes in the metamorphopsia group , and in all three eyes in the non - metamorphopsia group , posterior clumping disappeared during follow - up . at the first visit , in the metamorphopsia group , the m - scores of the two eyes showing posterior clumping were 0.8 and 0.4 . at the 3-month follow - up , the scores had improved to 0 , and metamorphopsia had thus disappeared . all 15 patients in the metamorphopsia group had m - scores of over 0.3 ; we sought a correlation between these scores and bvca data ( logmar values ) . no statistically significant correlation was evident ( pearson correlation analysis , p = 0.492 ) [ fig . 2 ] . at the 3-month follow - up , srf had disappeared in all instances , as had metamorphopsia ; the m - scores of all patients were 0 . the relationship between m - scores and visual acuity . no significant correlation was evident between these two parameters ( pearson correlation analysis ; p = 0.492 ) we explored the frequencies of the specific oct findings described above in the metamorphopsia and non - metamorphopsia groups [ table 1 ] . six eyes ( 40% ) in the metamorphopsia group and one ( 5.5% ) in the non - metamorphopsia group exhibited focal retinal ped ; this was significantly more common in the metamorphopsia group ( p = 0.03 ) . six of 15 eyes ( 40% ) in the metamorphopsia group and 5 of 18 ( 27% ) in the non - metamorphopsia group showed severe srf accumulation ( associated with a large area of sensory retinal layer detachment that was greater than one retinal thickness in extent ) ; the difference between the two groups was not statistically significant ( p = 0.48 ) . when the presence of metamorphopsia was analyzed in terms of high - level reflectivity of the photoreceptor layer ( as revealed by oct ) , 5 of 15 eyes ( 33% ) in the metamorphopsia group and 6 of 18 ( 33% ) in the non - metamorphopsia group showed high - level reflectivity ; the difference between the two groups was not statistically significant ( p = 1.00 ) . the m - scores of the five eyes in the metamorphopsia group ranged from 0.4 to 1.8 . the level of reflectivity as revealed by oct was reduced in all patients at the times of final visits . two of 15 eyes ( 13.3% ) in the metamorphopsia group and three of 18 ( 16.6% ) in the non - metamorphopsia group showed posterior clumping in the photoreceptor layer ; no clinically significant difference was evident between the two groups ( p = 1.00 ) . in one of the two eyes in the metamorphopsia group , and in all three eyes in the non - metamorphopsia group , posterior clumping disappeared during follow - up . at the first visit , in the metamorphopsia group , the m - scores of the two eyes showing posterior clumping were 0.8 and 0.4 . at the 3-month follow - up , six eyes ( 40% ) in the metamorphopsia group and one ( 5.5% ) in the non - metamorphopsia group exhibited focal retinal ped ; this was significantly more common in the metamorphopsia group ( p = 0.03 ) . six of 15 eyes ( 40% ) in the metamorphopsia group and 5 of 18 ( 27% ) in the non - metamorphopsia group showed severe srf accumulation ( associated with a large area of sensory retinal layer detachment that was greater than one retinal thickness in extent ) ; the difference between the two groups was not statistically significant ( p = 0.48 ) . when the presence of metamorphopsia was analyzed in terms of high - level reflectivity of the photoreceptor layer ( as revealed by oct ) , 5 of 15 eyes ( 33% ) in the metamorphopsia group and 6 of 18 ( 33% ) in the non - metamorphopsia group showed high - level reflectivity ; the difference between the two groups was not statistically significant ( p = 1.00 ) . the m - scores of the five eyes in the metamorphopsia group ranged from 0.4 to 1.8 . the level of reflectivity as revealed by oct was reduced in all patients at the times of final visits . two of 15 eyes ( 13.3% ) in the metamorphopsia group and three of 18 ( 16.6% ) in the non - metamorphopsia group showed posterior clumping in the photoreceptor layer ; no clinically significant difference was evident between the two groups ( p = 1.00 ) . in one of the two eyes in the metamorphopsia group , and in all three eyes in the non - metamorphopsia group , posterior clumping disappeared during follow - up . at the first visit , in the metamorphopsia group , the m - scores of the two eyes showing posterior clumping were 0.8 and 0.4 . at the 3-month follow - up , the symptoms of csc include minor blurring of vision , central scotoma , hypermetropization , and metamorphopsia . sometimes , visual disturbance persists , despite complete resolution of srf accumulation at the site of a macular lesion . some patients with csc experience metamorphopsia symptoms in the region of central vision . amsler grid charts have been used to evaluate the extent of metamorphopsia . however , these charts do not yield quantitative data . to the best of our knowledge , therefore , we aimed to quantify metamorphopsia in such patients using m - charts . also , we investigated possible relationships between specific oct findings in csc patients and the presence of metamorphopsia . m - charts , developed in 1999 , was first used to evaluate patients with an idiopathic erm . shinoda et al . , reported that the severity of erm correlated positively with the m - score . the cited authors found that m - charts was simple and useful when employed to quantitatively monitor the extent of metamorphopsia . later , arimura et al . , showed that the extent of horizontal retinal contraction correlated positively with the vertical metamorphopsia score . also , the extent of vertical retinal contraction was positively correlated with the horizontal metamorphopsia score in patients with an erm . the cited authors thus successfully associated the metamorphopsia pattern with the direction of retinal contraction . in another report , uei et al . the cited authors found that if the mh size was small pre - operatively , metamorphopsia improved more markedly after surgery . in the present study of 33 eyes , 15 ( 45.5% ) exhibited metamorphopsia and all 15 patients had m - scores of over 0.3 . a search of the pubmed database revealed that no report on the frequency of metamorphopsia in csc patients has yet appeared ; we were thus unable to compare the frequency of metamorphopsia in our csc patients with any prior data . however , we consider that a metamorphopsia rate of 45.5% is clinically meaningful ( indeed being rather high ) in csc patients . although m - charts could be successfully used to screen for metamorphopsia in csc patients , we could not detect any relationship between the m - score and bcva data . this finding is in line with that of matsumoto et al . , who found that m - scores did not correlate with bcva data in erm patients . three possible explanations may be advanced . first , it is possible that the duration of morbidity may differ among patients . second , m - charts is a subjective test that uses data provided by the patient . third , any decrease in the extent of central vision may render it difficult to discriminate between various dotted lines on the m - charts . thus , m - charts is more appropriately used to detect the mere existence of metamorphopsia . the technique may not be suitable for quantitative analysis of the extent of the condition . we , thus suggest that m - charts is a valuable , but supplementary , diagnostic tool for use in clinics that do not have expensive oct equipment . distortion of the retina by an erm causes photoreceptor disarray , which may induce metamorphopsia . we performed oct at all follow - up csc patient visits . at the first visit , we identified srf in the macular area . we sought to identify characteristic oct findings that were strongly associated with the presence of metamorphopsia . we defined four characteristic oct findings ( focal retinal ped , posterior clumping in the photoreceptor layer , high reflectivity of the photoreceptor layer , and a large region of sensory retinal layer detachment over one retinal thickness in depth ) that might reflect changes in anatomic retinal arrangement . no correlation was found between the extent of metamorphopsia and any of posterior clumping in the photoreceptor layer , high reflectivity of the photoreceptor layer , or large - scale sensory retinal layer detachment . however , patients showing focal retinal pigment layer epithelial detachment on oct had high m - scores . previously , it was shown that distortion of the retina caused by erm traction could cause metamorphopsia . we consider that focal retinal epithelial layer detachment distorts the retina at the site of detachment and induces development of metamorphopsia . m - chart examination collects the metamorphopsia score of vertical line and horizontal line involving the macula area . m - chart examination field is in accordance with vertical and horizontal 5 mm cross hair mode of the oct . the work was retrospective in nature , the study was non - randomized , and the sample size was relatively small . furthermore , although m - charts is very simple and inexpensive diagnostic method , m - charts has the limitation of subjective scoring system . although the degree of metamorphopsia does not correlate with bcva data , we nonetheless suggest that m - charts is a valuable screening test . in clinics lacking expensive oct facilities , or in developing countries , m - charts may be useful to observe clinical courses and to identify therapeutic outcomes in csc patients .

background : to evaluate the presence and extent of metamorphopsia using m - charts ( inami co. , tokyo , japan ) in patients with central serous chorioretinopathy ( csc).design : retrospective consecutive medical record review in a university hospital.materials and methods : we examined 33 eyes of 33 consecutive csc patients using m - charts , which yields scores reflecting the severity of metamorphopsia . the condition was considered present when an m - charts score was 0.3 or over . in all patients , optical coherence tomography ( oct ) was performed , best - corrected visual acuity ( bcva ) was assessed , and m - charts scores were calculated at the first and the 1- and 3-month follow - up visits . the correlation between m - charts scores and bcva values was determined . we also sought to define relationships between the level of metamorphopsia and specific oct findings.results:of 33 csc patients , 15 showed symptoms of metamorphopsia , and all 15 had m - charts scores of over 0.3 . however , no correlation was evident between bcva values and the extent of metamorphopsia as determined using m - charts . in metamorphopsia patients , the incidence of focal retinal pigment epithelial detachment was notably greater than in the non - metamorphopsia group ( p = 0.03).conclusion : m - charts is valuable for monitoring subjective symptom improvement during the clinical course of csc . m - charts serves as a useful adjunct to oct .

Materials and Methods Results Correlation between M-scores and BCVA values Relationship between specific OCT findings and metamorphopsia Relationship between focal retinal pigment epithelial detachment, and metamorphopsia Relationship between severe subretinal fluid accumulation and metamorphopsia Relationship between high reflectivity of the photoreceptor layer and metamorphopsia Relationship between posterior clumping in the photoreceptor layer and metamorphopsia Discussion

from december 2004 through november 2005 , a total of 651 fecal specimens were collected within 48 hours of symptom onset from 627 patients ( 43.5% male , < 197 years of age , 26.9% < 16 years of age ) with symptoms of gastroenteritis at prince of wales hospital , hong kong special administrative region , people 's republic of china . local monthly mean air temperature during the study period was obtained from the hong kong observatory ( available from http://www.hko.gov.hk/wxinfo/pastwx/ywx.htm ) . viral rna was purified from fecal specimens and transcribed to cdna as described ( 4 ) . all specimens had a detectable level of human -actin cdna , which suggests high rna integrity . nov gi and gii were detected by a quantitative and genogroup - specific real - time pcr assay , as previously described ( 5 ) . three amplicons from each genogroup were directly sequenced to confirm their identities and genogroups on a 3100 genetic analyzer ( applied biosystems , foster city , ca , usa ) . cdna viral load was quantified in triplicate per run against 10-fold serial dilutions ( 1010 copies ) of external plasmid standards prepared by cloning genogroup - specific amplicons into vector pcr2.1-topo ( invitrogen corp . , the lower detection limit of the assay was equivalent to 210 copies of cdna per gram of fecal specimen . coefficients of variation within and between runs were calculated as the percentage of the ratio between the standard deviation and mean of threshold cycle numbers from the standard curves . the respective intra- and interassay coefficients of variation for nov gi were 0%4.1% and 1.9%5.8% , respectively , and 0.1%6.1% and 2.7%6.6% , respectively , for nov gii . two common gastroenteritis - associated viruses , sapovirus and group a rotavirus , were detected in parallel , as previously described ( 4,6 ) . / g1skr and g2fb / g2skr for gi and gii , respectively , as described elsewhere ( 7 ) . since g1ff / g1skr and g2fb / g2skr completely spanned the region amplified by the rt - pcr assay , the 2 primer sets were also used to check for sequence complementarity among target , primers , and probe used in quantitation . statistical analyses were performed by spss version 11.5.1 ( spss inc . , chicago , il , usa ) , and figures were constructed by prism version 4.03 ( graphpad software , inc . , san diego , ca , usa ) and spss . novs were detected in 54 ( 8.3% ) fecal specimens . among the nov - positive specimens , 8 ( 14.8% ) were infected with gi , 37 ( 68.5% ) with gii , and 9 ( 16.7% ) were coinfected with gi and gii . moreover , 3 ( 5.6% ) specimens were coinfected with sapovirus , 2 ( 3.7% ) with group a rotavirus , and 1 ( 1.9% ) with sapovirus and group a rotavirus . the mean age of patients infected with nov gi and gii was 54.6 and 33.0 years , respectively ( p = 0.02 ) . sex and hospitalization rates between patients infected with the 2 genogroups did not differ significantly ( table ) . the median cdna viral load of nov gi and gii detected in the fecal specimens was 8.410 ( range 2.2102.910 ) and 3.010 ( range 2.5107.710 ) copies per gram of fecal specimen ( figure 1a ) , respectively . although the range was comparable between the genogroups , the median of nov gii was > 100-fold higher than that of gi ( p = 0.0022 , 2-tailed mann - whitney u test ) . similar findings were obtained when nov gi / gii coinfections ( p = 0.0066 , figure 1b ) or all viral coinfections ( p = 0.0042 , figure 1c ) were excluded . seven of 9 specimens with nov gi / gii coinfections had higher cdna viral load of gii than gi , with fold changes from 4 to 452 ( median 248 ) ( figure 2 ) . furthermore , while nov was detected year - round , a marked seasonal trend was evident : higher prevalence occurred in winter months , when the cdna viral load of gii was generally higher compared with gi ( figure a1 ) . scatterplots for cdna viral load of noroviruses ( nov ) genogroup i ( gi ) and gii . c ) all positive isolates , excluding all those with viral coinfection ( nov gi and gii together with sapovirus , group a rotavirus , or both ) . cdna viral load in 9 specimens with norovirus ( nov ) genogroup i ( gi ) and gii coinfection . multivariate linear regression model was used to determine the potential association between cdna viral load , nov genogroup , and patient 's age . after age stratification , the cdna viral load in fecal specimen was still significantly associated with nov genogroup ( = 0.390 , p = 0.002 ) . however , no significant association was found between cdna viral load and age of patients ( = -0.060 , p = 0.626 ) . of the 63 nov isolates , 43 ( 68.3% ) were successfully sequenced for phylogenetic analysis , including 7 gi and 36 gii isolates . nov gi isolates covered at least 5 genotypes , but no circulating strain predominated ( figure a2 ) . for nov gii isolates , we found > 8 genotypes ; gii/4 was the most prevalent ( figure a3 ) . to rule out the possibility of a quantitation artifact due to different stability between genogroups upon storage or freeze - thaw cycle , viral rna was re - extracted and requantitated from a fecal specimen that had been stored for > 6 months and coinfected with both nov gi and gii . repeat testing showed no drop in cdna viral load for either genogroup , which suggests a comparable stability upon storage . sequence complementarity among target , primers , and probe used in quantitation was also verified . while no sequence mismatch in primers and probe was found among the 7 nov gi isolates , 5 of the 36 gii isolates had a single mismatch . thus , the low cdna viral load of nov gi measured was unlikely due to sequence mismatching . in this study , we show for the first time that the median cdna viral load of nov gii is > 100-fold higher than that of gi in the fecal specimens of patients with nov - associated gastroenteritis . neither the possibility of quantitation artifacts as a result of primers and probe mismatching nor stability differences between genogroups on storage was likely to account for our observation . moreover , 7 of 9 specimens with nov gi / gii coinfection exhibited higher cdna viral load of gii than that of gi . also , the cdna viral load of nov gii was usually higher than that of gi for each collection month , a finding that further supports our interpretation . we speculate that the increased cdna viral load facilitates the transmission of nov gii from infected persons to susceptible hosts through the fecal - oral route . studies on other viruses have shown that viral load correlates well with the epidemiology of diseases . for example , the predominance of hiv-1 over hiv-2 has been suggested to be attributed to the higher viral load of hiv-1 ( 8) . however , the implication of viral shedding pattern and cdna viral load on epidemiologic characteristics and clinical manifestations of novs deserves further investigation . our findings provide strong molecular evidence for the worldwide predominance of nov gii and may open new research directions in the epidemiologic study of novs .

we report the median cdna viral load of norovirus genogroup ii is > 100-fold higher than that of genogroup i in the fecal specimens of patients with norovirus - associated gastroenteritis . we speculate that increased cdna viral load accounts for the higher transmissibility of genogroup ii strains through the fecal - oral route .

The Study Conclusions

provisional crown and fixed partial prosthesis today represent an important element of fixed prosthetic treatment.1,2 these prosthesis are made with the aim of supporting the teeth for which preparation is being made , observing prognosis , and giving the patient function , phonation , aesthetic appearance and tissue compatibility until permanent restoration can be administered.35 in order for provisional restorations to be successful , they have to be resistant to forces inside the mouth . many fibers of various kinds have been tested in recent years in order to increase the fracture resistance of provisional crowns . while there have been many studies showing that these fibers increase the resistance of acrylics , there are none on their impact on surface roughness . the surface roughness of dental materials is the main influence on plaque formation , discoloration , abrasion and aesthetic appearance . many bacteria are able to adhere to hard surfaces in the oral cavity.6,7 the roughness of intra - oral hard surfaces and free energy have a significant effect on primary adhesion and oral micro - organism retention . a surface roughness of 0.3 mm can be felt by the tongue , thus having a negative impact on patient comfort.8 in vitro studies regarding surface roughness for bacterial plaque retention have shown that an average surface roughness above 0.2 mm in fixed restorations increases the level of bacterial retention.810 the aim of this study was to investigate surface roughness in provisional crown resins , after polishing , reinforced with different concentrations of glass fibers . generally used and commercially available autopolymerizing resin was used in this study for provisional crown and fixed partial restoration ( dentalon plus , heraeus , kulzer gmbh , wehrheim , germany ) . the manufacturers recommended powder / liquid ratio was 2 grams of powder to 1 ml of liquid . four different glass fiber groups in different concentrations were established , according to the powder to liquid mixture ; group a ( no fiber ) , group b ( 0.5% ) , group c ( 1% ) and group d ( 2% ) , each group containing 12 disk specimens . a teflon mold was made in order to produce disk - shaped specimens ( 10 mm 2 mm ) . the unprocessed glass fibers were then cut to a length of 3 mm and kept in a predetermined amount of monomer . the provisional crown acrylic was mixed in the light of the manufacturer s recommendations and added to the glass fiber mixture in predetermined quantities . the provisional resin paste added to glass fiber in desired concentrations was kneaded manually for 40 seconds and placed in the mold . this was then placed in a hydraulic press ( rucher phi , birmingham , uk ) and pressure slowly applied in such a way as to permit excess resin to escape . pressure of 20 psi ( 140 kpa ) was applied for 5 minutes . once polymerization had been completed , the specimens were removed from the mold and analyzed with regard to air bubbles and size . all specimens were abraded for 10 seconds in a wet environment by means of a 300 rpm polishing device ( beuhler , meta serv , dusseldorf , germany ) using 600 grit sandpaper . all specimens were then polished for 15 seconds using a polishing machine with pumice mixed at a level of 2 g/2 ml . finally , diamond polishing paste was applied using a polishing device at 15,000 rpm . all specimens were washed in distilled water and left in an ultrasonic bath for 10 minutes . an average surface roughness value ( ra ) from 4 randomly selected points on the surface was calculated using a profilometer ( mitutoyo surf test 201 , japan ) . a 7.5 mm field was scanned at every measurement using the profilometer with a study gap of 250 m . forty - eight pieces of data ( 12 4 ) were obtained from each group , giving a total of 192 ( table 1 ) . in addition to profilometric analysis , photographic images , 2 from each group , were obtained using a scanning electron microscope ( sem ) at an original magnification of 400 in order to analyze post - polishing surface roughness . all analyses were performed using the statistical package for scientists ( sigmastat ) windows version 3.10b . the averages and standard deviation values obtained as a result of the surface roughness test are shown in table 1 . a significant difference was determined among the surface roughness values of provisional crown resins to which different concentrations of fiber had been added ( p<.001 ) ( table 1 ) . tukey s test was then used to perform paired comparisons of the data between the different groups , and a significant difference was found between group a ( no fiber ) ( figure 1 ) and the other groups , between group b ( 0.5% ) and group d ( 2% ) and between group c ( 1% ) and group d. on the other hand , there was no significant difference between group b and group c. in other words , no statistically significant difference was determined between the surface roughness of provisional crown resins reinforced with glass fibers at concentrations of 0.5% or 1% . in addition , compared with other groups , provisional crown resins reinforced with a 2% glass fiber concentration had a significantly greater surface roughness ( figure 2 ) . the sem images obtained clearly show the glass fiber particles in the group b , c and d provisional crown resins ( figures 3 , 4 and 5 ) . the surface roughness in group a , with an average ra value of 0.309 , was statistically significantly different to that of the other groups . sem images showed that provisional crown resins with no additional fiber had the lowest surface roughness , while provisional crown resins with a 2% concentration had a very different level of fiber coverage . the absence of any significant difference between groups b and c , with 0.5% and 1% concentrations , respectively , according to measurements performed using tukey s test , was confirmed by the sem images . surface quality is an important factor affecting the state of dental restorations in the oral cavity in a number of regards . studies have shown that decreased roughness on intraoral surfaces reduces plaque formation.9,11,12 various fibers have been used to strengthen the polymethylmetacrylate ( pmma ) resins used in dentistry.8,13,14 although carbon fibers increase the abrasion , tensile and transverse strength , bending and elasticity modulus of pmma resins , they are unpleasant in color . this makes them unpopular.1517 polyethylene fibers increase pmma resins tensile and flexural strength and young s modulus . in addition , they are not dark in color in the way carbon fibers are , but it may not be practical to roughen them in the dental surgery . however , glass fibers are invisible in pmma resin . glass fibers also have good biocompatibility , possess an appropriate capacity for bonding to the tooth structure and other resins , and are easily manipulated in the clinic or laboratory.18,19 they have thus become very popular in recent years . although the effect of glass fibers on provisional crown resistance is known , the same can not be said for their effect on surface roughness . our study evaluated the effect of glass fibers added in different concentrations to provisional crown resins on surface roughness using polymetric analysis and sem . fiber is installed in the resin in three different ways in dentistry : chopped , longitudinal and woven form.14 vallittu et al20 reported that fibers installed longitudinally in the resin changed place with the pressure applied when the mold was placed in a hydraulic press and that their parallelism was impaired . since the woven form resembles cloth , its contact with the acrylic is problematic and problems with bonding to the acrylic arise.14,21 since the negative features observed in the other forms are not seen in the chopped form , this was employed in our study . the ra values determined as a result of the surface roughness were : group a ( no fiber ) 0.309 ra , group b ( 0.5% ) 0.2 ra , group c ( 1% ) 0.990 ra , and group d ( 2% ) 1.73 ra . a significant difference was determined among the groups to which different concentrations of fiber were added ( p<.001 ) . no statistically significant difference was determined between the surface roughness values of provisional crown resins reinforced with different concentrations , 0.5% and 1% , of glass fiber in paired comparison tests . the reinforcement of provisional crown acrylics with 1% glass fiber increases mechanical properties more than reinforcement with 0.5% glass fiber.14,21 however , no significant difference in surface roughness in provisional crown acrylics reinforced with 0.5% and 1% concentrations of glass fiber was determined in our study . therefore , in terms of surface roughness , we recommend the reinforcement of provisional crown acrylics with 0.5% and 1% concentrations of glass fiber . in this study , group a specimens to which no fiber was added exhibited smoother surfaces than specimens from groups b , c and d to which fiber had been added , and the sem images obtained strengthened this conclusion ( figures 6,7,8 and 9 ) . according to an in vivo study by quirynen et al,22 clinically acceptable roughness values in the oral environment after hard surfaces have been polished should not exceed 0.2 m . wietnam and eames23 reported plaque accumulation on the surfaces of composite specimens with a surface roughness of 0.71.44 m . this study shows that 2% glass fiber added to provisional crown resins leads to a level of surface roughness that will increase plaque accumulation ( ra=1.734 ) . glass fibers , which make a positive contribution to the physical characteristics of provisional crowns , have a negative effect on surface roughness and on plaque accumulation . the sem images obtained show glass fiber particles on the homogeneous structure of the provisional crown methacrylate resin acrylic material . the glass fiber concentration may affect distribution , acrylic arrangement or materials natural chemistry surface roughness . borchers et al24 reported that when long - term provisional crowns are employed the importance of preventing plaque accumulation rises and far more effective polishing systems are essential for provisional restorations . it was determined within the parameters of this study that the reinforcement of methyl methacrylate with different concentrations of glass fiber increased surface roughness . the standardization of this study according to an in vitro protocol and its inability to ideally reflect clinical conditions are its main disadvantages . the polishing process in a clinical environment or in the laboratory is not as successful as the polishing process in this study . the first reason for this is that provisional crowns have concave and convex surfaces , for which reason polishing can never be performed on perfectly smooth surfaces as in this study . the second reason is that it is difficult to adjust the recommended speed and power of polishing materials in the surgery . in addition , effectiveness of polishing under clinical conditions is to a large extent dependent on the operator doing the polishing . the following conclusions emerged from within the parameters of this study : the reinforcement of provisional crown and fixed partial denture resin with glass fibers increases surface roughness . paired comparisons between groups revealed no significant difference only between the average surface roughness values of provisional crown and fixed partial denture resin specimens reinforced with 0.5% and 1% concentrations of glass fiber .

objectivesthe aim of this study was to investigate surface roughness in provisional crown acrylics , after polishing , reinforced with different concentrations of glass fibers.methodsa total of 48 disk - shaped specimens were prepared using autopolymerizing acrylic resin . these specimens were divided into four groups according to the level of glass fiber added : group a ( no fiber ) , group b ( 0.5% ) , group c ( 1% ) and group d ( 2% ) . after polishing the specimens , an average surface roughness ( ra ) value was calculated using a profilometer from four randomly selected points on the surface.resultsa significant difference was determined among the surface roughness values of provisional crown resins to which different concentrations of fiber had been added ( p<.001 ) . tukey s test was then used to perform paired comparisons of the data between the different groups , and a significant difference was found between group a ( no fiber ) and the other groups , between group b ( 0.5% ) and group d ( 2% ) and between group c ( 1% ) and group d. on the other hand , there was no significant difference between group b and group c.conclusionsthe reinforcement of provisional crown and fixed partial denture resin with glass fibers increases surface roughness .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSIONS

the transfemoral approach using the seldinger technique has been considered the preferred method for both coronary and peripheral arteriography . local vascular complications of transfemoral arteriography , advocated by judkins,1 ) are rare ( 5% to 10% ) but potentially serious.2)3 ) a meta analysis found major access complications in 0.3% of cases that used the transfemoral approach ( p<0.0001).4 ) complications that require surgical correction are more common when the arterial puncture site is outside the common femoral artery . the types of complications associated with the transfemoral approach were variable and included groin hematoma , arteriovenous fistula ( avf ) , false aneurysms , arterial dissection , arterial perforation and neurological deficits.5 ) transradial access for coronary artery intervention dramatically reduces these access site complications.1 ) only three cases of avf have been reported in previously published studies of radial catheter - based procedures ( table 1).6)7 ) we report here a rare case of avf , which developed after coronary angiography perfomed using the transradial approach . a 67-year - old man visited our hospital with a palpable mass on his right wrist . one year ago he underwent percutaneous coronary intervention ( pci ) for unstable angina , along with implantation of a drug - eluting stents in the proximal and distal right coronary artery and in the left anterior descending artery using the transradial approach without complication . blood pressure was 109/62 mmhg , heart rate was 90 beats / minute , and there were no other abnormal findings after physical examination and biochemical tests . an electrocardiogram showed t - wave inversion in leads ii and iii , and avf without interval change . he complained of a palpable mass ( 31.5 cm ) on his right wristat the previous puncture site of the radial artery , where palpated thrill , auscultated bruit , and edema were observed . a vascular ultrasound scan revealed suspicious turbulent flow in the systolic and diastolic phase at the previous puncture site of the right radial artery , which suggested avf or pseudoaneurysm ( fig . 1 ) . upper extremity computed tomography ( ct ) angiography revealed avf between the right radial artery and the adjacent cephalic vein around the right wrist . 2b , white arrows ) , and subclavian veins , and the superior vena cava ( fig . 2c , white arrows ) in the arterial phase through the fistula between the radial artery and the cephalic vein . the patient was referred to a vascular surgeon and received surgical ligation of the avf . it may be congenital , surgically created for hemodialysis treatment , or pathologically acquired via trauma or erosion of an arterial aneurysm . an avf results in a disruption of the normal blood flow pattern . normally , oxygenated blood flows to tissues through arteries and capillaries . following the release of oxygen , the blood returns to the heart in veins . in case of avf , the blood bypasses the capillaries and tissues , returning directly to the heart . arterial blood has a higher blood pressure than venous blood , and causes swelling of veins involved in the fistula . percutaneous transfemoral arterial cardiac catheterization has reached widespread acceptance and achieved remarkable growth as a tool for diagnostic and therapeutic endovascular intervention . in the large scale prospective study of kent et al.8 ) which included 1,838 patients , the majority of patients who suffer from an iatrogenic avf do not develop clinical signs of hemodynamic significance . all patients were routinely examined by the clinician before and after catheterization , including auscultation of both groins . in cases where there is clinical suspicion of a vascular complication , a duplex scan can be performed . these are surgical repair , implantation of covered stents , and ultrasound guided compression.9 ) among them , surgical repair has frequently been recommended for patients with iatrogenic avf.9 ) the use of transradial access for pci has increased dramatically since the first report of transradial cardiac catheterization in 198910 ) and pci in 1993.11 ) the transradial approach is associated with fewer vascular access complications than the transfemoral approach.5 ) furthermore , an avf of the radial artery is rare , and even less common than radial artery pseudoaneurysm because only small veins are present in the vicinity of the radial artery . but care must be taken to prevent vascular complications even when we perform coronary procedures using transradial access . in this case , we report a rare case of radial avf , which developed after coronary angiography perfomed using a transradial approach . vascular ultrasound scans and ct angiography can help physicians to evaluate avf precisely .

the percutaneous transfemoral approach has been routinely used for cardiac catheterization and coronary angioplasty . local vascular complications following angioplasty are seen in 5% to 10% of patients , especially in those who need prolonged anticoagulation . transradial access for coronary procedures dramatically reduces access site complications . we report a rare case of radial arteriovenous fistula , which developed after coronary angiography perfomed using the transradial approach .

Introduction Case Discussion

dose calculations using the monte carlo ( mc ) method have the potential for the most accurate predictions of dose distributions for clinical radiotherapy . accurate predictions of dose distributions and associated ranges are of particular importance for radiation therapy with proton and ion beams due to the conformity of the treatment . this is specifically challenging for complex treatment situations , involving large heterogeneities or metal implants [ 2 , 3 ] . a novel mc - based treatment - planning ( mctp ) tool was presented and validated for protons using scanned pencil beams for realistic patient treatment conditions in a previous paper . mctp can support tp by helping to understand and improve inaccuracies due to approximations made by analytical dose and fluence algorithms , and allows provision of a furthermore , the developed mctp tool seeks to enable tp and research studies for state - of - the - art ion beam therapy . an asset for such usage is the versatility of the mctp tool , which is to some extent due to the usage of the mc method and the flexible interface to external relative biological effectiveness ( rbe ) models via ion charge and energy - specific tabulations of the linear - quadratic ( lq ) model parameters , as predicted by the external model . in this work , an extension of this mctp tool to perform tp with carbon ions is presented for realistic patient treatment conditions . this will enable future tp studies to be carried out using and comparing different ions and optimization techniques . the mctp tool is composed of various program components that require a range of treatment- and facility - specific input information . a description of the workflow and details of the mctp tool can be found in mairani et al . , including in particular information about its general structure , the pre - optimization and pencil beam selection procedure , and the configuration of the mc code fluka [ 5 , 6 ] , that is used for dose and fluence computations in phantom and patient geometries . the tool allows the user to perform inverse optimization of single fields , and simultaneous multiple - fields optimization ( often referred to as intensity - modulated particle therapy ( impt ) ) of absorbed and rbe - weighted doses using gradient - based methods . for the present work , the tool was extended to be able to perform tp for ion beams for treatment conditions at the hit facility ( heidelberg ion - beam therapy , germany ) . this was achieved by merging the mctp tool with parts of the fluka - based mc framework fiction ( fluka integrated framework for ct - based calculations in ion therapy ) , developed at hit within the framework of partner ( http://partner.web.cern.ch ) and using the corresponding visualization tool . the fiction tool was validated and carefully fine - tuned to reproduce dosimetric measurements for hit treatment conditions [ 8 , 10 ] . fiction previously allowed only a recalculation of a given proton or carbon ion treatment plan and not for the mc - based optimization of treatment plans using protons , carbon ions or other light ions . differences in the biological effectiveness of ions were taken into account via tabulations of the linear and quadratic parameters of the lq model , specific to the ion charge and its energy , which can be generated from external rbe models . for this work , such input tables were obtained using a hit re - implementation of the local effect model ( lem ) in flavours of the lem versions i and iv [ 4 , 12 , 13 ] . further details about the calculation of absorbed and rbe - weighted dose with the mctp tool can be found in [ 4 , 8 ] . calculation and optimization of absorbed and rbe - weighted doses performed by the certified analytical treatment planning system ( tps ) , presented as comparison for the test carbon ion patient , are largely based on the work of krmer et al . . the mctp tool was used to compute and optimize a treatment field for a cube - shaped target volume in water . the pencil beams were optimized to yield a constant absorbed dose of 1 gy in the target volume . 1.carbon ion field computed and optimized by the mctp tool for a cube - shaped target volume in water . the pencil beams were optimized to yield a constant absorbed dose of 1 gy in the target volume . carbon ion field computed and optimized by the mctp tool for a cube - shaped target volume in water . the pencil beams were optimized to yield a constant absorbed dose of 1 gy in the target volume . as a further example , a test patient plan for a carbon ion treatment of a brain tumour for hit treatment conditions was created using the mctp tool . a biological optimization was performed to obtain an rbe - weighted dose of 3 gy ( rbe ) in the target volume using rbe values predicted by the lem - i for chordoma . figures 2 and 3 show a comparison of the example treatment plan created by the certified analytical tps used at hit ( siemens syngo rt planning ) and an mc recalculation of the same treatment plan using the fluka - based fiction tool together with a treatment plan computed with the mctp tool . for this test patient plan only minor differences between the treatment plan created using the analytical tps , the mc recalculation of the same plan , and the treatment plan created with the mctp tool are observable for the treated homogeneous tissue region . the mc recalculation of the plan created by the analytical tps predicts a slight over - dosage in the clinical target volume of about 2% , which is , however , not clinically relevant . doses to the brain stem are very small . observed differences in the dvh of the brain stem between the tps and mc recalculation are therefore not addressed in the mctp optimization . dvhs of the clinical target volume ( ctv ) and the brain stem of a treatment plan created with an analytical treatment planning tool , the mc recalculation of the same plan , and a treatment plan created with the mctp tool . sagittal ( left ) , coronal ( middle ) and axial ( right ) view are shown for ( a ) a treatment plan created with a tps using an analytical dose engine , ( b ) the mc recalculation of the same plan , and ( c ) a treatment plan created with the mctp tool . dvhs of the clinical target volume ( ctv ) and the brain stem of a treatment plan created with an analytical treatment planning tool , the mc recalculation of the same plan , and a treatment plan created with the mctp tool . sagittal ( left ) , coronal ( middle ) and axial ( right ) view are shown for ( a ) a treatment plan created with a tps using an analytical dose engine , ( b ) the mc recalculation of the same plan , and ( c ) a treatment plan created with the mctp tool . this test patient plan serves as a show - case and it is also a direct test of the mctp implementation at hit . larger discrepancies between plans obtained using an mc recalculation of an analytical tps and mctp can be expected in the presence of tissue regions in the beam , with large heterogeneities and patient cases involving metallic implants [ 2 , 3 ] . coupled with an adequate rbe model , the mctp tool is able to compute treatment plans not only for proton and carbon ion beams but also using other light ions , such as helium and oxygen , as well as treatment plans with several ion beams of different charges . the mc code fluka was shown to be able to simulate bragg curves and fragmentation of ions beams such as oxygen beams with a satisfactory accuracy for investigative tp studies [ 15 , 16 ] . tp involving ions other than protons and carbon ions , or even the usage of mixed - ion fields , could yield an improved therapeutic outcome for certain cases . for instance , ion beams with linear energy transfers ( let ) higher than those of carbon ions , such as oxygen beams , are proposed for use to target radio - resistant tumours and to treat hypoxic tumour regions more efficiently [ 15 , 17 ] . the simultaneous use of ions with different charges for patient treatment has been suggested : ( i ) to perform dose- and let - painting ; ( ii ) to decrease the fragmentation dose tail beyond the distal part of the spread - out bragg peak ( sobp ) , while compromising to a lesser degree the high - let component in the target , as well as to obtain benefit from the steeper lateral dose gradients achievable with ions heavier than protons ; ( iii ) to avoid microscopic cold spots ; and ( iv ) to reduce relative uncertainties of rbe for a given treatment protocol [ 1820 ] . in the following , treatment plans using ion beams of two different charges for a cubic - shaped target in a water phantom are presented . points ( iii ) and ( iv ) can be addressed by delivering a more homogeneous radiation quality in the target volume , which in turn can be achieved by plans using two ion species , even for mono - directional beams . 4 , where a combination of mono - directional proton and carbon ion pencil beams were optimized to obtain a constant rbe , as a measure for homogeneity of radiation quality , throughout the sobp . similarly , dual ion fields of protons and carbon ions can be optimized to obtain a sobp with a constant rbe - weighted dose in the target region , while delivering a high - let boost to a central hypoxic area with carbon ions , associated with a higher rbe , and delivering the dose around the boost region preferably by low - let protons . the plans were optimized using the lem - iv model for the proton and carbon ion beams with parameters for human salivary gland cells . fig . 4.a 4-cm sobp obtained using a combination of mono - directional proton and carbon ion pencil beams while optimizing for a constant rbe in the target volume . the left and right panels show rbe - weighted dose and rbe along the central axis of the field . the plan was optimized using the lem - iv model for the proton and carbon ion beams with parameters for human salivary gland cells . 5.a 4-cm sobp obtained using a combination of opposed fields of proton and carbon ion pencil beams . a constant rbe - weighted dose in the target volume is achieved while delivering a high - let boost to a central hypoxic area with carbon ions , associated with a higher rbe , and delivering the dose around the boost region preferably by low - let protons . the left and right panels show the rbe - weighted dose and rbe along the central axis of the field . the plan was optimized using the lem - iv model for the proton and carbon ion beams with parameters for human salivary gland cells . the area with the fine stripes marks the target volume including the boost volume . a 4-cm sobp obtained using a combination of mono - directional proton and carbon ion pencil beams while optimizing for a constant rbe in the target volume . the left and right panels show rbe - weighted dose and rbe along the central axis of the field . the plan was optimized using the lem - iv model for the proton and carbon ion beams with parameters for human salivary gland cells . the area with the fine stripes marks the target volume . a 4-cm sobp obtained using a combination of opposed fields of proton and carbon ion pencil beams . a constant rbe - weighted dose in the target volume is achieved while delivering a high - let boost to a central hypoxic area with carbon ions , associated with a higher rbe , and delivering the dose around the boost region preferably by low - let protons . the left and right panels show the rbe - weighted dose and rbe along the central axis of the field . the plan was optimized using the lem - iv model for the proton and carbon ion beams with parameters for human salivary gland cells . the mctp tool was used to compute and optimize a treatment field for a cube - shaped target volume in water . the pencil beams were optimized to yield a constant absorbed dose of 1 gy in the target volume . 1.carbon ion field computed and optimized by the mctp tool for a cube - shaped target volume in water . the pencil beams were optimized to yield a constant absorbed dose of 1 gy in the target volume . carbon ion field computed and optimized by the mctp tool for a cube - shaped target volume in water . the pencil beams were optimized to yield a constant absorbed dose of 1 gy in the target volume . as a further example , a test patient plan for a carbon ion treatment of a brain tumour for hit treatment conditions was created using the mctp tool . a biological optimization was performed to obtain an rbe - weighted dose of 3 gy ( rbe ) in the target volume using rbe values predicted by the lem - i for chordoma . figures 2 and 3 show a comparison of the example treatment plan created by the certified analytical tps used at hit ( siemens syngo rt planning ) and an mc recalculation of the same treatment plan using the fluka - based fiction tool together with a treatment plan computed with the mctp tool . for this test patient plan only minor differences between the treatment plan created using the analytical tps , the mc recalculation of the same plan , and the treatment plan created with the mctp tool are observable for the treated homogeneous tissue region . the mc recalculation of the plan created by the analytical tps predicts a slight over - dosage in the clinical target volume of about 2% , which is , however , not clinically relevant . doses to the brain stem are very small . observed differences in the dvh of the brain stem between the tps and mc recalculation are therefore not addressed in the mctp optimization . dvhs of the clinical target volume ( ctv ) and the brain stem of a treatment plan created with an analytical treatment planning tool , the mc recalculation of the same plan , and a treatment plan created with the mctp tool . sagittal ( left ) , coronal ( middle ) and axial ( right ) view are shown for ( a ) a treatment plan created with a tps using an analytical dose engine , ( b ) the mc recalculation of the same plan , and ( c ) a treatment plan created with the mctp tool . dvhs of the clinical target volume ( ctv ) and the brain stem of a treatment plan created with an analytical treatment planning tool , the mc recalculation of the same plan , and a treatment plan created with the mctp tool . sagittal ( left ) , coronal ( middle ) and axial ( right ) view are shown for ( a ) a treatment plan created with a tps using an analytical dose engine , ( b ) the mc recalculation of the same plan , and ( c ) a treatment plan created with the mctp tool . this test patient plan serves as a show - case and it is also a direct test of the mctp implementation at hit . larger discrepancies between plans obtained using an mc recalculation of an analytical tps and mctp can be expected in the presence of tissue regions in the beam , with large heterogeneities and patient cases involving metallic implants [ 2 , 3 ] . coupled with an adequate rbe model , the mctp tool is able to compute treatment plans not only for proton and carbon ion beams but also using other light ions , such as helium and oxygen , as well as treatment plans with several ion beams of different charges . the mc code fluka was shown to be able to simulate bragg curves and fragmentation of ions beams such as oxygen beams with a satisfactory accuracy for investigative tp studies [ 15 , 16 ] . tp involving ions other than protons and carbon ions , or even the usage of mixed - ion fields , could yield an improved therapeutic outcome for certain cases . for instance , ion beams with linear energy transfers ( let ) higher than those of carbon ions , such as oxygen beams , are proposed for use to target radio - resistant tumours and to treat hypoxic tumour regions more efficiently [ 15 , 17 ] . the simultaneous use of ions with different charges for patient treatment has been suggested : ( i ) to perform dose- and let - painting ; ( ii ) to decrease the fragmentation dose tail beyond the distal part of the spread - out bragg peak ( sobp ) , while compromising to a lesser degree the high - let component in the target , as well as to obtain benefit from the steeper lateral dose gradients achievable with ions heavier than protons ; ( iii ) to avoid microscopic cold spots ; and ( iv ) to reduce relative uncertainties of rbe for a given treatment protocol [ 1820 ] . in the following , treatment plans using ion beams of two different charges for a cubic - shaped target in a water phantom are presented . points ( iii ) and ( iv ) can be addressed by delivering a more homogeneous radiation quality in the target volume , which in turn can be achieved by plans using two ion species , even for mono - directional beams . 4 , where a combination of mono - directional proton and carbon ion pencil beams were optimized to obtain a constant rbe , as a measure for homogeneity of radiation quality , throughout the sobp . similarly , dual ion fields of protons and carbon ions can be optimized to obtain a sobp with a constant rbe - weighted dose in the target region , while delivering a high - let boost to a central hypoxic area with carbon ions , associated with a higher rbe , and delivering the dose around the boost region preferably by low - let protons . the plans were optimized using the lem - iv model for the proton and carbon ion beams with parameters for human salivary gland cells . 4.a 4-cm sobp obtained using a combination of mono - directional proton and carbon ion pencil beams while optimizing for a constant rbe in the target volume . the left and right panels show rbe - weighted dose and rbe along the central axis of the field . the plan was optimized using the lem - iv model for the proton and carbon ion beams with parameters for human salivary gland cells . 5.a 4-cm sobp obtained using a combination of opposed fields of proton and carbon ion pencil beams . a constant rbe - weighted dose in the target volume is achieved while delivering a high - let boost to a central hypoxic area with carbon ions , associated with a higher rbe , and delivering the dose around the boost region preferably by low - let protons . the left and right panels show the rbe - weighted dose and rbe along the central axis of the field . the plan was optimized using the lem - iv model for the proton and carbon ion beams with parameters for human salivary gland cells . the area with the fine stripes marks the target volume including the boost volume . a 4-cm sobp obtained using a combination of mono - directional proton and carbon ion pencil beams while optimizing for a constant rbe in the target volume . the left and right panels show rbe - weighted dose and rbe along the central axis of the field . the plan was optimized using the lem - iv model for the proton and carbon ion beams with parameters for human salivary gland cells . a 4-cm sobp obtained using a combination of opposed fields of proton and carbon ion pencil beams . a constant rbe - weighted dose in the target volume is achieved while delivering a high - let boost to a central hypoxic area with carbon ions , associated with a higher rbe , and delivering the dose around the boost region preferably by low - let protons . the left and right panels show the rbe - weighted dose and rbe along the central axis of the field . the plan was optimized using the lem - iv model for the proton and carbon ion beams with parameters for human salivary gland cells . it enables the user to perform tp with protons and carbon ions using realistic treatment conditions at hit as well as with other light ions . example treatment plans using carbon ions and mixed - ion treatments consisting of protons and carbon ions have been presented here . this versatile tool is useful for research applications and to support tp studies at state - of - the - art ion beam therapy facilities . in particular , this research project was supported by a marie curie initial training network fellowship of the european community 's seventh framework programme under contract no . pitnga-2008 - 215840-partner , by envision , which is co - funded by the european commission under fp7 grant agreement no . 241851 and by the bundesministerium fr bildung , wissenschaft , forschung und technologie of germany ( dotmobi project , grant 01ib08002f ) .

ion beam therapy , as an emerging radiation therapy modality , requires continuous efforts to develop and improve tools for patient treatment planning ( tp ) and research applications . dose and fluence computation algorithms using the monte carlo ( mc ) technique have served for decades as reference tools for accurate dose computations for radiotherapy . in this work , a novel mc - based treatment - planning ( mctp ) tool for ion beam therapy using the pencil beam scanning technique is presented . it allows single - field and simultaneous multiple - fields optimization for realistic patient treatment conditions and for dosimetric quality assurance for irradiation conditions at state - of - the - art ion beam therapy facilities . it employs iterative procedures that allow for the optimization of absorbed dose and relative biological effectiveness ( rbe)-weighted dose using radiobiological input tables generated by external rbe models . using a re - implementation of the local effect model ( lem ) , the mctp tool is able to perform tp studies using ions with atomic numbers z 8 . example treatment plans created with the mctp tool are presented for carbon ions in comparison with a certified analytical treatment - planning system . furthermore , the usage of the tool to compute and optimize mixed - ion treatment plans , i.e. plans including pencil beams of ions with different atomic numbers , is demonstrated . the tool is aimed for future use in research applications and to support treatment planning at ion beam facilities .

INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION Examples of carbon ion treatment plans Treatment plans using new ions and combined ion beams of different charges CONCLUSION AND PERSPECTIVE FUNDING

the colonization of land by plants was a major event in plant evolution , transforming the environment on land.1,2 knowledge of the origin of land plants is a prerequisite for understanding the transition from the aquatic to the terrestrial habitat of plants . the green algae are basically divided into charophyte and chlorophyte algae , and it is agreed that the charophyte algae are the closest algal relatives of land plants.3 analyses of both morphological and molecular data have established that land plants evolved within charophyte algae more than 450 million years ago.4,5 the charophyte algae are mostly freshwater green algae with diverse morphologies , comprising six distinct groups : mesostigmatales , chlorokybales , klebsormidiales , charales , coleochaetales , and zygnematales . of these , the latter three ( charales , coleochaetales , and zygnematales ) have been considered the ancestors of land plants ( fig . however , which group of charophyte algae is most closely related to land plants has remained controversial over the past decade . in recent years , large amounts of molecular data are available and methodological developments are increasing at a fast pace , thus investigating the origin of land plants becomes more feasible and tractable . in this review , we integrate recent phylogenetic developments on the origin of land plants , discuss the limitations in the phylogenomics era , and provide potential directions for further research on the land plants origin . next - generation sequencing techniques have changed the prospects for molecular evolution , and it is feasible to obtain more data at a reasonable cost . in the field of phylogenomics , which is the use of genomic data to establish and clarify evolutionary relationships , more data indeed are essential to accurately estimate phylogenetic trees ( eg , reducing sampling error by increasing the amount of information ; including new taxa that beak up long branches ) . however , it is certainly to be expected that deeper divergences will become increasingly difficult to address as we go further back in time , because the markov models we use for sequence evolution are expected to saturate and lose some information at the most ancient divergences.6 at shorter times , there are other potentially misleading processes happening with real populations , and a possible ancient rapid radiation at the time of terrestrial colonization by the descendants of charophyte algae7 could be a major factor impeding the accurate inference on the origin of land plants . charales , perhaps the most developmentally complex green algae , were initially suggested in an earlier period as a sister group of land plants8 ( fig . 1a ) , and the early molecular phylogenetic analyses using four ( two plastid , one mitochondrial , and one nuclear ) or six ( four plastid , one mitochondrial , and one nuclear ) genes uncovered this topology.9,10 this hypothesis was an appealing result , in that charales appeared to have similar morphologies and growth patterns to land plants , and it supported an evolutionary scenario toward increasing cellular complexity . however , the charales are macrophytic and coenocytic algae with multiple nuclei in large cells.11 in contrast , coleochaetales and zygnematales are true multicellular algae ( with plasmodesmata ) that have separate cells , each with a single nucleus . in this cytological sense , coleochaetales or zygnematales may represent more appropriate sister groups to land plants , based on the transition from unicellular to multicellular organization . indeed , the genome - scale molecular data consistently reject the charales as sister to land plants and support alternative charophyte groups . previous phylogenomic analyses of chloroplast genomes have yielded topology with coleochaetales as sister to land plants12,13 ( fig . 1b ) , but the taxon sampling of charophyte algae from these analyses was limited , possibly resulting in a less reliable topology . in addition , if evolutionary models do not describe the biological properties of the data , then tree building can be incorrect.14,15 worst of all perhaps , while the use of more data could reduce sampling errors , it simultaneously makes systematic errors more apparent . thus , not all phylogenetic problems can be easily resolved with genome - scale analyses , and more attention must be given to systematic errors when large datasets are used for phylogenetic inference . considering both sampling and systematic errors in genome - scale data , zhong et al.16 reported three new chloroplast genomes from charophyte algae and used a site pattern sorting method17 as well as site- and time - heterogeneous models1820 to reduce both classes of errors and address the branching order among charophyte algae and land plants . the chloroplast phylogenomic results strongly rule out earlier hypotheses placing charales or coleochaetales as sister group to land plants . furthermore , this analysis indicated that more realistic models have a better fit to the data with more confidence and better infer the origin of land plants . cox et al.21 also supported the zygnematales closest to land plants by reducing the compositional bias in chloroplast - genome data . because of the highly variable structure of algae mitochondria , there are few studies investigating the origin of land plants using mitochondrial genomes . turmel et al.22 analyzed 40 mitochondrial protein - coding genes from charophyte algae , but did not clearly resolve the relationship among the zygnematales , coleochaetales , charales , and land plants . recently , the multilocus nuclear data have been commonly used to infer the origin of land plants . phylogenomic analyses of a large number of nuclear genes have supported topologies with either zygnematales23,24 or the branch subtending zygnematales and coleochaetales25,26 as closest to land plants . however , sparse taxon sampling of charophyte algae ( 6 taxa23 , 8 taxa24 , and 10 taxa25,26 ) from these nuclear genome analyses can not yet unambiguously provide the accurate phylogenetic topology . to increase the taxon sampling , wickett et al.27 applied rna - seq technology to sequence 92 transcriptomes of green plants including 18 charophyte algae and found high support for a sister relationship between zygnematales and land plants . the large nuclear genomic data have been recently used to investigate land plant origins,2325 but there is considerable variation ( relatively low probabilities ) between gene trees from different nuclear genes . the concatenation method combines different genes into a single supergene tree that is then considered to be equivalent to the species tree . this method was suggested to give more accurate trees than a consensus approach that summarizes congruence among individual gene trees.28 the assumption of the concatenation method is that it assumes all genes have the same ( or at least similar ) gene trees,29,30 but it has become clear that individual gene trees appear to conflict with one another and gene tree heterogeneity is ubiquitous.31,32 thus , the concatenation method may yield misleading inferences of species relationships in the presence of a high level of gene tree heterogeneity.33,34 if selecting the genes with strong phylogenetic signals ( high average internode support ) , concatenation method may still accurately reconstruct the specie tree.35 high gene tree heterogeneity from nuclear genes has been a significant issue in phylogenomics.31,36 there are many reasons for gene tree heterogeneity and gene trees versus species trees conflict , including horizontal gene transfer , natural selection , and incomplete lineage sorting ( ils ) ( fig . 2a ) : it is well accepted within evolutionary studies that there is a continuum from individuals , populations , races , varieties , sibling species , species , species complexes , subgenera , genera , etc . along this continuum we expect introgression and hybridization to be quite normal , even if these two processes decrease at deeper divergences.natural selection ( fig . 2b ) : it has been generally assumed that most , if not all , mutations were neutral and that genetic drift was the dominant effect . in practice , we know very little about the factors of natural selection that might be operating in related lineages . if the mutational process is random ( and is not related to any needs of the organism ) and is occurring all the time , then there is no surprise if related lineages independently happen upon similar mutations that are advantageous.incomplete lineage sorting ( fig . 2c ) : it takes time for two variants in a population to coalesce , especially for larger populations . the failure of two or more lineages in a population to coalesce leads to the possibility that at least one of the lineages coalesces first with a lineage from a less - closely related population.36 this factor is currently best studied and modeled as to why gene trees are distinct . the probability of inferring the wrong species tree due to ils has been calculated theoretically for four individual species,37 and later pamilo and nei38 confirmed that ils is a general case and proposed that adding more gene sequences will still provide the correct relationship 2a ) : it is well accepted within evolutionary studies that there is a continuum from individuals , populations , races , varieties , sibling species , species , species complexes , subgenera , genera , etc . along this continuum we expect introgression and hybridization to be quite normal , even if these two processes decrease at deeper divergences 2b ) : it has been generally assumed that most , if not all , mutations were neutral and that genetic drift was the dominant effect . in practice , we know very little about the factors of natural selection that might be operating in related lineages . if the mutational process is random ( and is not related to any needs of the organism ) and is occurring all the time , then there is no surprise if related lineages independently happen upon similar mutations that are advantageous . 2c ) : it takes time for two variants in a population to coalesce , especially for larger populations . the failure of two or more lineages in a population to coalesce leads to the possibility that at least one of the lineages coalesces first with a lineage from a less - closely related population.36 this factor is currently best studied and modeled as to why gene trees are distinct . the probability of inferring the wrong species tree due to ils has been calculated theoretically for four individual species,37 and later pamilo and nei38 confirmed that ils is a general case and proposed that adding more gene sequences will still provide the correct relationship . in terms of investigating the origin of land plants , an ancient rapid radiation can lead to short internal and long external branches , which can increase the potential for both ils and gene tree heterogeneity . the multispecies coalescent model is designed to approximate variation in a species tree topology derived from ils , and it chooses ancestors from the population backward through time for multiple sequences but places some constraints on how recently the coalescences occur . because gene trees are allowed to vary in the multispecies coalescent model , coalescent methods can consistently estimate species trees in spite of the presence of heterogeneous gene trees.3941 using a data set of 289 nuclear genes from 32 green plant taxa , zhong et al.42 applied the multispecies coalescent model for the first time to revisit the origin of land plants . in this study , the coalescent method across different subsets of data consistently suggested that the ancestors of zygnematales are the closest relatives of land plants ( fig . in contrast , concatenation methods yield misleading inferences of species relationships in the presence of a high level of gene tree heterogeneity for the origin of land plants and support inconsistent relationships across different subsets . this analysis also shows that the multispecies coalescent model could greatly accommodate gene tree heterogeneity in deep - level phylogenies . later , wickett et al.27 used similar coalescent methods with increasingly larger number of taxa and arrived at the same results . thus , figure 1c appears the best estimate for the origin of land plants the zygnematales are the closest group to land plants . in molecular phylogenomics , markov models are used to describe substitutions among dna or protein sequences , and therefore to reconstruct phylogenetic trees and understand evolutionary events . when selecting the best model for specific data , there is always a balance between the oversimplified and overfitted models . oversimplified models often describe the evolutionary property with only a few parameters and have the same model for all sites , possibly leading to biased conclusions . in contrast , evolutionary models that use too many parameters may have all sites to vary consistently in their rates and substitution types and overfit the data resulting in errors for estimating a large number of parameters . so it is important to evaluate whether the data can be adequately explained by evolutionary models and to identify the misfitting parts in the data . we anticipate that a goodness - of - fit test between models and data will become a standard step in phylogenomic analyses . similarly , we suggest that the use of more complex ( well - fitted ) models that incorporate heterogeneity of the substitution process will significantly improve the accuracy of phylogenetic inference . further , with the increase of genomic data , gene tree versus species tree incongruence is becoming even more obvious , implying that biological factors may lead to incorrect gene trees and blur the treelike relationships . ils appears to be the main biological mechanism resulting in gene tree heterogeneity in empirical data sets , and the multispecies coalescent model should be considered as the useful tool to efficiently accommodate gene tree variation . in general , there has been little theoretical work on the ability of methods to recover deeper divergences ( eg , origin of land plants ) , although we can not say that it is impossible to recover very deep phylogeny accurately , neither has it been shown that we can . in the future , we need to better understand deeper and deeper phylogeny beyond the limit of markov models that were applied to primary sequences . we are now living in very exciting times , and the power of phylogenomics can be combined and integrated with many other aspects of biology to be able to study a wide range of questions . this has started that the origin of land plants is likely the ancestors of zygnematales . it appears to be the single - nucleus multicellular lineage of green algae ( rather than the lineage of the charales ) that led to the multicellular land plants . most of the charophyte algae have motile sperms , but the current members of zygnematales do not have motile sperms , which is assumed to be a derived feature within them . this scenario implies that there is an independent loss of motile sperms that occurred in the sister lineage of land plants.43 we indeed need additional genome - scale data from some lineages of charophyte algae , especially breaking up some long branches . given that congruence of results from multiple and independent lines of evidence is a key approach for the validation of phylogenetic estimation , it is also desirable to investigate which topologies are supported with indels , gene order , and retrotransposon data . we can also include cytological features on the optimal tree with sequence data and study the evolution of the cell structure of charophyte algae .

land plants are a natural group , and charophyte algae are the closest lineages of land plants and have six morphologically diverged groups . the conjugating green algae ( zygnematales ) are now suggested to be the extant sister group to land plants , providing the novel understanding for character evolution and early multicellular innovations in land plants . we review recent molecular phylogenetic work on the origin of land plants and discuss some future directions in phylogenomic analyses .

Introduction The Phylogenetic Progresses of Land Plants Origin The Limitations of Genomic Data on Resolving Land Plant Origins Future Perspectives

a cohort prospective study was conducted between october 2005 and october 2010 in jabir abueliz diabetic center ( jadc ) , khartoum , sudan . it included 330 diabetic patients with foot osteomyelitis ( study group ) and 1,808 diabetic patients with a foot ulcer but without foot osteomyelitis ( control group ) . all patients had an informed consent , and the study was approved by the ethical committee in jadc . clinical assessment of all patients who presented to our outpatient clinic with diabetic foot ulcers included the probe - to - bone ( ptb ) test . the ptb test was performed using a sterile probe to palpate the suspicious osteomyelitic bone at the base of the wound . repeated plain radiographic views were used to diagnose osteomyelitis and demonstrate bone destruction in addition to the follow - up for resolution of infection . magnetic resonance imaging ( mri ) and bone scintigraphy were only used selectively to differentiate between osteomyelitis and non - infective bone destruction in diabetic neuropathic patients . clinical pictures ( a , b ) demonstrating the probe - to - bone test in our study . surgical treatment included debridement , sequestrectomy , metatarsal and/or phalangeal resection , or toe amputation ( fig . surgical debridement was performed in patients who had no critical limb ischemia , and minor amputations were performed for those with localized gangrene . in all patients , major limb ischemia was diagnosed both clinically and with vascular non - invasive studies of ankle brachial index < 0.9 . wound healing was allowed by secondary intention or in cases where extensive tissue and skin loss or the wound edges were too far apart for closure , acceleration of wound healing was achieved by minor plastic reconstructive procedures such as secondary sutures , skin grafts , and flaps ( figs . 3 and 4 ) . postoperative wound off - loading was initiated with fiberglass casting , initial bed rest , accommodative dressings , external fixation , assistant devices , therapeutic shoes , or total contact casting . surgical resection and debridement of infected metatarsal and phalangeal bones ( a , b ) . intraoperative clinical pictures demonstrating the surgical probing to bone ( a ) , partial bone resection ( b ) , and wound closure ( c ) . the minimal duration of antibiotic treatment was 6 weeks , and it varied according to the clinical and radiological evidence of infection resolution . the commonly used antibiotics were ceftriaxone , ceftazidime , gentamicin , amikacin , amoxicillin / clavulanic acid , and ciprofloxacin . after wound healing , patients were followed for at least 1 year , and limb salvage was considered when no major lower extremity amputation was required . statistical tests using student 's t - test for numerical values and chi square ( ) tests were utilized . three hundred and thirty diabetic patients with foot osteomyelitis mainly in the forefoot ( study group ) and 1,808 diabetic patients without foot osteomyelitis ( control group ) were studied . table 1 shows that both groups were matched for age only with more male predominance in the study group . among the study group , toes were involved in 1,192 patients from both groups ( 51% ) , metatarsal heads in 37.5% , and the heel in only 3% . comparison between diabetic foot ulcerations with osteomyelitis ( study group ) and without osteomyelitis ( control group ) at initial presentation , 82.1% ( n=271 ) of the osteomyelitis patients in the study group had an ulcer penetrating the bone or joint level ( wagner grade 3 ulcer ) . the most common causative organisms for the study group were staphylococcus aureus ( 33.3% ) , pseudomonas aeruginosa ( 32.2% ) , and escherichia coli ( 22.2% ) . in the remaining 59 patients from the study group ( 17.9% ) , the diagnosis of osteomyelitis was based on clinical finding of increased size of the toe ( sausage toe ) with repeated findings on plain radiographic views . bone scintigraphy and mri were used only in 53 patients from both study and control groups . in the control group , 87.2% of the ulcers initially presented with a grade 2 or less wagner ulcer , and the most common bacterial isolates were similar to that of the study group . out of the patients with osteomyelitis , 61.2% had peripheral neuropathy compared to 50% in the control group ( p=0.05 ; = 3.84 ) . peripheral vascular disease was reported in 32.7% of the study group and in 28.8% of the control group ( p=0.007 ) . diabetic neuropathic osteoarthropathy was reported in 11 cases ( 3.3% ) of the study group and in 48 patients in the control group ( 2.7% ) . management entailed partial sequestrectomy for necrotic bone combined with long - term antibiotics for 68 weeks based on the results of bacteriological cultures and sensitivities . the degree of bone resection varied from minor excision of necrotic bone up to complete removal of the digital bones . in the study group , toes were affected in 237 patients ( 71.6% ) versus 955 in the control group ( 53% ) . toe amputation was performed in 116 patients in the study group ( 35% ) versus 355 in the control group ( 19% ) ( p=0.001 ) . the hallux was the most common digit to be amputated ( n=35 ) , which represented 10.6% of the study group . wound healing in the study group occurred within less than 6 months in 73% of patients compared to 89.9% in the control group ( p=0.0002 ) ( table 1 ) . in the study group , limb salvage was achieved in 81.8% compared to 96% in the control group ( p=0.0001 ) . in the study group , 52 patients ( 15.8% ) had a major lower extremity amputation caused by deep infection and extensive tissue necrosis in 40 patients , and peripheral vascular disease in the remaining 12 patients . in addition , there was no significant difference in the incidence of wound recurrence between the two groups during 1 year of follow - up ( table 1 ) . diabetic foot infections account for a substantial global burden of morbidity , psychosocial disruption , and economic cost . recommendations for best practice are continuously evolving in parallel with improvements in medical imaging modalities , development and clinical use of new antimicrobial agents , and data surrounding novel wound - healing adjunctive strategies ( 3 ) . in developing countries , patients usually present late for treatment with devastating complications of the advanced diabetes mellitus disease . in those cases of diabetic foot osteomyelitis with an ulcer presentation that can be probed to the bone level , imaging studies may rarely be used . the ptb test with bone specimen collection taken for microbiological culture , sensitivities , and/or biopsy is very reliable , and the diagnosis of osteomyelitis can confidently be established particularly if the underlying bone is necrotic and friable in consistency ( 1 , 46 ) . ptb testing should be included in the initial assessment of all diabetic patients with infected pedal ulcers ( 7 ) . in our study , a common presentation we encountered was a sizable sausage - shaped toe , the appearance of which should alert the physician to the possibility of underlying osteomyelitis ( 8) . in few cases , there is a diagnostic difficulty to differentiate between osteomyelitis and neuropathic osteoarthropathy especially when there is no wound and ptb testing can not be performed . in these cases , repeated plain radiographs , mri , and/or bone scintigraphy may be needed . in many previous studies , mri is thought to be the most accurate imaging tool to diagnose osteomyelitis ( 914 ) . it has been shown that surgical resection of the infected and necrotic bone favors a good outcome in chronic osteomyelitis ( 1518 ) and that careful assessment of the patient 's lower extremity vascular and neurological status is necessary before any surgical intervention ( 19 , 20 ) . surgical treatment in our study group included sequestrectomy and debridement of necrotic and friable bone to healthy bone margins . in some cases , more extensive surgical debridement in the form of partial resection of the metatarsal bone or even phalangeal bones was performed . minor amputations were performed if there was an extensive localized soft tissue necrosis provided that there was no critical ischemia . published data have reported that diabetic foot osteomyelitis , in the absence of extensive necrosis or gangrene , usually responds to antimicrobial therapy without the need for an ablative surgical procedure ( 21 ) . have also reviewed the management of osteomyelitis in a multidisciplinary diabetic foot clinic and reported that the success of conservative therapy with prolonged course of oral antibiotics challenges conventional advice that excision of infected bone is essential in the management of osteomyelitis in diabetic patients ( 22 ) . in our study , we have found that surgical sequestrectomy combined with prolonged oral antibiotic therapy gave the best results for the patients with diabetic foot osteomyelitis . this combined method may reduce the changes in biomechanical alterations of the diabetic foot and minimize the duration of antibiotic therapy . however , more research including studies of adjunctive therapies in cases of bone infection in the feet of diabetic patients is required ( 23 ) . the choice of antibiotic therapy is best guided by a bone biopsy or debridement culture results ( 19 ) . parenteral therapy is needed for severe infections , but oral therapy is adequate for most mild or moderate diabetic foot infections ( 24 ) . in our study group , bone specimens for culture and sensitivities to identify the causative pathogens were obtained after the surgical wound debridement in order to avoid contamination results . staphylococcus aureus was the most common pathogen to be isolated from our specimens , which was in agreement with most international reports ( 1 , 15 , 22 , 25 ) , but a higher than usual incidence of pseudomonas aeruginosa osteomyelitis was noticed . patients received antibiotics according to the results of culture and sensitivity for at least 6 weeks . initially , broad - spectrum intravenous antibiotics were used in the presence of a severe diabetic foot infection until the final microbiological results were received . in moderate or mild diabetic foot infections , oral antibiotics were used . the duration of antibiotics depended on the clinical , microbiological , and radiological evidence of infection control . when infection was adequately eradicated , the antibiotics treatment was discontinued even in the presence of a wound . non - infected wounds can heal if appropriate wound care with regular wound dressings are performed , and antibiotic therapy is not usually indicated in clinically non - infected wounds ( 17 , 26 ) . the duration of antibiotic therapy may be shortened considerably after surgical intervention ( 27 ) . split thickness skin grafting has also been shown to be an effective method of managing diabetic foot ulcers as compared to conservative wound dressings by reducing healing times and length of hospital stay with minimal donor - site morbidity ( 28 ) . after surgical debridement , off - loading played an important role for our postoperative care . relieving pressure on the ulcerated area is absolutely crucial in the treatment of the diabetic foot to prevent further trauma , reduce any shearing forces to the area , and facilitate wound healing . diabetic limb salvage was obtained in a considerable number of patients with osteomyelitis with a combined surgical and antibiotic treatment . however , we reported a significantly higher incidence of major amputation in the study group . this may be considered due to the more extensive tissue necrosis , bone and joint destruction , and loss of normal foot structure that presented in the study group with diabetic foot osteomyelitis . the hallux was also found to be the most common site affected in the study group ( 29 ) . in addition , both groups had almost similar wound recurrence rates during the postoperative period . in developing countries , due to the delayed presentation of a diabetic foot complication , initial medical imaging studies may rarely be used . combined surgical and medical treatment can achieve acceptable diabetic limb salvage rates and also reduce the duration of time to healing , duration of antibiotic treatment , and wound recurrence . the authors have not received any funding or benefits from industry or from elsewhere to conduct this study .

diabetic foot infections are a high risk for lower extremity amputation in patients with dense peripheral neuropathy and/or peripheral vascular disease . when they present with concomitant osteomyelitis , it poses a great challenge to the surgical and medical teams with continuing debates regarding the treatment strategy . a cohort prospective study conducted between october 2005 and october 2010 included 330 diabetic patients with osteomyelitis mainly involving the forefoot ( study group ) and 1,808 patients without foot osteomyelitis ( control group ) . diagnosis of osteomyelitis was based on probing to bone test with bone cultures for microbiological studies and/or repeated plain radiographic findings . surgical treatment included debridement , sequestrectomy , resections of metatarsal and digital bones , or toe amputation . antibiotics were started as empirical and modified according to the final culture and sensitivities for all patients . patients were followed for at least 1 year after wound healing . the mean age of the study group was 56.7 years ( sd = 11.4 ) compared to the control group of 56.3 years ( sd = 12.1 ) , while the male to female ratio was 3:1 . at initial presentation , 82.1% ( n=271 ) of the study group had an ulcer penetrating the bone or joint level . the most common pathogens were staphylococcus aureus ( 33.3% ) , pseudomonas aeruginosa ( 32.2% ) , and escherichia coli ( 22.2% ) with an almost similar pattern in the control group . in the study group , wound healing occurred in less than 6 months in 73% of patients compared to 89.9% in the control group . in the study group , 52 patients ( 15.8% ) had a major lower extremity amputation versus 61 in the control group ( 3.4% ) ( p=0.001 ) . during the postoperative follow - up visits , 12.1% of patients in each group developed wound recurrence . in conclusion , combined surgical and medical treatment for diabetic foot osteomyelitis can achieve acceptable limb salvage rate and also reduce the duration of time to healing along with the duration of antibiotic treatment and wound recurrence rate .

Patients and methods Results Discussion Conclusion Conflict of interest and funding

teamwork in the intensive care unit ( icu ) refers to the leadership , decision - making , communication , and coordination behaviors used by multidisciplinary team members to provide patient care . patient safety research has demonstrated the importance of effective teamwork for ensuring positive patient outcomes in the icu . poor communication during rounds and handovers ( or handoffs ) is frequently cited as a cause of medical error [ 2 - 4 ] , and units with high levels of nurse - doctor collaboration have improved patient mortality rates and reduced average patient length of stay . in attempting to understand and improve teamwork in the icu , researchers cite teamwork models and training techniques used to manage and improve teamwork skills in aviation . like work environments in aviation , the icu is a complex , high - risk , and stressful setting , and it can potentially gain from adopting and integrating the principles and techniques used to train team skills in aviation . we consider the case for this and reflect upon the similarities and differences that exist between aviation and intensive care . the aviation model of teamwork draws heavily from social and cognitive psychology and is based on an understanding that team behavior can both cause and protect against error . it considers the team - related ' active failures ' ( for example , failures to communicate the proximity of nearby aircraft ) and ' latent failures ' ( for example , lack of team training , poor ergonomic design , and organizational culture ) that influence behavior and error in the cockpit . psychology concepts relating to communication , shared decision - making , leadership , team cohesion , team mental models ( shared knowledge structures for teamwork and taskwork ) , and team climate are applied to understand performance and error . through the use of systemized models , these various concepts are bound together to explain how ' team processes ' ( for example , leadership and communication ) predict ' team outputs ' ( for example , error and team effectiveness ) . furthermore , shared knowledge structures and ' team inputs ' ( for example , group hierarchies and culture ) are shown to influence teamwork behaviors , and safety culture is particularly significant . to understand the specific team behaviors important for safety in aviation , human factor specialists have performed cognitive task analyses , error analyses , attitudinal surveys , observational studies , and ergonomic assessments . these data have structured the content of team training packages and have contributed to the identification of teamwork knowledge , skills , and attitudes that underpin effective team performance ( table 1 ) . training and assessment in aviation focus on improving communication skills , briefing behaviors , self - critique , leadership skills , workload management , vigilance and stress management , knowledge of team member skills / roles , and attitudes toward teamwork . teamwork research in the icu has shown that the systems and concepts used to understand team performance in aviation are also relevant for patient safety in intensive care medicine . however , although team training has become increasingly common within the icu , much can be learned from the aviation industry 's advances in developing and integrating into practice the systems for measuring team behavior , providing feed - back , and developing teamwork skills . team knowledge , skills , and attitude competencies this table , adapted from baker and colleagues and salas and colleagues , is original and has not been reproduced elsewhere . in aviation , team training is mandatory for commercial pilots in europe and the us . virtually all large airlines use team training packages . these use a combination of simulation and class - based training to help aircrews ( a ) prevent errors from occurring , ( b ) identify and trap errors , and ( c ) mitigate the consequences of error . the aviation model provides aircrews with ongoing team training ( for example , annually ) and uses established pedagogic models to evaluate effectiveness . such programs have a demonstrable impact on the attitudes of participants toward teamwork , teamwork behaviors , and knowledge of human factors . validation of crew resource management skills is a training requirement throughout the aviation industry , and best practice is determined by regulators . despite evidence that the importance of team training is widely accepted in health care , it has not been adopted uniformly and the number of teams that regularly participate in training is still small . key to the success of team training tools in health care is the identification of the domain - specific team skills required for effectively managing routine and emergency scenarios . in aviation , training strategies have focused on improving the skills required by aircrews to maintain effective decision - making under high levels of stress . techniques include exposing teams to high - stress situations , training pilots to facilitate team discussions before and after stressful team activities , and cross - training aircrew team members to understand the demands and needs of one another 's role . teams are trained in a multidisciplinary environment ( for example , pilots and cabin crew ) to facilitate an understanding of the challenges associated with different professional roles , to consider how group hierarchies influence behavior , and to develop expectations for behavior during different scenarios . this training helps aviation teams to form shared and positive perceptions on teamwork and stress management . to assess performance , these tools assess teamwork through observable behavioral indicators that indicate good or poor aircrew team skills . assessment and training can occur at either the individual or group level , and structured qualitative feedback is provided to participants . it is clear that the team training and assessment techniques used in aviation are relevant to the icu . for example , in the icu , as in aviation , hierarchical team structures have a negative impact on the attitudes and behaviors of doctors and nurses and , in turn , on patient safety . furthermore , a range of teamwork and leadership behaviors important for team performance and patient safety have been identified . in terms of applying this knowledge to formal team training programs , courses such as advanced trauma life support teach team skills and may provide a model for introducing team training into the teaching curriculum . training would consist of general principles underlying optimal team performance in the icu ( for example , communication openness ) and also the behavioral strategies associated with specific practices ( for example , resuscitations ) . table 2 notes the key stages associated with implementing an organization - wide team training program . key stages in the design and implementation of a team training program this table is original and has not been reproduced elsewhere . key difficulties in developing such a program would likely be related to the resources involved in managing a comprehensive team training program ( for example , trainers , simulators , and clinician time to participate ) , ensuring that programs are consistent across intensive care medicine , avoiding duplication with other team training programs ( for example , anesthesia ) , generating intuitional support for team training , and identifying the key team training requirements for multidisciplinary icu teams . to develop team training programs for the icu , it is necessary to consider the extent to which the models used to conceptualize team performance in aviation can be applied in intensive care medicine . as discussed above , parallels have been made between teamwork in aviation and intensive care . icu teams are also reliant upon teams that manage risk , complex technologies , changeable workloads , and uncertainty . fatigue and stress are known to negatively influence performance in the icu , and non - technical factors such as team communication , situation awareness , and decision making frequently underlie error . however , there are also a number of general critiques that can be made in the comparisons drawn between aviation and health care [ 24 - 26 ] . for example , owing to the catastrophic consequences associated with in - flight safety failures , there are positive perceptions ( and a general awareness ) of safety culture throughout aviation . in addition , medical errors often influence only a single patient ( and their family ) and , except in cases of negligence , the outcomes rarely impact other patients or health - care providers . furthermore , aircrews typically manage stable interlinked systems that operate within expected parameters , and emergency events occur when the functioning of these systems is threatened . they must tolerate high levels of risk and develop an ongoing understanding of the complex interactions between medical treatments and patient physiology . in regard to differences between aviation and the icu , a number of further distinctions can be drawn ( table 3 ) . it is notable that comparisons between aviation and acute medicine often focus on the domains of anesthesia and surgery . this reflects similarities in procedures with aviation ( for example , pre - operative checks , induction , extubation , post - operative checks , and awakening ) . however , the organization of work in intensive care medicine limits the extent to which these parallels can made . for example , unlike aviation work environments , icus consist of large medical and nursing teams that care for numerous patients simultaneously . problem solving is key , and teams must diagnose poorly understood patient illnesses , stabilize the condition of patients , and stimulate recovery . team members have minimal prior knowledge of patient histories , and patient populations are diverse in terms of demographic background , risk factors , and underlying pathology . key similarities and differences in the challenges faced by intensive care unit and aviation teams this table is original and has not been reproduced elsewhere . in addition , the flow of work in the icu differs considerably from that in aviation . for example , within a single icu , teams will perform a diverse range of hands - on , problem - solving , and monitoring tasks . in comparison , aircrews typically monitor and adjust a stable system in which outcomes are usually clear ( and positive ) , and team and task skills are essential for avoiding or managing emergency situations . problems in aircraft technical performance are often raised through automatic warning systems , and periods of activity tend to be discrete ( for example , a 12-hour flight ) . in the icu , length of patient care is frequently undeterminable , and the duration of stay depends on the likelihood that patients will experience a sudden deterioration , the stage of treatment , and system factors within a hospital ( for example , available bed spaces ) . patient outcomes are often unclear , and approximately 20% of uk patients do not survive intensive care . furthermore , patient care within the hospital system does not cease when a patient is discharged from the icu , and patients may return . numerous clinical and nursing staff may provide patient care , and continuity of care is maintained through regular handovers . while these are key to maintaining the quality and safety of care , they can be un - standardized and subject to error . furthermore , an icu will typically have several specialists leading the unit , and compared with their counterparts in aviation , each has substantial autonomy in terms of leadership style and preferred operating procedures . this can result in inconsistencies ( between specialists ) in their expectations for the standards and procedures used to manage patient care and in their expectations for teamwork behaviors and attitudes . despite these differences , intensive care and aviation teams they are multidisciplinary in nature and exhibit clear differences in the expertise and authority of team members . furthermore , team performance is influenced by factors such as team leadership and shared cognition , and lessons can be drawn from the psychology literature on error avoidance and performance - enhancing strategies . it is notable that both icu specialists and pilots believe in the importance of teamwork for safety and reject steep team hierarchies . however , in comparison with pilots , icu specialists are less likely to report making errors ( or to feel comfortable discussing error ) , and they tend to have overly positive perceptions ( compared with junior team members ) toward team communication . furthermore , although both aviation work environments and the icu are highly stressful , intensive care specialists are less likely ( than pilots ) to acknowledge the detrimental impact of factors such as stress and fatigue upon safety and performance . senior intensivists are generally considered ' expert ' in the icu , and the majority of medical staff are in a training role . trainees perform much of the hands - on clinical work and must learn to coordinate with nursing teams that have their own team structures , hierarchies , and levels of expertise . at an advanced level , trainees must learn to manage the icu on their own ( for example , at night ) . although senior intensivists are available to provide support , the thresholds for requesting help can depend on the trainee 's disposition to solicit help and on perceptions of the senior intensivists ' attitude toward false alarms . a further difference with aviation is the participation of other actors in ' operational ' decision - making . for example , patient decision - making in the icu can be influenced by non - clinical staff ( for example , patients and families ) and colleagues from other departments ( for example , surgery ) . however , like aviation teams , icu teams regularly work with colleagues in other departments ( for example , surgery , microbiology , and radiology ) . cockpit crews must also coordinate with teams in disparate locations ( for example , air traffic control towers ) . yet in the icu ( and in healthcare in general ) , the lines and protocols of communication between hospital units are often informal , un - centralized , and fragmented . an additional parallel between the icu and aviation is the reliance on protocols to ensure safety and quality . in the icu , a range of technical protocols are used to structure patient care and ensure safety . aviation teams also use numerous protocols ( for example , pre - flight checks ) , and within the icu the emulation of aviation - style protocols to improve patient handovers has been shown to have positive outcomes . however , owing to high levels of uncertainty associated with icu patients , clinical judgment remains key for determining patient treatments and outcomes , and the extent to which it is desirable to extend protocols to aspects of teamwork and decision making is unclear . finally , the use of simulation in icu training is increasing , and this will help to facilitate the adoption of the multidisciplinary team training methods used in aviation . on the surface , the aviation model does provide a strong initial platform against which to design and implement team training programs for the icu . the generic teamwork skills that underpin effective performance are similar , and the process of team training should draw on similar methods and techniques . however , it can be seen that there are many differences between aviation and the icu in the nature of work and team performance ( table 3 ) . it is not sufficient or desirable to simply transfer to the icu the programs developed for aviation or the operating theatre ( where , it can be argued , the cognitive structure of work is quite similar to that of aviation ) . rather , team training in the icu must consider the ebb and flow of work in critical care , and programs must focus on routine and non - routine events , and be reflective of cognitive tasks , team structures , and group norms . the specific team skills and behaviors that underpin team performance must be captured and explicitly stated if we are to develop a relevant and sustainable model of team training and assessment for the icu . this article is part of a series on healthcare delivery , edited by dr andre amaral and dr gordon rubenfeld .

the aviation industry has made significant progress in identifying the skills and behaviors that result in effective teamwork . its conceptualization of teamwork , development of training programs , and design of assessment tools are highly relevant to the intensive care unit ( icu ) . team skills are important for maintaining safety in both domains , as multidisciplinary teams must work effectively under highly complex , stressful , and uncertain conditions . however , there are substantial differences in the nature of work and structure of teams in the icu in comparison with those in aviation . while intensive care medicine may wish to use the advances made by the aviation industry for conceptualizing team skills and implementing team training programs , interventions must be tailored to the highly specific demands of the icu .

Introduction The aviation teamwork model Comparisons between aviation and the intensive care unit Conclusions Note Abbreviations Competing interests

the existence of coupling between neuronal activity , metabolic and hemodynamic responses is a prerequisite for brain function research employing non - invasive neuroimaging techniques such as functional magnetic resonance imaging ( fmri ) , positron emission tomography ( pet ) and near - infrared optical imaging ( nioi ) , which can visualize stimulus - induced activation areas in the human brain ( see rev . ) . although the mechanism of the coupling between these physiological parameters remains to be elucidated despite numerous investigations conducted over past decades ( see rev . ) , a tight coupling has been assumed to elucidate brain function based on the data obtained using these techniques ( see rev . ) . within the past some dozen years , it has been reported that changes in rcbf in response to visual stimuli are accompanied by smaller changes in the regional metabolic rate of o2 ( rcmro2 ) in the human visual cortex ( e.g. , rcbf : rcmro2 = 10:1 or 2:1 ) . this implies that the oxygen supply is not precisely matched with the demand ( referred to as " overcompensation " or " decoupling between rcbf and rcmro2 " ) . more recently , the use of optical techniques to monitor the visual cortex of animals has shown that ( 1 ) after onset of a stimulus , the concentration of deoxy - hb increases first at a focal region in the cortex co - localized with neuronal activation and increased o2 consumption , and ( 2 ) this is followed by a decrease in deoxy - hb and a large increase in oxy - hb , which is caused by a delayed but large and less localized increase in rcbf [ 6 - 8 ] . in the course of our studies , we found a decoupling between rcbf and rcbv during visual stimulation in the human occipital cortex , although it has been empirically appreciated that an increase in rcbf accompanies an increase in rcbv . the relationship between the two was determined using whole - head measurement , which is often used for the analysis of stimulus - induced changes in rcbf and rcbv . on the basis of our results , we propose that some mechanism regulates regional blood flow ( rcbf ) and blood volume ( rcbv ) above a certain level of neuronal activity . if the mechanism works as a general rule during regional brain activation , it should occur regardless of type of stimuli , area of cortex , or animal species . in the present study , we performed two different experiments to test the above hypothesis . first , the relationship between neuronal activity and hemodynamic responses was examined in the human occipital cortex using two types of visual stimuli ( a black and white annular checkerboard and a flash - photo stimulus ) . secondly , we investigated the relationship in the rat somatosensory cortex when the peripheral nerve was stimulated electrically . here all subjects had normal or corrected - to - normal vision and provided written informed consent . four of the six subjects participated in nioi measurements only . a flash - photo stimulator ( sls-2141 , nihon kohden kogyo co. ltd , japan ) was used to provide visual stimuli ( temporal frequency at 0.5 , 1 , 8 and 21 hz ) . the time sequence of the experiments consisted of [ control ( 30 sec ) + stimulation ( 30 sec ) ] . each of four different frequencies was shown four times in pseudo - random order . during the experiments , subjects sat still on a chair and were required to keep their eyes closed lightly . a black and white annular checkerboard , with a central fixation point and gray background , was used as the visual stimulus ( perimacular annulus , 1.2 to 5.8 degrees ; angle of each wedge , 10 degrees ; number of layers , 5 ; temporal frequency , 0.5 , 1.4 , 4.7 , and 14 hz ) . the time sequence of the experiments consisted of [ control ( 28 sec ) + stimulation ( 28 sec ) ] . each of four different reversal frequencies was shown four times in pseudo - random order . during the control and stimulation periods , subjects were required to fixate on a fixation cross in the middle of the checkerboard , and to lie still on his back on a patient table of mri . a 16-channel near - infrared optical imaging system , optim_a , was used to obtain optical images of changes in concentration of hemoglobin ( hb ) species in the occipital cortex for simultaneous measurement with fmri . the system consisted of six optical source units , each having three laser diodes ( 780 , 805 , and 830 nm ) and six photomultiplier tubes . the source units and detector tubes were connected to glass - fiber bundles for the illumination of incident light and for the collection of reflected light from the head . combinations of 16 nearest - neighbor pairs of input and output fibers were used to obtain a topographical image covering a 76 76 mm area in the occipital region of the head . the pixel size of the nioi was estimated to be 20 20 mm at a source - detector distance of 27 mm . a single - channel near - infrared spectroscopy ( om-100a , shimadzu co. , japan ) was used to monitor changes in concentrations of hb species during the flash - photo stimulation . the system consisted of one optical source unit , with three laser diodes ( 780 , 805 , and 830 nm ) , and one photomultiplier tube . changes in the hb species concentration , expressed in an arbitrary unit , ( [oxy - hb ] , [deoxy - hb ] , and [total - hb ] + [deoxy - hb ] ) ) from the control conditions were calculated based on a modified lambert - beer law , using the extinction coefficient of chromophores reported by matcher et al . as follows . = 1.855abs780 - 0.239abs805 - 1.095abs830 a 1.5 t mri scanner ( magnetom vision ; siemens , germany ) was used to obtain blood oxygen level - dependent contrast functional images . functional images weighted with the apparent transverse relaxation time ( t2 * ) were obtained with an echo planar imaging ( epi ) sequence ( repetition time ( tr ) , 4000 msec ; echo time ( te ) , 55.24 msec ; flip angle ( fa ) , 90 ; field of view ( fov ) , 256 256 mm ; matrix size , 64 64 ; slice thickness , 4 mm ) . areas of significant activation were determined using spm99 . motion correction and spatial smoothing ( three - dimensional gaussian kernel , 11 mm full width at half maximum ) areas of activation were determined by a statistical threshold of p < 0.0001 ( voxel level ) corrected for multiple comparison for the entire search volume ) . to enable the fmri and optical signals to be compared , the time series of the fmri signals were processed as follows . after removing motion artifacts from all the t2 * -weighted images using automated image registration ( air , version 3.0 , the time courses of the fmri signals from the region of interest were obtained using avs / express version 3.2 ( advanced visual systems inc . all animal experiments were conducted in accordance with our institutional guidelines for the care and use of laboratory animals . male wistar rats weighing 190220 g were purchased from slc ( shizuoka , japan ) and allowed free access to food and water . they were then tracheotomized , immobilized with pancuronium bromide ( 2 mg / kg / h ) , and artificially ventilated with room air . a craniotomy ( 4 5 mm ) was performed on the left hemisphere and the dura mater was removed to expose the somatosensory cortex . a pair of needle electrodes was inserted underneath the skin of the plantar and ankle region in the contralateral hindlimb . except as otherwise noted , the posterior tibial nerve ( in part , the peroneal nerve ) was electrically stimulated with a rectangular pulse of 3.8 ma intensity and 0.5 msec duration at 5 hz . no major changes were detected in the mean arterial blood pressure ( 110 mmhg 5 s.d . ) during and after posterior tibial ( pt ) nerve stimulation . regional changes in red - blood - cell flow ( rrbcflow ) , velocity ( rrbcveloc ) , and content ( rrbcmass ) were measured in 12 rats using a laser - doppler tissue flowmeter ( ldf ) ( flo - ce1 , omega flow inc . signal changes from the surface of the cortex ( semiglobular , 500 m in diameter ) were collected at a time constant of 0.5 sec . in separate experiments ( 5 rats ) , changes in the diameters ( d ) of second- and third- branches of the middle cerebral artery ( mca ) and rbc velocity ( v ) in these single pial arterioles were measured using a fiber - optic laser - doppler anemometer microscope ( fldam ) . the blood - flow rate in individual microvessels was calculated as v * (d/2 ) . another five rats were used to acquire digitized images through transmission filters at 577.3 ( 1.2 ) nm with a charge - coupled device ( ccd ) camera . the magnitude of absorption change at 577 nm ( a577 ) was calculated in each pixel and color - coded to produce a false - color map . the exposed cortex was stained with a voltage - sensitive dye jpw-1114 ( molecular probes , usa ) ( 0.5 mg / ml for 90 min ) . the hindlimb was electrically stimulated 21 times with a rectangular pulse of 3.8 ma intensity and 0.5 msec duration at a frequency of 0.33 hz . the fluorescence associated with membrane potential changes was measured with a high - speed ccd imaging system , micam01 ( brain vision inc . 84 images were acquired at 2 msec intervals , and 21 series of time - course images were averaged . all subjects had normal or corrected - to - normal vision and provided written informed consent . four of the six subjects participated in nioi measurements only . a flash - photo stimulator ( sls-2141 , nihon kohden kogyo co. ltd , japan ) was used to provide visual stimuli ( temporal frequency at 0.5 , 1 , 8 and 21 hz ) . the time sequence of the experiments consisted of [ control ( 30 sec ) + stimulation ( 30 sec ) ] . each of four different frequencies was shown four times in pseudo - random order . during the experiments , subjects sat still on a chair and were required to keep their eyes closed lightly . a black and white annular checkerboard , with a central fixation point and gray background , was used as the visual stimulus ( perimacular annulus , 1.2 to 5.8 degrees ; angle of each wedge , 10 degrees ; number of layers , 5 ; temporal frequency , 0.5 , 1.4 , 4.7 , and 14 hz ) . the time sequence of the experiments consisted of [ control ( 28 sec ) + stimulation ( 28 sec ) ] . each of four different reversal frequencies was shown four times in pseudo - random order . during the control and stimulation periods , subjects were required to fixate on a fixation cross in the middle of the checkerboard , and to lie still on his back on a patient table of mri . a 16-channel near - infrared optical imaging system , optim_a , was used to obtain optical images of changes in concentration of hemoglobin ( hb ) species in the occipital cortex for simultaneous measurement with fmri . the system consisted of six optical source units , each having three laser diodes ( 780 , 805 , and 830 nm ) and six photomultiplier tubes . the source units and detector tubes were connected to glass - fiber bundles for the illumination of incident light and for the collection of reflected light from the head . combinations of 16 nearest - neighbor pairs of input and output fibers were used to obtain a topographical image covering a 76 76 mm area in the occipital region of the head . the pixel size of the nioi was estimated to be 20 20 mm at a source - detector distance of 27 mm . a single - channel near - infrared spectroscopy ( om-100a , shimadzu co. , japan ) was used to monitor changes in concentrations of hb species during the flash - photo stimulation . the system consisted of one optical source unit , with three laser diodes ( 780 , 805 , and 830 nm ) , and one photomultiplier tube . changes in the hb species concentration , expressed in an arbitrary unit , ( [oxy - hb ] , [deoxy - hb ] , and [total - hb ] + [deoxy - hb ] ) ) from the control conditions were calculated based on a modified lambert - beer law , using the extinction coefficient of chromophores reported by matcher et al . as follows . = 1.855abs780 - 0.239abs805 - 1.095abs830 a 1.5 t mri scanner ( magnetom vision ; siemens , germany ) was used to obtain blood oxygen level - dependent contrast functional images . functional images weighted with the apparent transverse relaxation time ( t2 * ) were obtained with an echo planar imaging ( epi ) sequence ( repetition time ( tr ) , 4000 msec ; echo time ( te ) , 55.24 msec ; flip angle ( fa ) , 90 ; field of view ( fov ) , 256 256 mm ; matrix size , 64 64 ; slice thickness , 4 mm ) . areas of significant activation were determined using spm99 . motion correction and spatial smoothing ( three - dimensional gaussian kernel , 11 mm full width at half maximum ) areas of activation were determined by a statistical threshold of p < 0.0001 ( voxel level ) corrected for multiple comparison for the entire search volume ) . to enable the fmri and optical signals to be compared , the time series of the fmri signals were processed as follows . after removing motion artifacts from all the t2 * -weighted images using automated image registration ( air , version 3.0 , the time courses of the fmri signals from the region of interest were obtained using avs / express version 3.2 ( advanced visual systems inc . all subjects had normal or corrected - to - normal vision and provided written informed consent . four of the six subjects participated in nioi measurements only . a flash - photo stimulator ( sls-2141 , nihon kohden kogyo co. ltd , japan ) was used to provide visual stimuli ( temporal frequency at 0.5 , 1 , 8 and 21 hz ) . the time sequence of the experiments consisted of [ control ( 30 sec ) + stimulation ( 30 sec ) ] . each of four different frequencies was shown four times in pseudo - random order . during the experiments , subjects sat still on a chair and were required to keep their eyes closed lightly . a black and white annular checkerboard , with a central fixation point and gray background , was used as the visual stimulus ( perimacular annulus , 1.2 to 5.8 degrees ; angle of each wedge , 10 degrees ; number of layers , 5 ; temporal frequency , 0.5 , 1.4 , 4.7 , and 14 hz ) . the time sequence of the experiments consisted of [ control ( 28 sec ) + stimulation ( 28 sec ) ] . each of four different reversal frequencies was shown four times in pseudo - random order . during the control and stimulation periods , subjects were required to fixate on a fixation cross in the middle of the checkerboard , and to lie still on his back on a patient table of mri . a 16-channel near - infrared optical imaging system , optim_a , was used to obtain optical images of changes in concentration of hemoglobin ( hb ) species in the occipital cortex for simultaneous measurement with fmri . the system consisted of six optical source units , each having three laser diodes ( 780 , 805 , and 830 nm ) and six photomultiplier tubes . the source units and detector tubes were connected to glass - fiber bundles for the illumination of incident light and for the collection of reflected light from the head . combinations of 16 nearest - neighbor pairs of input and output fibers were used to obtain a topographical image covering a 76 76 mm area in the occipital region of the head . the pixel size of the nioi was estimated to be 20 20 mm at a source - detector distance of 27 mm . a single - channel near - infrared spectroscopy ( om-100a , shimadzu co. , japan ) was used to monitor changes in concentrations of hb species during the flash - photo stimulation . the system consisted of one optical source unit , with three laser diodes ( 780 , 805 , and 830 nm ) , and one photomultiplier tube . changes in the hb species concentration , expressed in an arbitrary unit , ( [oxy - hb ] , [deoxy - hb ] , and [total - hb ] + [deoxy - hb ] ) ) from the control conditions were calculated based on a modified lambert - beer law , using the extinction coefficient of chromophores reported by matcher et al . as follows . a 1.5 t mri scanner ( magnetom vision ; siemens , germany ) was used to obtain blood oxygen level - dependent contrast functional images . functional images weighted with the apparent transverse relaxation time ( t2 * ) were obtained with an echo planar imaging ( epi ) sequence ( repetition time ( tr ) , 4000 msec ; echo time ( te ) , 55.24 msec ; flip angle ( fa ) , 90 ; field of view ( fov ) , 256 256 mm ; matrix size , 64 64 ; slice thickness , 4 mm ) . areas of significant activation were determined using spm99 . motion correction and spatial smoothing ( three - dimensional gaussian kernel , 11 mm full width at half maximum ) areas of activation were determined by a statistical threshold of p < 0.0001 ( voxel level ) corrected for multiple comparison for the entire search volume ) . to enable the fmri and optical signals to be compared , the time series of the fmri signals were processed as follows . after removing motion artifacts from all the t2 * -weighted images using automated image registration ( air , version 3.0 , the time courses of the fmri signals from the region of interest were obtained using avs / express version 3.2 ( advanced visual systems inc . all animal experiments were conducted in accordance with our institutional guidelines for the care and use of laboratory animals . male wistar rats weighing 190220 g were purchased from slc ( shizuoka , japan ) and allowed free access to food and water . they were then tracheotomized , immobilized with pancuronium bromide ( 2 mg / kg / h ) , and artificially ventilated with room air . a craniotomy ( 4 5 mm ) was performed on the left hemisphere and the dura mater was removed to expose the somatosensory cortex . a pair of needle electrodes was inserted underneath the skin of the plantar and ankle region in the contralateral hindlimb . except as otherwise noted , the posterior tibial nerve ( in part , the peroneal nerve ) was electrically stimulated with a rectangular pulse of 3.8 ma intensity and 0.5 msec duration at 5 hz . no major changes were detected in the mean arterial blood pressure ( 110 mmhg 5 s.d . ) during and after posterior tibial ( pt ) nerve stimulation . regional changes in red - blood - cell flow ( rrbcflow ) , velocity ( rrbcveloc ) , and content ( rrbcmass ) were measured in 12 rats using a laser - doppler tissue flowmeter ( ldf ) ( flo - ce1 , omega flow inc . , japan ) combined with a microscopy system . signal changes from the surface of the cortex ( semiglobular , 500 m in diameter ) were collected at a time constant of 0.5 sec . in separate experiments ( 5 rats ) , changes in the diameters ( d ) of second- and third- branches of the middle cerebral artery ( mca ) and rbc velocity ( v ) in these single pial arterioles were measured using a fiber - optic laser - doppler anemometer microscope ( fldam ) . the blood - flow rate in individual microvessels was calculated as v * (d/2 ) . another five rats were used to acquire digitized images through transmission filters at 577.3 ( 1.2 ) nm with a charge - coupled device ( ccd ) camera . the magnitude of absorption change at 577 nm ( a577 ) was calculated in each pixel and color - coded to produce a false - color map . the exposed cortex was stained with a voltage - sensitive dye jpw-1114 ( molecular probes , usa ) ( 0.5 mg / ml for 90 min ) . the hindlimb was electrically stimulated 21 times with a rectangular pulse of 3.8 ma intensity and 0.5 msec duration at a frequency of 0.33 hz . the fluorescence associated with membrane potential changes was measured with a high - speed ccd imaging system , micam01 ( brain vision inc . , 84 images were acquired at 2 msec intervals , and 21 series of time - course images were averaged . all animal experiments were conducted in accordance with our institutional guidelines for the care and use of laboratory animals . male wistar rats weighing 190220 g were purchased from slc ( shizuoka , japan ) and allowed free access to food and water . they were then tracheotomized , immobilized with pancuronium bromide ( 2 mg / kg / h ) , and artificially ventilated with room air . a craniotomy ( 4 5 mm ) was performed on the left hemisphere and the dura mater was removed to expose the somatosensory cortex . a pair of needle electrodes was inserted underneath the skin of the plantar and ankle region in the contralateral hindlimb . except as otherwise noted , the posterior tibial nerve ( in part , the peroneal nerve ) was electrically stimulated with a rectangular pulse of 3.8 ma intensity and 0.5 msec duration at 5 hz . no major changes were detected in the mean arterial blood pressure ( 110 mmhg 5 s.d . ) during and after posterior tibial ( pt ) nerve stimulation . regional changes in red - blood - cell flow ( rrbcflow ) , velocity ( rrbcveloc ) , and content ( rrbcmass ) were measured in 12 rats using a laser - doppler tissue flowmeter ( ldf ) ( flo - ce1 , omega flow inc . , signal changes from the surface of the cortex ( semiglobular , 500 m in diameter ) were collected at a time constant of 0.5 sec . in separate experiments ( 5 rats ) , changes in the diameters ( d ) of second- and third- branches of the middle cerebral artery ( mca ) and rbc velocity ( v ) in these single pial arterioles were measured using a fiber - optic laser - doppler anemometer microscope ( fldam ) . the blood - flow rate in individual microvessels was calculated as v * (d/2 ) . another five rats were used to acquire digitized images through transmission filters at 577.3 ( 1.2 ) nm with a charge - coupled device ( ccd ) camera . the magnitude of absorption change at 577 nm ( a577 ) was calculated in each pixel and color - coded to produce a false - color map . the exposed cortex was stained with a voltage - sensitive dye jpw-1114 ( molecular probes , usa ) ( 0.5 mg / ml for 90 min ) . the hindlimb was electrically stimulated 21 times with a rectangular pulse of 3.8 ma intensity and 0.5 msec duration at a frequency of 0.33 hz . the fluorescence associated with membrane potential changes was measured with a high - speed ccd imaging system , micam01 ( brain vision inc . , 84 images were acquired at 2 msec intervals , and 21 series of time - course images were averaged . figure 1 shows the hemodynamic responses measured using nioi and/or fmri in human occipital cortex during visual stimulation . using flash - photo stimulation , the hb species concentrations measured with nioi increased from their basal levels , but the increases were minimum at a temporal frequency of 8 hz ( fig . this result was the opposite to results obtained using pet or fmri , which showed the maximum increase in rcbf in the visual cortex occurred at around 8 hz . to investigate this discrepancy between changes in hb species concentrations and rcbf , we performed simultaneous nioi and fmri measurements on two subjects using a black / white annular checkerboard ( because we were unable to use our photo stimulator in the mri system ) ( fig . changes in the blood oxygenation level - dependent ( bold ) fmri signals of individual subjects showed a maximum at stimulus frequencies around 1.44.7 hz , while [oxy - hb ] , [deoxy - hb ] , and [total - hb ] measured with nioi showed a minimum around these frequencies . it should be noted that the frequency of stimulation using flickering checkerboards is considered to be twice the white - to - white or black - to - black frequency of the checkerboard , if the visual stimulus basically comes from pattern reversal . therefore , the present results obtained using a checkerboard stimulus are consistent with our nioi results and the results of other studies obtained using flash - photo stimulation [ 16 - 18 ] . moreover , the use of this stimulus highlighted the following two findings : ( 1 ) changes in [ deoxy - hb ] for the checkerboard stimulation decreased from the basal level ( [deoxy ] < 0 ) , whereas those for the flash - photo stimulation increased from the basal level ( [deoxy ] > 0 ) , and ( 2 ) the responses of the hb parameters and bold signals dissociated at around 8 hz . one possible explanation for the former finding is that the difference in the [ deoxy - hb ] reflects differences in the metabolic and circulatory conditions in the visual cortex during the resting state . the subjects were asked to close their eyes during the flash - photo stimulation , whereas during the checkerboard stimulation they were asked to keep them open . it has been reported that the metabolic rate of glucose in the visual cortex ( cmrglc ) decreased from the basal level when subjects closed their eyes , whereas during the checkerboard stimulation ( with the eyes open ) it increased above the basal level . as for the second finding , the result indicates that the dissociation between rcbf and rcbv occurs at a temporal frequency around 8 hz , since the temporal frequency dependence of the bold signal responses corresponded well with the rcbf responses [ 16 - 18 ] , whereas the responses of the hb parameters , especially [ total - hb ] , reflected changes in the rcbv . moreover , it has been reported that electrical and cmro2 responses showed a maximum at a frequency around 4 hz ( i.e. , 8 pattern reversals / sec ) when a checkerboard was used for visual stimulation . these results suggest that there are physiological requirements for the dissociation of stimulus - induced responses of rcbf and rcbv above a certain level of neuronal activity . , [oxy - hb ] ( arbitrary unit ) ; , [total - hb ] ; x , [deoxy - hb ] ( b ) simultaneous measurement with fmri and nioi . the data show subject a ( left ) , b ( right ) , respectively . a black and white annular , bold signal ( % ) ; , [oxy - hb ] ( arbitrary unit ) ; , [total - hb ] ; x , [deoxy - hb ] if the above dissociation phenomenon applies generally to any type of regional brain activation , it should occur regardless of stimulus type , cortical area , or animal species . to test the above hypothesis , we examined stimulus - induced hemodynamic responses in the somatosensory cortex of rats during electrical stimulation of the peripheral nerve ( see materials and methods ) . figure 2 shows the spatiotemporal profile of stimulus - induced activation in the somatosensory cortex of the rat . figure 2a shows a ccd image over the left parietal cortex viewed through the cranial window . the vessel labeled a is a second - order ( parietal ) branch of the middle cerebral artery ( mca ) , and vessels b and c are its tributaries ( third - order branches ) . vessel b predominantly supplies the hindlimb somatosensory area and vessel c predominantly supplies the trunk area ( left branch ) . one of the tributaries of vessel c formed an interarterial anastomosis with the anterior cerebral artery ( aca ) , denoted by a broken line . the stimulus - induced maximal neuronal activation obtained with changes in the membrane potential was localized in the hindpaw area at 28 msec after stimulus onset ( fig . in contrast , figure 2c shows an absorbance change at a wavelength of 577 nm ( a577 ) , which mainly reflects [ oxy - hb ] , indicating that the change in rcbf spread beyond the hindlimb area at 6 sec after stimulus onset . this wide distribution of cbf correlated well with the widespread increase in intravascular po2 measured using albumin - bound oxygen - sensitive phosphorescence dye , although the maximal increases in rcbf and po2 were observed over the hindlimb area ( fig . the bottom right corner of the figure shows 0.5 mm lateral and 0.5 mm caudal from the bregma . vessels traced with red solid line denote parietal branches of the mca , and broken lines denote parietal branches of the anterior cerebral artery ( aca ) . the map was obtained above 50% of threshold ( 0.15 f / f ( % ) 0.3 ) at 28 msec after stimulus onset . time courses of changes in membrane potential at the numbered pixels are superimposed ( 1 and 2 , hindpaw area ; 3 , hindlimb area ) . ( c ) spatial distribution of stimulus - induced absorption change ( a577 ) at 6 sec after stimulus onset . ( d ) maximal spatial distribution of intravascular po2 at 7 sec after stimulus onset . the somatosensory area could be divided into the following four regions : upper right , predominantly hindlimb area ; lower right , predominantly motor area ; upper and lower left , predominantly trunk area . figure 3a shows representative temporal profiles of changes in the hemodynamic parameters measured using ldf in the maximally activated hindpaw area ( marked with a white circle in figs . 2c and 2d ) , in which maximal changes in rbc flow ( rrbcflow ) , rbc velocity ( rrbcveloc ) , and rbc number ( rrbcmass ) were observed 5~7 sec after stimulus onset . to investigate the relationship between stimulus intensity and degree of change in these hemodynamic parameters , the ldf measurements were performed in the activated hindpaw area at various current intensities and stimulus periods ( fig . since it has been reported that electrical stimulation of the peripheral nerve of rats showed a maximal response ( without tetanus ) of the hemodynamic parameters at around 5 hz , the stimulus frequency was kept at 5 hz during this experiment . the index of stimulus intensity ( horizontal axis in fig . 3b ) was assumed as a function of a product of the current intensity and stimulus period . at a lower stimulus intensity ( si 2 ) , rrbcflow , rrbcveloc , and rrbcmass all increased ( p < 0.001 ) due to functional hyperemia , while at a higher stimulus intensity ( si > 2 ) , rrbcflow and rrbcveloc increased , while rrbcmass decreased ( p < 0.001 ) . these results demonstrated that the dissociative response between rcbf and rcbv in the human visual cortex ( fig . 1 ) also occurred in the somatosensory cortex of rats in response to different stimuli . this finding strongly suggests that grubb 's relationship between cbf and cbv ( cbv = 0.8*cbf ) does not always apply , especially to the relationship between regional changes in cbf and cbv ( probably above a certain level of neuronal activation ) . in addition , the saturation of the increase in rrbcflow indicates that the maximal level of increase in o2 inflow into the activated area remains at a certain level ( about 30% , see fig . ( a ) typical example of temporal profiles of stimulus - induced changes in hemodynamic parameters measured using ldf . measurements focused on the hindpaw area shown with a white circle ( 500 m in diameter ) in figs 2(c ) and 2(d ) . vertical axis denotes percent increases in tissue blood flow ( rrbcflow ) , red blood cell velocity ( rrbcveloc ) , and number of red blood cells ( rrbcmass ) in the hindpaw area measured with ldf . horizontal axis denotes index of stimulus intensity as a function of stimulus duration ( 2 , 4 or 8 sec ) and current intensity ( 2.5 , 5 , 7.5 or 10 ma ) . other stimulus conditions were pulse duration of 0.5 msec and stimulus frequency of 5 hz . statistical analysis was done using a bonferroni multiple comparison test , and p < 0.05 was regarded as statistically significant . figure 4a shows changes in the blood flow rate and diameter ( inset ) of the pial arterioles supplying the blood to the hindpaw area ( see fig . the blood flow and diameter of the afferent vessel a and its tributaries ( b , which supplies the hindlimb area , and c , which supplies the trunk area ) increased just after the onset of stimulation ( fig . the tissue blood flow in the hindpaw area measured using the laser - doppler flowmeter increased in accordance with the increase in blood flow in vessel b measured using the fldam . the blood flow and diameter of vessel b showed long - lasting increases , probably due to the metabolic effect of the neuronal activation in the hindpaw area . it should be noted that vessel c does not supply blood to the activated area , but the change in blood flow in vessel c was almost the same as that in vessel b. these results suggest that the increases in the diameter and blood flow in vessel c are regulated so that vessel c plays an active role as an " escape route " to prevent excess inflow of o2 into vessel b. the increase in po2 more than 10 mmhg may be undesirable in the capillary bed and venules in the activated area ( cf . , fig . these results may account for the finding that the maximal level of increase in o2 inflow into the activated area remained at a certain level ( i.e. , the asymptotic increase in rrbcflow in fig . 3 ) . the stimulus conditions used in this study ( a rectangular pulse of 3.8 ma intensity and 0.5 msec duration at 5 hz ) considerably exceeded motor and sensory thresholds , which may have been sufficient to excite a , a , and a axons and c - fibers . in turn , this may have been enough to elicit the maximal increase in rrbcflow and a maximal level of o2 inflow in the hindpaw area . the diameter and blood flow of the afferent vessel a and its tributaries , b and c , increased just after onset of the stimulation due to a fast and transient neurogenic regulation . the blood supply to the activated area was maintained by a delayed and lasting metabolic factor . vessel c does not supply blood to the activated area , but the change in blood flow in vessel c ( 27% increase ) was almost the same as that in vessel b ( 30% increase ) , suggesting that vessel c plays an active role as an " escape route " to prevent excess o2inflow into vessel b and the activated area . this regulation could be achieved by a dissociation between rcbf and rcbv responses , called a flow - mass regulatory mechanism . a third mechanism , possibly a high - o2 sensing mechanism and/or fluid shear stress , may act as a regulator for the mechanism in addition to the neurogenic and metabolic regulation . stimulus - induced changes in pial arteriolar blood flow and diameter in the somatosensory cortex . ( a ) comparison of the time course of rcbf measured using ldf and blood - flow rate in individual pial arterioles measured using fldam . vessels labeled a are second - order branches of mca ( 32.7 m 14.3 sd in diameter ) , those labeled b are third - order branches ( 25.0 m 11.3 sd ) supplying the hindlimb ( hindpaw ) somatosensory area , and those labeled c are third - order branches ( 24.3 m 11.1 sd ) predominantly supplying the trunk area ( see fig . averaged values from 15 trials of 5 rats are shown ; the errors for each data point are less than 10% . ( b ) illustration of blood - flow regulation in the somatosensory cortex during pt nerve stimulation . f.i . our results indicate the existence of a flow(rcbf)-mass(rcbv ) regulatory mechanism , and that changes in blood flow during brain activation are not tightly regulated to supply only to an the activated area . this loose regulation serves to prevent intense functional hyperemia and excess o2 inflow into the focally activated area . a high - o2 sensing mechanism and/or fluid shear stress are proposed as a regulator of the flow - mass regulatory mechanism , which may elicit a neurogenic modulation of vascular tonus in the activated cortex . collapse of the flow - mass regulatory mechanism ( e.g. , arteriosclerosis ) would result in excess inflow of oxygen into the focally activated area , triggering the production of harmful reactive oxygen species and leading to the accumulation of irreversible neuronal damage ( fig . relationship between o2 inflow and rcbf in the activated area is shown by red line . during moderate neuronal activation , rcbf , rcbv and o2 inflow increase in the activated area ( functional hyperemia ) . above a certain level of neuronal activation , dissociation of increase in rcbf and rcbv takes place to prevent excess o2 inflow into the focally activated area ( flow - mass regulation ) . normal regulation of rcbf and rcbv is probably achieved by the action of both regulations ( i.e. , functional hyperemia and flow - mass regulation ) . further , we hypothesize that when flow - mass regulation is disrupted ( e.g. , arteriosclerosis ) , rcbf , rcbv , and o2 inflow may increase to undesirable levels in the activated area , leading to the production of harmful reactive oxygen species resulting in accumulation of neuronal damage . as conceived , designed and coordinated the study , participated in all the human and animal experiments , and drafted the manuscript . js participated in the design and coordination of the study , and carried out the fldam measurements . this research was supported by the breakthrough 21 project of the ministry of post and telecommunications of japan , and in part by grants - in - aid from the nissan science foundation of japan .

backgroundthe correlation between regional changes in neuronal activity and changes in hemodynamics is a major issue for noninvasive neuroimaging techniques such as functional magnetic resonance imaging ( fmri ) and near - infrared optical imaging ( nioi ) . a tight coupling of these changes has been assumed to elucidate brain function from data obtained with those techniques . in the present study , we investigated the relationship between neuronal activity and hemodynamic responses in the occipital cortex of humans during visual stimulation and in the somatosensory cortex of rats during peripheral nerve stimulation.methodsthe temporal frequency dependence of macroscopic hemodynamic responses on visual stimuli was investigated in the occipital cortex of humans by simultaneous measurements made using fmri and nioi . the stimulus - intensity dependence of both microscopic hemodynamic changes and changes in neuronal activity in response to peripheral nerve stimulation was investigated in animal models by analyzing membrane potential ( fluorescence ) , hemodynamic parameters ( visible spectra and laser - doppler flowmetry ) , and vessel diameter ( image analyzer).resultsabove a certain level of stimulus - intensity , increases in regional cerebral blood flow ( rcbf ) were accompanied by a decrease in regional cerebral blood volume ( rcbv ) , i.e. , dissociation of rcbf and rcbv responses occurred in both the human and animal experiments . furthermore , the animal experiments revealed that the distribution of increased rcbf and o2 spread well beyond the area of neuronal activation , and that the increases showed saturation in the activated area.conclusionsthese results suggest that above a certain level of neuronal activity , a regulatory mechanism between regional cerebral blood flow ( rcbf ) and rcbv acts to prevent excess o2 inflow into the focally activated area .

Background Methods Human Experiments Subjects Optical Measurements and Analysis fMRI Measurements and Analysis Animal Experiments Animal Preparation Measurement of Hemodynamic Parameters Measurements of Activation Area and Blood-Flow Distribution Results and Discussion Authors' contributions Acknowledgements

vbd is associated with various neurologic deficits , including cranial nerve syndromes , brainstem compression , hydrocephalus , ischemic stroke , subarachnoid hemorrhage , and central sleep apnea [ 24 ] . although numerous investigations have examined the neuroradiologic and pathologic features of vbd , little is known about the mechanisms that underlie its pathogenesis or its treatment . previous studies have shown that hypertension , atherosclerosis , older age , male sex , obesity , smoking , dyslipidemia , and diabetes mellitus are more common in individuals with vbd . however , about 20% of patients with vbd have no recognized risk factors for cardiovascular diseases , suggesting that additional factors may also contribute to the pathogenesis of vbd . vbd is the most common type of intracranial arterial dolichoectasia , suggesting that the vertebrobasilar arterial ( vba ) system may have unique characteristics that predispose to dolichoectasia . the human ba is the only major blood vessel formed by the confluence of 2 arteries , and the bilateral vas can differ significantly in diameter ( termed va asymmetry ) . doppler ultrasound studies have found that morphologically asymmetric vas may cause asymmetric blood flow within these arteries , but it is still unknown if these differences are congenital or acquired . since hemodynamic factors are thought to be involved in the occurrence of many cerebrovascular diseases , it is possible that deviations in blood flow during the course of vba atherosclerosis could promote the occurrence of vbd . the aim of this study was to investigate whether variations in the vascular structure of the vba system , in addition to known risk factors such as smoking and alcohol consumption , are associated with vbd . specifically , the study was designed to determine if a dominant va ( dva ) is associated with vbd by making the va vessels broader and more laterally shifted . because it is challenging to perform radiological follow - up of a fixed cohort , for several decades vba system morphological parameters were measured in populations , and the relationships were determined between these parameters and the presence or absence of a dva ( as an approach to determining the role of a dva in morphological changes of the vba system ) . this study was approved by the ethics committee of the changhai hospital ( shanghai , china ) . all participants provided written informed consent . this was a retrospective study of adult individuals who underwent contrast - enhanced magnetic resonance angiography ( ce - mra ) of the head and neck in our hospital between june 1 2012 and november 30 2012 . the inclusion criteria were : 1 ) age 18 years and 2 ) ce - mra of the neck and head . the study participants included patients undergoing investigations for suspected cerebral ischemia and symptoms such as headache , as well as individuals undergoing routine health examinations that included ce - mra for any reason . individuals were excluded from the study if they had any diseases that might seriously affect the blood flow or morphology of the vba system , including the presence of moderate - to - severe stenosis from the proximal part of the va ( neck side ) to the bilateral va confluence ; va aneurysm ; moyamoya disease ; vba dissection ; vba fenestration malformation ; vba arterio - venous shunt ; abnormal va origin ( from the intracervical artery or aortic arch ) ; and posterior fossa tumors as shown by mra . patients with stroke were not excluded , because cardiovascular and cerebrovascular diseases have been reported to be associated with vbd . the following cardiovascular variables were collected from all recruited participants : histories of hypertension , diabetes mellitus , serum cholesterol , smoking , and alcohol consumption . ce - mra was performed using the 1.5 t mr system ( avanto , siemens , munich , germany ) and the 3d flash sequence . gd - dtpa ( 0.1 mmol / kg body weight ) was used as a contrast enhancement agent and was administered intravenously via the antecubital vein at a rate of 3 ml / s ( medrad spectris solaris mr injection system , bayer , leverkusen , germany ) , followed by an intravenous bolus injection of 20 ml of 0.9% normal saline at 3 ml / s . all ce - mra images were 3-dimensionally rebuilt on the workstation using the maximum intensity projection technique and the volume scanning method ( numaris/4 syngo mr b17 , siemens ) . all vba system morphological parameters were measured independently and in a blinded fashion by 2 radiologists , each with more than 8 years of experience . the data were entered into an excel spreadsheet ( microsoft corp , washington d.c . ) for comparison . differences 0.2 mm between the 2 interpreters were resolved by repeat measurements until the difference was < 0.2 mm . the following parameters were measured ( figure 1 ) : the diameter of the bilateral va ( measured 3 mm from the va confluence ) ; lateral displacement of the bilateral va ( a straight line was drawn from the cranial access point of the va to the confluence site , and the maximum distance from the va to the line was measured ) ; the maximal diameter of the ba ( along its entire course ) ; lateral displacement of the ba ( a straight line was drawn between the distal end of the ba and the bilateral va confluence , and the maximum distance from the ba to the line was measured ) ; and lateral displacement of the bilateral va confluence ( the maximum distance between the va confluence and the median sagittal plane crossing the midpoint of the horizontal line between the 2 va transverse foramens ) . in addition , the presence or absence of a dva was established using the following criteria to define dva : a difference in the bilateral va diameters of 0.50 mm , with the larger va joining the ba at a greater angle . the diagnosis of vbd from ce - mra images required consensus between 2 neuroradiologists working independently . a diagnosis of vbd was made if the diameter of any segment of the ba was 4.5 mm , and 2 or more of the following criteria were also fulfilled : ba length > 29.5 mm ; a displacement of the ba from its starting point to the initial bifurcation of the posterior cerebral artery of > 10.0 mm ; length of the v4 segment of the va > 23.5 mm ; and any va segment displaced > 10.0 mm from the line joining the va cranial access point to the va confluence point . data are presented as values with percentages , means standard deviations , or medians with ranges , as appropriate . univariate and multivariate logistic regression analyses with calculation of odds ratios ( ors ) and 95% confidence intervals ( 95% cis ) were performed to identify variables independently associated with vbd . this study was approved by the ethics committee of the changhai hospital ( shanghai , china ) . all participants provided written informed consent . this was a retrospective study of adult individuals who underwent contrast - enhanced magnetic resonance angiography ( ce - mra ) of the head and neck in our hospital between june 1 2012 and november 30 2012 . the inclusion criteria were : 1 ) age 18 years and 2 ) ce - mra of the neck and head . the study participants included patients undergoing investigations for suspected cerebral ischemia and symptoms such as headache , as well as individuals undergoing routine health examinations that included ce - mra for any reason . individuals were excluded from the study if they had any diseases that might seriously affect the blood flow or morphology of the vba system , including the presence of moderate - to - severe stenosis from the proximal part of the va ( neck side ) to the bilateral va confluence ; va aneurysm ; moyamoya disease ; vba dissection ; vba fenestration malformation ; vba arterio - venous shunt ; abnormal va origin ( from the intracervical artery or aortic arch ) ; and posterior fossa tumors as shown by mra . patients with stroke were not excluded , because cardiovascular and cerebrovascular diseases have been reported to be associated with vbd . the following cardiovascular variables were collected from all recruited participants : histories of hypertension , diabetes mellitus , serum cholesterol , smoking , and alcohol consumption . ce - mra was performed using the 1.5 t mr system ( avanto , siemens , munich , germany ) and the 3d flash sequence . gd - dtpa ( 0.1 mmol / kg body weight ) was used as a contrast enhancement agent and was administered intravenously via the antecubital vein at a rate of 3 ml / s ( medrad spectris solaris mr injection system , bayer , leverkusen , germany ) , followed by an intravenous bolus injection of 20 ml of 0.9% normal saline at 3 ml / s . all ce - mra images were 3-dimensionally rebuilt on the workstation using the maximum intensity projection technique and the volume scanning method ( numaris/4 syngo mr b17 , siemens ) . all vba system morphological parameters were measured independently and in a blinded fashion by 2 radiologists , each with more than 8 years of experience . the data were entered into an excel spreadsheet ( microsoft corp , washington d.c . ) for comparison . differences 0.2 mm between the 2 interpreters were resolved by repeat measurements until the difference was < 0.2 mm . the following parameters were measured ( figure 1 ) : the diameter of the bilateral va ( measured 3 mm from the va confluence ) ; lateral displacement of the bilateral va ( a straight line was drawn from the cranial access point of the va to the confluence site , and the maximum distance from the va to the line was measured ) ; the maximal diameter of the ba ( along its entire course ) ; lateral displacement of the ba ( a straight line was drawn between the distal end of the ba and the bilateral va confluence , and the maximum distance from the ba to the line was measured ) ; and lateral displacement of the bilateral va confluence ( the maximum distance between the va confluence and the median sagittal plane crossing the midpoint of the horizontal line between the 2 va transverse foramens ) . in addition , the presence or absence of a dva was established using the following criteria to define dva : a difference in the bilateral va diameters of 0.50 mm , with the larger va joining the ba at a greater angle . the diagnosis of vbd from ce - mra images required consensus between 2 neuroradiologists working independently . a diagnosis of vbd was made if the diameter of any segment of the ba was 4.5 mm , and 2 or more of the following criteria were also fulfilled : ba length > 29.5 mm ; a displacement of the ba from its starting point to the initial bifurcation of the posterior cerebral artery of > 10.0 mm ; length of the v4 segment of the va > 23.5 mm ; and any va segment displaced > 10.0 mm from the line joining the va cranial access point to the va confluence point . data are presented as values with percentages , means standard deviations , or medians with ranges , as appropriate . univariate and multivariate logistic regression analyses with calculation of odds ratios ( ors ) and 95% confidence intervals ( 95% cis ) were performed to identify variables independently associated with vbd . a total of 1153 individuals were included in the study 614 with dva and 539 without dva . the clinical and demographic characteristics of the study participants are presented in table 2 . in both the dva and no - dva groups , mean bmi was significantly lower in females than in males , and significantly fewer females ( as compared with males ) were smokers or consumed alcohol ( p<0.05 ) . in both groups , there were no significant differences between males and females with regard to age , hyperlipidemia , or diabetes . in the dva group , the prevalence of hypertension was significantly higher in females ( p<0.05 ) , but no difference between sexes was observed in the no - dva group . comparisons between the dva and no - dva groups revealed that the dva group had a higher mean age , higher prevalence of hypertension ( 44.6% vs. 37.5% ) , and lower prevalence of smoking ( 24.3% vs. 30.6% ) ( all p<0.05 ) . when dividing the patients according to sex and then by dva , older age was associated with dva both in men and in women ( p=0.005 and p=0.01 , respectively ) . men with dva had a higher frequency of hypertension ( p=0.008 ) and a greater ba displacement ( p=0.03 ) . women without dva had a higher frequency of smoking ( p<0.001 ) ( table 2 ) . there were no significant differences between the dva and no - dva groups with regard to bmi , the prevalence of hyperlipidemia or diabetes mellitus , or alcohol consumption ( table 2 ) . data for the morphological characteristics of the ba and va , determined from analysis of ce - mra images , are shown in tables 2 , 3 . ba diameter and dva diameter were significantly larger in males in the dva group , while ba displacement was significantly larger in males in the no - dva group ( p<0.05 ) . within each group the prevalence of vbd did not differ significantly between males and females in either the dva or no - dva group , despite numerically higher values in males in both groups ( table 2 ) . the prevalence of vbd was 6.4% overall , and was significantly higher in the dva group than in the no - dva group ( 8.1% vs. 4.5% ; p<0.05 ) . univariate logistic regression analysis revealed that older age , male sex , hypertension , hyperlipidemia , smoking , alcohol consumption , and the presence of a dva were all associated with the occurrence of vbd ( table 4 ) . multivariate logistic regression showed that only older age and the presence of a dva were independently associated with vbd ( table 4 ) . a total of 1153 individuals were included in the study 614 with dva and 539 without dva . the clinical and demographic characteristics of the study participants are presented in table 2 . in both the dva and no - dva groups , mean bmi was significantly lower in females than in males , and significantly fewer females ( as compared with males ) were smokers or consumed alcohol ( p<0.05 ) . in both groups , there were no significant differences between males and females with regard to age , hyperlipidemia , or diabetes . in the dva group , the prevalence of hypertension was significantly higher in females ( p<0.05 ) , but no difference between sexes was observed in the no - dva group . comparisons between the dva and no - dva groups revealed that the dva group had a higher mean age , higher prevalence of hypertension ( 44.6% vs. 37.5% ) , and lower prevalence of smoking ( 24.3% vs. 30.6% ) ( all p<0.05 ) . when dividing the patients according to sex and then by dva , older age was associated with dva both in men and in women ( p=0.005 and p=0.01 , respectively ) . men with dva had a higher frequency of hypertension ( p=0.008 ) and a greater ba displacement ( p=0.03 ) . women without dva had a higher frequency of smoking ( p<0.001 ) ( table 2 ) . there were no significant differences between the dva and no - dva groups with regard to bmi , the prevalence of hyperlipidemia or diabetes mellitus , or alcohol consumption ( table 2 ) . data for the morphological characteristics of the ba and va , determined from analysis of ce - mra images , are shown in tables 2 , 3 . ba diameter and dva diameter were significantly larger in males in the dva group , while ba displacement was significantly larger in males in the no - dva group ( p<0.05 ) . within each group the prevalence of vbd did not differ significantly between males and females in either the dva or no - dva group , despite numerically higher values in males in both groups ( table 2 ) . the prevalence of vbd was 6.4% overall , and was significantly higher in the dva group than in the no - dva group ( 8.1% vs. 4.5% ; p<0.05 ) . univariate logistic regression analysis revealed that older age , male sex , hypertension , hyperlipidemia , smoking , alcohol consumption , and the presence of a dva were all associated with the occurrence of vbd ( table 4 ) . multivariate logistic regression showed that only older age and the presence of a dva were independently associated with vbd ( table 4 ) . the main findings of the present study were that individuals with a dva tended to be older and have a higher prevalence of hypertension , lower prevalence of smoking , and higher prevalence of vbd than individuals without a dva . furthermore , older age and the presence of a dva were both independently associated with the occurrence of vbd . these novel findings indicate that certain morphological changes of the vba system , including the presence of a dva , may be associated with vbd occurrence . the overall prevalence of vbd in the present study was 6.4% , consistent with values reported in previous investigations ranging from 3.7% ( in patients with posterior circulation ischemic stroke ) to 18.8% ( in patients with isolated pontine infarct ) . the prevalence of vbd in asymptomatic japanese individuals was recently determined to be 1.3% , illustrating the fact that vbd is often associated with neurologic pathology and symptoms . a previous study found that for each 1-mm increase of the diameter of the basilar artery , stroke mortality hazard ratio increased 1.23 times ; if the diameter was greater than 4.3 mm , the hazard ratio was 3.69 ; and if the height of the basilar artery bifurcation score was greater than 1 point , the hazard ratio was 2.08 . previous studies have reported a significant difference in ba diameter between normal male and female populations . the present study found that in the population with a dva , both ba diameter and dva diameter were larger in males than in females . therefore , it would seem necessary to re - define the diagnostic criteria for vbd in men and women , taking into account sex differences . however , few studies have focused on determining appropriate sex - specific diagnostic criteria for vbd . some investigations have used cranial volume as a reference to adjust vascular parameters such as arterial diameter , and this seems to be a potentially promising correction method . va asymmetry is a very common clinical phenomenon and can result in differences in blood volume and flow rate between the vas . asymmetric blood flow may cause deviation of blood flow , producing high local shear stress on lateral regions of the ba wall on the side contralateral to the dva , and low shear stress on the medial curvature of the vessel ipsilateral to the dva . the va confluence angle is also an important factor affecting the hemodynamic characteristics of the ba , including the direction of the confluenced blood flow . however , it remains unknown whether a dva simply accompanies vbd or acts to promote the occurrence of vbd , and there is little information on eventual treatments for symptoms of abnormal dva . it has been reported that the ba in individuals with a dva tended to bend toward the contralateral side and become thicker , although it was not established whether this phenomenon was congenital or the result of the dva . the dva itself may be at least partly congenital , but the resulting changes in the ba might be acquired . in addition , ba length has been found to increase with age , with this elongation promoted by the presence of a dva . consistent with these findings , the present study observed that individuals in the dva group were significantly older and exhibited significantly greater lateral displacement of the ba than those in the no - dva group . this suggests that a dva could promote morphological dilation and deviation of the vba system , although the underlying mechanisms remain to be elucidated . an important finding of the present study is that the prevalence of vbd in the dva group was nearly double that in the no - dva group . this suggests that the presence of a dva is associated with the occurrence of vbd , and the odds may be greater still if displacement of the vba system occurs . since a dva has been reported to promote the elongation and curvature of the ba , patients in whom this occurs may be particularly susceptible to vbd . thus , the detection of certain morphological changes ( such as dva , ba displacement , and va confluence displacement ) with ce - mra in individuals without vbd might identify individuals at higher risk of having vbd , allowing implementation of measures to control other risk factors as well as regular follow - up to reduce the risk of vbd development . however , the present study failed to demonstrate such a correlation , with sex being not associated with vbd after adjustment for other parameters . the observations in previous studies may be explained by male sex being associated with other parameters associated with vbd ( including those reported previously ) , such as dva diameter , smoking , and alcohol consumption . smoking is generally recognized as an important risk factor for cardiovascular diseases , including stroke [ 35,10 ] , and tobacco smoking may have multiple effects on vascular remodeling , possibly by promoting sclerosis of the vascular wall . the present study showed a significant difference in smoking between men and women ( 47.1% vs. 2.9% ) , although no significant sex - related difference in vbd occurrence was observed . thus , the mechanism underlying the possible effect of smoking on the development of vbd needs to be further explored . first , this was a single - center study in china , and the findings may not be generalizable to other regions of china or other countries . second , there is currently no unified diagnostic criteria for vbd and using a cutoff of 4.5 cm for the ba might result in overestimation of de in men and underestimation in women . third , the prevalence of vbd in our patients may not reflect the general population , as all the included patients had attended hospital and thus would be predicted to have a higher incidence of pathology . fourth , only a limited number of parameters were investigated for their association with vbd . fifth , it was not possible to investigate the mechanisms underlying the associations between age and the presence of a dva on vbd . it is possible that vba system displacement and other morphological changes contribute , in part , to age- and dva - related associations with vbd . further studies are needed to examine these associations in more detail and explore possible underlying mechanisms .

backgroundvertebrobasilar dolichoectasia ( vbd ) is characterized by abnormal dilation , distortion , and extension of the vertebral artery ( va ) and basilar artery ( ba ) . this study investigated whether ba and va morphological characteristics were factors predicting vbd.material/methodsindividuals aged 18 years undergoing contrast - enhanced magnetic resonance angiography ( ce - mra ) of the head / neck were enrolled in 2012 at changhai hospital , shanghai . data concerning cardiovascular risk factors were recorded . bilateral va diameter and lateral displacement , ba diameter and lateral displacement , va confluence displacement , and dominant va ( dva ) presence / absence were determined from ce - mra . vbd was diagnosed using established criteria . dva and no - dva groups were compared . logistic regression analysis was used to identify variables independently associated with vbd.resultsour study included 1153 individuals , of which 614 ( 53.3% ) had dva . the dva group had higher mean age , hypertension prevalence ( 44.6% vs. 37.5% ) , and vbd prevalence ( 8.1% vs. 4.5% ) , and lower smoking prevalence ( 24.3% vs. 30.6% ) , than no - dva patients . univariate analysis revealed that age , female sex , hypertension , hyperlipidemia , smoking , alcohol consumption , and dva presence were associated with vbd occurrence . multivariate analysis showed that age and presence of a dva were independently associated with vbd.conclusionsage and presence of dva are independently associated with vbd .

Background Material and Methods Patients CE-MRA technique Image analysis Statistical analysis Results Clinical and demographic characteristics of the study participants BA and VA morphological characteristics and prevalence of VBD Logistic regression analysis of factors associated with VBD Discussion Conclusions

systemic inflammation is now known to be an important aspect of chronic obstructive pulmonary disease ( copd ) which is able to extend its effects to the skeletal muscular structure . even if this muscular dysfunction does not similarly involve all the peripheral muscles , available evidence suggests that respiratory muscles are almost always involved ( gosselink et al 2000 ) . the weakness of the respiratory musculature ( with reduced strength and muscular resistance ) has significant clinical consequences for copd ( decramer 2001 ) and this reason may partially explain the appearance of common symptoms like the effort dyspnea , hypercapnia , and reduced tolerance to physical exercise . so far , a clinical study has demonstrated that respiratory muscle weakness is likely to increase health care resources and is correlated to reduced survival in copd ( gray - donald et al 1996 ) . respiratory muscle dysfunction is attributed to multiple factors related to the presence and severity of copd . indeed , intrinsic ( muscular and metabolism mass ) as well as extrinsic factors ( changes in chest wall geometry and diaphragm position , and systemic metabolic factors ) may alter respiratory muscle function ( gosselink et al 2000 ) . the mismatch between the demand for respiratory muscle work and the capacity to meet that demand is mainly caused by dynamic hyperinflation ( dh ) produced by the incomplete emptying of the lungs during expiration . hence , one of the most critical factors able to impair respiratory muscle function is the pulmonary hyperinflation which induces the so - called intrinsic positive end expiratory pressure ( peepi ) generating an inspiratory threshold load which accounts for a higher ventilatory demand and a reduced tolerance during exercise . while inspiratory muscle weakness is at least partially attributed to hyperinflation ( placing the inspiratory muscles at a mechanical disadvantage ) , expiratory muscle weakness is a feature of the generalized myopathy observed in patients with copd ( decramer 2001 ) including very low lactate threshold ( gallagher 1994 ) which in turn reduces muscle oxidative enzyme activities ( whittom et al 1998 ) . the most common forms of respiratory muscle training ( rmt ) generally include both inspiratory muscle training ( imt ) and expiratory muscle training ( emt ) component to a various extent . imt assumes a prominent role in this type of training and the definitive role of emt is still under debate . the positive influence of inspiratory muscle strengthening upon dyspnea is supported by observations on healthy young individuals ( volianitis et al 2001 ; romer et al 2002 ) where pressure threshold imt has also been associated with improved athletic performance . two exhaustive meta - analyses ( smith et al 1992 ; lotters et al 2002 ) have collected available data from randomized trials focused on the effectiveness of imt in patients with copd : results have shown a compelling body of evidence in favour of such training , so far included by the joint statement from the american college of chest physicians and american association of cardiovascular and pulmonary rehabilitation committee ( accp / aacvpr ) among the recommended activities in the pulmonary rehabilitation programs ( accp / aacvpr 1997 ) . in particular , it has also been demonstrated that placing a load on the respiratory muscle during contraction is sufficient in increasing strength , thus causing a meaningful reduction of breathlessness and an increase of physical exercise ability ( lotters et al 2002 ) . additionally , a more recent trial that evaluated the 1-year effects of imt ( beckerman et al 2005 ) provides evidence that imt also decreases the use of healthcare services , which may translate into economic benefits as well . there is still debate in regards to which is the mechanism responsible for the enhanced inspiratory muscle force output ( strength ) following imt . some authors argue that inspiratory muscles of copd patients are already well adapted to chronic loading and do not express any adaptation in response to training . nonetheless , a substantial increase in the proportion of type i fibers ( by 38% ) and in the size of type ii fibers ( by 21% ) of the external intercostal muscles have been found after imt ( ramirez - sarmiento et al 2002 ) . these structural changes presumably represent adaptive effects with the genuine remodeling of inspiratory muscle structure during imt . in contrast with the plentitude of existing data inherent to imt , the literature is still lacking in showing clinical and physiological studies related to emt . the first and complete study that explored the efficacy of emt has shown that the change in expiratory muscle strength and endurance and the six - minute walk distance were significantly greater after emt compared with controls ; however , this advantage did not translate into any significant change in the sensation of dyspnea during daily activities ( weiner et al 2003a ) . in another study emt has been compared with both imt and combined imt+emt , showing that there is no additional benefit in including emt to the training of the respiratory muscles ( weiner et al 2003b ) . overall , the inclusion of a specific rmt in a typical program focused on rehabilitation of symptomatic copd is recommended . so far , the general guideline consensus ( accp / aacvpr 1997 ) indicated that rmt should be considered in selected patients with inspiratory muscle weakness or with ventilatory limitation during physical activity , who remain symptomatic despite optimal therapy . it appears obvious that providing imt in a patient with maximal inspiratory pressure ( mip ) below 60 cmh2o , can allow optimal benefits for that patient . however , adding imt might also benefit those patients with preserved and higher inspiratory muscular abilities . similarly , highly trained athletes with mip values above 120 cmh2o have also shown improvements in dyspnea and exercise performance ( volianitis et al 2001 ; romer et al 2002 ) . these data support the notion that since there are no known side - effects of imt , this modality of training attenuates respiratory effort sensation irrespectively of the functional status of the inspiratory muscle . thus it is likely that all the patients with symptomatic copd ( well - motivated patients with low response to other treatments ) can benefit from rmt . to confirm this assumption , the most recent consensus on pulmonary rehabilitation considers imt as an adjunctive therapy in pulmonary rehabilitation , primarily in patients with suspected or proven respiratory muscle weakness although , rmt is associated with intra - thoracic decompression , there are almost no side - effects associated with the training itself ( pardy et al 1988 ) . furthermore , patients with heart failure experience no deterioration of their cardiac output during training . hence , with the exception of patients with unstable asthma and low perception of dyspnea , a history of spontaneous pneumothorax or emphysema bubbles near pleura rmt can be delivered as an in - patient , out - patient , or domiciliary program setting , and it is typically administered and supervised by suitably trained physiotherapists . it may be implemented as a stand - alone intervention or as part of a comprehensive program of pulmonary rehabilitation . the domiciliary setting is generally the most convenient for the patient and it usually follows a period during which patients rmt is closely supervised in an in - patient or out - patient clinic . involvement of family members may also be beneficial as they can provide encouragement and sustain patient s motivation . the three most common used modalities of rmt in patients with copd are based on breathing against resistive loading ( rl ) , breathing against pressure threshold loading ( ptl ) and voluntary normocapnic hyperpnea ( nh ) . this method requires individuals to inspire or expire via a variable - diameter orifice , whereby , for a given airflow , the smaller the orifice the greater the load achieved . although rl may improve respiratory muscle function ( aldrich and karpel 1985 ; clanton et al 1985 ) conclusions from these studies should be interpreted with caution . a reasonable limitation of inspiratory rl is that inspiratory pressure , and consequently the training load , varies with flow rate according to a power function and not just to the orifice size ( pardy et al 1988 ) . therefore , it is crucial that the individual s breathing pattern is monitored during training , thus allowing for the provision of a quantifiable training stimulus . in their meta - analysis on imt delivered on patients with copd , smith and coworkers ( 1992 ) concluded that the use of inspiratory rl without controlling the inspiratory flow rate fails to elicit significant improvement in inspiratory muscle function . on the other hand , several studies which provided feedback control of flow rate during rl resulted in effective benefits , with particular regard to strength , dyspnea and physical exercise tolerance ( harver et al 1989 ; belman and mittman 1991 ; sanchez riera et al 2001 ) . nonetheless , such modifications require additional hardware , because of the increasing cost and complexity of this type of imt . this technique requires individuals to produce a negative pressure sufficient to overcome the load of the device and thereby initiate inspiration . threshold loading allows variable loading at a detectable intensity by providing near flow independent resistance to inspiration . it has been achieved in several ways , by way of a weighted plunger ( nickerson and keens 1982 ) , a solenoid valve ( bardsley et al 1993 ) , a constant negative pressure system ( chen et al 1998 ) , or a spring - loaded poppet valve ( larson et al 1988 ; gosselink et al 1996 ; caine and mcconnell 2000 ) . the spring characteristics are linear such that a given change in spring length results in the same change in valve opening pressure at each spring length . the valve only opens when the inspiratory pressure generated by the patient exceeds the spring tension . threshold loading has been shown to induce improvements in strength ( larson et al 1988 ; lotters et al 2002 ) , maximum rate of muscle shortening ( romer et al 2002 ; villafranca et al 1998 ; romer and mcconnell 2003 ) , maximum power output ( lisboa et al 1994 ; villafranca et al 1998 ; romer and mcconnell 2003 ) , and muscle endurance ( lisboa et al 1994 ; weiner et al 2004 ) . due to its flow independence in addition , ptl using a device with a mechanical poppet valve is both portable and easy to use , with evidence of efficacy when implemented in a domiciliary setting , as well as in long - term use ( see also figure 1 ) . to cut short , although it appears to be as effective as rl , ptl ( probably due to its simplicity , reliability and user - friendliness ) has been implemented most widely , especially using the poppet valve method . to the best of our knowledge , the nh technique has been applied in very few studies ( belman and mittman 1980 ; levine et al 1986 ) . this method requires individuals to maintain high target levels of ventilation up to 30 minutes . to prevent hypocapnia training sessions are typically conducted 3 to 5 times per week at about 70%90% of maximal sustainable voluntary ventilation and the training effect is evaluated by monitoring the change in the time to exhaustion during either sustained or incremental isocapnic ventilation . because the complicated equipment needed to prevent hypocapnia this technique has usually been carried on in hospital facilities or research laboratory , and it has not been available for domiciliary purposes . this method requires individuals to inspire or expire via a variable - diameter orifice , whereby , for a given airflow , the smaller the orifice the greater the load achieved . although rl may improve respiratory muscle function ( aldrich and karpel 1985 ; clanton et al 1985 ) conclusions from these studies should be interpreted with caution . a reasonable limitation of inspiratory rl is that inspiratory pressure , and consequently the training load , varies with flow rate according to a power function and not just to the orifice size ( pardy et al 1988 ) . therefore , it is crucial that the individual s breathing pattern is monitored during training , thus allowing for the provision of a quantifiable training stimulus . in their meta - analysis on imt delivered on patients with copd , smith and coworkers ( 1992 ) concluded that the use of inspiratory rl without controlling the inspiratory flow rate fails to elicit significant improvement in inspiratory muscle function . on the other hand , several studies which provided feedback control of flow rate during rl resulted in effective benefits , with particular regard to strength , dyspnea and physical exercise tolerance ( harver et al 1989 ; belman and mittman 1991 ; sanchez riera et al 2001 ) . nonetheless , such modifications require additional hardware , because of the increasing cost and complexity of this type of imt . this technique requires individuals to produce a negative pressure sufficient to overcome the load of the device and thereby initiate inspiration . threshold loading allows variable loading at a detectable intensity by providing near flow independent resistance to inspiration . it has been achieved in several ways , by way of a weighted plunger ( nickerson and keens 1982 ) , a solenoid valve ( bardsley et al 1993 ) , a constant negative pressure system ( chen et al 1998 ) , or a spring - loaded poppet valve ( larson et al 1988 ; gosselink et al 1996 ; caine and mcconnell 2000 ) . the spring characteristics are linear such that a given change in spring length results in the same change in valve opening pressure at each spring length . the valve only opens when the inspiratory pressure generated by the patient exceeds the spring tension . threshold loading has been shown to induce improvements in strength ( larson et al 1988 ; lotters et al 2002 ) , maximum rate of muscle shortening ( romer et al 2002 ; villafranca et al 1998 ; romer and mcconnell 2003 ) , maximum power output ( lisboa et al 1994 ; villafranca et al 1998 ; romer and mcconnell 2003 ) , and muscle endurance ( lisboa et al 1994 ; weiner et al 2004 ) . due to its flow independence , ptl training can be undertaken without monitoring the individual s breathing pattern . in addition , ptl using a device with a mechanical poppet valve is both portable and easy to use , with evidence of efficacy when implemented in a domiciliary setting , as well as in long - term use ( see also figure 1 ) . to cut short , although it appears to be as effective as rl , ptl ( probably due to its simplicity , reliability and user - friendliness ) has been implemented most widely , especially using the poppet valve method . to the best of our knowledge , the nh technique has been applied in very few studies ( belman and mittman 1980 ; levine et al 1986 ) . this method requires individuals to maintain high target levels of ventilation up to 30 minutes . to prevent hypocapnia training sessions are typically conducted 3 to 5 times per week at about 70%90% of maximal sustainable voluntary ventilation and the training effect is evaluated by monitoring the change in the time to exhaustion during either sustained or incremental isocapnic ventilation . because the complicated equipment needed to prevent hypocapnia this technique has usually been carried on in hospital facilities or research laboratory , and it has not been available for domiciliary purposes . interpretation of the data relating to rmt in patients with copd has been hampered by some studies with inadequate experimental designs ; flaws have often included a failure to apply basic training theories . the negative outcomes of most studies contributed to early scepticism about the value of rmt . however , in the overall assessment of the respiratory muscle training it is also important to consider both physiological ( eg , respiratory muscle strength and lung function ) and clinical responses ( eg , individual s dyspnea , exercise tolerance , and even quality of life ) . from the individual s functional ability , the efficacy of rmt needs to be assessed in terms of inspiratory and expiratory muscle function . the most straight - forward non - invasive assessment of respiratory muscle function are mip and maximal expiratory pressure ( mep ) . these measures are indicative for weakness of the respiratory muscles and are indirectly assessed through the maximal and voluntary pressure generated during inspiration or expiration . to confirm the importance of the appraisal of the respiratory muscle function measurements there are updated documents in recent literature clarifying these aspects ( ats / ers 2002 ; troosters et al 2005 ) . an argument favoring the use of mip is that this functional improvement is linked to changes in dyspnea ; additionally , it has been clearly defined that changes in dyspnea only occur when training results in improved muscle strength . this has been so far recognized in clinical trials ( harver et al 1989 ; lisboa et al 1994 ) . regular monitoring of mip also provides both reassurance that patients are adhering to the prescribed training regimen , and the basis for resetting training loads : ideally , monitoring should be undertaken once per week . it is notable that a significant positive relationship exists between the percentage increase in mip and the relative magnitude of the imt load ( pardy and rochester 1992 ) , thus suggesting that the higher the load relative to the subject s inspiratory muscle strength , the greater is the increase in strength achieved . the existing data suggest that to achieve a 20% increase in mip , a load of 30% mip is then required ( lotters et al 2002 ) . the lack of effectiveness of training at a load < 30% of mip is supported by previous observation ( presseur et al 1994 ) showing that mip failed to improve significantly after 12 weeks of imt at a load equal to 22% of mip . reid has recommended the following parameters for imt in copd : an initial training interval as short as 35 min , progressing to two 15 min or one 30 min session per day , 46 days per week at a training intensity of 40%70% mip indefinitely ( reid et al 2004 ) . finally , more recent studies ( sturdy et al 2003 ; hill et al 2006 ) have examined the feasibility of using high - intensity , interval - based threshold loading imt ( a total of about 20 minutes alternating cycles of 2-minutes of breathing at the maximum load tolerable , followed by 1 minute of rest ) . the results regarding duration of mip s improvements have been studied in only one randomized trial of imt ( weiner et al 2004 ) : in this study the largest improvement of mip has been recorded during the first 3 months of their study ( 32% ) , then followed by a smaller increase ( ~6% ) in the four subsequent 3-month blocks of imt . the early plateau effect of imt has been observed so far in pathology ( larson et al 1988 ; lisboa et al 1997 ) as well as in healthy individuals . the development of a plateau can not be ascribed to a lack of load progression ( increasing the training load to accommodate increases in mip ) , since it occurs regardless of this measure . instead , it is a reflection of a basic property of muscle adaptation to strength training stimuli , which necessitates periodic changes in the training stimulus in order to maintain the adaptation process . despite the now overwhelming evidence that rmt , and particularly imt using threshold loading , produces improvements in inspiratory muscle function , which in turn result in functional benefits to copd patients , some researchers still ascribe these improvements to mechanisms other than an adaptation to a training stimulus . ramirez - sarmiento and coworkers ( 2002 ) observed a significant increase in the size of type 2 muscle fibres taking biopsies from the external intercostals muscles following 5-week imt ; this is very strong evidence that imt induces genuine remodeling of inspiratory muscles . assessments of individual s functional capacity ( in terms of 6-minute or 12-minute walked distance ) and dyspnea ( bdi , tdi ) are measures often associated with respiratory muscle strength recording . the effect of rmt by isocapnic hyperpnea in copd patients has been translated into benefits of both respiratory muscle endurance and exercise tolerance , concluding that respiratory muscle endurance training improves health - related quality of life similar findings have been obtained using a target - flow incentive spirometry system to train the inspiratory muscles , thus showing a significant increase of the distance walked at 6 months with respect to controls ( sanchez riera et al 2001 ) . the benefits of rmt to respiratory breathlessness , exercise tolerance and quality of life were confirmed in a recent published study of rmt by threshold loading method in severely impaired copd patients ( covey et al 2001 ) . the improvements in inspiratory muscle strength and endurance , paralleled the reduction in the sense of respiratory effort experienced during a loaded breathing task and in the respiratory symptoms associated with activities of daily living . these respiratory muscle function benefits have also been recently confirmed in terms of 6-minute walked distance and quality of life by using a high - intensity , interval - based threshold loading imt ( hill et al 2006 ) . like other skeletal muscles , respiratory muscles undergo adaptation in response to stimuli overload during exercise training in stable copd patients , thus resulting in significant increases of strength and endurance and in a clinically significant change of dyspnea sensation at rest and during exercise . three types of rmt have been reported , ( resistive training , pressure threshold loading , and normocapnic hyperpnea ) with no data , at present , to support one method over the other . for a training effect , the frequency , duration , and intensity of exercise must be considered . a number of factors are associated with successful outcomes after rmt ; a training frequency of 12 times per day for a total amount of 30 minutes , with a frequency of 35 days per week for a duration of 6 weeks has been suggested and may induce desired changes . with concern to the inspiratory load , the evidence supports the use of training loads that exceed 30% of mip with a repetition duration dependent upon the load , as higher loads can not be sustained as long as lower loads . while it seems that imt is slightly superior to emt in providing additional benefit other than respiratory muscle function such as a reduction in dyspnea , the effects and the safety of emt in patients with copd is yet to be elucidated . therefore , actual evidence for rmt , in addition to regular exercise training in stable copd patients with or without respiratory muscle weakness , needs to be further implemented .

it is known that respiratory muscles undergo adaptation in response to overload stimuli during exercise training in stable copd patients , thus resulting in significant increase of respiratory muscle function as well as the individual s improvements . the present article reviews the most updated evidence with regard to the use of respiratory muscle training ( rmt ) methods in copd patients . basically , three types of rmt ( resistive training , pressure threshold loading , and normocapnic hyperpnea ) have been reported . frequency , duration , and intensity of exercise must be carefully considered for a training effect . in contrast with the plentitude of existing data inherent to inspiratory muscle training ( imt ) , literature is still lacking in showing clinical and physiological studies related to expiratory muscle training ( emt ) . in particular , while it seems that imt is slightly superior to emt in providing additional benefits other than respiratory muscle function such as a reduction in dyspnea , both the effects and the safety of emt is still to be definitively elucidated in patients with copd .

Rationale Patient selection Techniques Resistive loading Pressure threshold loading Voluntary normocapnic hyperpnea Outcomes Conclusions and clinical implications

insulin continues to be the main treatment for type 1 diabetes . as effective as insulin is in addition , its dosage is highly variable through the course of a day , depending on diet as well as activity level . ideally , for insulin to be most effective , it would be administered in amounts that would vary minute by minute , as blood glucose itself varies minute by minute . this is impractical currently , as even a regimen of 45 variable injections per day is a challenge for the typical patient . because of these issues , there has been significant interest in the development of an artificial pancreas , a system that can administer variable amounts of insulin in response to blood glucose information . multiple solutions to this problem have been explored , including ( 1 ) exogenous implanted beta cells , ( 2 ) sugar responsive insulin releasing polymers , and ( 3 ) a continuous glucose monitor ( cgm ) combined with an insulin pump . the latter approach is the most mature and is the subject of human clinical trials . one of the advantages of the cgm / pump approach is that the function of blood glucose monitoring is separated from the function of insulin delivery , so that each piece of the final system can be optimized independently . one of the main challenges associated with insulin pumps is that they require a physical connection between the outside of the patient ( i.e. , insulin reservoir ) and the inside of the patient . this leads to multiple problems : the point of insertion gets rapidly biofouled , leading to variation in delivery or complete blockage , requiring cannula replacement every 2 days . in addition , the pump and cannula in the course of a normal active life can get snagged or removed . what we have sought is a method of insulin delivery that retains the advantages of a pump ( continuous , variable insulin release ) , while eliminating the physical connection between insulin reservoir and the patient . ideally it would allow the insulin to be initially administered in a fashion identical to normal insulin via injection , but allow for continuously variable release in response to blood glucose information . we introduced such an approach recently , the so - called photoactivated depot or pad approach . this prior work described a material in which insulin was linked to an insoluble polymer via a photocleavable linker . we demonstrated in vitro that insulin was released from this material in a controlled and predictable fashion using pulses of light from an led . the long - term aim for such a material is that it be injected in a fashion identical to insulin ( i.e. , cutaneously ) and then be irradiated through the skin by a small light source that is guided by blood glucose information ( figure 1 ) . thus , insulin release could be varied continuously without the need for a physical connection that is inherently vulnerable and invasive . the success of this material in vitro suggested multiple critical questions that we sought to address in this work : ( 1 ) can sufficient light cross the upper layers of skin to allow photolysis of the pad in vivo ? ( 2 ) will the released insulin retain its biological activity , despite the synthetic processing required to originally create the pad ? ( 3 ) can sufficient moles of insulin be released to stimulate blood glucose reduction ? ( 4 ) can insulin release be varied by varying the amount of light applied ? pad material consisting of insulin linked to polymer via photocleavable linker injected under the skin . this is followed by transcutaneous irradiation , photolysis of the insulin pad bond , and uptake into circulation . in this work after intradermal injection of the material to form the insoluble depot site in the skin of diabetic rats , light from a compact led source is capable of stimulating release of insulin into the bloodstream . we demonstrate that additional pulses of led illumination result in additional pulses of insulin released into the bloodstream . finally , we show that insulin release is followed by a reduction in blood glucose . all the observed effects are specific to the irradiation of the depot and are not seen in control animals , similarly treated . the results confirm the potential of remotely controlled drug release , which will be particularly useful in the case of diseases like diabetes that require highly varying amounts and highly varying timing of administration . in addition to the following , a complete description of methods and materials , including characterization of photoactivated depot materials and intermediates , is contained in detail in the supporting information . the light source was constructed from a nichia ncsu033b led , with a 365 nm peak irradiation . this was driven by a 6.5 v power source using a current limiting power resistor . the light source holds the led 0.32 cm from the skin surface , and the measured absolute irradiance at the skin was 0.71 w / cm . the absolute irradiance of the light source was determined using a calibrated usb2000 spectrophotometer ( ocean optics ) and a cc-3uv - s cosine corrector via an optic fiber . the spectrasuite software was used to analyze absolute irradiance in the range of 350400 nm that brackets the led output . spague dawley male rats ( 250300 g ) were obtained from harlan laboratories ( indianapolis , in ) . chemical diabetes was induced by treatment with 65 mg / kg streptozotocin ( sigma - aldrich , st . diabetes was defined as blood glucose concentrations > 250 mg / dl on 3 consecutive days using a one touch ii glucometer and blood obtained from the tail vein . this study was carried out in strict accordance with the recommendations in the guide for the care and use of laboratory animals of the national institutes of health , eighth edition . the protocol was approved by the university of missouri kansas city institutional animal care use committee protocol # 1401 . the upper backs of rats were shaved prior to injection of the pad materials . injections of 80 l of pad material were made using a 1/2 cc syringe and a 27 gauge needle . due to limitations of the volume of material that can be injected into the dermal layer of skin at one time , two injections ( 40 l each ) of pad materials were made side by side . the compact led light source was anchored to the skin over the injection sites by two small dots of superglue . blood samples were collected in microvette 100 l li - hep tubes ( sarstedt ) from the tail - vein using a glass capillary . after collecting all time points from an experiment the supernatant was removed and stored at 20 c until the elisa analysis was performed . glucose measurements were made using one touch ii lifescan glucometer and strips ( johnson & johnson , milpitas , ca ) using plasma from blood samples obtained from the tail vein . the insulin pad material was synthesized in an analogous fashion to our previously described material . specifically , human insulin was joined to a photocleavable linker via an ester linkage formed between carboxyl groups on insulin and a diazo group on the linker . this linker was terminated in an azide . in parallel , we synthesized a base resin that would ultimately attach to the linked insulin . our previous insulin pad material was built using chemmatrix resin as the base upon which insulin was attached via a photocleavable linker . while this resin was sufficient for in vitro demonstration of the approach , it had a particle size ( 150500 m ) that was too large to be conveniently injected during in vivo experiments . we therefore created a new pad material using small diameter tentagel rink amide beads ( rapp polymere ) . these were 10 m in diameter , which allowed them to be injected using a standard 27 g needle . the amine group of the resin was coupled with dibenzocyclooctyne ( dbco ) acid . click reaction with insulin monoazide , which was synthesized as previously described ( figure 2 ) . the final synthesized material was characterized in two ways , by cleavage of the entire species ( dbco - linker - photocleavable group - insulin ) from the resin using tfa . this was confirmed to have the expected molecular weight ( 6597.0 observed , 6593.4 calculated ) . synthesis of pad material using a 10 m rink - amide tentagel resin coupled with strained cyclo - octyne , then reacted with i m a ( insulin monoazide ) containing one photocleavable group . the material was also photolyzed in vitro using light from a 365 nm led ( figure 3 ) . in this experiment , test and control samples were treated identically , except that light was blocked from irradiating the control sample by aluminum foil . for the 5 min prior to sampling , we gently vortexed the resin , followed by centrifugation and sample withdraw at the time point . we observed no detectable insulin release for the light - blocked control sample ( figure 3 left ) and significant insulin release in the light - irradiated test sample . a majority of the released insulin was detected in the first time point after irradiation , but we continued to see additional release approaching a plateau in later time points . because we see no insulin release in the control samples , we associate this additional insulin detected to a slower kinetic process such as diffusion from the resin following photolysis . at 65 min , we again irradiated the samples for 2 min and saw a similar pattern : no detectable insulin in the light - blocked control sample and a spike in insulin release , followed by a slower and plateauing evolution of insulin . the material released from the resin in response to irradiation showed an hplc retention time identical to insulin ( figure 3 , upper right ) . in addition , esi mass spectrometry confirmed this , showing a native molecular weight ( 5808.0 calculated , 5808.0 observed ) ( figure 3 , lower right ) . in vitro insulin pad photolysis . pad material was exposed to two 2 periods of 365 nm led light ( blue bars ) . material released showed a retention time in hplc consistent with insulin ( upper right ) , and this was confirmed to be insulin via esi - ms ( lower right ) . this pad material has two key components and attributes : ( 1 ) an insoluble , but injectable polymer that keeps the material at the site of injection ; ( 2 ) a linkage to insulin that is cleaved with light and releases native insulin . complete synthetic schemes and characterization are contained within the supporting information . because the insulin was exposed to multiple synthetic steps , some involving organic solvents , we wanted to ensure that it retains biological activity in vivo after this processing . we previously have demonstrated that insulin photoreleased from resin retains the molecular weight and hplc retention time of native insulin . in addition , it is recognized by anti - insulin antibodies in an elisa sandwich assay . both of these data suggest that our processed insulin has retained its native conformation . to confirm that this in vitro activity persists in vivo , we tested our processed insulin in a diabetic rat model . for all studies , we have used a streptozotocin induced rat model of diabetes . diabetes was induced with a one - time injection of streptozotocin resulting in rats with average blood glucose levels of 450 mg / dl by day 2 postinjection . for all experiments , we lightly anesthetized the rats to reduce distress during the procedures . in - vitro , we photolyzed the insulin pad material , and collected the released insulin in the supernatant above the resin . the dermal layer has multiple advantages , including that it is shallow and therefore more accessible to light as well as leading to faster uptake of insulin.figure 4 shows the change in blood insulin and glucose levels in response to these injections . this is accompanied by a rapid decrease in blood glucose levels , demonstrating that , despite synthetic processing , in vitro photoreleased insulin retains biological activity . confirmation of in vivo activity of in vitro photolyzed insulin from the pad . insulin isolated from photolyzed pad material was injected into the dermal layer of diabetic rats ( n = 3 ) . blood glucose ( purple squares ) was reduced , confirming in vivo activity of in vitro photolyzed pad insulin . the blood glucose reduction that we observed by injecting photoreleased insulin is very similar to what is expected from unprocessed human insulin . studies with unprocessed human insulin injected intradermally follow similar kinetics with respect to insulin concentration and % blood glucose reduction ( data not shown ) . these matched what is reported elsewhere , specifically that a 23 iu / kg dose of human insulin causes an approximately 70% reduction in glucose levels in sprague dawley rats when injected subcutaneously . we have utilized a 2.36 iu / kg ( 14.2 nmol / kg ) dose here and observe a similar result when injected intradermally . we then examined the ability of the pad material to release insulin into the systemic circulation after injection and transcutaneous irradiation of the injection site . diabetic rats were injected with 80 l of pad material , containing 140 nmoles of covalently bound insulin , into the dermal layer . both experimental and control animals were fitted with a compact led light source that uses a nichia 365 nm led , with an estimated output of 0.71 w / cm at the skin ( figure 5 ) . control animals were also irradiated but had the light blocked by a layer of aluminum foil , thus allowing for the control of any heat effects ( we observe a 9 c increase in temperature during the irradiation period ) . the only difference between experimental and control animals was the presence of light on the skin of the experimental animals . we did not observe any surface changes such as scabbing in the skin several days postexperiment . we monitored both blood insulin levels and blood glucose levels ( via blood obtained from the tail vein ) . blood glucose was determined in real time using test strips , and blood insulin levels were determined using a human insulin elisa assay ( alpco ) . the elisa assay shows minimal cross reaction with rat insulin , allowing us to track specifically the human insulin released from our material . figure 6 shows the results of these experiments performed in triplicate experimental and control animals . light source shown from top and bottom ( left and middle panels ) and in place on rat back ( right panel ) . blood insulin levels , as determined by elisa assay ( top panel ) , and blood glucose levels ( bottom panel ) before and after a 2 min period of led activation ( indicated by blue bar ) . prior to irradiation , almost undetectable amounts of insulin are observed in the blood of both experimental and control animals . this persists in the control animal over a 2 h period , demonstrating no leaching of insulin from the pad material due to biochemical degradation . the experimental animals , however , showed a sharp increase in plasma insulin levels immediately after irradiation , with a peak level at 25 min , followed by a slow decrease . this decrease is likely due to normal degradative and absorptive processes . to our knowledge , this is the first demonstration of insulin release in a live animal stimulated by light . following an increase in plasma insulin we observed a modest decrease in blood glucose , with only the 45 time point showing significance ( p < 0.05 ) . we then investigated whether we could further decrease blood glucose by stimulating the release of two pulses of insulin from the depot with a second pulse of led light from the light source . as before , we injected 80 l of the insulin pad material containing 140 nmol of insulin covalently linked to the polymer , and then irradiated the skin over the depot site . control animals again were treated identically except the light was blocked from the skin by aluminum foil . blood insulin levels , as determined by elisa assay ( top panel ) , and blood glucose levels ( bottom panel ) before and after 2 min periods of led activation at time 0 and 65 min ( indicated by blue bar ) . * indicates p < 0.05 for differences between control and experimental points . we measured both the blood insulin and glucose levels , starting at 20 min prior to the first irradiation . we observed little to no leaching of insulin from the depot site into the blood . at time 0 , we irradiated for 2 min . as before we saw a sharp increase in blood insulin level only in the experimental animals , peaking at 15 min , and a modest drop in blood glucose . at 65 min , we irradiated the injection site for an additional 2 min period and saw an additional release of insulin into the blood , peaking at 85 min . with this additional irradiation step , we now observed a robust drop in blood glucose in the experimental vs control animals . this demonstrates that we can meter insulin release with light and that by doing so we can meter the control of blood glucose . in this work we have described for the first time an injectable form of insulin that is controlled with light in a living animal . the insulin pad material described is a first generation material , and each element in it ( polymer , photocleavable linker , insulin ) is amenable to optimization to improve performance . for example , there is the potential for immunogenicity , and this can be modulated by the nature of the polymer carrier . we currently use a peg based polymer , which is likely not to be cleared easily from the dermal site , as it is biocompatible , not biodegradable . second generation materials under development are based on biodegradable polymers or methods that require no polymer . these will eliminate the potential for toxicity associated with the matrix portion of the materials . in addition , the di - methoxy nitrophenyl ethyl ( dmnpe ) photocleavable group currently used requires 365 nm light to cleave , which has the potential for phototoxicity . previous studies that utilize 350365 nm light for light triggered release in vivo , or light activated transdermal polymerization purposes have not revealed cell toxicity after a 23 min exposure . given this , we are developing materials that release insulin using visible light , to eliminate any residual phototoxicity and to increase dermal light penetration . this has the potential to significantly reduce the amount of light needed to photolyze . this resulted in 140 nmol of insulin per depot injection or about 0.8 mg of insulin . given that the loading efficiency of this material is in the low single digits , it suggests that second generation , higher loading materials ( > 50% ) will have sufficient material to last for several days in a human . increasing insulin loading and release efficiency can reduce the volume of injection needed , increase the lifetime of the depot , and reduce the amount of light needed to stimulate insulin release . an optimized insulin pad has the potential to allow continuously variable release of insulin in response to blood glucose information using a familiar injectable material . as such , it can form the foundation of an artificial pancreas system in which insulin delivery is not controlled by an unwieldy pump and cannula , but rather through pulses of light delivered through a light source . when combined with blood sugar information provided by a continuous glucose monitor ( cgm ) , such a system has the potential to provide a convenient and usable route to control of blood glucose and the health benefits that result from this control .

in this work we demonstrate that blood glucose can be controlled remotely through light stimulated release of insulin from an injected cutaneous depot . human insulin was tethered to an insoluble but injectable polymer via a linker , which was based on the light cleavable di - methoxy nitrophenyl ethyl ( dmnpe ) group . this material was injected into the skin of streptozotocin - treated diabetic rats . we observed insulin being released into the bloodstream after a 2 min trans - cutaneous irradiation of this site by a compact led light source . control animals treated with the same material , but in which light was blocked from the site , showed no release of insulin into the bloodstream . we also demonstrate that additional pulses of light from the light source result in additional pulses of insulin being absorbed into circulation . a significant reduction in blood glucose was then observed . together , these results demonstrate the feasibility of using light to allow for the continuously variable control of insulin release . this in turn has the potential to allow for the tight control of blood glucose without the invasiveness of insulin pumps and cannulas .

Introduction Materials and Methods Results and Discussion Conclusions

whilst patients presenting with symptomatic carotid occlusion constitute a relatively small proportion of stroke admissions , they have a higher risk of recurrent inhospital stroke and early death compared with otherwise undifferentiated acute ischaemic stroke ( ais ) or transient ischaemic attack ( tia ) patients . an analysis of 4144 patients from the canadian stroke network found symptomatic occlusion of the extracranial internal carotid artery ( ica ) in 6.8% of patients ; this group experienced significantly higher rates of recurrent inhospital stroke ( 6.7% vs. 2.8% ) and death ( 12.0% vs. 3.8% ) 1 . similar findings were seen in 4157 ais / tia patients presenting to the german stroke collaboration : 6.5% had symptomatic extracranial carotid occlusion , with significantly elevated rates of recurrent stroke within 72 h ( 7.4% vs. 3.5% ) and death within 100 days ( 21.2% vs. 10.3% ) 2 . populationbased studies ( olmsted county , minnesota , usa ) have also shown elevated risks of early stroke recurrence after symptomatic carotid occlusion : 8% within the first 30 days , nearly half occurring within the first week of diagnosis 3 . whilst intravenous thrombolysis and endovascular therapy can help improve outcomes in ais due to carotid occlusion 4 , 5 , optimal medical treatment of patients ineligible for such interventions is unknown . factors associated with lack of inhospital recurrent stroke in patients who presented to our institution with a newly symptomatic isolated carotid occlusion [ not involving the circle of willis and anterior / middle cerebral arteries ( aca / mca ) ] who were deemed ineligible for intravenous thrombolysis or endovascular intervention were therefore evaluated . this study is a research subjects review board ( the institutional review board committee ) approved retrospective analysis of consecutive patients presenting with a diagnosis of ais / tia at a single quaternary referral center ( designated as a comprehensive stroke center by the joint commission ) from july 2008 to april 2014 . clinical charts and imaging of all patients who had a discharge diagnosis of ais / tia were reviewed . patients with an acute anterior circulation ais / tia in whom a newly diagnosed ( i.e. never previously documented ) ipsilateral ica occlusion was found on initial vascular imaging were included . all isolated ica occlusions were diagnosed using computed tomography angiography ( cta ) , magnetic resonance angiography ( mra ) and/or conventional angiography of the head and neck . patients were excluded who ( a ) presented more than 24 h after last known to be well , ( b ) received intravenous thrombolytic treatment or endovascular intervention at presentation , ( c ) had initial ct / mri showing intracerebral hemorrhage , ( d ) had initial vascular imaging showing occlusion of the circle of willis or intracranial large vessel [ defined as the first segment of the aca ( a1 ) or first / second segment of the mca ( m1/m2 ) ] ipsilateral to the symptomatic hemisphere and/or ( e ) had initial vascular imaging showing severe symptomatic intracranial stenosis . imaging and medical records of patients were reviewed to abstract relevant information , including but not limited to demographics , stroke severity [ as measured by the national institutes of health stroke scale ( nihss ) ] , vascular risk factors , inhospital treatment with antiplatelets or anticoagulation , and followup imaging to examine the status of the occluded artery . anticoagulation consisted of therapeutic weightbased dosage of heparin , dalteparin or enoxaparin ( dosages targeting prophylaxis against venous thromboembolism did not qualify ) , started within 48 h of presentation . patients were divided into two groups : those who suffered recurrent stroke during their admission ( defined as worsening of nihss score 4 points and new infarct on followup imaging in the territory of the occluded carotid ) and those who did not . clinical worsening ( change in nihss score 4 points ) was investigated as per clinical practice with ct and/or mri , and was not attributable to edema in our series . occurrence of death , recurrent stroke and hemorrhagic transformation found on repeat imaging within 7 days and 1 month was recorded , as were results of any repeat vascular imaging within 1 year after initial diagnosis of carotid occlusion . initial and final infarct volumes on ct / mri images were verified and measured ( using an automated , validated algorithm itk snap software version 3.2.0 www.itksnap.org ) by a boardcertified neuroradiologist 6 , 7 . univariate analyses were performed using jmp ( cary , nc , usa ) 11.0.0 statistical software and a p value < 0.05 was considered as significant . of 2670 patients presenting with stroke / tia during the study time period , 195 patients ( 7.3% ) were identified as having an ica occlusion . of those 195 patients , 33 patients had known prior carotid occlusion and were excluded . of the remaining 162 patients with newly diagnosed ica occlusion on their initial neurovascular imaging , patients were excluded who ( i ) were last known well 24 h ( n = 10 ) , ( ii ) had received intravenous and/or intraarterial thrombolysis / thrombectomy ( n = 20 ) , ( iii ) had proximal mca and/or aca occlusion in addition to their ica occlusion ( n = 86 ) and ( iv ) had severe symptomatic intracranial stenosis ( n = 3 ) or other exclusion criteria ( hemorrhage on initial imaging , bilateral or posterior circulation stroke , incomplete imaging ; n = 10 ) . a total of 33 patients met the final inclusion criteria , none of whom were deemed candidates for intraarterial thrombolysis / thrombectomy due to lack of intracranial large vessel occlusion and low nihss score [ median of 4 , interquartile range ( iqr ) = 19 ] . a review of initial neurovascular imaging found all ica occlusions to begin at or a few centimeters above the cervical bifurcation and extend to the intracranial petrous / cavernous segment , with supraclinoid reconstitution proximal to the intracranial ica terminus . acute ischaemic changes were seen in 31/33 patients on initial neuroimaging ( 25 on mri , six on ct where mri was not available ) ; the remaining two patients had mild stroke ( nihss score 4 and 2 ) , both of whom underwent ct scan only . recurrent stroke was seen in eight ( 24.3% ) of the included patients during their admission , all of which occurred within the first week . in univariate analysis of factors including age , presenting nihss score , vascular risk factors and medical treatment ( table 1 ) , only early anticoagulation was significantly associated with a lower risk of recurrent inhospital stroke . specifically , there was a significant decrease in the incidence of stroke recurrence within 1 week in anticoagulated patients ( 6.7% vs. 38.9% , p = 0.032 ) . all recurrent strokes occurred early ( 7 days ) , were during the same admission and were within the territory of the occluded carotid artery . recurrent stroke during the same admission nihss , national institutes of health stroke scale ; tia , transient ischaemic attack ; htn , hypertension ; hld , hyperlipidemia ; dm , diabetes mellitus ; cad , coronary artery disease ; af , atrial fibrillation . as univariate analysis found only anticoagulation to be significantly associated with lower risk of recurrent inhospital stroke ( table 1 ) , patients were divided into those treated with anticoagulation and those who did not receive anticoagulation , and subsequently differences between these two groups were examined ( table 2 ) . there was no difference in the initial stroke volume in patients who underwent anticoagulation versus no anticoagulation ( 4.3 2.2 vs. 9.6 3.1 ml , p = 0.164 ) . nonanticoagulated patients with recurrent stroke showed a significant increase in stroke volume from that seen on initial imaging ( 7.2 2.0 vs. 68.6 25.3 ml , p < 0.02 ) . hemorrhagic transformation was not seen in either group . at 1 month , 1/15 ( 6.7% ) of anticoagulated patients experienced a recurrent stroke ( on day 6 poststroke ) and one died ( day 25 poststroke ) ; none was lost to followup . during the same period , 7/18 patients ( 38.9% ) who were not anticoagulated developed recurrent stroke ( median 3 days after initial stroke , iqr = 14 ) , one died ( day 13 poststroke ) and one was lost to followup ( 5.6% ) . death or stroke at 1 month was significantly less in anticoagulated patients ( 13.3% vs. 47.1% , p = 0.040 ) . however , univariate analysis did not reveal any significant difference in other potential predictors of outcome ( age , presenting nihss score , vascular risk factors ) between anticoagulated versus nonanticoagulated patients ( table 2 ) . in patients with repeat vascular imaging , ica recanalization was seen more often in anticoagulated patients ( 46.2% vs. 9.1% , p = 0.047 ) . characteristics and outcomes of anticoagulated patients nihss , national institutes of health stroke scale ; tia , transient ischaemic attack ; htn , hypertension ; hld , hyperlipidemia ; dm , diabetes mellitus ; cad , coronary artery disease ; af , atrial fibrillation ; dvt / pe , deep vein thrombosis and pulmonary embolism ; ica , internal carotid artery . median , interquartile range ; significant p value ; all recurrent strokes were during the same initial admission ; in patients with repeat carotid imaging . patients with symptomatic carotid occlusion represent a small but potentially high risk subgroup of ais patients 1 , 2 . in our study , 7.3% of our stroke / tia patients presented with newly diagnosed symptomatic intracranial or extracranial ica occlusion , similar to previous studies 1 , 2 . these prior series found symptomatic carotid occlusion to be associated with more than double the baseline risk of early stroke recurrence 1 , 2 . our data suggest an even higher stroke recurrence rate in patients with isolated symptomatic carotid occlusion ( i.e. not involving the circle of willis ) . this may be due to ( i ) excluding patients who were treated with intravenous thrombolysis or endovascular therapy in our cohort and ( ii ) including only patients who did not have concomitant intracranial occlusion affecting the circle of willis ( and thus had low stroke burden ; median nihss score 4 ; iqr = 19 ) . our study population therefore represents a more specific and smaller fraction of newly symptomatic carotid occlusions ( 20.4% ) and of the general stroke population ( 1.2% ) than prior investigations , who nevertheless harbor a markedly elevated risk of early stroke recurrence ( 24.3% ) . it is possible that recurrent stroke may be more readily detectable in these patients ( who have a low admission nihss score ) , and/or clot propagation or stump emboli from an occluded carotid may pose a graver risk to patients whose intracranial circulation is initially patent . our study suggests that early anticoagulation is associated with a lower incidence of recurrent stroke during initial admission and a lower incidence of death and/or stroke at 1 month in this highly selected group of ais patients . in contrast , large randomized trials of anticoagulation in ais ( including fiss , toast , haest and ist ) have not shown a significant benefit with respect to outcomes at discharge or stroke related morbidity and mortality 8 , 9 , 10 , 11 , 12 , and a recent metaanalysis of the five largest acute stroke trials to include heparins also failed to find a subgroup of ais patients that might benefit from acute anticoagulation 13 . however , this metaanalysis ( and most trials ) of anticoagulation in ais has not accounted for stroke heterogeneity seen on acute vascular imaging ( such as cta or mra of the head and neck ) , which is increasingly obtained at time of presentation in ais patients . it is therefore possible that a small subgroup of ais patients , defined by their initial vascular imaging , may benefit from early anticoagulation . for example , subgroup analysis from both the toast and fisstris trials suggested a benefit for anticoagulation in ais patients with large artery occlusive disease 9 , 14 . the mechanism by which patients with acute symptomatic isolated carotid occlusion ( not reaching the circle of willis ) might benefit from anticoagulation is unclear . it is hypothesized that early anticoagulation may help ( i ) by preventing ica clot extension into circle of willis endarteries ( i.e. mca or aca ) , which would deprive them of collateral supply from the anterior / posterior communicating arteries , and ( ii ) by preventing stump emboli from the occluded carotid 15 , 16 . it is important to acknowledge that anticoagulation is not without risk of hemorrhagic transformation . in our study , none of the patients in either group experienced hemorrhagic transformation , perhaps due to low initial stroke burden ( median nihss score 34 ) . prior investigations have reported spontaneous recanalization following carotid occlusion in 5%67% 17 , 18 , 19 , 20 , 21 of cases , and the recent dutch acute stroke study ( dust ) found early recanalization in approximately 40% of patients 22 . however , prior series have not excluded patients undergoing acute thrombolysis or thrombectomy ( 54.7% of patients in dust received intravenous tissue plasminogen activator ) 22 and have not differentiated between choice of medical therapy . none of our patients had undergone intravenous thrombolysis or thrombectomy , and spontaneous recanalization was found in 46.2% of anticoagulated patients , versus 9.1% of nonanticoagulated patients ( p = 0.047 ) . a major weakness of our paper is the retrospective , observational , nonrandomized nature of our data . in particular , the decision to use anticoagulation was dictated by the treating physicians , whose selection bias could have affected our results by making the two groups not comparable . no significant difference ( such as age , race , presenting nihss score , infarct volume , deep vein thrombosis and pulmonary embolism ( dvt / pe ) during admission , dementia , renal insufficiency , malignancy ) was found between anticoagulated and nonanticoagulated patients , decreasing the chances that physician selection bias alone may explain the association between anticoagulation and decreased stroke recurrence in our patients ; however , unmeasured confounding remains possible . additionally , none of the patients had known reasons other than carotid occlusion for anticoagulation ( such as pe or dvt ) that could have further biased our results . other weaknesses in our data include a lack of prespecified intervals for imaging or clinical followup which , whilst similar across both groups , made the data nevertheless incomplete . anticoagulated patients were more likely to undergo repeat vascular imaging , although this was not significantly different from patients who were not anticoagulated . lastly , it was not possible to confirm the cause or chronicity of ica occlusions on initial neurovascular imaging , and study inclusion was based solely on whether ica occlusion was a new diagnosis or not . patients with newly symptomatic isolated carotid occlusion represent a small minority of ais patients , yet are at high risk of early stroke recurrence .

background and purposepatients with symptomatic internal carotid artery ( ica ) occlusion constitute a small proportion of stroke / transient ischaemic attack patients who are at increased risk of early stroke recurrence and poor outcome . the optimal medical treatment for patients with symptomatic ica occlusion who are ineligible for thrombolysis or thrombectomy is unknown.methodsconsecutive patients presenting at a single center with newly diagnosed symptomatic ica occlusion ( not involving the circle of willis ) were retrospectively reviewed . those treated with intravenous thrombolysis or intraarterial thrombolysis / thrombectomy were excluded . patients were divided into two groups based on whether they experienced recurrent inhospital stroke.resultsthe selected study population ( n = 33 ) represented a small ( 20.4% ) proportion of all newly symptomatic carotid occlusions , who nevertheless had an elevated risk of recurrent stroke during admission ( 24.2% ) . of the variables examined ( age , gender , admission national institutes of health stroke scale score , vascular risk factors , atrial fibrillation , prior stroke / transient ischaemic attack and anticoagulation within 48 h of presentation ) , only anticoagulation was significantly associated with a lower risk of inhospital recurrent stroke . anticoagulated patients showed a decreased incidence of stroke recurrence within the first week ( 6.7% vs. 38.9% , p = 0.032 ) and fewer strokes or deaths at 1 month ( 13.3% vs. 47.1% , p = 0.040 ) . hemorrhagic transformation was not observed in any patient . on followup imaging , ica recanalization was significantly more frequent in anticoagulated patients ( 46.2% vs. 9.1% , p = 0.047).conclusionpatients with newly diagnosed symptomatic ica occlusion ( not involving the circle of willis ) represent a small but high risk subgroup of patients with carotid occlusion . early anticoagulation was associated with fewer recurrent strokes and increased ica recanalization . larger scale prospective studies may be justified .

Introduction Methods Results Discussion Conclusion Disclosure of conflicts of interest

la sroprvalence des virus de lhpatite b ( vhb ) et de lhpatite c ( vhc ) slve 0,4 % et 0,8 % , respectivement , au canada , mais les taux sont variables dans diverses populations . dterminer la sroprvalence du vhb et du vhc chez les participants une foire asiatique sur la sant du lower mainland , en colombie - britannique , et lier les rponses au questionnaire sur le statut vaccinal avec les profils srologiques . les participants une foire asiatique sur la sant ont t invits participer volontairement ltude . ils ont rpondu un questionnaire contenant des questions sur lethnie et le statut vaccinal . du sang a ensuite t prlev en vue dune srologie du vhb et du vhc . le vhb actif tait dfini comme un rsultat positif lantigne de surface du vhb ( aghbs ) , tandis que la sroprvalence du vhc tait dfinie comme une raction aux anticorps anti - vhc . une exposition passe au vhb tait dfinie comme un rsultat positif lantigne capsidique du vhb ( anti - hbc ) et ngatif laghbs . la non - immunit tait dfinie comme des rsultats ngatifs lanti - hbc et lanticorps de surface du vhb . seulement ceux do nt linformation dmographique exacte correspondait aux rsultats srologiques ont particip ltude . au total , 192 participants consentants ont particip la foire , do nt 112 ltude . des participants , 91 % taient chinois . trois taient atteints dune infection active par le vhb ( 2,7 % [ 95 % ic 0,6 % 7,6 % ] ) et deux , dune infection par le vhc ( 1,8 % [ 95 % ic 0,2 % 6,3 % ] ) . plus de 40 % des participants avaient dj t exposs au vhb ( 42 % [ 95 % ic 33 % 51 % ] ) . prs de 20 % ont dmontr une non - immunit au vhb ( 19 % [ 95 % ic 12 % 27 % ] ) . on constatait une importante discordance entre les rponses au questionnaire sur le statut vaccinal et les profils srologiques . la sroprvalence du vhb et le vhc de cette cohorte slevait 2,7 % et 1,8 % , respectivement , soit des rsultats plus levs que les taux nationaux . ces rsultats font ressortir que labsence de connaissances sur linfection par le vhb et le statut vaccinal demeure un problme clinique significatif dans la communaut asiatique de la colombie - britannique . the united chinese community enrichment services society ( success ) , a nonprofit charitable organization in bc , holds an annual health fair in the lower mainland of bc . the present study was undertaken during one of these health fairs , held at a local community centre in september 2014 . this health fair featured talks and discussions by physicians , including gastroenterologists , and other health care professionals , as well as display booths from various sponsors / supporters and private organizations . advertisement for this event , including the availability of viral hepatitis testing , was circulated by radio , newspaper , the success website and television announcements , as well as posters with full details posted throughout the community . attendees at this health fair who were interested in viral hepatitis testing presented to the viral hepatitis testing booth . volunteers were present to provide proper translation in english , cantonese and mandarin , if necessary . study participants provided demographic information including age , ethnicity and years of residency in canada . they also completed a questionnaire that documented whether they had been tested for hepatitis previously , were aware that they were a carrier or had chronic hepatitis , or had received vaccination(s ) against hepatitis . if a family physician and/or specialist cared for the participant , this information was also recorded . study participants allowed serological information ( hbv and hcv serology ) to be collected and compared with their questionnaire results . if attendees were not interested in the study , they were allowed to have serology drawn nonetheless , but these serological results were not collected for the study and these individuals did not complete the questionnaire . two individuals who presented to the booth for viral hepatitis testing did not wish to participate in the study . their family doctor or a prearranged walk - in clinic followed up with their serological results . attendees were not asked to participate in the study when they entered the doors of the community hall , but they had the opportunity to present to the viral hepatitis testing booth ( as well as other booths ) and participate if interested . in general , the majority of attendees presented for viral testing ; therefore , participants in the present study would be expected to be similar to other attendees . blood was drawn for hbv and hcv serology for evaluation by the bc centre for disease control ( bccdc ) . results were sent to participants respective family physicians to ensure proper follow - up care . those without a family physician had their results forwarded to a prearranged walk - in clinic . only those with correct demographic information matched to results from the bccdc were included in the study . the bccdc required at least two personal identifying data to be correct ( name , date of birth or provincial health number ) for serological results to be released . the responses of participants from the questionnaires were then compared with their respective serological profiles . previous hbv exposure was defined as hbv core antibody positive ( anti - hbc+ ) and hbsag negative ( hbsag ) . natural immunity was defined as previous hbv exposure with hbv surface antibody positivity ( anti - hbc+ and anti - hbs+ , 10 iu / ml ) while hbv immunity by vaccination was defined as anti - hbs+ , hbsag and anti - hbc. nonimmunity to hbv was defined as hbv surface antibody negative ( anti - hbs <3 iu / ml ) , hbsag and anti - hbc. hcv sero - prevalence was defined as being hcv antibody reactive . comparisons among response groups were calculated using fisher s exact test with graphpad prism ( graphpad inc , usa ) ; p<0.05 was considered to be statistically significant . the present study was approved by the clinical research ethics board of the university of british columbia ( vancouver , bc ) . there were 192 participants who consented , of whom 112 ( 58% ) were included in the study . the other participants were excluded because demographic information from the bccdc did not completely match information collected from the health fair ; thus , these data were considered to be inaccurate . among the 112 participants , the median age was 65 years ( inter - quartile range 58 to 70 years ) . there was an approximately equal distribution with regard to sex . the majority ( 91% ) of participants were chinese , of whom 74% spoke cantonese and 26% spoke mandarin ; the remaining 9% were korean . questionnaire results showed that 23% of the participants had been previously tested for hepatitis while 36% were unsure whether they had been tested ( table 1 ) . a small percentage of participants ( 6% ) had been told they were carriers or had chronic hepatitis , but only 43% of these individuals were being followed by their family physician or specialist with respect to their diagnosis . nearly 30% of participants stated that they had been previously vaccinated for hepatitius a virus and/or hbv . most commonly , they stated that they had complete vaccinations against hbv ( 38% ) . active hbv was found in three participants ( 2.7% [ 95% ci 0.6% to 7.6% ] ) and hcv infection was found in two participants ( 1.8% [ 95% ci 0.2% to 6.3% ] ) ( table 2 ) . these cases of chronic hepatitis were previously known before testing , except for one new case of hcv . only 60% of these individuals were followed by their family physician and/or specialist regarding their hepatitis . surprisingly , 42% ( 95% ci 33% to 51% ) of participants had been previously exposed to hbv , of whom six ( 13% ) had no natural immunity ( ie , anti - hbs ) . more than one - third of participants ( 37% [ 95% ci 28% to 46% ] ) in the cohort had been vaccinated for hbv while 19% ( 95% ci 12% to 27% ) had a serological panel consistent with no previous hbv vaccination or exposure to the virus ( table 2 ) . among participants who were anti - hbs+ , the average level of these antibodies was 198 miu / ml ( 95% ci 104 miu / ml to 292 miu / ml ) . the rate of nonimmunity to hbv was higher among participants who stated that they had never been tested for hepatitis compared with those who said they had been tested or that they did not know ( 37% versus 7.7% versus 7.5% , respectively ; p<0.01 ) . otherwise , there were no other significant differences in the groups with respect to this question . when participants were asked whether they had ever told that they were a hepatitis carrier or had chronic hepatitis , all seven individuals who answered yes had evidence of being previously exposed to hbv ( four participants ) or had active hbv ( three participants ) ( table 3 ) . the study participant with known hcv was accounted for in the former group and was not followed by his family doctor and/or specialist with respect to his positive anti - hcv result . the three participants with active hbv were followed by their family doctor and/or specialist with respect to their chronic hepatitis . among the group who answered no or unknown to the same question , there were 28 ( 38% ) and 15 ( 48% ) individuals , respectively , who were exposed to hbv . similarly , there were 19 ( 26% ) and two ( 6.4% ) individuals , respectively , who had no immunity to hbv . when participants were asked regarding their previous vaccinations , interestingly , among the 19 individuals who stated that they had complete vaccinations to hbv , 22% actually had no immunity to hbv , 17% had natural immunity and 61% showed evidence of being vaccinated ( table 3 ) . nine individuals stated that they had been partially vaccinated to hbv ( table 3 ) . four ( 44% ) of these individuals had natural immunity to hbv , while five ( 55% ) had serological evidence of hbv vaccination . there were a significantly higher proportion of participants who were exposed to hbv who answered no or unknown when asked about previous hbv vaccination compared with the group who answered yes to complete hbv vaccinations ( 72% and 44% versus 17% , respectively ; in our study , the seroprevalences of hbv and hcv were 2.7% ( 95% ci 0.6% to 7.6% ) and 1.8% ( 95% ci 0.2% to 6.3% ) , respectively higher than nationally reported rates . collectively , our results suggest that viral hepatitis , especially hbv , remains an important issue in this asian community in bc . previous studies have reported lower rates of hbv than in our cohort ( 13,5,6 ) . in one study , glasgow et al ( 5 ) demonstrated that the hbsag seroprevalence among individuals 14 to 30 years of age was between 0.24% to 0.47% in a northern ontario town . chiavetta et al ( 6 ) observed rates of 0.1% to 0.5% for hbv among first - time canadian blood donors . finally , rotermann et al ( 3 ) examined the seroprevalences of hbv and hcv in 15 canadian cities and collected survey information ( conducted by statistics canada in collaboration with the public health agency of canada and health canada ) . these investigators reported the seroprevalence of hbv to be 0.4% for the entire population ; however , the seroprevalence of hbv was 1.8% among nonwhite participants and 1.6% among the foreign - born population ( 11% were from southeast asian and hong kong ) . concerns about missing vulnerable populations ( eg , ethnic groups ) have been suggested in these previous studies ( 13 ) . for example , the public health agency of canada reported much higher rates of hbv as high as 5% to 15% among chinese and vietnamese canadians ( 1 ) . a recent quality improvement project conducted in vancouver also found higher rates of hbv and hcv among patients admitted at a tertiary hospital ( 4 ) . based on trends from statistics canada , wong et al ( 7 ) estimated the prevalence of chronic hbv to be 5% among immigrants . the seroprevalence of hbv in our study was consistent with these previous reports ( 1,4,7 ) . our rate may have been somewhat lower given the older population of our cohort ( median age 65 years ) . in addition , the study participants have resided in canada , on average , for > 20 years . therefore , our cohort may not be an accurate reflection of the higher burden of hbv among recent immigrants described in previous reports ( 4,7 ) . the attendees who participated in this health fair may also be more health conscious and have taken preventive measures to avoid hepatitis . although this would not affect the likelihood of vertical transmission of hbv , it may have been a factor with respect to horizontal transmission of hbv and hcv . finally , given that universal screening of prenatal women with hbv vaccination of neonates was introduced in canada in the late 1980s , followed by childhood vaccination in the 1990s and universal infant vaccination approximately 15 years ago ( depending on the province ) , the participants in our study who were born outside of the country and of older age would not have been expected to have been vaccinated . in fact , almost 20% of our cohort did not have immunity to hbv , suggesting that they had never received the hbv vaccination . this proportion is substantially higher than the rate of 4.2% reported previously among all canadians ( 3 ) . the individuals in our cohort may have seroconverted their hbsag spontaneously , given the large proportion of participants who were exposed to the virus ( ie , anti - hbc+ ) but were hbsag. this may have occurred via acute hbv infection ( eg , sexual relations with an hbv carrier or vertical transmission from mother to child ) with immune clearance in which the patient was asymptomatic and/or did not seek medical attention . in a small minority of chronic hbv carriers although immunity may wane over five to 10 years , these individuals had no serological evidence of any protective antibodies . occult hbv infection may also explain an isolated elevated anti - hbc level ; however , hbv dna or liver enzyme levels were not measured to help differentiate this entity . in addition , our study demonstrated that approximately 40% of these individuals were unaware of their hbv exposure these participants answered that they had not been tested for hepatitis or did not know their status . this previous exposure to hbv may lead to reactivation of hbv in the context of immunosuppression , causing severe or potentially fatal liver disease ( 810 ) . patients who will undergo chemotherapy , immunosuppression , or receive stem cell or solid organ transplantation should be screened for hbv ( hbsag and anti - hbc ) ( 10 ) . our study also found significant discordance between questionnaire answers regarding vaccination status and actual serological results ( table 3 ) . for example , 22% of participants who stated they had complete vaccinations to hbv had no serological evidence of protective antibodies . in addition , there may be misunderstanding on the part of the study participants and/or misinformation by the family physician regarding vaccination status . three study participants were told they had been a hepatitis carrier or had chronic hepatitis ; however , they had only been exposed to hbv , with no evidence of active hbv . our findings corroborate previous studies that have demonstrated that knowledge of hbv is limited in the asian population ( 11 ) , even among those with chronic hbv ( 12,13 ) . the risk of social stigma has also been attributed to reduced hbv screening in the asian community ( 14 ) . thus , continuing education of physicians and patients regarding viral hepatitis as well as encouragement of screening remain important issues in the asian community in bc . with regard to hcv , our seroprevalence rate was higher than previous reports ( 3,15 ) . in a canadian study examining 15 cities , uhanova et al ( 15 ) reported the same rate from an administrative database of manitoba from 1995 to 2002 . this finding may relate to the older age of our population , which has been associated with hcv infection ( 3,15 ) . another possible explanation is unawareness of this disease among the asian community ; in our study , one of the cases of hcv was newly diagnosed . other risk factors for hcv , such as previous blood transfusions , intravenous drug use and sexual practices were not explored in our study . we were able to determine the true seroprevalence rates of an at - risk population . our study may allow for generalizability to other similar cities in north america with a growing asian and/or immigrant population . limitations of the present study include the significant loss of participants for analysis ( 42% ) because of incorrect registration of data . better coordination will be needed in the future between event organizers and the bccdc to improve data collection . our study also did not explore other important risk factors in our questionnaire ( eg , sexual practices , intravenous drug use , etc ) . there was a selection bias in our study as well , given that the participants in our cohort voluntarily attended a health fair and may not accurately reflect the at - risk asian population who may have limited knowledge of available resources or restricted access to health care . furthermore , although we did identify four study participants with known hepatitis who wished to undergo hepatitis testing nonetheless , those with chronic liver disease may be less inclined to participate , given no potential gain in enrolling in the study as well as social stigma associated with testing . recall bias was another potential limitation because participants were asked several questions that may be difficult to recollect such as vaccination status or years of residency in canada . we recognize that the attendees of a health fair are only a small sample of a much larger asian community ; therefore , the present study was hypothesis generating . larger epidemiological studies , however , should be considered in this community to generate definitive conclusions . future directions would include studies examining other factors related to hbv or hcv infection , such as socioeconomic status , among the asian and/or immigrant populations . local hepatitis screening programs aimed at this population will also be an important consideration for health care spending and resource allocation . finally , ongoing education of hbv and hcv , such as the translated lectures and discussions at this asian health fair , will be a critical aspect of ongoing medical care among this population . further education of primary care physicians and counselling of patients will help promote knowledge of viral hepatitis and accurate dissemination of health information . the seroprevalences of hbv and hcv found at an asian health fair in the lower mainland of bc were 2.7% and 1.8% , respectively . our results highlight that the lack of knowledge of hbv infection and vaccination status remains a significant clinical issue in the asian community of bc .

in canada , the seroprevalences of the hepatitis b virus ( hbv ) and the hepatitis c virus ( hcv ) are believed to vary significantly among different ethnic groups and at - risk populations . data regarding the prevalence of hbv and hcv in southeast asian canadians may vary significantly from the general population . because this population may be less likely to participate in epidemiological studies , it is possible that hbv and hcv seroprevalences are under - reported . the authors of this study correlated questionnaire answers regarding vaccination status to serological profiles collected from an asian health fair in british columbia to assess the seroprevalences of hbv and hbc in this population .

HISTORIQUE : OBJECTIFS : MTHODOLOGIE : RSULTATS : CONCLUSION : METHODS RESULTS DISCUSSION CONCLUSION

hypertriglyceridemia is the third most common cause of acute pancreatitis , accounting for 14% of cases presenting to the hospital.1 diabetic ketoacidosis ( dka)-induced hypertriglyceridemia causing pancreatitis is an interesting phenomenon that has rarely been reported in literature.2 in dka , insulin deficiency leads to lipolysis and inhibition of lipoprotein lipase in peripheral tissues that leads to elevated triglycerides ( tg).1,2 a toxic role of accumulated free fatty acids in the pancreatic tissues , post - pancreatic lipase mediated hydrolysis of tg has been suggested . tg levels greater than 1,000 u / l have been implicated as a cause of acute pancreatitis . types i , iv , and v dyslipidemias have also been associated with acute pan - creatitis.3 types i and v dyslipidemias can cause acute pancreatitis without a predisposing factor , whereas type iv can do so in the presence of an underlying condition that may increase serum tg levels.2 infusions of insulin , heparin , and plasmapheresis have been used to lower tg levels in different subsets of patients.4 insulin activates lipoprotein lipase , while heparin leads to the release of endothelial lipoprotein lipases.4 in combination , these enzymes accelerate chylomicron degradation into glycerol and fatty free acids lowering levels of circulating lipids . we present the case of a male in his 40 s with extensive past medical and surgical history . this included hypertension , dyslipidemia ( never worked up in the past , previous reported tg level of 315 mg / dl , managed with 20 mg daily pravastatin ) , alcohol abuse ( 1 l of hard liquor / day ) , and recurrent episodes of acute on chronic alcoholic pancreatitis . the patient underwent distal pancreatectomy and splenectomy secondary to splenic subcapsular liquefactive hematomas and a benign cystic lesion in the tail of pancreas , in the setting of an attack of acute pancreatitis ( presumably involving trauma ) following an alcohol binge , seven months ago . he developed diabetes mellitus post distal pancreatectomy and was being managed with subcutaneous nph insulin therapy , 40 units in the morning and 36 units in the evening . he presented to the emergency room with worsening abdominal pain , nausea , and vomiting for 1 day . he reported insulin rationing for a week and therefore had been taking less than the prescribed doses . examination of the abdomen revealed diffuse tenderness to palpation , no distension with normal bowel sounds . / l , anion gap of 31 , a white count of 14,610/mm , lipase of 8223 u / l , tg of 4,854 mg / dl , sodium of 126 mg / dl , potassium of 5.3 mg / dl , calcium of 8.3 mg / dl , and albumin of 3.3 g / dl . the patient was found to be in dka and was admitted to the medical intensive care unit . ct scan ( figs . 2 and 3 ) revealed severe acute inflammatory changes and edema of the residual pancreas . dka was treated with intravenous hydration using normal saline , potassium supplementation , and intravenous regular insulin initial bolus of 0.1 units ( u)/kg body weight followed by an infusion at the rate of 0.1 u / kg / hour . when blood glucose was lowered < 200 mg / dl , rate of infusion was halved to 0.05 u / kg / hour . once the anion gap normalized and the patient was able to eat , subcutaneous insulin was overlapped with intravenous infusion for two hours . being treated , the patient underwent one cycle of plasmapheresis for four hours , following which tg levels decreased from 4,854 to 537 u / l . the subsequent stay in the hospital was uneventful and the patient was discharged on the 5th day . the patient was non - compliant with outpatient follow - up once discharged and workup for dyslipidemia could not be completed . plasmapheresis involves removal of a patient s blood , separation of plasma using a first filter , followed by filtration of separated plasma using a second filter . the small pores in the second filter prevent the passage of high - molecular weight molecules ( eg , tg ) . the plasma is then either re - infused into the patient or an isovolumetric substance is used to replace the plasma.5 it is used as an important treatment modality in various neurological , hematological , and rheumatologic diseases . successful use of plasmapharesis for patients with hypertriglyceridemic acute pancreatitis has been reported previously in literature.6,7 multiple mechanisms have been postulated explaining the utility of plasmapharesis in these patients . these include removal of chylomicrons , proteases , and pro - inflammatory cytokines and reduction of hyperviscosity.8 as per the american society for apheresis 2010 guidelines , the recommendation for the use of plasmapharesis in these cases is only grade 2c , implying weak recommendation with low - quality or very low - quality evidence.9 this results from the fact that the evidence behind the use of plasmapharesis in these patients is limited to case reports and summaries without any randomized controlled trials . both patients were subjected to repeated cycles of plasmapharesis with reduction in amylase and lipase as well as resolution of symptoms.6 another study done by ramirez - bueno et al involved 11 patients admitted to the intensive care unit with severe hypertriglyceridemic pancreatitis and were treated with plasmapheresis.5 in all , 8 of these 11 patients needed one cycle of plasma exchange , 2 patients needed two cycles , while 1 patient needed one cycle , to decrease tg levels to less than 1000 mg / dl . yeh et al enrolled 17 patients with hypertriglyceridemic acute pan - creatitis and subjected them to plasmapharesis.10 of these , 13 recovered completely with reduction in amylase and tg levels . the remaining patients succumbed to complications from acute pancreatitis , namely , intra - abdominal abscess , septic shock , and multi - organ failure . in addition to the conventional management of acute pancreatitis in these patients , hypertriglyceridemia needs to be treated effectively to bring down tg below 500 u / l , which has been correlated with marked improvement in symptoms.11 normoglycemic patients who are hemodynamically stable and have no contraindications to establishment of central venous access are considered to be good candidates to undergo plasmapheresis.12 better outcomes have been noted in patients who are subjected to apheresis within 48 hours of onset of symptoms.11,12 we treated our patient s dka with insulin , intravenous hydration , and electrolyte replacement . once the patient s hyperglycemia resolved , he was subjected to plasmapheresis with excellent results after one cycle .

diabetic ketoacidosis ( dka)-induced hypertriglyceridemia causing pancreatitis is an interesting phenomenon that has rarely been reported in literature . plasmapharesis is a well known treatment modality for hypertriglyceridemia - induced pancreatitis . we report a patient with dka - induced hypertriglyceridemic acute pancreatitis treated successfully with plasmapharesis .

Introduction Case Discussion

the virilizing forms of 21-hydroxylase and 11-hydroxylase deficiency cah manifest a complete spectrum of virilization in 46,xx individuals ranging from none to complete virilization such that in rare cases the external genitalia are entirely male with absent testes . when this diagnosis of cah is recognized in infancy , the recommendation for sex of rearing even in those with fully virilized external genitalia has been categorically female . the support for this dogmatic approach revolves around the preservation of fertility ; that is , because there are ovaries and a uterus , a female assignment is justified . this recommendation stems from the outcome data that show that with appropriate therapy , normal female growth , development , and fertility , and , a female sexual identity can be reasonably anticipated with a female sex assignment . however , these outcome data have also been disappointing in some respects , particularly in those who were markedly virilized at birth [ 1 , 2 ] . it is important to point out the similarities of this reasoning to the rationale present in the optimal gender approach used beginning in the 1950 's to guide sex assignment in dsd infants . although almost all ( ~95% ) 46,xx cah infants develop a female gender identity as adults , a sizable number have difficulty establishing intimate relationships and fertility is markedly reduced [ 3 , 4 ] . while gender role behavior and sexual orientation should not be considered as evidence of treatment failure , a larger portion of these cah patients are homo- or bisexual compared with the general population . the role played by prenatal androgen exposure on the developing brain and its relationship to outcomes in cah patients remains unclear , but the evidence supporting a relationship between androgen and brain development is irrefutable . the available outcome data on sexual identity in 46,xx cah patients cited throughout this paper suggests that it may be related to the variable degrees of virilization of the external genital seen in this disorder , and it is therefore counterintuitive to propose that all 46,xx cah infants be managed identically regardless of degree of genital virilization . while rare , the percentage of 46,xx patients with cah born with prader 4 - 5 genitalia is unknown , and it would be expected to occur more commonly in those patients harboring mutations causing severe enzyme deficiency . further , since reports of gender assignment do not clearly indicate what portion were born with prader 4 - 5 genitalia , the historical percentage of this subgroup of cah infants who are reared male versus female is unknown . further , it is impossible to ascertain surgical histories . however , since this surgical history is both incomplete and likely not representative of modern surgical approaches history , it should have little bearing on considerations for the future care . using modern surgical techniques , virilized 46,xx cah infants would need only one procedure to remove internal structures , correct hypospadias / chordee , and to place prosthetic testes if desired . in this report , we attempt to separate this unique group of virilized cah infants and present what is known about their outcomes . in the last year , we have reported our experience with a group of 46,xx male cah patients . this report described 12 adult 46,xx cah males , all of whom have a male gender identity and were sexually attracted to females , 10 of whom had always been reared male , as well as a group of four 46,xx infants whose parents chose a male sex assignment ( after full disclosure ) even after the diagnosis of cah in the neonatal period . it was during the preparation of the paper about the 12 adult cah males that we found extensive literature regarding other similar patients and decided to prepare this review . this literature review included searching for information on severely virilized 46,xx cah patients on pubmed , general internet , and traditional library searches , old and current endocrinology textbooks , followed by locating references of earlier publications cited in located publications . historically , the diagnosis of cah in those rare individuals with prader 4 or 5 external genitalia has been delayed in spite of clinical evidence of adrenal crisis ( table 1 ) . especially prior to the availability of glucocorticoid therapy , the diagnosis was often made at autopsy following a death from adrenal insufficiency . in others , the diagnosis of cah was made during the assessment of presumed cryptorchidism , gynecomastia , or hematuria . previously it was recommended that these patients be reassigned female when the diagnosis was made during childhood . more recently , however , it has been recognized that gender identity appears to be established in the first several years of life and that gender reassignment may be harmful . this practice has provided a small group of 46,xx cah adult males whose quality of life can now be assessed . those patients listed in table 1 include patients whose genitalia were essentially male at birth , having fully fused labia with the penile urethra being at the tip of the glans or distally on the underside of the penis ( prader stage 4 or 5 ) . while there are several reports , these are essentially case reports and do not involve systematic assessment of subjects but rather descriptions of presentation and natural history . table 1(b ) lists those reared male but reported during childhood so that long - term outcome data are not available . table 1(c ) lists patients reassigned female including some for whom outcome data is known . table 1(d ) includes patients reared male who were reported during adulthood ; within this later group are the most informative outcome data summarized below . the attempt is to review outcome information , with a focus on outcomes in patients born with male genitalia , requiring little to no genital surgery . there are additional reports of patients born with genital ambiguity who had gender dysphoria who declared a male gender in adulthood . this later group constitutes a different situation than the sexual identity issues seen in the nonambiguous primary group reported here . the standard of care for 46,xx cah patients diagnosed in infancy has been to recommend a female gender assignment and sex of rearing . this standard is based on the idea that these patients are really female as defined by karyotype and the benefit of preserving fertility outweighs a small risk of future gender dysphoria or dysfunctional sexual function resulting from surgery . the expectation has been that , with appropriate medical care of adrenal hyperplasia , growth , puberty , sexuality , and reproduction would be similar to unaffected females . historically , even 46,xx cah patients with male external genitalia were felt to have a reasonable expectation of fertility . however , while fertility rates in many 46,xx cah patients are only slightly impaired , the fertility rate of severely virilized cah patients is strikingly low . this generation of patients also underwent feminizing surgery that often damaged the neurovascular supply of the external genitalia , thereby precluding normal sexual responsiveness . while it is hoped that modern surgical techniques reduce the risk of neurovascular damage , it is likely that other factors also influence sexuality and fertility in these patients . in the case of the fully virilized 46,xx cah patient , a male sex of rearing minimizes the need for external genital surgery ( other than placement of prosthetic testes ) , and the outcome in these patients showing sufficient male sexual function suggests that satisfactory adult sexual activity is possible . given the high rates of male gender identity and sexual orientation toward females in 46,xx cah patients assigned male with appropriate family support we propose that it is reasonable to consider a male sex of rearing in the markedly virilized 46,xx cah patient , even when diagnosed in the neonate . to support this proposal , outcome information from markedly virilized patients reared male will be reviewed . as noted , early reports often involved patients who died in infancy or childhood due to adrenal insufficiency . in others , the diagnosis was made after the child had firmly established a male gender identity and reassignment was not considered . it is from this small group of 46,xx cah adult males ( table 1(d ) ) that outcome information is particularly informative . in 2005 , a literature review of gender identity , gender change and gender dysphoria in 46,xx cah patients included 250 subjects with varying amounts of masculinization of external genitalia reared female and 33 subjects with male genitalia reared male . initial sex assignment is not clear for all of the 250 reared female , 24 of whom were initially assigned male . in those 24 initially assigned male , female reassignment occurred in the first 19 months of life for 20 and the remaining 4 of these 250 reared female , 4 were subsequently reassigned male , including 2 who had been assigned male at birth . a total of 13 had gender dysphoria , including all of the patients reassigned male . hence , among 235 , 222 or 94.4% had a female gender identity with no gender dysphoria . gender identity problems were found in 4.6% , a higher percentage than the 0.008% found in one country , which may not be representative of the general population . among the 33 who were initially assigned and reared male , disturbed gender identity , one was ambivalent , and one was not adjusted as a male . these 4 ranged in age from 17 to 49 years . while the percentages differ , there simply are inadequate data to conclude that there is a difference regarding gender problems among cah patients reared male or female . it is noteworthy that gender problems were reported only for those over 17 years of age , forming the rationale for our focus on subjects aged 17 years or older . this report illustrates the complexities of attempting to make meaningful conclusions because degree of virilization , age of gender assignment and reassignment , and evidence for gender dysphoria were not systematically assessed . among the 13 of the 250 reared female reported to have gender dysphoria , severity of masculinization at birth many of these 250 females were born with lesser degrees of genital virilization in contrast to the 33 subjects initially assigned and reared male , all of whom had essentially male genitalia . further , gender dysphoria was reported among those of all ages , while gender dysphoria manifest during adulthood is probably stronger evidence . while the authors ' conclusion was that there was no basis for a gender assignment other than female for all cah 46,xx patients , the two groups , those reared female and male , are not comparable given their different numbers , age at assessment , and spectrum of masculinization . while the authors of the above report conclude that the general policy of assigning severely masculinized 46,xx cah patients female is justified , we would disagree based on the fact that the outcome data , which did not consistently report the degree of virilization , was insufficient to allow the degree of virilization to be compared with the outcome measures used . to be fair , we do not feel that this report presents enough data to recommend a male assignment either . however , the following citations of available adult outcome data , although scant , are adequate to suggest male gender identity , satisfactory sexual function , and an expectation of sexual orientation toward females in those severely virilized 46,xx cah patients who were assigned male . these factors together with the differences in the extent and consequences ( fertility , sexual function ) of surgical repair required for female assignment need to be considered when making the decision to raise a child in the male or female sex . it is of interest that fully virilized 46,xx cah individuals develop an apparently clear male gender identity during infancy , at the age when gender identity is expected to occur . however , the relative influence of other factors , including prenatal androgen exposure and other cultural influences , including being treated by parents and others as a male , remains unclear . although correlative animal studies suggest that neuroendocrine mechanisms of differentiation of neural circuits are involved in sexual partner preference ( sexual orientation ) , applicability to human gender identity and sexual orientation is unclear . prenatal and neonatal brain exposure to androgens may play a role in human sexual behavior , no impact on gender identity is known . in fact , evidence suggests that the initial gender assignment remains the best indicator of adult gender identity , a factor that must be considered for the markedly virilized 46,xx cah patient assigned male . further review of reports of those with essentially complete male virilization includes the several studies that report subjects less than 17 years of age : two at 3.5 years of age and 12 years of age , another two 46,xx prader 5 patients reared male without gender problems who were diagnosed during evaluation for cryptorchidism , six patients ( including 2 brothers ) diagnosed at birth but reared as male at parents insistence , who had no recognized evidence of gender problems at ages 3 to 16 years , and 3 prader 5 patients assigned male continued to live as males when reported ( aged 1116 years ) with one who expressing concern about living as a male . in a series from saudi arabia , 6 of 51 46,xx cah children underwent gender reversal and were managed as males . the choice was based primarily on parents ' input , with 4 of the 6 having delayed diagnosis . all had gonadectomy and excision of mllerian - derived structures ; 2 received circumcision / hypospadias repair and 4 underwent chordee repair . all were reported to be well adjusted to their sexual status with normal male behavior and activities but none were adults , all aged between 3 to 16 years . this report likely reflects cultural differences in attitudes about gender and sexuality , the role of the sexes in society , and parents ' perceptions . adult patients ( > 17 years ) included one reared male with prader 4 genitalia before glucocorticoid therapy and without surgery who had a clear male gender identity , sexual orientation toward females , and an intimate sexual relationship , another adult patient who had always lived as a male with no gender issues , and four prader 5 patients originally assigned male who continued to live as males without gender problems ( aged 31 to 50 years ) . one of these subjects was married and another denied ever having a sexual experience with a partner . for the remainder of those listed in table 1(d ) , outcome adjustment is not indicated beyond the fact that they were male . among twenty adult patients reared male , brief comments were included for 3 with gender problems ( table 1(d)-120 ) . in addition , we have added ten more 46,xx males , aged 35 to 69 years of age who have always lived as male . these men are all prescribed calculated replacement glucocorticoid therapy to provide adequate therapy for daily glucocorticoid needs and suppress sex steroid excess and have been also prescribed replacement testosterone therapy . although some of these men have had significant adjustment issues and poor family support , all retain a male gender identity with a sexual orientation toward females ; 8 were married or had long - term female partners . thus , while these men were not uniformly assessed , brief comments regarding gender problems or unknown severity were noted in 3 of the 30 . while gender change from female to male has been documented in 46,xx cah patients , the authors are not aware of any instance of gender change from male to female in this group of patients . the available outcome data are not sufficiently complete to allow comparison of outcomes between fully masculinized 46,xx cah patients reared male versus those reared female , and it is unlikely that such data will be available in the near future given the complexity of the factors needed to accurately assess outcome . the relationship between gender identity and quality of life has not been adequately studied in such situations . reports of quality of life among chronically ill older patients report inconsistent findings regarding the relationship of quality of life and gender role [ 22 , 23 ] , while it is clear that those with gender identity disorders have significant quality - of - life issues [ 24 , 25 ] further , it is quite possible that quality of life for the virilized 46,xx cah patient proceeds from the initial gender assignment , providing the basis for a secure gender identity . this is consistent with a stable gender identity being an important factor in quality of life . fortunately , there is some agreement on those outcome factors that should be used to judge quality - of - life outcomes for 46,xx cah patients : self esteem , body image , fulfilling interpersonal relationships , harmonious sexual identity ( gender identity , sexual experience satisfaction ) , and fertility . when these factors are measured in 46,xx cah patients assigned male , the outcome is comparable to those assigned female . in this latter group , those who were most virilized often manifest the worst outcomes . hence , we feel that a male gender assignment for the severely virilized patient is worthy of consideration and are advocating for this . further , we feel the available data provide some compelling reasons to consider a male assignment in some of the severely virilized 46,xx cah subjects . furthermore , we believe that these specialized cases of 46,xx dsd have something to say about gender assignment in general and for those difficult cases of 46,xy dsd . when considering gender assignment , many factors must be taken into consideration . it would be incorrect to assign gender based upon the presumed dictates of biological variables alone . what needs to be done as illustrated by the cases herein is to weigh all the factors with a focus on what assignment would hopefully provide the best quality of life in the long run .

there is ample historical verification of 46,xx congenital adrenal hyperplasia ( cah ) patients being born with essentially male genitaliawhile outcome information is scant . prior to glucocorticoid therapy , most patients died very young from adrenal insufficiency . most available reports from laterchildhood , contain little information concerning sexual identity . reports on older individuals lack adequate information about sexual identity and quality of life . the difficulty in assessing the relative impact of multiple dynamic environmental factors on the development of sexual identity , self- and body esteem and overall adjustment to life is clear . nevertheless , it remains unclear whether those infants whose masculine genitalia at birth resulted in an initial male assignment would have enjoyed a better adult outcome had they been allowed to remain male rather than the female reassignment that most received . further , one could ask whether a male sex of rearing should be considered in 46,xx cah infants with male external genitalia . after reviewing available literature , we conclude that because those extremely virlized 46,xx cah patients who were reared male with healthy social support demonstrated satisfactory levels of social and sexual function as adults a male sex assignment should be considered in these types of infants when social and cultural environment are supportive .

1. Background 2. Literature Review 3. Review of Recommendation for GenderAssignment 4. Report of Gender Outcome, Including but Not Limited to Those Fully Masculinized 5. Small Series of Outcome Information 6. Reports Vary by Age and Completeness of Assessment 7. Fully Masculinized Adult Patients Assigned/Reared Male

despite the large number of studies about left ventricular noncompaction ( lvnc ) , many uncertainties exist . echocardiography is accepted as the method of choice for lvnc diagnosis . magnetic resonance imaging ( mri ) was used extensively for this purpose as well ; however , artifacts from arrhythmias or breathing and higher cost are its disadvantages . large areas of hypertrabeculation ( ht ) can be seen in many diseases including dilated cardiomyopathy ( dcmp ) and even in normal subjects . it is not known whether this hypertrabeculation is a milder form of noncompaction ( nc ) or a different pathology . three sets of echocardiographic criteria proposed by chin , jenni , and stllberger developed to differentiate lvnc from other diseases . in spite of the existing criteria this problem may result from the nature of these criteria which depends on the finding of an area with maximal nc , or the number of ht / nc areas in lv . failure to find the area with maximal nc or all ht / nc areas may result in a misdiagnosis . measuring the percentage of hypertrabeculated or noncompacted myocardium ( ht / nc% ) may decrease misdiagnosis . we introduce a method for this measurement by echocardiography and examined it on a cohort of patients with lvnc cardiomyopathy , dcmp , and normal subjects . in order to create a 3-dimensional concept from september 2009 to june 2011 targeted subjects for this study were enrolled . all children with a diagnosis of dilated or lvnc cardiomyopathy admitted at our hospital or referred to our outpatient clinics were included and a control group of healthy subjects were also selected in a convenient method . for lvnc cardiomyopathy patients , the study period extended to june 2012 due to the small number of patients . a noncompacted to compacted myocardial dcmp was diagnosed when a patient had left ventricular ejection fraction ( lvef ) less than 50% ( present or past ) and disease duration of at least 3 months . the control group consisted of age - matched children referred to our outpatient clinics , with a final diagnosis of innocent murmur or non - cardiac chest pain and normal echocardiogram . two dcm patients with poor echocardiographic windows were excluded from the study . after obtaining informed consent from the parents , all study subjects were echocardiographically investigated by a single echocardiographer using a single echocardiographic scanner ( micromaxx ultrasound system , sonosite inc . the main reason for using this scanner was its portability which permitted us to study subjects in both the intensive care unit and outpatient clinics . echocardiographic parameters including left ventricular ejection fraction ( lvef ) , left ventricular fractional shortening ( lvfs ) , and left ventricular myocardial performance index ( lvmpi ) were obtained . the nc / c ratio during systole was measured as described by jenni et al . the ht / nc% was defined as the mean percentages of ht / nc myocardium at three levels : apical , papillary muscles , and mitral valve . at each level , short axis view at systole was obtained and three areas were measured : whole myocardium and lv cavity ( a ) , area encompassing only ht / nc myocardium and lv cavity ( b ) , and only lv cavity ( c ) ( fig . the ht / nc% at each level was calculated by using the following formula : % ht - nc = 100 ( b - c)/(a - c ) the parameters required to calculate the percentage of hypertrabeculated / noncompacted myocardium . the numbers 1 , 2 , and 3 refer to the apical , papillary muscle and mitral valve levels , respectively the apical level was defined when a small amount of lv cavity can be seen to precisely measure all desired areas ( fig . 1 ) . the papillary muscle level was defined when these muscles were first viewed when sweeping echocardiography probe from the apex toward the cardiac base . maximal care was undertaken not to include papillary muscles , aberrant chordae tendineae and lv bands in the ht / nc areas . the study was accepted by the ethical committee board of tehran university of medical sciences and in accordance with good clinical practice and the declaration of helsinki . descriptive statistics such as mean , standard deviation ( expressed after ) , and frequency were calculated for each variable . independent - sample t , chi - square , and pearson correlation tests were used for the statistical analyses . twenty six patients with dcmp , 4 with lvnc cardiomyopathy and 25 normal subjects were enrolled in the study . there was no statistically significant difference regarding the sex , age , weight , and body surface area between dcmp and control groups ( table 1 ) . demographic and basic echocardiographic data in three groups * nc / c , noncompacted to compacted myocardial thickness ; dcmp , dilated cardiomyopathy , lvnc , left ventricular noncompaction comparing the averages in dcmp and control groups patients with dcmp had statistically lower ef , fs , mpi , and higher nc / c ratio in comparison to the normal subjects ( table 1 ) . the%ht / nc% at all 3 levels and its average were significantly higher in the dcmp group than in the normal subjects ( table 2 ) . the ht / nc% was significantly correlated with the nc / c ratio ( correlation coefficient = 0.543 , p<0.001 ) . left ventricular hypertrabeculation / noncompaction percentage at three different levels in the left ventricle sd : standard deviation ; dcmp : dilated cardiomyopathy ; lvnc : left ventricular noncompaction comparing the averages in dcmp and control groups lvnc was accepted as a distinct type of cardiomyopathy by the world health organization . however , there are many controversies regarding its etiology , pathogenesis , diagnosis , and management . the diagnosis is especially important because the prognosis and management of lvnc differ from those of its differential diagnoses . the chin criteria was first described and based on x - to - y ratios at 3 levels ( mitral valve , papillary muscle , and apex ) . x corresponds to the distance between the epicardial surface and trough of a trabecular recess , while y to the distance between the epicardial surface and peak of the trabeculation . the measurements should be performed at end diastole and a ratio up to 0.5 is required for the diagnosis of lvnc . the jenni criterion postulates a systolic ratio of nc myocardial thickness to the adjacent compacted myocardium of more than 2 at the thickest part of myocardium , confirmation of blood flow in the recesses , absence of any cardiac abnormality , and the presence of characteristic trabeculations and deep recesses between the trabeculations . pignatelli et al suggested that a ratio of at least 1.4 is sufficient for the diagnosis of lvnc in children . jenni criterion is the most accepted among these three sets and used for the diagnosis of lvnc in this study . the stllberger criteria require the presence of at least 4 trabeculations distal to the papillary muscles at one plane and intertrabecular spaces filled from the ventricular cavity . definite diagnosis is present when the patients fulfill both jenni and stllberger sets of criteria , while probable corresponds to the fulfillment of just one , and possible to the situation where the number of trabeculations is less than 4 or the nc / c ratio is lower than two . kohli et al studied a cohort with heart failure and investigated all these 3 sets of diagnostic criteria . , 78.7% met the chin criterion , 63.8% the jenni criterion , and 53.2% the stllberger criteria . only one set of criteria was fulfilled by 36.2% of the patients , while only 29.8% met all sets . only 3 out of these 8 patients were diagnosed accurately by 2-dimensional echocardiography using jenni criterion . the idea of lvnc quantification by area measurement was first introduced by belanger et al . we introduced a new method for the quantification of ht / nc of lv and examined it on patients with dcmp , lvnc cardiomyopathy and normal subjects . the echocardiographer should investigate at least 3 levels in the myocardium and the result is based on an average rather than the areas of maximal involvement . we showed that this ht / nc% is well correlated with a carefully measured maximal nc / c ratio . petersen et al measured the nc / c ratio during diastole and showed that a value greater than 2.3 could be 86% sensitive and 99% specific for the diagnosis of lvnc . alhabshan et al measured the end - systolic nc / c ratio by both mri and echocardiography . they found that mri can found a higher nc / c ratio than echocardiography in some subjects . they found a diastolic value of 22% in their unique lvnc patient and a mean of 11.3% ( range 1.5 - 19 ) in 10 dcm patients . fernndez - golfin et al studied the same method on a larger cohort of ischemic heart disease , dcm , valvular heart disease , and left ventricular hypertrophy patients , and normal subjects . they found relatively higher values in their patients ( 17.24.9 in normal subjects , 23.36 in dcm patients ) . they studied patients with lvnc , dcm , hypertrophic cardiomyopathy ( hcm ) , and normal subjects they found that mean percentages were 3210 in lvnc , 114 in dcm , 124 in hcm , and 125 in controls . they reported that a percentage of more than 20% can be 93.7% specific and similarly sensitive to predict the presence of lvnc . in our cohort , only two dcmp subjects had a percentage higher than 17% while our 4 lvnc patients had values of 73 , 24 , 17 , and 24% . this means that the threshold value of 17% can distinguish lvnc from dcmp with 92% specificity and 100% sensitivity and from normal subjects with 100% specificity and sensitivity . color doppler echocardiography confirmation of direct blood flow from the ventricular cavity into deep intertrabecular recesses seems to be necessary for the diagnosis of lvnc , as it is a unique feature of this disease . our suggested echocardiographic threshold value of 17% is very close to the mri threshold of 20% which was suggested by jaquier et al , and korcyk et al . in summary , our suggested method is the echocardiographic equivalent of mri ht / nc% measurement while the jenni criterion is the equivalent of mri nc / c ratio measurement . second , the study was performed in a pediatric setting ; therefore , this method was not examined on adult patients . in addition , it was impossible to blind the echocardiographer to the diagnosis of the studied subjects . although the echocardiographer tried his best , there may be some bias in the echocardiographic measurements . second , the study was performed in a pediatric setting ; therefore , this method was not examined on adult patients . in addition , it was impossible to blind the echocardiographer to the diagnosis of the studied subjects . although the echocardiographer tried his best , there may be some bias in the echocardiographic measurements . we introduced a new echocardiographic method to measure ht / nc% and tested it on patients with dcm or lvnc , and normal subjects . we showed that the percentage had a statistically significant correlation with the noncompacted to compacted lv ratio .

objectivealthough there are several echocardiographic criteria , there is not yet a general consensus about the diagnosis of left ventricular noncompaction . the current criteria are mostly based on the areas with maximal noncompaction in the heart . the echocardiographer may miss this maximal point leading to a misdiagnosis . accordingly , we suggested a new method to measure the percentage of myocardial noncompaction using two - dimensional echocardiography.methodsin this study , the new method was examined on 4 noncompaction and 26 dilated cardiomyopathies , and 25 normal subjects . the percentage of noncompaction was measured at 3 levels ( apical , papillary muscle and mitral valve ) and averaged.findingsthe mean percentages of myocardial noncompaction were 3.592.27 , 8.865.52 and 34.726.1 in the control , dilated cardiomyopathy and noncompaction groups , respectively . a value of 17% or greater could distinguish left ventricular noncompaction from dilated cardiomyopathy with 92% specificity and 100% sensitivity and from normal subjects with 100% specificity and sensitivity . this percentage had a statistically significant association with noncompacted to compacted myocardial thickness ratio ( p<0.001).conclusionthis method showed good correlations with the existing echocardiographic and magnetic resonance criteria . however , it is not dependent on finding the area of maximal involvement . being comparable to magnetic resonance imaging in accuracy , it is easier to perform and more available .

Introduction Subjects and Methods Findings Discussion Study Limitations Conclusion Conflict of Interest

undescended testis is the most common congenital urological disorder with an overall incidence of 1.8% to 4% in full - term male newborns and decreases to 1% at age 1 year . untreated cryptorchidism has deleterious effects on the testis over time , with the risk of malignancy in intraabdominal testis as high as 5% , increasing with age . therefore , early investigations and treatment of impalpable testis is important to increase the likelihood of fertility and to allow adequate follow - up for possible testicular malignancies . overall , the majority of patients with undescended testes are identified and treated in childhood , but a significant portion of them in third - world countries present late due to the inaccessibility of healthcare and various other socioeconomic reasons . historically , surgical exploration has often been used to diagnose and manage impalpable testis . with the advent of laparoscopy , a technique reported by cortesi has been used widely in the diagnosis of undescended testis . the diagnostic and therapeutic management of the nonpalpable testis has changed over the years , and there are many studies on laparoscopic management of nonpalpable testis in pediatric surgery , but very few studies have been performed for the management of older patients . with this background , we evaluated the usefulness of laparoscopy in localization and treatment of impalpable testis by using prentiss ' maneuver to shorten the course of the spermatic cord in adolescents and older patients . this prospective study was conducted at liaquat university of medical and health sciences , jamshoro , pakistan , from june 2003 to july 2008 . thirty - eight patients with 46 impalpable testes who were admitted to our institution for management were enrolled in this study . six patients were lost in follow - up and were excluded from the study ; therefore , 32 evaluable patients with 40 impalpable testes were included in the study . careful physical examination to palpate and locate the testis was performed with patients in supine and standing positions . all patients with impalpable testis who were 10 years of age were included in study . patients with palpable testes , who were < 10 years of age and who did not give consent were excluded from the study . because it was cost effective and noninvasive , ultrasonography ( us ) of the abdomen and pelvis was performed in all cases . computed tomography ( ct ) and magnetic resonance imaging ( mri ) were not done , because most patients could not afford them , and patients immediately underwent laparoscopic assessment . all patients were fully informed regarding the laparoscopic - assisted orchiopexy or orchiectomy according to our hospital protocol . however , in special cases where patients preferred orchiopexy and strictly refused orchiectomy , the wishes of the patients were considered accordingly after counseling in detail and explanation of the possible future consequences . data were collected in a specially designed proforma document , containing all demographic , operative , and postoperative details for each subject . laparoscopy was performed with all patients under general anesthesia ( ga ) . before laparoscopy , a urethral catheter was placed to empty the bladder , and the patient was placed in a trendelenburg position for laparoscopy . a 12-mm supraumbilical transverse incision was made , and a 10-mm trocar was inserted under direct vision by using the hasson technique . two other 5-mm ports were made along the anterior axillary line on either side accordingly for orchiopexy or orchiectomy . when the testis was diagnosed as intraabdominal , the volume of the testis , length of the vas and vessels , and the association of inguinal hernia were determined . where the testis was found to be atrophic , laparoscopic orchiectomy was the preferred procedure . a grasper was used to lift up the testis , and spermatic vessels and vas were freed , clipped , and cut with laparoscopic scissors . in cases where the vas deferens and spermatic vessels were seen entering the deep inguinal ring , intraabdominal testis were excluded and the inguinal canal explored . in these cases , the inguinal canal was explored by using the open surgical technique , and orchiopexy or orchiectomy was performed taking into consideration the size of the testis , age and wishes of the patient . in the majority of patients in our study , when testis was found near the deep ring ( peeping into the internal ring ) or found having a normal size , testis along with its vascular pedicle were mobilized . dissection was started by incising the peritoneum over the testis , and the pedicle was mobilized carefully as high as possible . the length of the vas and vessels was measured by using a ruler intraoperatively before and after mobilization . after sufficient length was obtained , the prentiss ' maneuver was used to shorten the course of the spermatic cord by creating a neo - inguinal ring medial to the epigastric vessels by a small inguinal incision . testes were brought down into the scrotum and were fixed in a subdartos pouch in a standard fashion as in the open surgical technique . none of the patients in this study had hypospadias , mllerian ductus remnants , or ambiguous genitalia . all those patients who underwent orchiopexy were reviewed at 3 months and 1 year after the procedure to assess the postoperative outcome . all those patients who underwent orchiopexy were reviewed at 3 months and 1 year after the procedure to assess the postoperative outcome . during the study period , 32 evaluable patients with 40 impalpable testes underwent laparoscopic management of the testis . ages of patients ranged from 11 years to 37 years with a mean age ( + sd ) of 19.3 + 6.98 years . of 32 patients , 18 ( 56.25% ) had impalpable testis on the right side , 6 ( 18.75% ) on the left side , and 8 ( 25.00% ) patients had bilateral involvement . ultrasonography localized 16 ( 40% ) of these impalpable testis , while laparoscopy revealed 36 ( 90% ) , and the remaining 4 ( 10% ) testes were diagnosed as vanishing testis ( anorchia ) as shown in table 1 . testicular localization by ultrasound versus laparoscopy of 30 intraabdominal testes , single - stage laparoscopic - assisted orchiopexy was successfully performed in 16 ( 40% ) testes , while laparoscopic orchiectomy was performed in 14 ( 35% ) testes . six testes where vas and vessels entered the internal ring were diagnosed as intracanalicular testis . they were explored by inguinal incision , inguinal orchiopexy was done in 2 ( 5% ) testes , and inguinal orchiectomy was performed in the remaining 4% of testes . blind ending vessels were seen in 4 cases , and they were diagnosed as vanishing testes as shown in table 2 . seven ( 17.5% ) testes were associated with ipsilateral hernia , and hernia repair was done laparoscopically at the same time . the mean operative time was 20 minutes ( range , 10 to 25 ) for diagnostic laparoscopy , 60 minutes ( range , 45 to 70 ) for orchiectomy , and 90 minutes ( range , 60 to 100 ) for laparoscopic - assisted orchiopexy as shown in table 3 . procedures and outcomes * * diag = diagnostic ; lap = laparoscopic ; ing = inguinal ; intraabd = intraabdominal ; int = internal . minor complications were seen in 3 patients : subcutaneous hematoma at the port site in 1 patient and surgical emphysema in 2 patients . texf}the ability to reproduce has always been of paramount importance , but cryptorchidism / undescended testis may cause infertility . the diagnostic yield of ultra sonography , computed tomography , and magnetic resonance imaging varies from 32.1% to 67.0% , which is not satisfactory . many surgical techniques have remained in use for correction of this pathology over the years . cortesi et al were the first to use laparoscopy as a diagnostic tool for impalpable testes , while jordan described the first laparoscopic orchiopexy in 1992 . since then after the success of laparoscopy in many other fields and improvements in video technology , laparoscopic orchiopexy and orchiectomy have gained considerable support and are used frequently . the main benefit of laparoscopy lies in the fact that it can be used as a diagnostic tool then converted immediately into a therapeutic tool . it is not permissible to leave the intraabdominal testis untreated , unless it is a vanishing testis . another benefit of laparoscopic surgery is that surgery can be done minimally invasively with few holes and a small inguinal incision . conventional orchiopexy can not produce good results in the case of intraabdominal testis , because the testicular vessels are short and adequate lengthening is not easy . one- and 2-stage laparoscopic fowler - stephens orchiopexy have been used successfully in pediatric patients . very few studies have been performed analyzing the laparoscopic management of impalpable testis in older patients . this is because in the western world patients are identified and treated in childhood due to good health care systems and awareness of the problem . in developing countries , late presentation of undescended testis is not uncommon ; however , with the introduction and increasing use of laparoscopy in the third world , a few studies have been done in india for management of impalpable testis in adults with satisfactory results inconsistent with the results of this study . in our study , patients were comparatively older compared with patients in other international studies , because of the late presentation of patients in this part of world . we utilized the benefits of minimally invasive surgery in this age group and performed either orchiectomy or one - stage laparoscopic - assisted orchiopexy in the majority of patients . there are current recommendations for orchiectomy in postpubertal patients up to age 32 and 50 years . however , we could not adapt this aggressive approach due to patient 's preference for orchiopexy for various social reasons . orchiopexy was done after frozen section in this subset of patients who strictly refused orchiectomy . these patients were informed regarding the future consequences including risk of cancer and were advised to receive regular follow - up . in this study , we used prentiss ' maneuver and shortened the course of vas and vessels by creating a new inguinal ring medial to inferior epigastric vessels . in this way , we were able to bring down the testis and fix it in the subdartos pouch successfully without tension , in all cases . in this laparoscopic - assisted study , the spermatic vessels were mobilized as high as possible by laparoscopy , a neo - inguinal ring was created medial to inferior epigastric vessels to shorten the course of the spermatic cord , and the remaining part of the procedure , ie , fixation of testis in the subdartos pouch , was completed by the open surgical method . in our study , operative time for single - stage laparoscopic - assisted orchiopexy was 90 minutes compared with other international studies where operative time for laparoscopic orchiopexy was 205 and 180 minutes , respectively . this short operative time may be because after mobilization , fixation of the testis in the subdartos pouch was performed using open surgery . however , these international studies were done in pediatric patients , whereas our study was done in comparatively older patients . laparoscopy is a safe , effective modality in the diagnosis and management of impalpable testis in adolescents and adult men , especially when ultrasonography is not informative . performing the prentiss ' maneuver by shortening the usual path of the spermatic cord medial to the vessels was beneficial for fixing the testis in the scrotum without tension .

laparoscopic - assisted single - stage orchiopexy appears to be a safe , effective procedure for intraabdominal testis in adolescent and older patients .

INTRODUCTION PATIENTS AND METHODS Follow-up RESULTS DISCUSSION CONCLUSION

parental obesity increases the risk of obesity in offspring through genetic , biological , and environmental influences [ 13 ] . maternal obesity , weight gain , and increased body mass index ( bmi ) between pregnancies and gestational diabetes increase risks of offspring obesity , type 2 diabetes mellitus ( t2 dm ) , and cardiovascular disease ( cvd ) in the offspring [ 47 ] . consistent with the chronic low - grade inflammatory state of obesity , elevated concentrations of interleukin-6 ( il-6 ) and c - reactive protein ( crp ) have been observed in obese pregnant women . higher maternal levels of il-6 were predictive of the increased growth and adiposity in the offspring . maternal diet - induced obesity in sheep resulted in higher fetal triglyceride ( tg ) levels and upregulated inflammatory signaling . offspring of rats injected with il-6 throughout pregnancy had an altered inflammatory profile associated with greater body fat mass and reduced insulin sensitivity . epigenetic processes are important mediators of early - life environment , metabolism , and body composition in offspring . epigenetic changes in genes involved in the inflammatory response have been observed in response to maternal diet and adiposity . differences in methylation levels of the peroxisome proliferator - activated receptor alpha ( ppara ) and glucocorticoid receptor promoters have been observed in the liver of offspring of rats fed with protein - restricted diet during pregnancy [ 13 , 14 ] . methylation status of retinoid x receptor alpha ( rxra ) promoter in umbilical cord tissue dna was correlated with increased adiposity in children of mothers with lower carbohydrate intake . epigenetic mechanisms have been involved in inflammation and associated disorders including obesity [ 15 , 16 ] . bariatric surgery is known to improve glucose and lipid metabolism [ 1719 ] and prevent arterial hypertension and type 2 diabetes [ 1921 ] . bariatric surgery also decreases the low - grade inflammation associated with obesity . in previous studies , we demonstrated that children born after maternal bariatric surgery ( ams ) exhibited lower prevalence of severe obesity , greater insulin sensitivity , and improved lipid profile in comparison to siblings born before maternal surgery ( bms ) [ 23 , 24 ] . in addition , ams children demonstrated differences in a marker of chronic low - grade inflammation , namely the plasma c - reactive protein ( crp ) . this study was designed to analyze the relationship between maternal biliopancreatic diversion surgery and methylation levels of genes involved in immunologic and inflammatory pathways in bms and ams offspring . correlation analyses between gene methylation , expression , and plasma crp levels were conducted for the il-8 pathway . women from qubec city and surrounding areas ( administrative regions of capitale - nationale , mauricie , and chaudire - appalaches ) who had given birth before and after biliopancreatic diversion with duodenal switch for severe obesity were eligible for the current study . a subset of 20 unrelated mothers was recruited along with 50 siblings born before and after surgery ( 25 bms and 25 ams offspring ) . mothers and offspring attended the qubec heart and lung institute ( qubec city , qubec , canada ) or a regional hospital for assessment between july and october 2010 . there were 17 mothers with siblings born before and after surgery ( 23 bms and 24 ams ) , two with bms offspring only ( 2 bms ) , and one mother with only one ams offspring . this study was approved by the qubec heart and lung institute ethics committee . written informed consent was obtained from adults and mothers with assents from minors . percent body fat was determined for individuals at 6 years or more ( bms , n = 23 ; ams , n = 17 ) using bioelectric impedance analysis ( tanita , arlington heights , il , usa ) . weight , height , and resting systolic ( sbp ) and diastolic ( dbp ) blood pressure were obtained using standardized procedures and measured at the interview . bmi was calculated for mothers , and bmi percentile for children was obtained from the national health and nutrition examination survey 2000 charts . bmi z - score was calculated for children using charts from the centers for disease control and prevention . severe obesity in offspring was defined using age- and sex - corrected adiposity measurements ( bmi z - score > 3 ; bmi percentile > 98% ) . blood samples were collected from mothers and offspring after an overnight fast into bd vacutainer tubes containing edta and paxgene blood rna collection tubes ( qiagen , valencia , ca , usa ) . plasma tg , high - density lipoprotein cholesterol ( hdl - c ) , low - density lipoprotein cholesterol ( ldl - c ) , total cholesterol ( total - c ) , total - c / hdl - c ratio , glucose , and insulin concentrations were measured as previously described . the homeostatic model of insulin resistance ( homa - ir ) index was calculated as glucose insulin/22.5 . genomic dna was isolated from the blood buffy coat using the genelute blood genomic dna kit ( sigma , st . louis , mo , usa ) and quantified using both nanodrop spectrophotometer ( thermo scientific , wilmington , de , usa ) and picogreen dna methods . dna ( 1 g ) was bisulfite converted , and quantitative genome - wide methylation analysis was conducted using the infinium humanmethylation450 beadchip ( illumina , san diego , ca , usa ) . arrays were processed at the mcgill university and gnome qubec innovation centre ( montral , canada ) according to the manufacturer 's instructions ( illumina , san diego , ca , usa ) . the infinium humanmethylation450 beadchip array was designed for genome - wide methylation analysis with coverage targeted across gene regions with sites in the promoter region , 5utr , first exon , gene body , and 3utr . the beadchip interrogates more than 485 000 methylation sites at single - nucleotide resolution . visualization and analysis of methylation data were conducted using the genomestudio software version 2011.1 ( illumina inc . ) and the methylation module . methylation levels ( beta values ; ) were estimated as the ratio of signal intensity of the methylated alleles to the sum of methylated and unmethylated intensity signals of the alleles ( value = c/(t + c ) ) . internal control probe pairs were used for data correction ( background subtraction and normalization ) , and cpg sites with a detection p value > 0.05 were removed from analysis . differences in methylation levels between bms and ams groups ( mean values ) were tested using illumina custom model . false - discovery - rate - corrected ( fdr - corrected ) p values and diffscores were computed . diffscore is a differential methylation score calculated from p values and differences in ( delta ) between the two groups and was used here as the main statistical results for comparison of bms and ams siblings . differential methylation analysis between bms and ams siblings revealed 5698 genes ( 14 466 probes ) with significant differences in methylation levels ( fdr - corrected diffscore |13 distribution of differentially methylated probes obtained from comparison between bms and ams offspring is provided in supplementary table 1 available online at http://dx.doi.org/10.1155/2013/492170 . total rna was isolated and purified from whole blood for 46 offsprings ( 23 bms and 23 ams ) using paxgene blood rna kit ( qiagen ) following the manufacturer 's recommendations . the integrity of the purified rna was analyzed using both nanodrop ( thermo scientific , wilmington , de , usa ) and 2100 bioanalyzer ( agilent technologies , cedar creek , tx , usa ) . expression levels were measured using the humanht-12 v4 expression beadchip ( illumina inc . ) which contains more than 47 000 probes derived from ncbi refseq release 38 . microarray experiments were carried out using 250 ng of total rna and processed according to the manufacturer 's instructions at the mcgill university and gnome qubec innovation centre ( montral , canada ) . expression data were visualized and analyzed using the flexarray software ( version 1.6 ) , and the lumi algorithm was used for expression data analysis and normalization . probe detection analysis was conducted using the flexarray filter algorithm to generate a list of expressed probes . to be considered as significantly expressed , a probe had to show a detection p value 0.05 in at least 25% of the samples of a group . ( sam ) algorithm with unequal - variance ( welch 's ) t - statistic was used to assess differences between bms and ams siblings for significantly expressed probes . the sam algorithm uses permutations of the data set to generate an empirical null distribution and to assess the significance of observed effects , rather than using the hypothetical t - distribution . in addition , a cutoff of fold change 1.2 or 0.83 ( symmetrical fold change 1.2 or 1.2 ) was used . p values obtained from permutations and fold change cutoff values were then used to minimize the chances of false positives . differential expression analysis revealed a total of 862 probes differentially expressed with a symmetrical fold change |1.2| ( p 0.05 ; fold change < 0.83 or > 1.2 ) . gene expression microarray results were validated using real - time polymerase chain reaction ( rt - pcr ; applied biosystems gene expression assays ; applied biosystems , foster city , ca , usa ) . spearman correlations were computed for expression levels assessed by microarray and rt - pcr methods in a subset of genes ( bcl2 , nm_000633 ; ccnd2 , nm_001759 ; ncf2 , nm_000433 ; pik3r1 , nm_181523 ; prkch , nm_006255 ) for whom correlations between gene expression and methylation levels were observed . samples were analyzed in duplicate using predesigned probes ( hs00608023_m1 , hs00153380_m1 , hs01084940_m1 , hs00933163_m1 and hs00178933_m1 ) and calibrated to the actb housekeeping gene ( endogenous control ; actb : hs99999903_m1 ) . relative quantification estimations were performed on an applied biosystems 7500 real - time pcr system ( applied biosystems , foster city , ca , usa ) . analysis of potentially altered pathways was conducted using the knowledge base of the ingenuity pathway analysis ( ipa ) system . the lists of 14 466 differentially methylated and 862 differentially expressed probes produced from differential methylation and differential expression analysis , respectively , were submitted to ipa . ipa measured the likelihood that these genes participate in a particular pathway and calculated p values using a right - tailed fisher 's exact test for each pathway . clinical data were expressed as mean sd . the effect of bariatric surgery in mothers was assessed using a within - subject paired t - test . differences in anthropometric data between bms and ams siblings were tested using analysis of variance ( general linear model , type iii sum of squares ) with adjustments for the effects of sex and puberty . in the absence of tanner scores , we arbitrarily defined puberty as 12 years for girls and 14 for boys . differences in severe obesity between bms and ams siblings were evaluated using bmi percentile and bmi z - score and tested using fisher 's exact test . p values for crp were adjusted for the effects of sex , puberty and bmi percentile , an age- and sex - corrected adiposity measurement . pairwise pearson correlations between methylation , expression , and plasma crp were computed for the il-8 signaling pathway that was overrepresented in both differential methylation and expression analyses . partial pearson correlations were also computed for the il-8 signaling pathway after adjustments for age and sex . statistical analyses were conducted using the sas software version 9.2 ( sas institute inc . ) . a total of 20 mothers ( 41.0 5.3 years ; mean sd ) who had undergone biliopancreatic diversion were recruited . mean postoperative follow up was 12 years and 2 months at the time of the study . bariatric surgery induced dramatic weight loss in mothers . on average , the women weighted 121.5 19.2 kg ( bmi = 45.0 7.2 ) at the time of the surgery and 74.8 11.9 kg ( bmi = 27.6 4.8 ) at the recruitment interview . the mean weight loss of 46.7 16.1 kg was associated with significant improvements in plasma lipids ( p 0.01 for tg , hdl - c , ldl - c , total - c , and total - c / hdl - c ratio ) and reductions in insulin resistance ( homa - ir index ; p 0.001 ) and blood pressure ( sbp and dbp ; p 0.001 ) with a trend toward lower plasma glucose levels ( p = 0.06 ) . the 50 bms and ams offspring of 20 mothers were aged between 2 years and 8 months and 24 years and 11 months with similar sex distribution ( 40% males in both bms and ams ) . bms offspring were born 3 years and 5 months before and ams offspring were born 3 years and 7 months after maternal bariatric surgery . bms siblings were older ( mean age 14.9 y versus 9.6 y ) than ams siblings ( table 1 ) . following adjustments for the effects of sex and puberty , ams offspring showed a trend toward lower body fat percent ( p = 0.07 ) . there was a significantly lower prevalence of severe obesity in ams using bmi percentile ( p = 0.01 ) or bmi z - score ( p = 0.05 ) as indicators . ams offspring had improved fasting insulin levels ( p = 0.03 ) , lower homa - ir index ( p = 0.03 ) , and blood pressure . plasma crp levels were different in bms versus ams offspring ( 5.14 7.90 versus 3.58 11.09 ; p = 0.03 ) even after taking into account the sex effect ( p = 0.03 ) . these differences in plasma crp levels were no longer significant after further adjustments for the effects of puberty , and bmi ( bmi percentile ) . from the list of 5698 differentially methylated genes between bms and ams offspring , ipa revealed 160 pathways significantly overrepresented ( p < 0.05 ) . similar analysis conducted from the list of 862 differentially expressed genes between bms and ams offspring identified 68 overrepresented pathways . the list of the top 20 overrepresented inflammatory and immune pathways identified from differential methylation analysis along with corresponding results obtained from gene expression analysis is presented in table 2 . among them , 5 pathways were found to be overrepresented in both methylation and expression : il-8 signaling , icos - icosl signaling in t - helper cells , role of nfat in regulation of the immune response , b - cell receptor signaling , and glucocorticoid receptor signaling . among the 5 pathways listed above it was thus selected for further analyses to highlight the potential link between gene methylation , expression , and inflammation . among the 193 genes assigned to the il-8 signaling pathway by ipa , 70 genes represented by 214 methylation probes were found to be differentially methylated in bms versus ams ( supplementary table 2 ) . corresponding expression data were available for 102 of these probes ( 46 genes ) . among the 46 genes analyzed , correlations between dna methylation and expression were significant for 17 genes ( 23 methylation probes ; table 3 ) . further analyses were then focused on these 17 genes to correlate gene methylation and expression with crp levels . there were significant correlations between gene methylation and plasma crp levels for 16 genes . gene expression levels of 5 genes were found to correlate with plasma crp levels ( table 3 ) . all 5 genes with significant correlations between gene expression and plasma crp levels ( bcl2 , ccnd2 , ncf2 , pik3r1 , and prkch ) also demonstrated correlations between methylation and expression and between gene methylation and plasma crp levels ( table 3 ) . following adjustments for the effects of age and sex , all 17 genes initially showing correlation between gene methylation and expression levels demonstrated significant correlation after adjustments . in addition , the rhoh gene ( methylation probe cg26163153 ) reached significance level while initially showing a trend toward significant correlation ( p = 0.09 ) . from the 16 genes correlated with crp levels only one ( pik3r1 ) of the five genes with significant correlations between gene methylation , expression , and crp levels remained significant after adjustments , while trends toward significant correlation were found for bcl2 , ccnd2 , and ncf2 . validation of gene expression microarray data for these 5 genes demonstrated significant correlations between microarray and rt - pcr results for 4 of the genes assessed ( ccnd2 , r = 0.358 , p = 0.02 ; ncf2 , r = 0.574 , p < 0.0001 ; pik3r1 , r = 0.349 , p = 0.02 ; prkch , r = 0.462 , p = 0.001 ) , while bcl2 did not reach significance ( r = 0.223 , p = 0.14 ) . we demonstrated here for the first time that surgical treatment of severe maternal obesity results in sustained differences in the methylome and transcriptome of genes involved in inflammatory pathways in ams offspring compared to bms siblings . the proportion of 34.7% of differentially methylated genes ( 1976 of 5698 genes ) being identified by two probes or more strengthen , the validity of our results arguing for a regulation of methylation levels in offspring . differential analysis of gene methylation and expression levels revealed important differences between the sibling groups . pathway analysis from differentially methylated genes in bms versus ams revealed important regulation of inflammatory and immunity pathways : 29 inflammatory- or immunity - related pathways being identified among the top 50 overrepresented pathways ( data not shown ) . pathway analysis from differentially expressed genes between bms and ams revealed 5 overrepresented pathways among the top overrepresented pathways from differential methylation data ( table 2 ) . overrepresentation of genes from the il-8 signaling pathway was identified from both methylation and expression data , and significant correlations were found between gene methylation and expression levels . moreover , 5 genes from the il-8 pathway also demonstrated correlation of gene methylation and expression levels with plasma crp levels . despite the fact that the impact of dna methylation on gene expression seems to be site and location dependent , results obtained here for the il-8 pathway generally comply to the known phenomenon that intragenic methylation ( gene body , 5utr and 3utr ) correlates with increased gene expression , while promoter methylation is associated with decreased expression [ 30 , 31 ] . gene expression profiling in obese patients who had undergone weight loss or bariatric surgery demonstrated a regulation of inflammation - related transcripts and changes in inflammatory marker levels [ 32 , 33 ] . in the present study , we extend these data by reporting that metabolic improvements in mothers following biliopancreatic diversion surgery are reflected in gene methylation and expression levels of immunologic and inflammatory genes in offspring , indeed reinforcing the involvement of epigenetic differences in immunity and inflammatory genes in the determination of the offspring phenotypes . a limited number of epigenetic studies have evaluated the impact of maternal nutrition and obesity on methylation of immune and inflammatory genes in offspring . recently , human studies have revealed the implication of immune and inflammatory gene methylation in children with respect to adiposity . methylation levels of the rxra gene in umbilical cord tissue dna of healthy neonates were associated with maternal carbohydrate intake in early pregnancy and childhood adiposity at 9 years old . relton and collaborators reported associations between anthropometric indices ( bmi , fat mass , lean mass , and height ) in 9 years old children and methylation levels of selected immune and inflammatory genes in cord blood samples . with a different design involving siblings born under different maternal obesity condition , our study supports the role of epigenetic factors in immunity and inflammatory genes in the determination of offspring phenotypes . transcriptomic data revealed that improvements seen in mothers following bariatric surgery are reflected in gene expression levels of immunologic and inflammatory genes in offspring . animal studies have demonstrated a similar impact of maternal obesity and nutrition on immune and inflammatory genes in the offspring [ 3537 ] . these results are consistent with those obtained from the present gene expression analysis in bms offspring versus ams siblings and may provide potential mechanisms for higher levels of systemic inflammation found in bms offspring . we used dna extracted from blood as it is more convenient and acceptable than biopsies of target tissues , especially in children . although epigenetic signatures have been shown to differ between tissues , the overall impact is minor given the known similarities in methylation patterns . gene expression levels are also known to be tissue - or cell - type dependent but also correlated [ 4042 ] thus justifying the use of blood in clinical studies . differential gene expression analysis led to a limited number of differentially expressed genes ( 862 ) in comparison with the 5698 differentially methylated genes identified . this discrepancy may be attributable to differences in statistical algorithms , in corrections for multiple testing , or in the different cutoffs used ; a cutoff fold change 1.2 or 0.83 was applied for gene expression analysis . nonetheless , pathway analyses conducted from differentially methylated and expressed genes are concordant and demonstrate an overrepresentation of immune and inflammatory pathways . we did not stratify for sex in these gene methylation and expression analyses ; several studies did not find sex - specific autosomal methylation patterns [ 43 , 44 ] . owing to the before - after design of the study , we were unable to fully correct for the age difference between the sibling groups . this design and the young age of the ams offspring ( 80% being younger than 12 years old ) do not allow discussing the long - term effects in children . longitudinal studies are thus needed to further assess long - term effects of maternal bariatric surgery in the offspring . age - related differential methylation has been reported but was shown to be site- and location dependent [ 4547 ] and represented a very small proportion of cpg sites . furthermore , longitudinal studies in humans demonstrated relative stability of dna methylation over time . in regards to the general conclusion drawn from our results , the potential impact of maternal weight regain on offspring is limited in the current study considering the sustained weight loss achieved with the biliopancreatic diversion with duodenal switch [ 19 , 48 , 49 ] . analysis of maternal clinical files along with the lack of inflammation - related perioperative complications in biliopancreatic diversion with duodenal switches argues against the potential impact of specific inflammatory condition in mothers . the current study was not designed to analyze methylation and expression changes induced in mothers following bariatric surgery . however , based on a recent meta - analysis demonstrating a reduction in low - grade inflammation associated with obesity following bariatric surgery , it would be tempting to speculate that these changes may be accompanied by similar changes in methylation and expression levels . improvements in inflammatory profiles in mothers following bariatric surgery may be potentially responsible for the inflammatory effects seen in offspring through modification of the in utero environment and improved methylation profiles in ams offspring . using analysis of gene methylation and expression data , we reveal that improvements seen in mothers following bariatric surgery reflect on the expression and methylation levels of genes involved in immune and inflammatory pathways in the offspring . these results argue for a beneficial effect of maternal weight loss before pregnancy and provide potential mechanisms of action for physiological improvements through regulation of methylation and expression of genes involved in inflammatory and immune pathways . since inflammation is recognized as an independent risk factor for cardiovascular diseases ( cvd ) and is also associated with the development of the metabolic syndrome , insulin resistance , hypertension , and obesity [ 50 , 51 ] , it would be important to conduct longitudinal studies to examine the long - term effect of maternal bariatric surgery on offspring .

background . maternal obesity , excess weight gain and overnutrition during pregnancy increase risks of obesity , type 2 diabetes mellitus , and cardiovascular disease in the offspring . maternal biliopancreatic diversion is an effective treatment for severe obesity and is beneficial for offspring born after maternal surgery ( ams ) . these offspring exhibit lower severe obesity prevalence and improved cardiometabolic risk factors including inflammatory marker compared to siblings born before maternal surgery ( bms ) . objective . to assess relationships between maternal bariatric surgery and the methylation / expression of genes involved in the immune and inflammatory pathways . methods . a differential gene methylation analysis was conducted in a sibling cohort of 25 bms and 25 ams offspring from 20 mothers . following differential gene expression analysis ( 23 bms and 23 ams ) , pathway analysis was conducted . correlations between gene methylation / expression and circulating inflammatory markers were computed . results . five immune and inflammatory pathways with significant overrepresentation of both differential gene methylation and expression were identified . in the il-8 pathway , gene methylation correlated with both gene expression and plasma c - reactive protein levels . conclusion . these results suggest that improvements in cardiometabolic risk markers in ams compared to bms offspring may be mediated through differential methylation of genes involved in immune and inflammatory pathways .

1. Introduction 2. Material and Methods 3. Results 4. Discussion 5. Conclusion

the role of bacteria in initiating and perpetuating pulp and periapical disease is well established . therefore , the purpose of endodontic treatment is to eliminate microorganisms from the root canal system , and to prevent recontamination by creating a fluid - tight seal between the canal and the obturating material . for this purpose , a material which can completely seal the infected root canal system would be ideal for clinical practice . however , previous studies showed that current root canal obturation materials such as gutta - percha and/or polymer - based materials can not provide a bacteria - tight seal . mineral trioxide aggregate ( mta ) has been successfully used as a biomaterial in both surgical and nonsurgical endodontics . mta has been shown to provide superior sealing and biomineralization ability , despite concerns about the macro- or microporous structure of the material caused by inadequate water - to - powder ratio , insufficient packing or water evaporation . indeed , it has been reported that the porosity caused by dissolution of calcium hydroxide within mta could be self - repaired ' by mineral precipitates such as calcium silicate hydrate gel that is formed by the hydration reaction of the material , and the tag - like structures formed at the mta / dentin interface . these characteristic structures appear to be important in sealing dentinal tubules and biomineralization of the material . for biomineralization , the interaction of mta and phosphate - buffered saline ( pbs ) triggers the initial precipitation of calcium - deficient carbonated apatites via an amorphous calcium phosphate phase , which further promotes the process . furthermore , it has been reported that these carbonated apatites promote the formation of an interfacial layer with tag - like structures at the mta / dentin interface . consequently , mta - induced biomineralization may be enhanced if pbs is used as the mixing vehicle for hydration . however , there have not been any studies on the effectiveness of mta pbs paste as an obturation material , and little is known about the capacity for mta - induced biomineralization to entomb bacteria in infected root canals . orthomta ( biomta , seoul , korea ) is a newly developed mta cement for orthograde root canal obturation , that is mainly composed of tricalcium silicate and contains less heavy metal than the original proroot mta ( dentsply , tulsa , ok , usa ) . therefore , the aim of this study was to examine the effects of mta - induced biomineralization with regard to bacterial entombment in dentinal tubules , by using orthomta the null hypothesis was that the orthomta pbs obturation can effectively entomb bacteria by intratubular mineralization in enterococcus faecalis - infected root canals . this study was carried out under the approval of the institutional review board of seoul national university dental hospital , seoul , korea . sixty human single - rooted premolars with fully formed apices that were without root cracks or defects when viewed under a microscope ( opmi pico , carl zeiss , germany ) were collected from patients undergoing extractions for orthodontic reasons in the department of oral and maxillofacial surgery . all of the teeth were decoronated with a minitom saw ( struers , rodovre , denmark ) , and apical patency was obtained with a size # 10 stainless steel k - file ( dentsply , tulsa , ok , usa ) . the working length was determined to be 1 mm short of the apical foramen when visually inspected with a size # 10 stainless steel k - file ( dentsply , tulsa , ok , usa ) . the coronal third of the canals were flared with gates glidden burs # 24 ( komet , rock hill , sc , usa ) . the canals were then instrumented to an apical size # 50/.06 with a crown - down technique using profile 0.04 and 0.06 ni ti rotary instruments ( dentsply maillefer , ballaigues , switzerland ) , and copiously irrigated with 5.25% sodium hypochlorite and 17% ethylenediaminetetraacetic acid ( edta ) between instruments . the smear layer was removed from the canal walls by immersing the specimens for 5 min each in 17% edta ( ph 7.2 ) followed by 5.25% sodium hypochlorite within an ultrasonic bath ( elmasonic 1 ultrasonic cleaner ; camlab , cambridge , uk ) . finally they were autoclaved at 121 c for 15 min to ensure that there was no bacterial contamination , and then incubated in brain heart infusion ( bhi ) broth at 37 c for 24 h. the roots were stored at 37 c in 100% humidity until use . roots were randomly assigned to four groups that determined whether or not they would receive an inoculation and/or an mta obturation . group 1 : 10 sterile roots were filled with pbs ; group 2 : 10 inoculated roots were filled with pbs ; group 3 : 20 sterile roots were orthograde filled with orthomta pbs ; group 4 : 20 inoculated roots were orthograde filled with orthomta pbs paste . each group was further subdivided into five subgroups for the observation periods 1 , 2 , 4 , 8 and 16 weeks . enterococcus faecalis was grown overnight in bhi broth , adjusted to a turbidity of 0.5 on the mcfarland scale ( 1.510 cfuml ) and inoculated into all root canal lumens in groups 2 and 4 . all of the roots were then placed into conical tubes containing fresh bhi ( 20 ml ) that was replaced every second day , and incubated for 3 weeks at 37 c in a humidified incubator with 5% co2 ( bbd 6220 co2 incubator ; thermo fisher scientific , waltham , ma , usa ) . the purity of the cultures was confirmed by gram staining , catalase production and colony morphology on bhi blood agar . following this incubation , then , all of the canals in groups 3 and 4 were filled to their working length with orthomta cement ( biomta , seoul , korea ) . the orthomta powder was mixed with pbs ( liquid / powder=0.3 ) with a sterile plastic stick , and an mta carrier ( biomta , seoul , korea ) was used to insert mta incrementally into each canal . ti compactor and hand pluggers ( biomta , seoul , korea ) were used alternatively to condense the mta increments and prevent voids . the orthomta compactor was applied with a continuous , slight pecking movement using a reduction handpiece ( 1281 ; w & h dentalwerk burmoos gmbh , burmoos , austria ) and electric motor ( tcm 3000 ; nouvag ag , goldach , switzerland ) at 60 rmin . all of the obturations were performed by a single endodontist , and radiographs were taken to ensure that the canals were adequately filled and without voids . then , the cervical 3 mm of all root canals were packed with pbs - soaked sterile cotton and sealed with intermediate restorative material ( irm ; dentsply caulk , milford , de , usa ) . finally , the roots were stored in sterile plastic vials containing 20 ml of pbs that was replaced weekly for 1 , 2 , 4 , 8 or 16 weeks at 37 c . at the end of each incubation period ( 1 , 2 , 4 , 8 and 16 weeks ) , each root was aseptically transferred from its vial to a teflon beaker that was covered with sterile foil ( nalgene labware , rochester , ny , usa ) . the roots were then split in half by creating two parallel longitudinal grooves on their outer surfaces with slow - speed carborundum disks ( henan meijiasheng trading , zhengzhou , china ) , and using sterile long - handled end cutting pliers ( channellock , meadville , pa , usa ) . to prevent contamination , each sample was prefixed with a pbs solution of 2.5% glutaraldehyde and 2% paraformaldehyde ( ph 7.2 ) at 4 c overnight and washed 3 times with pbs solution ( ph 7.2 ) . for post fixation , each sample was treated with 1% osmium tetroxide for 1.5 h then washed three times with distilled water and dehydrated in graded ethyl alcohol ( 70%80%90%95%100% each for 15 min and 100% for 15 min ) . the samples were dried with hexamethyldisilazane in air overnight before coating with ion - beam sputtering . the split roots were then mounted on aluminum stubs , sputter coated with a 30 nm layer of gold and examined both longitudinally and cross - sectionally along the mta - dentin interfaces of the canals by scanning electron microscopy ( sem , model s4700 ; hitachi , tokyo , japan ) . the voltage was set to 15 kv , the type of signal used was secondary electrons , the working distance was 12 mm and the scan speed was 16 frames per 20 s. the central areas of each sample were photographed . this study was carried out under the approval of the institutional review board of seoul national university dental hospital , seoul , korea . sixty human single - rooted premolars with fully formed apices that were without root cracks or defects when viewed under a microscope ( opmi pico , carl zeiss , germany ) were collected from patients undergoing extractions for orthodontic reasons in the department of oral and maxillofacial surgery . all of the teeth were decoronated with a minitom saw ( struers , rodovre , denmark ) , and apical patency was obtained with a size # 10 stainless steel k - file ( dentsply , tulsa , ok , usa ) . the working length was determined to be 1 mm short of the apical foramen when visually inspected with a size # 10 stainless steel k - file ( dentsply , tulsa , ok , usa ) . the coronal third of the canals were flared with gates glidden burs # 24 ( komet , rock hill , sc , usa ) . the canals were then instrumented to an apical size # 50/.06 with a crown - down technique using profile 0.04 and 0.06 ni ti rotary instruments ( dentsply maillefer , ballaigues , switzerland ) , and copiously irrigated with 5.25% sodium hypochlorite and 17% ethylenediaminetetraacetic acid ( edta ) between instruments . the smear layer was removed from the canal walls by immersing the specimens for 5 min each in 17% edta ( ph 7.2 ) followed by 5.25% sodium hypochlorite within an ultrasonic bath ( elmasonic 1 ultrasonic cleaner ; camlab , cambridge , uk ) . finally they were autoclaved at 121 c for 15 min to ensure that there was no bacterial contamination , and then incubated in brain heart infusion ( bhi ) broth at 37 c for 24 h. the roots were stored at 37 c in 100% humidity until use . roots were randomly assigned to four groups that determined whether or not they would receive an inoculation and/or an mta obturation . group 1 : 10 sterile roots were filled with pbs ; group 2 : 10 inoculated roots were filled with pbs ; group 3 : 20 sterile roots were orthograde filled with orthomta pbs ; group 4 : 20 inoculated roots were orthograde filled with orthomta pbs paste . each group was further subdivided into five subgroups for the observation periods 1 , 2 , 4 , 8 and 16 weeks . enterococcus faecalis was grown overnight in bhi broth , adjusted to a turbidity of 0.5 on the mcfarland scale ( 1.510 cfuml ) and inoculated into all root canal lumens in groups 2 and 4 . all of the roots were then placed into conical tubes containing fresh bhi ( 20 ml ) that was replaced every second day , and incubated for 3 weeks at 37 c in a humidified incubator with 5% co2 ( bbd 6220 co2 incubator ; thermo fisher scientific , waltham , ma , usa ) . the purity of the cultures was confirmed by gram staining , catalase production and colony morphology on bhi blood agar . following this incubation , then , all of the canals in groups 3 and 4 were filled to their working length with orthomta cement ( biomta , seoul , korea ) . the orthomta powder was mixed with pbs ( liquid / powder=0.3 ) with a sterile plastic stick , and an mta carrier ( biomta , seoul , korea ) was used to insert mta incrementally into each canal . an orthomta ni ti compactor and hand pluggers ( biomta , seoul , korea ) were used alternatively to condense the mta increments and prevent voids . the orthomta compactor was applied with a continuous , slight pecking movement using a reduction handpiece ( 1281 ; w & h dentalwerk burmoos gmbh , burmoos , austria ) and electric motor ( tcm 3000 ; nouvag ag , goldach , switzerland ) at 60 rmin . all of the obturations were performed by a single endodontist , and radiographs were taken to ensure that the canals were adequately filled and without voids . then , the cervical 3 mm of all root canals were packed with pbs - soaked sterile cotton and sealed with intermediate restorative material ( irm ; dentsply caulk , milford , de , usa ) . finally , the roots were stored in sterile plastic vials containing 20 ml of pbs that was replaced weekly for 1 , 2 , 4 , 8 or 16 weeks at 37 c . at the end of each incubation period ( 1 , 2 , 4 , 8 and 16 weeks ) , each root was aseptically transferred from its vial to a teflon beaker that was covered with sterile foil ( nalgene labware , rochester , ny , usa ) . the roots were then split in half by creating two parallel longitudinal grooves on their outer surfaces with slow - speed carborundum disks ( henan meijiasheng trading , zhengzhou , china ) , and using sterile long - handled end cutting pliers ( channellock , meadville , pa , usa ) . to prevent contamination , each sample was prefixed with a pbs solution of 2.5% glutaraldehyde and 2% paraformaldehyde ( ph 7.2 ) at 4 c overnight and washed 3 times with pbs solution ( ph 7.2 ) . for post fixation , each sample was treated with 1% osmium tetroxide for 1.5 h then washed three times with distilled water and dehydrated in graded ethyl alcohol ( 70%80%90%95%100% each for 15 min and 100% for 15 min ) . the samples were dried with hexamethyldisilazane in air overnight before coating with ion - beam sputtering . the split roots were then mounted on aluminum stubs , sputter coated with a 30 nm layer of gold and examined both longitudinally and cross - sectionally along the mta - dentin interfaces of the canals by scanning electron microscopy ( sem , model s4700 ; hitachi , tokyo , japan ) . the voltage was set to 15 kv , the type of signal used was secondary electrons , the working distance was 12 mm and the scan speed was 16 frames per 20 s. the central areas of each sample were photographed . there were no mineral precipitates in dentinal tubules of all the non - mta filled root in groups 1 and 2 until 16-weeks ' observation period ( figure 2a and 2b ) , whereas the formation of uniform tag - like structures was generally found over entire surface at coronal ( figure 2c and 2d ) , middle ( figure 2e and 2f ) and apical ( figure 2 g and 2h ) parts of all the mta - filled root in groups 3 and 4 . in group 3 , the formation of tiny leaflet - like crystalline structures indicated a biomineralization process on the dentinal tubular surface in a 1-week specimen ( white arrows , figure 3a and 3b ) . in a 2-week sample , it was observed that the tag - like structures obstructed the entrance of dentinal tubule and the crystalline structures were formed inside the dentinal tubules ( figure 3c ) . the 4-week sample showed crystalline structures forming simultaneously on the entire surface of the dentinal tubules observed ( white arrow , figure 3d ) . after 8 weeks , the specimen showed obstruction of the dentinal tubules by newly formed crystalline structures ( white arrow , figure 3e ) . a cross - sectional sem view of a 16-week specimen showed almost complete obstruction of the dentinal tubule lumens by growth of newly formed crystalline structures ( figure 3f ) . not only dentinal tubules but also the apical foramen was shown to be obliterated with newly formed crystalline apatite structures in 4-week specimens in group 3 ( figure 3 g and 3h ) . in group 4 , the dentinal tubules harbored e. faecalis , and the distinctive crystalline structures had not yet formed in 1-week sample ( white arrow , figure 4a ) . in the 2-week sample , the needle - like crystalline structures grew along the entire wall of the dentinal tubules ( white arrows , figure 4b ) , indicating that bacterial entombment had begun in this period . a 4-week specimen showed e. faecalis entombment resulting from narrowing of the infected dentinal tubules by the formation of leaflet - like crystals ( figure 4c ) . a magnified view of the yellow rectangular area in figure 4c showed that each e. faecalis bacterium is being entombed by a growing crystalline structure ( figure 4c ) . an 8-week sample showed the almost complete obstruction of the lumen of the infected dentinal tubule by leaflet - like crystalline structures and entombed bacteria ( white arrow ) . the yellow arrows showed the sites that e. faecalis had been entombed and detached in the process of preparing the samples for sem ( figure 4e ) . the 16-week sample showed that newly formed crystalline structures appeared in tiny needle - like structures ( yellow arrow ) or as an agglomerate of leaflet - like structures ( white arrow ) in almost the whole dentinal tubule ( figure 4f ) . the crystalline structures were formed in the apical foramen area of a 12-week sample ( figure 4 g ) , which showed a small amount of needle - like crystals among the plate - like ones ( figure 4h ) . this is the first study to have shown bacterial entombment by intratubular mineralization over time following orthograde obturation with mta . the entombment of intracanal bacteria was suggested by sundqvist and figdor to be one of the main objectives of root canal obturation . however , the entombment of bacteria within the root canal space has not been achieved by with either gutta percha or resilon obturation materials . although the resin - based sealers in resilon could effectively penetrate the dentinal tubules in moist dentin , they are still susceptible to the effects of matrix metalloproteinase in the dentin matrix . in contrast , mta has been shown to resist leakage at a higher rate when placed in a moist environment such as the root canal system . furthermore , recent studies have suggested that mta - induced mineralization could be enhanced by the use of pbs . it was reported that the addition of phosphate to portland cement that has a similar composition to mta , accelerated the hydration reaction which improved the flexural strength and reduced the solubility of the set material . calcium and phosphate ions in pbs could precipitate amorphous calcium phosphate , which is a precursor of hydroxyapatite , and thereby promote carbonated apatite deposition and strengthen the mta / dentin interface . however , until now , there have not been any reports on the use of pbs as the mixing vehicle for mta , and on its capacity to stimulate intratubular mineralization . in every orthomta pbs paste - filled specimens , short tag - like structures obliterated the entrance of the dentinal tubules and long tag - like precipitates filling the dentinal tubule lumens were routinely observed . these characteristic features might decrease the nutritional supply to the intratubular bacteria , and their further growth into dentinal tubule might reduce the available space for bacterial survival and growth . the phosphorus required in intratubular crystalline growth process seems to have been supplemented from the dentinal fluid , as was reported by by camilleri et al . the depletion of intratubular phosphorus might result in the inhibition of e. faecalis because the phosphorus ion is essential to the survival of e. faecalis . this bacterial entombing mechanism under moisture condition is a unique feature of mta not previously reported in any of the other root canal filling materials . considering the superior sealing ability and physiochemical and bioactive properties of the material as well , mta appears to be a potential benefit as a root canal obturation biomaterial . the chemical profile of the crystalline precipitates formed in this study was not fully confirmed yet . a recent study speculated that intratubular crystalline precipitation induced by mta is partly related to the transformation of metastable amorphous calcium phosphate phase into an apatite phase . moreover , the plate - like crystals and needle - like crystals observed at the apical foramen ( figure 4h ) , as reported in the study of teng et al . , might possibly are octacalcium phosphates and hydroxyapatites , respectively . although its intratubular biomineralization ability , mta has some drawbacks such as irretrievability , tooth discoloration , and slow setting time as a canal obturation material . also , there are concerns regarding the possibility of bacterial ingress by the formation of voids or porosities within mta and at the mta / dentin interface after obturation or hydration . therefore , orthograde mta obturation should be carefully performed to minimize the possible formation of voids / porosities and limited in selected clinical cases until its long - term benefits and prognosis is further confirmed . under the limitation of the present study , orthograde canal obturation with orthomta pbs paste could induce amorphous tag - like structure formation and intratubular crystalline growth over time which effectively entombs the intratubular bacteria . the present study suggests the potential antibacterial effect of orthograde obturation with orthomta pbs paste in infected root canals .

the time domain entombment of bacteria by intratubular mineralization following orthograde canal obturation with mineral trioxide aggregate ( mta ) was studied by scanning electron microscopy ( sem ) . single - rooted human premolars ( n=60 ) were instrumented to an apical size # 50/0.06 using profile and treated as follows : group 1 ( n=10 ) was filled with phosphate buffered saline ( pbs ) ; group 2 ( n=10 ) was incubated with enterococcus faecalis for 3 weeks , and then filled with pbs ; group 3 ( n=20 ) was obturated orthograde with a paste of orthomta ( biomta , seoul , korea ) and pbs ; and group 4 ( n=20 ) was incubated with e. faecalis for 3 weeks and then obturated with orthomta pbs paste . following their treatments , the coronal openings were sealed with pbs - soaked cotton and intermediate restorative material ( irm ) , and the roots were then stored in pbs for 1 , 2 , 4 , 8 or 16 weeks . after each incubation period , the roots were split and their dentin / mta interfaces examined in both longitudinal and horizontal directions by sem . there appeared to be an increase in intratubular mineralization over time in the orthomta - filled roots ( groups 3 and 4 ) . furthermore , there was a gradual entombment of bacteria within the dentinal tubules in the e. faecalis inoculated mta - filled roots ( group 4 ) . therefore , the orthograde obturation of root canals with orthomta mixed with pbs may create a favorable environment for bacterial entombment by intratubular mineralization .

Introduction Materials and methods Selection and preparation of teeth Bacterial inoculation and root canal obturation Scanning electron microscopy analysis Results Discussion Conclusion

intracardiac masses are commonly encountered clinical entity and include thrombi , vegetations , tumors , inflammatory granuloma , etc . among cardiac tumors , although the definite diagnosis of a cardiac tumor can be established only after surgical resection , certain epidemiological and morphological features can help in differential diagnosis of primary cardiac tumors . myxomas are easiest to diagnose pre - operatively due to their much higher prevalence and characteristic echocardiographic appearance . however , rarely , some other cardiac tumors can present in a similar manner resulting in misdiagnosis . we hereby describe a case of a young lady who presented with a right atrial paraganglioma , an extremely rare primary cardiac tumor,1 ) masquerading as a myxoma . a 35-year - old lady presented to the hospital with atypical chest pain and exertional breathlessness for past six months . physical examination revealed a pulse rate of 90 bpm , and respiratory rate of 24 breaths / min ; other physical findings were normal . electrocardiography revealed normal sinus rhythm with t - wave inversion in leads iii and avf . transthoracic echocardiogram revealed a 1.9 2.4 cm well - circumscribed , sessile , echo - dense mass in the right atrium , attached to the interatrial septum ( fig . 1a , supplementary movie 1 ) . it showed a larger mass ( 2.4 3.7 cm ) than seen with transthoracic echocardiography ( fig . the mass was attached near the coronary sinus ostium without causing obstruction to coronary sinus flow . multiple views of the mass showed hyperechoic tissue density , except for a small area of central echolucency ( supplementary movie 2 ) . her inferior vena cava was clear . computed tomography of abdomen was also normal . although the homogeneous echodensity of the mass was suggestive of a solid tumor , a presumptive diagnosis of right atrial myxoma was made due to its characteristic location of interatrial septum , high prevalence of atrial myxomas and the patient 's clinical profile . after detailed preoperative analysis and planning , open - heart surgery for tumor resection was performed on the 3rd day of hospitalization . intraoperatively , a 2.5 3.5 cm sized , firm , encapsulated , smooth tumor was seen arising from the area between the annulus of the septal leaflet of tricuspid valve and the posterior margin of coronary sinus ostium ( fig . histopathology of the excised mass using conventional hematoxylin and eosin staining revealed homogeneous polygonal cells with moderately pleomorphic nucleoli and moderate eosinophilic cytoplasm . the patient was discharged in stable condition with no recurrence of the tumor 4 months later . myxomas are the most common primary cardiac tumors whereas paragangliomas are amongst the rarest , accounting for < 1% of all cases.1)2 ) paraganglioma is a tumor of neural crest origin and is similar to a pheochromocytoma . for this reason , paragangliomas are also known as extra - adrenal pheochromocytoma. mediastinal paragangliomas can be either intracardiac or extracardiac and arise from autonomic neural tissue in these organs . intracardiac paragangliomas have been found mostly in the left atrium and less commonly in the interatrial septum , left ventricle , anterior surface of the heart , right ventricular outflow tract , or very rarely , right atrium.3 ) to our knowledge , only few cases of right atrial paraganglioma have been described in the world medical literature so far.1)4)5)6)7)8)9 ) clinically , cardiac paragangliomas can present either with symptoms of adrenergic excess or with mass effect.4)7)9 ) mass effect depends on the location and the size of the tumor in relation to cardiac structures . thus , the patients can present with acute coronary syndrome ( compression of coronary ostium ) , heart failure ( valvular obstruction ) , syncope ( valvular obstruction , compression of great vessels ) , etc.4)5 ) rarely , these tumors may also remain completely asymptomatic . diagnosis of paragangliomas is most often established after surgical resection only as there are no specific echocardiographic features . however , in catecholamine secreting tumors , preoperative diagnosis is important because surgical resection of such tumors without prior pharmacological conditioning can lead to disastrous consequences during the immediate postoperative period . surgery can be quite challenging in these cases due to vascularity of these tumors and their proximity with vital structures . for obvious reasons , mediastinal and cardiac paragangliomas are among the most technically demanding to resect.10 ) after surgical resection , long - term follow - up is essential , as paragangliomas can recur many years after initial surgery.10 ) our patient did not have any significant mass effect due to the tumor . further , she probably had a non - secreting tumor because she was not complaining of any symptoms suggestive of catecholamine excess such as hot flush , sweating , headache or intermittent palpitation . unfortunately , as we did not suspect paraganglioma in this case , we did not check for urine and serum metanephrine levels . however , in hindsight , we realized that measurement of urine and serum catecholamines should be performed in all primary cardiac tumors , particularly when tumor presents with atypical features and the diagnosis is not readily apparent . transthoracic echocardiogram showing a large , echo - dense , sessile mass in the right atrium , attached to the interatrial septum at the level of atrioventricular junction . transesophageal echocardiogram showing a large , echo - dense , sessile mass seen attached to the interatrial septum near coronary sinus ostium .

in this report , we present a case of 35-year - old lady who had presented with atypical chest pain and exertional breathlessness for past six months . transthoracic and transesophageal echocardiograms showed a well - circumscribed , echo - dense mass in the right atrium , attached to the interatrial septum at the level of atrioventricular junction and in the vicinity of coronary sinus ostium . she underwent successful resection of the cardiac mass . histopathology revealed paraganglioma , which was reconfirmed by immunohistochemistry study . this represents an extremely rare presentation as primary cardiac tumors are 20-times less common than metastatic tumors and paraganglioma is one of the rarest primary cardiac tumors , accounting for < 1% of all cases .

Introduction Case Discussion Supplementary movie legends

the carney complex ( cnc ) is a rare dominantly inherited syndrome characterized by skin pigment abnormalities , endocrine over activity and cardiac myxomas . about 600 patients worldwide have been reported by the national institute of health ( nih ) - mayo clinic ( usa ) and the cochin centre ( france ) by january 2008 . cardiac myxomas are rare benign tumors with an estimated incidence of 0.5 - 1 per million population per year , accounting for 45% primary cardiac tumors in adults and 15% in children . recurrence is reported in sporadic ( 4%-7% ) and familial cases ( 10%-21% ) with the interval between the formation of the new tumor of more than 4 years . although well documented in the adult population , information about cerebral embolism in the pediatric population is still limited . the following case illustrates a combination of the two rare diseases clinically presenting with a cerebral stroke and an extremely rapid recurrence of the left atrial myxoma in a teenager . an athletic , dark - haired 13-year - old girl was admitted to our hospital with an acute migraine attack with vomiting , dispnoea , abdominal pain , and left - sided body weakness . anamnesis revealed frequent migraines within the previous 2 years associated with vomiting and bulbar motion abnormalities . on admission , she was somnolent , pale , with left facial nerve paresis , left - sided body weakness , hyperactive deep tendon reflexes , and positive plantar reflex . multiple hyperpygmentated skin spots and hairy forearms and thighs were also noted without visible evidence of neurofibromas . cardiac auscultatory findings , the chest x - ray and the computed tomography ( ct ) of the brain performed on admission were normal . the repeated ct scan after 12 h demonstrated a massive right - sided fronto - parietal ischemic zone [ figure 1a ] . heart ultrasound ( echo ) showed a huge left atrial mass ( 28 37 57 mm ) on a short peduncle , arising from the roof of the left atrium protruding through the mitral valve into the left ventricle [ figure 1b ] . the mass was enucleated in toto including a piece of the underlying atrial septum via the left and right atriotomy [ figure 2a , b ] . the postoperative course was uneventful and the girl was discharged to a rehabilitation centre . her postoperative cardiac echo examination on day 15 , 2 , and 4 months after surgery showed no residual tumor . she was readmitted to our hospital six months after the initial operation with severe headache , choking and speech difficulties . the cardiac echo demonstrated a new tumorous mass ( 8 10 mm ) , hanging on a long peduncle from the midportion of the interatrial septum . the finding was confirmed by nuclear magnetic resonance imaging ( nmr ) [ figure 1c ] . more attention was paid to her hypertelorism and pigmentation but no endocrine abnormalities ( thyroid and parathyroid gland , pituitary and adrenal gland ) were detected by routine imaging and laboratory investigations . the dna samples were sent to the referent centre for carney complex ( dr stratakis , national institute of health , university of washington , and seattle ) where it was confirmed protein kinase a regulatory subunit 1a mutation ( prkar1a ) , c418_419delca het in exon 4 in our patient . the genetic investigation of the family was negative , the girl obviously being a new mutation . ( c ) nuclear magnetic resonance imaging of recurrent myxoma ( a ) intraoperative view of the tumor ( b ) the enucleated myxoma her routine follow up at 1 , 3 , 6 , 12 , and 24 months showed no new cardiac masses . intracardiac tumors in the pediatric age group are rare with an incidence of 0.17% in children . myxomas account for 6% of all pediatric cardiac tumors after rhabdomyomas ( 63% ) and fibromas ( 6% ) . recurrence of the tumor has been reported with the majority of patients being reoperated more than four years after the initial surgery . carney complex is a genetic disease inherited in an autosomal dominant manner , one of the additional criteria being a myxoma ( cutaneous , cardiac , breast or bone ) . our patient with atrial myxoma had a de novo carney complex diagnosed after an extremely short recurrence period of the cardiac tumor . the carney complex associated with myxoma of various locations is being extensively studied in connection with associated genetic abnormalities . the most interesting controversy is a rather frequent recurrence of myxoma after complete resection , the fact not observed in most benign neoplasms . in spite of low incidence of the carney complex , its diagnosis is often established after several years of neurological symptoms and abnormal and clearly visible skin pigmentation . this report supports the possibility of an early recurrence of cardiac myxoma , more likely to be attributed to its underlying genetic nature , rather than incomplete surgical resection .

we report a case of an extremely early recurrence of left atrial myxoma in a 13-year - old girl . on hospital admission , the clinical presentation was of cerebral embolism with noticeable spotty skin pigmentation and hypertelorism . the left atrial myxoma originated from the roof of the left atrium . the histology specimen showed typical finding of a myxoma . six months later a new intracardial mass was evacuated , the postoperative result showing the same type of myxomatous tissue . genetic investigations demonstrated carney complex . the genetic analysis of the child 's family was negative , demonstrating de novo mutation of this rare disorder .

Introduction Materials and Methods Results Comment

privatization of public services has been mentioned as a way to solve public sector s traditional problems such as inefficiency and lack of motives among its staff ( 13 ) . hence , preference of private over public units has been raised by many theories such as agency , property - right as well as public choice ( 47 ) , although some have argued that public sector has been attacked by false assumptions ( 8) . some governments have used private sector s mechanisms in their public sector entities under the new public management ( 9 ) . health sector , as one of whom traditionally managed by governments , has also been subject to some extent of privatization as well . even nations such as the uk with longest running public health systems has shown some interests in diluting the role of the central government at their health services especially across hospitals ( 10 ) . privatization or liberalization has resulted in improved efficiency in some nations such as the usa ( 11 ) and germany ( 12 ) . although privatization may resolve inefficiency problem in the public sector , evidence suggest that sudden and mass liberalization of public sector could lead to dysfunctional consequences , as caused a massive fiscal shock across the former soviet nations after the dissolution ( 13 ) . moreover , some governments believe that privatization of health sector would mean as shirking their duty of saving and improving public health stated and supported through 1978 alma - ata and 2004 mumbai declarations ( 14 ) . based on such evidence and believes some models especially one developed by harding and preker ( 15 ) , suggest that liberalization of hospitals could be considered as a spectrum , with some intermediate steps ( fig . 1 ) . based on this model , at the first stage of privatization public facilities would be acknowledged as autonomous units , distinguished from the budgetary units by having greater freedom at financial management , recruitment and promotion of staff . harding and preker s ( 15 ) model of organizational reform towards corporatization in iran , the economy has been mainly owned and administered by the public sector . the privatization efforts were taken more seriously after 2003 , when the government was allowed to privatize or decentralize of 80 percent of the state assets according to the article 44 of the iranian constitution . based on such a general policy , the ministry of health and medical education ( mohme ) gradually started moving toward liberalization of public university owned hospitals in 2006 ( encompassing about two - third of all 900 hospitals in iran ) , with granting autonomy to 18 hospitals . then mohme asked all medical universities - which act on behalf of the mohme in each province and are responsible for delivering health care , academic education at medical sciences and monitoring public and private healthcare organizations - to announce at least one public hospital from their catchment area as autonomous , delegating them the appropriate management and autonomy in 2009 . mohme stated the goals of the reform as ( i ) continuous quality improvement ; ( ii ) productivity improvement ; ( iii ) acceleration of health services delivery and ( iv ) increase of patient satisfaction with services across hospitals ( 16 ) . in parallel , the mohme added another incentive for hospitals switched into autonomous with increasing their annual budget compared to the regular public hospitals . this extra budget was committed by the mohme and two main basic insurance organizations in iran , social security insurance organization ( ssio ) and medical services insurance organization ( msio ) . the insurance organizations committed to pay a double bill to autonomous hospitals . in addition , the mohme committed to increase the budget from 1.2 times of the bill to 1.6 . hence , altogether the budget would increase by about 64 percent for converted autonomous hospitals while patients would pay only as equal as regular public hospital charges . in response to mohme s order , the iranian medical universities all over the country announced 36 teaching hospitals to undergo the reform and convert into the board of trustees - operated or autonomous entities , which increased the total number of the autonomous hospitals to 54 . granting autonomy to hospitals would give a wider range of freedom to the hospitals . table 1 compares a regular public hospital with an autonomous one based on the autonomy and responsibilities delegated by the government to the latter . comparison of autonomous and regular public hospitals in terms of autonomy the iranian government granted them the board of trustees includes the chancellor of the affiliating medical university ( as the head of the board ) , hospital head , an expert in management recommended by the hospital head , a representative of charitable people recommended by the province s charity society , two consultants from the hospital recommended by the hospital head , a representative recommended by the provincial governor or mayor , and two members from the basic insurance organizations . these members are assigned by the chancellor for a two - year period and can be selected again . the board meetings should be held at least every 3 months with two - thirds of the members . all approved regulations by the board should be confirmed by the chancellor to be executed . although granting autonomy to the hospitals was started by the formal announcement of 54 hospitals as autonomous , the implementation of the reform encountered some obstacles . as a result , the reform did not spread to the remaining 500 university hospitals . some news warned the failure of the reform ( 17 ) and even suggested cessation of the reform due to its poor implementation and misuse of regulations ( 18 ) . very small numbers of studies have conducted on autonomous hospitals reform in iran , among which one concluded that the necessary autonomy was not transferred to the hospitals , especially at the areas of strategic management , human and physical resources management , and governance arrangement and accountability ( 19 ) . hence , this study aimed to explore the obstacles of establishing autonomous hospitals in the iranian public health sector and to figure out how the obstacles hindered the reform . we used a qualitative approach through 2013 for our study with two phases . at the first phase , we posted a questionnaire with open - ended questions to all medical universities and all 54-university hospitals that had been granted autonomy in iran . the questionnaire was developed by the authors and its validity checked through content analysis by a group of experts . the questionnaire included three questions : ( i ) if the reform had been implemented well ; ( ii ) what the obstacles were ( if any ) ; and ( iii ) how the obstacles affected the reform . the respondents were hospital heads and hospital managers ( members of the board of trustees ) , and quality improvement officer at each hospital , plus one staff from each medical university in charge of administrative issues of the reform and some other key informants at the universities . consequently , 276 paper based questionnaires were sent with a stamped empty envelope of which 202 were returned after two rounds of telephone follow up ( response rate = 73% ) . the completed questionnaires were assessed primarily for the development of themes through thematic analysis ( 20 ) . at the second phase of data collection , we contacted selected respondents from the first phase for telephone interview . the selection of interviewees was based on the nine themes developed through the first phase . for each general theme , we contacted at least three respondents who had given answers that are more comprehensive in order to obtain in - depth information . therefore 23 telephone interviews were undertaken ( some people were interviewed for more than one theme ) by one of the authors ( nm ) . most interviewees discussed other themes beside their own theme as well because the themes were generally connected . the foci of the interview questions were : ( i ) what the exact obstacle(s ) were for implementation of the reform at the levels of mohme , university or hospital ; ( ii ) when , how , and why they occurred ; ( iii ) what the impact was . all interviews were recorded after the interviewees agreement and a verbal consent was obtained and recorded at the start of each interview . the general frame of themes was developed at the first phase , so we used framework method ( 20 ) for analysis of the transcripts . nevertheless , some themes were amended . at the final stage , we contacted some interviewees , as member checking ( 21 ) , in order to make sure that the developed meanings and findings were consistent with the interviewees original meanings . all organizations and interviewees name were kept private at all stages of the study and only the researchers could access to them . the names of medical universities and interviewees were switched to codes to avoid any accidental release of identities through the study . the themes or barriers were not at a same level and some might be at a higher degree of importance and trigger other barriers , but for greater clarity , we did not merge them and reported all at a same level . we used walt and gilson s ( 22 ) framework for analysis of health sector policies which incorporates our developed themes for structuring our findings . therefore the themes , which counts as barriers , are reported under three headings of policy content , process ( generally policy implementation ) , and context . actors or stakeholders were not reported under a separate heading but discussed through the three - abovementioned headings . nevertheless , we could not avoid overlaps and some themes may seem appropriate to be listed under other headings as well . the board composition many barriers that challenged the reform were due to the regulations set at the policy content . the main problem mentioned by some respondents was related to the members of the board of trustees . this meant that the affiliating medical university would have the ultimate power at the board , so the hospital would lack real autonomy . indeed the autonomous hospitals would probably be run through the university instead of making their policies inside the hospital . this decreases motivation among other board members , as the university is still the boss . what is our autonomy then ? another concern was mohme s negligence in appointing some key members at the board . the structure lacked an expert in budgeting . as hospitals would have greater degree of financial autonomy , the board would need an expert in budgeting to handle the financial issue of the hospital . respondents believed that the board had certain members to support and lead physicians and administrative staff at hospital , but no one for nurses . mohme s delay in announcing formal charges to autonomous hospitals unclearness about the charges and physicians share from them ( fee for service ) appeared as a serious problem at the first stages of implementation of the reform . in iran , a list of charges for services is announced annually by the mohme at the start of each year , but the mohme did not announce any special list for the autonomous hospitals , but only for the regular public ones . this caused some problems in the autonomous hospitals in paying physicians share and in contracting the insurance organizations , which were supposed to reimburse the autonomous hospitals . we contacted the mohme for the list of charges but they have not developed that . we have to charge like a regular hospital and now are in problem with our physicians fee for service . lack of financing by the committed organizations as explained in the introduction , the autonomous hospitals were supposed to be benefited from higher budgets , as an incentive to work autonomously . the main insurance organizations did not pay their appointed share ( 2 times as they paid to the regular public hospitals ) . their payment to the autonomous hospitals was delayed and then just as same they paid the regular public hospitals . moreover , the mohme also could not pay its own share - 1.6 times of the bill - to the hospitals . these caused hospitals could not pay fee for to their physicians services and ask their affiliating medical universities to assist on the delayed payments , which challenged the medical universities . what a disastrous situation for the medical universities ! poor follow up for implementation of the reform the reform lacked a leading body at the mohme to follow the execution . they just asked for announcing a hospital as autonomous and then no follow up was made by the mohme . hence , if the medical universities did not wish to establish the reform at the announced hospital , no obligation forced them to proceed . we did not feel any force from their side , so everything we did was almost on the paper . indeed some key informant even mentioned that the university chancellors typically did not wish the reform proceeds because granting autonomy to hospitals could decrease the chancellors autonomy . university chancellors say if the reform proceeds and all their hospitals get autonomy then what they would have to do ! irregular board meetings and absence of members this barrier may have been resulted partly from the abovementioned factor of lack of mohme s follow up . hospitals board of trustees should meet every three months with at least two - third of their members . however , this was not the case at most hospitals and the meetings were held less frequently and with fewer members . in some provinces , due to the members absence and irregular meetings , the affiliating medical university had to hold joint meetings for all its autonomous hospitals , which questions hospitals autonomy . obviously , certain members , especially those beyond the hospitals , did not have enough motives to attend the meetings and get involved at hospitals policymaking . lack of an external overseer ; uncertainty to proceed on the reform some interviewees believed that letting hospitals have more autonomy would dilute supervision on autonomous hospitals . public hospitals are under strict supervision of the legal auditors , especially in terms of their financial issues , but for autonomous hospitals , no external overseer was appointed . this caused some hospitals make illegal decisions , so medical university chancellors get cautious about the reform implementation that slowed the reform down even more . lack of any governmental supervision on [ autonomous hospital ] boards decisions is obvious . some for example have decided to change their wards to private wards , with no insurance coverage , which ultimately limits patients access . therefore , the chancellor that would take all responsibility should be very cautious on carrying out the reform issues . they may get reluctant shortage of full - time physicians at public hospitals the autonomous hospitals were supposed to change all their physicians to the full - time state , by changing their contracts or employing new physicians as full - time . however , this proved to be impossible for hospitals in practice . first , most physicians who worked at public hospitals , especially in big cities , were simultaneously working at private sector as well , so did not like to change to full - time at public hospitals . this was caused by lack of any serious rule to prohibit physicians from dual practice and the huge difference between private and public hospitals charges that would make private hospitals payment to their physicians much more than that of the public hospitals . second , hospitals could not cease their contract with the employed physicians , because ( i ) they were not allowed legally , and ( ii ) they could not replace physicians with new ones , due to the lack of physicians who would be happy to work full - time . moreover , employing physicians at certain specialties was not possible due to shortage of physicians in some specialties at the country . therefore , the mohme s goal of changing 100 percent of hospitals physicians to full - time ones at autonomous hospitals by 2013 would be practically impossible . who is willing to work full - time at public hospitals with such a low and delayed payments . most physicians like to have their private sector activities and work only as part - time physicians at autonomous hospitals . lack of management stability at public hospitals public hospitals usually are very prone to changes at their top levels of managerial positions and this causes difficulties in the implementation of the reform . the changes happen usually after elections or after any major change at the mohme level . in the last 4 years our hospital has had 4 different heads and 3 managers . the managers are not confident enough to undergo the reform , because they do not know whether they would stay at their position . health insurance organizations delayed payments to the public hospitals health insurance organizations are traditionally very late in paying hospital bills . two main health insurance organizations usually have a delay of at least six months , which makes autonomous hospitals more vulnerable ( 23 ) . most interviewees believed that with such a delay the autonomous hospitals could not afford their heavy human resources payments and so would not survive . although all public hospitals are paid late by the insurance organizations , autonomous hospitals are more vulnerable . the board composition many barriers that challenged the reform were due to the regulations set at the policy content . the main problem mentioned by some respondents was related to the members of the board of trustees . this meant that the affiliating medical university would have the ultimate power at the board , so the hospital would lack real autonomy . indeed the autonomous hospitals would probably be run through the university instead of making their policies inside the hospital . this decreases motivation among other board members , as the university is still the boss . what is our autonomy then ? another concern was mohme s negligence in appointing some key members at the board . the structure lacked an expert in budgeting . as hospitals would have greater degree of financial autonomy , the board would need an expert in budgeting to handle the financial issue of the hospital . respondents believed that the board had certain members to support and lead physicians and administrative staff at hospital , but no one for nurses . mohme s delay in announcing formal charges to autonomous hospitals unclearness about the charges and physicians share from them ( fee for service ) appeared as a serious problem at the first stages of implementation of the reform . in iran , a list of charges for services is announced annually by the mohme at the start of each year , but the mohme did not announce any special list for the autonomous hospitals , but only for the regular public ones . this caused some problems in the autonomous hospitals in paying physicians share and in contracting the insurance organizations , which were supposed to reimburse the autonomous hospitals . we contacted the mohme for the list of charges but they have not developed that . we have to charge like a regular hospital and now are in problem with our physicians fee for service . lack of financing by the committed organizations as explained in the introduction , the autonomous hospitals were supposed to be benefited from higher budgets , as an incentive to work autonomously . the main insurance organizations did not pay their appointed share ( 2 times as they paid to the regular public hospitals ) . their payment to the autonomous hospitals was delayed and then just as same they paid the regular public hospitals . moreover , the mohme also could not pay its own share - 1.6 times of the bill - to the hospitals . these caused hospitals could not pay fee for to their physicians services and ask their affiliating medical universities to assist on the delayed payments , which challenged the medical universities . what a disastrous situation for the medical universities ! poor follow up for implementation of the reform the reform lacked a leading body at the mohme to follow the execution . they just asked for announcing a hospital as autonomous and then no follow up was made by the mohme . hence , if the medical universities did not wish to establish the reform at the announced hospital , no obligation forced them to proceed . we did not feel any force from their side , so everything we did was almost on the paper . indeed some key informant even mentioned that the university chancellors typically did not wish the reform proceeds because granting autonomy to hospitals could decrease the chancellors autonomy . university chancellors say if the reform proceeds and all their hospitals get autonomy then what they would have to do ! irregular board meetings and absence of members this barrier may have been resulted partly from the abovementioned factor of lack of mohme s follow up . hospitals board of trustees should meet every three months with at least two - third of their members . however , this was not the case at most hospitals and the meetings were held less frequently and with fewer members . in some provinces , due to the members absence and irregular meetings , the affiliating medical university had to hold joint meetings for all its autonomous hospitals , which questions hospitals autonomy . obviously , certain members , especially those beyond the hospitals , did not have enough motives to attend the meetings and get involved at hospitals policymaking . usually no one attends on behalf of the mayor or commander . they have no motives . lack of an external overseer ; uncertainty to proceed on the reform some interviewees believed that letting hospitals have more autonomy would dilute supervision on autonomous hospitals . public hospitals are under strict supervision of the legal auditors , especially in terms of their financial issues , but for autonomous hospitals , no external overseer was appointed . this caused some hospitals make illegal decisions , so medical university chancellors get cautious about the reform implementation that slowed the reform down even more . lack of any governmental supervision on [ autonomous hospital ] boards decisions is obvious . sometimes they convince the chancellor for very dramatic changes . some for example have decided to change their wards to private wards , with no insurance coverage , which ultimately limits patients access . therefore , the chancellor that would take all responsibility should be very cautious on carrying out the reform issues . shortage of full - time physicians at public hospitals the autonomous hospitals were supposed to change all their physicians to the full - time state , by changing their contracts or employing new physicians as full - time . however , this proved to be impossible for hospitals in practice . first , most physicians who worked at public hospitals , especially in big cities , were simultaneously working at private sector as well , so did not like to change to full - time at public hospitals . this was caused by lack of any serious rule to prohibit physicians from dual practice and the huge difference between private and public hospitals charges that would make private hospitals payment to their physicians much more than that of the public hospitals . second , hospitals could not cease their contract with the employed physicians , because ( i ) they were not allowed legally , and ( ii ) they could not replace physicians with new ones , due to the lack of physicians who would be happy to work full - time . moreover , employing physicians at certain specialties was not possible due to shortage of physicians in some specialties at the country . therefore , the mohme s goal of changing 100 percent of hospitals physicians to full - time ones at autonomous hospitals by 2013 would be practically impossible . who is willing to work full - time at public hospitals with such a low and delayed payments . most physicians like to have their private sector activities and work only as part - time physicians at autonomous hospitals lack of management stability at public hospitals public hospitals usually are very prone to changes at their top levels of managerial positions and this causes difficulties in the implementation of the reform . the changes happen usually after elections or after any major change at the mohme level . in the last 4 years our hospital has had 4 different heads and 3 managers . the managers are not confident enough to undergo the reform , because they do not know whether they would stay at their position . health insurance organizations delayed payments to the public hospitals health insurance organizations are traditionally very late in paying hospital bills . two main health insurance organizations usually have a delay of at least six months , which makes autonomous hospitals more vulnerable ( 23 ) . most interviewees believed that with such a delay the autonomous hospitals could not afford their heavy human resources payments and so would not survive . although all public hospitals are paid late by the insurance organizations , autonomous hospitals are more vulnerable . in this qualitative study , we explored the obstacles that the iranian health system encountered through liberalization of the public university owned hospitals . the findings showed different obstacles , categorized in three general headings of policy content , policymaking process ( policy implementation ) and the context . as a serious obstacle categorized under policy content , composition of the autonomous hospitals board role of the university chancellor as the head of the board would mean that the autonomous hospitals could have no real freedom and their policies would be imposed by the affiliating university and the mohme ultimately . this shows the central state s concerns over the first stages of liberalization and its cautious policy in delegating responsibilities to the local health sectors . similar pattern has been seen even among developed nations such as the uk where foundation trusts , as autonomous entities , were indeed controlled by primary care trusts that could dictate the central government s priorities ( 24 ) . nevertheless , the whole reform was not exhausted in the uk ( 25 ) and most developed nations such as germany ( 12 ) . although one may argue that the chancellor is only one of the members and he / she would not necessarily impose the university s policies on the hospital board , sensitivity to the fact that the chancellor is the head and has the ultimate power would decrease inspiration among hospital - based members . moreover , chancellors concern about decrease of their authority and power probably has slowed down the process of accomplishment of the reform . furthermore , the university would not charge a 5% overhead cost from autonomous hospitals , which again counts as a competing incentive against the reform . therefore , there might be some degree of veiled resistance against the reform at the iranian medical universities and even the ministry level . although resistance against liberalization of public hospitals is not unprecedented even among less - centralized health systems such as germany s due to the nature of health that should not be treated such as a commodity ( 26 ) , the resistance in iran was due to a different reason ; losing power among some authorities . at the implementation stage , the reform encountered various barriers that made the establishment of real autonomous hospitals almost impossible in iran . this was probably because the ministry knew that it could not afford autonomous hospitals bills ( 27 ) , and/or the insurance organizations had warned the mohme they could not afford the costs , although they had agreed the reform . hence , the charges were announced late and then neither the mohme nor the insurance organizations paid hospitals the amounts they had guaranteed to pay . the mohme could pay just partially and the insurance organizations paid the autonomous hospitals just as same as regular public hospitals . we had no finding about why the insurance organizations did not pay their committed payments to autonomous hospitals while they had agreed this in advance , but a possible explanation could be that the basic insurance organizations had experienced many changes after signing the agreement and their heads did not and could not pay what their predecessors had committed . moreover , it is possible that the negotiations between the mohme and insurance organizations had conducted only at their supreme levels , not tailored first among their experts and middle level managers . the delayed or reduced funding when governments decentralize their facilities and delegate some authority has been reported in similar reforms such as the indonesian health sector reform ( 28 ) . poor follow up from the mohme part was obvious and so the medical universities did not take the implementation serious . we did not examine directly why this was not taken serious by asking direct questions , because we could not access the mohme s top managers . however , our other findings might answer this ; the mohme could not afford higher costs of the autonomous hospitals at least at short term . therefore hospital boards would not have enough motives to hold their meetings regularly due to lack of receiving committed budgets form the mohme and insurance organizations . moreover the board s head , the university chancellor , was reluctant to lead the reform because the reform would limit his / her power , both in terms of managerial authority and financial , due to missing a 5% university share of hospitals revenue . moreover , lack of any external overseer and certain ambiguities in rules and regulations would make the chancellor very cautious in implementation of the reform because he / she would have to take all the responsibilities for the consequences . lack of any regulation against physicians mobility between public and private hospitals and physicians natural and traditional interest in working at both sectors hindered the reform . the public sector s safety and private income would shape a model of dual practice that is obvious in the iranian health sector although it could be seen across many other nations ( 29 ) . therefore , hospitals could not change all their clinicians into full - time ones as the reform required . moreover , at some rare specialties changing physicians to full - time would not be appropriate as this can limit patients access . lack of managerial stability at most public organizations in iran , seen at hospitals as well , was the other contextual barrier , which slowed down the reform . most managers were not sure if they could establish the reform at their hospitals during their mission at hospitals and so did not proceed on reforms . even where the autonomous hospitals reform was starting to proceed , it restarted after new managers came . lack of managerial stability through insurance organizations , discussed earlier , also would probably have obstructed working of the reform , by delayed and decreased payments to the hospitals . our first phase of study included all iranian medical universities and all autonomous hospitals , to catch their views on obstacles and barriers of the reform . by this comprehensive sample , we potentially have all barriers and experiences of the reform across all possible locations with their specific context . nevertheless , we could not interview the mohme authorities who knew policy issues at the highest level of the health sector . the findings had some similarities and differences with those of at different countries where the world bank s autonomy hospitals reform was established . in pakistan , the reform was proved very political and not straightforward ( 30 ) . it was run generally based on the donors will rather than the government s own , while in iran no external will obstructed the reform . in pakistan , street bureaucrats as was in iran where insurance organizations , university chancellors and physicians did this . in south - east asia , the reform has proceeded in philippines , indonesia and vietnam but no significant transformation at their public stewardship has occurred ( 31 ) , and the reform could not improve efficiency and quality of care ( 32 ) . in iran , no study has examined the impact of the reform on hospitals clinical indicators . the story was a bit different where the autonomous hospitals were implemented at developed countries . foundation trusts are good example of successful liberalization of public hospitals in order to increase business - like practices ( 25 ) . liberalization of public hospitals , especially in the settings with a dominant public sector , would be a political reform rather than just a managerial delegation . we saw that the iranian reform was not supported very well by the mohme as the main policy - maker and its introducer . the mohme should have taken into account all its capacities and thought about all necessary tools , such as lobbying the key stakeholders or establishing necessary regulations ( say for dual practice ) , and then decide to implement the reform , or at the other case , cease it totally . the iranian health insurance organizations as the key stakeholders and the most influential bodies in financing the autonomous hospitals did not stand on their commitment , probably because the mohme s initial agreement with them was poor and could not satisfy their benefits . more detail policy formulation issues , such as revising the board structure , should have been approved by all direct and indirect stakeholders . in iran , the board should not be dominated by the affiliating university , but by the local authorities and the hospital if the reform is really going to be implemented . instead the reform was agreed by the mohme and insurance organizations , however when it was the insurance organizations turn to pay the hospitals based on the agreed amount , they denied their commitment . the reasons behind such behavior are not clear for us and so could be investigated through further research . our first phase of study included all iranian medical universities and all autonomous hospitals , to catch their views on obstacles and barriers of the reform . by this comprehensive sample , we potentially have all barriers and experiences of the reform across all possible locations with their specific context . nevertheless , we could not interview the mohme authorities who knew policy issues at the highest level of the health sector . the findings had some similarities and differences with those of at different countries where the world bank s autonomy hospitals reform was established . in pakistan , it was run generally based on the donors will rather than the government s own , while in iran no external will obstructed the reform . in pakistan , also the reform was altered or obstructed by street bureaucrats as was in iran where insurance organizations , university chancellors and physicians did this . in south - east asia , the reform has proceeded in philippines , indonesia and vietnam but no significant transformation at their public stewardship has occurred ( 31 ) , and the reform could not improve efficiency and quality of care ( 32 ) . in iran , no study has examined the impact of the reform on hospitals clinical indicators . the story was a bit different where the autonomous hospitals were implemented at developed countries . uk s foundation trusts are good example of successful liberalization of public hospitals in order to increase business - like practices ( 25 ) . liberalization of public hospitals , especially in the settings with a dominant public sector , would be a political reform rather than just a managerial delegation . we saw that the iranian reform was not supported very well by the mohme as the main policy - maker and its introducer . the mohme should have taken into account all its capacities and thought about all necessary tools , such as lobbying the key stakeholders or establishing necessary regulations ( say for dual practice ) , and then decide to implement the reform , or at the other case , cease it totally . the iranian health insurance organizations as the key stakeholders and the most influential bodies in financing the autonomous hospitals did not stand on their commitment , probably because the mohme s initial agreement with them was poor and could not satisfy their benefits . more detail policy formulation issues , such as revising the board structure , should have been approved by all direct and indirect stakeholders . in iran , the board should not be dominated by the affiliating university , but by the local authorities and the hospital if the reform is really going to be implemented . instead the reform was agreed by the mohme and insurance organizations , however when it was the insurance organizations turn to pay the hospitals based on the agreed amount , they denied their commitment . the reasons behind such behavior are not clear for us and so could be investigated through further research . the findings had some similarities and differences with those of at different countries where the world bank s autonomy hospitals reform was established . in pakistan , the reform was proved very political and not straightforward ( 30 ) . it was run generally based on the donors will rather than the government s own , while in iran no external will obstructed the reform . in pakistan , also the reform was altered or obstructed by street bureaucrats as was in iran where insurance organizations , university chancellors and physicians did this . in south - east asia , the reform has proceeded in philippines , indonesia and vietnam but no significant transformation at their public stewardship has occurred ( 31 ) , and the reform could not improve efficiency and quality of care ( 32 ) . in iran , no study has examined the impact of the reform on hospitals clinical indicators . the story was a bit different where the autonomous hospitals were implemented at developed countries . uk s foundation trusts are good example of successful liberalization of public hospitals in order to increase business - like practices ( 25 ) . liberalization of public hospitals , especially in the settings with a dominant public sector , would be a political reform rather than just a managerial delegation . we saw that the iranian reform was not supported very well by the mohme as the main policy - maker and its introducer . the mohme should have taken into account all its capacities and thought about all necessary tools , such as lobbying the key stakeholders or establishing necessary regulations ( say for dual practice ) , and then decide to implement the reform , or at the other case , cease it totally . the iranian health insurance organizations as the key stakeholders and the most influential bodies in financing the autonomous hospitals did not stand on their commitment , probably because the mohme s initial agreement with them was poor and could not satisfy their benefits . more detail policy formulation issues , such as revising the board structure , should have been approved by all direct and indirect stakeholders . in iran , the board should not be dominated by the affiliating university , but by the local authorities and the hospital if the reform is really going to be implemented . instead the reform was agreed by the mohme and insurance organizations , however when it was the insurance organizations turn to pay the hospitals based on the agreed amount , they denied their commitment . the reasons behind such behavior are not clear for us and so could be investigated through further research . the iranian autonomous hospitals reform , as a major public sector liberalization attempts , was challenged by different factors such as poor policy formulation where the potential stakeholders interest were not met . even the policymakers at the top levels of the mohme and the key stake - holders seem to have reached no consensus on the implementation and have moved back from their commitments . therefore , the medical universities and hospitals were struggled at execution of the reform . all our findings bring us to this conclusion that the stages of policy formulation and policy implementation were performed separately in iran and were not thought simultaneously and in common with those who formulate a policy and those who have to implement and execute it . in addition , the contextual factors , such as prevalent dual practice among physicians , were not considered by the policy makers in order to alter the policy accordingly . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .

background : liberalization and decentralization of public sector has been triggered in some developing countries and in iran by the ministry of health and medical education ( mohme ) that granted autonomy to 54 public hospitals . however , establishment of such a complex organizational reform was rather unsuccessful . we aimed to explore the obstacles and barriers caused such a failure and their mechanisms.methods:using a qualitative approach in 2013 , we consulted key informants at the autonomous hospitals and their affiliating universities . data collection was done within two phases : ( i ) 276 unstructured questionnaires asking respondents of barriers , and ( ii ) 23 semi - structured interviews from the first phase s key respondents . the first phase data were analyzed using thematic analysis and the second s by framework approach based on the frame shaped at the first phase.results:nine obstacles were recognized including autonomous hospitals board composition , delay in announcing autonomous hospitals charges by the mohme , lack of financing by the committed organizations , poor follow up for implementation of the reform , irregular board meetings , lack of an external overseer , shortage of full - time physicians , lack of management stability , and health insurance organizations delayed payments.conclusion:the mohme and insurance organizations did not pay the reform expenses . there were some competing motives as well to slow the reform or to shut it down . the stages of policy formulation and implementation were done separately in iran , so this big organizational reform encountered serious obstacles .

Introduction Materials & Methods Results Policy Content Process (Policy implementation) Context (Iranian health Sector inherent problems) Discussion Strengths/Limitations Comparison with other reforms Policy and research implications Conclusion Ethical considerations

siamese twins are joined by a part of their body at birth and the causes of the merger are often unknown . two cases of siamese twins in connection with taking clomiphene and two with griseofulvin have been reported . the thoraco - omphalopagus are attached at the chest and abdomen ( 74% of the cases ) , pygopagus are joined at the buttocks ( 18% of cases ) , ischiopagus are attached at ischions ( 6% of the cases ) , and craniopagus at the level of the head ( 2% of cases ) . the first case reported was that of deslonchamps , in 1851 , cited by taruffi c 1882 and schwalbe in 1907 . more recently a meta - analysis of 1200 cases of merged twins reported another case . the other rachipagus ( 21 cases ) of this series of 1200 cases are rather defined as rachipagus parasite . we present two additional cases of parasite rachipagus on the chest and lumbar levels at the national hospital of niamey , niger . a three - month - old male infant with a superrnumerary ( extra ) leg attached to the lumbar region was admitted in the neurosurgery services of the niamey national hospital , niger . this boy was from a consanguineous marriage , after a pregnancy of eight months , and he was delivered per vaginum . the mother was 17 years old and a history of twin pregnancy was reported in the father 's family . the infant had a good general condition , and the weight and height were normal . the back outgrowth looked to be a limb attached to the lower lumbar region with a proximal lipoma . this limb did not move spontaneously or after stimulation , but the child cried when the parasite was pinched . there was an appendix located in the upper part of the junction area resembling the male sex organ . radiographs of the parasite limb and the spine of the child showed the bone structures of the femur , tibia , and fibula , with a junction area at l3-l4 . the posterior arch was absent from l2 to l5 , with a duplication or agenesis of the posterior articular . the parasitic limb was excised at the base of which an extradural lipoma and a voluminous meningocele were found . the intra - dural content included a neural plate and normal roots with a single spinal cord . excision of the lipoma , repair of the meningocele , and musculofascial reconstruction were easy , and the postoperative follow - up has been uneventful . autopsy dissection of the parasite showed a dysmorphic ischium merged to the femur by a rudimentary capsule . lower extremity attached to the lumbar region before surgery lower extremity removed at surgery same patient as figure 1 , immediately after excision this was a male infant born of a consanguineous marriage after eight months of pregnancy . he presented with a double outline of the upper limb grafted in the inter - scapular region in the midline . there was no spontaneous motor reflex in the parasite limb , but only a sensation of pain . these bones were dysmorphic and merged to the dorsal spine , with spina bifida from t5 to t8 . the bony part of each parasite corresponded , at the spine merger , to the autosite articular bones . anatomical dissection of the parasite showed structures reminiscent of the scapula bone , humerus , radius , and ulna . a three - month - old male infant with a superrnumerary ( extra ) leg attached to the lumbar region was admitted in the neurosurgery services of the niamey national hospital , niger . this boy was from a consanguineous marriage , after a pregnancy of eight months , and he was delivered per vaginum . the mother was 17 years old and a history of twin pregnancy was reported in the father 's family . the infant had a good general condition , and the weight and height were normal . the back outgrowth looked to be a limb attached to the lower lumbar region with a proximal lipoma . this limb did not move spontaneously or after stimulation , but the child cried when the parasite was pinched . there was an appendix located in the upper part of the junction area resembling the male sex organ . radiographs of the parasite limb and the spine of the child showed the bone structures of the femur , tibia , and fibula , with a junction area at l3-l4 . the posterior arch was absent from l2 to l5 , with a duplication or agenesis of the posterior articular . the parasitic limb was excised at the base of which an extradural lipoma and a voluminous meningocele were found . the intra - dural content included a neural plate and normal roots with a single spinal cord . excision of the lipoma , repair of the meningocele , and musculofascial reconstruction were easy , and the postoperative follow - up has been uneventful . autopsy dissection of the parasite showed a dysmorphic ischium merged to the femur by a rudimentary capsule . lower extremity attached to the lumbar region before surgery lower extremity removed at surgery same patient as figure 1 , immediately after excision this was a male infant born of a consanguineous marriage after eight months of pregnancy . he presented with a double outline of the upper limb grafted in the inter - scapular region in the midline . there was no spontaneous motor reflex in the parasite limb , but only a sensation of pain . these bones were dysmorphic and merged to the dorsal spine , with spina bifida from t5 to t8 . the bony part of each parasite corresponded , at the spine merger , to the autosite articular bones . anatomical dissection of the parasite showed structures reminiscent of the scapula bone , humerus , radius , and ulna . no glandular tissue or other neural tube structures were found at the histological examination . the follow - up ( one year ) was uneventful . siamese twins occur in cases of twin pregnancies of the mono chorionic , mono amniotic type . they owe their name to chang and eng bunker ( 1811 - 1874 ) , who were merged twins , from siam . literature has reported few cases of rachipagus and parasite rachipagus.[36 ] the parasite follows the disappearance of one of the embryos with survival of certain additional structures attached to the normal embryo near or at the junction area . the two cases in this series are boys from consanguineous marriages with a family history of twin pregnancies . these cases were rachipagus parasite with the autosite healthy , without associated anomalies or neurological disorders . in one case the parasite was at the lower lumbar position and in the second case at the upper thoracic position . it is not uncommon to find sensory or motor innervations of the autosite . in both cases we report that there was no spontaneous movement of the parasites , but the autosite was sensitive to painful parasite stimulation . the mechanism that leads to fusion of the twins begins very early in embryonic life , at d6 , post fertilization at the blastocyst stage . rachipagus merger would ocur at the stage of the neural groove , before the closure of the neural tube , at specific areas called ectodermic depressions . embryologic events during this period may form a single or double spinal canal with one or two spinal cords . for spencer , fusion alone does not explain the embryogenesis of rachipagus . this is because during the dissection , the parasite contains abnormal anatomical structures and because neural groove fusion alone will only lead to a union of bones of the vertebral arches of the two embryos , with a unique spinal channel . it is the mechanism of division - diversion - reunion , which explains the presence of two spinal cords and two vertebral columns in some malformations . the existence of a single channel containing a single spinal cord in both cases of this study supports the hypothesis of the fusion theory as the mechanism of occurrence of rachipagus . bones of the limbs are frequently present . more rarely heart and neural tube structures can be found in the parasite . in some lumbar parasites , the glandular tissue , intestine or anal orifice can be observed . limbs are most frequently found in rachipagus parasites than in teratomas or in the fetus in fetus . this means that there is a thin line between these pathological entities.[810 ] in some cases a simple surgical resection of the parasite gives satisfactory results for autosites . rachipagus is a rare embryogenic malformation with a good prognosis on the autosite in the absence of associated congenital anomalies .

we present two cases of rachipagus in two male infants and review the literature on this anomaly . these infants were from consanguineous marriages and cases of twins were reported in their families . in the first case it was a limb attached to the lower lumbar region with a rudimentary posterior arch . at the junction there was a lipomeningocele . anatomical dissection of the limb identified the bones of the lower limb . in the second case , the parasites were joints of the upper limb that were attached to the chest by rudimentary posterior arches . in both cases there was only one spinal canal and a single spinal cord . except the spina bifida in the first case no other malformation was diagnosed . the parasites were successfully excised . the two patients are well at one year of follow - up . rachipagus is a rare embryogenic malformation with a good prognosis in the absence of associated congenital anomalies .

INTRODUCTION CASE REPORTS Case 1: [Figures Case 2: [ DISCUSSION CONCLUSION

uk patients with vl are often referred to the hospital for tropical diseases , london , for confirmation of diagnosis or treatment . thirty - nine patients were identified from our hospital database and laboratory records , representing 83% of cases reported in the united kingdom ( figure 1 ) . number of visceral leishmaniasis ( vl ) cases , united kingdom , 1985 - 2004 ( data from health protection agency).(data from health protection agency ) . the mean age of these patients was 36 years ( range 266 years ) ; 4 patients were < 15 years of age . patients acquired visceral leishmaniasis while in the following areas : 30 ( 76.9% ) in mediterranean countries ( 13 in spain , 9 in italy , 4 in greece , 3 in malta , 1 in cyprus ) , 5 ( 12.8% ) from africa , 3 ( 7.7% ) from asia , and 1 ( 2.6% ) from south america . during the entire 20-year period , 55.5% of patients had been tourists to these vl - endemic regions , and 44.5% were immigrants or refugees , but after 2000 , all patients were tourists . two patients had significant immunosuppression from other causes : 1 from chronic lymphatic leukemia and 1 from immunosuppressive drugs received after kidney transplantation . time from onset of symptoms to diagnosis was 111 months ( mean 3 months ) . diagnoses of vl were confirmed by > 1 method : microscopic identification of amastigotes in tissue aspirates ; histologic examination of biopsy material from bone marrow , liver , or spleen ; serologic analysis ; and pcr for leishmania dna ( 7 ) . leishmania amastigotes were found in 32 bone marrow aspirates , 3 liver biopsy specimens , 2 splenic aspirates , and 1 skin biopsy specimen . pcr to detect leishmania dna has been performed in this study since 1995 and was positive in 7 of 11 cases . it was the method of confirmatory diagnosis for 1 patient ( performed on a bone marrow aspirate that had no visible amastigotes ) . serum analysis for leishmania antibodies was performed on samples from 33 patients ; results were positive for all hiv - negative patients and for 2 of 13 hiv - positive patients ( table 1 ) . * vl , visceral leishmaniasis ; ifat , indirect immunofluorescent antibody test , 19851994 ; dat , direct antibody agglutination test ( beginning in 1989 ) ; latex , latex agglutination test , 19962003 ; k39 , recombinant k39 antigen detection test ( beginning in 2002 ) ; + , positive result ; , negative result . before 1995 , treatment of leishmaniasis involved several drugs , including sodium stibogluconate , paromomycin , meglumine antimoniate , and pentamidine . the latter 2 were used for patients who received initial treatment outside the united kingdom ; within the united kingdom , most ( 59% ) patients were treated with sodium stibogluconate . after 1995 , liposomal amphotericin became the drug of choice and was used in 14 ( 83% ) of 17 patients . of the 13 patients who had a relapse , 8 ( 53% ) had hiv coinfection . of the 13 who had hiv coinfection , 8 ( 62% ) had a relapse , compared with 7 ( 27% ) of the 26 hiv - negative patients who had a relapse . two patients had other risk factors for relapse : 1 had had a kidney transplant , and the other had chronic active hepatitis b. three patients who had relapses had no apparent risk factors . relapse occurred in 5 ( 33% ) of 15 patients who received sodium stibogluconate , compared with 1 ( 7% ) of 14 who received liposomal amphotericin as their initial drug . at first , relapsed patients were treated with a combination of sodium stibogluconate and allopurinol , which was unsuccessful in contrast with its reported success in kenya , or with amphotericin deoxycholate ( 8) . hiv - infected patients who had relapses received further treatment with liposomal amphotericin , usually successful , but 2 became unresponsive to treatment . miltefosine was used in 2 patients with hiv coinfection who had relapses , but relapses recurred , 1 while the patient was still receiving the drug ( 9 ) . since 2000 , pentamidine prophylaxis has been used in 3 immunocompromised patients . na stibo , stibogluconate ; meg , meglumine antimoniate ; paro , paromomycin ; pent , pentamidine ; amb , ambisome ; amp , amphotericin . the number of patients in the final cure category excludes patients who had had a relapse . the 3 patients who died had advanced hiv disease ; 1 had an additional complication of liver failure secondary to hepatitis c cirrhosis . the data from this cohort show that vl is imported into the united kingdom at a constant rate , particularly in adult male tourists to the mediterranean , and that during the past 20 years , hiv and vl had interacted strikingly . the mediterranean vl - endemic zone accounts for only a small proportion of vl cases globally , but it is a popular holiday destination for the british , and tourism is driving the epidemiology of the imported infection . in the past 5 years , we have seen no immigrants or refugees with vl . the data show that high rates of tourism to an area of low endemicity for a parasitic disease can result in a substantial number of imported cases . the highest rates of reported hiv coinfection worldwide are from europe , where 85% of the cases are from the southwest ; 71% of these are in intravenous drug users ( 2 ) . hiv / vl coinfection is a serious disease that has high death rates , reflected by the 3 deaths in our cohort . highly active antiretroviral therapy for hiv is decreasing the numbers of these coinfections and improving survival rates ( 10,11 ) . this delay resulted mainly from physicians failure to consider the diagnosis , although a few cases were difficult to diagnose . for 2 patients , initial microscopic examination of bone marrow biopsy results did not show amastigotes ; reinspection showed scarce amastigotes . for another patient , serologic results by direct agglutination were negative when performed early in the course of disease but positive when repeated . the low sensitivity of serologic tests for hiv - infected patients in this cohort confirms that serologic tests can not be relied on as a means of excluding vl in hiv - infected patients . our cohort shows a rise and fall in the proportion of cases of hiv / vl coinfection , starting in the early 1990s , rising to a peak of 50% during 19931996 , and then decreasing , possibly because of greater use of highly active antiretroviral therapy . vl remains an imported disease in the united kingdom and is often associated with hiv infection . we suggest that a formal notification system for visceral leishmaniasis in the united kingdom , as elsewhere in europe , would be beneficial for monitoring trends and health planning ( 12 ) . our data also show the importance of looking at rare imported diseases over a long period so that emerging risk factors can be identified . these data also highlight the usefulness of having 1 center that deals with unusual infections , where expertise in diagnosis and management can be built up and maintained .

a 20-year ( 19852004 ) retrospective review of 39 patients with imported visceral leishmaniasis found that tourism to mediterranean countries and hiv infection were associated with visceral leishmaniasis . diagnosis was often delayed . treatment with liposomal amphotericin b has improved prognosis . visceral leishmaniasis should be made a reportable disease .

The Study Conclusions

the main goal of periodontal treatment is to control the inflammation in periodontal tissues and to regenerate the lost tissues predictably . to meet this goal guided tissue regeneration is an accepted method for enhancement of lost periodontal tissue . in this technique a barrier membrane is used to prevent epithelial cell migration and stabilization of the clot into the defect . this prevention results in the migration of periodontal ligament cells and osteoblasts into defect and these cells are known to be responsible for tissue regeneration . different types of barrier membranes are introduced that had shown favorable results due to different studies . these membranes are different in composition and structure , but all of them prevent the migration of epithelial and gingival connective tissue cells into the defect and ideally , a barrier membrane should enhance the cell attachment and migration of the progenitor cells . wound healing is a complex process which includes cell migration , cell attachment to various extracellular matrix components , and cell proliferation . cell attachment process is a four - step sequence which includes adsorption of glycoproteins to the substrate surface , cell contact , attachment , and spreading . tissue integration property ensures the stabilization of the wound and inhibits the migration of epithelial cells , which results in better gain of clinical attachment levels . according to their degradation characteristics , barrier membranes are divided into two groups of resorbable and non - resorbable membranes . it facilitates hemostasis and wound stability by promotion of platelet aggregation along with fibroblast migration which accelerates wound closure , but collagenous membranes are not stiff enough to resist soft tissue pressure during healing . although their biocompatibility and positive effect on bone regeneration was shown , but a second surgery is required for their removal which may traumatize the newly formed immature periodontal tissue and causes patient discomfort and increases the treatment time and cost . also , the membrane stiffness may result in tissue dehiscence which is the main reason of treatment failure 3 weeks after membrane placement and exposes the membrane which leads to bacterial infection and decrease in the levels of gained clinical attachment . an alternative to an expanded ptfe membrane is a high - density polytetrafluroethylene ( d - ptfe ) membrane which is commercially available as txt-200 and gbr-200 . high - density polytetrafluroethylene membranes have small porosities , so bacterial contamination is eliminated and therefore there is no need of primary closure when they are being used and they can be left exposed to the oral cavity . the acellular dermal matrix ( alloderm ) was originally introduced in medicine for reconstructive plastic surgeries but is also used in dentistry in various periodontal procedures like root coverage and keratinized tissue augmentation around teeth and implants . it has many advantages , but the absence of cells and vessels makes tissue incorporation slower , therefore , attempts of culturing fibroblasts on alloderm were performed to achieve early wound healing and decrease wound contraction in periodontium . it has been shown that the key factor in the success of regenerative treatment is the recruitment or delivery of cells to the defect site and the production of suitable extracellular matrix along with the periodontal tissues . introduction of specific cell adhesion molecules to the membrane surfaces may lead to specific tissue responses . different growth factors and proteins have been introduced and one of them is enamel matrix derivatives . a commercially available product of enamel matrix derivatives is called emdogain ( emd ) . it is an acidic extract of low molecular weight procine enamel proteins mainly amelogenin and a propylene glycol alginate vehicle . different studies showed that emd enhances the adhesion , proliferation , and matrix production of periodontal ligament fibroblasts , stimulates cell growth , and production of insulin growth factor-1 and transforming growth factor-1 in periodontal ligament cells although it has no appreciable effect on osteoblastic differentiation and has no effect on epithelial cells . all of the described characteristics of emd make it a suitable functional material for regenerative treatments . therefore , its effects on cell adhesion to different materials were investigated in the present study . there was also no available study that had compared the fibroblast adhesion among txt-200 , gbr-200 , alloderm , and collagenous membrane ( rtm collagen , cytoplast ) or the effect of emd on fibroblast attachment to these common barrier membranes . the present study was performed to compare cell adhesion among the prementioned membranes and also to investigate the effect of emd on gingival fibroblast attachment . for this experimental in vitro study , gingival fibroblast cells ( ncbi codece c165 ) were provided by pasteur institute of iran . cells were cultured in a culture flask and cultured in the presence of dulbecco 's modified eagle medium ( dmem , sigma - aldrich , st . louis , mo , usa ) containing 10% fetal calf serum and 100 g / ml of penicillin , streptomycin , and amphotericin b. the flask was kept in 37c in a 5% co2 atmosphere in an incubator with humidity . ( gbr1224 , lot : 2541 ) ( cytoplast , osteogenic biomedical , lubbock , tx , usa ) , txt-200 ( txt1224 , lot : 3688 ) ( cytoplast ) , rtm collagen ( rtm2030 , lot : c2030263 ) ( cytoplast ) and acellular dermal matrix ( adm , 302111 , lot : b42234 ) ( alloderm , biohorizons , birmingham , al , usa ) . each membrane was cut into two 66-mm pieces and washed with sterile saline solution according to the supplier 's instructions . in rtm collagen and adm groups , four groups were used for membranes ( each group containing four wells for each membrane ) . all of the membranes were adapted at the bottom of the selected group of wells . no membrane was added to the fifth group and it served as a control group to check the growth of seeded cells . 10 g / ml of emd ( lot : c2822 , emdogain , straumann , malm , sweden ) was added to two wells of each group ( emd+ ) and two wells were left without any emd ( emd- ) . plate was placed in a 37c incubator with humidity and 5% co2 atmosphere for 24 hours . the growth of seeded cells in the fifth group was evaluated by means of a light microscope . then cells were washed four times with phosphate buffer saline ( pbs ) to remove non - adherent cells . the membranes were fixed in 2.5% glutaraldehyde for 2 hours , washed five times with distilled water for 20 minutes , treated with 1% osmium tetroxide for 1 hour , washed again five times with distilled water for 20 minutes and finally dehydrated through a series of graded ethanol solutions and left for 24 hours in room temperature to dry . to finish the process , they were coated with gold and analyzed with field emission scanning electron microscope ( hittachi s4160 , stanford , ca , usa ) . each membrane was divided into four intellectual parts under sem with 300 magnifications and one image was taken from each part . another two observers totally unaware of the experiment counted the cells on each image and if there was a difference , the least cell count was recorded . data was analyzed by independent t - test , one - way anova , two - way anova , and post hoc lsd test with spss18 ( version 18;spss inc , chicago , il , usa ) . p < 0.05 in independent t - test analysis and p < 0.001 in one - way anova , two - way anova , and post hoc lsd analysis was considered statistically significant . figures 14 illustrates the membranes in emd- and emd+ groups under sem with 300 magnifications and table 1 shows the gained data after cell counting process by two observes . sem illustration of gbr-200 membrane , a- emd- group , b- emd+ group sem illustration of txt-200 membrane , a- emd- group , b- emd+ group sem illustration of rtm collagen membrane , a- emd- group , b- emd+ group sem illustration of adm , a- emd- group , b- emd+ group the mean of attached cells to membranes in emd+ and emd- groups figure 5 shows the mean of attached gingival fibroblasts to the barrier membranes used in this study in emd+ and emd- groups . mean of attached cells to membranes in emd+ and emd- groups two - way anova test showed the membrane type ( p < 0.001 ) and the presence of emdogain ( p = 0.04 ) affect the gingival fibroblast adhesion efficacy . the quality of cell adhesion to each membrane in emd+ and emd- groups was evaluated by independent t - test and it was shown that cell adhesion in gbr-200 was slightly higher in emd- group , but this difference was not statistically significant ( p = 0.060 ) . on the other hand , cell adhesion to txt-200 membrane was higher in emd- group and the difference was statistically significant ( p = 0.020 ) . cell adhesion to rtm collagen showed no significant difference between emd+ and emd- groups ( p = 0.310 ) . unlike other membranes , adm showed higher cell adhesion efficacy in emd+ group and the difference was statistically significant ( p = 0.004 ) . mean of attached cells in emd+ and emd- groups to the studied membranes one - way anova also showed that adm has the highest cell adhesion capacity in emd+ group and the difference was statistically significant ( p < 0.001 ) . it was also shown that in emd- group gingival fibroblasts adhesion to txt-200 and adm is statistically significantly higher in comparison to gbr-200 and rtm collagen ( p < 0.001 ) . post hoc lsd test was used to compare membranes two by two . as it is shown in figure 3 , this test revealed when emd is present , cell adhesion to adm is higher than gbr-200 ( p < 0.001 ) , txt-200 ( p < 0.001 ) , and rtm collagen ( p < 0.001 ) . this test also showed when emd is not present , cells significantly adhere to txt-200 more than rtm collagen ( p < 0.001 ) and gbr-200 ( p < 0.001 ) . also when emd was not present , cell adhesion to txt-200 was slightly higher than adm , but it was not statistically significant ( p = 0.156 ) . tissue engineering represents very exciting advances in regenerative medicine ; however , periodontal literature only contains few reports . it has many advantages , but the absence of cells and vessels makes tissue incorporation slower . in an attempt to solve this problem , fibroblasts were cultured on alloderm as an alternative to achieve early wound healing and decrease wound contraction in periodontium . in this study , the highest cell efficacy in all of the studied groups belonged to txt-200 in absence of emd followed by adm in the presence of emd and then adm in the absence of emd . when emd was not present , gbr-200 had slightly higher cell adhesion in comparison to the presence of emd , but this difference was not significant ( p = 0.060 ) . same happened to txt-200 , but the difference was significant ( p = 0.02 ) . cell adhesion to rtm collagen was slightly higher when emd was present but the difference was not significant in comparison to the absence of emd ( p = 0.310 ) . the difference in the cell adhesion efficacy when emd is present can be related to its mitogenic properties . observed that 0.1 - 50 g / ml of emd promotes cell migration in the wound healing process and it is inhibited at 100 g / ml . also , in other studies it was reported that the emd with the concentration of 25 g / ml and lower leads to better results , so in the present study the concentration of emd was considered 10 g / ml for the emd+ groups . hoang et al . had shown that under physiologically relevant conditions , amelogenin ( the main composition of emd ) does not bind to collagen . van der pauw et al . declared that with collagen as a substratum , emd has an inhibitory influence on periodontal ligament cells attachment and spreading . these conflicting results may be due to the higher concentration of emd ( 500 g / ml ) which was used by these authors . in the present study , cell adhesion to rtm collagenmembrane showed no significant difference in emd+ and emd- groups which was similar to some of the mentioned studies . adm which has a collagenous composition showed higher cell adhesion efficacy in the presence of emd . study but the concentration of emd which was used in the present study ( 10 g / ml ) was different form theirs ( 500 g / ml ) . it can be concluded that adm , per se has a good cell adhesion efficacy . it is derived from human skin and is prepared by a controlled process that removes epidermis and the cells from the dermis but leaves the basement membrane and extracellular matrix organization and collagen and elastin fibers undamaged . although rtm collagen is a collagenous membrane , but similarity of adm structure to human skin may be the reason of its better cell adhesion efficacy in comparison with rtm collagen . in emd- groups , txt-200 showed statistically higher cell adhesion in comparison to gbr-200 ( p < 0.001 ) but in the presence of emd this difference was not significant ( p = 0.118 ) . although their composition is the same and they are both made of dense polytetrafluoroethylene , but their surface texture is different . txt-200 has a roughened surface that is caused by the presence of macro - porosities on its surface but gbr-200 lacks these porosities [ figures 1 and 2 ] . it seems that emd may cover the porosities of txt-200and decrease the cell adhesion efficacy of this material . these results show that surface texture and material structure play an important role on the cell adhesion efficacy . cell adhesion affects the tissue integrity efficacy of biomaterials and higher tissue integrity efficacy results in better gain of clinical attachment levels . within the limits of the present study , it is shown that the membranes used in this study affect cell adhesion , proliferation and differentiation of gingival fibroblasts . also , emd may lower the cell adhesion efficacy of gbr-200 , txt-200 , and rtm collagen but it can promote this efficacy in adm . when membranes are used without emd , txt-200 shows the highest cell adhesion efficacy followed by adm without a statistically significant difference . this study also showed not only composition of biomaterials , but also their surface texture and internal structures may play an important role in their cell adhesion efficacy .

background : tissue engineering represents very exciting advances in regenerative medicine ; however , periodontal literature only contains few reports . emdogain ( emd ) consists of functional molecules that have shown many advantages in regenerative treatments . this study investigated emd effect on gingival fibroblast adhesion to different membranes.materials and methods : two dense polytetrafluoroethylene membranes ( gbr-200 , txt-200 ) , alloderm and a collagenous membrane ( rtm collagen ) were used in this experimental study . each membrane was cut into four pieces and placed at the bottom of a well in a 48-well plate . 10 g / ml of emd was added to two wells of each group . two wells were left emd free . gingival fibroblasts were seeded to all the wells . cell adhesion was evaluated by means of a field emission scanning electron microscope after 24 hours incubation . data was analyzed by independent t - test , one - way and two - way anova and post hoc lsd test . p < 0.05 in independent t - test analysis and p < 0.001 in one - way anova , two - way anova and post hoc lsd analysis was considered statistically significant.results:alloderm had the highest cell adhesion capacity in emd+ group and the difference was statistically significant ( p < 0.001 ) . in emd- group , cell adhesion to txt-200 and alloderm was significantly higher than gbr-200 and collagenous membrane ( p < 0.001).conclusion : this study showed that emd may decrease the cell adhesion efficacy of gbr-200 , txt-200 and collagenous membrane but it can promote this efficacy in alloderm . it also showed the composition of biomaterials , their surface textures and internal structures can play an important role in their cell adhesion efficacy .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION

a 43-year - old man , impacted in his chest by a car accident , complained of severe chest pain in his anterior chest wall with palpable sternal instability . computed tomography ( ct ) of the chest showed a displaced compound mid - body sternal fracture ( fig . 1 ) . troubled with fracture of several cervical bones accompanied by sternal fracture , he was scheduled for open sternal fixation 3 days after the trauma because of combined operation with spine surgery . open reduction and internal fixation of the sternum was performed using the sternalock system ( biomet microfixation inc . , after a midline longitudinal incision over the sternum , the fracture site was carefully debrided of any fibrous union and old hematoma to expose healthy bone . before plate fixation , manual reduction of the sternal fracture was assisted by the use of bone reduction forceps placed within the surrounding intercostal spaces . three 4-holed straight plates were used vertically and horizontally due to compound sternal fracture ( fig . 2 ) , manually contoured to the underlying sternum , and secured using self - drilling , self - tapping screws . the screw length was 10 mm , which was chosen by the thickness of the sternum ( as measured on chest ct ) at each point of screw placement . the patient was not discharged because he was receiving rehabilitation treatment for his leg , which had been paralyzed due to the cervical spine trauma . the 3-month follow - up demonstrated normal wound healing with no complaints of symptoms associated with instability . sternal fractures are common after severe chest wall trauma . more than 95% of sternal fractures are treated conservatively , and there are few reports on the late sequelae or evolution of such fractures . surgery is a viable option when severely displaced fractures of the sternum entail physical deformity and prolonged pain . the rationale for surgical repair in our case was evident physical deformity associated with a relatively young age , uncontrolled pain , and combined surgery for cervical spine fractures . open reduction and stainless steel wiring has been the mainstay of treatment . however , the advantage of this technique is only that it is less expensive than plating . this technique takes advantage of the non - rigid nature of the wires , and the potential for wire pull - through can result in secondary sternal fractures or sternal nonunion . moreover , this technique is barely suitable for compound sternal fractures , which are not stabilized by the non - rigid wire . more rigid fixation using a plate and screw system minimizes these risks . in our case sternal plating systems , such as the sternalock system we used , incorporate a thinner cuttable section that spans the fracture line and can be easily divided using common wire cutters . in contrast with other plating systems , the strongest point of sternalock uses self - drilling and self - tapping screws , eliminating the need for drilling and reducing the chance of injury to mediastinal structures . therefore , sternalock may enable more secure reductions . in summary , we report the successful treatment of traumatic compound sternal fracture with open reduction and rigid internal fixation using the sternalock plating system .

a 43-year - old man experienced chest trauma due to a car accident . compound sternal fractures with severe dislocation were seen on computed tomography of the chest . using a sternalock plating system with manual reduction , fixation of the sternal fracture was successfully performed . there were no complications related to the operation .

CASE REPORT DISCUSSION

monomethylmercury ( mmhg ) is a toxic and bioaccumulative organometallic compound that poses serious health risks to both humans and wildlife . humans are primarily exposed to mmhg via the consumption of marine fish and shellfish , with over 90% of marine fisheries products originating from estuarine and open ocean areas . many estuarine organisms currently contain elevated mmhg levels , which can cause health problems in humans , but there is considerable uncertainty concerning the relative importance of the sources and exposure pathways of mmhg to estuarine food webs . sediments have long been suggested as the dominant mmhg source to estuarine food webs . estuarine sediments act as an important sink for hg , receiving hg via atmospheric deposition , industrial runoff and riverine input , and provide geochemical conditions that promote biotic methylation . past studies have also reported strong linkages between total hg ( thg ) concentrations in sediments and thg in estuarine forage fish in san francisco bay . in contrast , chen et al . recently documented a strong positive association between pelagic forage fish ( fundulus heteroclittus and menidia menidia ) mmhg concentrations and water column particulate mmhg concentrations , but not with sediments , across multiple estuaries on the northeast coast , u.s . based on this observation , the authors suggested that the mmhg accumulated into water column particulates may be a more dominant mmhg source to pelagic organisms than sediment mmhg . monomethylmercury can enter the water column via diffusion , advection and resuspension from sediments . inflowing fluvial and tidal waters have been suggested as important external mmhg sources to pelagic food webs in the bay of fundy and the hudson river estuary , with coastal sediments being a less important source . at chesapeake bay and long island sound , both sediments and external sources were found to be important mmhg sources to these systems . given these diverse sources , tools that can differentiate mmhg sources and exposure pathways are expected to help highlight the most important biogeochemical processes affecting mmhg in estuarine food webs . studies of the natural abundance of hg isotopes have enhanced understanding of the sources and biogeochemical processing of hg in natural environments . mercury isotopes undergo mass - dependent fractionation ( mdf , reported as hg ) and mass - independent fractionation ( mif , reported as hg and hg ) . while mdf has been documented in various environmentally relevant reactions such as biotic methylation , demethylation , thiol ligand exchange and photochemical reactions , mif in natural systems is thought to occur primarily in odd - mass number isotopes via photochemical reduction and degradation of inorganic hg ( ihg ) and mmhg . recently , hg has been applied as a biological and ecological tracer for understanding processes such as bioaccumulation and trophic transfer as well as transfers of mmhg between ecosystems . the ratio of hg/hg has also become a valuable tool for distinguishing between photochemical reduction of ihg ( hg/hg = 1.00 ) and degradation of mmhg ( hg/hg = 1.21.4 ) . mercury isotope ratios have recently been used to provide insight into the sources and exposure pathways of mmhg to diverse marine food webs . based on these studies , we can make predictions as to how hg isotope ratios might be useful for understanding the sources and biogeochemical processing of mmhg in estuaries . for instance , high positive hg values have been documented in pelagic fish ( > 1 ) compared to coastal fish ( < 1 ) , indicating that mmhg that has been subjected to extensive photochemical degradation in the open ocean water column is the dominant mmhg source to pelagic food webs . in shallow coastal environments it has been suggested that mmhg produced in the sediment , that has undergone relatively little photochemical degradation , enters the base of the food web . in another relevant study , gehrke et al . documented relatively low hg values ( < 1 ) in intertidal forage fish ( i.e. , topsmelt and silverside ) that feed on epibenthic invertebrates across the san francisco bay estuary . fish hg values were found to be consistently higher by 0.6 compared to nearby sediments at multiple sites , which led to the conclusion that the fractionation imparted during production and degradation pathways of mmhg in the sediment or during trophic transfer was responsible for these hg offsets . fish feeding experiments , have now documented an absence of hg isotope fractionation during trophic transfer of mmhg to fish , and therefore the isotopic offset is thought to provide insight into the biogeochemical pathways of mmhg prior to introduction to the food web . we also expect that the isotopic offset between fish and sediments may differ between sites that vary in hg biogeochemical cycling , as well as between different feeding guilds among estuarine organisms . in this study , we investigated the sources and exposure pathways of mmhg in food webs from five estuaries located across the northeastern coast of the u.s . sediments and organisms from these sites have been previously studied for ihg and mmhg concentrations by chen et al . is one of the most productive marine ecosystems in the world and supports valuable commercial and recreational fisheries . in the last century , this area has become severely impacted by an increase in population , industrial activity , and emission of anthropogenic pollutants including hg . here we characterize the hg isotopic compositions of estuarine sediments across sites on the northeast coast to identify hg sources in these regions . the sources and exposure pathways of mmhg were evaluated across food webs consisting of epibenthose ( green crab ; carcinus maenas , killifish ; fundulus heteroclittus ) , filter feeders ( blue mussel ; mytilus edulis , ribbed mussels ; geukensia demissa ) , and consumers ( common eider ; somateria mollissima ) . we determined the hg isotopic composition of the estuarine organisms and estimated the isotopic composition of mmhg to identify the dominant mmhg source and exposure pathway to the estuarine food webs . the mmhg isotopic compositions were compared across sites and between feeding guilds ( i.e. , groups of species that exploit the same resources ) to assess potential spatial and ecological variability in mmhg sources . to our knowledge , this is the first attempt to use hg isotope ratios to compare mmhg sources to varying marine feeding guilds across multiple ecosystems . ( maine ; me , massachusetts ; ma , rhode island , ri ; connecticut , ct , new jersey ; nj ) in the summers of 2008 and 2010 ( supporting information ( si ) figure s1 ) . all sites were adjacent to coastal marsh habitats except for bold point , ri ( bold ) , which was located in an unvegetated area of the providence river estuary . the webhannet estuary in wells , me ( wells ) and buzzards bay , ma ( buzz ) are characterized by sandy beaches and are sparsely populated . both sites receive primarily atmospherically deposited hg from nonpoint sources and the inputs are relatively small compared to the other northeast coast sites . bold is situated in urbanized providence , ri , and receives some atmospheric point source hg from local waste incinerators ( 10% of the total hg budget ) . bold is impacted by local wastewater treatment facilities ( 21% of hg input ) and industrially impacted rivers ( 69% of hg input ) . barn island , ct ( barn ) is located in the southeastern tip of connecticut and also receives hg via local wastewater treatment facilities and industrially impacted rivers the connecticut river ( 59% of hg input ) and the east river ( 25% of hg input ) . mill creek , nj ( mill ) is impacted by the hackensack river , which has been heavily contaminated by landfills , and a hg recovery plant that discharged 30400 tons of hg including elemental hg , mercuric oxide , and other forms of oxidized hg byproducts during its operation between 1929 and 1974 . the estuarine sediments were measured for thg and mmhg concentrations at the university of connecticut department of marine sciences and were reported previously ( n = 9 ) . four types of biota were analyzed for this study : green crabs ( carcinus maenas ) ( n = 6 ) , blue mussels ( mytilus edulis ) ( n = 5 ) or ribbed mussels ( geukensia demissa ) ( n = 2 ) , killifish ( fundulus heteroclittus ) ( n = 9 ) , and eider ( somateria mollissima ) ( n = 5 ) ( referred to as crab , mussel , fish , and bird hereafter ) . the methods for sampling and processing of the sediments and aquatic biota are described in chen et al . the aquatic biota were measured for stable nitrogen and carbon isotopic composition at the stable isotope laboratory , dartmouth college to characterize the trophic positions and feeding guilds . thg and mmhg analyses were conducted for most samples at the trace element analysis laboratory , dartmouth college . additional samples of mussels ( n = 4 ) and crabs ( n = 3 ) were measured for thg concentrations at the university of michigan . these samples were freeze - dried prior to removing the shells , and homogenized in a zirconium grinding mill ( retsch , mixer mill mm 301 ) . the mussels and crabs were measured for thg using atomic absorption spectroscopy ( aas ) following combustion of samples at 800 c using a nippon instruments ma-2000 hg analyzer . standard reference material nist-3133 was used to generate calibration curves and for quality control . standard reference material tort-3 ( n = 4 ) was analyzed as an external standard and agreed within 5% of certified values . samples of bird blood were collected near wells and buzz between january and april 2010 ( si figure s1 ) . the birds were captured using floating mist nets and the blood samples were collected by following the standard tissue collection protocol described in evers et al . the blood samples were drawn nonlethally by venipuncture from either the cutaneous ulnar or tarsal vein using needles and syringes . the samples were sealed on both ends with critocaps , placed in 10 cc plastic vacutainers , and frozen at 25 c prior to the analyses for thg concentrations at the wildlife mercury research lab at the biodiversity research institute , maine , u.s . the thg concentrations were determined using a direct hg analyzer ( dma 80 , milestone incorporated ) . the standard reference materials dolt-4 and dorm-4 were used to generate calibration curves and for quality control . dolt-4 ( n = 5 ) and dorm-3 ( n = 5 ) were analyzed with samples and agreed within 10% of certified values . the thg concentrations of sediments and aquatic biota are reported in dry weight and the aquatic biota represent whole body tissues . the sediment and biota samples were measured for stable hg isotopic composition at the university of michigan . blood samples were thawed and oven - dried at 5060 c in acid washed ceramic boats . samples of aquatic biota were weighed and loaded into ceramic boats with sodium carbonate and aluminum oxide powders . offline two - stage combustion furnace systems were used to release hg ( as hg ) from the samples . the ceramic boats were loaded into the first combustion compartment and heated to 750 c over a 6-h period . released hg was directed to the second combustion compartment ( 1000 c ) via a stream of hg - free oxygen and subsequently oxidized in a trap solution ( 1% kmno4 in 10% trace metal grade h2so4 ) . the solutions containing hg were neutralized with hydroxylamine , reduced back to hg with sncl2 and purged into a new trap solution to remove combustion product matrix components from the sample . procedural blanks were prepared in the same manner as the samples ( but with no sample placed in the ceramic boat ) and measured for thg before and after the transfer steps . the procedural blanks had an average thg of 0.2 0.1 ng ( n = 6 ) . the thg concentrations of the samples as well as the standard reference materials erm ce 464 ( n = 3 ) , tort-2 ( n = 1 ) , and mess-3 ( n = 2 ) were measured before and after the transfer step to monitor the recoveries of thg during the combustion and transfer processes . the recoveries of the combustion and transfer steps of the samples and standard reference materials ranged between 89100% , and 92106% , respectively . stable hg isotope ratios were measured using a nu instruments multicollector inductively coupled plasma mass spectrometer ( mc - icp - ms ) . the trap solutions were neutralized using hydroxylamine . to match the thg concentration of the sample to the standard , the trap solutions containing the sample were diluted to between 1 and 5 ng / g using the same neutralized trap solution matrix . mercury was introduced to the mc - icp - ms as hg by reducing hg in solution with sncl2 , and separating hg using a frosted glass tip phase separator . on - peak instrumental mass bias was corrected using an internal tl standard ( nist srm 997 ) and by bracketing each sample with nist srm 3133 matched to sample thg concentrations and matrix composition . mdf is reported as hg in permil ( ) referenced to nist srm 3133:1 mif represents the difference between the measured hg value and the value predicted based on mdf and the hg value . the calculation is based on an approximation valid for < 10:23 analytical uncertainty at 2 sd is estimated based on either replicate analysis of a standard solution ( um - almden ) or replicate analyses of standard reference materials . we used erm ce 464 to report analytical uncertainty since it had a larger uncertainty . um - almden ( n = 30 ) had mean values ( 2 sd ) of hg = 0.57 0.06 , hg = 0.04 0.04 , and hg = 0.02 0.05 . standard reference material erm ce 464 ( n = 3 ) had mean values of hg = 0.66 0.08 , hg = 1.91 0.06 , and hg = 2.31 0.09 ; tort-2 ( n = 1 ) had values of hg = 0.10 , hg = 0.57 , and hg = 0.79 ; and mess-3 ( n = 2 ) had mean values of hg = 1.81 0.08 , hg = 0.05 0.05 , and hg = 0.01 0.03 . the thg concentrations of the northeast coast sediments are quite low at buzz ( 5.70 ng / g ) and wells ( 9.43 ng / g ) and higher at the other three sites ( barn , bold , mill ) ( 42.0 to 2961 ng / g ) ( si table s1 ) . due to the low thg values at the buzz and wells sites ( typical of uncontaminated sites ) , we designate wells and buzz as background sites and due to the relatively higher values at bold , barn , and mill we designate them as contaminated sites . the contaminated sites are associated with hg point sources ( see site description ) and have at least 6 times higher thg concentration compared to the background sites . overall , the sediments displayed ranges of hg values between 0.89 and 0.38 , and hg values between 0.04 and 0.19 , and were within the range of values reported previously in other coastal marine sediments . we plotted 1/thg concentration against hg and hg to linearize mixing relationships and to characterize the hg isotopic compositions of the sediments in relation to the hg contamination . we observed a weak negative ( r = 0.26 , p = 0.16 ) and significant positive ( r = 0.77 , p < 0.05 ) relationship between 1/thg concentration and hg and hg , respectively ( figure 1 ) . the hg values of the sediments were distinct between the background and contaminated sites with the contaminated sediments exhibiting uniform hg 0 , and slightly elevated hg in the background sediments . the sediments displayed ranges of negative hg values and were less well correlated with the sediment thg concentrations . plot of 1/thg concentration ( ng / g ) versus hg and hg values of the northeast coast estuary sediments . each site is represented with different colors ; buzz ( black ) , wells ( blue ) , barn ( green ) , bold ( orange ) , and mill ( red ) . the fact that the hg values of the northeast coast sediments are correlated with the thg concentrations suggests that these sediments reflect inputs from multiple hg sources associated with the northeast coast estuaries . when we compared the background sediments to the contaminated sediments , the sites designated as background displayed negative hg values with hg values that were distinctly positive compared to the contaminated sediments . coastal and marine sediments from other studies that were characterized as background , or those that are preanthropogenic in age , display low thg concentrations , negative hg and slightly elevated hg . the background sediments from this study are consistent with the hg and hg values reported in those previous studies . the positive hg values in the background sediments are likely the result of fractionation caused during partial photochemical reduction of ihg , which may occur either through deposition of photochemically reduced ihg from surface water , periodic exposure of surface sediments to sunlight during tidal fluctuation of water levels ( 12 m ) , or deposition of photochemically reduced ihg from rainwater . photochemical reduction of ihg has been used to explain the positive hg values documented in shallow and relatively undisturbed marshes ( 0.66 ) and coastal and intertidal sediments ( 0.08 ) and we suggest that positive hg values may be imparted in background sediments that lack significant inputs from anthropogenic hg sources . in the contaminated sediments , we observed similar ranges of negative hg values but uniform hg 0 , reflecting the dominance of anthropogenic hg sources in these sediments . various industrial hg sources have been characterized by wide ranges of negative hg and zero hg values , and the input of industrial hg sources likely explains the low hg values , high thg concentrations , and wide ranges in hg values observed in the contaminated sediments . the range of hg values for the contaminated sites that are impacted by local industrial hg sources ( barn , bold ; 0.60 to 0.82 ) were also consistent with values for hg used in gold mining in the san francisco bay estuary ( 0.59 to 0.78 ) . thus , the hg isotopic compositions and the thg concentrations of the sediments appear to be consistent with the presence of multiple anthropogenic hg sources in these regions . the thg concentrations of the estuarine biota increase in the order : crabs ( 55.3 24 ng / g ) < fish ( 138 188 ng / g ) < mussels ( 145 52 ng / g ) < bird blood ( 863 724 ng / g ) ( si table s1 ) . the fraction of thg that is in the form of mmhg ( referred to as % mmhg hereafter ) for the aquatic biota increases in the order : mussels ( 57.9 4.5% ) < crabs ( 83.7 3.0% ) < fish ( 91.4 5.9% ) and these values follow the same order as n values ( 7.4 1.0 , 10.3 3.0 , 11.3 3.2 ; si table s1 ) , representing the approximate trophic position . the increasing % mmhg with trophic position ( n ) is consistent with the pattern of mmhg biomagnification documented in many aquatic food webs . we designate the feeding guilds of the estuarine biota based on the c values and the detailed feeding behaviors are shown in si table s1 and chen et al . the n ( 13.2 ) and c ( 17.4 ) values for the birds ( si table s1 ) were estimated from hobson et al . who measured the same species in the arctic . this estimate was adequate for approximating the relative trophic position and feeding guild of these birds , which suggests a slightly higher trophic position compared to the fish measured in this study . across the northeast coast estuarine study sites , we observed wide ranges of hg values but relatively narrow ranges of hg values in the estuarine biota ( si table s1 ) . at each study site the hg and hg values of the estuarine biota displayed an increasing trend with trophic position following the order mussels , crabs , fish , and birds ( figure 2a , b ) . similar trends have previously been attributed to the varying extent of mmhg bioaccumulation with trophic position . we plotted % mmhg against hg and hg of the sediment and aquatic biota ( without the birds ) and observed significant positive relationships with hg ( p < 0.05 ) across all sites ; ( wells ; r = 0.86 , buzz ; r = 0.70 , bold ; r = 0.72 , barn ; r = 0.89 ) and of hg at all sites except bold ; ( wells ; r = 0.68 , p < 0.05 , buzz ; r = 0.71 , p < 0.05 , bold ; r = 0.52 , p = 0.08 , barn ; r = 0.80 , p < 0.05 ) . due to the significant positive relationships observed at most sites , the hg isotopic composition reflecting the bioaccumulated mmhg was estimated using a linear regression of % mmhg against hg and hg . the hg and hg values estimated for mmhg demonstrated relatively narrow ranges across the northeast coast estuarine food webs ; 0.22 to 0.28 and 0.39 to 1.00 , respectively ( figure 2a , b ) . at sites where birds were measured ( in close proximity to wells and buzz ) , the birds ( containing > 98% mmhg ) had similar hg but much higher hg compared to the fish ( containing > 90% mmhg ) measured at the same locations ( bird hg ; 0.59 to 1.39 , fish hg ; 0.34 to 0.23 ) . at bold plot of % mmhg versus hg ( a ) and hg values ( b ) of estuarine sediments and biota . each site is represented by a different color ; buzz ( black ) , wells ( blue ) , barn ( green ) , bold ( orange ) , and mill ( red ) . the solid lines represent the range of estimated mmhg isotopic composition needed to explain sediments , crabs , and fish . the dotted lines represent the range of estimated mmhg isotopic composition needed to explain mussels from bold and birds from buzz and wells . the estimated mmhg and estimated ihg represent the ranges of hg isotopic composition extrapolated for 100% mmhg and 100% ihg , respectively , based on the linear regression of % mmhg vs hg and hg . overall , we find strong evidence for an increasing trend in the hg and hg values of estuarine biota with % mmhg ( trophic position ) in the northeast coast estuarine food webs . this trend has also been documented in other aquatic food webs . while metabolic fractionation was previously proposed as a potential mechanism , recent fish feeding experiments showed that metabolic fractionation does not occur during trophic transfer to fish . instead , the differences in hg isotopic composition between mmhg and ihg and the varying extent of mmhg versus ihg bioaccumulation with trophic position provide a consistent explanation for the hg isotopic composition variability in food webs . thus , the absence of mdf and mif during mmhg trophic transfer implies that the estuarine biota mainly reflect the isotopic composition of mmhg incorporated at the base of the food web . the anomalously high hg values observed in the wells and buzz birds and the bold mussels suggest that these organisms may be accumulating mmhg from an additional source . below we assess the dominant mmhg source and exposure pathways in the northeast coast estuarine food webs using the hg isotopic composition estimated for mmhg and provide an explanation for the hg values found in the birds and the bold mussels . the northeast coast estuarine biota analyzed in this study collectively displayed moderately positive hg values ( 0.21.0 ) ( si table s1 ) . this suggests that the bioaccumulated mmhg was subjected to photochemical degradation prior to incorporation into the estuarine food web . in fish , which have consistently high % mmhg and for which we have isotope data at each site , we found lower hg in the contaminated sites ( 0.56 0.15 ) compared to the uncontaminated sites ( 0.90 0.06 ) . this indicates that the fish at the contaminated sites are either exposed to mmhg that was subjected to a lesser degree of photochemical degradation compared to those found at the uncontaminated sites or mmhg originated from anthropogenic ihg sources which have low hg ( 0 ) . the slope of hg/ hg has been used to distinguish between photochemical degradation and reduction of mmhg versus ihg in natural aquatic ecosystems . we plotted hg against hg for all estuarine biota , and used a york regression to estimate the slope of hg/ hg , which is 1.22 0.07 ( r = 0.90 , p < 0.05 ) . this slope is consistent with the slopes reported in other marine fish ( 1.2 ) exposed to photochemically degraded mmhg from their respective environments . on a hg versus hg diagram we plot values for sediments and biota and the experimentally derived slopes representing the expected changes in the mmhg isotopic composition caused by photochemical degradation of mmhg ( hg = 4.79 0.33 hg at 10 mg / l doc ) ( figure 3 ; dotted lines ) . these slopes are derived from previously published mmhg photochemical degradation experiments that employed aquatic solutions spiked with mmhg and doc , and natural sunlight , and are only rough estimates since experimental conditions were different from those in the natural setting we studied . based on values for fish , we estimate that mmhg is photochemically degraded to varying degrees ranging from 5 to 12% across the northeast coast sites prior to entering the food webs . each site is represented with different colors ; buzz ( black ) , wells ( blue ) , barn ( green ) , bold ( orange ) , and mill ( red ) . the hg values for mmhg prior to photochemical degradation were estimated following the approach of gehrke et al . and sherman and blum and were all higher than the corresponding hg values of thg measured in the sediments ( figure 3 ) . given that the sediment is mainly composed of ihg , we suggest that mmhg that is bioaccumulated is mass dependently fractionated compared to the ihg in the sediment . this has been observed in previous studies and has been attributed to the net effect of microbial hg methylation and demethylation , which has increased hg values prior to photochemical degradation . the degree of the offset in hg between the mmhg ( before photodegradation ) and ihg are somewhat variable across the sites but generally consistent with previous studies . an alternate explanation for this offset in hg between ihg and mmhg is that it is caused by introduction of mmhg from a different source than the local sediment , which has higher hg ( e.g. , methylation in upstream marshes ) . the proportion of mmhg photochemical degradation estimated here is comparable with many shallow coastal regions and high turbidity lakes , but much lower than open ocean environments . the simplest explanation for the source of the mmhg to which estuarine biota are exposed is that it is derived from the ihg in sediments and has subsequently undergone small amounts of photochemical degradation in the water column , perhaps becoming attached to particles and subsequently redeposited to the sediment . in a study of fish and sediment in the gulf of mexico it was observed that the hg isotopic composition of coastal fish was consistent with exposure to sediment - derived mmhg that had undergone small amounts of photochemical degradation , whereas open ocean fish had much higher hg values indicative of much higher degrees of photodegradation . day et al . also found ranges of hg values in the eggs of epipelagic seabirds with the individuals feeding near shallow coastal embayments displaying significantly lower hg values compared to those feeding on open ocean species . the positive offsets in hg between ihg ( in sediment ) and mmhg ( in biota ) are consistent with previous studies suggesting that the local sediments may be the primary site for mmhg production prior to photochemical degradation in the water column and bioaccumulation in the food webs . it has been shown that microbial methylation causes the fractionation of hg , leading to lower hg in the product - mmhg compared to the reactant . a portion of hg that has been methylated could subsequently be microbially demethylated , resulting in higher hg values in the remaining mmhg , and the net effect of these processes provides an explanation for the hg values in the sediments . large positive offsets in hg have been documented in estuarine sediments , and to a lesser extent in rocky streambeds where mmhg production in sediments is less likely to occur . the site - specific variation in the offsets in hg suggests that the relative degree of fractionation due to microbial methylation versus demethylation differs across the northeast coast study sites . recently documented variable methylation rates in sediment across the northeast coast estuarine sites . while our results are consistent with the previous findings that suggested sediments as the primary site for mmhg production , it is possible that mmhg derived from various external sources may also play an important role in the northeast coast estuarine food webs . methylmercury produced within wetlands and river watersheds have been shown to supply significant amounts of mmhg to aquatic ecosystems in the northeast u.s . chen et al . recently documented a lack of relationship between mmhg concentrations in sediments and in the water column across the same sites of the northeast coast estuaries that we studied and suggested that sediments may be a minor contributor to mmhg found in water column . given that the mmhg flux via sedimentation exceeds that due to resuspension at our study sites , it is possible that external mmhg sources deposited in the sediment via settling particles may provide a viable alternative explanation for the observed offsets in hg between ihg ( sediment ) and the bioaccumulated mmhg . it is difficult to make a clear differentiation between in situ mass dependent fractionation of sediment - produced mmhg versus mixing of external mmhg sources in this study . further investigation will be required to characterize the isotopic composition of various external mmhg sources and biogeochemical processes affecting mmhg production in sediments . in summary , our results are consistent with either the production of mmhg from ihg in sediments or derivation of mmhg externally with deposition to the sediments . this mmhg is then subjected to a small amount of photodegradation in the water column before entering the food web and being passed to the various organisms at the study sites ( with one exception described below ) . the use of hg isotope ratios in this study provides additional insight into the sources and exposure pathways of mmhg studied by chen et al . in the same northeast coast estuarine food webs . chen et al . documented a strong positive association between pelagic fish ( silverside , killifish ) mmhg concentrations and water column particulate mmhg concentrations , but not with sediment mmhg concentrations . mussels and crabs did not show significant correlations with sediment and water column concentrations of mmhg . based on these observations , it was suggested that while sediments may be the main repository for hg , sediment mmhg concentrations are not an accurate predictor for mmhg bioaccumulation in estuarine biota . the authors also argued that the mmhg exposure via the water column may be the result of either complex interactions between water and sediment mmhg or input of external mmhg sources from offshore . given that the estuarine biota studied demonstrate different feeding behaviors and variable mmhg uptake routes , the consistent mmhg isotopic composition observed in various feeding guilds from each study location suggest that there may be extensive mmhg cycling between the sediment and water column via deposition and resuspension cycles without significant changes in the hg isotopic compositions of the mmhg . in other words , even if the fish derive mmhg primarily from the water column , the mmhg in the water column may be isotopically similar to the small proportion of mmhg in the sediments . while it appears that most aquatic organisms in this study acquire sediment - associated mmhg via trophic transfer , the high positive hg values found in the wells and buzz birds and the bold mussels suggest that these organisms are exposed to a different ( or additional ) mmhg source that has considerably higher hg values ( figure 2 ) . considering the mussels first , the main difference between the bold mussels and the mussels sampled in the other northeast coast estuaries is that while the other mussels have a hg isotopic composition consistent with a mixture of ihg and mmhg from the sediment , this pattern was observed only for hg , but not hg in the bold mussels ( figure 2 ) . thus , we infer that the bold mussels may be exposed to an additional mmhg source , possibly from the water column , due to their active filter feeding mechanism . the c values confirm that they feed on both pelagic and benthic resources , which is clearly different from the crabs and fish that depend dominantly on benthic and epibenthic resources closely associated with the sediments . we have identified two different scenarios that might explain how the bold mussels are exposed to hg with anomalously high positive hg values . first , to achieve high positive hg values , the sediment - associated mmhg would have to be subjected to additional nonphotochemical degradation and accompanying fractionation , causing the remaining mmhg to shift to higher hg values . we speculate that resuspension of sediment - associated mmhg followed by microbial demethylation in the water column could produce mmhg with high positive hg that is available for uptake by the mussels . bold is characterized by the highest tss and particulate mmhg concentrations , and this region may be particularly susceptible to additional biogeochemical processing of hg in the water column . second , it is also possible that the bold mussels were exposed to a second , and possibly unrelated external mmhg source that either has high hg values inherited from an anthropogenic source or has undergone extensive microbial demethylation prior to being released into the estuary . bold is surrounded by an unvegetated area and diverse point sources of hg , which may expose this site to extensive runoff of industrial hg sources . moreover , based on recent evidence that suggests inflowing fluvial mmhg can serve as an important external mmhg source to pelagic food webs , we presume that exposure to an externally derived mmhg source may be a viable alternate explanation for the high hg in the bold mussels . in the birds , we documented similar hg but much higher hg compared to fish from the same sites , which are the highest trophic level aquatic organisms measured in this study ( figure 2 ) . it is possible that the high hg mmhg is caused by the differences in food sources obtained from their respective sampling habitats compared to those of wells and buzz ( si figure s1 ) or by their selective feeding behavior given that they feed dominantly on benthic invertebrates including mussels . thus , if we assume that the birds analyzed in this study feed primarily on mussels , we might expect a significant positive relationship between % mmhg and hg , and between % mmhg and hg of the sediments , mussels , and birds due to the trophic transfer of mmhg . we plotted % mmhg against the hg and hg values of the sediments , mussels , and birds and observed significant positive relationships at wells ( hg ; r = 0.87 , p < 0.05 , hg = 0.93 , p < 0.05 ) and buzz ( hg ; r = 0.99 , p < 0.05 , hg ; r = 0.97 , p < 0.05 ) . however , the trophic transfer of mmhg from the sediment , to mussels , to birds would indicate that the crabs and fish are exposed to a different mmhg source than the mussels , and this is not what we observed , except at the bold site . moreover , given that the species of bird analyzed in this study have a relatively large feeding habitat ( 60 km ) , the small difference in the feeding habitat probably can not account for the high hg in the birds . instead , we attribute the high hg values in the birds to an internal metabolic fractionation of hg . while metabolic fractionation of hg has not been observed in fish , internal demethylation has been proposed to occur in the liver of many species of bird and this may lead to the fractionation of hg in birds . previous studies have documented 12 higher hg values in birds ( egg contents ) , and in mammals including seals , whales , and human hair compared to their respective diets and attributed this pattern to the kinetic fractionation of hg via internal demethylation . our study demonstrates that the measurement of hg isotope ratios provides new insight into sources and exposure pathways of mmhg in estuarine food webs . past studies that utilized hg isotope ratios to decipher mmhg sources and exposure pathways in coastal food webs have only examined fish , and over smaller coastal regions . we found evidence for multiple hg sources across the northeast coast sediments , and the mmhg associated with the sediments appears to serve as the dominant mmhg source to the estuarine food webs . there has been a long - standing debate over the relative importance of mmhg derived from sediment or from the water column as a source to estuarine organisms . complex biogeochemical processes affecting hg bioavailability between sediment and water column however make it difficult to trace the dominant mmhg sources in the estuarine food webs based on hg concentration alone . this study suggests that mmhg associated with sediments probably acts as the dominant source to many estuarine organisms , but that certain feeding guilds and certain localities are more susceptible to accumulating additional external mmhg sources . while further investigation is necessary to characterize various external mmhg sources , our study demonstrates that the measurement of hg isotope ratios can be a valuable tool for deciphering mmhg sources and exposure pathways in diverse aquatic food webs and assessing the ecological variability of mmhg sources .

we measured mercury ( hg ) isotope ratios in sediments and various estuarine organisms ( green crab , blue mussel , killifish , eider ) to investigate methylmercury ( mmhg ) sources and exposure pathways in five northeast coast ( u.s . ) estuaries . the mass independent hg isotopic compositions ( mif ; 199hg ) of the sediments were linearly correlated with the sediment 1/hg concentrations ( 199hg : r2 = 0.77 , p < 0.05 ) , but the mass dependent isotope compositions ( mdf ; 202hg ) were not ( r2 = 0.26 , p = 0.16 ) , reflecting inputs of anthropogenic hg sources with varying 202hg . the estuarine organisms all display positive 199hg values ( 0.21 to 0.98 ) indicating that mmhg is photodegraded to varying degrees ( 512% ) prior to entry into the food web . the 202hg and 199hg values of most organisms can be explained by a mixture of mmhg and inorganic hg from sediments . at one contaminated site mussels have anomalously high 202hg , indicating exposure to a second pool of mmhg , compared to sediment , crabs and fish . eiders have similar 199hg as killifish but much higher 202hg , suggesting that there is an internal fractionation of 202hg in birds . our study shows that hg isotopes can be used to identify multiple anthropogenic inorganic hg and mmhg sources and determine the degree of photodegradation of mmhg in estuarine food webs .

Introduction Materials and Methods Results and Discussion

hip fractures represent one of the most common injuries in the elderly and are associated with a high incidence of complications and mortality . hip fracture surgery is the mainstay treatment , and lung infections are the most common postoperative complication associated with this procedure , contributing to increased hospital stays and increased mortality rates [ 2 , 3 ] . traditionally , being bedridden for long periods of time was regarded as the main risk factor for acquiring lung infections . however , despite improvements to surgical techniques and nursing care resulting in a reduction in the time patients remain bedridden , the current risk of lung infections and mortality after hip fracture remains high . therefore , it is necessary to define the relationship between lung infections and hip fracture surgery . trauma and tissue damage trigger an inflammatory response which can result in additional organ damage and the development of multiorgan failure ( mof ) . a growing body of evidence suggests that severe trauma , such as burns , hemorrhagic shock , and polytrauma , induces the systemic release of various danger signals damage - associated molecular patterns ( damps ) which leads to an overwhelming inflammatory response and subsequent indirect lung injury [ 69 ] . similarly , we have demonstrated that hip fracture and surgery also elevate systemic proinflammatory mediators in elderly patients , and the inflammatory response may play an important role in postoperative liver and lung dysfunction . however , there is little understanding of whether hip fracture and accompanying surgery have an adverse effect on the lungs of aged patients and whether postoperative lung infections are associated with the impaired lung conditions . therefore , our first aim was to characterize the systemic inflammatory response and pulmonary injury following hip fracture and surgery using an aged rodent model . next , we examined whether aged rats suffering from hip fracture and surgery were more susceptible to bacterial infection than the sham - operated rats . we hypothesized that hip fracture and surgery may induce a pulmonary inflammatory response and injury to lung tissues that would increase susceptibility to bacterial infections in elderly individuals . experiments were performed according to the guidelines for experimental animal care and use approved by beijing military general hospital . a total of 116 male sprague dawley ( sd ) rats of age 22 - 23 months ( 460570 g ) were used in this study . animals were purchased from the haiwang laboratory animal center ( beijing , china ) and housed with access to food and water ad libitum and were maintained on a 12 : 12 h light / dark cycle . all rats were housed for at least 1 week in our facility prior to being subjected to experimental procedures . rats were randomly divided into groups consisting of the sham group ( anesthesia only ) or injury ( hip fracture plus surgery ) group . blood , bal fluid , and lung tissues were collected at each time point and stored at 80c until analyzed . animals used to investigate susceptibility to infection were anesthetized again , and an intratracheal bacterial suspension was instilled at 1 , 3 , and 7 days after injury . animals were sacrificed 24 h following bacterial infection , and blood and bal fluid were collected and stored as above . injection of xylazine ( 25 mg / kg ) and ketamine ( 75 mg / kg ) and then placed onto the base of a blunt guillotine ramming apparatus in a prone position with one rear leg immobilized by a rubber band attached to a screw . the weight of the blunt guillotine was 500 g , and the average drop height was 14 cm . current reports indicate that surgery for a hip fracture should be performed as soon as possible to reduce postoperative complications and mortality [ 1214 ] . to mimic the injury sustained due to this type of operation , proximal prophylactic preoperative antibiotics ( gentamicin , 5 mg / kg ) were administered before incision . a proximal femur lateral incision ( approximately 0.5 cm ) was made , and the fracture ends exposed . a 1.25 mm kirschner wire was inserted retrograde into the proximal femoral medullary cavity with a drill , and the proximal part of the pin emerged from the piriform fossa . the proximal portion of the pin was connected to the drill , and the distal femoral medullary cavity entered . the proximal portion of the pin was cut , and the incision was closed with 3 - 0 polyglycolic acid sutures . following surgery , injection of 5 ml of sterile saline solution and were allowed to eat and drink ad libitum . the animals were administered buprenex ( buprenorphine ; 0.1 mg / kg ) every 1012 h for pain control . p. aeruginosa was selected as the pathogenic bacterium for these studies since it is gram - negative and one of the most common causes of nosocomial pneumonia . briefly , p. aeruginosa ( atcc strain 27853 ) was inoculated into trypticase soy broth with constant shaking overnight at 35c . bacteria were harvested by centrifugation at 6000 g and then washed and resuspended to an absorbance of 0.5 a600 nm ( 4 10 cfu / ml ) . at 1 , 3 , and 7 days after injury , rats were anesthetized again with inhaled isoflurane , and endotracheal intubation was performed as described previously . after catheter intubation , a total of 40 l of p. aeruginosa diluted in normal saline ( corresponding to 4 10 cfu / ml ) was slowly injected intratracheally . rats were then held vertically for 1 min to ensure delivery of the bacteria into the lungs . rats subjected to hip fracture and surgery were sacrificed 1 , 3 , and 7 days after surgery . blood samples were harvested , and serum was collected to determine the tnf- , il-6 , il-1 , and il-10 concentrations by elisa ( r&d , minneapolis , mn , usa ) according to the manufacturer 's instructions . lungs were removed and placed in 1 ml of homogenization buffer , centrifuged at 12,000 rpm for 20 min at 4c , and supernatants were collected . caspase-3 activity was assessed as a marker of apoptosis in lung tissue homogenates using the commercially available caspase-3 colorimetric assay kit ( biovision , san francisco , ca , usa ) according to the manufacturer 's instructions . bal was collected by slowly instilling and withdrawing 1 ml of hank 's balanced salts solution ( hbss ) 710 times through the cannula . bal fluid was then centrifuged at 3000 rpm for 3 min , and cell pellets resuspended with 1.0 ml of phosphate buffered saline ( pbs ) . a hemocytometer and cytospin ( following staining with hema3 , biochemical sciences ) were used to determine total cell counts and differential cell counts , respectively . injured rats were deeply anesthetized with isoflurane 24 h after bacterial infection . using sterile procedures , blood and bal fluid samples were obtained by direct cardiac puncture and tracheal instillation with 1 ml sterile saline . the fluid was diluted in sterile saline and plated on sheep 's blood agar plates . plates were incubated overnight at 37c , and colony counts were determined 24 h later . colony counts were expressed as colony forming units ( cfu)/ml of fluid , and log transformation of calculated colony counts was then used for further analysis . lung specimens were fixed in 10% formalin , embedded in paraffin and 4 m sections prepared and stained with hematoxylin and eosin ( h&e ) . slides ( 100 magnification ) were evaluated and scored by a pathologist blinded to the experimental groups according to the pulmonary injury scoring system . lung injury scoring was based on categories of inflammatory cell infiltration , pulmonary edema , congestion , and intra - alveolar hemorrhage graded on a scale from 0 : normal , 1 : mild , 2 : moderate , to 3 : severe injury , with a maximum possible score of 12 . data analysis was performed using prizm version 4.0 ( graphpad software , san diego , ca , usa ) . data are presented as mean standard error ( se ) of the mean . data at each time point were compared for all groups using one - way anova with the tukey post hoc test . in order to determine if hip fracture surgery was associated with changes in serum cytokine levels , il-6 , tnf- , il-1 , and il-10 levels in blood were quantified 1 , 3 , and 7 days after hip fracture and surgery ( including sham - operated controls ) . il-6 and il-1 concentrations were significantly elevated 1 and 3 days following injury and returned to sham - operated levels by day 7 ( figures 1(a ) and 1(c ) ) . however , tnf- levels were significantly upregulated only on day 1 after hip fracture and surgery ( figure 1(b ) ) . to assess the nature of the inflammatory cell infiltrates present in the lung following hip fracture and surgery , we examined the numbers of inflammatory cells present in the bal of aged rats in the different groups . at 1 and 3 days after injury , significant acute pulmonary inflammation was observed ( figure 2(a ) ) consisting of macrophages ( figure 2(b ) ) , lymphocytes ( figure 2(c ) ) , and neutrophils ( figure 2(d ) ) compared to cells present in the bal fluid of sham operated animals . the inflammatory cell accumulation returned to sham - operated levels 7 days following injury . increased protein concentrations in the bal fluid are thought to be a marker of pulmonary injury in rodents . in this study , we observed that bal fluid protein concentrations were significantly elevated 1 and 3 days following hip fracture and surgery ( figure 3 ) . to further characterize lung injury in response to hip fracture and surgery , active caspase-3 levels ( an index of pulmonary cell apoptosis ) active caspase-3 levels in the lung were also significantly increased 1 and 3 days after injury . no significant changes at day 7 following hip fracture and surgery were observed ( figure 4 ) . light microscopic examination of h&e stained lung sections showed significant histological changes ( figures 5(a)5(d ) ) . lungs harvested 1 and 3 days after injury presented with increased congestion , pulmonary edema , polymorphonuclear and mononuclear cell infiltrates , and disrupted alveolar architecture when compared to sham controls . 7 days after injury , the pathologic changes were similar to the sham group with the exception of some neutrophil infiltrates . the lung injury score was determined by a pathologist blinded to the study using a 012 point scale . this analysis revealed significant pulmonary pathology 1 and 3 days after injury ( figure 6 ) . because we observed an increase in pulmonaryinflammation and injury in rats 1 and 3 days following hip fracture , we hypothesized that pulmonary inflammation and injury induced by hip fracture and surgery may render aged rats more vulnerable to bacterial infections . to address this possibility , the survival rates and the ability to clear bacteria from the lungs and blood were evaluated in animals undergoing pulmonary infection 1 , 3 , and 7 days after injury . these experiments demonstrated that aged rats undergoing pulmonary infection had decreased survival rates 1 and 3 days after injury ( 16.67% and 25% , resp . ) compared to sham operated rats ( 91.67% ) . however , animals that underwent a secondary pulmonary infection 7 days after injury showed no significant differences in survival ( 83.33% ) compared to sham - operated animals ( figure 7 ) . moreover , bal fluid ( figure 8(a ) ) and blood cultures ( figure 8(b ) ) showed increased bacterial numbers in animals that underwent pulmonary infection 1 and 3 days after injury compared to animals in the sham group . susceptibility to lung infections increases following hip fracture surgery in the elderly and is often associated with high mortality rates . age , gender , general medical condition , preoperative comorbidities , surgery duration , and bedridden time were regarded as predictors of perioperative complications and outcomes following hip fracture surgery [ 2023 ] . recently , immunoinflammatory responses to trauma and surgical stress were experimentally and clinically proposed to be critically involved in the development of organ damage and postoperative complications [ 2426 ] . however , it is unclear if similar immunological changes would occur in the elderly recovering from surgery due to a hip fracture . therefore , evaluation of the systemic inflammatory response and pulmonary condition after hip fracture surgery in the elderly may lead to a better understanding of the increased susceptibility to lung infection . to our knowledge , the present study represents the first investigation into the relationship between hip fracture surgery and lung infection using an aged rat model . in the current study , we demonstrated that lung infections were dependent on the severity of systemic inflammation and lung injury induced by hip fracture and surgery . here , we have shown that hip fracture and proximal femoral intramedullary pinning in aged rats resulted in significant changes in plasma cytokine levels and markers of lung injury 1 and 3 days after injury . these changes included increased plasma cytokine ( il-6 , tnf- , il-1 , and il-10 ) levels , the presence of inflammatory cells in bal fluid , detectable pulmonary apoptosis , and histological changes to the lung . in addition , rats challenged with p. aeruginosa at 1 and 3 days after injury had decreased survival rates and increased pulmonary and circulating blood bacterial counts compared to rats challenged at 7 days after surgery and in sham - treated animals . this decreased survival rate and increased susceptibility to p. aeruginosa infection were associated with significantly increased pulmonary inflammation and injury . hyper inflammatory responses can be activated by various types of serious injury , that is , hemorrhagic shock , multiple fractures , burns , chest trauma , brain injury , or a combination of injuries [ 8 , 9 , 27 , 28 ] ; furthermore , changes in cytokine levels are dependent on the degree of injury . it seems that hip fractures , a low energy type of trauma , are insufficient to elicit significant physiologic alterations and immunological reactions . however , it can not be ignored that soft - tissue injuries and hemorrhage associated with surgical procedures result in the cellular release of damps into the circulation that in turn activate innate immune responses resulting in the systemic inflammatory response syndrome [ 30 , 31 ] . findings from this study indicated that a hip fracture followed by surgery induced the excessive ( systemic ) release of pro- and anti - inflammatory mediators ( il-6 , tnf- , il-1 , and il-10 ) 1 and 3 days after injury in aged rats . furthermore , except for traumatic factors , age and immune status of the host also had profound effects on the immunoinflammatory response to injury . aging is associated with increased inflammation following injury , and aged mice are more likely to die from sepsis due to the elicitation of overwhelming inflammatory responses compared to responses elicited in young mice . furthermore , kang et al . described that age influenced the immune responses and lung inflammatory responses after bone fracture , tissue trauma , and hemorrhage [ 34 , 35 ] . therefore , in our study , aging might be a vital factor that boosted the inflammatory response after hip fracture and surgery . even though the mechanisms that result in remote organ damage post injury remain undefined , it is well established that inflammatory - associated pulmonary injury is a major cause of multiple organ dysfunction syndrome ( mods ) and mortality following serious orthopedic trauma [ 36 , 37 ] . in previous studies , inflammatory - associated lung injury was reported to occur following bilateral femur fracture ( with fixation ) or a vertebral column fracture [ 26 , 38 , 39 ] . however , little information exists regarding adverse effects of the initial traumatic insult and surgical procedures on the lung tissues of aged individuals . our findings demonstrated for the first time that hip fracture and surgery resulted in reversible pulmonary inflammation and injury that coincided with a significant elevation in the serum levels of inflammatory cytokines . compared to controls , animals euthanized 1 and 3 days after injury presented with increased numbers of inflammatory cells and protein concentrations in bal fluid , enhanced caspase-3 activity , and elevated pathologic scores . significantly increased serum levels of il-6 , tnf- , il-1 , and il-10 were also observed at the same time points . this finding was particularly important because it suggested that these significant changes in lung inflammation and injury observed at 1 and 3 days after injury may represent the pathophysiologic window associated with lung infection susceptibility associated with hip fracture and surgery . to further substantiate these observations , susceptibility to lung infection 1 , 3 , and 7 days after injury was evaluated . results showed that aged rats infected with p. aeruginosa 1 and 3 days after injury had decreased survival rates and bacterial clearance . effective clearance of invading microbes from the lung requires effective immune responses and architectural integrity . pulmonary immune defenses include the epithelial barrier , the mucociliary apparatus , and innate immune cells suggesting that any form of damage to these defenses would increase susceptibility to infection . for example , impaired immunological function , increased numbers of neutrophils and macrophages , and apoptosis of endothelial and epithelial cells ( as well as destruction of alveolar septa ) were reported to contribute to the bacterial infections in copd patients or in animal models of cigarette smoke - induced pulmonary injury [ 4042 ] . in this study , similar markers of pulmonary injury were observed 1 and 3 days after injury as evidenced by the presence of increased inflammatory cells ( neutrophils , macrophages , and lymphocytes ) and elevated protein concentrations in bal fluid , caspase-3 activity , and extensive pathologic changes in lung tissue . results from this study indicated that lung injury induced by hip fracture and surgery increased susceptibility to infection in aged rats 1 and 3 days after injury . first , this study was based on the aged rat model , which can not exactly reproduce the immunobiology observed in humans due to the substantive evolutionary gap between species . second , susceptibility to infection and mortality was increased due to surgically induced immune suppression ; however , the results of this study did not provide sufficient information to determine whether immune suppression occurred following hip fracture and surgery . in conclusion , this study demonstrated that hip fracture and surgery resulted in significantly elevated systemic inflammatory responses associated with lung injury in aged rats 1 and 3 days after injury , increasing susceptibility to infection and mortality .

pulmonary infections frequently occur following hip fracture surgery in aged patients . however , the underlying reasons are not fully understood . the present study investigates the systemic inflammatory response and pulmonary conditions following hip fracture surgery as a means of identifying risk factors for lung infections using an aged rodent model . aged , male sprague - dawley rats ( 8 animals per group ) underwent a sham procedure or hip fracture plus femoral intramedullary pinning . animals were sacrificed 1 , 3 , and 7 days after the injury . markers of systemic inflammation and pulmonary injury were analyzed . both sham - operated and injured / surgical group animals underwent intratracheal inoculation with pseudomonas aeruginosa 1 , 3 , and 7 days after surgery . p. aeruginosa counts in blood and bronchoalveolar lavage ( bal ) fluid and survival rates were recorded . serum tnf- , il-6 , il-1 , and il-10 levels and markers of pulmonary injury were significantly increased at 1 and 3 days following hip fracture and surgery . animals challenged with p. aeruginosa at 1 and 3 days after injury had a significantly decreased survival rate and more p. aeruginosa recovered from blood and bal fluid . this study shows that hip fracture and surgery in aged rats induced a systemic inflammatory response and lung injury associated with increased susceptibility to infection during the acute phase after injury and surgery .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

signal transducer and activator of transcription 5 ( stat5 ) is widely expressed throughout the hematopoietic system , both in stem and progenitor cells as well as in committed erythroid , myeloid and lymphoid cells . indeed , it is not surprising that stat5 can be activated by a wide variety of cytokines and growth factors . these include cytokines and growth factors that can signal through the interleukin 3 ( il3)-receptor family [ il3 , il5 , granulocyte - macrophage colony stimulating factor ( gm - csf ) ] , through the common -chain receptor family ( il2 , il7 , il9 , il12 , il15 ) , through single chain receptors [ erythropoietin ( epo ) , thrombopoietin ( tpo ) , growth hormone ( gh ) , prolactin , granulocyte - colony stimulating factor ( g - csf ) ] , through class ii receptors [ interferon ( ifn- ) , ifn- , il22 ] or through tyrosine kinase receptors [ stem cell factor ( scf ) , platelet derived growth factor ( pdgf ) , epidermal growth factor ( egf ) ] ( fig . 1 ) . in most cases , janus kinase ( jak ) tyrosine kinase activity mediates stat5 tyrosine phosphorylation , and stat5 can be activated by jak1 , 2 or 3 , depending on the cytokine - activated receptor complex . alternatively , the tyrosine kinase receptor family can also induce stat5 phosphorylation in a jak - independent manner . while stat5 is expressed in the majority of hematopoietic cell types , thus , specific cytokines are able to induce stat5 activity in subsets of cell types only . for example , cytokines that activate stat5 in the most immature human hematopoietic stem compartment include scf and tpo . these cytokines have been shown to promote long - term hematopoiesis in vitro , and hypersensitivity to tpo in lnk mice resulted in elevated stem cell self - renewal , which coincided with increased levels of stat5 activity . within the erythroid compartment , stat5 is activated by epo , where stat5 fulfills an important anti - apoptotic role by upregulating bcl - xl , although a more direct role in initiating erythroid commitment might exist as well . in myeloid cells , stat5 can be activated by a variety of cytokines , including il3 , il5 , gm - csf and csf1 ( reviewed in ref . although initially in stat5ab mice myelopoiesis appeared to be relatively unaffected , it is likely that in myeloid cells many of the signals initiated by e.g. , il-3 and gm - csf are , at least in part , mediated by stat5 , thereby regulating myeloproliferation or anti - apoptosis . during myelosuppression , mice completely deficient of stat5ab failed to produce enhanced levels of neutrophils and were unable to respond to gm - csf . stat5 activation is required for il2-induced t cell proliferation and the production of nk cells , or for il7-mediated b cell expansion . as summarized in table 1 and figure 1b , a wide variety of genetic defects in myeloid leukemias and myeloproliferative diseases ( mpds ) result in activation of the stat5 pathway , including mutations in flt3 and ckit receptors , jak2 mutations , translocations such as tel - pdgfra , and bcr - abl , but also as a result of increased cytokine signaling . numerous functional studies have indicated that aberrant activation of stat5 can contribute to the process of leukemic transformation . downstream of flt3-itd ( internal tandem duplication ) mutations , stat5 is strongly activated via two tyrosine residues within the flt3 receptor , y589 and y592 that act as docking sites for the sh2 domain of stat5 molecules . mutation of these residues into phenylalanines completely abrogated activation of stat5 , and importantly completely impaired induction of a myeloproliferative disease in vivo in a murine transplantation model . thus , it is likely that stat5 signaling is essential for the transforming potential of flt3-itd . although in human cells introduction of flt3-itd did not result in a myeloproliferative disease in transplanted nod - scid mice , the activated stem cell phenotype imposed on cb cd34 cells , as revealed by the formation of early cobblestone area forming cells ( cafcs ) , was impaired by coexpression of a dominant negative stat5a ( y694f ) mutant , suggesting that also in human cells stat5 is an important mediator of flt3-itd - induced signaling . in studies in which stat5 expression was targeted in primary acute myeloid leukemia ( aml ) cd34 cells using a lentiviral approach , it was observed that long - term expansion and the formation of leukemic cafcs was strongly impaired by downmodulation of stat5 . although the presence of flt3-itds was not the exclusive genetic mutation that induced constitutive stat5 signaling in the samples that were studied , these data clearly underscore the important role that stat5 fulfills in long - term expansion and self - renewal of primary aml stem / progenitor cells as well . in chronic myeloid leukemia ( cml ) induced by bcr - abl a number of studies have shown that stat5 is efficiently activated downstream of bcr - abl , and interference with stat5 activation negatively impacts the survival and proliferation of bcr - abl - expressing cells . bcr - abl p210-transduced stat5 murine bone marrow ( bm ) cells developed cml with low frequencies , with a delayed onset of disease . the induction of acute lymphoid leukemia ( all ) was not impaired in these animals . complete abrogation of stat5 expression in stat5ab mice also impaired lymphoid transformation induced by bcr - abl - expressing murine bm . in primary human cml cells , it was demonstrated that downmodulation of stat5 expression by rnai impaired bcr - abl - dependent proliferation and also reduced colony formation in methylcellulose . inhibition of stat5 by pimozide reduced colony formation of cml cd34 cells , also in tyrosine kinase - resistant patient samples . in myeloproliferative diseases it has been demonstrated in mouse models that bone marrow ( bm)-transduced with tel - jak2 no longer induced disease in recipient mice when the oncogene was introduced in a stat5 background . finally , enhanced stat5 activity has been observed in polycythemia vera ( pv ) , caused by the activating jak2 v617f mutation . inhibition of jak2 kinase activity abrogated the activation of stat5 , which coincided with a suppression of erythropoiesis in vitro and in vivo . the most direct evidence for stat5 acting as an oncogene arises from murine bm transplantation studies in which constitutively activated stat5 ( s711f ) mutants were overexpressed . lethally irradiated recipients receiving activated stat5-transduced bm died within 6 weeks after transplantation of a multilineage leukemia . it was demonstrated that a tryptophan residue in the n - terminal region of stat5 is required for tetramerization of stat5 dimers , and tetramer - deficient stat5 mutants were unable to induce leukemia in mice . another activating mutant of stat5 , stat5a(1 * 6 ) that contains two point mutations ( h299r and s711f ) was earlier shown to induce myeloid hyperproliferation , but not leukemia , in a murine retroviral overexpression model . this was later confirmed by others , and a fatal mpd was observed by overexpression of these stat5 mutants , but only when the most primitive cd34lin ckitsca1 ( lsk ) population was transduced and used for transplantation to irradiated recipients , suggesting that the stem cell , but not a committed progenitor is the target cell for transformation induced by activated stat5 . intriguingly , while these examples clearly demonstrate that stat5 can transform murine hematopoietic stem cells ( hscs ) , no in vivo stat5-induced transformation has been reported in human cell populations . while enhanced self - renewal and long - term stem cell maintenance can be achieved by introduction of activated stat5 in human cd34 cells , a myeloproliferative disease or leukemia does not occur in non - obese diabetic / severe combined immunodeficiency ( nod - scid ) transplantations models . it is plausible that the nod - scid xenograft model is not suitable to completely recapitulate human disease , or alternatively it is possible that species - specific differences in stat5 signaling exist . in line with these observations , introduction of bcr - abl in murine bm resulted in a rapid and lethal mpd whereby recipients die within 3 weeks after transplantation . introduction of bcr - abl in human cd34 cells does not result in a rapid leukemia or mpd in engrafted nod - scid mice , and only after 5 mo progression to an early stage disease was observed in some animals . collectively , these data indicate that stat5 is frequently activated in various hematological malignancies , whereby it strongly affects processes such as self - renewal and lineage fate determination . whether stat5 target genes in normal and leukemic stem cells are identical , or whether leukemic stem cell - specific stat5 target genes exist remains to be determined . also , it will be informative to study how stat5 might cooperate with additional leukemic oncogenes in a multi - hit approach to model the development of human leukemias . loss - of - function and gain - of - function experiments have revealed critical roles for stat5 in the hematopoietic stem / progenitor compartment . stat5ab mice have been used to assess stem cell function in the absence of wt stat5 signaling . these mice were characterized by normal hsc numbers and stem cells isolated from the bone marrow or fetal liver were capable of engrafting irradiated recipients . yet , competitive repopulating capacity of stat5ab hscs was severely impaired . the underlying mechanisms are not fully elucidated yet , but it has been observed that the responsiveness of stat5ab hscs to early - acting cytokines such as il3 and scf was reduced , while the sensitivity to 5-fluoroacil was enhanced . loss of protection against apoptosis most likely does not explain the stat5ab hscs phenotypes , as overexpression of bcl2 was not sufficient to rescue repopulating defects . although homing of stat5ab bm cells into lethally irradiated recipients was not impaired , retention in the bone marrow was reduced under non - myeloablative conditions , leaving open the possibility that competition for the niche might play a role . more recently , using an mx1-cre inducible mouse model , it was shown that conditional deletion of stat5 results in a loss of stem cell quiescence , associated with reduced survival and gradual loss of the hsc pool . in order to study stat5 signaling in human hematopoietic stem / progenitor cells , we have used a lentiviral shrna approach in cord blood ( cb ) cd34 cells . downmodulation of stat5 to about 30% of the endogenous levels reduced progenitor frequencies as determined by colony forming cell ( cfc ) assays in methylcellulose as well as stem cell frequencies as determined by long - term culture - initiating cell ( ltc - ic ) assays in limiting dilution . this resulted in reduced long - term expansion on ms5 bone marrow stroma upon downmodulation of stat5 expression , whereby the myeloid and erythroid differentiation were unaffected . single - cell assays using transduced cd34/cd38 cells revealed that cell cycle progression induced by early - acting cytokines scf and tpo was impaired by stat5 downmodulation . reversely , activating mutants of stat5 have been introduced in murine cd34lsk cells and the effects on stem and progenitor cells were assessed in vitro and in vivo . introduction of stat5a(1 * 6 ) or stat5a(1 * 7 ) mutants resulted in a strong ex vivo expansion of immature cfu - nmem progenitors , without affecting the symmetry of stem cell divisions as determined in paired - daughter cell assays . importantly , long - term repopulating hscs could be maintained under ex vivo culture conditions as cd34lsk cells expressing activated stat5 had a strong competitive repopulating advantage over wild type cells after 7 d and 10 d ex vivo culturing in the presence of scf or scf and tpo . overexpression of stat5a(1 * 6 ) in human cd34 cord blood cells resulted in enhanced stem cell self - renewal . this enhanced self - renewal was only observed in bone marrow stromal cocultures , but not in cytokine - driven liquid culture conditions . these data argued that stat5-induced hsc cell self - renewal depends on the presence of a bone marrow microenvironment , and it was indeed observed that stat5a(1 * 6)-expressing cd34 cells have a strongly enhanced interaction with bone marrow stromal cells , resulting in the appearance of early cafcs underneath the stroma within 1 week after plating . these cafcs contained self - renewal potential as demonstrated by their capacity to give rise to second cafcs upon harvest and replating onto new stroma , as well as by their capacity to engraft in sublethally irradiated nod - scid mice . upon serial replating , long - term cultures could be established by overexpression of activated stat5 for over 20 weeks , giving rise to new cafcs upon each replating as well as to progeny in suspension . hematopoietic progenitors could be maintained long - term in these culture conditions and the suspension cells retained an immature blast - like morphology . when stat5a(1 * 6 ) mutants were expressed in murine embryonic stem ( es ) cells , the generation of hematopoietic stem cells was greatly facilitated as studied on op9 bone marrow stromal cells . importantly , these cafcs could be serially passaged onto new op9 stroma , giving rise to second and third cafcs that were able to sustain long - term hematopoiesis and generate high numbers hematopoietic progenitors , indicative of hsc self - renewal in vitro . also , the cafcs generated by activation of stat5 could engraft sublethally irradiated nod - scid mice , indicating that stat5 facilitates the generation of es - derived hscs that can contribute to hematopoiesis in vivo as well . although various stat5 target genes have been identified , the mechanisms by which stat5 acts on hscs remain to be elucidated . using cell lines or heterogeneous stem / progenitor cell populations , enhanced cell growth is one of the most dominant phenotypes that is frequently observed in various studies , and several genes that are regulated by stat5 associate with cell proliferation and cell cycle progression , including cyclin d1 , pim1 and c - myc . pim serine / threonine kinases act as mediators of cytokine - induced cell growth by promoting acceleration of cell - cycle progression both at the g1/s and g2/m transitions by phosphorylating and activating the phosphatases cdc25a and cdc25c , respectively . c - myc controls the balance between self - renewal and differentiation of hscs . however , when more purified stem cell populations were studied using a conditional deletion mx1-cre model it was observed that stat5 was required to maintain hsc quiescence . upon stat5 deletion a decrease in the percentage of cells in g0 within the long - term and short - term hsc compartments was observed , coinciding with a decrease in expression of quiescence - associated genes such as p57 and tie2 . in erythroid cells , it has been convincingly demonstrated that stat5 contributes to cell survival by upregulating the anti - apoptosis gene bcl - xl . survival of flt3-itd aml cells has been shown to depend on stat5-mediated expression of mcl1 . also , bcl2 can be upregulated by stat5 and is required to prevent apoptosis during terminal differentiation of myeloid cells . whether prevention of apoptosis contributes to stat5-induced hsc self - renewal is currently unclear , but bcl2 overexpression was not sufficient to rescue the repopulation defects of stat5ab hscs , suggesting that protection against apoptosis is not the main role of stat5 signaling in hscs . in our co - cultures , despite strong reductions in ltc - ic and cfc frequencies , we also did not detect an increased rate of apoptosis in stat5 rnai - transduced cd34 cb cells , and no decreased expression of the bcl - xl gene was observed . the basic helix - loop - helix transcriptional inhibitor id1 is also upregulated by stat5 , and id1-deficient hscs fail to self - renew , leading to low steady - state hsc numbers and premature hsc exhaustion . little evidence exists that stat5 affects the expression of other known hsc self - renewal regulators such as bmi1 or hoxb4 . recently , we observed that stat5 binds to and activates the promoter of hypoxia induced factor 2 ( hif2 ) in human cd34/cd38 hscs . functional studies indicated that stat5-induced long - term expansion and elevated ltc - ic and cfc frequencies were reduced upon downmodulation of hif2. glucose uptake was enhanced in cells expression activated stat5 , coinciding with a hif2-dependent upregulation glucose metabolism genes , suggesting that pathways normally active under hypoxia might be utilized by stat5 under normoxic conditions as well to maintain stem cell properties . the phenotype imposed on cells by stat5 might well depend on the actual level of stat5 activity that is induced . using a 4-hydroxytamoxifen inducible system that allowed titration of stat5 activity in human stem and progenitor cells we have demonstrated that the stem cell maintenance properties require intermediate stat5 activation . on the other hand , high stat5 activation levels resulted in erythroid differentiation at the expense of hsc self - renewal . c / ebp levels were reduced upon stat5 activation , which reached maximum reduction levels at intermediate stat5 activation . in line with these observations , in mice c / ebp deficiency resulted in hyperproliferation of hematopoietic progenitor cells and enhancement of hematopoietic stem cell repopulating capacity and self - renewal . reintroduction of c / ebp in stat5a(1 * 6)-transduced human cd34 cells was sufficient to impair hsc self - renewal capacity . the mechanisms by which stat5 affects c / ebp expression levels are still under investigation , but these observations leave open the possibility that enhanced hsc self - renewal might in part be explained by reduction in c / ebp expression levels . it is remarkable that the effects of stat5 on hsc self - renewal are confined to intermediate stat5 activation levels . this dosage effect of stat5 on self - renewal is consistent with the observed constitutive activation of stat5 in aml samples , which is typically lower then cytokine - induced stat5 activation . such a dosage effect of transcription factors is at present not well understood , but besides stat5 this has also been observed for the myeloid transcription factor pu.1 , which at 20% expression gives rise to self - renewing murine myeloid leukemias , whereas 50% or 100% reduction in expression do not have such a dramatic effect . recently , also for wnt signaling it was demonstrated that intermediate activation levels enhance self - renewal of hscs . collectively , these examples clearly underscore the role of transcription factor dosage in regulating hsc self - renewal . the observation that stat5 drives cell cycle progression in various cell types and anti - apoptosis in others , while stat5 is also required to maintain quiescence of hematopoietic stem cells , suggests that the cell - biological consequences of stat5 signaling might be highly cell type - specific . we have addressed this issue by introducing a 4-hydroxytamoxifen ( 4oht)-inducible stat5-er fusion in human stem and progenitor cells . activation of stat5 specifically in hsc , common myeloid ( cmp ) , granulocyte - macrophage ( gmp ) or megakaryocyte - erythroid progenitor ( mep ) populations resulted in rather distinct phenotypes . long - term self - renewal and enhanced cobblestone formation could only be imposed on hscs , but not on committed progenitor subpopulations . erythroid differentiation could be induced in hsc , cmp and mep populations , but not in gmps . gene expression profiling revealed that rather distinct gene expression profiles were induced in hsc as compared with more committed progenitor subpopulations . for instance , tubb1 , hif2 , sod2 , il8 and also the cell cycle inhibitor cdkn1a / p21 were particularly upregulated in hscs but not in committed progenitors ( fig . 2 ) . in contrast , osm , pim1 and the negative feedback regulators cish and socs2 were upregulated both in hscs and mpps . the underlying mechanisms are currently unclear , but a number of possibilities might be hypothesized . first , it has been shown that several cofactors such as p300/cbp , but also interactions with other transcription factors such as foxo3a , can modulate and fine - tune the stat5 response . cell type - specific interaction with such cofactors would then dictate a cell type - specific stat5 activation pattern of target genes . seen from this perspective , the modulation of stat5 signaling by p300/cbp could add to a stem vs. progenitor - specific component of stat5 . it has been observed that , unlike p300 , cbp is essential for hsc self - renewal maintenance , while p300 is suggested to play a role in differentiation . interaction of various transcription factors with p300/cbp is facilitated by the p300/cbp interacting protein cited2 which has been shown to be a target gene of stat5 and has differential expression and functions in hematopoietic stem vs. progenitor cells ( and our own observations ) . in part , such interactions can be mediated by posttranslational modifications such as serine phosphorylation or glycosylation of stat5 . thus , besides the induction of stat5 tyrosine phosphorylation required for dimerization , nuclear translocation and dna binding , the simultaneous activation of pathways that mediate stat5 serine phosphorylation or glycosylation would be required . ( 2 ) epigenetic factors that influence stat5 dna binding . ( 3 ) expression of receptors and ligands . ( 4 ) niche interactions . hypermethylation of specific promoters or polycomb - mediated condensation of chromatin might prevent stat5 association with regulatory promoter elements and thus transactivation of certain genes . clearly , such differences in epigenetic status and cofactor expression might also be dictated by different responses to extracellular stimuli . thus , the repertoire of specific cytokine and growth factor receptors that is expressed on a cell , as well as direct interactions between hematopoietic stem cells and their bone marrow niche , might ultimately determine the specific stat5 response ( fig . 2 ) . single cell tyrosine phospho - stat5 analysis revealed that within the normal hematopoietic stem cell and progenitor compartment highly distinct cytokine - induced stat5 activation patterns are observed . also in primary aml patient samples , rather heterogeneous responses toward a series of cytokines were observed , not directly linked to whether or not the cognate receptor was expressesed . there was clear heterogeneity between different patient samples , but also different responses could be observed within distinct cellular compartments within a single patient . for instance , in some patient samples strong il3 and gm - csf responses were observed , but only in the cd34 subpopulation , while in other cases strong tpo responses were observed within cd34/cd38 and cd34/cd38 compartments . these observations clearly indicate that strong differences exist in how cytokine and growth factor signals are mediated within a certain cell type , both normal as well as leukemic . although elucidation of molecular mechanisms by which cell type specific stat5 signaling is orchestrated needs further studies , cell type - specific stat5 target genes clearly do exist . the observation that p21 is upregulated by stat5 , particularly in hscs , is remarkable ( our unpublished observations and ref . it will be interesting to analyze whether the enhanced long - term self - renewal that is observed upon activation of stat5 in hematopoietic stem cells involves improved stem cell maintenance by keeping the hscs pool in a relatively quiescent state via upregulation of p21 . knockout studies in mice have indicated that p21 is required during stress hematopoiesis , and although p21 was also initially downregulated in stat5 depleted lsk cells , this downmodulation was not maintained . on the other hand , in murine embryonic fibroblasts it has also been shown that stat5 can negatively regulate cell cycle progression through activation of p21 . inhibition of jak2/stat5 signaling by the specific jak2 inhibitor az960 stimulated cell cycling in cd34/cd38 cells in conjunction with downregulation of p21 . further , activation of p21 has been shown to be critical in preventing excess dna - damage accumulation and functional exhaustion of leukemic stem cells , and it will be interesting to further reveal its role downstream of stat5 in hscs . furthermore , hif2 was upregulated in hscs and cmps by stat5 , but not in meps and gmps . under normoxic conditions , proline residues of hypoxia - induced factor 2 are hydroxylated resulting in a reduction in protein levels via vhl - mediated proteasomal degradation . under hypoxic conditions , such as in the presumed endosteal quiescent stem cell niche , it is currently unknown whether and which hif - induced target genes are essential to maintain stemness of normal hscs , but it was recently shown that in hif1 mice hscs numbers decrease during stress which was associated with a loss of hsc quiescence . another report indicated that hscs in the quiescence niche utilize glycolysis for their energy demands , which depended on a meis1-induced hif1 signaling network . whether hif1 and hif2 display similar or distinct functions in hscs remains to be established . our understanding of the mechanisms that determine whether , where and when a stem cell will self - renew or differentiate is still limited , but recent advances have indicated that the stem cell microenvironment provides essential cues that direct these cell fate decisions . it is remarkable that stat5-induced long - term self - renewal is typically observed when cells are cultured in direct contact with stromal cells , in contrast to , e.g. , bmi1-induced self - renewal , which occurred in a more microenvironment - independent manner . thus , altered interactions with the stem cells niche might also underlie the enhanced self - renewal properties imposed on hscs by activated stat5 . although the mechanisms by which the interaction with the microenvironment of stat5a(1 * 6)-expressing cd34 cells are still unclear , our ongoing studies in which gene - expression profiling was performed in hscs and progenitor subsets revealed that the list of stat5-targets is significantly enriched for membrane ( associated ) proteins . one of the stat5 targets that has been identified is muc1 which is a ( proto)oncogene involved in adhesion and transendothelial migration , and has been associated with initiation of various intracellular signal transduction pathways including -catenin , p53 and nfb pathways . also , muc1 has been shown to mediate an oscillatory calcium signal upon binding to icam1 . within the endosteal region of the bone marrow where stem cells are thought to reside , ca levels are high , and hsc retention within the niche depends on the calcium - sensing receptor ( car ) . thus , stat5 might exert its phenotype , at least in part , by influencing interactions between hscs and their niche . in both murine and human model systems it has been convincingly shown that stat5 fulfills an important role in hematopoietic stem cell self - renewal . although the precise mechanisms by which hsc self - renewal is orchestrated by stat5 remain elusive to date , an increasing number of stat5 target genes have been identified that are currently under investigation . in myeloproliferative diseases and leukemias , a number of oncogenes have been identified that are capable of inducing stat5 activity , and accumulating evidence has indicated that stat5 participates in self - renewal of leukemic stem cells as well . thus , it appears likely that stat5 will become an important diagnostic marker in the near future , and specific targeting of stat5 should be focus of therapeutical intervention strategies to improve treatment of hematological malignancies .

the level of transcription factor activity critically regulates cell fate decisions such as hematopoietic stem cell self - renewal and differentiation . the balance between hematopoietic stem cell self - renewal and differentiation needs to be tightly controlled , as a shift toward differentiation might exhaust the stem cell pool , while a shift toward self - renewal might mark the onset of leukemic transformation . a number of transcription factors have been proposed to be critically involved in governing stem cell fate and lineage commitment , such as hox transcription factors , c - myc , notch1 , -catenin , c / ebp , pu.1 and stat5 . it is therefore no surprise that dysregulation of these transcription factors can also contribute to the development of leukemias . this review will discuss the role of stat5 in both normal and leukemic hematopoietic stem cells as well as mechanisms by which stat5 might contribute to the development of human leukemias .

Introduction STAT5 as a Stem Cell Self-Renewal Factor Mechanisms Involved in STAT5-Induced HSC Self-Renewal Cell Type-Specific STAT5 Signaling: Differential Role of STAT5 in Hematopoietic Stem and Progenitor Cells? Conclusions and Future Perspectives

the reductions in leg strength have been observed during concentric and isometric actions . moreover , positive correlations between lower leg strength and walking tolerance have been identified , suggesting that interventions to improve leg strength might increase exercise tolerance in these patients.5 however , basic locomotor tasks involve not only concentric and isometric , but also eccentric action,6 which is defined as the force exerted by muscles while lengthening . lower eccentric strength and endurance might also be related to exercise intolerance in patients with ic . therefore , interventions to improve eccentric strength and endurance might also be useful in improving exercise tolerance in these patients . nevertheless , this is the first study to analyze the effect of peripheral arterial disease in eccentric strength . we hypothesized that reduced muscle strength and endurance would be observed during both concentric and eccentric actions . eleven male patients with unilateral peripheral arterial disease ( 11 symptomatic and 11 asymptomatic legs ) and stable symptoms of ic were recruited from a tertiary center specializing in vascular disease . patients were included if they had fontaine stage ii peripheral arterial disease,7 ankle / brachial index ( abi ) at rest 0.90 in one leg , abi > 1.0 in the other leg , and symptoms of calf claudication . moreover , since the assessment of strength and endurance was performed on the gastrocnemius and soleus muscles , the arterial obstruction had to be present in femoral - popliteal and/or iliac - femoral sites as determined by arterial palpation . patients were excluded under the following conditions : abi measurement could not be obtained , presence of chronic lung disease , exercise tolerance limited by factors other than claudication ( e.g. , dyspnea or poorly controlled blood pressure ) , presence of electrocardiogram response suggestive of myocardial ischemia during the exercise test , or history of revascularization in the previous year . this study was approved by the ethics committee for research involving human trials , in compliance with helsinki declaration of 1975 , as revised in 1989 . arm and leg blood pressures were measured using a mercury column ( unitec ) and doppler ultrasound ( martec dv600 ) . the abi was obtained by dividing the highest value of systolic blood pressure recorded in the legs ( in the dorsalis pedis artery or in the posterior tibial artery ) by the highest brachial systolic blood pressure ( right or left arm ) . the tests were carried out using a cybex 6000 isokinetic dynamometer ( cybex , division of lumex , ronkonkoma , new york ) in both concentric and eccentric modes . both action modes were tested in the supine position with the knee flexed at 90 and with the thigh supported by a custom apparatus . the axis of rotation of the dynamometer arm was aligned with the ankle joint , and the foot was stabilized in a specific support apparatus using velcro straps.8 patients were tested unilaterally . the order of leg testing ( symptomatic or asymptomatic ) and action types ( concentric or eccentric ) were randomly determined . patients were allowed to practice three submaximal and two maximal trials before each test . during all procedures , concentric and eccentric peak torque ( pt ) and total work ( tw ) during plantar flexion was measured during maximal voluntary contractions at a speed of 120/s . the highest pt assessed over five consecutive repetitions was considered for analysis , while tw was obtained during 60 consecutive repetitions . we employed a rest period of 30 s between warm up and testing , and 1 min between testing pt and tw . the rest period between legs and action types was 10 min . to analyze the quality of pt and tw data , the reliability was assessed in all patients during two different test sessions separated by at least three days . the obtained intraclass correlation coefficient ranged from 0.94 to 0.98 without any differences in the means between sessions for both pt and tw , confirming the reliability of the data . the statistically required sample size was calculated using data from a previous study.1 for a desired power of 80% and an alpha error of 5% , a total of 20 legs were needed to detect differences between symptomatic and asymptomatic limbs . shapiro - wilks and levene tests confirmed the normal distribution and the homogeneity of variance of the data , respectively . the comparisons between symptomatic and asymptomatic legs in concentric and eccentric pt and tw were performed using the two - tailed t test for dependent samples . significance was established at an alpha level of p 0.05 , and data are expressed as means standard deviation . eleven male patients with unilateral peripheral arterial disease ( 11 symptomatic and 11 asymptomatic legs ) and stable symptoms of ic were recruited from a tertiary center specializing in vascular disease . patients were included if they had fontaine stage ii peripheral arterial disease,7 ankle / brachial index ( abi ) at rest 0.90 in one leg , abi > 1.0 in the other leg , and symptoms of calf claudication . moreover , since the assessment of strength and endurance was performed on the gastrocnemius and soleus muscles , the arterial obstruction had to be present in femoral - popliteal and/or iliac - femoral sites as determined by arterial palpation . patients were excluded under the following conditions : abi measurement could not be obtained , presence of chronic lung disease , exercise tolerance limited by factors other than claudication ( e.g. , dyspnea or poorly controlled blood pressure ) , presence of electrocardiogram response suggestive of myocardial ischemia during the exercise test , or history of revascularization in the previous year . this study was approved by the ethics committee for research involving human trials , in compliance with helsinki declaration of 1975 , as revised in 1989 . arm and leg blood pressures were measured using a mercury column ( unitec ) and doppler ultrasound ( martec dv600 ) . the abi was obtained by dividing the highest value of systolic blood pressure recorded in the legs ( in the dorsalis pedis artery or in the posterior tibial artery ) by the highest brachial systolic blood pressure ( right or left arm ) . the tests were carried out using a cybex 6000 isokinetic dynamometer ( cybex , division of lumex , ronkonkoma , new york ) in both concentric and eccentric modes . both action modes were tested in the supine position with the knee flexed at 90 and with the thigh supported by a custom apparatus . the axis of rotation of the dynamometer arm was aligned with the ankle joint , and the foot was stabilized in a specific support apparatus using velcro straps.8 patients were tested unilaterally . the order of leg testing ( symptomatic or asymptomatic ) and action types ( concentric or eccentric ) were randomly determined . patients were allowed to practice three submaximal and two maximal trials before each test . during all procedures , the inactive leg was immobilized using a specific support as recommended by manufacturer . concentric and eccentric peak torque ( pt ) and total work ( tw ) during plantar flexion was measured during maximal voluntary contractions at a speed of 120/s . the highest pt assessed over five consecutive repetitions was considered for analysis , while tw was obtained during 60 consecutive repetitions . we employed a rest period of 30 s between warm up and testing , and 1 min between testing pt and tw . the rest period between legs and action types was 10 min . to analyze the quality of pt and tw data , the reliability was assessed in all patients during two different test sessions separated by at least three days . the obtained intraclass correlation coefficient ranged from 0.94 to 0.98 without any differences in the means between sessions for both pt and tw , confirming the reliability of the data . the statistically required sample size was calculated using data from a previous study.1 for a desired power of 80% and an alpha error of 5% , a total of 20 legs were needed to detect differences between symptomatic and asymptomatic limbs . shapiro - wilks and levene tests confirmed the normal distribution and the homogeneity of variance of the data , respectively . the comparisons between symptomatic and asymptomatic legs in concentric and eccentric pt and tw were performed using the two - tailed t test for dependent samples . significance was established at an alpha level of p 0.05 , and data are expressed as means standard deviation . the abis of the symptomatic legs were lower than those of the asymptomatic legs ( p < 0.05 ) . the concentric and eccentric pt and tw of symptomatic and asymptomatic legs are presented in table 2 . concentric pt and tw in symptomatic legs were lower than in asymptomatic legs ( p < 0.05 ) . this study is one of the few to analyze strength and endurance during concentric action , and it is the first to evaluate eccentric action in patients with ic . the main findings of this study were ( i ) patients with unilateral ic exhibited significantly lower concentric pt and tw in the symptomatic compared with the asymptomatic leg ; and ( ii ) there were no differences in eccentric pt or tw between symptomatic and asymptomatic legs . peak torque is considered the most important indicator of muscle strength that can be obtained using an isokinetic dynamometer.9 it can be used to identify any early impairment in muscular performance as well as to assess maximal strength levels . total work represents the work performed by the muscular group during the whole test , indicating the muscle endurance capacity of muscle groups.9 it is considered the most sensitive parameter for evaluating muscle fatigue.10 reduced concentric strength in patients with ic has been observed in previous studies . impaired concentric strength in the gastrocnemius and tibial muscles was observed in 26 men with ic compared with six age - matched controls.4 the effects of the disease in terms of muscle strength and endurance were confirmed by other studies using isometric11,12 and concentric10 actions . moreover , a significant relationship was observed between lower extremity strength , abi , and walking tolerance , suggesting that strength levels are associated with disease severity.5 the mechanisms underlying the strength impairments in patients with peripheral arterial disease are not completely understood and remain controversial . it has been hypothesized that type i and ii fiber atrophy and denervation of muscle fibers are the main causes of decreased muscle function in such patients.4,13 the lower tw in the symptomatic leg compared with the asymptomatic leg during concentric action in patients with ic was previously observed in studies analyzing lower10 and upper leg regions.1 these results may be due to the aerobic nature of the endurance test protocol ( 60 actions ) , which results in maximum flow demands to the leg . therefore , once the symptomatic leg has an arterial obstruction , a lower level of performance is expected in symptomatic as compared with asymptomatic legs . no previous study has evaluated eccentric strength in ic patients , despite the importance of this contraction in the daily activities of elderly people.6 several factors inherent to eccentric action might explain the lack of influence of the disease in terms of the strength and endurance of this action mode . the reduction in eccentric strength with aging seems to be less pronounced than that in concentric strength,1416 suggesting that strength and endurance are better preserved during disease process in eccentric than in concentric action . the similar tw between symptomatic and asymptomatic legs during eccentric action may be partly caused by the lower caloric cost of this mode of contraction.1719 some authors have reported a 14% to 20% lower energy cost in eccentric compared with concentric action.17 thus , the limited blood flow observed in patients with ic has fewer muscle endurance effects in eccentric as compared with concentric action . however , this hypothesis must be analyzed carefully , because no prior study has investigated the net caloric cost of eccentric isokinetic contractions in this population . the reduced muscle strength and endurance have been associated with impaired walking tolerance in ic patients.5 therefore , interventions to improve muscle strength and endurance , such as strength training , might be useful to minimize the effects of the disease on strength and to improve exercise tolerance in patients with unilateral ic . previous studies analyzing the effects of strength training in ic patients that used both concentric and eccentric action during training showed improvements in walking tolerance20 and in quality of life.21 the results of the present study suggest that a strength training program that focuses on concentric strength would probably be most effective for patients with ic . however , the effects of different strength training programs for patients with ic remain unknown . this study highlights the need for future studies to analyze the effects of different strength training programs on concentric muscle strength and endurance , as well as on functional limitations of these patients . since the design of this study did not include a control group , it was not possible to compare muscle strength and endurance of subjects with and without peripheral arterial disease however , it is well known that strength and endurance are influenced by several factors , including both physical activity levels22,23 and associated diseases.24,25 therefore , the inclusion of a control group with different physical activity levels and diseases would not have allowed us to determine the specific effects of ic on strength and endurance . therefore , the use of the asymptomatic leg as the control permitted us to determine the specific effects of the disease in terms of strength and endurance while controlling other possible variables . the present study showed that strength and endurance in the symptomatic leg of patients with intermittent claudication is reduced in concentric , but not in eccentric action as compared to the asymptomatic leg . future studies are recommended to investigate the mechanisms underlying these responses and to analyze the effects of interventions to improve concentric strength and endurance in the context of functional limitations in patients with intermittent claudication .

objective : to analyze concentric and eccentric strength and endurance in patients with unilateral intermittent claudication.introduction:basic motor tasks are composed of concentric , isometric , and eccentric actions , which are related and contribute to physical performance . in previous studies of patients with intermittent claudication , the disease - related reduction in concentric and isometric muscular strength and endurance resulted in poorer walking performance . to date , no study has evaluated eccentric muscle action in patients with intermittent claudication.methods:eleven patients with unilateral intermittent claudication performed isokinetic concentric and eccentric actions at the ankle joints to assess peak torque and total work in both symptomatic and asymptomatic legs.results:concentric peak torque and total work were lower in the symptomatic than in the asymptomatic leg ( 80 32 vs. 95 41 n / m , p = 0.01 ; 1479 667 vs. 1709 879 j , p = 0.03 , respectively ) . there were no differences in eccentric peak torque and total work between symptomatic and asymptomatic legs ( 96 30 vs. 108 48 n / m ; 1852 879 vs. 1891 755 j , respectively).conclusion : strength and endurance in the symptomatic leg were lower during concentric compared to eccentric action . future studies are recommended to investigate the mechanisms underlying these responses and to analyze the effects of interventions to improve concentric strength and endurance on functional limitations in patients with intermittent claudication .

INTRODUCTION MATERIALS AND METHODS Patients Ankle Brachial Index Assessment of muscular strength and endurance Statistical analysis RESULTS DISCUSSION CONCLUSION

according to traditional chinese medicine , tongue is the main window into the body ( 1 , 2 ) . a number of authors explain that tongue lesions represent an important part of oral mucosal lesions , with incidence varying among epidemiologic research from different parts of the world ( 1 ) . several studies have been working on the prevalence of tongue lesions ( 1 - 4 ) but cancers are of particular importance and prevalence of oral malignancies reveals vast geographic difference ( 5 ) . curriculums of cancer control are structured on the principles that the early detection of the lesion lead to better treatment , increased survival rate , and mortality reduction ( 6 ) . therefore , the purpose of this study was to illustrate the prevalence of malignant tumors of the tongue in iranian population and compare these findings with those previously reported in the other countries . this multicenter , retrospective , cross - sectional study was carried out to assess the recorded cases of tongue malignancies in the cancer research center ( crc ) of shahid beheshti university of medical sciences . patients records and the associated pathology reports were retrieved from the archives . then age and sex of the patients and its microscopic type were assessed and classified in tables . crc has been collecting the needed information about patients with cancer from all major hospitals in iran since 2003 . one of the primary objectives of this center is to record the changes in pattern of malignancies in iran . such information is classified and recorded according to the guidelines of the cancer office of center for disease control ( cdc ) . these standards include monitoring of information coverage and complete details , controlling the accuracy of information , and elimination of repeated cases . also , collected data dating back to 2008 and onward were in the process of electronic storage and the crc did not provide us with such information . during the years 2003 to 2008 , a total number of 952 new cases of the tongue cancer were recorded in the crc . in the current study , tongue cancers accounted for 21.33% of oral malignancies and 2.22% of head and neck cancers . the tongue cancers were the most common in the fourth to eighth decades of life and most cases are diagnosed in the sixth and seventh decades ( table 1 ) . 450 cases ( 47.2% ) were men and 489 cases ( 51.36% ) were women . four different types of malignant lesions ( epithelial , salivary gland , hematopoietic and mesenchymal ) were diagnosed . epithelial tumors were the most prevalent malignancies ( 93% ) of which squamous cell carcinoma ( scc ) made up 87.39% of all lesions ( table 2 ) . salivary gland tumors had the second place with 3.15% of the total lesions . among salivary gland malignancies , adenoid cystic carcinoma ( adcc ) and mucoepidermoid carcinoma ( mec ) were the most common . non - hodgkin lymphoma especially diffuse large b cell lymphoma ( dlbl ) was most prevalent in hematopoietic group . mesenchymal malignancies made up 0.4% of the cancers and rhabdomyosarcoma was the most common form . 13.02% of all cancers and 13.3% of sccs occurred below 40 years and 32.11% was detected in women . several studies established that tongue was the most common site of occurrence in oral cavity cancers with incidence rate of 50% ( 7 ) , 43% ( 8) , 23% ( 5 ) , and 20% ( 6 , 9 ) . in contrast some studies introduced other sites such as gingival as the most common location in this regard ( 10 , 11 ) . this represents that geographic regions can potentially influence the area of involvement within oral cavity . for example in south and south - east of asia the most common site in oral cavity for cancer development is buccal mucosa followed by tongue carcinoma but in western countries the tongue is a more common location ( 12 ) . the susceptibility of tongue for malignancies was described in previous reports ( 5 , 13 , 14 ) . saliva would combine with carcinogen agents and collected at the bottom of the mouth and persistently wash these regions . in addition , lateral border and ventral part of the tongue have thin and nonkeratinized mucosa with less protection ( 5 ) . tongue has rich lymphatic network and highly muscularized structure which makes it poorly supplied to save itself from invasion and metastasis ( 13 , 14 ) . in our research scc this is in agreement with most of the previously published reports ( 1 , 5 , 7 - 10 , 15 ) . in our study the most cases are diagnosed in the sixth and seventh decades of life similar to other studies ( 1 , 16 ) . many studies showed oral cancers have tendency to affect elderly patients ( 5 - 10 ) . in accordance with previous reports ( 5 , 7 , 17 ) , in our series 13.02% of all cancers and 13.3% of sccs occurred below 40 years . ( 16 ) found that only 6.9% of the patients were younger than 40 years . other studies reported 29.2% ( 9 ) , 27.1% ( 18 ) , 25.8% ( 19 ) , 34.3% ( 20 ) and 45% ( 21 ) of the cases were under 40 years of age . tongue seems to be the most common location in young patients with head and neck scc without a history of tobacco use , or association with hpv ( 22 ) . further studies in this age group were required to assess the risk factors and characteristics of tongue cancer ( 16 ) . biopsy of suspicious oral lesions was necessary to exclude malignancy in young patients ( 7 ) . the prevalence of tongue cancers including scc was almost equal between men and women in our study with a mild tendency to women . this is in compliance with other studies on scc of tongue ( 16 , 23 - 25 ) . in contrast , a male to female ratio 1.75 ( 21 ) , 2 ( 26 ) and 2.5 ( 27 ) was reported . moreover , it was described that the prevalence of oral carcinoma considerably elevated among females rather than males ; especially in developing countries ( 11 , 28 ) . but previous reports demonstrated that malignancies of the oral cavity predominantly occurred in men ( 6 , 7 , 10 ) . there are many risk factors for oral scc such as alcohol and tobacco , geographic variation , genetic predisposition , diets , immune status , oncogenic viruses , radiation , poor oral hygiene , and environmental factors ( 5 , 29 - 31 ) . diets rich in fresh fruits and vegetables , micronutrients and vitamins a , c , e may have protective role against oral cancer ( 32 ) . risk of oral malignancies is greater for non - vegetarians probably due to increased exposure to polycyclic aromatic hydrocarbons that are present in high concentrations in meat products ( 31 ) . obesity and a diet rich in fat were associated with oral malignancies ( 32 ) . also , bosetti et al . ( 33 ) indicate that diabetes may increase the risk of cancers of the oral cavity . moreover , in iron deficiency , epithelial cells of the oral mucosa turn over more rapidly and produce an atrophic or immature mucosa and consequently may cause malignancy ( 34 ) . the majority of the iranian population are muslims and their religion prohibits them from alcohol consumption . but unfortunately traditional water pipe ( hookah ) is smoked in many cafes and restaurants due to this wrong insight that hookah smoking is less harmful than cigarette smoking especially among young women . another problem in iran , ( afghanistan and pakistan ) is smokeless tobacco use named nass ( snus ) whose consumers are unaware of the harm and it is cheap and easily available . smokeless tobacco is very strongly correlated with cancers of the cheek and gums ( 35 ) . epithelial cancers constituted 93% of all malignant tumors and most of them were scc ( 87.39% of all tumors ) . this is in agreement with most of the previously published reports ( 1 , 5 , 7 - 10 ) . ( 16 ) found that 63.2% of tongue cancers were scc and 36.8% were other types but they did not describe other types of malignancies . in our series salivary gland carcinomas comprised 3.15% of the total lesions followed by non - hodgkin lymphoma and sarcomas . anis et al . ( 7 ) found 13.6% of malignancies had salivary gland origin that mec ( 5.4% ) was the most common followed by adcc ( 2.7% ) . ( 9 ) found that salivary gland malignancies comprised 4.9% of the all lesions that adcc with 3.3% and mec with 0.9% . the low percentage of cancers of glandular origin in our series is related to evaluation of tongue malignancies and the common site for salivary gland tumor in oral cavity was palate . dias et al . ( 8) found that only 3% of tumors were non - epithelial that 1.3% of them were non - hodgkin lymphoma . moreover in another study , the prevalence of lymphoma was 2.7% of the oral cancers ( 7 ) that was similar to our findings . in our series dlbl was the most common form ; whereas , in other studies , burkit lymphoma was common ( 9 , 10 ) . ( 36 ) mentioned that the proportion of orofacial scc in nigerians is quite low ( 42.8% ) because of a high ratio of salivary gland carcinoma and burkitt s lymphoma . as seen in most of the studies , sarcomas were less common than carcinomas ( 5 , 7 , 37 ) . in our research sarcomas this is in agreement with other studies ( 5 , 36 ) . in conclusion , in iranian population scc is the most prevalent malignancy of tongue and female to male ratio was equal . these lesions were prevalent in the sixth and seventh of life but it may be seen below 40 years old . the dentists have a special role in detection and initial management of oral cavity lesions . screening examination of tongue by dental practitioner , especially in elderly patients is necessary for early detection of cancerous lesions .

backgroundthe incidence of oral cancers varies from one country to another , which can be clarified by the difference in the distribution of the risk factors and the possible etiologies . tongue is a main segment of oral cavity and malignant lesions of this region accounts for nearly 30% of all oral cancers.objectivesin the present study , we evaluated the pattern of tongue cancer in iranian population and compared these findings with those previously reported in the other countries.methodsin this multicenter , retrospective cross - sectional study recorded cases of the malignant tongue tumors in the cancer research center ( crc ) of shahid beheshti university of medical sciences were extracted . the patient records and their microscopic reports were retrieved from the archives and age , sex and microscopic types were evaluated . it is to be noted that the crc has been serving as a cancer registry center for major hospitals all over the country since the year of 2003 . thus , the obtained statistics are highly reliable.resultsduring the years 2003 to 2008 , a total number of 952 new cases of the tongue cancer were recorded in the crc . most cases are diagnosed in the sixth and seventh decades of life . 450 cases ( 47.2% ) occurred in men and 489 cases ( 51.36% ) in women . four different types of malignant lesions ( epithelial , salivary gland , hematopoietic and mesenchymal ) were diagnosed . epithelial tumors were the most prevalent malignancies ( 93% ) of which squamous cell carcinoma ( scc ) made up 87.39% of all lesions . salivary gland tumors had the second place with 3.15% of the total lesions.conclusionsin iranian population , squamous cell carcinoma is the most prevalent malignancy of tongue and it is notable that the ratio of female to male population was equal . these lesions were prevalent in the sixth and seventh decades of life . thus screening examination of tongue by dentist especially in elderly patients is necessary for early detection of cancerous lesions .

1. Background 2. Objectives 3. Methods 4. Results 5. Discussion

the structure and property relationship ( spr ) in polymer nanocarriers are normally hard to be defined clearly , due to the polydispersity of polymer and the limited capability for the site - specific functionalization . in contrast , the biomacromolecule systems , e.g. peptide , protein , and the oligonucleotides have a precise structure ( sequence)property relationship in regulating the activities of the biologics . it is clear that the well - defined structures of materials are essential for the quantitative analysis of the spr in functional materials and allow for the application of the theoretical and computational approaches to rationally design and predict the properties of the nanocarriers . these approaches would significantly accelerate the development of the efficient nanocarriers for drug delivery , compared with the empirical approaches in nanocarrier development . anticancer drugs encapsulated in nanoparticles , e.g. liposomes , polymer micelles , and polymer nanoparticles , are normally administered via intravenous injections that require the nanocarriers to be hemocompatible and have stealth property in order to avoid fast clearance by the reticuloendothelial system ( res ) . the formation of the nanocarriers is mostly driven by the hydrophobic aggregation or ionic interactions of the amphiphilic materials , which have a tendency to interact with cell membranes via hydrophobic or charge interactions . such plasma membrane lytic activity may raise safety issues for in vivo applications of nanocarriers . synthetic amphiphilic polymers have been synthesized to form micelle nanocarriers for drug delivery . to elucidate the spr in membrane activity is crucial in optimizing the nanocarrier for safe and efficient in vivo drug delivery . we have developed a biohybrid system , i.e. poly(ethylene glycol ) ( peg)-b - dendritic oligocholic acid ( ca ) ( named as telodendrimer ) via peptide chemistry . it has a well - defined structure with the capability of the precise structural design and functionalization . telodendrimers self - assemble into stable micelles for efficient paclitaxel ( ptx ) encapsulation and a few other anticancer drugs ( see citations in supporting information [ si ] ) . while the paclitaxel - loaded micelles formed by such telodendrimers exhibited a safe profile in in vivo administration for anticancer treatment in mouse models and companion dogs , the empty telodendrimer micelles showed moderate hemolytic properties at relative high concentrations ( 1 mg / ml ) in vitro . the former can be explained by enhanced hydrophobic interactions within the nanotherapeutics by loading highly hydrophobic ptx . however , the loading of some other drug molecules may not be able to stabilize the micelle and may result in hemolysis when given intravenously . the cross - linking approaches are able to stabilize micelles and reduce hemolytic properties . however , the additional reagents and treatments for micelle cross - linking usually require extensive purification before in vivo administration , which may lead to the loss of drug molecules and will be a significant burden for clinical application in terms of quality control and regulations . therefore , there is a need to study the structure and hemolytic activity relationship of nanocarrier to eliminate the hemolytic potential , which could be studied via a series of structural modifications and the property characterization . cholic acid , the key building block in telodendrimers , is known to have strong membrane activity as a small - molecule surfactant . the stacking between the hydrophilic surfaces of cholic acid units via hydrogen bonding is essential to shelter the polar groups allowing for the insertion of a whole complex into the hydrophobic phospholipids bilayer membrane . we hypothesize that introducing bulky hydrophilic groups onto hydroxyl groups of ca may disrupt the compact interactions between the polar surfaces of cas and increase the polar surface area ( psa ) of the whole complex , therefore reducing the membrane activity of telodendrimers . in order to modify the telodendrimer with a well - defined structure , we chose the bottom - up approach to modify cholic acid before being conjugated onto the telodendrimer . glycerol or amino glycerol groups are introduced onto the cholic acid via ether bond formation with hydroxyl groups at the 3- and 7- or 12-positions . the core - forming subunits of the telodendrimers have been studied via molecular dynamics to study the conformations and the corresponding polar surface area ( psa ) to predict the membrane activities of the nanocarriers . further , the telodendrimer subunits with different glycerol substitution were synthesized directly and the membrane activities were tested to validate the theoretical predictions . the anticancer drugs , paclitaxel ( ptx ) and doxorubicin ( dox ) , were successfully loaded into the modified telodendrimer micelles . the drug loading capacity , stability , tumor targeting , and anticancer effects were systemically studied in vitro and in vivo . monomethylterminated poly(ethylene glycol ) monoamine hydrochloride(meo - peg - nh2hcl , mw : 5000 da ) was purchased from jenkem technology ( dallas , tx ) . paclitaxel ( ptx ) was purchased from ak scientific ( union city , ca ) . nirf dye did ( 1,1-dioctadecyl-3,3,3,3-tetramethylindodicarbocyanine perchlorate , d-307 ) , was purchased from invitrogen . tetrazolium compound [ 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2h - tetrazolium , mts ] and phenazine methosulfate ( pms ) were purchased from promega ( madison , wi ) . cholic acid ( ca ) , epichlorohydrin , diisopropyl carbodimide ( dic ) , n - hydroxybenzotriazole ( hobt ) , and all other chemicals were purchased from sigma - aldrich ( st . louis , mo ) . molecular dynamics simulations were carried out using the freely distributed gromacs 4.5.5 software package.h nmr spectra of the small molecules and polymers were recorded using bruker avance 600 mhz spectrometer in cdcl3 or dmso - d6 . particle sizes of micelle were measured using a dynamic lighter scattering ( dls ) particle sizer ( zetatrac , microtrac inc . ) and the area - based mean particle sizes were presented . the tem images of micelles were recorded on a transmission electron microscope ( jeol jem-2100 ) and samples were stained with uranyl aceate . vis nanodrop spectrometer and a simadzu hplc ( lc20at ) equipped with a c18 column and 55% mecn as mobile phase were used for detection of drug loading efficiency and drug release studies . fortessa ( becton dickinson , san jose , ca ) flow cytometer was used for cell uptake study , and ivis-200 small animal imager was used for in vivo tumor imaging . the nomenclature of the telodendrimers and the dimer molecules followed the system used in the previous studies : for example , telodendrimer pegca8 indicates that the molecular weight of peg is 5 kda and there are eight cholic acids conjugated on the periphery of dendritic polylysine . the additional functional groups on ca were described as ca-4oh , ca-5oh , ca-3oh - nh2 , representing one glycerol , two glycerols and one animoglycerol introduced onto cholic acid , respectively . the corresponding telodendrimers were named as peg(ca-4oh)8 , peg(ca-5oh)8 , peg(ca-3oh - nh2)8 , the dimer molecules were synthesized from ca and ca derivatives via a lysine ( k in abbreviation ) bridge and named as kca2 , k(ca-4oh)2 , k(ca-5oh)2 . the preparations of cholic acid derivatives and the dimer molecules are described in si . as reported in our previous procedure , telodendrimers have been prepared from meopeg - nh2 with 5000 da molecular weight via stepwise solution phase fmoc - peptide chemistry . briefly , fmoc peptide chemistry was used to couple ( fmoc)lys(fmoc)-oh onto the n - terminal of peg ( mw = 5 or 10 kda ) using diisopropyl carbodimide ( dic , 3 equiv ) and n - hydroxybenzotriazole ( hobt , 3 equiv ) as coupling reagents in dmf overnight . upon confirmation of negative results from the kaiser test for the reaction , chilled ether was added to the reaction solution to precipitate out the polymer , which was further washed twice with chilled ether . fmoc protecting groups were removed by treatment with 20% piperidine in dmf for 30 min , and polymer was precipitated and washed with cold ether . after three steps of repeated coupling of ( fmoc)lysine(fmoc)-oh and de - fmoc reactions , a dendritic polylysine was synthesized at one end of peg . then , the active nhs esters of ca derivatives ( shown in si ) reacted with the free amino groups at the periphery of polylysine in the presence of triethylamine . the dry polymer product was dissolved in water and purified via dialysis ( mwco : 3500 da ) against pure water . ptx was loaded into telodendrimer micelles via a dry - down ( evaporation ) method as described previously . briefly , 20 mg of telodendrimer along with 4 mg of paclitaxel were first dissolved in chcl3 and evaporated on rotavapor to obtain a homogeneous dry polymer film . the film was reconstituted in 1 ml phosphate - buffered solution ( pbs ) , followed by sonication for 30 min to allow micelle dispersion . no precipitation was observed with the monodispersed particle size from 15 to 30 nm during dls measurement , which indicated the complete drug loading . to track the biodistribution of nanoparticles , hydrophobic nirf dye did was coencapsulated with ptx into the micelles using the same method as described above . the particle sizes of the micelle solution were measured via a dls particle sizer . finally , the micelle formulation was filtered with a 0.22 m filter to sterilize the sample . the encapsulation of dox into the polymeric micelles was carried out by following the procedure described previously . briefly , 1 mg of dox - hcl was stirred with 3 mol equiv of triethylamine ( tea ) in chloroform ( chcl3)/methanol ( meoh ) ( 1:1 , v / v ) overnight to neutralize hcl in dox - hcl . ten mg of peg - ca8 or peg-(ca-4oh)8 telodendrimer was added into above dox solution in chloroform / methanol and mixed , evaporated on rotavapor to obtain a homogeneous dry polymer film , and further dried under high vacuum to further remove tea and solvents . the film was reconstituted in 1 ml phosphate - buffered solution ( pbs ) , followed by sonication for 30 min , allowing the sample film to disperse into micelle solution . the particle sizes of the micelle solution were measured via a dls particle sizer . finally , the micelle formulation was filtered with a 0.22 m filter to sterilize the sample . two ml of blood was added into 10 ml of pbs , and then red blood cells ( rbcs ) were separated from plasma by centrifugation at 1000 g for 10 min . the rbcs were washed three times with 10 ml of pbs solution , and resuspended in 20 ml pbs . two hundred l of diluted rbc suspension was mixed with polymers at serial concentrations ( 10 , 100 , 500 , and 1000 ug / ml ) by gentle vortex and incubated at 37 c . after 0.5 h , 4 h , and overnight , the mixtures were centrifuged at 1000 g for 5 min . the supernatant free of hemoglobin was measured by the absorbance at 540 nm using a uv vis spectrometer . rbcs incubation with triton-100 ( 2% ) and pbs were used as the positive and negative controls , respectively . the percent hemolysis of rbcs was calculated using the following formula : ptx loaded nanoformulations ( 500 ul ) were placed in the dialysis bags with the mwco of 3.5 kda and dialyzed against 4 five ul of drug solutions were sampled at the designed time intervals and pbs solution were refreshed at each measurement . the ptx concentrations were analyzed via hplc ( simadzu lc20 t ) equipped with a c-18 column , and mobile phase was 55% mecn / water . the releases of dox from the nanoformulations were also studied using the samiliar dialysis method . however , the dox concentration was monitored at 480 nm using uv vis absorbance ( nanodrop ) . the quantitative cellular uptake of various dox formulations by raji tumor cells was analyzed by flow cytometry . briefly , 3 10 raji cells were incubated with free dox , dox - peg - ca8 , or dox - peg - ca4 at different dox concentrations ( 1 , 3 , and 9 m ) for 30 min or 2 h at 37 c , respectively . then , the cells were washed with pbs three times and resuspended in pbs for the flow cytometry analysis using the fortessa ( becton dickinson , san jose , ca ) . cell - associated dox was excited with an argon laser ( 488 nm ) , and fluorescence was detected at 560 nm ; 10,000 events were collected for each sample . ovarian cancer cell line skov-3 , colon cancer cell line ht-29 , breast cancer cell line mda - mb-231 and lymphoma raji cell line were purchased from american type culture collection ( atcc ; manassas , va , u.s.a . ) . ovarian cancer cell line skov-3 , colon cancer cell line ht-29 , and lymphoma raji cell line were purchased from american type culture collection ( atcc ; manassas , va , u.s.a . ) . all these cells were cultured in mccoy s 5a ovarian cancer cell line skov-3 , colon cancer cell line ht-29 , breast cancer cell line mda - mb-231 and lymphoma raji cell line were purchased from american type culture collection ( atcc ; manassas , va , u.s.a . ) . skov-3 and ht-29 cells were cultured in mccov s 5a medium and mda - mb-231 and raji cells were cultured with rpmi 1640 medium supplemented with 10% fetal bovine serum ( fbs ) , 100 u / ml penicillin g , and 100 g / ml streptomycin at 37 c using a humidified 5% co2 incubator . skov-3 cells were seeded in 96-well plates at a density of 10,000 cells / well 24 h prior to the treatment . empty micelles and various formulations of ptx with different dilutions were added to the plate and then incubated in a humidified 37 c , 5% co2 incubator . after 72 h incubation , celltiter 96 aqueous cell proliferation reagent , which is composed of mts and an electron coupling reagent pms was added to each well according to the manufacturer s instructions . the cell viability was determined by measuring the absorbance at 490 nm using a microplate reader ( biotek synergy 2 microplate reader ) . results are shown as the average cell viability [ ( odtreat odblank)/(odcontrol odblank ) 100% ] of triplicate wells . female athymic nude mice ( nu / nu strain ) , 68 weeks age , were purchased from harlan . all animals were kept under pathogen - free conditions according to aaalac ( association for assessment and accreditation of laboratory animal care ) guidelines and were allowed to acclimatize for at least 4 days prior to any experiments . all animal experiments were performed in compliance with institutional guidelines and according to protocol approved by the committee for the humane use of animals of the state university of new york upstate medical university . a subcutaneous colon cancer xenograft mouse model was established by injecting 1 10 ht-29 or mda - mb-231 cancer cells in a 100 l of mixture of pbs and matrigel ( 1:1 v / v ) subcutaneously at the right flank in female nude mice . nude mice with subcutaneous tumors of an approximate 810 mm in diameter were subjected to in vivo nirf optical imaging . at different time points postinjection of did- and ptx - coloaded micelles formed by telodendrimer ii ( the mass ratio of did and ptx within nanocarrier was 0.25:1:10 ) , mice were scanned using a ivis-200 small animal imager at cy5.5 excitation and emission channels . the mice were anaesthetized by isofluorane gas before and during each imaging . after in vivo imaging , animals were euthanized by co2 overdose at 48 or 72 h after injection . tumors and major organs were excised and imaged with the ivis-200 small animal imager . advanced molecular dynamics simulations were performed to identify the most stable structures of ca dimers in polar ( water ) and nonpolar ( decane ) solvents . the initial structures of ca dimers were generated in the chembio 3d ultra 13.0.0.3015 software followed by molecular dynamics simulations in gromacs molecular dynamics package 4.5 . gromos96 45a3 force field was used to model ca dimers and decane , while water was modeled using the spc / e potential . each of the dimers was subjected to energy minimization in vacuum using the steepest decent algorithm ; however , to explore the potential energy landscape and to identify a global minimum energy geometry , simulated annealing ( sa ) method was employed . for each of the ca dimers , a set of 1000 independent annealing simulations were performed from randomly selected starting structures generated by a canonical nvt ensemble simulation run at t = 1000 k. the annealing was then performed by gradually reducing the temperature from 1000 to 5 k over 1 ns . each of the 1000 independent annealing profiles were analyzed to identify the one that led to the most stable structure . the minimum energy structure was then solvated in water and decane and equilibrated using isothermal isobaric npt ensemble at t = 300 k. the production molecular dynamics runs were performed at 300 k for 100 ns to calculate the average psa and representative equilibrium structure geometries . cholic acid , the key building block in telodendrimers , is known to have strong membrane activity as a small - molecule surfactant . the membrane activity of the telodendrimer micelles is believed due to the facial amphiphilic structure of ca subunit , which self - assembles through hydrogen bonding with the hydrophobic surfaces exposed to the lipid bilayer . it has been reported that the oligomer of cholic acid ( so - called molecular umbrella ) can effectively deliver hydrophilic biomacromolecules through the phospholipid bilayer membrane . also , the insertion of the assembled dimers or tetramers of ca into the phospholipid s bilayer membrane have been reported to form artificial ion channels , where hydrophilic hydroxyl groups are sheltered from the hydrophobic lipids . therefore , the disruption of the packing between the hydrophilic surfaces of oligo - cholic acid is expected to reduce the plasma membrane lytic activity of these types of molecules and the peg - block - oligoca telodendrimers . in this study , glycerol and amino - glycerol have been introduced into the 3- and 7-oh or 12-oh groups of ca via ether bond formation to increase the steric hindrance while maintaining the facial amphiphilicity of ca ( scheme 1 ) . reagents and conditions : ( i ) tfaa , anhydrous thf , 05 c , 1.5 h ; ( ii ) t - buoh , below 5 c , then at rt for 7 h ; ( iii ) nh3h2o ( 2030% ) , 05 c for 12 h , then rt for 4 h ; ( iv ) epichlorohydrin , 50% naoh , ( n - bu)4noh30 h2o , ch2cl2 , rt , 16 h ; ( v ) nh3 in meoh ( 7 m ) , licl ( 1.2 equiv ) in a sealed container , rt , 24 h ; ( vi ) fmoc - osu ( 1.2 equiv ) , diea ( 1.5 equiv ) , ch2cl2 , 12 h ; ( vii ) 50% tfa in ch2cl2 , 0 c , 30 min ; ( iii ) lioh water solution ( 10 equiv ) , rt , 1836 h ; ( ix ) hosu ( 1.2 equiv ) , dcc ( 1.2 equiv ) , ch2cl2 , rt , 12 h. first , the carboxylic acid of ca was protected via an acid labile tert - butyl ester via an intermediate of the hybrid anhydride with trifluoroacetic acid ( tfa ) . a white powder of ca tert - butyl ester 1 was obtained with a yield over 97% . next , epichlorohydrin was conjugated onto hydroxyl groups of ca in the presence of aqueous sodium hydroxide . through flash column , the monosubstituted 2 and diepoxy substituted compound 3 it should be mentioned that the diepoxy - substituted compound 3 may be a mixture of the compounds of 3,5-disubstituted and 3,7-disubstituted species due to the similar reactivity of 5-oh and 7-oh groups . it was evidenced via the partial decrease of the proton signals on both 5 and 7 carbons ( 3.82 and 3.93 ppm ) , which corresponds to the c h with the unsubstituted hydroxyl groups ( figure s1 in si ) . in addition , two new peaks appeared at 3.3 and 3.4 ppm , indicating the graft of glycerol onto both 5 and 7 carbons via ether groups . in this study , we did not attempt to separate these two isomers , since they may have very similar physical properties in telodendrimers . the tert - butyl ester of mono- and diepoxy - substituted compounds 2 and 3 were cleaved via a treatment with 50% of tfa in dcm at 0 c . in the next step , the epoxy groups were opened via the treatment with lithium hydroxide solution to yield diol derivatives 4 and 5 at yields of 84.4% and 36.5% , respectively . in addition , monoepoxy - derived compound 2 was treated with an nh3 solution in methanol in the presence of licl as a catalyst to introduce amino groups on the polar surface of ca ( compound 6 ) . furthermore , free amine in compound 6 was protected via fmoc - osu , then tert - butyl ester in compound 7 was removed via the treatment of 50% tfa in dcm to yield fmoc - protected amino cholic acid 8 with an 88.4% yield after flash column purification . all the ca derivatives with free carboxylic acids 4 , 5 , and 8 were activated via coupling with hosu using dcc as a condensation reagent to yield active esters 9 , 10 , and 11 , respectively , for telodendrimer conjugation . all the nmr spectra ( figure s1 in si ) and mass spectra ( figure s2 in si ) indicated the correct chemical structures of these intermediates of ca derivatives . following our previous procedure , we further synthesized the telodendrimers i , ii , iii , and iv ( scheme 2 ) via liquid peptide chemistry using ca and ca derivatives as building blocks to cap the periphery of dendritic polylysine . the proton signal of 3-oh on ca disappeared in telodendrimers ii and iv , and new hydroxyl groups on glycerol and amino - glycerol appeared in telodendrimers ii and iv , indicating the expected 3-position glycerol substitution . five hydroxyl groups on diglycerol - substituted compound 5 were observed in the proton nmr spectrum ( figure s1 in si ) , which was also shown in the nmr spectrum of telodendrimer iii . the complete disappearance of the 3-hydroxyl group and the partially decreased proton signals of both 7- and 12- hydroxyl groups on ca in telodendrimer iii were observed in the nmr spectrum ( figure 1 ) . in addition , the substitution on 12-oh caused the proton signal of c-18 methyl groups shifted partially toward the low field from 0.57 to 0.60 ppm . similar phenomena have been reported in the literature . the above nmr results indicated that ca-5oh derivative may have two different isomers , e.g. 3,7- and 3,12-disubstitutions . the number of cholic acid and its derivatives coupled onto the telodendrimer were calculated to be 7.47.6 ( theoretical number of 8) via the integration of peg proton signal and 18-methyl group on cholic acid . as expected , the engineered telodendrimer ii peg(ca-4oh)8 micelles exhibited negligible hemolytic properties compared with typical telodendrimer i pegca8 ( figure 2 ) after incubation with red blood cells for both 4 and 20 h at 37 c . after being loaded with ptx , peg(ca-4oh)8 micelles were observed to be nonhemolytic up to 1 mg / ml after 20 h incubation . however , 100% and 50% hemolysis were caused by the original telodendrimer i pegca8 before and after ptx loading , respectively , at the same 1 mg / ml concentration . telodendrimer iv with amino - derived cholic acid as building block shows almost 100% hemolysis even at a concentration as low as 0.1 mg / ml for a 4 h incubation period ( figure 2 ) . it is due to the positive charges on this telodendrimer iv increasing the interaction with negatively charged cell membrane . very surprisingly , much more hydrophilic telodendrimer iii with five hydroxyl groups on each cholic acid scaffold also showed significant hemolysis at high concentrations of about 0.5 to 1 mg / ml after 4 h incubation , which was even higher than the parent telodendrimer pegca8 ( figure 2 ) . it has been reported that the bulky hydrophilic block in an amphiphilic polymer may disturb the liquid crystalline packing of lipid bilayer in addition to the effect brought by the hydrophobic block alone . in particular , block copolymers having branched polyglycerol as hydrophilic blocks show a far more pronounced effect on membrane structure as compared to copolymers with linear peo blocks . however , it is still unclear why the plasma membrane lytic activity of telodendrimers varied with the number of glycerols introduced on ca . proton nmr spectra of the telodendrimers with ca and ca derivatives as building blocks . hemolytic properties of telodendrimers with different glycerol modifications and with / without ptx loading after incubation with human red blood cells for 4 h ( a ) and 20 h ( b ) . the triplicated data are presented as mean sd ( * : p < 0.05 ; * * : p < 0.005 ) . although , it is not easy to study the interactions between micelles and plasma membrane directly via molecular simulation at the atom level , we could apply these approaches to study the conformations of the hydrophobic subunits of the telodendrimers , which directly interact with plasma membrane . it is believed that the plasma membrane lytic activity of a polymer micelle solution are caused by a small portion of the free amphiphilic polymers existing in solution rather than the intact micelles which are covered by a layer of inert hydrophilic polymer . polar surface area ( psa ) is commonly used to characterize the permeability of a drug molecule . a small molecule with a psa less than 1.40 nm is likely to be able to penetrate through the cell membrane . therefore , the psa of the polymer subunits can be used to compare their membrane activities . the density of the polar functional groups , i.e. hydroxyl groups in cholic acid , contributes to the psa of telodendrimers . a dimer of cholic acids bridged via a lysine , kca2 , is a subunit of telodendrimer i , which was calculated to have 3.15 nm of psa solely based on the functional group contribution . however , the varying conformation of a molecule may change its topological polarity significantly . therefore , the stable conformation of the kca2 was studied via simulated annealing molecular dynamics simulations . the psa of the most stable conformations were calculated on the basis of the topology of the molecules . energy - minimized folded conformations of the ca dimers ( in vacuum ) with varying glycerol substitutions displayed in two modes and orientations . as shown in figure 3 , a hand - in - hand like hairpin conformation of kca2 with the efficient shelter of their hydroxyl groups at the interface of the complex formed via hydrogen bonding . a majority of kca2 hydrophobic surface is exposed , which favors membrane insertion and may directly contribute to the observed hemolytic properties . a considerably reduced psa of kca2 with the minimized energy was calculated in vacuum to be 1.08 nm ( table 1 ) , which was much smaller than the psa solely based on the functional group contributions ( 3.15 nm ) . in a biological system , the interaction of polymers with the plasma membrane occurs in an aqueous condition . therefore , a comparison of the psa of ca dimers in the presence of water molecules may be more representative for the membrane activity of the free amphiphilic molecules in water . on the other hand , the disintegrated polymer micelle may merge with the cell membrane from the exposed hydrophobic core , especially when nanoparticles are chemically or physically anchored onto the cell membrane via targeting ligands or nonspecific interactions . in this case , the core - forming ca dimers aggregate in the hydrophobic core of the micelles . therefore , the conformations of the ca dimers were equilibrated in hydrophobic decane to probe these scenarios . it is noticed that the molecules have small psa after being simulated in vacuum . after equilibration with the solvent molecules ( water or decane ) at 300 k for 100 ns , solvent molecules could insert into the folded structures . the hydroxyl groups were exposed more , and the psa increased , especially in aqueous conditions ( table 1 ) . however , the dimer molecules still remained in the folded conformations restricted by the hydrogen bonding . the stable structures in vacuum were first obtained by the simulated annealing process and then solvated in water or decane at 300 k and equilibrated . the production md simulation runs were performed at 300 k for 100 ns to calculate the average psa and the equilibrium structure geometries . according to our hypothesis , we expect to see the increased psa and the disrupted folding of the ca dimers after introducing bulky hydrophilic groups to ca . the molecular dynamics simulations revealed that the single - glycerol modified ca dimer , k(ca-4oh)2 , also forms a hairpin - like folded conformation via hydrogen bonding ( figure 3 ) . compared to kca2 the k(ca-4oh)2 dimer resulted in a lower - energy structure ( figure s3 in si ) using a simulated annealing approach that is attributed to the enhanced hydrogen bonding . however , as shown in figure 3 , the extra hydroxyl groups are exposed to the solvent molecules at the bottom of the molecular clips . as expected , the k(ca-4oh)2 dimer possesses a higher psa in vacuum ( 1.19 nm ) and after equilibration in water ( 1.65 nm ) or decane ( 1.34 nm ) , which may prohibit the insertion of the telodendrimer into the hydrophobic lipid bilayer membrane . as shown in figure 3 , the ca dimer with diglycerol modification , possessing five hydroxyl groups on each cholic acid , k(ca-5oh)2 , forms a very stable folded conformation via an extensive hydrogen - bonding network . the stable conformations of folded k(ca-5oh)2 lead to the highest energy stabilization ( figure s3 in si ) during the annealing and folding process compared to other ca modifications . most polar groups have been sheltered within the folded conformation , and the psa was calculated to be the smallest at 1.04 nm for k(ca-5oh_7)2 in vacuum , which is even smaller than that for kca2 in the original telodendrimer i. the possible isomers of the disubstituted ca dimers with the second glycerol on the 7 or 12 position ( e.g. , k(ca-5oh_7)2 ; k(ca-5oh_12)2 and k(ca-5oh_7/12)2 ( figure s4 in si ) ) have the similar small psa values and low binding energies during the simulated annealing process ( figure s3 in si ) . the smaller psa and stable conformation both contribute to the hemolytic activity of the telodendrimer iii . as shown in figure 3 , the subunit of telodendrimer iv , k(ca-3oh - nh2)2 , also formed a folded conformation via hydrogen bonding to partially shelter the polar groups after equilibration through molecular dynamics simulations . the psa of the amino - derived ca dimer with an energy - minimized folded conformation was calculated to be higher , 1.21 nm in vacuum , which is further increased to 1.43 nm upon protonation . however , the positively charged amino groups are located at the bottom of the resulting ca dimers , which are believed to induce stronger electrostatic interactions with phospholipid bilayer cell membranes . accordingly , a 100% hemolysis was observed for telodendrimer iv even at 0.1 mg / ml after a 4 h incubation ( figure 2 ) , which is the combination of charge and hydrophobic effects . structure of the cholic acid dimers with different glycerol substitution prepared via solution - phase organic synthesis ( a ) ; hemolytic properties of small - molecule dimers of cholic acid with different glycerol modifications after incubation with human red blood cells for 30 min ( b ) and 4 h ( c ) . the triplicate data are presented as mean sd ( * : p < 0.01 ; * * : p < 0.001 ) . the above molecular simulation studies have clearly revealed the potential spr between ca modification and the hemolytic activity of telodendrimers . however , the direct validation of the computational simulation might be essential for applying these approaches to study the spr of nanocarriers . therefore , cholic acid dimers studied in molecular simulation were synthesized and evaluated . cholic acid dimers with the different glycerol substitution were prepared via solution - phase peptide chemistry ( figure 4a ) . as shown in the si , k(ca)2 , k(ca-4oh)2 , and k(ca-5oh)2 have been characterized with proton nmr ( figure s5 in si ) and maldi - tof ms ( figure s6 in si ) , demonstrating the right structures . the hemolysis properties of these three dimers were tested directly via red blood cell incubation . it is expected that these small molecules showed higher hemolysis compared with telodendrimers , due to the lack of peg sheltering . as predicated in the md simulation , the k(ca-4oh)2 exhibited a significantly lower membrane activity in hemolysis assays than both k(ca-5oh)2 and k(ca)2 for 30 min and 4 h incubation ( figure 4b , c ) . it was also observed that unmodified k(ca)2 showed a significantly higher membrane activity than k(ca-5oh)2 , especially at relatively low concentration of 0.1 mm . however , telodendrimer i pegca8 showed significantly lower hemolysis than telodendrimer iii peg(ca-5oh)8 after 4 h incubation ( figure 2a ) . this may due to the better integrity of pegca8 micelles with the relative low cmc ( as discussed below ) compared with peg(ca-5oh)8 micelles , which are more hydrophilic with higher cmc . the dynamic nature of peg(ca-5oh)8 micelles makes them readily interact with the plasma membrane . ( a ) dls particle sizes of telodendrimer i and ii and the micelles loaded with ptx and dox . the mean particle sizes are presented based on area - distribution ; ( b ) tem images of telodendrimer ii after being loaded with ptx and dox , respectively , with uranyl acetate staining ( scale bar : 100 nm ) . the above chemical modifications of ca on the hydrophilic surface maintained the facial amphiphilic property of ca within the telodendrimer , which ensured the formation of micellar nanoparticles for drug loading . however , such modification on ca increased the critical micellization concentrations ( cmcs ) of the telodendrimers . the cmcs were measured via the classic pyrene 1:3 method to be 17.4 g / ml , 24.2 g / ml , 95.9 g / ml and 49.3 g / ml for telodendrimers i , ii , iii , and iv , respectively ( figure s-7 in si ) . the significantly increased cmcs for telodendrimers iii and iv indicated the higher free polymer concentration in micelle solutions , which may further contribute to the enhanced hemolytic properties . the telodendrimer ii peg(ca-4oh)8 showed similar particle size and stability before and after ptx loading at 3/20 drug / polymer ratio , compared with the original telodendrimer i pegca8 , due to the similar structures and cmcs . in addition , telodendrimers i and ii both exhibited good loading capacity and stability for another anticancer drug , doxorubicin ( dox ) , at 1/10 drug / polymer w / w ratio . the particle sizes have been detected via dls to be 34 and 19.5 nm with narrow distribution , respectively ( figure 5a ) . at these ptx and dox loading ratios , clear micelle solutions were obtained without any drug precipitation observed both by eye and by dls analysis , which indicated the complete drug loading efficiency . further , no drug precipitation was observed from these ptx and dox nanoformulations after storages for weeks at 4 c . the tem studies have revealed the spherical micelles formed by telodendrimer i before and after ptx and dox encapsulation . in this study , we also utilized tem to study the morphology of the nanoparticles formed by peg(ca-4oh)8 . narrow dispersed , homogeneous spherical nanoparticles were observed ( figure 5b ) , which is similar to the dls analysis ( figure 5a ) . on the contrary , telodendrimer iii can only assemble into smaller particles with heterogonous distributions , e.g. 1 nm and 5 nm sizes . it is due to the overwhelming hydroxyl groups introduced to the ca polar surface , which broke the balance of the amphiphilicity of telodendrimers . after ptx loading ( 2:10 , w / w , ptx / iii ) , the sizes of the micelles increased to 62 nm with a small portion of larger sizes at 295 nm ( figure s8 in si ) . telodendrimer iv was observed to aggregate into micelles about 343 nm in size in pure water solution , which were reduced to about 11 nm upon adjusting ph to 5.5 due to the increased polarity and charge repulsion of positively charged amino groups . such ptx - loaded nanoparticles ( 2:10 w / w ptx / iii ) exhibited heterogeneous size distribution of 51 and 341 nm in pbs ( figure s9 in si ) , which is not preferred for in vivo applications . the drug release of both ptx and dox from the telodendrimer ii were observed to be slightly slower than those from telodendrimer i ( figure 6a , b ) , which may due to the stronger hydrogen bonding . ptx released slowly from both nanocarriers with 50% drug release at about 18 h ; in contrast , burst releases were observed for dox and 50% of drug released at 8 h , due to the better water solubility of drug molecules . accumulative drug release profile of ptx and dox loaded in the nanocarrier formed with telodendrimer i ( a ) and monoglycerol derived telodendrimer ii ( b ) ; quantitative flow cytometry analysis of the cellular uptake of various dox formulations by raji cells after 30 min ( c ) and 2 h ( d ) incubation at three drug concentrations . the cell viability assays to evaluate the cytotoxicity of telodendrimer ii and the anticancer effects of the micelles loaded with ptx ( e ) and dox ( f ) on the skov-3 ovarian cell line and raji lymphoma cell line , respectively . given the lowered membrane activity for telodendrimer ii , one may ask whether it will decrease the cell uptake and lower the efficacy of the encapsulated chemodrugs ? to address this issue , we performed the quantitative flow cytometry study to analyze the cell uptake of the chemodrugs . doxorubicin is a fluorescent anticancer drug molecule , which was loaded in nanocarriers for cell uptake study in flow cytometry experiments . as shown in figure 6c , d , the quantitative flow cytometric analysis demonstrated the similar cell uptake for free dox and dox loaded in telodendrimer micelles in raji cells after 30 min and 2 h incubation at different drug concentrations . the cellular uptakes of all dox formulations were in concentration- and time - dependent patterns . furthermore , the in vitro cytotoxicity studies ( figure 6f ) revealed the similar anticancer effects on the raji lymphoma cells for the free dox and dox loaded in the nanocarriers i and ii after 72 h incubation . additionally the ptx - loaded telodendrimer ii ( ic50 : 1.6 ng / ml ) and ptx - loaded telodendrimer i ( ic50 : 3.4 ng / ml ) exhibited slightly higher anticancer effects than free ptx ( ic 50:14.5 ng / ml ) formulated in a mixture of cremophore el and ethanol ( 1:1 v / v ) in an ovarian cancer cell line , skov-3 ( figure 6e ) . this may be due to the partial precipitation of ptx from the cremophore formulation after dilution with cell culture medium . overall , the telodendrimer ii was nontoxic up to 0.5 mg / ml concentration for both cell lines . ex vivo biodistribution of telodendrimer nanocarrier ii loaded with ptx and nirf dye did in colon cancer - bearing nude mice after 48 h postinjection via tail vein ( a ) ; the comparison of the average fluorescence intensity in various organs and ht-29 tumors between the animals given did - ptx - np ii or free dye did ( b ) ; ex vivo biodistribution of telodendrimer nanocarrier ii loaded with ptx and nirf dye did in breast cancer bearing nude mice after 72 h postinjection via tail vein ( c ) ; quantitative analysis of the average fluorescence intensity in various organs and mda - mb-231 tumors between the animals given did - ptx - np ii or free dye did ( d ) . as reported in our previous studies , telodendrimer i nanocarrier was able to target various solid tumors efficiently in animal models . therefore , we would like to further evaluate the biodistribution and tumor targeting properties of the optimized telodendrimers in solid tumor xenograft models , such as colon and breast cancers after intravenous injection of telodendrimer ii micelles coloaded with nirf dye did and ptx . did is a hydrophobic near - infrared fluorescence cyanine dye , which could be stably entrapped within nanocarrier with very slow release profile ( figure s-10 in si ) and could be used as a surrogate to probe the distribution of the nanocarriers . as shown in figure 7 , the ex vivo images revealed the highest uptake of fluorescent signal in tumors compared to other organs in both tumor types . the same targeting effects for telodendrimer i were also observed previously in animal models bearing solid tumors . the free did administration led to a relatively low accumulation in tumors and significant high deposition in lung , liver , and spleen , which were significantly reduced in animals treated with the nanoformulations . as shown in figure 7b and figure 6d , nanocarriers might be able to deliver much higher concentrations of hydrophobic drug molecules to tumor sites ( 24 fold ) , compared with the free did injections . with the enhanced in vivo anticancer effects for the ptx formulated in telodendrimer i nanocarriers , we anticipate these nonhemolytic nanotherapeutics formed by telodendrimer ii will further improve the anticancer effects via efficient tumor - targeted drug delivery . the further pk / pd studies and the in vivo efficacy of this optimized nanocarrier in delivering different chemodrugs in animal models will be tested and reported in a separate account . the spr of a telodendrimer system in interacting with plasma membranes has been clearly revealed via computational and experimental approaches . to minimize the hemolytic properties of telodendrimer nanocarriers , we took a rational approach to modify telodendrimer structures by introducing hydrophilic glycerol or amino - glycerol groups onto the polar surface of cholic acid . with the aid of molecular dynamics simulations , we had a better understanding of the relationship between plasma membrane lytic activity and the structural conformations of the amphiphiles . the introduction of hydrophilic monoglycerol onto the polar surface of cholic acid was predicated via molecular dynamics to be optimal in disrupting the molecular folding of the subunit of telodendrimer and increasing the polar surface area of the complex . on the contrary , introduction of two glycerols or an amino - glycerol on each cholic acid led to the increased hemolytic properties of the resulting telodendrimers , which were correlated with the decreased psa and the exposed positive charges in the molecular dynamics simulations , respectively . further , the computation results have been verified in the experiments via the synthesis of the telodendrimer subunits , which were tested to be consistent with the theoretical prediction for the membrane activities . such spatial modification of ca via monoglycerol grafting sustained the balance of the facial amphiphilicity of ca , therefore maintaining the ptx and dox loading capacity , stability , and anticancer effects of the nanotherapeutics . given the nonhemolytic property , efficient cancer cell uptake , and the excellent in vivo tumor - targeted properties , the monoglycerol derivatized telodendrimer ii has been demonstrated as a promising nanocarrier for efficient anticancer drug delivery .

a series of telodendrimer ( a linear polyethyelene glycol - block - dendritic oligo - cholic acid ) have been synthesized via a bottom - up approach to optimize the hemocompatibility of the nanocarrier . numbers of hydrophilic glycerol groups were introduced onto the polar surface of cholic acid to reduce the plasma membrane lytic activity of telodendrimers . an interesting result was observed : only an optimum number of glycerol introduced could reduce the hemolytic properties of the nanocarrier ; on the contrary , more glycerols or the amino - glycerol substitution onto cholic acid significantly increased the hemolytic properties of the nanocarriers . to further elucidate the structure property relationship , the molecular dynamic approach was used to simulate the conformation of the subunits of telodendrimers with different glycerol substitution , and the binding energies and the polar surface areas of the hairpin conformations were calculated to explain the membrane activities of nanocarriers . in addition , these telodendrimer subunits were synthesized and their membrane activities were tested directly , which validated the computational prediction and correlated with the observed hemolytic activity of nanocarriers . the glycerol substitution sustained the facial amphiphilicity of cholic acid , maintaining the superior drug loading capacity ( paclitaxel and doxorubicin ) , stability , cell uptake , and anticancer efficacy of payloads . the in vivo optical imaging study indicated that the optimized nanocarriers can specifically deliver drug molecules to the tumor sites more efficiently than free drug administration , which is essential for the enhanced cancer treatment .

Introduction Experimental Section Results and Discussion Conclusions

plasmatic viral load strongly predicts t cd4 cell count decline , aids progression and death . anyway , disease prognosis in hiv infected subjects is more rigorously defined by the combination of plasmatic viral load quantification and t cd4 cell count.1 it is internationally noted that the main predictive factors for failure of antiretroviral therapy are t cd4 cells low count and elevated viral load before commencing treatment.2 the efficacy of the highly active antiretroviral therapy ( haart ) and the pattern of therapy management could be evaluated based on plasmatic rna viral load assessement . in hiv / aids treatment the response is considered successful when the hiv rna levels remain undetectable by certified commercial assays , notwithstanding in a variable proportion of haart submitted patients , the viral replication and evolution goes on which could eventually contribute to the development of antiretroviral drug resistance and therapeutic failure.3 unsuccessful antiretroviral therapy could occur due to virologic and immunologic failure and clinical manifestations that can appear during the course of hiv infection . the identification of therapeutic failure is based on patient follow - up during treatment , taking into account the initial level of t cd4 , plasmatic hiv rna load and the patient clinical evolution . also , many factors could be related to therapeutic failure such as low treatment adhesion , insufficient drug dosage , mal - absorption , hiv antiretroviral resistance and drug interactions that could reduce the efficacy and hiv resistance to antiretroviral medications . patients that failed to respond to antiretroviral therapy confirmed by the genotype resistant assay will be guided to choose new drugs . this choice is based on the knowledge of previous treatments and yet the reason to remove a drug from the antiretroviral regimen is mainly justified by the in vitro antiretroviral resistance profile . the antiretroviral therapeutic suspension as an alternative therapy is based on the reemergence of the initial virus population before treatment initiation , which would be susceptible to the antiretroviral drugs earlier prescribed , so this proposal is presently under evaluation . the essential objective of treatment in patients presenting therapeutic failure is to maintain t cd4 acceptable cell population density , whilst new therapeutic options are awaited , contrary to the priority aim to reach and keep up an undetectable viral load.4 according to moore et al,5 virological failure is characterized by viral load higher than 400 copies / ml after 48 weeks of initial treatment or among subjects that had complete viral suppression , but later on the viral load will recrudesce . the viral failure precedes the immunologic failure which is defined by a decline of more than 25.0% in the subsequent count of t cd4 lymphocytes or regresion to the initial t cd4 cell count before treatment . these conditions are mainly suggestive of immunologic failure but laboratory analysis confirmation is mandatory.6 cozzi - lepri et al7 concluded that patients remaining in haart failure presented viral load slowly progressing during the next 12 months , differently to t cd4 cell count which remained stable . the impact of haart on t cd4 cell count and viral load of hiv infected patients has been demonstrated to improve the patient s immunological status and it also diminished the viral load , interrupting the aids progression.8 however there are crucial limitations of haart regimen , as it does not eradicate viral infection despite long and permanent antiretroviral therapy . consequently , a significant number of these patients on haart therapy develop viral resistance to the drugs besides diverse side effects including metabolic disorders . therefore new approaches are necessary to control and/or eradicate hiv infection.9,10 this research work aimed to analyze t cd4 cell density and viral load response in hiv infected patients undergoing different therapeutic regimens which failed virologically , and also the associated factors to it during 20022008 in brasilia , federal district , brazil . a cohort study was conducted in the health center number 01 attached to the secretary of health , federal district ( ses / df ) ( centro de sade nmero 01 , secretaria de sade do distrito federal ) which included 139 hiv-1 infected patients . the patients had clinical and laboratory diagnosis as defined by the 1993 aids clinical course criteria and by the us center for disease control ( cdc)11 and also by the recommendations of the brazilian consensus of antiretroviral therapy in infected adults and adolescents by the ministry of health , secretary of health surveillance , brazilian national program of sexually transmitted diseases and aids.12 patients selected for the study were identified in the records of logistic system of the ministry of health , siclom13 utilized by the hospital dia , ses / df . the plasmatic hiv rna load was quantified by the bdna system 340 presenting sensitivity of less than 50 copies / ml . the t cd4 helper lymphocytes count was carried out by automatized flow cytometry utilizing the facscalibur count system . the sampling utilized for patient selection was by convenience whose inclusion criteria were : ( a ) age higher than 18 years old and of both sexes ; ( b ) hiv infection diagnosis defined by the brazillian ministry of health standardized patterns ; ( c ) detectable viral load previous to haart beginning > 400 copies / ml ; ( d ) t cd4 cell count < 500 cells / mm before haart regimen initiation ; ( e ) present laboratory analysis for viral load and t cd4 count between 6 and 12 months in order to compare the former ones with those of baseline ; ( f ) patients have had clinical and immunological follow up during 3 months intervals . if undetectable viral load of 50 copies / ml was not sustained during 24 weeks of treatment or higher than 400 copies / ml after 48 weeks treatment , it was considered virological failure to the initial antiretroviral therapeutic regimen.5 immunological failure was considered by the declining of t cd4 cell counting 25.0% of the absolute values6 or by returning to the t cd4 cell count initial values before antiretroviral therapy initiation . the viral load previous to haart regimen initiation and t cd4 cell count were evaluated as possible predictors of viral failure leading us to establish the cut off values to viral load > 100.000 copies / ml or 100.000 copies / ml as also t cd4 > 200 cells / mm or 200 cells / mm . the antiretroviral therapy regimen were : ( a ) double with two nucleoside reverse transcriptase inhibitor and non nucleoside reverse transcriptase inhibitor ; ( b ) triple with two nucleoside reverse transcriptase inhibitor and one protease inhibitor and ( c ) three nucleoside reverse transcriptase inhibitor , according to cdc classification and the brazilian ministry of health guidelines as previously described . in the population here studied , the chosen antiretroviral regimen was decided by the physician in charge without interference by the authors of this research work . the criteria for the diagnosis of hepatitis b and c virus infection followed the guidelines established by the manual of viral hepatitis consultancy , secretary of health surveillance , department of epidemiological surveillance , braslia , ministry of health14 and also for the tuberculosis diagnosis , the technical manual for tuberculosis control , notebook of basic attention , secretary of health politics , department of basic attention , braslia . ministry of health.15 the exclusion criteria for this research were : ( a ) be pregnant or minor under 18 years old ; ( b ) be prescribed with medications which could metabolically interact with antiretroviral drugs , including phytotherapics ; ( c ) have had last clinical appointment in a period longer than 6 months which was considered lost to follow - up . the analysis of baseline characteristics ( initial data previous to initiation of treatment referring to t cd4 cell count and viral load ) included frequency tables of categorical variables and their descriptive statistics ( median , arithmetic mean and standard deviation ) as also as continuous variables . in order to measure the dependent association between two categorial variables it was utilized the chi - square test ( x ) or when necessary the exact fisher test . to compare before and after results the macnemar test was applied . for the analysis of logistic regression and to predict the event of virological failure16 ( depedent variable ) , the wald method was applied . the association measurement calculated from the logistic model is the adjusted odds ratio ( or ) . the patients data were confidential and consentment to utilize information were obtained at the health center number 01 direction according to the federal district secretary ( ses / df ) of health agreement . the research work protocol was approved by the federal district secretary of health researh ethics committee , foundation of teaching and research in health sciences ( fepecs ) . a cohort study was conducted in the health center number 01 attached to the secretary of health , federal district ( ses / df ) ( centro de sade nmero 01 , secretaria de sade do distrito federal ) which included 139 hiv-1 infected patients . the patients had clinical and laboratory diagnosis as defined by the 1993 aids clinical course criteria and by the us center for disease control ( cdc)11 and also by the recommendations of the brazilian consensus of antiretroviral therapy in infected adults and adolescents by the ministry of health , secretary of health surveillance , brazilian national program of sexually transmitted diseases and aids.12 patients selected for the study were identified in the records of logistic system of the ministry of health , siclom13 utilized by the hospital dia , ses / df . the plasmatic hiv rna load was quantified by the bdna system 340 presenting sensitivity of less than 50 copies / ml . the t cd4 helper lymphocytes count was carried out by automatized flow cytometry utilizing the facscalibur count system . the sampling utilized for patient selection was by convenience whose inclusion criteria were : ( a ) age higher than 18 years old and of both sexes ; ( b ) hiv infection diagnosis defined by the brazillian ministry of health standardized patterns ; ( c ) detectable viral load previous to haart beginning > 400 copies / ml ; ( d ) t cd4 cell count < 500 cells / mm before haart regimen initiation ; ( e ) present laboratory analysis for viral load and t cd4 count between 6 and 12 months in order to compare the former ones with those of baseline ; ( f ) patients have had clinical and immunological follow up during 3 months intervals . if undetectable viral load of 50 copies / ml was not sustained during 24 weeks of treatment or higher than 400 copies / ml after 48 weeks treatment , it was considered virological failure to the initial antiretroviral therapeutic regimen.5 immunological failure was considered by the declining of t cd4 cell counting 25.0% of the absolute values6 or by returning to the t cd4 cell count initial values before antiretroviral therapy initiation . the viral load previous to haart regimen initiation and t cd4 cell count were evaluated as possible predictors of viral failure leading us to establish the cut off values to viral load > 100.000 copies / ml or 100.000 copies / ml as also t cd4 > 200 cells / mm or 200 cells / mm . the antiretroviral therapy regimen were : ( a ) double with two nucleoside reverse transcriptase inhibitor and non nucleoside reverse transcriptase inhibitor ; ( b ) triple with two nucleoside reverse transcriptase inhibitor and one protease inhibitor and ( c ) three nucleoside reverse transcriptase inhibitor , according to cdc classification and the brazilian ministry of health guidelines as previously described . in the population here studied , the chosen antiretroviral regimen was decided by the physician in charge without interference by the authors of this research work . the criteria for the diagnosis of hepatitis b and c virus infection followed the guidelines established by the manual of viral hepatitis consultancy , secretary of health surveillance , department of epidemiological surveillance , braslia , ministry of health14 and also for the tuberculosis diagnosis , the technical manual for tuberculosis control , notebook of basic attention , secretary of health politics , department of basic attention , braslia . ministry of health.15 the exclusion criteria for this research were : ( a ) be pregnant or minor under 18 years old ; ( b ) be prescribed with medications which could metabolically interact with antiretroviral drugs , including phytotherapics ; ( c ) have had last clinical appointment in a period longer than 6 months which was considered lost to follow - up . the analysis of baseline characteristics ( initial data previous to initiation of treatment referring to t cd4 cell count and viral load ) included frequency tables of categorical variables and their descriptive statistics ( median , arithmetic mean and standard deviation ) as also as continuous variables . in order to measure the dependent association between two categorial variables it was utilized the chi - square test ( x ) or when necessary the exact fisher test . to compare before and after results the macnemar test was applied . for the analysis of logistic regression and to predict the event of virological failure16 ( depedent variable ) , the wald method was applied . the association measurement calculated from the logistic model is the adjusted odds ratio ( or ) . the patients data were confidential and consentment to utilize information were obtained at the health center number 01 direction according to the federal district secretary ( ses / df ) of health agreement . the research work protocol was approved by the federal district secretary of health researh ethics committee , foundation of teaching and research in health sciences ( fepecs ) . initially , 165 patients were eligible to participate in the study for starting the treatment in the period 20022008 . however , only 139 patients met the inclusion criteria . among them ( table 1a and b ) , males predominated ( 74.1% ) . ages ranged from 2065 years old ( mean = 39.7 years , median = 40.0 ) . there was a slight predominance of patients in the range of 4165 years old ( 51.1% ) compared to younger patients . as for race / ethnical background , there was a predominance of mestizos ( 54.6% ) . regarding to the marital status , there was a predominance of single people ( 48.2% ) . people living in taguatinga ( 13.7% ) , a satellite city located in the surrounding areas of braslia , represented the majority of the patients enrolled in this study . the place of birth showed that patients predominated from the midwest ( 40.3% ) and the northeast of brazil ( 34.5% ) . hetrosexual relationships predominated ( 51.8% ) , followed by the homosexual relationships ( 23.7% ) . the initial viral load ranged between 1.643 copies / ml to 500.000 copies / ml ( mean = 180.721 copies / ml ; arithmetic mean = 126.417 copies / ml ) presenting more than half of the patients ( 55.4% ) cell density higher than 100.000 copies / ml ( table 2 ) . after antiretroviral therapy , the initial profile changed substantially more than 70% of the patients had viral load lower than 50 copies / ml . in reference to the initial t cd4 cell count , 68.3% of the patients were in the range of 0200 cells / mm . after treatment a relevant change was observed in the patients profile concerning t cd4 cell counts , remaining less than 37% of the cases in this stage . in the following cell density interval , there was an expressive increment in the number of cases , representing more than 43.0% of the patients ( table 2 ) . initially the most utilized antiretroviral regimen included two drugs , the nucleoside reverse transcriptase inhibitor and non nucleoside reverse transcriptase inhibitor in 71.2% of the cases and the remaining 28.1% included two nucleoside reverse transcriptase inhibitor and one protease inhibitor . during the course of the treatment , the presented regimen distribution slightly changed to 66.9% to the first drug combination and 32.4% to the second one , there remaining only one utilizing three nucleoside reverse transcriptase inhibitor ( table 2 ) . virologic failure was 12.2% ( table 3 ) , or antiretroviral treatment success was 88.8% , exceeding the results obtained by johnson and way of 80%.17 among the socioeconomic and demographic variables , just the birthplace and the fact that originating in the midwest region which includes the federal district , was associated with the occurrence of virologic failure in the study . cole et al18 stated that hiv infection is sufficiently widespread , suggesting that it is a multidimensional epidemic , with demographic , residential , social , biological and behavioral significance . perhaps this is a natural social structural marker as the study was conducted in the midwest region compared to those migrating people from other regions to the federal district . there was a trend toward a higher incidence of virologic failure being male , over 40 years old , mestizo , unmarried or separate and also heterossexual exposure category . patients from the midwestern had 2.7 times greater risk of virologic failure than those from other regions of brazil , especially because the study was conducted in brasilia , which is part of this region . in this study , the initial viral load is not statistically associated and significant to the occurrence of virologic failure . however , there is the presence of a higher incidence of virologic failure among those who had viral load greater than 100.000 copies / ml after the introduction of haart . the virologic target for patients on haart is to achieve viral load plasma levels below 50 copies / ml when two or more potent drugs are used . these results highlight the importance of compliance with primary success and reinforces the need to work on the accession of such patients . some authors19 interpret and agree that those with viral load higher than the baseline level of 100.000 copies / ml had a slower pace to achieve viral suppression . however , a potent and well tolerated prophylactic regimen with haart can improve cd4 t cell count at the beginning , during and after treatment . kantor et al2 concluded that plasma viral load strongly predicts the rate of cd4 lymphocyte count decrease , progression to aids and death . but the prognosis for people infected with hiv is more strictly defined by the combination of plasma viral load measurement and cd4 lymphocytes counts . some patients with viral load higher than 100.000 copies / ml remained in treatment failure after haart regimen in contrast to t cd4 lymphocyte counts decrease at a slower pace , leaving some in virologic failure , probably due to the emergence of hiv resistant strains . cozzi - lepri et al7 advocate that patients who remained in haart regimen failure , the viral load in the next twelve months was growing at a relatively slow pace , the cd4 t cell count was stable and the time course of viral replication in patients with virological failure had not been fully elucidated . asjo and langeland20 suggest that the lack of complete suppression of viral replication allows the continued development of hiv variants with different degrees of resistance . it results not only in treatment failure , but it also increases the risk of hiv primary resistance and dissemination . patients with initial cd4 t cell count 200 cells / mm had a tendency to virologic failure , however , there was not any statistical significance . tuberculosis coinfection was associated with virologic failure demonstrated with statistical significance , p = 0.019 . patients with a previous diagnosis of tuberculosis infection had 2.9 times great risk of virologic failure . it is observed that the t cd4 cell count baseline above 200 cells / mm was not statistically associated with virological failure , but the incidence of failure in this group was noticeably lower than in those with initial t cd4 less than 200 cells / mm . studies conducted by skowron et al21 demonstrated that t cd4 cell count is a better predictor of viral suppression . however , in order to achieve viral load suppression to undetectable levels , it is necessary to have an optimal response of t cd4 cell count in patients under antiretroviral therapy . piliero22 comments that the maximum suppression of viral replication remains the primary goal of therapy after haart regimen , therefore t cd4 cell count and hiv plasma viral load values are the prognostic markers for treatment success after four , eight or twelve weeks post treatment , as the changes are predictive of favorable long - term success in six months or more . according to moreno et al23 in multifailed patients , at least two active drugs can not be used , the therapeutic scheme should be kept in use until new drugs become available , assuming that there is an immunologic and clinical stability in order to avoid the use of a drug from a common chemical group which usually leads to a rapid viral resistance development , further limiting future treatment options . geretti et al24 stated that patients in first haart line who maintained consistently undetectable plasma viral load for a year , had a low risk of virologic failure . in this study , special attention should be given to early tuberculosis diagnosis during the early haart regimen prescription . studies reported by bekker et al25 and von reyn et al26 showed that the mycobacterial disease was a major contributor to hiv mortality . in addition , the infection increases the risk of latent tuberculosis reactivation , a new infection progression or re - infection to active disease , increasing the risk of the emergence of hiv resistant strains to the usual antiretroviral therapy . tuberculosis also accelerates the course of hiv induced disease by activating viral replication and accentuating the decline of t cd4 cells . in the logistic regresion analysis the best model to explain the event of virological failure is the one that includes variables such as origin and infection by m. tuberculosis , yielding or values of 3.2 and 3.8 respectively despite the enormous progress as a result of the impact of haart - related morbidity and mortality in patients with hiv / aids continue and will continue to fail in the face of the therapeutic classes of haart currently available . the presented results reinforce the importance of monitoring the biological markers t cd4 cells and viral load in patients living with and without aids , both to ensure that viral replication is under control and to reassure the maintenance of immune reconstitution compatible with life , and to predict the risk of developing resistance and therapeutic failures in the course of the treatment of hiv - infected people . it should be noted that the sample size limited the analysis of this study , as the retrospective information taken from the medical records , excluded some data from the laboratory and the clinical follow up . the sample obtained in this way may have had a limited ability to highlight the predictive differences of risk for both t cd4 cell count and viral load in naive patients . it is possible that working with a larger cohort of patients and longer follow - up of these predictors probably would show more consistent evidence that is statistically supported . initial treatment with any nnrti - based regimen or an ip , but not both , is a good strategy for managing the long - term antiretroviral treatment in naive hiv patients . moreover , the recent availability of new antiretroviral agents for the treatment of hiv has increased treatment options and improved durability , tolerability and efficacy in the long - term haart regimen . other limitations that should be highlighted refer to the possibility of verifying the association of hbv and hcv coinfections which do not have evolutionary studies of these hiv comorbidities . it is possible that if we had a homogeneous group of patients already in advanced stages of these pathologies , the risk of virologic failure would be high . the sociodemographic data were collected from medical records and not through interviews , this fact may also have skewed the results of the analysis of association between these variables and treatment failure . however , this service data and variables accounted are limitations imposed by real situations in nosocomial institutions in the federal district in brazil . it is of great relevance to the findings in this study considering the limitations and difficulties of conducting studies in routine service , as it can be concluded that even in the non - ideal conditions of a clinical trial , patients treated in this unit had virological success of 12.2% up to one year of treatment , a fact that can predict the durability of the first scheme which is better than expected in many other international centers.17 also tuberculosis infection should be traced as a priority as early as possible . as the low values of t cd4 cell counts and high viral load pre - treatment should be considered to implement the prescribed antiretroviral therapy , especially when new classes are available and have superior performance , as much viral suppression and immune reconstitution could be achieved .

little data exists concerning the efficacy of the antiretroviral therapy in the federal district in brazil , therefore in order to improve hiv / aids patients therapy and to pinpoint hot spots in the treatment , this research work was conducted . of 139 hiv / aids patients submitted to the highly active antiretroviral therapy , 12.2% failed virologically . the significant associated factors related to unresponsiveness to the lentiviral treatment were : patients place of origin ( or = 3.28 ; ic95% = 1.09.73 ; p = 0.032 ) and mycobacterium tuberculosis infection ( rr = 2.90 ; ic95% = 1.197.02 ; p = 0.019 ) . in the logistic regression analysis , the remaining variables in the model were : patients birthplace ( or = 3.28 ; ic95% = 1.109.73 ; p = 0.032 ) and tuberculosis comorbidity ( or = 3.82 ; ic95% = 1.1912.22 ; p = 0.024 ) . the patients enrolled in this survey had an 88.0% therapeutic success rate for the maximum period of one year of treatment , predicting that t cd4 + low values and elevated viral loads at pretreatment should be particularly considered in tuberculosis coinfection , besides the availability of new antiretroviral drugs displaying optimal activity both in viral suppression and immunological reconstitution .

Introduction Material and Methods Patients Results and Discussion Conclusion

nanotechnology has the potential to create new materials and devices with wide - ranging applications in medicine,13 agriculture,4 and energy or electronic production.5,6 the size - dependent optical , electrical , and magnetic properties of nanoparticles make nanotechnology a promising candidate for bioapplications such as in vivo imaging , sensing , catalysis , therapeutics , and cell targeting.79 based on different approaches , physicians , physicists , chemists , biologists as well as bioengineers share a common interest to treat severe diseases through nanotechnology . theoretically , nanoparticles can be tailored to reach the right target at the right time . pathogenic agents such as viruses or bacteria , and cancer cells could be precisely targeted and affected without disturbing healthy tissues . this crucial task has been one of the highest priorities for the past 10 years . among several medical applications , nanoparticles could be largely employed as carriers of therapeutical biomolecules.10 the combination of nanoparticles with biomolecules such as proteins or specific polypeptides offers opportunities for the design of very precise and versatile hybrid systems mostly useful in helping to fight cancer and immunological diseases.1113 there are more than 50,000 different proteins in the human body.14 proteins are present in complex biological processes such as muscle contraction , immune protection and transmission of nerve impulses . all enzymes and most hormones are proteins ; hence , proteins are vital sources for the body s metabolism and their lack can result in several diseases ( eg , lack of insulin in type 1 diabetes ) . the latest development of protein engineering allows the production of proteins having desired properties and great potential market;15 however , protein fragility is one of the major drawbacks for their utilization . consequently , the discovery and development of new therapeutic proteins have also created new opportunities for drug - delivery systems involving the design of appropriate nanocarriers such as liposomes , micro- , and nanoparticles.1619 the oral route is a comfortable way for drug administration especially when repeated or routine dosing is necessary.20 nevertheless , the development of oral carriers for many proteins remains a challenge due to the fact that bioavailability of these molecules is limited.21 indeed , most polypeptides and proteins are quickly degraded in the gastrointestinal ( gi ) tract by proteolytic enzymes.22,23 moreover , the intestinal epithelium is a major barrier to the absorption of hydrophilic drugs that can not easily diffuse across the cells through the lipid - bilayer cell membranes . numerous investigations have shown that nanocarriers can improve the stability of therapeutic agents against enzymatic degradation and achieve desired therapeutic levels in target tissues for the required duration . nanoparticle drug - delivery systems ( nano - dds ) could permit an optimal pharmacokinetic profile and meet specific needs . for example , nanoparticles as oral protein carriers could protect the active ingredient in the gi tract and/or prolong the residence time of its contents on the mucous membrane . after administration , nano - dds can be taken up and transported across the intestinal mucosa by enterocytes or m cells in the peyer s patches because of their small size.24 several articles and reviews on the use of nanoparticles or microparticles for oral drug delivery are dedicated to insulin.2528 in 1980 , couvreur and colleagues performed the first study on hypoglycemic effects after oral and parenteral administration of insulin - loaded nanoparticles to diabetic rats.26 proteins are also difficult to be delivered via topical or transdermal routes and therefore their parenteral administration is still largely applied . besides the general complications of the parenteral route ( such as local infections , thrombophlebitis , rarely tissue necrosis ) , small proteins ( < 30 kd ) are quickly filtered out by the kidneys . without an appropriate drug carrier , proteins can also cause unwanted allergic reactions , can be targeted by the immune system and be rapidly degraded . for example , rapid clearance from the circulation can be an explanation of the modest in vivo antitumor effects of the antiangiogenic rgd ( arg gly asp ) peptides.29 bone morphogenetic proteins ( bmps ) induce bone formation after implantation ; their orthopedic application in repair of bone fractures and defects is focused in local device and spinal fusion procedures . the problem of bmp is its rapid diffusion from the administration site when applied without a carrier . currently , one of the most effective and biocompatible carriers for bmp delivery is the type i bovine absorbable collagen sponge ( acs ) . however the bmp release rate is difficult to control and to maintain constant for long term because of a high initial burst release of this device . the use of new nanotechnologies could maintain bmps at the treatment site preventing extraneous bond formation and optimizing the drug release.30 synthetic antigenic peptides are specific sections or a variant sequence of viral / bacterial proteins able to induce an immune response in the host . these small peptides are very useful in the vaccine development compared to the use of the whole protein / antigen . to date , several antigenic peptides have been identified but delivery problems still limit their application . even in this case , the design of an effective delivery system is an important challenge in nanotechnology field . an efficient protein carrier should solve different problems allowing the access to the target sites , at the right time and for the proper duration . in order to choose the best nanosystem , five factors must be considered : nature of the protein , route of administration , pattern of drug release , method of delivery and formulation.31,32 proteins such as albumin , antibody , growth factors , transferrin , cytokines and low - density lipoprotein can be also used as active ligands to help nanoparticles loaded with chemotherapeutic or other drugs to reach particular sites in the body.3335 abraxane ( abraxis bioscience , los angeles , ca ; astrazeneca , wilmington , de ) , albumin bound nanoparticle of paclitaxel , is an example of us food and drug administration ( fda)-approved protein - based active ligand for the treatment of metastatic breast cancer.35 monoclonal antibodies ( mab ) has been widely used as bioprobes in diagnostics as well as delivery drug to specific tumors.36,37 ox26 mab can help nanoparticles to cross the blood brain barrier and diffuse in the brain tissue in order to transport drugs ( eg , the anticaptase peptide , z - devd - fmk ) for the treatment of neurological and psychiatric disorders.38 nanoparticles can be also coated with mab for cell surface antigen and used as a bait for detection or isolation of various kind of cells including lymphocyte and tumor cells.39,40 despite many potential applications , the interaction of nanoparticles with biomolecules and living systems is still not fully understood.4150 continuous study on this subject contributes to the current knowledge and stimulates the development of novel therapies such as nonviral vectors for gene therapies or as precise anticancer molecules.37,5153 furthermore , by clarifying these aspects , specific protein - based nanovectors with optimized functions could be developed . this review aims to provide an overall picture on current progress and general aspect of the most successful approaches used to combine proteins with nanosystems . these methods and the correlated problems of protein denaturation are discussed in turn in this review . the interaction between biological and synthetic materials impacts on a vast range of medical issues from implants to pharmacokinetic aspects . the study of the materials bio - compatibility starts , therefore , with the analysis of protein absorption on surfaces.54 synthetic materials for biomedical applications are immediately covered by proteins when put in contact with a biological environment.55,56 after protein binding , nanoparticles are quickly cleared by the mononuclear phagocytic system ( mps ) , also known as the reticuloendothelial system ( res).57,58 these macrophages , which are typically kupffer cells of the liver , can not directly identify the nanoparticles themselves , but rather recognize specific opsonin proteins bound to the surface of the particles.59 the interaction between proteins and nanoparticles surface leads to the formation of proteins corona around nanoparticles that largely defines their biological identity as well their potential toxicity.49,50,58,6064 recently , lynch and dawson postulated the importance of the protein corona as the vehicle and the biological identity of a nanoparticle for its transport through cell membranes.60 the nanoparticle surface is immediately occupied by proteins with high concentrations and high association rate constants and successively by proteins having lower concentrations but a higher affinity.47 competitive absorption of proteins is influenced by several factors such as electrostatic interactions , protein stability , and kinetic parameters.65 as the protein corona could affect the nanoparticle behavior , including its biological effect , the nanoparticle could also have an effect on the protein behavior . some nanoparticles seem able to promote the protein assembly into amyloid fibrils in vitro by assisting the nucleation process.66 bellezza and colleagues found that nanoparticles affect the morphology of the myoglobin absorbed onto phosphate - grafted zirconia nanoparticles , inducing prefibrillar - like aggregates.67 this phenomenon could have important implications for medical application of nanoparticles because the self - assembly of a variety of proteins and peptides is known to be the cause of human amyloid diseases where fibrous protein aggregates are formed , resulting in amyloid plaque deposition in the extra - cellular tissues.6874 moreover , fibrillar structure seems to be related to heavy human disorders such as alzheimer s disease , parkinson s disease , and spongiform encephalopathies . for instance , there are nanosystems such as c60 hydrated fullerenes that can relax fibrillar structures.60,68 certainly , the control of the protein absorption on nanoparticle surfaces is an important issue to control their fate in biological systems.75 in order to prevent or control the opsonization , several methods of disguising nanoparticles have been developed . in these methods , generally , nanoparticles are coated with biocompatible polymers that have the double function of preventing their aggregation and retarding the protein absorption.57,76,77 a common strategy to improve blood compatibility and to increase the blood circulation half - life of the nanoparticles is the construction of a protein - coated surface resistant to the absorption of the other opsonines.78 a thin layer of protein appears to minimize adhesion and aggregation of nanoparticles , avoiding subsequent macrophage recognition or , in the worst case , a thrombus formation . moreover , it is possible to properly tune the cells uptake of the nanoparticles using specific proteins.35 proteins are mainly amphiphatic molecules that typically adhere to the surface of a biomaterial in a nonspecific way . in various cases , this nonspecific adhesion is sufficient to artificially immobilize proteins on the nanoparticles surface , and no surface modification is necessary . despite of the large number of studies , the absorption of a protein on whatever the solid surface is still a complex and not well understood process.60,7985 in the case of nanoparticles , size and radius of curvature become significant when compared to the protein size resulting in new interactions not shown with the bulk materials.47 the high hydrophobicity of many proteins seems to play an important role in their absorption on the nanoparticles surface.86 several models of protein absorption on surfaces identify two main steps in the process . the first step could involve the arrival of the protein at the interface , through a diffusion process following the brownian law of motion , and its further collision with the solid surface . depending on the balance of the energetic interaction if the protein has been absorbed , the second step could lead to conformational changes ( because of van der waals interactions ) , surface charge , protein dipole moment , and protein size or solution ionic strength.84,85,8790 this second step often involves irreversible changes in the protein structure up to denaturation.9193 proteins can be divided in two groups : hard and soft proteins . the first group includes proteins with high internal stability , while proteins in the second group have a low internal stability . soft proteins seem to be able to change their conformation better than the hard ones . this characteristic results in a gain in conformational entropy when absorbed on solid surfaces , improving the efficacy of the absorption process when compared to the hard proteins . on the other hand , it seems that some degree of denaturation upon absorption is more probable for soft proteins than for the hard ones , especially on hydrophobic surfaces.84,9497 during the artificial absorption of protein to nanoparticles surface , the use of a large excess of the target material could allow the retention of sufficient biological activity and native epitopes , even if some proteins are denatured . however , problems associated with denaturation of the protein over time , or its exchange with other proteins in solution , could make this strategy satisfactory only for short - term uses . the success of an absorption strategy to deliver drug or therapeutical proteins using protein - based nanoparticles as a carrier can be influenced by several factors such as the type of nanoparticles , delivery route and the nature of proteins to be absorbed . for this reason , nanoparticle protein affinity needs to be intensely examined case - by - case . the knowledge of how the protein - based nanoparticles interact with other proteins present in the blood is fundamental for the understanding of their biological and toxicological properties.77 many methods based on established techniques could be applied such as size - exclusion chromatography , isothermal titration calorimetry , surface plasmon resonance , atomic force microscopy , differential scanning calorimeter , and circular dichroisim ( cd ) spectroscopy.47,67 even if several existing characterization methods for measuring the nature and the amount of absorbed protein on solid surfaces could be applied to nanoparticle systems,96 the development of new physical and biophysical methods may be necessary to fully understand the relationship between proteins and nanomaterials . conjugation of biomolecules on nanoparticle surfaces has attracted widespread interest in biotechnology and medicine.7,98100 the conjugation of specific proteins with nanoparticles has introduced a new advancement in molecular and cellular biology which has further led to a vast improvement of in vivo gene delivery , clinical diagnosis , medical / cancer imaging , receptor - targeted delivery.40,101105 a preferred method used in many areas of biochemistry to couple specific protein to solid surface is the bioconjugation by covalent binding . while protein absorption on solid surfaces such as nanoparticles can be reversible depending on ph , salt concentration , temperature or other environment physicochemical characteristics , protein covalent bounds are highly stable . to fulfill the purpose of stable covalent binding , a large number of reactions have been proposed and many protein modifications using new techniques have been developed.7,106111 the choice of the bioconjugation procedure depends strictly on physicochemical and biochemical properties of nanomaterials and proteins . protein made by various side chains and residues can interact by multiple coating ligands with the same nanoparticles or even with more nanoparticles . moreover , nanoparticles can be more or less polydispersed and have different physicochemical surface properties such as area , porosity , and charge . these aspects are very important since the hydrophobicity , charge and site affinity could affect the interaction and thus jeopardize the stability of final covalent - coupled products . the most popular approach for coupling covalently nanoparticle to protein is based on the existence on proteins of specific and reactive functional groups such as amino nh2 ( lysine ) , carboxylic acid cooh ( aspartic , glutamic ) , hydroxyl oh ( serine , tyrosine ) and sh ( cysteine).112 proteins can be chemically coupled to different kinds of nanoparticles using established reagents such bifunctional cross - linker molecules . in this case , nanoparticles need to be functionalized with functional groups such as carboxylic acid , hydroxyl , sulfhydryl and amino groups . proteins , including antibodies , generally have several primary amines in the side chain of lysine residues and the n - terminus of each polypeptide that are available as targets for n - hydroxysuccinimide - ester and carbodiimide reagents . cysteine residues on proteins can react with maleimides and iodoacetamides reagents to give thioether - coupled products.113 these reagents react rapidly at physiological ph and can be usually coupled with thiol groups selectively in the presence of amine groups . maleimides and iodoacetamides have the same application but the first reagent seems to have better selectivity than the second one , not apparently reacting with histidine or methionine . cross - linking reagents contain reactive ends to specific functional groups ( such as primary amines , sulfhydryls ) on proteins or other molecules . they can be divided into homobifunctional ( same reactive groups ) and heterobifunctional ( different reactive groups ) which chemical cross - links may or may not be reversed.114 homobifunctional cross - linkers have a disadvantage of potentially connecting two neighboring groups , either on the nanoparticle surface or on the protein inducing undesired cross - linking . sulfosuccinimidyl-4-(n - maleimidomethyl)-cyclohexane-1-carboxylate ( sulfo - smcc ) can be used to couple thiol - containing biomolecules with amine coated nanoparticles , or vice versa . whereas the hetero - bifunctional cross - linker 1-ethyl-3-(3-dimethylaminopropyl ) carbodiimide ( edc ) is commonly used to link nh2 and cooh groups ( table 1).114118 many cross - linkers are available in the market and they can be chosen for specific needs ( such as chemical specificity , spacer arm length , cleavability ) . among several cross - linkers , the zero - length ones such as carbodiimides are widely used allowing covalent bonds between nanoparticles and proteins without insertion of an exogenous spacer . nevertheless , the direct attachment of a protein to a surface without a spacer can cause steric constraint modifying the protein reactivity compared to the protein in solution . in addition , without a spacer , multiple contacts between protein and nanoparticle surface are more probable favoring total or partial protein denaturation and thus decreasing protein activity.119 when protein does not have the suitable residue necessary for the specific conjugation , the most common way to get it is the chemical introduction of sulfhydryl groups . this process ( figures 1a and 1b ) can be mainly made by the following four methods : 1 ) reduction of protein disulfide bonds using reductive agents such as dithiotreitol ( dtt = clelands reagent ) . 3 ) quenching of reactive protein aldehyde residues with cystaminiumdichloride reagents or 4 ) coupling of cystaminiumdichloride to carboxyl groups via 1-ethyl-3-(3-dimethyl - aminopropyl)carbodiimide ( edc ) ; both cases followed by the disulfide bonds reduction with dtt as outlined above.112,120123 the avidin / streptavidin biotin bound is the strongest noncovalent biological interaction known ; for this reason this technology is commonly used in biological labs.124,125 biotinylated proteins / antibodies / enzymes can be efficiently coupled on amino nanoparticle surfaces by streptavidin - biotin technology accomplished by streptavidin activation through carbodiimide ( edc ) chemistry . biotin binds strongly to this biochemically modified surface in the most specific and sensitive way . furthermore , streptavidin through carbodiimide ( edc ) chemistry can be covalently coupled with different ligands such as mab and enzymes which make the biotin streptavidin system widely used in a variety of biotinylated nanoparticles.38,126128 proteins having cysteine residues can be directly attached to some metal nanoparticle surfaces such as gold and silver by stable metal sulfur bonds.129,130 in the other cases , the covalent coupling of proteins on nanoparticle surfaces is always a long experimental procedure . covalent bioconjugation procedure can be summarized in : 1 ) coating of nanoparticles with the selected active functional groups . 2 ) chemical activation of thiol groups on the protein side with specific reductive agents , if necessary . 3 ) total removal of the reduction agent in excess ; this step can create unplanned reactions and spoil the whole coupling process . in addition to the disadvantage of the long experimental procedure , covalent bioconjugation can affect the protein structure and function resulting in its partial denaturation ( figure 2 ) . moreover , modification of enzymes under strong denaturing conditions can result in their complete loss of activity . proteins can be denaturated during manipulations or formulations mainly by two mechanisms : conformational denaturation ( eg , reversible unfolding and irreversible aggregation via noncovalent interactions ) and chemical denaturation ( covalent bonds such as deamidation , hydrolysis , oxidation , -elimination , incorrect disulfide formation , maillard reaction , and transamidation ) . even if the first denaturation mechanism can happen during the nanoparticles bioconjugation process , the second one is often necessary to obtain high efficacy of the coupling . for example , the sh or s - groups in cysteine sh or disulfide s s bridges are important in maintaining the conformation of the proteins . as a result , the engineering introduction of sulfhydryl groups in the protein changes its natural disulfide bonds resulting in partial conformational and chemical denaturation . the dtt reagent , widely used to reduce disulfide bonds in biochemical systems , can alter protein function not only by thiol - disulfide exchanging but also by interacting with protein domains in the absence of cysteine residues.131 while carboxyl groups seem to play an important role in enzymes catalytic activity,132 their modification likely results in a change of protein secondary and tertiary structure . the - amino groups of lysine are often specifically targeted because of their high reactivity and their modification seems to have fewer effects on protein properties . unfortunately , the high abundance of these groups in many proteins can lead to increased heterogeneity and restricted conformational flexibility owing to multipoint attachment on a nanoparticles surface . it is also possible that other reagents used during the coupling chemical process can contribute to the protein denaturation and to its activity loss . therefore biological function checking as well as close monitoring of the quality and quantity of conjugated protein are extremely important to be assessed before being used.111 gold or silver nanoparticles too , due to the similar strength bond between au / ag s and s s , can potentially break up protein disulfide s s bridges leading to denaturation . specific elisa kits can be used to explore the activity of the proteins coupled to nanosystems . however there are nanoparticles such as quantum dots ( qd ) that can have an overlap in the absorption spectra and the elisa essay end product . in this case the proper specific activity of the protein needs to be assessed directly by in vitro testing.133 therapeutic biomolecules based on peptides , proteins or enzymes can be extremely fragile and easily aggressed by external agent such as proteases . encapsulation of these fragile drugs in nanocarriers is a possible strategy for preventing their aggression and denaturation . this process can also improve the drug pharmacokinetic pathway and reduce immunological reactions.19 an optimal drug delivery system should be biocompatible , biodegradable and should not cause any immunological adverse reaction in the human body . among several candidates , liposomes are considered as the most promising vectors for proteins delivery due to their biocompatibility and their capacity to improve the drug pharmacokinetic . liposomes , also known as lipid - based vesicles , are generally composed of concentric amphiphilic lipids , such as phospholipids , containing a water compartment . these carriers are versatile and their physico chemical characteristics can be properly tuned.19 liposomes synthesized from dehydrated rehydrated vesicles are widely used due to the ease of this preparation process and the low amount of stress applied to the proteins.134 liposome formulations are most frequently considered for parental administration of the drug , but may also be a potential formulation principle for alternative routes such as topical and nasal administration . several liposomes have immunoadjuvant properties and their application in vaccines based on recombinant protein subunits and synthetic peptide antigens is attractive . the first liposome based vaccine ( against hepatitis a ) that has been licensed for human use is commercially known as epaxal berna vaccine.135 the main drawback of liposomes is their instability in biological media as well as their sensitivity to many external parameters such as temperature or osmotic pressure . theoretically , it could be possible to increase their stability following several strategies such as the polymerization of a two dimensional network in the hydrophobic core of the membrane , coating the liposome with a polyelectrolyte shell or adding surface active polymers to form mixed vesicular structures.136138 however , poor loading and partial protein / enzyme denaturation during the entrapment process can occur . another well established technique to encapsulate biological species such as enzymes , antibodies and other proteins in a functional state is based on the sol gel chemistry method.139 silica is indeed considered a very appealing material for drug delivery systems because it is relatively inexpensive , chemically inert , thermally stable , and biocompatible . amorphous silica , used for decades as a food additive and for specific applications , is generally regarded as safe . up until now , the fda has not established if existing silica safety data can be applied to nanoscale forms of the material . in this approach , polypeptides , especially enzymes , could be entrapped inside silica matrix allowing the retention of enzymatic activity.139141 on the other hand , process difficulties such as uncontrolled release , denaturation and the hardness control of the protein orientation can be found.142,143 the control of the drug release of such silica nanoparticles is the most important and difficult parameter that needs to be properly tuned . the encapsulation efficacy of insoluble protein is greatly different compared to the soluble one and the existence of soluble and insoluble part of polypeptides in the same therapeutic protein subunit complicates the synthesis process . additionally , in the crowded environment of a silica matrix , the physical and chemical properties of the silica can directly influence protein structure and activity . furthermore , functional activity of proteins entrapped into the sol - gel matrix needs to be accurately analyzed case - by - case using several techniques such as cd spectropolarimetry.144,145 the drug release and the capability of the carrier to be metabolized can be important factors to be considered when chronic or repeated treatments are necessary . the disadvantage associated with inorganic and synthetic carriers are the poor or slow biodegradability and possible inflammatory responses.146 biodegradable polymers nanosystems are an attractive alternative to liposomes since they have the advantages of longer circulation in the blood stream and generally higher drug carrying capacity.147 polymers such as poly(lactic acid ) ( pla ) , poly(lactic - co - glycolic acid ) ( plga ) have been extensively investigated for their biocompatibility and potential capability of releasing therapeutically proteins in a controlled way even over a prolonged period of time.148154 these polymers are degradable by bulk erosion through hydrolysis of the ester bonds . the hydrolysis rate depends on several nanoparticles physicochemical parameters and can be tailored according to the desired release pattern of the protein to be incorporated . pla and plga are fda - approved as excipients to achieve sustained release of the active ingredient . however , their application in protein delivery systems is often characterized by low entrapment efficiency , burst release , instability of encapsulated hydrophilic protein and partial protein release.155158 to improve the performance of these polymer nanoparticles , polysaccharides such as alginate ( alg ) and chitosan ( cs ) could be applied.151,159 cs and its derivatives have been intensively studied as carriers for proteins and drugs . more specifically these nanoparticles can be totally made by cs or used in several copolymer combinations.25,160 copolymers made by the combination of cs / alg are able to generate a more friendly environment which protects peptides and proteins from stressing conditions and allows their stabilization during encapsulation , storage and release.161166 glycol chitosan nanoparticles modified with hydrophobic bile acid analogs self - assemble into polymeric nanoparticles with hydrophilic shells of glycol chitosan and hydrophobic cores of bile acid derivatives have been reported as possible vehicle for rgd ( arg gly asp ) peptide.29,30 regardless of the nanomaterial chosen for protein encapsulation , an important issue that needs to be considered is the understanding of protein protein interactions . protein interactions that occur in the cell , which in turn control a large number of cellular processes . these transient interactions of protein complexes can cause several effects such as activation / inactivation of certain proteins , resulting in the formation of a new binding site.167,168 kinetics properties of enzymes can be also altered by denaturation during the entrapment process allowing potential change of the protein specificity to its substrate.169171 gaining a clear picture of these basics knowledge will definitely lead to a change of object design to increase the protein load , to control the protein release and to retain the protein integrity and efficacy . the interaction between biological and synthetic materials impacts on a vast range of medical issues from implants to pharmacokinetic aspects . the study of the materials bio - compatibility starts , therefore , with the analysis of protein absorption on surfaces.54 synthetic materials for biomedical applications are immediately covered by proteins when put in contact with a biological environment.55,56 after protein binding , nanoparticles are quickly cleared by the mononuclear phagocytic system ( mps ) , also known as the reticuloendothelial system ( res).57,58 these macrophages , which are typically kupffer cells of the liver , can not directly identify the nanoparticles themselves , but rather recognize specific opsonin proteins bound to the surface of the particles.59 the interaction between proteins and nanoparticles surface leads to the formation of proteins corona around nanoparticles that largely defines their biological identity as well their potential toxicity.49,50,58,6064 recently , lynch and dawson postulated the importance of the protein corona as the vehicle and the biological identity of a nanoparticle for its transport through cell membranes.60 the nanoparticle surface is immediately occupied by proteins with high concentrations and high association rate constants and successively by proteins having lower concentrations but a higher affinity.47 competitive absorption of proteins is influenced by several factors such as electrostatic interactions , protein stability , and kinetic parameters.65 as the protein corona could affect the nanoparticle behavior , including its biological effect , the nanoparticle could also have an effect on the protein behavior . some nanoparticles seem able to promote the protein assembly into amyloid fibrils in vitro by assisting the nucleation process.66 bellezza and colleagues found that nanoparticles affect the morphology of the myoglobin absorbed onto phosphate - grafted zirconia nanoparticles , inducing prefibrillar - like aggregates.67 this phenomenon could have important implications for medical application of nanoparticles because the self - assembly of a variety of proteins and peptides is known to be the cause of human amyloid diseases where fibrous protein aggregates are formed , resulting in amyloid plaque deposition in the extra - cellular tissues.6874 moreover , fibrillar structure seems to be related to heavy human disorders such as alzheimer s disease , parkinson s disease , and spongiform encephalopathies . for instance , there are nanosystems such as c60 hydrated fullerenes that can relax fibrillar structures.60,68 certainly , the control of the protein absorption on nanoparticle surfaces is an important issue to control their fate in biological systems.75 in order to prevent or control the opsonization , several methods of disguising nanoparticles have been developed . in these methods , generally , nanoparticles are coated with biocompatible polymers that have the double function of preventing their aggregation and retarding the protein absorption.57,76,77 a common strategy to improve blood compatibility and to increase the blood circulation half - life of the nanoparticles is the construction of a protein - coated surface resistant to the absorption of the other opsonines.78 a thin layer of protein appears to minimize adhesion and aggregation of nanoparticles , avoiding subsequent macrophage recognition or , in the worst case , a thrombus formation . moreover , it is possible to properly tune the cells uptake of the nanoparticles using specific proteins.35 proteins are mainly amphiphatic molecules that typically adhere to the surface of a biomaterial in a nonspecific way . in various cases , this nonspecific adhesion is sufficient to artificially immobilize proteins on the nanoparticles surface , and no surface modification is necessary . despite of the large number of studies , the absorption of a protein on whatever the solid surface is still a complex and not well understood process.60,7985 in the case of nanoparticles , size and radius of curvature become significant when compared to the protein size resulting in new interactions not shown with the bulk materials.47 the high hydrophobicity of many proteins seems to play an important role in their absorption on the nanoparticles surface.86 several models of protein absorption on surfaces identify two main steps in the process . the first step could involve the arrival of the protein at the interface , through a diffusion process following the brownian law of motion , and its further collision with the solid surface . depending on the balance of the energetic interaction if the protein has been absorbed , the second step could lead to conformational changes ( because of van der waals interactions ) , surface charge , protein dipole moment , and protein size or solution ionic strength.84,85,8790 this second step often involves irreversible changes in the protein structure up to denaturation.9193 proteins can be divided in two groups : hard and soft proteins . the first group includes proteins with high internal stability , while proteins in the second group have a low internal stability . soft proteins seem to be able to change their conformation better than the hard ones . this characteristic results in a gain in conformational entropy when absorbed on solid surfaces , improving the efficacy of the absorption process when compared to the hard proteins . on the other hand , it seems that some degree of denaturation upon absorption is more probable for soft proteins than for the hard ones , especially on hydrophobic surfaces.84,9497 during the artificial absorption of protein to nanoparticles surface , the use of a large excess of the target material could allow the retention of sufficient biological activity and native epitopes , even if some proteins are denatured . however , problems associated with denaturation of the protein over time , or its exchange with other proteins in solution , could make this strategy satisfactory only for short - term uses . the success of an absorption strategy to deliver drug or therapeutical proteins using protein - based nanoparticles as a carrier can be influenced by several factors such as the type of nanoparticles , delivery route and the nature of proteins to be absorbed . for this reason , nanoparticle protein affinity needs to be intensely examined case - by - case . the knowledge of how the protein - based nanoparticles interact with other proteins present in the blood is fundamental for the understanding of their biological and toxicological properties.77 many methods based on established techniques could be applied such as size - exclusion chromatography , isothermal titration calorimetry , surface plasmon resonance , atomic force microscopy , differential scanning calorimeter , and circular dichroisim ( cd ) spectroscopy.47,67 even if several existing characterization methods for measuring the nature and the amount of absorbed protein on solid surfaces could be applied to nanoparticle systems,96 the development of new physical and biophysical methods may be necessary to fully understand the relationship between proteins and nanomaterials . conjugation of biomolecules on nanoparticle surfaces has attracted widespread interest in biotechnology and medicine.7,98100 the conjugation of specific proteins with nanoparticles has introduced a new advancement in molecular and cellular biology which has further led to a vast improvement of in vivo gene delivery , clinical diagnosis , medical / cancer imaging , receptor - targeted delivery.40,101105 a preferred method used in many areas of biochemistry to couple specific protein to solid surface is the bioconjugation by covalent binding . while protein absorption on solid surfaces such as nanoparticles can be reversible depending on ph , salt concentration , temperature or other environment physicochemical characteristics , protein covalent bounds are highly stable . to fulfill the purpose of stable covalent binding , a large number of reactions have been proposed and many protein modifications using new techniques have been developed.7,106111 the choice of the bioconjugation procedure depends strictly on physicochemical and biochemical properties of nanomaterials and proteins . protein made by various side chains and residues can interact by multiple coating ligands with the same nanoparticles or even with more nanoparticles . moreover , nanoparticles can be more or less polydispersed and have different physicochemical surface properties such as area , porosity , and charge . these aspects are very important since the hydrophobicity , charge and site affinity could affect the interaction and thus jeopardize the stability of final covalent - coupled products . the most popular approach for coupling covalently nanoparticle to protein is based on the existence on proteins of specific and reactive functional groups such as amino nh2 ( lysine ) , carboxylic acid cooh ( aspartic , glutamic ) , hydroxyl oh ( serine , tyrosine ) and sh ( cysteine).112 proteins can be chemically coupled to different kinds of nanoparticles using established reagents such bifunctional cross - linker molecules . in this case , nanoparticles need to be functionalized with functional groups such as carboxylic acid , hydroxyl , sulfhydryl and amino groups . proteins , including antibodies , generally have several primary amines in the side chain of lysine residues and the n - terminus of each polypeptide that are available as targets for n - hydroxysuccinimide - ester and carbodiimide reagents . cysteine residues on proteins can react with maleimides and iodoacetamides reagents to give thioether - coupled products.113 these reagents react rapidly at physiological ph and can be usually coupled with thiol groups selectively in the presence of amine groups . maleimides and iodoacetamides have the same application but the first reagent seems to have better selectivity than the second one , not apparently reacting with histidine or methionine . cross - linking reagents contain reactive ends to specific functional groups ( such as primary amines , sulfhydryls ) on proteins or other molecules . they can be divided into homobifunctional ( same reactive groups ) and heterobifunctional ( different reactive groups ) which chemical cross - links may or may not be reversed.114 homobifunctional cross - linkers have a disadvantage of potentially connecting two neighboring groups , either on the nanoparticle surface or on the protein inducing undesired cross - linking . sulfosuccinimidyl-4-(n - maleimidomethyl)-cyclohexane-1-carboxylate ( sulfo - smcc ) can be used to couple thiol - containing biomolecules with amine coated nanoparticles , or vice versa . whereas the hetero - bifunctional cross - linker 1-ethyl-3-(3-dimethylaminopropyl ) carbodiimide ( edc ) is commonly used to link nh2 and cooh groups ( table 1).114118 many cross - linkers are available in the market and they can be chosen for specific needs ( such as chemical specificity , spacer arm length , cleavability ) . among several cross - linkers , the zero - length ones such as carbodiimides are widely used allowing covalent bonds between nanoparticles and proteins without insertion of an exogenous spacer . nevertheless , the direct attachment of a protein to a surface without a spacer can cause steric constraint modifying the protein reactivity compared to the protein in solution . in addition , without a spacer , multiple contacts between protein and nanoparticle surface are more probable favoring total or partial protein denaturation and thus decreasing protein activity.119 when protein does not have the suitable residue necessary for the specific conjugation , the most common way to get it is the chemical introduction of sulfhydryl groups . this process ( figures 1a and 1b ) can be mainly made by the following four methods : 1 ) reduction of protein disulfide bonds using reductive agents such as dithiotreitol ( dtt = clelands reagent ) . 3 ) quenching of reactive protein aldehyde residues with cystaminiumdichloride reagents or 4 ) coupling of cystaminiumdichloride to carboxyl groups via 1-ethyl-3-(3-dimethyl - aminopropyl)carbodiimide ( edc ) ; both cases followed by the disulfide bonds reduction with dtt as outlined above.112,120123 the avidin / streptavidin biotin bound is the strongest noncovalent biological interaction known ; for this reason this technology is commonly used in biological labs.124,125 biotinylated proteins / antibodies / enzymes can be efficiently coupled on amino nanoparticle surfaces by streptavidin - biotin technology accomplished by streptavidin activation through carbodiimide ( edc ) chemistry . biotin binds strongly to this biochemically modified surface in the most specific and sensitive way . furthermore , streptavidin through carbodiimide ( edc ) chemistry can be covalently coupled with different ligands such as mab and enzymes which make the biotin streptavidin system widely used in a variety of biotinylated nanoparticles.38,126128 proteins having cysteine residues can be directly attached to some metal nanoparticle surfaces such as gold and silver by stable metal sulfur bonds.129,130 in the other cases , the covalent coupling of proteins on nanoparticle surfaces is always a long experimental procedure . covalent bioconjugation procedure can be summarized in : 1 ) coating of nanoparticles with the selected active functional groups . 2 ) chemical activation of thiol groups on the protein side with specific reductive agents , if necessary . 3 ) total removal of the reduction agent in excess ; this step can create unplanned reactions and spoil the whole coupling process . in addition to the disadvantage of the long experimental procedure , covalent bioconjugation can affect the protein structure and function resulting in its partial denaturation ( figure 2 ) . moreover , modification of enzymes under strong denaturing conditions can result in their complete loss of activity . proteins can be denaturated during manipulations or formulations mainly by two mechanisms : conformational denaturation ( eg , reversible unfolding and irreversible aggregation via noncovalent interactions ) and chemical denaturation ( covalent bonds such as deamidation , hydrolysis , oxidation , -elimination , incorrect disulfide formation , maillard reaction , and transamidation ) . even if the first denaturation mechanism can happen during the nanoparticles bioconjugation process for example , the sh or s - groups in cysteine sh or disulfide s s bridges are important in maintaining the conformation of the proteins . as a result , the engineering introduction of sulfhydryl groups in the protein changes its natural disulfide bonds resulting in partial conformational and chemical denaturation . the dtt reagent , widely used to reduce disulfide bonds in biochemical systems , can alter protein function not only by thiol - disulfide exchanging but also by interacting with protein domains in the absence of cysteine residues.131 while carboxyl groups seem to play an important role in enzymes catalytic activity,132 their modification likely results in a change of protein secondary and tertiary structure . the - amino groups of lysine are often specifically targeted because of their high reactivity and their modification seems to have fewer effects on protein properties . unfortunately , the high abundance of these groups in many proteins can lead to increased heterogeneity and restricted conformational flexibility owing to multipoint attachment on a nanoparticles surface . it is also possible that other reagents used during the coupling chemical process can contribute to the protein denaturation and to its activity loss . therefore biological function checking as well as close monitoring of the quality and quantity of conjugated protein are extremely important to be assessed before being used.111 gold or silver nanoparticles too , due to the similar strength bond between au / ag s and s s , can potentially break up protein disulfide s s bridges leading to denaturation . specific elisa kits can be used to explore the activity of the proteins coupled to nanosystems . however there are nanoparticles such as quantum dots ( qd ) that can have an overlap in the absorption spectra and the elisa essay end product . in this case the proper specific activity of the protein needs to be assessed directly by in vitro testing.133 therapeutic biomolecules based on peptides , proteins or enzymes can be extremely fragile and easily aggressed by external agent such as proteases . encapsulation of these fragile drugs in nanocarriers is a possible strategy for preventing their aggression and denaturation . this process can also improve the drug pharmacokinetic pathway and reduce immunological reactions.19 an optimal drug delivery system should be biocompatible , biodegradable and should not cause any immunological adverse reaction in the human body . among several candidates , liposomes are considered as the most promising vectors for proteins delivery due to their biocompatibility and their capacity to improve the drug pharmacokinetic . liposomes , also known as lipid - based vesicles , are generally composed of concentric amphiphilic lipids , such as phospholipids , containing a water compartment . these carriers are versatile and their physico chemical characteristics can be properly tuned.19 liposomes synthesized from dehydrated rehydrated vesicles are widely used due to the ease of this preparation process and the low amount of stress applied to the proteins.134 liposome formulations are most frequently considered for parental administration of the drug , but may also be a potential formulation principle for alternative routes such as topical and nasal administration . several liposomes have immunoadjuvant properties and their application in vaccines based on recombinant protein subunits and synthetic peptide antigens is attractive . the first liposome based vaccine ( against hepatitis a ) that has been licensed for human use is commercially known as epaxal berna vaccine.135 the main drawback of liposomes is their instability in biological media as well as their sensitivity to many external parameters such as temperature or osmotic pressure . theoretically , it could be possible to increase their stability following several strategies such as the polymerization of a two dimensional network in the hydrophobic core of the membrane , coating the liposome with a polyelectrolyte shell or adding surface active polymers to form mixed vesicular structures.136138 however , poor loading and partial protein / enzyme denaturation during the entrapment process can occur . another well established technique to encapsulate biological species such as enzymes , antibodies and other proteins in a functional state is based on the sol gel chemistry method.139 silica is indeed considered a very appealing material for drug delivery systems because it is relatively inexpensive , chemically inert , thermally stable , and biocompatible . amorphous silica , used for decades as a food additive and for specific applications , is generally regarded as safe . up until now , the fda has not established if existing silica safety data can be applied to nanoscale forms of the material . in this approach , polypeptides , especially enzymes , could be entrapped inside silica matrix allowing the retention of enzymatic activity.139141 on the other hand , process difficulties such as uncontrolled release , denaturation and the hardness control of the protein orientation can be found.142,143 the control of the drug release of such silica nanoparticles is the most important and difficult parameter that needs to be properly tuned . the encapsulation efficacy of insoluble protein is greatly different compared to the soluble one and the existence of soluble and insoluble part of polypeptides in the same therapeutic protein subunit complicates the synthesis process . additionally , in the crowded environment of a silica matrix , the physical and chemical properties of the silica can directly influence protein structure and activity . furthermore , functional activity of proteins entrapped into the sol - gel matrix needs to be accurately analyzed case - by - case using several techniques such as cd spectropolarimetry.144,145 the drug release and the capability of the carrier to be metabolized can be important factors to be considered when chronic or repeated treatments are necessary . the disadvantage associated with inorganic and synthetic carriers are the poor or slow biodegradability and possible inflammatory responses.146 biodegradable polymers nanosystems are an attractive alternative to liposomes since they have the advantages of longer circulation in the blood stream and generally higher drug carrying capacity.147 polymers such as poly(lactic acid ) ( pla ) , poly(lactic - co - glycolic acid ) ( plga ) have been extensively investigated for their biocompatibility and potential capability of releasing therapeutically proteins in a controlled way even over a prolonged period of time.148154 these polymers are degradable by bulk erosion through hydrolysis of the ester bonds . the hydrolysis rate depends on several nanoparticles physicochemical parameters and can be tailored according to the desired release pattern of the protein to be incorporated . pla and plga are fda - approved as excipients to achieve sustained release of the active ingredient . however , their application in protein delivery systems is often characterized by low entrapment efficiency , burst release , instability of encapsulated hydrophilic protein and partial protein release.155158 to improve the performance of these polymer nanoparticles , polysaccharides such as alginate ( alg ) and chitosan ( cs ) could be applied.151,159 cs and its derivatives have been intensively studied as carriers for proteins and drugs . more specifically these nanoparticles can be totally made by cs or used in several copolymer combinations.25,160 copolymers made by the combination of cs / alg are able to generate a more friendly environment which protects peptides and proteins from stressing conditions and allows their stabilization during encapsulation , storage and release.161166 glycol chitosan nanoparticles modified with hydrophobic bile acid analogs self - assemble into polymeric nanoparticles with hydrophilic shells of glycol chitosan and hydrophobic cores of bile acid derivatives have been reported as possible vehicle for rgd ( arg gly asp ) peptide.29,30 regardless of the nanomaterial chosen for protein encapsulation , an important issue that needs to be considered is the understanding of protein protein interactions . protein interactions that occur in the cell , which in turn control a large number of cellular processes . these transient interactions of protein complexes can cause several effects such as activation / inactivation of certain proteins , resulting in the formation of a new binding site.167,168 kinetics properties of enzymes can be also altered by denaturation during the entrapment process allowing potential change of the protein specificity to its substrate.169171 gaining a clear picture of these basics knowledge will definitely lead to a change of object design to increase the protein load , to control the protein release and to retain the protein integrity and efficacy . although new proteins are available for medical purposes , their administration as therapeutics still remains difficult . nanosystems seem to be the optimal solution to improve protein bioavailability , biodistribution and safety . moreover , the combination of nanoparticles with proteins could also be a valid system to achieve the design of efficient nanovectors for drug delivery . indeed , nanoparticles can be properly tuned for specific applications and could be precisely designed to meet biological needs . however , to completely fulfill this purpose , it is necessary to better clarify the nature of interaction between nanoparticles and biomolecules . the control of the protein denaturation is another important parameter that needs a deeper understanding . further investigations should help to manage these hybrid nanosystems , opening new therapeutic and diagnostic perspectives as well as new challenges in the near future .

the latest development of protein engineering allows the production of proteins having desired properties and large potential markets , but the clinical advances of therapeutical proteins are still limited by their fragility . nanotechnology could provide optimal vectors able to protect from degradation therapeutical biomolecules such as proteins , enzymes or specific polypeptides . on the other hand , some proteins can be also used as active ligands to help nanoparticles loaded with chemotherapeutic or other drugs to reach particular sites in the body . the aim of this review is to provide an overall picture of the general aspects of the most successful approaches used to combine proteins with nanosystems . this combination is mainly achieved by absorption , bioconjugation and encapsulation . interactions of nanoparticles with biomolecules and caveats related to protein denaturation are also pointed out . a clear understanding of nanoparticle - protein interactions could make possible the design of precise and versatile hybrid nanosystems . this could further allow control of their pharmacokinetics as well as activity , and safety .

Introduction and background Nanoparticleprotein absorption, bioconjugation, and encapsulation Absorption of proteins on nanoparticles surface Bioconjugation of proteins on nanoparticle surfaces Protein encapsulation Conclusion

angiokeratoma corporis diffusum ( fabry disease ) is a widespread form associated with deficiency of galactosidase a. the localized form includes solitary angiokeratoma , angiokeratoma circumscriptum neviforme , angiokeratoma of mibelli and angiokeratoma of fordyce . angiokeratoma of fordyce is the commonest type of angiokeratoma seen , common over the scrotum , can also be seen on the vulva and thighs . angiokeratoma of the vulva ( fordyce ) is common in older women and usually asymptomatic . we present a case of giant and multiple angiokeratoma of the vulva in a middle - aged woman because of its rarity and uncommon presentation . a 45-year - old female presented with multiple asymptomatic soft papules and nodules over the vulva of two years duration . the lesions started spontaneously on the right side of the vulva as small papules and gradually grew to attain the present size . the patient was married 20 years back and there was no history of obstetric complications during delivery . multiple 0.5 to 1 cm bluish papules and nodules were seen on either side of the vulva [ figure 1 ] . the tumors were excised by electrocautery under local anesthesia under aseptic precautions and sent for histopathological examination . histopathology revealed hyperkeratosis , irregular acanthosis and papillomatosis of the epidermis and multiple thin - walled vessels containing red blood corpuscles ( rbcs ) in the papillary dermis , confirming the diagnosis of angiokeratoma of fordyce [ figures 2 and 3 ] . angiokeratoma of fordyce multiple , reddish blue soft papules and nodules are seen on either side of the vulva angiokeratoma of fordyce ( h and e , 10 view ) epidermis is showing hyperkeratosis , irregular acanthosis and papillomatosis and multiple thin - walled vessels containing rbcs are seen in the papillary dermis angiokeratoma of fordyce ( h and e , 40 view ) multiple vessels with rbcs are seen in the dermis the pathogenesis of angiokeratoma of fordyce is unknown ; the speculated pathogenesis is localized venous hypertension . there are reports of angiokeratoma of fordyce seen in association with varicocele or conditions with increased venous pressure ( e.g. , hernias , epididymal tumors , trauma , thrombophlebitis , tumors of urinary system ) . angiokeratoma of fordyce presents as asymptomatic , 2 to 5 mm , blue to red papules with scaly surface over the scrotum ( commonest presentation ) , shaft of penis , labia majora , inner thighs , or lower abdomen . early lesions of angiokeratoma are soft , red and easily compressible ; later , they become blue , keratotic and non - compressible . solitary type of presentation is more common . in a study by imperial et al . , on vulval angiokeratomas , 54% patients had predisposing factors for the development of angiokeratomas such as pregnancy , vulval varicosity and hysterectomy while the rest had none . there are many reports of penile and vulval angiokeratomas following radiation treatment for genitourinary malignancy . the differential diagnoses of angiokeratoma on the vulva ( fordyce ) are angiokeratoma corporis diffusum ( fabry disease ) , condyloma accuminata , cherry hemangioma , and granuloma pyogenicum . patients of fabry disease present with acute lancinating limb pains and angiokeratoma all over the body . treatment of angiokeratomas depends on the site and size of the lesion and also availability of the surgical equipment like electrocautery , radiofrequency , cryotherapy or ablative lasers . angiokeratoma of fordyce can also be seen is seen in females over vulva and can present in giant form .

angiokeratoma of fordyce occurring over vulva is rare . angiokeratoma of fordyce commonly occurs in males over scrotum or penile shaft and presents as multiple verrucous reddish papules . they are usually asymptomatic and noticed accidentally . in the present article , we present and review the literature of giant angiokeratoma of fordyce in middle - aged women due to its rarity .

Introduction Case Report Discussion

spontaneous rupture of the liver is a rare event often associated with the presence of malignant liver disease or occurring in the context of a hellp syndrome . the cases reported in the literature refer to hepatic rupture in pregnancy or cases in the context of the rupture of a hepatocellular adenoma , in idiopathic peliosis hepatis and other more rare conditions such as coagulation disturbances and connective tissue disease like amyloidosis . the clinical case described here is one of a female patient admitted to our intensive care department for spontaneous rupture of the liver in the aftermath of recent surgical clipping of a cerebral aneurysm . a 50-year - old woman was transferred from the bolzano hospital department of neurosurgery to the intensive care unit as a result of anemia ( hemoglobin down to 8.2 g / dl ) and the occurrence of major abdominal pain in the right hyperchondrium . on examination , the patient was normotensive ( blood pressure 125/70 mmhg , pulse rate 90/min ) and had a firm , tender abdomen . an ultrasound examination of the abdomen was performed , showing a fluid collection in the perihepatic region and in the pelvic area , partly with an echogenic appearance . the patient had been admitted a week earlier to the neurosurgery department following a subarachnoid hemorrhage due to a bleeding aneurysm of the right pericallosal artery , treated with a right frontal craniotomy and clipping . the patient and her husband denied the possibility of a trauma related to the cerebral hemorrhage . an abdominal ct scan was performed with contrast medium showing a voluminous fluid collection in a subcapsular site along the ventral margin of the liver . in the context of this collection , moreover , the presence of a circumscribed leakage of arterial contrast medium was observed at the level of the 4th segment . a diffuse fluid collection was also present in all the peritoneal recesses ( figs . 1 and 2 ) . the patient was then given a blood transfusion with 2 units of packed red blood cells with an increase in hemoglobin from 8.2 to 8.7 g / dl . the patient was subjected to hepatic angiography which revealed no signs of arterial leakage of contrast medium , but showed multiple petechial images in the peripheral portions of the hepatic parenchyma . we then proceeded with reversible gelatin sponge embolization of the branches for the central hepatic segments and the left lobe . the patient was stable from the hemodynamic point of view ( blood pressure 140/70 mmhg , pulse rate 95/min ) , with increased lactates ( 64 mg / dl ) , and tended to be oliguric . as regard laboratory tests , there was a marked increase in liver function indices ( ast 4092 u / l ) , with normal value of bilirubin and coagulation profile . in the hours following embolization , the patient presented a new reduction in hemoglobin to 6.9 g / dl and an increase in lactates above 80 mg / dl . resection of the 7th and 8th hepatic segments and packing of the liver were performed . during the operation the patient was given massive blood transfusions with 11 units of packed red blood cells , 1800 ml of fresh frozen plasma , 1 platelet concentrate and 4 g of fibrinogen . the patient 's clinical condition was stable during the 72 h after the operation with hemoglobin values of 9 g / dl , and without any need for blood transfusions . however , the patient was subjected to renal replacement therapy in cvvhdf due to the presence of oligoanuria and a tendency to develop metabolic acidosis . on postoperative day 3 , the patient was taken once again to the operating theater where she underwent a depacking operation . twelve days after admission to the intensive care department the patient was transferred to the surgery department , awake and contactable , and stable from the hemodynamic and respiratory points of view . the patient 's hemoglobin values remained stable at 9.5 g / dl , her liver parameters reverted to normal and she resumed urinating spontaneously . the pathology report relating to the liver resection slice on the day of the first operation described a capsular parenchymal laceration with subcapsular blood extravasations , together with diffuse ectasia and vascular congestion , and multiple , partly confluent areas of hemorrhagic necrosis . the pathologist suggest to exclude the posttraumatic origin of the lesion and to evaluate the possibility of a recent stroke or an acute heart failure . spontaneous hepatic rupture remains a rare event , associated more often than not with pregnancy or traumatic events . the treatment of hemorrhage due to spontaneous rupture of the liver includes , in addition to serial monitoring of hemoglobin values , in cases of unstable patients , embolization , hepatic resection and packing . in the case described , the recent history of bleeding from a cerebral aneurysm led us to believe that initially an abdominal trauma had gone unrecognized . the patient and her husband consistently denied any such trauma , inasmuch as the patient had presented acute cerebral symptoms , headache and vomiting while seated at table . furthermore the cerebral bleeding was not correlated with an evidence of vasculitis or others connective diseases in the pathology findings . the therapeutic approach adopted was characterized by two phases : the first consisted in angiography , revealing no active site of bleeding , while the second , the liver resection and packing surgery , achieved definitive hemostasis . though the angiographic study did not show a significant blush of contrast medium , there was multiple petechial images in the peripheral portions of the hepatic parenchyma . the embolization was performed with reversible gelatin sponge following the ct scan that showed a spotty extravasation of the branches for the central hepatic segments and the left lobe . transarterial embolization was chosen as the first option , in that the procedure is less invasive compared to exploratory laparotomy and surgical treatment and less risky for the patient , but in our case it failed to resolve the problem of controlling the bleeding . surgical treatment was postponed because the patient presented stable vital parameters , considering from the outset the possibility of the rupture of a hepatic angioma , the bleeding of which is often self - limiting . the intraoperative macroscopic appearances and the pathology findings relating to the liver resection slice excluded the possibility of this cause , in that a capsular parenchymal laceration was described with subcapsular hemorrhagic extravasations , vascular congestion and multiple areas of hemorrhagic necrosis without any evidence of malignancy . a clinical pathological correlation between cerebral and liver bleeding should be confirmed from the presence of an inflammatory process , microaneurysms , vasculitis or hepatic failure . the laboratory tests , the ct scans and the pathology findings did not evidence these diseases . spontaneous hepatic rupture not associated with pregnancy or with the presence of a liver tumor remains a rare event , requiring combined treatment consisting in close clinical monitoring , transarterial angiography and possibly surgical intervention . diagnosis of liver rupture is not easy and can be made on the basis of clinical examination , laboratory tests and abdominal imaging . however , the etiology of liver rupture remains difficult almost in some cases in then the right succession of events is not clear . a thorough history taking of the patient must rule out abdominal trauma and the presence of pathological conditions including rare diseases such as idiopathic peliosis hepatis or amyloidosis . in our case , we were unable to uncover the real cause of liver bleeding . subclinical trauma remains a remote possibility since the husband denied a history of fall or blunt injury . at the time of onset of the first symptoms the patient was seated on the table . the vomiting could have caused the rupture of the liver , in accordance with the location of the laceration , the ventral surface that is in strictly contact with the costal margin . the case described here shows that spontaneous rupture of the liver may be due to indefinable causes and that its treatment remains complex and multidisciplinary . marianna zatelli contributed in writing and data collection , and alessio comai contributed in figure collection .

highlightsspontaneous rupture of the liver is a rare event often associated with the presence of malignant liver disease or occurring in the context of a hellp syndrome.the treatment of hemorrhage due to spontaneous rupture of the liver includes , in addition to serial monitoring of hemoglobin values , in cases of unstable patients , embolization , hepatic resection and packing .

Introduction Presentation of case Discussion Conclusions Conflict of interest Funding Ethical approval Author contributions

the concept of targeted drug delivery ( tdd ) implies selective accumulation of a drug within the affected tissue after systemic administration of the carrier - bound drug with the minimal possible side effects on irrelevant organs and tissues.1 the idea of tdd was first introduced by paul erlich in 1906 , who put forward the concept of the magic bullet directed against the target cell alone , with no damage to healthy cells.2 site - targeted nanosized particles as drug carriers may offer an advantage of safety and efficacy superior to that of more routine prototypes . an important step in its fabrication is the functionalization of the particle , which implies the binding of the targeting ligand to the particle surface . the ligand should ensure specific interaction of the particle with the complementary molecule , whenever delivered to the target cell . the nanoparticles can also be bound to radioactive isotopes or fluorescent dyes , which allow their visualization in the tissue of interest . effective tdd with use of nanoparticulate carriers can bring solutions to such problems as drug toxicity , insufficient bioavailability , poor solubility and stability . to date , the research on tdd has been mostly concentrated on the development of tumor - targeted nanomedicines . it might be hypothesized that tdd strategy approved in oncology can be applied in other clinical fields , not for destruction of specific tissue , more for the salvage of reversibly injured cells ; in particular cells destined to die within the area of myocardial ischemia - reperfusion . one reasonable approach to the problem may be targeted intramyocardial delivery of the agents ( such as certain angiogenic growth factors , erythropoietin , adenosive triphosphate ( atp ) -sensitive potassium channel openers ) , either covalently and/or noncovalently bound to the nanoparticulate carriers . one may suppose that local accumulation of drug - loaded nanoparticles within the ischemic area of the heart can at least in principle be achieved by selective binding of annexin v to the particle surface . annexin v is a naturally expressed soluble protein that binds to phosphatidylserine head in a calcium - dependent fashion . phosphatidylserine is normally localized to the inner surface of the plasma membrane , but when sublethal cell injury occurs it is translocated to the external layer the cell surface.3 annexin v is widely used as a marker protein for the visualization of cell injury and apoptotic death in vitro . specific interaction of the nanoparticle - anchored annexin v with phosphatidylserine would potentially ensue the binding of nanoparticles to the cardiomyocyte membrane with their subsequent accumulation in the area of interest . apart from the active heart targeting by annexin v , we can not rule out the probability that passive targeting may be helpful in treating ischemic - reperfused myocardium.4 the basic idea is that the nanoparticulate carriers can be retained and accumulated within the ischemic - reperfused area of the heart owing to increased microvascular permeability to all macromolecules , the nanocarrier including.5 in this regard , the functional characteristics of myocardial microvessels are more or less similar to those of the tumor , which would make the proposed approach even closer to that already practiced . in this study , we provide preliminary evidence that 10 nm silica nanoparticles ( snp ) might be used for heart - targeted drug delivery in both passive and active ways as described above . the study was aimed at the development of a technique of snp functionalization , evaluation of snp effects on the parameters of systemic hemodynamics , and investigation of snp biodistribution using optical fluorescence . the standard pyrogenic highly dispersed silica ( aerosil of a170 , a300 , and a380 marks obtained from vekton , st petersburg , russia ) was used throughout the experiments . emmett teller ( bet ) method and averaged from 170 to 380 m / g . the technique of snp functionalization included three sequential steps : modification of snp with ( 3-aminopropyl)triethoxysilane , hydrolysis of unreacted alkoxysilane groups , and binding of fluorescein . chemosorption of ( 3-aminopropyl)triethoxysilane was performed from the gaseous phase with use of dried nitrogen as a carrier gas . the synthesis was done in the vertical quartz flow reactor at 220c for 2 hours . hydrolysis of the unreacted alkoxysilane groups was achieved with water vapor at 150c for 1 hour . the covalent binding of fluorescein to the aminated silica was done using carbodiimide technique for 1 hour ( scheme 1 and 2 ) . all chemicals were purchased from sigma - aldrich chemical co ( moscow , russia ) . the surface reactions were controlled with infrared spectroscopy ( diffuse reflection ) ( perkin elmer 1760 ) . the amount of fluorescein bound to the surface of snp was determined spectrophotometrically at = 490 nm . fluorescein content within the samples of modified snp varied from 0.01 to 0.02 mm / g . another fluorescent dye that can be used for labeling of snp is considered to be indocyanine green ( icg ) . this fluorophore has an absorption band in the near - infrared region ( = 780 nm ) . we have developed the technique of indocyanine green immobilization on the surface of aminated silica . first of all , it has been established that the sample obtained is stable in the saline to be used for the evaluation of nanoparticle biodistribution . we studied in the rat model the acute effect of nanoparticle formulations on basic hemodynamic parameters . for this purpose , the suspensions of silica ( nsio2 ) , fluorescein - doped silica ( nsio2 + fluorescein ) , and carbon ( nc ) nanoparticles in 0.9% sodium hydrochloride solution were prepared . in all suspensions , the final concentration of either silica or carbon was 2 mg / ml . the binding of fluorescein to the nanoparticle surface was performed using the chemical assembly method described above . fluorescein concentration in the suspension of nsio2 + fluorescein was about 0.013 mg / ml . male wistar rats , 250 to 300 g body weight were used throughout the experiments . all experiments were performed in accordance with the guide for the care and use of laboratory animals ( publication no . the trachea was intubated through a cervical incision . in spontaneously breathing animals the right carotid artery and femoral vein measurements of heart rate ( hr ) , mean arterial pressure ( map ) and pulse arterial pressure ( pap ) were done in all groups at baseline , that is , 2 minutes before the first infusion . the volume of the first infusion for any tested nanoparticle formulation was 0.2 ml , while for two following infusions it was 0.4 ml , so that the total volume was 1 ml ( 0.7 mg of nanoparticulate carrier per 100 g of the animal body weight ) . the intravenous infusions of the equivalent amounts of 0.9% sodium hydrochloride were performed in the controls . in all groups , the hemodynamic responses to infusions were evaluated at the next time points : 2 minutes after initiation of each infusion , by the end of each infusion , as well as 10 minutes and 20 minutes following each infusion ( figure 1 ) . the animals ( n = 3 for each fluorescent dye ) received intravenous infusion of fluorescently labeled nanoparticles suspended in normal saline at a volume of 1 ml totally for 10 minutes . twenty minutes after the end of each infusion , the animals were sacrificed by an overdose of anesthesia , and heart , brain , liver , spleen , lung , and kidney were removed for subsequent measurements . the fluorescence was registered using the home - made flum3 setup equipped with mercury lamp illuminator and tv camera . the fluorescence of fluorescein- and indocyanine green - labeled nanoparticles was elicited using band - pass interference filters of 435 and 780 nm , respectively . the images obtained in the experiments with fluorescein - labeled nanoparticles were split into red , green , blue ( rgb ) channels . the relative change in the fluorescence intensity ( percentage change as related to the control , g% ) has been calculated as follows : g = ( g2g1)/g1 , where g1 is the level of ( auto)fluorescence in controls , g2 the fluorescence intensity of samples obtained from the animals treated with nsio2 + fluorescein . in the experiments with indocyanine green - labeled nanoparticles , black - and - white images were obtained , and the relative change in the fluorescence level ( ie , percentage change from control , f% ) was calculated as described above . statistical analysis was performed by the mann - whitney u test , with p values < 0.05 considered significant . the standard pyrogenic highly dispersed silica ( aerosil of a170 , a300 , and a380 marks obtained from vekton , st petersburg , russia ) was used throughout the experiments . emmett teller ( bet ) method and averaged from 170 to 380 m / g . the technique of snp functionalization included three sequential steps : modification of snp with ( 3-aminopropyl)triethoxysilane , hydrolysis of unreacted alkoxysilane groups , and binding of fluorescein . chemosorption of ( 3-aminopropyl)triethoxysilane was performed from the gaseous phase with use of dried nitrogen as a carrier gas . the synthesis was done in the vertical quartz flow reactor at 220c for 2 hours . hydrolysis of the unreacted alkoxysilane groups was achieved with water vapor at 150c for 1 hour . the covalent binding of fluorescein to the aminated silica was done using carbodiimide technique for 1 hour ( scheme 1 and 2 ) . all chemicals were purchased from sigma - aldrich chemical co ( moscow , russia ) . the surface reactions were controlled with infrared spectroscopy ( diffuse reflection ) ( perkin elmer 1760 ) . the amount of fluorescein bound to the surface of snp was determined spectrophotometrically at = 490 nm . fluorescein content within the samples of modified snp varied from 0.01 to 0.02 mm / g . another fluorescent dye that can be used for labeling of snp is considered to be indocyanine green ( icg ) . this fluorophore has an absorption band in the near - infrared region ( = 780 nm ) . we have developed the technique of indocyanine green immobilization on the surface of aminated silica . first of all , it has been established that the sample obtained is stable in the saline to be used for the evaluation of nanoparticle biodistribution . we studied in the rat model the acute effect of nanoparticle formulations on basic hemodynamic parameters . for this purpose , the suspensions of silica ( nsio2 ) , fluorescein - doped silica ( nsio2 + fluorescein ) , and carbon ( nc ) nanoparticles in 0.9% sodium hydrochloride solution were prepared . in all suspensions , the final concentration of either silica or carbon was 2 mg / ml . the binding of fluorescein to the nanoparticle surface was performed using the chemical assembly method described above . fluorescein concentration in the suspension of nsio2 + fluorescein was about 0.013 mg / ml . male wistar rats , 250 to 300 g body weight were used throughout the experiments . all experiments were performed in accordance with the guide for the care and use of laboratory animals ( publication no . [ nih ] 85 - 23 ) . the trachea was intubated through a cervical incision . in spontaneously breathing animals the right carotid artery and femoral vein measurements of heart rate ( hr ) , mean arterial pressure ( map ) and pulse arterial pressure ( pap ) were done in all groups at baseline , that is , 2 minutes before the first infusion . the volume of the first infusion for any tested nanoparticle formulation was 0.2 ml , while for two following infusions it was 0.4 ml , so that the total volume was 1 ml ( 0.7 mg of nanoparticulate carrier per 100 g of the animal body weight ) . the intravenous infusions of the equivalent amounts of 0.9% sodium hydrochloride were performed in the controls . in all groups , the hemodynamic responses to infusions were evaluated at the next time points : 2 minutes after initiation of each infusion , by the end of each infusion , as well as 10 minutes and 20 minutes following each infusion ( figure 1 ) . the animals ( n = 3 for each fluorescent dye ) received intravenous infusion of fluorescently labeled nanoparticles suspended in normal saline at a volume of 1 ml totally for 10 minutes . twenty minutes after the end of each infusion , the animals were sacrificed by an overdose of anesthesia , and heart , brain , liver , spleen , lung , and kidney were removed for subsequent measurements . the fluorescence was registered using the home - made flum3 setup equipped with mercury lamp illuminator and tv camera . the fluorescence of fluorescein- and indocyanine green - labeled nanoparticles was elicited using band - pass interference filters of 435 and 780 nm , respectively . the images obtained in the experiments with fluorescein - labeled nanoparticles were split into red , green , blue ( rgb ) channels . channel g has been chosen as a target one . the relative change in the fluorescence intensity ( percentage change as related to the control , g% ) has been calculated as follows : g = ( g2g1)/g1 , where g1 is the level of ( auto)fluorescence in controls , g2 the fluorescence intensity of samples obtained from the animals treated with nsio2 + fluorescein . in the experiments with indocyanine green - labeled nanoparticles , black - and - white images were obtained , and the relative change in the fluorescence level ( ie , percentage change from control , f% ) was calculated as described above . statistical analysis was performed by the mann - whitney u test , with p values < 0.05 considered significant . briefly , in all animal groups , there were no significant alterations in heart rate throughout the trials . the first infusion of any nanoparticle formulation tested had no effect on hemodynamic parameters ( see also figure 2 ) . furthermore , there was no significant difference in map between the baseline time point and the end of the experiment . however , both second and third infusions of nsio2 evoked transient increase of map ( figure 2 ) . there was a significant increase in pap of the animals that received nsio2 or nc at the end of the observation . administration of nsio2 + fluorescein resulted in an increase of pap too , while pap in the controls remained unaffected throughout the experiment ( table 1 ) . thus , intravenous infusion of distinct nanoparticle formulations caused mild changes in systemic hemodynamics which appears to be indicative of the appropriate biocompatibility of nanomaterials tested . it should be noted that exposure of the organ samples to uv light ( = 435 nm ) for detection of fluorescein - doped nanoparticles was associated with significant autofluorescence that may interfere with the signal of interest . we nevertheless were able to discriminate statistically between meaningful and background signals to show the predominant accumulation of fluorescein - labeled nanoparticles within the lung , spleen and liver , that is , in the organs of res . besides , indocyanine green has proved to be helpful for the avoidance of tissue excessive autofluorescence at = 780 nm . concerning indocyanine green - labeled nanoparticles , the highest accumulation was within the liver and kidney compared to other organs . therefore , for fluorescent labeling of snp and investigation of their biodistribution the infrared fluorophores appear to be preferable . briefly , in all animal groups , there were no significant alterations in heart rate throughout the trials . the first infusion of any nanoparticle formulation tested had no effect on hemodynamic parameters ( see also figure 2 ) . furthermore , there was no significant difference in map between the baseline time point and the end of the experiment . however , both second and third infusions of nsio2 evoked transient increase of map ( figure 2 ) . there was a significant increase in pap of the animals that received nsio2 or nc at the end of the observation . administration of nsio2 + fluorescein resulted in an increase of pap too , while pap in the controls remained unaffected throughout the experiment ( table 1 ) . thus , intravenous infusion of distinct nanoparticle formulations caused mild changes in systemic hemodynamics which appears to be indicative of the appropriate biocompatibility of nanomaterials tested . the biodistribution data are shown in table 2 . it should be noted that exposure of the organ samples to uv light ( = 435 nm ) for detection of fluorescein - doped nanoparticles was associated with significant autofluorescence that may interfere with the signal of interest . we nevertheless were able to discriminate statistically between meaningful and background signals to show the predominant accumulation of fluorescein - labeled nanoparticles within the lung , spleen and liver , that is , in the organs of res . besides , indocyanine green has proved to be helpful for the avoidance of tissue excessive autofluorescence at = 780 nm . concerning indocyanine green - labeled nanoparticles , the highest accumulation was within the liver and kidney compared to other organs . therefore , for fluorescent labeling of snp and investigation of their biodistribution the infrared fluorophores appear to be preferable . although the idea of tdd to the ischemic heart put forward in this paper seems to be justified , at least in principle , the following problems lie ahead . since systemic administration of drug nanocarriers results in their selective accumulation in the targets under conditions of normal blood flow , it remains to be solved in what way their effective concentration can be achieved in the ischemic hearts . supposedly , the increased residence time of nanocarriers within the normally perfused tissue adjacent to ischemic one would be the solution if one takes into consideration the sufficient diffusion between the two . an alternative solution may be an increase in payloading of each nanoparticle with drugs and/or targeting ligands . it should be borne in mind , however , that such a strategy might be at substantial risk of the competitive uptake of nanocarriers by the immune system at the expense of the targets . more studies are required to elucidate the pharmacokinetics of nanocarriers , their biodistribution and putative toxicity . all of the newly developed nanosystems for targeted delivery demonstrate unique properties and need careful testing . the refinement of the techniques of nanocarrier fabrication is under way and aimed primarily at ensuring better uptake of nanoparticles by the target cells , formation of a higher gradient of drug concentration between injured and unaffected tissue , and lowering drug toxicity . the solution of these problems would be a major step in the development of the ideal tool for well - addressed delivery of the drug into the tissue of interest . in the current study , it was shown that intravenous infusion of snp is associated with mild changes in hemodynamic parameters . an important issue related to the potential use of snp for medical applications is their biocompatibility and biodegradability . it has been found before in the cell culture experiments that mesoporous snp did not affect cell viability as well as plasma membrane integrity.6 furthermore , mesoporous snp were recently used for glucose - responsive controlled release of both insulin and cyclic adenosine monophosphate,7 for intracellular delivery of cysteine,8 hydrophobic fluorophores,9 and genetic constructs.10 it should be noted however , that long - term biocompatibility of snp awaits further investigation in the relevant models . as to the biodegradability of silica nanomaterials , one recent study suggested that porous sol gel silica microparticles can be rapidly eliminated from the organism.11 the metabolic pathway for silica biodegradation includes erosion of the nanoparticle surface with formation of plasma - soluble silicic acid and its subsequent excretion by the kidney . in conclusion , targeted delivery of the nanoparticle - bound drugs to the ischemic cardiac muscle seems to be a challenging strategy to treatment of coronary artery disease . infrared fluorophores such as indocyanine green are preferable for fluorescent labeling of snp and investigation of their biodistribution .

the clinical outcome of patients with ischemic heart disease can be significantly improved with the implementation of targeted drug delivery into the ischemic myocardium . in this paper , we present our original findings relevant to the problem of therapeutic heart targeting with use of nanoparticles . experimental approaches included fabrication of carbon and silica nanoparticles , their characterization and surface modification . the acute hemodynamic effects of nanoparticle formulation as well as nanoparticle biodistribution were studied in male wistar rats . carbon and silica nanoparticles are nontoxic materials that can be used as carriers for heart - targeted drug delivery . concepts of passive and active targeting can be applied to the development of targeted drug delivery to the ischemic myocardial cells . provided that ischemic heart - targeted drug delivery can be proved to be safe and efficient , the results of this research may contribute to the development of new technologies in the pharmaceutical industry .

Introduction Materials and methods Preparation and characterization of SNP Acute toxicity and biodistribution Results Acute effects of nanoparticle suspensions on hemodynamic parameters Biodistribution Discussion

giardia lamblia , probably the most frequent pathogenic intestinal protozoan infection in man , is an important cause of diarrhoeal disease in children and adults throughout the world . although giardiasis the disease this protozoan causes is usually perceived as mild and self - limiting , symptoms generally subside within 2 - 3 weeks in otherwise healthy individuals . this infectious disease may have both immediate and long - term consequences including chronic diarrhoea with or without dehydration and intestinal malabsorption , recurrent abdominal pain , and weight loss . additionally , it has been currently related to chronic fatigue , postinfectious irritable bowel syndrome [ 3 , 4 ] , and particularly , in early childhood , poor cognitive function and failure to thrive ; all of these have attracted an increasing attention to this protozoan infection in the recent years . despite its worldwide distribution , data from surveys , excluding documented outbreaks , indicate that in industrialized countries the prevalence rate is between 2% and 5% . data on the prevalence of giardiasis in cuba is limited ; in a national survey the overall prevalence of giardia infection was estimated to be 6.02% . however , higher prevalences have been found among young children attending day - care centres and primary schools [ 710 ] . clinical giardiasis also gives the impression to be a common reason for hospitalization in paediatric hospitals in the capital of cuba [ 11 , 12 ] ; where , according to a study of risk factors for giardia infection among hospitalized children , it seems that , at least at the individual level , giardiasis - prevention activities in havana should be focused on health education to improve personal hygiene and food - related practices . health education ( he ) continues to be one of the most important strategies in the fight against intestinal parasites . appropriate management of giardiasis , including patient education to promote adherence to preventive measures that may protect against infection and reinfection , not only might reduce the frequency of outpatient clinic visits and hospitalizations for giardiasis , but also could reduce the costs associated with this disease . in childhood giardiasis , mothers and other caregivers , are therefore , of foremost importance in recognizing the disease and seeking treatment for their wards . very little is known about the perceptions of parents and carers when dealing with giardiasis in the paediatric setting . their ideas and behaviours concerning giardiasis might enhance or interfere with the effectiveness of giardiasis prevention and control . a qualitative study in cuba by escobedo et al . , in 2011 , reported deficiencies in the children caregivers ' knowledge and practices concerning giardiasis . it is important to assess the current knowledge about giardiasis before devising an intervention strategy for education campaigns among general population . the purpose of this study was to ( 1 ) explore the perceptions of a group of caregivers about medical aspects of giardiasis ( clinical features , modes of transmission , prevention , and consequences ) , its prevention and treatment ; ( 2 ) assess the sources and channels of information caregivers would prefer using to be informed about giardiasis . all of this might highlight areas where the support of health care professionals can be improved . this was a descriptive cross - sectional study conducted between january and march 2010 , at academic paediatric hospital centro habana ( aphch ) , havana , cuba . this 226-bed study hospital is a government - funded and public facility which provides secondary and tertiary medical care and active ambulatory and emergency services , within all clinical and surgical specialities , for children from all over cuba but mainly to the paediatric population from the municipalities of centro habana , cerro , habana vieja , and plaza municipalities . the study included respondents aged > 18 years who were willing to participate in the study and gave individual verbal consent . only health professionals and students in the medical professions a structured questionnaire was designed on the basis of a qualitative research conducted in the same hospital by the authors . the questionnaire was peer - reviewed and discussed with health care professionals working within paediatric wards and also was pilot - tested on random patients ' relatives at the hospital over a 1-week period to evaluate the language used , to verify the relevance of the questions , and for clarity and consistency . it focused on basic demographic data ( age and gender ) , education , and questions about their knowledge regarding giardiasis , mode of transmission , organ affected , its suggestive signs and symptoms , prevention , most reliable method of diagnosis , and whether giardiasis was a curable disease . additionally , caregivers were also assessed about from which sources and channels they would like to receive information on giardiasis . answers were categorized into either correct ( if matching the medically correct answer ) or incorrect . all consecutive parents / carers who fulfilled the eligibility criteria for inclusion and who agreed to participate were recruited if they were either new attenders or reattending . respondents were adult members of patients ' families ( parents / carers ) who visited the outpatient clinic of aphch for gastrointestinal problems . after the interviewers , who were three of the research team authors ( y. salazar , m. alfonso , and i. v. dawkins ) , explained the purpose of the study and obtained individual verbal consent from the respondents , they administered the questionnaire to parents / carers , while waiting for the consultation of their child . the interviews were conducted in private to maintain confidentiality and to reduce the influence of relations of peers . verbal informed consent was obtained from the study participants before the research instruments were administered . confidentiality of all information obtained from participants was maintained by not allowing information to be accessible to nonmembers of the research team . database was prepared using epi info version 6.0 , and accordingly data entry was done . frequency distributions were obtained . in the exploration of possible associations between respondent characteristics and awareness about transmission and prevention , analysis was done taking into account education of respondents , which was categorized into two categories ( less than 12 years of formal education or 12 years of formal education ) and age of respondents ( less than 40 year of age and 40 years of age ) . crude odds ratio ( or ) , their 95% confidence intervals ( cis ) and p values were calculated with set at 0.05 . of the 202 caregivers interviewed , 177 ( 87.6% ) were females and 25 ( 12.4% ) were males . a substantial proportion of caregivers , 157 ( 77.7% ) , had received 12 years of formal education or more , and 128 ( 63.3% ) were employed outside home . of the 202 caregivers , more than half ( 72.7% ) considered that giardiasis is a modern problem , and , although almost half ( 47.5% ) stated that this disease could not lead to death , 39.1% did , and 13.4% did not know . small intestine was correctly identified as the site of giardiasis by 125 ( 61.9% ) of the caregivers . however , more than one organ was mentioned as a possible target of giardia infection including gallbladder ( 66 ( 32.7% ) ) and liver ( 54 ( 26.7% ) ) . for 127 ( 62.9% ) of respondents those who harbour giardia infection thirty - two ( 15.8% ) of the respondents did not have knowledge about the signs and symptoms of giardiasis . those having knowledge mentioned abdominal pain ( 77.6% ) , diarrhoea ( 70.6% ) , and loss of weight 59.4% as the symptoms of giardiasis . however , other clinical manifestations including hives , itching , spots in the skin , and tiredness were mentioned for more than 30% ( table 1 ) . the majority of caregivers , 171 ( 84.6% ) , considered the microscopy of duodenal aspirate as the most effective diagnostic tool for giardiasis . the microscopy of faecal smears was only cited by 18 ( 8.9% ) respondents ( table 1 ) . one hundred and sixty - nine caregivers ( 83.6% ) in this study knew that giardia could be transmitted through drinking unboiled water and unwashed vegetables and fruits intake . the other modes of transmission mentioned by interviewees were walking barefoot and using utensils previously used by patients with giardiasis ( table 2 ) . those with an education of 12 years of formal education or more were four times more likely to be aware of prevention than those with less than 12 years of education ( or = 4.5 , 95% ci = 1.910.8 ) . interaction between knowledge of transmission and age was tested and found to have no significance ( table 3 ) . nearly all caregivers ( 95.5% ) almost all the respondents 175 ( 86.3% ) considered giardiasis to be preventable , most of them ( 169 ( 83.6% ) ) believe that prevention could be achieved by drinking boiled water , washing hands , and washing vegetables and fruits ; 86.3% , 89.6% , and 91.5% , respectively . other actions including avoiding walking barefoot and avoiding utensils used by patients with giardiasis were also mentioned by a group of them ( table 5 ) . those with an education of 12 years of formal education or more were nearly three times more likely to be aware of prevention than those with less than 12 years of education ( or = 2.8 , 95% ci = 1.35.9 ) . no significant association was observed between knowledge of prevention and age ( table 5 ) . one hundred and fifty - nine of the caregivers stated that they did not receive information on giardiasis during the last year from any source or channel . caregivers were asked which methods they would prefer to know or to improve their knowledge about giardiasis . among the suggested sources and channels , television was mentioned by 130 ( 64.3% ) , nurses and medical doctors 107 ( 52.9% ) , printed materials leaflets , posters , and pamphlets94 ( 46.5% ) , and radio 35 ( 17.3% ) . the goals of treating symptomatic giardiasis properly are to minimize the duration of illness , ensure cure , stop transmission of infection , and could also be to prevent the emergence of drug resistance . caregivers ' input , as in other areas of medicine involving children , seems to be critical to clinical management in paediatric giardiasis . the importance of providing caregivers with appropriate information is to enable them to participate effectively in giardiasis recognition , and preventative measures should be recognized . even when there were some important gaps in various issues , it was encouraging to observe that in most issues caregivers ' perceptions on giardiasis closely paralleled that of the biomedical understanding . this coincidence should be used as an entry point for a broader he activity , which is then expanded to also accommodate other disease aspects , that is , its mode of transmission , signs and symptoms , and appropriate prevention methods , to provide accurate and complete knowledge on giardiasis . internationally , this disease is gaining increasing attention , first as a reemerging infectious disease in industrialized countries and , second , as a part of the neglected disease initiative by the world health organization . its diagnosis has been established progressively with improving sanitation and with fading of the role of fatal epidemic infections as the overwhelming everyday problem . these , together with the fact that in cuba high prevalences have been reported among young children attending day - care centres and primary schools [ 7 , 8 ] , might be justifying the perception held by most respondents that this disease is a modern problem . additionally , giardia has also been frequently isolated from faeces of cuban children with diarrhoea , and it seems to be a common cause of children hospitalization [ 11 , 12 , 16 ] . these could have led some caregivers to conclude that this disease could cause death . giardia organisms primarily affect the proximal small intestine ; however , during the last decades , there have been various reports concerning other localizations of giardia trophozoites including gallbladder , urinary tract , gastric mucosa [ 1921 ] , colonic and ileal mucosa [ 22 , 23 ] , and pancreas . the majority of caregivers were able to recognize that giardia infection is frequently asymptomatic , and diarrhoea and abdominal pain are the clinical manifestations of symptomatic giardiasis . this is probably due to the educational message in the mass media stating that two of the primary clinical features of symptomatic intestinal parasitic diseases are diarrhoea and abdominal pain . this could be of importance , taking into account that an early treatment in some aspects could depend upon prompt recognition of symptoms and signs of giardiasis in the household , mainly by caregivers . it was surprising because , although this sign has been reported associated with giardiasis in the scientific literature [ 2528 ] , it is not so common . considering the frequent asymptomatic nature of this infection and the high prevalence of this protozoan worldwide , urticaria most of the times indicates that it is necessary to look for an alternative diagnosis . nevertheless , it should be stated that , coincidently , in a survey of knowledge , perceptions and practices about giardiasis in 63 gastroenterologist of havana , it was evidenced that 55.6% of these specialists in havana stated that this parasitic infection was a frequent cause of cutaneous manifestations . the intermittent excretion of giardia cysts might be affecting the perceptions of the microscopic study of faecal specimens which for most of the caregivers considered useless . at the same time two studies on knowledge and practices on giardiasis among gastroenterologist and dermatologists in havana showed that 52.4% of gastroenterologists and 64% of dermatologist considered that duodenal aspiration was the best way to diagnose this parasitic disease . certainly , duodenal aspirate is a valuable diagnostic aid for avoiding delays in diagnosis and prolongation of patient morbidity . however , this situation could be counterproductive because other parasitologic diagnoses potentially causing disease . however , there were some important gaps concerning these two issues which indicate that people today tend to combine all of the general preventive measures against intestinal parasitic infections , maybe , as a reflection of a result of previous activities directed at intestinal parasites control . additionally , there exists a link between hygiene and infection , which is a common theme in the lay literature , and caregivers could be able to make connections and draw inferences from previous similar experiences . g. lamblia remains the leading waterborne diarrhoea - causing disease [ 31 , 32 ] , either when people drink accidentally or swallow water from contaminated or untreated sources ( no heat inactivation , filtration , or chemical disinfection ) . the correct treatment of water and food and hand hygiene ( i.e. , hand washing with soap and water or the use of a waterless , alcohol - based hand rub ) are considered the most important measures in preventing infections transmitted via the faecal - oral route . it has been recently shown in a systematic review the impact of interventions to improve hand washing with soap in the community could reduce diarrhoea risk by 47% . in the usa , an outbreak of giardiasis , involving multiple modes of transmission , eventually stopped , possibly influenced by a vigorous hand washing campaign . in the present study , the higher educational level of the caregivers had a positive influence on the knowledge of transmission and prevention of giardiasis . the parents ' educational level is one of the factors of health inequalities among children . education is important for health because of the opportunities it creates to obtain better material living conditions ; well - educated people are less likely to be unemployed , and more likely to have full - time jobs , fulfilling work , and high income . a good example could be a study carried out in peru where participants with greater wealth indexes were associated with protection against giardia and persistent giardia infections ( > 14 days ) . in a study carried out in portugal , children with mothers without any education were more likely to be infected with giardia than those with educated mothers . similarly , children living with fathers with no education had a 12.26 times higher risk of being infected with giardia than those with educated fathers . this highlights the need for giardiasis he programmes and material targeted at groups with special needs . even in a country like cuba , where the educational level is very high , groups still exist where low education and thus higher risk of diseases , such as giardiasis , may interact to create an unfavourable situation . to target populations for prevention messages , it is important to know which sources and channels of information are most frequently reported as being used to keep informed about a specific topic . consistent with a previous study , it was found that television was the preferred channel of information , followed closely behind by their medical doctors , and printed materials . he materials such as posters and brochures may be an effective way to disseminate health information , providing such information in the local language that could be displayed at prominent places , such as health facilities and community centres . at present , access to culturally appropriate and easy - to - understand educational materials on giardiasis is lacking . based on this study , it may be recommended that he materials oriented towards increasing the knowledge in different issues of giardiasis should be developed . the case group and their mothers were separately covered by the he programmes that included washing hands with soap , cutting nails , washing vegetables , and making the families knowledgeable about giardiasis and its effects on their children . all the programmes were performed by he methods , that is , poster , video film , face - to - face meetings , and pamphlets . three months later , a triple stool examination was done in both groups to check reinfection . after the implementation of the programmes , the mean of the mother 's awareness about controlling of giardiasis increased from 6.54% to 27.16% ( p = 0.00001 ) , without any variation in the control group in this item . the mean of children 's information about giardiasis and its methods of control in the case and control groups before implementation of the he programmes was 4.76% and 4.86% , respectively , but after the implementation of the programs , it increased to 16.3% in the case group but remained at 4.86% in the control group ( p = 0.00001 ) . after implementation of he programs , the rate was 23.3% in the case group but 86.7% in the control group , indicating a significant difference between the two groups . the interpersonal communication , which is the most effective method of communicating health information , that takes place in the doctor 's offices and the waiting room may offer the opportunity for physicians and other health care professionals to display their potential to play a significant role in promoting individual patient action and contributing to the development of social norms concerning health behaviour . health care workers ( medical doctors and nurses ) occupy a position of high credibility and trust which make their pronouncement well received ; they have a well - recognized role encouraging prevention . however , as key communicators , they need the necessary skills to carry out activities that allow discussions , feedback , and explanation to the target audience . in the cuban context , some studies carried out among gastroenterologist , and dermatologists have evidenced the necessity of improving the giardiasis management and prevention information they provide to their patients [ 29 , 30 ] . this might be a fruitful area for future health intervention campaigns . study participants were restricted to caregivers who were recruited from only one health facility , and , therefore , their views may be biased by contact with the same paediatric gastroenterology team and their standard educational practices . participants were recruited among parents / carers attending to the hospital ( a majority resided in havana ) , and thus we likely failed to capture the views of people in other provinces . as parents were recruited from those taking their children to the outpatient clinic for gastroenterology and within population are likely to be a large group of children who have giardiasis , it is reasonable to assume that parents of these children are more likely to know what giardiasis is than parents from the general population . additionally , it should be noted that people attending health facilities at a hospital are expected to have a relatively greater awareness about common health issues . there is not a previous study in this area , and hence this questionnaire survey was the first to explore some of the issues in detail . face - to - face administration of the questionnaire might have led to some degree of bias in the interviewees ' responses . the study has revealed reasonable knowledge of the symptoms of giardiasis ; however , there is a need for educational intervention directed towards correcting misconceptions . there was a need for an effective education programme focusing on giardiasis transmission and prevention which should be emphasised in order to avoid reinfections . the central necessity of caregivers ' involvement in developing educational strategies that reflect their understandings and interpretations of this disease should not be overlooked .

background . giardia lamblia is an important cause of diarrhoeal disease throughout the world . giardiasis a mild and self - limiting disease that this protozoan causes is perceived as a harmful disease . aim . to explore the general level of awareness about giardiasis , clinical features , mode of transmission , prevention , and consequences and describe the sources and channels of information caregivers would prefer using to be informed about this disease . methods . a cross - sectional survey was conducted among caregivers attending to the outpatient paediatric hospital setting in havana . results . a total of 202 caregivers were interviewed . nearly 73% considered giardiasis as a modern problem , and 39% considered that it could be a fatal disease . although 76.7% were aware that small intestine is the organ affected , other localizations were cited . abdominal pain and diarrhoea were recognized as the commonest symptoms . around one - third could identify that giardiasis may spread through drinking unboiled water and unwashed vegetables other incorrect ways were mentioned ; respondents with more than 12 years of formal education were more likely to have better knowledge . discussion . strategies to control giardiasis need to be through an integrated approach aiming at boosting caregivers ' knowledge and encouraging healthcare workers to act as a readily available source for health information .

1. Introduction 2. Study Population and Methods 3. Results 4. Discussion 5. Limitations of the Study 6. Conclusions

this cohort study was approved by the centre hospitalier universitaire de qubec research ethics board . participants were <3 years of age and either received medical attention at an outpatient pediatric clinic or were hospitalized at a pediatric center for acute rti during 4 winter seasons ( 20062010 ) , in qubec city , qubec , canada . clinical data were prospectively collected at study entry and after 1-month follow - up . for all patients , at the first visit a nasopharyngeal aspirate was collected . the aspirate was frozen at 80c until subsequent testing by a multiplex pcr / dna hybridization assay that detects rsv genotype - a ( rsv - a ) , rsv - b , and 22 other respiratory viruses ( infiniti rvp assay ; autogenomics , carlsbad , ca , usa ) ( 14 ) . rsv infection was identified in aspirates from 467 ( 63.6% ) of 734 hospitalized children ( 257 rsv - a , 210 rsv - b ) and from 147 ( 48.2% ) of 305 outpatient children ( 85 rsv - a , 62 rsv - b ) . during 20062010 , a total of 724 children received palivizumab in the qubec city region ( l. cliche , pers . rsv - positive samples from all 12 study participants receiving palivizumab and from 100 not receiving palivizumab underwent rsv - f sequencing . additionally , f - gene analysis was performed on 11 rsv - positive clinical samples from palivizumab recipients retrospectively identified by using neonatal clinic registries at mcmaster children s hospital ( hamilton , ontario , canada ) and montral children s hospital ( montral , qubec , canada ) during 20092010 . rna was extracted directly from nasopharyngeal samples by using a qiamp viral rna mini kit ( qiagen , mississauga , ontario , canada ) . random primers ( amersham , piscataway , nj , usa ) and superscript ii rt kit ( invitrogen , carlsbad , ca , usa ) were used for reverse transcription . pcr amplification was performed with quantifast probe pcr+rox vial kit ( qiagen ) ; primers and thermocycling conditions are available from g.b . upon request . rsv - f amplicons were sequenced by using an automated sequencer ( applied biosystems , foster city , ca , usa ) . along with the newly generated nucleotide sequences from the 123 children ( 23 palivizumab recipients ; 100 nonrecipients ) , we analyzed 92 clinical rsv - f sequences provided by other investigators ( 10,11 ) or available from genbank . we also included 10 unpublished rsv - f sequences from a 20042005 study of palivizumab recipients in canada ( 15 ) . a 1,524-bp region ( positions 791602 in the prototype a2 and b1 rsv - f genes ) was translated into amino acid sequences , and the palivizumab binding site ( residues 262276 ) was assessed for variations . the final dataset comprised 170 unique sequences , including 89 that were newly generated in this study ( genbank accession nos . however , this segregation likely reflects temporal evolution rather than geographic influence because all rsv - f sequences originating from other countries were collected > 10 years ago . previous rsv - g studies have demonstrated concurrent circulation of related lineages in distant areas ( 13 ) . . this difference may reflect sampling bias because more rsv - a sequences originating from diverse locations and years were available ; however , the greater genetic diversity of rsv - a compared with rsv - b has also been observed in a study conducted in south korea ( 10 ) . phylogenetic analysis of 170 near full - length unique respiratory syncitial virus fusion ( rsv - f ) gene sequences ( nt 791602 ) . panels a and b are detailed phylograms of the rsv - a and rsv - b taxa analyzed , respectively . one bovine rsv - f sequence was added to the dataset ( genbank accession no . af295543.1 ) as the outgroup ( not shown ) and used for rooting the phylograms . topology was inferred by using the neighbor - joining method , and evolutionary distances were computed by using the maximum - composite likelihood method in mega5 software ( www.megasoftware.net ) . only bootstrap values > 50% are shown . blue text and triangles represent rsv strains isolated in canada and sequenced at the centre de recherche du centre hospitalier universitaire de qubec ; red branches indicates a sublineage of rsv - a with a n276s mutation ; underlining indicates prototypical rsv a2 and rsv b1 strains . the clinical origin of strains from canada ( prospective study hospitalized patient [ h ] or clinic patient [ c ] ; 20042005 palivizumab study patient [ s ] ; retrospectively identified patient from the montral children s hospital [ mch ] or mcmaster children s hospital [ mac ] ) is indicated , followed by the year collected , the specimen identifier , and the result of rsv genogroup testing ( rsv - a [ a ] , rsv - b [ b ] ) by multiplex pcr / dna hybridization assay ( 14 ) . specimens with a nonsilent mutation at codon 272 have the amino acid substitution identified in brackets . when a taxon represents > 1 identical sequences , the number of patients that it represents and the number of palivizumab recipients ( pzb ) among these patients are noted in parentheses . sa , south africa ; chn , people s republic of china ; uk , united kingdom , jpn , japan ; aus , australia ; usa , united states ; cdc , us centers for disease control and prevention ; ny , new york ; sl , st . louis ; wv , west virginia ; mn , minnesota ; md , maryland ; wa , washington ; sel , seoul , south korea . * mean nucleotide and amino acid identities were estimated by calculating pairwise distances in mega5 software ( www.megasoftware.net ) and using the maximum - composite likelihood and poisson correction models , respectively . rsv , respiratory syncytial virus . of the 23 rsv - f amino acid sequences from patients who received palivizumab ( table 2 ) , 2 exhibited a mutation at residue 272 ( k272q , k272 m ) , whereas no such mutations were identified in the other 100 strains obtained from those who did not receive palivizumab ( 8.7% versus 0% ; p = 0.03 , by fisher exact test ) . a sublineage of rsv - a , noteworthy for an n276s substitution in the palivizumab binding site , emerged during 20082009 ( 8 [ 44% ] of 18 rsv - a strains ) and became the predominant rsv - a clade during 20092010 ( 25 [ 100% ] of 25 strains ) in palivizumab recipients and nonrecipients . no sequences from genbank or other studies ( 10,11 ) harbored any palivizumab binding site mutation . * patient identification ( i d ) nomenclature : hospitalized ( h ) or clinic ( c ) prospective study participant , montral children s hospital ( mch ) or mcmaster children s hospital ( mac ) patient . ga , gestational age ; pzb , palivizumab ; multiplex pcr / dna , hybridization assay ; mutation , mutation in respiratory syncytial virus fusion protein pzb binding site ( residues 262276 ) ; rsv , respiratory syncytial virus ; lbw , low birthweight ( 1,5002,500 g ) ; nf , no mutation found in pzb binding site ; vlbw , very low birthweight ( 1,0001,499 g ) ; elbw , extremely low birthweight ( < 1,000 g ) ; rti , respiratory tract infection ; bpd , bronchopulmonary dysplasia ; iugr , intrauterine growth restriction . median patient age 6.0 mo ( range 124 mo ) . median interval between last palivizumab dose and symptom onset : 15.0 d ( range 327 d ) . retrospectively identified participants from montral children s hospital or mcmaster children s hospital were rsv - positive by direct immunofluorescence assay ( chemicon international , temecula , ca , usa ) and were not tested by the multiplex pcr / dna hybridization assay ( 14 ) . rsv was incubated ( for 2 h at 37c ) with serially diluted palivizumab , then cultured in vero cells ( for 5 d ) . rsv replication and 50% inhibitory concentrations ( ic50 ) were subsequently determined by f protein quantification by using elisa . the mean sd ic50 of c09101006a , a n276s strain , was 0.33 0.04 g / ml , similar to that of rsv - a2 wild type ( ic50 0.46 0.04 g / ml ) and therefore was considered susceptible . we report the prevalence of resistance - conferring mutations in rsv - f among children receiving or not receiving palivizumab . although infrequent ( 8.7% of infections in palivizumab recipients ) , residue 272 mutations were significantly associated with palivizumab exposure and not observed at all in nonexposed patients . we identified 2 new clinical specimens with position 272 mutations ( k272q and k272 m ) . we can not exclude the possibility that additional specimens contained mixed viral populations with minor proportions of position-272 mutants not detectable by conventional sequencing methods . changes at this position ( from lysine to asparagine , glutamine , glutamic acid , methionine , or threonine ) have produced palivizumab resistance in vitro ( 9 ) and in a cotton rat model ( 7 ) . as previously reported , 1 ( 10.0% ) of 10 sequences from our 20042005 study of palivizumab patients carried a 272 mutation ( k272e ) ( 15 ) . the k272e substitution is the only substitution also demonstrated to confer resistance to motavizumab , an enhanced - potency monoclonal antibody developed by affinity maturation of palivizumab ( 9 ) . we could not perform neutralization assays on position-272 variants because they did not grow in culture . phylogenetic analysis demonstrated that mutations in the palivizumab binding site occur in diverse genetic backgrounds ; all 3 strains with substitutions at residue 272 grouped to different clades ( figure ) . furthermore , these mutant strains caused mild disease treatable in an outpatient clinic and severe illness requiring hospitalization . from 3 canadian communities we detected a lineage harboring an n276s mutation in 44.4% of rsv - a sequences from 20082009 and 100% from 20092010 , unrelated to palivizumab exposure . adams et al . have proposed that n276s led to palivizumab resistance in a clinical specimen ( 8) . however , that sample also comprised a k272e subpopulation . our microneutralization assay results and unpublished neutralization data using recombinant viruses and clinical isolates ( q. zhu , pers . comm . ) suggest that n276s does not confer resistance . although serious rsv rtis during palivizumab prophylaxis remain uncommon , we observed an 8.7% prevalence of known resistance mutations among 23 medically attended patients receiving palivizumab .

to assess molecular evolution of the respiratory syncytial virus ( rsv ) fusion gene , we analyzed rsv - positive specimens from 123 children in canada who did or did not receive rsv immunoprophylaxis ( palivizumab ) during 20062010 . resistance - conferring mutations within the palivizumab binding site occurred in 8.7% of palivizumab recipients and none of the nonrecipients .

The Study Conclusions