Datasets:

LA1512

/

pubmed-val-1K

like 0

transfusion - related acute lung injury ( trali ) is typically presented as pulmonary edema with bilateral pulmonary infiltrations on chest radiography and severe dyspnea , tachypnea and cyanosis which develops during or within 6 hr of transfusion ( 1 ) . the diagnostic criteria was proposed by trali consensus conference in 2004 ( table 1 ) ( 2 ) . most patients having suspected trali require supplemental oxygen and approximately 70% of affected patients require mechanical ventilation . although the estimated incidence of trali is 1 in 5,000 and the mortality is 6% , the true frequency is not known ( 1 , 3 ) . suspected cases of trali may have been misdiagnosed or underestimated until now due to the poor awareness or lack of laboratory evidence . many studies revealed that the mechanism of trali is triggered by the presence of anti - human leukocyte antigen ( anti - hla ) or anti - human neutrophil antigen ( anti - hna ) antibodies present in plasma of donor and/or recipient . the identification of anti - hla or anti - hna antibodies in plasma of donor and/or recipient supports the diagnosis of trali ( 2 ) . although there are a few documented reports about trali in korea , the identification of immunopathogenic evidence was not performed sufficiently ( 4 ) . recently , we 've experienced two cases of trali triggered by patients ' anti - hla antibodies which were specific for hlas of transfused packed red blood cells ( prbc ) . clinical manifestations as well as the findings of donors ' and patients ' hla and anti - hla concordance strongly supported the diagnosis of trali triggered by minor pathogenesis . a 66-yr - old man having lung cancer with fibrosis was admitted through emergency room due to dyspnea on august 25 , 2008 . the initial vital signs were blood pressure 97/56 mmhg , pulse rate 77/min , respiratory rate 22/min and body temperature 37.3 and laboratory findings were spo2 80% and 3,960/l-10.0 gm / dl-12410/l for white blood cells ( wbc)-hemoglobin ( hb)-platelet , respectively . on the second hospital day , pancytopenia became aggravated ( 2,810/l-7.8 gm / dl-7210/l for wbc - hb - platelet , respectively ) , so transfusion of 2 units of prbc was planned to correct anemia . approximately 5 min after starting transfusion of the second unit of prbc , the patient presented dyspnea , cyanosis and shivering with elevation of body temperature ( 38 ) , he developed severe respiratory failure ( sao2 < 50% , paco2 25.7 mmhg , pao2 25.8 mmhg , respiratory rate > 60/min ) and hypotension ( systolic blood pressure < 70 mmhg ) . the chest radiograpy taken after intubation showed interval aggravation of bilateral diffuse ground glass opacity of lung parenchyma with pleural effusion but with normal cardiothoracic ratio ( fig . the echocardiogram taken soon after the patient was transferred to the intensive care unit showed normal lv cavity size and moderate lv systolic dysfunction ( lv ejection fraction was 39% ) with mild aortic regurgitation . the patient did not have any clinical signs of transfusion associated - circulatory overload ( taco ) such as jugular venous distension , systolic hypertension or gallop . b - type natriuretic peptide ( bnp ) ( triage , biosite , united kingdom ) level measured an hour after the event of respiratory failure was 106 pg / ml which was slightly elavated ( reference range 5 - 100 pg / ml ) . it has been suggested that if the level of bnp is higher than 250 pg / ml , it is indicative of congestive heart failure , but if less than 150 pg / ml , trali is more likely ( 5 ) . acute hemolytic transfusion reaction also has been excluded based on repeated compatible serologic cross - match result and absence of typical clinical features such as hemoglobinuria , decreased hemoglobin level or renal failure . one month ago , he had been transfused with 2 units of prbc without any adverse transfusion reactions . since there were no angioedema , wheezing , strigor or urticaria , the diagnosis of anaphylactic transfusion reaction was also excluded . patient 's pre- and post - transfusion blood samples and remnants of 2 units of transfused prbc were subjected to further immunologic studies . hla typing and tests for panel reactive antibody ( pra ) were performed by pcr - ssp ( biotest , germany ) and elisa ( gti , usa ) , respectively . prior to transfusion , the patient already had multiple anti - hla antibodies ( anti - a32 , anti - dr8 ) which were specific for hla type of prbc ( first prbc : a*32/dr8 and second prbc : a*33/cregs ) . and the % pras of patient 's serum after transfusion were further increased to 40% ( anti - a1 , -a25 , -a32 , -b37 , -b45 , -b51 , -b63 ) and 37% ( anti - dr8 , -dr52 ) of anti - hla class i and ii antibodies , respectively . the spectrum of donor specific anti - hla antibodies became broadened and the titers were elevated ( table 2 ) . there was no clinical improvement in pulmonary complications and the patient could not wean ventilator support . a 62-yr - old woman was hospitalized for palliative treatment of rectal cancer with multiple lung metastasis on october 1 . on the 9th hospital day , she complained of mild dyspnea and had a radiological finding compatible with mild pulmonary edema ( fig . day , transfusion of 8 units of platelet concentrates ( pc ) and 2 units of prbc were planned to correct thrombocytopenia and anemia ( 7,880/l-8.0 g / dl-910/l for wbc - hb - platelet , respectively ) . 8 units of pc were transfused without any adverse transfusion reactions . however , after transfusion of approximately 30ml of the first unit of prbc , the patient complained of difficulty in breathing . a chest radiography taken shortly after the onset of symptoms showed aggravated bilateral lung infiltrations ( fig . 2b ) . patient 's blood pressure was increased to 164/92 mmhg from 114/60 mmhg , but it became normalized to 105/61 mmhg after 2 and half hours . to differentiate taco , further echocardiogram or bnp blood test were not done . however , taco was less likely for worsening the patient 's pulmonary symptoms and signs when considering the facts that blood pressure was decreased to the baseline level shortly after stopping transfusion and pulmonary edema with dyspnea was not improved by diuretics therapy during hospitalization . other clinical entities which cause acute respiratory distress such as acute hemolytic transfusion reactions and anaphylactic transfusion reactions have been excluded in the same manner with the first case . similarly with the first case , patient 's serum after transfusion had multiple anti - hla antibodies ( 36.5% pra for hla class ii ) including anti - dr4 which was specific for hla type of transfused prbc ( table 2 ) . based on the clinical and laboratory findings including the presence of patient 's anti - hla antibodies which potentially could have reacted with donor 's leukocyte antigens , the diagnosis of trali that is responsible for worsening the patient 's respiratory function which had pre - existing mild pulmonary edema has been made . a 66-yr - old man having lung cancer with fibrosis was admitted through emergency room due to dyspnea on august 25 , 2008 . the initial vital signs were blood pressure 97/56 mmhg , pulse rate 77/min , respiratory rate 22/min and body temperature 37.3 and laboratory findings were spo2 80% and 3,960/l-10.0 gm / dl-12410/l for white blood cells ( wbc)-hemoglobin ( hb)-platelet , respectively . on the second hospital day , pancytopenia became aggravated ( 2,810/l-7.8 gm / dl-7210/l for wbc - hb - platelet , respectively ) , so transfusion of 2 units of prbc was planned to correct anemia . approximately 5 min after starting transfusion of the second unit of prbc , the patient presented dyspnea , cyanosis and shivering with elevation of body temperature ( 38 ) , he developed severe respiratory failure ( sao2 < 50% , paco2 25.7 mmhg , pao2 25.8 mmhg , respiratory rate > 60/min ) and hypotension ( systolic blood pressure < 70 mmhg ) . the chest radiograpy taken after intubation showed interval aggravation of bilateral diffuse ground glass opacity of lung parenchyma with pleural effusion but with normal cardiothoracic ratio ( fig . the echocardiogram taken soon after the patient was transferred to the intensive care unit showed normal lv cavity size and moderate lv systolic dysfunction ( lv ejection fraction was 39% ) with mild aortic regurgitation . the patient did not have any clinical signs of transfusion associated - circulatory overload ( taco ) such as jugular venous distension , systolic hypertension or gallop . b - type natriuretic peptide ( bnp ) ( triage , biosite , united kingdom ) level measured an hour after the event of respiratory failure was 106 pg / ml which was slightly elavated ( reference range 5 - 100 pg / ml ) . it has been suggested that if the level of bnp is higher than 250 pg / ml , it is indicative of congestive heart failure , but if less than 150 pg / ml , trali is more likely ( 5 ) . acute hemolytic transfusion reaction also has been excluded based on repeated compatible serologic cross - match result and absence of typical clinical features such as hemoglobinuria , decreased hemoglobin level or renal failure . one month ago , he had been transfused with 2 units of prbc without any adverse transfusion reactions . since there were no angioedema , wheezing , strigor or urticaria , the diagnosis of anaphylactic transfusion reaction was also excluded . patient 's pre- and post - transfusion blood samples and remnants of 2 units of transfused prbc were subjected to further immunologic studies . hla typing and tests for panel reactive antibody ( pra ) were performed by pcr - ssp ( biotest , germany ) and elisa ( gti , usa ) , respectively . prior to transfusion , the patient already had multiple anti - hla antibodies ( anti - a32 , anti - dr8 ) which were specific for hla type of prbc ( first prbc : a*32/dr8 and second prbc : a*33/cregs ) . and the % pras of patient 's serum after transfusion were further increased to 40% ( anti - a1 , -a25 , -a32 , -b37 , -b45 , -b51 , -b63 ) and 37% ( anti - dr8 , -dr52 ) of anti - hla class i and ii antibodies , respectively . the spectrum of donor specific anti - hla antibodies became broadened and the titers were elevated ( table 2 ) . there was no clinical improvement in pulmonary complications and the patient could not wean ventilator support . a 62-yr - old woman was hospitalized for palliative treatment of rectal cancer with multiple lung metastasis on october 1 . on the 9th hospital day , she complained of mild dyspnea and had a radiological finding compatible with mild pulmonary edema ( fig . day , transfusion of 8 units of platelet concentrates ( pc ) and 2 units of prbc were planned to correct thrombocytopenia and anemia ( 7,880/l-8.0 g / dl-910/l for wbc - hb - platelet , respectively ) . 8 units of pc were transfused without any adverse transfusion reactions . however , after transfusion of approximately 30ml of the first unit of prbc , the patient complained of difficulty in breathing . a chest radiography taken shortly after the onset of symptoms showed aggravated bilateral lung infiltrations ( fig . patient 's blood pressure was increased to 164/92 mmhg from 114/60 mmhg , but it became normalized to 105/61 mmhg after 2 and half hours . to differentiate taco , further echocardiogram or bnp blood test were not done . however , taco was less likely for worsening the patient 's pulmonary symptoms and signs when considering the facts that blood pressure was decreased to the baseline level shortly after stopping transfusion and pulmonary edema with dyspnea was not improved by diuretics therapy during hospitalization . other clinical entities which cause acute respiratory distress such as acute hemolytic transfusion reactions and anaphylactic transfusion reactions have been excluded in the same manner with the first case . similarly with the first case , patient 's serum after transfusion had multiple anti - hla antibodies ( 36.5% pra for hla class ii ) including anti - dr4 which was specific for hla type of transfused prbc ( table 2 ) . based on the clinical and laboratory findings including the presence of patient 's anti - hla antibodies which potentially could have reacted with donor 's leukocyte antigens , the diagnosis of trali that is responsible for worsening the patient 's respiratory function which had pre - existing mild pulmonary edema has been made . in 1983 , popovsky and moore first identified " trali " as a distinct clinical entity ( 6 ) . recently trali has risen many concerns and awareness as the leading cause of transfusion - related mortality . trali is defined as acute hypoxemia and non - cardiogenic bilateral lung infiltrations , which presents as severe dyspnea , tachypnea and cyanosis , and develops during or within 6 hr after completion of transfusion ( 1 ) . trali must be differentiated clinically from taco and a variety of other conditions including acute hemolytic transfusion reactions , anaphylactic transfusion reactions , pulmonary embolism , acute myocardial infarction and bacterial contamination of the transfused product ( 7 ) . like trali there are a lot of questions about the possibility of coexistence of trali and taco and the difficulties in assigning transfusion - associated respiratory failure to a single cause , even when taco can be demonstrated clearly ( 7 , 8) . taco is defined by a combination of clinical signs such as post - transfusion hypertension , tachycardia , jugular vein distension , elevated central venous pressure and pulmonary artery occlusion pressure , pulmonary edema with cardiomegaly on chest radiography and the prompt response to diuretics or treatment of ischemia . bnp and n - terminal pro - bnp ( nt - pro - bnp ) , cardiac neurohormones specifically being secreted from the ventricles in response to volume expansion , pressure overload or hypoxemia , have been reported as useful markers for diagnosis or exclusion of taco ( 8) . however , li and colleagues recently found that natriuretic peptides have limited diagnostic value in a differential diagnosis of pulmonary edema after transfusion in the critically ill patients . because bnp and nt - pro - bnp secretions were attributed to stimulatory effect of hypoxemia , as well as volume expansion and pressure overload and accuracy of bnp tests could be affected by the timing of the blood collection and other underlying diseases ( 5 ) . therefore , we can not totally depend on elevated bnp or nt - pro - bnp to differentiate trali from taco in patients presenting dyspnea and hypoxemia after transfusion . in our cases , the possibility of coexistence of trali and taco could n't be excluded completely . all plasma containing blood components have been associated with development of trali , including whole blood , prbc , pc , fresh frozen plasma ( ffp ) , and rarely , cryoprecipitate , iv immunoglobulin , and stem cell preparations . plasma rich blood components , such as ffp and pc were known to be most commonly implicated in trali ( 9 ) . it was reported that almost any blood component containing about 50ml or more of plasma could be implicated in trali . recently , one report showed that estimated residual plasma volume as low as 10 - 20 ml which contains donor derived leukocyte antibodies might cause trali ( 10 ) . the anti - hla and anti - hna antibodies and biologically active lipids in stored cellular blood components have been described ( 11 ) . most cases of trali has been so far considered to be caused by anti - hla class i , anti - hla class ii , or anti - hna antibodies in the donor 's plasma , which is called the major pathogenesis . transfusion of donor 's antibodies into a recipient who has the cognate antigens leads to neutrophil activation and release of oxidative substances that damage the pulmonary endothelium . this injury to pulmonary endothelium may cause an imbalance between the amount of fluid entering the alveoli and being actively removed and then results in severe pulmonary edema ( 1 , 3 ) . however , fewer than 10% of trali cases involve the reverse mechanism in which the recipient has anti - hla or anti - hna antibodies against donor 's leukocyte antigens ( 12 ) . due to relatively small number of leukocytes in the transfused blood components , it has been questioned whether trali can be caused by leukocyte antibodies in the patient 's serum . the development of trali even with a relatively few leukocytes transfused in our cases might be explained by the activation of the recipient 's own leukocytes either as a consequence of activating factors released by the small number of transfused leukocytes after antibody binding or by an abnormal binding of the recipient 's alloantibodies to his / her own leukocytes . leukocyte antibodies in the recipient reacting with leukocytes in the blood product have also been described in several studies ( 1 , 13 - 15 ) . trali has traditionally been associated with the infusion of anti - hla class i antibodies in transfused blood components . however , trali caused by anti - hla class ii antibodies without simultaneous presence of anti - hla class i antibodies have rarely been described . in recent report , it has been suggested that anti - hla class ii antibodies play a critical role in initiating trali development ( 16 ) . proposed mechanism is that hla class ii - expressing cells , such as monocytes , may lead to the production of il-1 , tnf- and tissue factors and release of these cytokines may result in the secondary activation of neutrophils and/or endothelial cells leading to endothelial damage , capillary leak , and eventually trali ( 12 , 17 , 18 ) . our second case supports the role of anti - hla class ii alone as the cause of trali . there has been international movement to reduce the risk of trali ( 11 , 19 ) . most efforts are focusing on reducing of the use of plasma components from female donors . since the donors of the implicated blood component in trali have been usually multiparous women who produced multiple antibodies against paternal leukocyte antigens during pregnancies . according to the 2008 annual serious hazards of transfusion ( shot ) report of uk , no case of trali due to ffp was reported in 2005 , 2006 and 2007 , following the introduction of preferential use of ffp from male donors since late 2003 . in 2008 , observed rates of trali remain lower than those in 2003 - 2004 when trali risk reduction strategies were first initiated and no deaths occurred as a result of trali which is the lowest rate since 1996 . base on these , shot organization emphasizes the need to achieve 100% use of male ffp and plasma for platelet pooling across the uk ( 20 ) . in conclusion , trali must be considered as a serious but not infrequent adverse transfusion reaction which needs to be diagnosed promptly in a ways of clinical suspicion , and radiological , biochemical and immunological findings and treated appropriately .

transfusion - related acute lung injury ( trali ) is a serious adverse transfusion reaction that is presented as acute hypoxemia and non - cardiogenic pulmonary edema , which develops during or within 6 hr of transfusion . major pathogenesis of trali is known to be related with anti - hla class i , anti - hla class ii , or anti - hna in donor 's plasma . however , anti - hla or anti - hna in recipient against transfused donor 's leukocyte antigens also cause trali in minor pathogenesis and which comprises about 10% of trali . published reports of trali are relatively rare in korea . in our cases , both patients presented with dyspnea and hypoxemia during transfusion of packed red blood cells and showed findings of bilateral pulmonary infiltrations at chest radiography . findings of patients ' anti - hla antibodies and recipients ' hla concordance indicate that minor pathogenesis may be not as infrequent as we 'd expected before . in addition , second case showed that anti - hla class ii antibodies could be responsible for immunopathogenic mechanisms , alone .

INTRODUCTION CASE REPORT Case 1 Case 2 DISCUSSION

the main frequent changes observed among women aged between 30 and 60 years due to the natural and continuing aging process are the appearance of small wrinkles , atrophy of subcutaneous fat , and decreases in collagen and elastin production . repeated contractions of the mimic muscles might be involved in the process . in young participants an magnetic resonance imaging ( mri ) study was used to demonstrate that the anterior convexity curve of the mimic muscles is due to the existence of a deep fat pad at the back of these muscles . while this mass of fat is effectively a mechanical sliding plane , its convexity constitutes the founding principle of a youthful midface appearance . with age , the muscle gradually straightens and shortens , due to the repeated contractions that expel the underlying fat and increase the tonus at rest . the structural aging becomes visible and , with time , the person s expression consequently becomes more rigid.2 the skin becomes drier and thinner and there is an evident loss in the skin texture and elasticity . a variety of external or extrinsic factors often act together with the aging process to prematurely age the skin . the most important and aggressive extrinsic factor related to aging other external factors include repetitive or exaggerated mimic expressions , gravity , sleeping position , and smoking . the combination of extrinsic and intrinsic aging factors determine different aspects and characteristics in patients aged under 50 years . the most frequent are skin and deep structure flaccidity , wrinkle expression in the upper third of the face , tear through , increase in the nasolabial fold , drop of the angle of the mouth , loss of definition in the mandibular border , cervico - facial platysmal bands , changes in skin pigmentation , and evident veins ( or telangiectasia).1 since symmetry is one of the major biologic factors contributing to facial attractiveness , facial rejuvenation procedures are commonly aimed at improving symmetry . there is a need for adapting and specifying esthetic approaches to the special needs of the individual patient . we will now discuss three minimally invasive procedures ; smoothing wrinkles and folds by temporary chemodenervation of facial muscles with botulinum toxin , correction of volume loss by fillers , and improvement of skin surface and dyschromia by peels . btx - a is produced by clostridium botulinum . synthesized as a single - chain polypeptide of 150 kda , btx has relatively little potency until it is cleaved by trypsin or bacterial enzymes into two chains , a heavy chain of 100 kda responsible for binding to the target structure and a light chain of 50 kda known as the toxifying chain . when btx is injected into a muscle , the heavy chain of the molecule binds to glycoproteins expressed specifically on cholinergic nerve endings . after internalization of the whole molecule by pinocytosis , the chains are cleaved within the cytoplasm . the light chain binds with high specificity to the soluble n - ethylmaleimide - sensitive fusion ( snare ) attachment protein receptors essential for exocytosis of acetylcholine . btx - a cleaves plasma membrane synaptosome associated protein [ snap-25 ] that results in a blockade of vesicle fusion.4,5 two to five days after btx is injected into a muscle paresis occurs which lasts for at least three months and gradually starts to wear off . the subjective duration of action in a given patient seems to be stable , but there is a great variability between different people . saturation will be seen with higher dosages after approximately three months.5 on the european market , three different branches of btx - a are off icially registered : botox / vistabel ( allergan ) , dysport ( ipsen)/azzalure ( galderma ) , and xeomin / bocouture ( merz ) . the products have different amounts of complexing proteins or are free of complexing proteins ( ie , xeomin / bocouture).6 the diffusion of the different drugs seems to be dependent on concentration.7 btx - a has an excellent safety profile8 and has been used extensively for facial rejuvenation with a focus on hyperkinetic wrinkles and to improve facial wound healing after surgery.912 different products can be inserted under the skin in different layers to correct depressed folds , wrinkles , furrows , scars , angles , and flaccidity . the main concept is to create a volume or even to replace an original volume compromise for the aging process of the face and neck . the types and number of dermal fillers have evolved , allowing clinicians to select the most appropriate agent for each specific purpose . filler properties differ both between and among classes , so clinicians must have a thorough understanding of these properties and the best techniques to use to provide the most satisfactory outcomes . permanent fillers are no longer recommended because their long term safety has not been established . nevertheless , some authors have published excellent results for the use of permanent fillers like artefill.13 temporary fillers consist of various substances including collagen , hyaluronic acid ( ha ) , alginates , and other polysaccharides . substances such as polylactic acid or hydroxylapatite are considered to be semipermanent fillers with a longer half life.14 the most common used substance today is ha , a natural polysaccharide and a component of human dermis and epidermis . ha - based fillers offer excellent biocompatibility while providing the same structural and mechanical properties of normal subcutaneous tissue . naturally occurring hyaluronan is rapidly broken down by hyaluronidase with a half - life of about 12 hours and eliminated through the lymphatics and by the hepatic metabolism to carbon dioxide and water.14,15 cross - linking gives ha fillers an in vivo life span of 6 to 18 months . the use of ha is particularly attractive for soft - tissue augmentation , because it is hydrophilic and a normal extracellular component of skin . it is directly involved in extracellular matrix function and because of its tolerability profile , it can be used without skin testing.15 corrections of displacement can easily be done by injection of hyaluronidase.16 factors that impact ha persistence include ha concentration , percentage of cross - linkage , type of cross - linkage , water binding capacity , and injection technique . monophasic gels seem to be more stable compared with diphasic gels . to improve longevity , manufacturers use various agents to cross - link the ha . as a result , the final proportion of cross - linked ha and the degree of cross - linking impact the physical characteristic of the final product . the water - binding capacity or hydrophilic nature allows the ha to create larger volumes relative to their mass . if all other factors are the same among has , the product with the highest degree of cross - linking experiences the least amount of degradation by enzymes and free radicals . the cross - linking agents also have an impact on connective tissue reaction to injectable fillers.17 injection technique can play a role in longevity of the dermal filler . injection into the deep dermis has been shown to increase de novo collagen synthesis , hypothesized to be the result of fibroblast stretching . therefore as the ha is degraded , novel collagen synthesis replaces the ha which results in longer - lasting correction . nerve blocks are used to reduce this during the procedure.18 the combination of ha filler with btx - a has been shown to produce improved and longer lasting effects for glabellar lines than either btx - a or filler alone.19 another filler with potential long term effects is autologous adipose tissue used for facial sculpturing . adipose tissue is believed to constitute an ideal source of uncultured stromal stem cells . by optimizing the harvesting , storage , and transplantation of adipose tissue , long - lasting results can be obtained.20 the long lasting volumizing in many patients seems to be due to mesenchymal stem cells that eventually differentiate into fibroblasts , adipocytes , and blood vessel.2123 autologous fat transfer has been successfully used for facial lipodystrophy and for facial sculpturing in esthetic facial surgery.24,25 autologous fat transfer to the midface has definite long - term volume augmentation results . on average , however , some variability exists in the percentage of volume that remains , meaning that a touch - up procedure may be required.26 in the future is it hoped that better identification of and enrichment with stem cells for adipose transfer will create a more predictable long - term outcome.27 progenitor , endothelial , and mesenchymal stem cells derived from adipose tissue could therefore not only be central to plastic and reconstructive surgery applications , but also become the focus of an array of therapeutic solutions for many disease conditions , such as those affecting bone , cartilage , muscle , liver , kidney , the heart , the brain , and the pancreas , expanding the possible indications and translational potential of tissue , cell - based , and regenerative medicine strategies.21 chemical peeling is the topical application of chemical agents to the skin , which causes controlled destruction of part of or the entire epidermis , with or without the dermis , leading to exfoliation and removal of superficial lesions , followed by regeneration of new epidermal and dermal tissues . indications for chemical peeling include pigmentary disorders , superficial acne scars , aging skin changes , and benign epidermal growths . peels have been classified according to the chemical compounds involved or the depth of the exfoliation.28 superficial chemical peels are currently performed with various compounds including trichloracetic acid , alpha hydroxy acids , and jessner s solution ( 14% lactic acid , 14% resorcinol , and 14% salicylic acid ) . alpha hydroxy acids , in particular glycolic acid ( ga ) , are common chemical peel agents . ga peels in concentration ranging from 20%70% have been shown to be effective in reducing facial hyperpigmentation and fine lines / wrinkles.29 based on the available information , these salicylic ingredients are safe for use when formulated to avoid skin irritation or to avoid increasing the skin s sun sensitivity , or , when increased sun sensitivity would be expected , directions for use include the daily use of sun protection.30,31 kligman and kligman have developed salicylic acid , a beta hydroxy acid ( 30% in a hydro ethanolic vehicle ) , as an alternative peel to ga.32 the benefits of salicylic acid peels are resurfacing moderately photodamaged facial skin , fading of pigment spots , decreased surface roughness , and reduction of fine lines also in pigmented skin.33 derivatives of salicylic acid , especially long - chain fatty acylconjugates of salicylic acid , have been claimed to be more effective at lower concentrations for skin peeling use . a lipophilized ester - derivative of salicylic acid , capryloyl salicylic acid ( csa ) , has been shown to be an effective exfoliating agent due to its reduced penetration in the skin.34 salicylic acid causes a loss of cornified cells from the horny layer followed by the activation of the epidermal basal cells and the underlying fibroblasts.35 in photoexposed human facial skin , immature cornified envelopes ( ces ) were replaced with mature ces four weeks after treatment with salicylic - polyethylene glycol ( peg ) . there is no doubt that that classic surgical and nonsurgical procedures such as blepharoplasty , rhytidoplasty , or laser peelings still represent important techniques in esthetic and facial rejuvenation . it is also obvious that the combination of these traditional treatments with other procedures that offer improved skin quality and texture , wrinkles , low risk , good cost - effectiveness , low morbidity , and quick recovery represent an important advance and a real tendency . in this context , btx - a injection combined with different types of fillers or soft tissue augmentation represent an important non - surgical resource that , combined with traditional techniques , can improve or extend the results . these two procedures , btx and fillers , can also be combined with some kinds of lasers or light sources in order to produce a nonablative or fractional skin rejuvenation , superficial improvement , pigmented lesions , vascular alterations , wrinkles , and acne scars as well as to offer adequate skin tightening . the concept is to treat the wrinkles and folds and also improve the photodamage related to the aging process and skin laxity . a total of 1,559 patients ( 91% female ) have been treated , aged under 50 years . middle - aged women are a major group for esthetic treatments . fifty point three percent of patients received a combined treatment . the major combination was btx - a and fillers ( n = 784 , with 97% females ) . the main treated areas were periorbital , frontal , glabellar , platysma , depressor anguli oris , and nasal ( figures 17 ) . eighty - four percent of these patients received a reinjection of btx - a on average five months after the first treatment . this high number indicates patients satisfaction leading to a continuation of the initial procedures despite costs . facial plastic surgery procedures , such as cervicofacial rhytidoplasty or blepharoplasty , are the most common procedures used in combination with btx - a and fillers . whether the optimal moment for injecting btx - a is before or after the surgery remains a subject of debate . a potential advantage of using it prior to surgical intervention is the stabilization of cutaneous or even myocutaneous tissues . this , in turn , would facilitate their adequate accommodation , decreasing tension in the incision , suture , flaps and traction areas , thus improving the quality of the cicatricial process . despite its transient duration and relatively high cost limit the use of neurotoxins as an adjunctive agent in surgery is suitable for most patients . in the first weeks following surgery , the relaxing effect of the versatility and reproductive effect of btx - a among these patients represent an important characteristic of this approach . the aspect of a frontal surgical surgery ( open or video - assisted ) can be temporarily mimicked or reproduced with an adequate application into the frontal , corrugators , procerus , and orbicularis oculi muscles . this resource is useful for patients aged under 50 years , who do not want or do not have clinical conditions to undergo surgery or prefer a less invasive procedure . btx - a application can effectively offer an elevation of the lateral aspect of the eyebrow or of the mouth commissure . thus , for the treatment of eyelid ptosis , whatever technique is used ( open , endoscopic , or combined approach ) , previous neurotoxin application may be very useful for inhibiting or smoothing possible cutaneous and muscular creases in the treated areas . on the upper third of the face , btx - a can attenuate the hyperdynamic wrinkles caused by muscular activity , eliminating the need for either a coronal incision in treating the frontal musculature or for an endoscopic procedure . when it is injected into the palpebral region , it is possible to obtain an elevation of the caudal portion of the eyebrow and modify its shape or position , which is useful especially when performing a blepharoplasty . this palpebral elevation ( lifting effect ) brings about significant appearance of rejuvenation as well as the improvement of it is possible , in selected cases , to decrease the quantity of skin to be removed and consequently , to decrease the scar dimension . although many researchers promote its postoperative use , there is no consensus as to the ideal time of application in these cases . btx - a injection into the lateral and anterior cervical regions and in the depressor anguli oris is capable of attenuating the platysmal band and elevating the angles of the mouth , creating harmony between this area and the rest of the face and improving the result of the rhytidoplasty . although btx - a can be used in combination with fillers , lasers , and surgical procedures or even applied into other areas of the face and neck , we should use common sense and carefully examine the patient s anatomy when using this neurotoxin in order to avoid excessive muscle relaxation , muscle paralysis , or the end result of a face incapable of natural expressions . several fillers , skin care techniques , chemical peelings , dermabrasion , and different types of ablative and nonablative lasers and energy sources can be combined with btx - a use in order to prevent or to treat the aging process . to improve superficial skin texture and pigmentary problems chemical peels twenty patients ( 15 females and 5 males , skin type i iv ) with acne , acne scars , or actinic damage were included in an open clinical trial . all of them underwent a preparation period of two weeks before first peeling with 5% csa solution . the peeling was performed twice a month for a total of 4 to 5 treatments . patients global assessments and physicians global assessments of the csa peels were considered good or better in its clinical effects in 18 of 18 and 17 of 18 patients who completed the series of peels . two patients dropped out because of intolerance to either the preparation agents or to 5% csa . in all other patients the treatment csa peels are well tolerated in most patients of skin type i iv with improvement of inflammatory acne lesions , facial acne scars , radiance , pigmentary changes , and fine wrinkling.37 future researchers could investigate the performance of repeated series every other year . improved knowledge of cellular and skin aging , the use of stem cells , new and safer filler options , the technical evolution of surgical techniques , advances of laser sources , fractional laser and other energy sources , as well as new neurotoxin complexes represents a promising future in the treatment of the aging aspects of patients aged 30 to 50 years . the appropriate evaluation and correct use of these minimally or less invasive techniques led to a younger and healthier look for the treatment of facial aging . this neurotoxin in conjuction with fillers has a low risk , efficiently treats skin aging , and also prevents or reduces some aspects and characteristics related to the facial aging process . chemical peels like csa can further contribute to a youthful facial appearance with a more even skin tone and increased radiance .

facial rejuvenation is a significant process involved in restoring youthfulness . the introduction of less invasive procedures has increased acceptance of such procedures . often a combination of different techniques allows individualized treatment with optimal outcomes . furthermore , this leads to a natural look without a significant downtime . we report herein the use of such a combined approach in middle - aged women with particular emphasis on botulinum toxin type a , dermal fillers , and chemical peels .

Etiological factors related to skin aging Botulinum toxin type A (BTX-A) Fillers Chemical peeling Our concept of minimally invasive facial rejuvenation in women between 30 and 50 years of age Combination with peels Perspectives Conclusions

in computational geometry , many fundamental properties of finite point sets do not depend on the actual coordinates of each point in real space , but rather on the relative position of the points among each other . in their landmark paper , goodman and pollack capture this idea by defining the order type of a point set . in the plane , two point sets have the same order type if there is a bijection between the sets s.t . for every triple p , q , r of the first set , the corresponding points (p),(q ) , and (r ) have the same orientation ( i.e. , are both oriented clockwise or counterclockwise).3 this orientation can be tested by the inequalitydet(pxpy1qxqy1rxry1)>0 , which indicates whether r is to the left of the directed line through p and q , i.e. , whether the triple is oriented counterclockwise . the sign of the determinant therefore gives a predicate (p , q , r ) that is true iff the triple is oriented counterclockwise . this mapping of all triples of a set to their orientation is also called the chirotope of the set ( cf . remark 1.6 in and [ 3 , p. 95 many combinatorial properties of a set of points only depend on its order type , like its convex hull , the set of its crossing - free graphs , etc . we implicitly assume throughout this paper that all sets are in general position , i.e. , do not contain collinear triples . metric properties of a point set that are not determined by the order type . this includes the sets delaunay triangulation ; it is straightforward to construct two sets of the same order type whose delaunay triangulations are different . guibas and stolfi separate topological from geometric aspects , using a predicate incircle(p , q , r , s ) that is true iff the triple ( p , q , r ) is oriented counterclockwise and the point s lies inside the circle defined by the first three points . their delaunay triangulation algorithm depends almost entirely on this predicate , making it a robust approach , that is intended to be easy to implement and to prove . he defines five axioms over a ternary predicate p and calls sets of triples obeying them cc systems . axiom 4interiorityp(t , p , q)p(t , q , r)p(t , r , p)p(p , q , r ) . axiom 5transitivityp(p , q , r)p(p , q , s)p(p , q , t)p(p , r , s)p(p , s , t ) p(p , r , t ) . p(t , p , q)p(t , q , r)p(t , r , p)p(p , q , r ) . p(p , q , r)p(p , q , s)p(p , q , t)p(p , r , s)p(p , s , t ) p(p , r , t ) . these are fulfilled by all point sets in the euclidean plane , with p= defined as point triple orientation . for these sets , however , there exist cc systems that can not be constructed as point sets in r2 . cc systems are equivalent to abstract order types , which , for example , can be used in so - called abstract order type extension . every abstract order type can be mapped to an arrangement of pseudo - lines in the projective plane . a stretchable arrangement corresponds to a set of realizable order types [ 3 , pp . goodman and pollack showed that all cc systems of up to 8 elements are realizable as point sets . the concept of the convex hull of a point set generalizes to all cc systems . the axiomatic approach can also be extended to cover delaunay triangulations . in the axiomatic settings , knuth provides o(nlogn ) time algorithms for both problems , where the time bound for the latter holds in the expected case . he points out that the algorithm of guibas and stolfi uses the coordinate representation to find a line that partitions the point set into two equally sized subsets ( cf . 9798 ] therefore asks for an algorithm to find such a partition of a cc system in linear time . the problem is straightforward when given an extreme point of the set ( i.e. , an element of the convex hull boundary ) . proving the existence of a linear - time algorithm for finding a single extreme point is also explicitly part of open problem 1 . in this work , we answer both parts of the open problem in the affirmative . in section 2 , we give a simple o(n ) time algorithm that , given a point c of a set s of size n , finds a halving edge through c ; more specifically , it finds a second point cs s.t . not more than n22 points are on each side of the supporting line of c and c. we then describe in section 3 an algorithm that , given two points p and q , returns the edge of the convex hull that is crossed by the ray from p through q. we first show that the algorithm runs in o(n ) time for realizable sets . we then show that the time bound is also correct for non - realizable sets , that is , for all cc systems . our main motivation is to show that the asymptotic running time for solving these problems does not depend on the representation by coordinates . while an arbitrary halving edge can easily be found by picking a point with median , say , x - coordinate , the problem is more sophisticated when the halving line should pass through a predefined point . e.g. , the linear time ham - sandwich - cut algorithm of lo , matouek and steiger can be adapted to find a halving line through a point . the straightforward way of finding an extreme point of a set given by coordinates is selecting the one with , say , lowest x - coordinate . finding a convex hull edge that is traversed by a given line in linear time is a subroutine of the so - called ultimate convex hull algorithm of kirkpatrick and seidel . there , the median of the slopes of an arbitrary matching of the points is used for the prune and search approach . recent algorithms that operate only on triple orientations involve computing the convex hull of disks . also note that there are models that allow for more abstract order types to be realized than by point sets in the euclidean plane . a preliminary version of this work appeared as . in this section we describe an algorithm to compute a halving edge through a given point c of a finite point set s of size n in the plane . while we give the algorithm for realizable order types , note throughout the proof that all assumptions also hold in the abstract setting . the idea is to split the point set evenly by two double wedges centered at c. we identify the double wedge that must contain a halving edge , and continue with the points therein . imagine a directed line rotated by 180 clockwise around c , starting at p1 . let p2, ,pn1 be the remaining points in the order passes through them , either with its front or its tail . we denote this order by , which is actually the order described in [ 3 , p. 16 for each pair of s{c } , we can compute the relative order in which passes through them in constant time , using the predicate . thus the median m = pn2 with respect to can be computed in o(n ) time . ( note that the number of points to the right of may not change monotonically while rotating . ) the supporting lines of cp1 and cm define two double wedges , containing s1={ps{c}:pm } and s2={ps{c}:mp } , respectively , each having not more than n22 points . more than n22 points to the right of 1 and thus less than n22 points to the right of n . due to our general position assumption , while rotating only one point changes sides at the same time . if less than n22 points are right of n2 , then one of the points in s1 forms a halving edge with c ( recall that there are w.l.o.g . . otherwise one of the points in s2 does . this way we can decide which subset contains a halving edge , exclude the other subset and iterate . observe that all the points we exclude belong to two ( open ) wedges centered at c , one entirely to the left and one entirely to the right of the non - removed lines of 2, ,n1 . the closure of each wedge contains a ray of 1 . we store how many points each of these wedges contained . now , if we want to compute the number of points to the right of some line i in subsequent iterations , then we only need to consider the remaining points and add the number of points belonging to the excluded wedge to the right of i . the algorithm has linear running time , as we exclude approximately half of the points in each linear - time iteration . theorem 2given a point set sr2 of size n in general position and a point cs , a halving edge of s incident to c can be found in linear time using only the predicate . given a point set sr2 of size n in general position and a point cs , a halving edge of s incident to c can be found in linear time using only the predicate . now we argue that the above approach does not require that s is realizable , that is , it works for any cc system ( using the predicate p ) . the order around c we use is also defined for cc systems by signing the points in a way that the positive points are to the right of 1 and the negative ones are to the left of 1 , where each negative sign will change the orientation of a triple containing c [ 3 , p. 16 this allows us to give a purely combinatorial formulation of our algorithm : let s be a variable initialized to 0 and let ri be the number of negative points preceding point pi plus the number of positive points succeeding pi with respect to in the current iteration ( this corresponds to the points to the right of i ) . if the sum of rm and s is less than n22 , we remove the points that succeed m , and add the number of removed positive points to s. otherwise , we remove the points that precede m and add the number of removed negative points to s. note that for every point pi , the value of ri+s is an invariant over all iterations . eventually , we end up with an element pj such that rj+s=n22. in the combinatorial formulation of the algorithm , the crucial properties of the sequence r we use is that subsequent elements change by one and that the required value is between r1 and rn . therefore , the algorithm is also adaptable to more sophisticated problems than finding a halving edge . one example is the search for a balanced line , that is , a line that separates a set consisting of n white points and n black points in a way that the difference between the black and white points on each side of the line is 0 ( additional care has to be taken when defining the sequence r since a balanced line does in general not pass directly through a given point c , i.e. , there is no explicit representation of the line as a supporting line of two points ) . there , it is shown that certain crossing - free matchings on a point set are not unique by constructing a balanced line crossing a segment of a given matching . for realizable sets , for the oriented hyperplane h through the points ( p1, ,pd ) , (p1, corollary 3given a point set srd in general position , d constant , and distinct points c1, ,cd1s , one can find a halving hyperplane through c1, ,cd1 in linear time using only . given a point set srd in general position , d constant , and distinct points c1, ,cd1s , one can find a halving hyperplane through c1, in this section we show how to compute a convex hull edge of a set in linear time , only using the orientation of triples . we first present the algorithm for point sets and then extend it to general cc systems . as a first step we describe an algorithm called basicmin , which plays a crucial role as a subroutine . let s be a point set in the plane and suppose we are given two points p , rs . let r be the coordinate origin and let p be on the positive part of the x - axis . let m be an arbitrary perfect matching between the points above and below the x - axis , i.e. , for any edge s = abm we have (p , r , a)(p , r , b ) . let be the binary operator that accepts two edges s , sm as input and returns the edge on the convex hull boundary of ss that crosses the x - axis at the smallest x - coordinate , i.e. , the pair of endpoints whose upward - directed supporting line has all other points of s and s to the right . the relevant property of the operator is that the crossing of (s , s ) with the x - axis is not to the right of the crossings of s and s with the x - axis . basicmin takes a point set s and two points p and r as input , partitions s arbitrarily into the matching m={s1, ,s(n22 ) } , and computes a special edge m = m(n22 ) iteratively viam1=s1,m(i+1)=(mi , s(i+1 ) ) . obviously , the running time of basicmin is linear in n. note that m does not need to be on the convex hull of the whole set . also , m may depend on the ( undefined ) order in which the elements of m are processed by basicmin . lemma 4let be a line directed upwards , crossing the x - axis left of the crossing of m with the x - axis . then at least n22 points of s are to the right of . proofnote that the crossing of with the x - axis is further to the left than any other such crossing of m. assume , for the purpose of contradiction , that there is an edge in m for which both points lie to the left of . then also the crossing with the x - axis is to the left of the crossing of m , a contradiction . hence , for each of the n22 edges in m at least one endpoint lies to the right of . let be a line directed upwards , crossing the x - axis left of the crossing of m with the x - axis . then at least n22 points of s are to the right of . note that the crossing of with the x - axis is further to the left than any other such crossing of m. assume , for the purpose of contradiction , that there is an edge in m for which both points lie to the left of . then also the crossing with the x - axis is to the left of the crossing of m , a contradiction . hence , for each of the n22 edges in m at least one endpoint lies to the right of . note that , even though the argumentation of lemma 4 involves relative positions of crossings , the constant - time operation can be expressed by using only . now we are ready to give the main algorithm . theorem 5given two points p , q of a point set sr2 of size n in general position , one can find the edge e of the sets convex hull that passes through the ray pq in o(n ) time using the predicate . proofw.l.o.g . let pq be horizontal with q left of p. note first that the case where q is a vertex of the convex hull can be identified in linear time . we therefore concentrate on the setting where one endpoint of e is below pq and the other one is above . let u be the set strictly above pq , whereas l is the set strictly below pq . w.l.o.g . let |u|n22.consider the endpoint u1u of e. if we remove u1 , the ray pq intersects the boundary of the ( new ) convex hull at a new edge e with an endpoint u2u . note that the other endpoint of e might now be q. in any case , iteratively removing points from u of the intersected convex hull edge induces an order on u ( see fig . 4 ) . note that this corresponds to the order in which the points of u are traversed by a tangent t of ch(l{p , q } ) that is rotated clockwise around that hull , starting at e and ending at pq . the main observation is that in the search for u1 , given a point ui and the tangent t passing through ui , we can discard all points of u to the right of ui with respect to the point l where t touches ch(l{p , q } ) , since none of these points can be u1 . the support ll{q } of t can be found in linear time , since the radial order of l{p , q } around any ui is linear.note that these observations already imply the following randomized approach . the other support l of the tangent ( recall that this might as well be q ) can be found in linear time . we discard the points of u right of lui and iterate . however , consecutive bad choices of ui result in overall quadratic worst - case behavior . we therefore have to make a good choice of ui in order to discard a linear number of points per iteration.the points of u are ordered linearly around p. let ur be the median of this order , which we select in linear time . let m be an arbitrary perfect matching between the points of u to the left and to the right of pur ( maybe omitting one point ) , see fig . now we apply basicmin on m with r = ur , which results in an edge m = uaub . by construction , all edges of m as well as uaub cross the ray pur . now , find the tangents ta and tb of ch(l{p , q } ) through ua and ub , respectively ( we consider them being directed upwards ) . let =ta if ub is to the right of ta , otherwise let =tb . note that p is right of since q is included in the set that we place the tangent on . if crosses the ray pur at a point x , then the crossing of uaub is on the ray between p and x ( by definition of ) . due to lemma 4 , at least half of the points of m are to the right of . otherwise , if does not cross the ray pur , then all points of u to the right of the ray are also to the right of . in both cases , we can discard at least half of the points , which is at least a quarter of the overall set s ( recall that u was w.l.o.g . larger than l ; in each iteration , the process is applied to the larger of the two sets ) . we can therefore in linear time reduce this problem to constant size such that it then can be solved by a brute - force approach . given two points p , q of a point set sr2 of size n in general position , one can find the edge e of the sets convex hull that passes through the ray pq in o(n ) time using the predicate . w.l.o.g . let pq be horizontal with q left of p. note first that the case where q is a vertex of the convex hull can be identified in linear time . we therefore concentrate on the setting where one endpoint of e is below pq and the other one is above . let u be the set strictly above pq , whereas l is the set strictly below pq . consider the endpoint u1u of e. if we remove u1 , the ray pq intersects the boundary of the ( new ) convex hull at a new edge e with an endpoint u2u . note that the other endpoint of e might now be q. in any case , iteratively removing points from u of the intersected convex hull edge induces an order on u ( see fig . 4 ) . note that this corresponds to the order in which the points of u are traversed by a tangent t of ch(l{p , q } ) that is rotated clockwise around that hull , starting at e and ending at pq . the main observation is that in the search for u1 , given a point ui and the tangent t passing through ui , we can discard all points of u to the right of ui with respect to the point l where t touches ch(l{p , q } ) , since none of these points can be u1 . the support ll{q } of t can be found in linear time , since the radial order of l{p , q } around any ui is linear . the other support l of the tangent ( recall that this might as well be q ) can be found in linear time . we discard the points of u right of lui and iterate . however , consecutive bad choices of ui result in overall quadratic worst - case behavior . we therefore have to make a good choice of ui in order to discard a linear number of points per iteration . the points of u are ordered linearly around p. let ur be the median of this order , which we select in linear time . let m be an arbitrary perfect matching between the points of u to the left and to the right of pur ( maybe omitting one point ) , see fig . 5 . now we apply basicmin on m with r = ur , which results in an edge m = uaub . by construction , all edges of m as well as uaub cross the ray pur . now , find the tangents ta and tb of ch(l{p , q } ) through ua and ub , respectively ( we consider them being directed upwards ) . let =ta if ub is to the right of ta , otherwise let =tb . note that p is right of since q is included in the set that we place the tangent on . if crosses the ray pur at a point x , then the crossing of uaub is on the ray between p and x ( by definition of ) . due to lemma 4 , at least half of the points of m are to the right of . otherwise , if does not cross the ray pur , then all points of u to the right of the ray are also to the right of . in both cases , we can discard at least half of the points , which is at least a quarter of the overall set s ( recall that u was w.l.o.g . larger than l ; in each iteration , the process is applied to the larger of the two sets ) . we can therefore in linear time reduce this problem to constant size such that it then can be solved by a brute - force approach . note that the transitivity of the order on u directly follows from the definition of the convex hull and carries over to general cc systems . also , the transitivity of l{p , q } around any point of u holds for cc systems due to axiom 5 . however , the linear time bound depends on the number of points that are to the right of . in order to show that the bound also holds for abstract order types , we need to prove that basicmin also works as expected on non - realizable sets , and that then also has at least half of the points of u to the right . there exist several equivalent definitions for the convex hull of a finite point set s in the plane . for example , the convex hull can be defined as the convex polygon of smallest area that contains all points of the set . equivalently , the boundary of the convex hull of s is the sequence of pairs uv with { u , v}s such that all points s{u , v } are to the left of uv . this latter definition is more combinatorial and carries over to the abstract setting , where we are no longer concerned with geometric artefacts like area or perimeter.4 in this subsection , we will give a brief summary of the relevant properties of abstract order types , following goodman and pollack , which we suggest to the reader for further information on that topic , in addition to . throughout this section , let us again start in the euclidean plane by considering a point set s , which we still require , for ease of presentation , to be in general position ( see on how to handle other cases ) . let be a directed line not orthogonal to any supporting line of s. project the points orthogonally on , which gives us a sequence of the points along . if we rotate in counterclockwise direction , then eventually two points , let them be u and v , will happen to be projected to the same point on . when continuing the rotation process , u and v will have changed their position in the sequence along . after a rotation of 180 , the initial sequence of the projected points on will be reversed . continuing the rotation gives an infinite periodic sequence of transpositions like the one of u and v. it is called the circular sequence of permutations associated to s , or the circular sequence of s , for short . one can observe that after a reversal of u and v all other pairs are reversed until u and v are reversed again . the circular sequence allows us to observe several geometric properties of s. a point that precedes all others in some permutation ( on ) in the circular sequence is an extreme point . note that all the information we can get from the circular sequence is encoded in one half - period . we therefore can identify the vertices of the convex hull as those points that are topmost or bottommost on at some point , when we look at such that it is directed downwards . for every subset of s , the circular sequence therefore gives the point on its convex hull . consider again the moment when u and v change their position in the permutation , say from uv to vu . then the triple uvw is oriented counterclockwise if and only if w is projected below ( i.e. , after ) both u and v when they change their position ( assuming counterclockwise rotation of ) . note that this requires that at the beginning of the half - period u is above ( before ) v. it is common and convenient to identify the points of s with their order at the initial position of . for s={p1, ,pn } , we therefore start with pi above pj on iff i < j . while the starting position of in the half - period is arbitrary , this labeling is useful when comparing point triples . after a half - period , the points are given in the sequence pn, ,p1. the circular sequence contains strictly more information than the order type of a set . while the order type is implied by the circular sequence , it is rather straightforward to construct point sets with different circular sequences that have the same order type . consider an arrangement of pseudo - lines in the projective plane p2 ( a set of closed curves not separating p2 that pairwise intersect in exactly one point ) . an arrangement is simple if no three pseudo - lines intersect in one point . one important property of pseudo - line arrangements , shown by levi , is that they can be extended by additional pseudo - lines . lemma 6levi enlargement lemmagiven a pseudo - line arrangement a in p2 and two points that do not both lie on the same element of a , there exists a pseudo - line arrangement a{ } such that the pseudo - line passes through these two points . given a pseudo - line arrangement a in p2 and two points that do not both lie on the same element of a , there exists a pseudo - line arrangement a{ } such that the pseudo - line passes through these two points . using this lemma , choose a pseudo - line not part of the arrangement as the line at infinity . place a point on . if we choose as the point at vertical infinity , we can identify the arrangement of pseudo - lines with an arrangement of x - monotone pseudo - lines in the euclidean plane ( where the curves are no longer closed ) . this requires the application of the levi enlargement lemma to get x - monotonicity , details are given in . if we sweep this arrangement from left to right , we get again a half - period of a circular sequence , where a change of a pair happens as we sweep across the intersection of two pseudo - lines . goodman and pollack show that any circular sequence of a point set describes the topology of an arrangement of pseudo - lines in p2 . actually , for every point set in the euclidean plane , the standard duality transform for point sets gives an arrangement of straight lines whose crossings , when sweeping from left to right , give a half - period of the circular sequence of the set . there are , however , arrangements of pseudo - lines in the projective plane that are not stretchable . for them , no point set in the euclidean plane exists that implies any sequence derived from such an arrangements by any choice of . recall that we were able to derive the orientation of a point triple uvw by the position of the points in a half - period of the circular sequence . given a direction around a point at infinity allows us to give a triple of pseudo - lines an orientation , even if there does not exist a corresponding point set order type in the euclidean plane ( i.e. , the sequence is non - realizable ) ; we still get a predicate a that gives each triple an orientation , that is , an abstract order type . knuth shows that , for any simple arrangement , a fulfills the five axioms defining cc systems , and from any cc system a corresponding arrangement can be derived ; hence , the terms cc system and abstract order type are merely synonyms . we can use either the axioms or a pseudo - line arrangement ( together with a direction around a point at infinity ) for arguing about abstract order types . in the next section , we will use the model of x - monotone pseudo - lines in the euclidean plane . at first sight , the identification of abstract order types with pseudo - line arrangements in the projective plane might feel like a detour to x - monotone arrangements in the euclidean plane as representation of circular sequences . this might be the case for the application of the concept in this paper , however , it is profound in the whole theory about abstract order types . recall that different circular sequences might correspond to two point sets having the same order type . ( on the other hand , for arrangements of pseudo - lines in the projective plane , there are transformations that are order - type - preserving and some that are not . ) if two pairs uv and st of four different points change their position in the sequence and uv happens right before st in the half - period , then changing st right before uv results in the same order type . ( to reduce the cases to consider , we will nevertheless make use of that relative position of pseudo - line crossings in the next section . ) there is another aspect that is not directly captured by x - monotone arrangements in the euclidean plane . when mapping the arrangement from the projective to the euclidean plane , we chose the line at infinity through arbitrarily ; however , the topology of the arrangement in the projective plane does not depend on the choice of this line . analogously , the circular sequence of a point set does not depend on the actual starting position of . in terms of pseudo - lines in the euclidean plane , the following can be shown ( more details are given in ) . consider a crossing of two pseudo - lines that has no further crossings to the left from its initial position . then we can move this crossing to the right end of the arrangement , such that the resulting arrangement still represents the same abstract order type . in other words , we untangle the crossing at the left end and introduce a new one to the right ( note that this corresponds to removing the position change uv at the beginning by a change vu at the end ) . for every abstract order type and any crossing therein , we can therefore choose a x - monotone representation where that crossing is leftmost . to see why care has to be taken when we deal with non - realizable order types , note that in general the order type does not capture the relative position of the supporting lines of point pairs and the crossings of these lines . however , abstract order types capture some of the information that is related to crossings of supporting lines , which allows us to show that the properties needed for basicmin are also present in the abstract setting.5 we use the dual representation of abstract order types in the euclidean plane by x - monotone pseudo - lines ; this allows us to use the obvious meaning of terms like above and below when describing an arrangement a ( e.g. , a pseudo - line a is above a point b when the point on a that has the same x - coordinate as b has a larger y - coordinate than b ) . we are given a set s of n elements ( which we call points , even though s might not be a realizable point set ) , containing two special points p and q. the set s is separated by pq into a set u to the right of pq , and a set l to the left of it ( where left and right are indicated by a predicate a ) . we want to obtain the pair l1u1,l1l , u1u that is consecutive on the convex hull of s , where p is to the right of l1u1 . this is done by obtaining a pair =ljui such that at least half of the points of u ( minus a constant ) are to the right of and no point of l is to the left of . consider the dual x - monotone pseudo - line arrangement a representing the abstract order type of s. keep in mind that p is an extreme point of the set u{p } , and that r = ur is the median of the points in u ordered radially around p. we can represent the arrangement such that the crossing of the pseudo - lines p and r ( which corresponds to the supporting line of pr in the primal6 ) is the leftmost crossing in the x - monotone representation of a. the linear order of the points around p in the primal splits the set u{ur } into left and right points , separated by pr . in the dual , the right pseudo - lines pass above the crossing pr , and the left pseudo - lines pass below . the operator accepts two point pairs , each pair consisting of a left and a right point . the output of the operator is a pair z consisting of a left and a right point such that all other points are to the right of the oriented line through these points . this pair z is well - defined in the abstract setting as well ( and there is always a geometric representation due to theorem 1 ) . recall that we compute a special pair m = m(n22 ) iteratively viam1=s1,m(i+1)=(mi , s(i+1 ) ) . the crucial property of the pair m = uaub ( and later the line tangent to ch(l{p , q } ) through ua or ub ) is that at least one endpoint of each pair sim lies on the same side of m as the pivot p. ( we assume that m and the elements of m are directed from the left point to the right point and hence p is to the right of m. ) in the dual , each element of m is represented as the crossing of a right and a left pseudo - line in a ( this corresponds to the supporting line of the matched pair of points in the primal ) . the crucial property for m in the dual therefore is to have at least one pseudo - line of each pair sim passing below its crossing in a. for realizable point sets , we were able to argue for the correctness of basicmin using the intersection of a matched pair s with the supporting line of p and r. in the dual , this intersection corresponds again to a pseudo - line that can be added to a ; this pseudo - line passes through the crossing pr and s. also for non - realizable sets , such a pseudo - line exists due to the levi enlargement lemma . in fact , in non - realizable settings the intersections behave in the same transitive manner as in the realizable setting ; see fig . 7 for an illustration of the following statement . observation 7let z=(a , b ) and z=(c , d ) be two pairs such that the point p is to the right of both pairs ( i.e. , in the dual the pseudo - line p is below the crossings z and z ) . let ( ) be a dual pseudo - line through the crossings pr and z ( z ) . if none of a and b is to the left of the primal line z , then the dual pseudo - line is above in the part of the dual arrangement that is to the right of the dual crossing pr . let z=(a , b ) and z=(c , d ) be two pairs such that the point p is to the right of both pairs ( i.e. , in the dual the pseudo - line p is below the crossings z and z ) . let ( ) be a dual pseudo - line through the crossings pr and z ( z ) . if none of a and b is to the left of the primal line z , then the dual pseudo - line is above in the part of the dual arrangement that is to the right of the dual crossing pr . hence , after applying basicmin to the matching m , we obtain in the dual a pseudo - line crossing m on a pseudo - line m that passes through the crossing pr , such that no crossing of m is above m . suppose , for the sake of contradiction , that there is a pair ( a , b ) such that both dual pseudo - lines a and b pass above the crossing m , but the crossing ab is below m . if the crossing ab is to the left of m in the x - monotone arrangement , then , when traversing a from left to right , one would have to pass below m and then go above it again before m. otherwise , if the crossing ab is to the right of m , then b would have to intersect m to be above it at m and then has to be below m again to reach the crossing ab . both cases contradict the fact that a pair of pseudo - lines intersects exactly once in the x - monotone arrangement . hence , half of the pseudo - lines are below the pseudo - line crossing m in a. this corresponds to at least half of the points being on the same side of m as p. recall that in the proof of theorem 5 , we chose a directed line supported by a point ll{q } and either ua or ub such that no elements of l{p , q , ua , ub } is to the left of it . we now proceed to show that at least one point of each pair ( v , w ) in m is to the right of the directed line , as demanded in the proof of theorem 5 . the points involved are { p , q , r , l , ua , ub , v , w } , where l and q might be the same point . since these are at most eight points , we are allowed to use geometric arguments due to theorem 1 . however , we must not rely on the positions of the crossing points on the ray pr . suppose , for the sake of contradiction , that neither of v and w is right of . at least one of v or w has to be to the right of uaub . these observations imply that vw is an edge of the convex hull of { p , ua , ub , v , w}. however , this means that the crossing of the pseudo - lines v and w is above ua and ub in a , which contradicts the fact that uaub is m. thus , we conclude theorem 8theorem 5 also holds for non - realizable cc systems , i.e. , abstract order types . theorem 5 also holds for non - realizable cc systems , i.e. , abstract order types . as a first step we describe an algorithm called basicmin , which plays a crucial role as a subroutine . let s be a point set in the plane and suppose we are given two points p , rs . let r be the coordinate origin and let p be on the positive part of the x - axis . let m be an arbitrary perfect matching between the points above and below the x - axis , i.e. , for any edge s = abm we have (p , r , a)(p , r , b ) . let be the binary operator that accepts two edges s , sm as input and returns the edge on the convex hull boundary of ss that crosses the x - axis at the smallest x - coordinate , i.e. , the pair of endpoints whose upward - directed supporting line has all other points of s and s to the right . the relevant property of the operator is that the crossing of (s , s ) with the x - axis is not to the right of the crossings of s and s with the x - axis . basicmin takes a point set s and two points p and r as input , partitions s arbitrarily into the matching m={s1, ,s(n22 ) } , and computes a special edge m = m(n22 ) iteratively viam1=s1,m(i+1)=(mi , s(i+1 ) ) . obviously , the running time of basicmin is linear in n. note that m does not need to be on the convex hull of the whole set . also , m may depend on the ( undefined ) order in which the elements of m are processed by basicmin . lemma 4let be a line directed upwards , crossing the x - axis left of the crossing of m with the x - axis . then at least n22 points of s are to the right of . proofnote that the crossing of with the x - axis is further to the left than any other such crossing of m. assume , for the purpose of contradiction , that there is an edge in m for which both points lie to the left of . then also the crossing with the x - axis is to the left of the crossing of m , a contradiction . hence , for each of the n22 edges in m at least one endpoint lies to the right of . let be a line directed upwards , crossing the x - axis left of the crossing of m with the x - axis . then at least n22 points of s are to the right of . note that the crossing of with the x - axis is further to the left than any other such crossing of m. assume , for the purpose of contradiction , that there is an edge in m for which both points lie to the left of . then also the crossing with the x - axis is to the left of the crossing of m , a contradiction . hence , for each of the n22 edges in m at least one endpoint lies to the right of . note that , even though the argumentation of lemma 4 involves relative positions of crossings , the constant - time operation can be expressed by using only . now we are ready to give the main algorithm . theorem 5given two points p , q of a point set sr2 of size n in general position , one can find the edge e of the sets convex hull that passes through the ray pq in o(n ) time using the predicate . proofw.l.o.g . let pq be horizontal with q left of p. note first that the case where q is a vertex of the convex hull can be identified in linear time . we therefore concentrate on the setting where one endpoint of e is below pq and the other one is above . let u be the set strictly above pq , whereas l is the set strictly below pq . w.l.o.g . let |u|n22.consider the endpoint u1u of e. if we remove u1 , the ray pq intersects the boundary of the ( new ) convex hull at a new edge e with an endpoint u2u . note that the other endpoint of e might now be q. in any case , iteratively removing points from u of the intersected convex hull edge induces an order on u ( see fig . 4 ) . note that this corresponds to the order in which the points of u are traversed by a tangent t of ch(l{p , q } ) that is rotated clockwise around that hull , starting at e and ending at pq . the main observation is that in the search for u1 , given a point ui and the tangent t passing through ui , we can discard all points of u to the right of ui with respect to the point l where t touches ch(l{p , q } ) , since none of these points can be u1 . the support ll{q } of t can be found in linear time , since the radial order of l{p , q } around any ui is linear.note that these observations already imply the following randomized approach . the other support l of the tangent ( recall that this might as well be q ) can be found in linear time . we discard the points of u right of lui and iterate . however , consecutive bad choices of ui result in overall quadratic worst - case behavior . we therefore have to make a good choice of ui in order to discard a linear number of points per iteration.the points of u are ordered linearly around p. let ur be the median of this order , which we select in linear time . let m be an arbitrary perfect matching between the points of u to the left and to the right of pur ( maybe omitting one point ) , see fig . 5 . now we apply basicmin on m with r = ur , which results in an edge m = uaub . by construction , all edges of m as well as uaub cross the ray pur . now , find the tangents ta and tb of ch(l{p , q } ) through ua and ub , respectively ( we consider them being directed upwards ) . let =ta if ub is to the right of ta , otherwise let =tb . note that p is right of since q is included in the set that we place the tangent on . if crosses the ray pur at a point x , then the crossing of uaub is on the ray between p and x ( by definition of ) . due to lemma 4 , at least half of the points of m are to the right of . otherwise , if does not cross the ray pur , then all points of u to the right of the ray are also to the right of . in both cases , we can discard at least half of the points , which is at least a quarter of the overall set s ( recall that u was w.l.o.g . larger than l ; in each iteration , the process is applied to the larger of the two sets ) . we can therefore in linear time reduce this problem to constant size such that it then can be solved by a brute - force approach . given two points p , q of a point set sr2 of size n in general position , one can find the edge e of the sets convex hull that passes through the ray pq in o(n ) time using the predicate . w.l.o.g . let pq be horizontal with q left of p. note first that the case where q is a vertex of the convex hull can be identified in linear time . we therefore concentrate on the setting where one endpoint of e is below pq and the other one is above . let u be the set strictly above pq , whereas l is the set strictly below pq . consider the endpoint u1u of e. if we remove u1 , the ray pq intersects the boundary of the ( new ) convex hull at a new edge e with an endpoint u2u . note that the other endpoint of e might now be q. in any case , iteratively removing points from u of the intersected convex hull edge induces an order on u ( see fig . 4 ) . note that this corresponds to the order in which the points of u are traversed by a tangent t of ch(l{p , q } ) that is rotated clockwise around that hull , starting at e and ending at pq . the main observation is that in the search for u1 , given a point ui and the tangent t passing through ui , we can discard all points of u to the right of ui with respect to the point l where t touches ch(l{p , q } ) , since none of these points can be u1 . the support ll{q } of t can be found in linear time , since the radial order of l{p , q } around any ui is linear . the other support l of the tangent ( recall that this might as well be q ) can be found in linear time . however , consecutive bad choices of ui result in overall quadratic worst - case behavior . we therefore have to make a good choice of ui in order to discard a linear number of points per iteration . the points of u are ordered linearly around p. let ur be the median of this order , which we select in linear time . let m be an arbitrary perfect matching between the points of u to the left and to the right of pur ( maybe omitting one point ) , see fig . 5 . now we apply basicmin on m with r = ur , which results in an edge m = uaub . by construction , all edges of m as well as uaub cross the ray pur . now , find the tangents ta and tb of ch(l{p , q } ) through ua and ub , respectively ( we consider them being directed upwards ) . let =ta if ub is to the right of ta , otherwise let =tb . note that p is right of since q is included in the set that we place the tangent on . there are two cases to consider . if crosses the ray pur at a point x , then the crossing of uaub is on the ray between p and x ( by definition of ) . due to lemma 4 , at least half of the points of m are to the right of . otherwise , if does not cross the ray pur , then all points of u to the right of the ray are also to the right of . in both cases , we can discard at least half of the points , which is at least a quarter of the overall set s ( recall that u was w.l.o.g . larger than l ; in each iteration , the process is applied to the larger of the two sets ) . we can therefore in linear time reduce this problem to constant size such that it then can be solved by a brute - force approach . note that the transitivity of the order on u directly follows from the definition of the convex hull and carries over to general cc systems . also , the transitivity of l{p , q } around any point of u holds for cc systems due to axiom 5 . however , the linear time bound depends on the number of points that are to the right of . in order to show that the bound also holds for abstract order types , we need to prove that basicmin also works as expected on non - realizable sets , and that then also has at least half of the points of u to the right . there exist several equivalent definitions for the convex hull of a finite point set s in the plane . for example , the convex hull can be defined as the convex polygon of smallest area that contains all points of the set . equivalently , the boundary of the convex hull of s is the sequence of pairs uv with { u , v}s such that all points s{u , v } are to the left of uv . this latter definition is more combinatorial and carries over to the abstract setting , where we are no longer concerned with geometric artefacts like area or perimeter.4 in this subsection , we will give a brief summary of the relevant properties of abstract order types , following goodman and pollack , which we suggest to the reader for further information on that topic , in addition to . throughout this section , let us again start in the euclidean plane by considering a point set s , which we still require , for ease of presentation , to be in general position ( see on how to handle other cases ) . let be a directed line not orthogonal to any supporting line of s. project the points orthogonally on , which gives us a sequence of the points along . if we rotate in counterclockwise direction , then eventually two points , let them be u and v , will happen to be projected to the same point on . when continuing the rotation process , u and v will have changed their position in the sequence along . after a rotation of 180 , the initial sequence of the projected points on will be reversed . continuing the rotation gives an infinite periodic sequence of transpositions like the one of u and v. it is called the circular sequence of permutations associated to s , or the circular sequence of s , for short . one can observe that after a reversal of u and v all other pairs are reversed until u and v are reversed again . the circular sequence allows us to observe several geometric properties of s. a point that precedes all others in some permutation ( on ) in the circular sequence is an extreme point . note that all the information we can get from the circular sequence is encoded in one half - period . we therefore can identify the vertices of the convex hull as those points that are topmost or bottommost on at some point , when we look at such that it is directed downwards . for every subset of s , the circular sequence therefore gives the point on its convex hull . consider again the moment when u and v change their position in the permutation , say from uv to vu . then the triple uvw is oriented counterclockwise if and only if w is projected below ( i.e. , after ) both u and v when they change their position ( assuming counterclockwise rotation of ) . note that this requires that at the beginning of the half - period u is above ( before ) v. it is common and convenient to identify the points of s with their order at the initial position of . for s={p1, ,pn } , we therefore start with pi above pj on iff i < j . while the starting position of in the half - period is arbitrary , this labeling is useful when comparing point triples . after a half - period , the points are given in the sequence pn, ,p1. the circular sequence contains strictly more information than the order type of a set . while the order type is implied by the circular sequence , it is rather straightforward to construct point sets with different circular sequences that have the same order type . consider an arrangement of pseudo - lines in the projective plane p2 ( a set of closed curves not separating p2 that pairwise intersect in exactly one point ) . an arrangement is simple if no three pseudo - lines intersect in one point . one important property of pseudo - line arrangements , shown by levi , is that they can be extended by additional pseudo - lines . lemma 6levi enlargement lemmagiven a pseudo - line arrangement a in p2 and two points that do not both lie on the same element of a , there exists a pseudo - line arrangement a{ } such that the pseudo - line passes through these two points . given a pseudo - line arrangement a in p2 and two points that do not both lie on the same element of a , there exists a pseudo - line arrangement a{ } such that the pseudo - line passes through these two points . using this lemma , choose a pseudo - line not part of the arrangement as the line at infinity . place a point on . if we choose as the point at vertical infinity , we can identify the arrangement of pseudo - lines with an arrangement of x - monotone pseudo - lines in the euclidean plane ( where the curves are no longer closed ) . this requires the application of the levi enlargement lemma to get x - monotonicity , details are given in . if we sweep this arrangement from left to right , we get again a half - period of a circular sequence , where a change of a pair happens as we sweep across the intersection of two pseudo - lines . goodman and pollack show that any circular sequence of a point set describes the topology of an arrangement of pseudo - lines in p2 . actually , for every point set in the euclidean plane , the standard duality transform for point sets gives an arrangement of straight lines whose crossings , when sweeping from left to right , give a half - period of the circular sequence of the set . there are , however , arrangements of pseudo - lines in the projective plane that are not stretchable . for them , no point set in the euclidean plane exists that implies any sequence derived from such an arrangements by any choice of . recall that we were able to derive the orientation of a point triple uvw by the position of the points in a half - period of the circular sequence . given a direction around a point at infinity allows us to give a triple of pseudo - lines an orientation , even if there does not exist a corresponding point set order type in the euclidean plane ( i.e. , the sequence is non - realizable ) ; we still get a predicate a that gives each triple an orientation , that is , an abstract order type . knuth shows that , for any simple arrangement , a fulfills the five axioms defining cc systems , and from any cc system a corresponding arrangement can be derived ; hence , the terms cc system and abstract order type are merely synonyms . we can use either the axioms or a pseudo - line arrangement ( together with a direction around a point at infinity ) for arguing about abstract order types . in the next section , we will use the model of x - monotone pseudo - lines in the euclidean plane . at first sight , the identification of abstract order types with pseudo - line arrangements in the projective plane might feel like a detour to x - monotone arrangements in the euclidean plane as representation of circular sequences . this might be the case for the application of the concept in this paper , however , it is profound in the whole theory about abstract order types . recall that different circular sequences might correspond to two point sets having the same order type . ( on the other hand , for arrangements of pseudo - lines in the projective plane , there are transformations that are order - type - preserving and some that are not . ) if two pairs uv and st of four different points change their position in the sequence and uv happens right before st in the half - period , then changing st right before uv results in the same order type . ( to reduce the cases to consider , we will nevertheless make use of that relative position of pseudo - line crossings in the next section . ) there is another aspect that is not directly captured by x - monotone arrangements in the euclidean plane . when mapping the arrangement from the projective to the euclidean plane , we chose the line at infinity through arbitrarily ; however , the topology of the arrangement in the projective plane does not depend on the choice of this line . analogously , the circular sequence of a point set does not depend on the actual starting position of . in terms of pseudo - lines in the euclidean plane , the following can be shown ( more details are given in ) . consider a crossing of two pseudo - lines that has no further crossings to the left from its initial position . then we can move this crossing to the right end of the arrangement , such that the resulting arrangement still represents the same abstract order type . in other words , we untangle the crossing at the left end and introduce a new one to the right ( note that this corresponds to removing the position change uv at the beginning by a change vu at the end ) . for every abstract order type and any crossing therein , we can therefore choose a x - monotone representation where that crossing is leftmost . to see why care has to be taken when we deal with non - realizable order types , note that in general the order type does not capture the relative position of the supporting lines of point pairs and the crossings of these lines . however , abstract order types capture some of the information that is related to crossings of supporting lines , which allows us to show that the properties needed for basicmin are also present in the abstract setting.5 we use the dual representation of abstract order types in the euclidean plane by x - monotone pseudo - lines ; this allows us to use the obvious meaning of terms like above and below when describing an arrangement a ( e.g. , a pseudo - line a is above a point b when the point on a that has the same x - coordinate as b has a larger y - coordinate than b ) . we are given a set s of n elements ( which we call points , even though s might not be a realizable point set ) , containing two special points p and q. the set s is separated by pq into a set u to the right of pq , and a set l to the left of it ( where left and right are indicated by a predicate a ) . we want to obtain the pair l1u1,l1l , u1u that is consecutive on the convex hull of s , where p is to the right of l1u1 . this is done by obtaining a pair =ljui such that at least half of the points of u ( minus a constant ) are to the right of and no point of l is to the left of . consider the dual x - monotone pseudo - line arrangement a representing the abstract order type of s. keep in mind that p is an extreme point of the set u{p } , and that r = ur is the median of the points in u ordered radially around p. we can represent the arrangement such that the crossing of the pseudo - lines p and r ( which corresponds to the supporting line of pr in the primal6 ) is the leftmost crossing in the x - monotone representation of a. the linear order of the points around p in the primal splits the set u{ur } into left and right points , separated by pr . in the dual , the right pseudo - lines pass above the crossing pr , and the left pseudo - lines pass below . the operator accepts two point pairs , each pair consisting of a left and a right point . the output of the operator is a pair z consisting of a left and a right point such that all other points are to the right of the oriented line through these points . this pair z is well - defined in the abstract setting as well ( and there is always a geometric representation due to theorem 1 ) . recall that we compute a special pair m = m(n22 ) iteratively viam1=s1,m(i+1)=(mi , s(i+1 ) ) . the crucial property of the pair m = uaub ( and later the line tangent to ch(l{p , q } ) through ua or ub ) is that at least one endpoint of each pair sim lies on the same side of m as the pivot p. ( we assume that m and the elements of m are directed from the left point to the right point and hence p is to the right of m. ) in the dual , each element of m is represented as the crossing of a right and a left pseudo - line in a ( this corresponds to the supporting line of the matched pair of points in the primal ) . the crucial property for m in the dual therefore is to have at least one pseudo - line of each pair sim passing below its crossing in a. for realizable point sets , we were able to argue for the correctness of basicmin using the intersection of a matched pair s with the supporting line of p and r. in the dual , this intersection corresponds again to a pseudo - line that can be added to a ; this pseudo - line passes through the crossing pr and s. also for non - realizable sets , such a pseudo - line exists due to the levi enlargement lemma . in fact , in non - realizable settings the intersections behave in the same transitive manner as in the realizable setting ; see fig . 7 for an illustration of the following statement . observation 7let z=(a , b ) and z=(c , d ) be two pairs such that the point p is to the right of both pairs ( i.e. , in the dual the pseudo - line p is below the crossings z and z ) . let ( ) be a dual pseudo - line through the crossings pr and z ( z ) . if none of a and b is to the left of the primal line z , then the dual pseudo - line is above in the part of the dual arrangement that is to the right of the dual crossing pr . let z=(a , b ) and z=(c , d ) be two pairs such that the point p is to the right of both pairs ( i.e. , in the dual the pseudo - line p is below the crossings z and z ) . let ( ) be a dual pseudo - line through the crossings pr and z ( z ) . if none of a and b is to the left of the primal line z , then the dual pseudo - line is above in the part of the dual arrangement that is to the right of the dual crossing pr . hence , after applying basicmin to the matching m , we obtain in the dual a pseudo - line crossing m on a pseudo - line m that passes through the crossing pr , such that no crossing of m is above m . suppose , for the sake of contradiction , that there is a pair ( a , b ) such that both dual pseudo - lines a and b pass above the crossing m , but the crossing ab is below m . if the crossing ab is to the left of m in the x - monotone arrangement , then , when traversing a from left to right , one would have to pass below m and then go above it again before m. otherwise , if the crossing ab is to the right of m , then b would have to intersect m to be above it at m and then has to be below m again to reach the crossing ab . both cases contradict the fact that a pair of pseudo - lines intersects exactly once in the x - monotone arrangement . hence , half of the pseudo - lines are below the pseudo - line crossing m in a. this corresponds to at least half of the points being on the same side of m as p. recall that in the proof of theorem 5 , we chose a directed line supported by a point ll{q } and either ua or ub such that no elements of l{p , q , ua , ub } is to the left of it . we now proceed to show that at least one point of each pair ( v , w ) in m is to the right of the directed line , as demanded in the proof of theorem 5 . the points involved are { p , q , r , l , ua , ub , v , w } , where l and q might be the same point . since these are at most eight points , we are allowed to use geometric arguments due to theorem 1 . however , we must not rely on the positions of the crossing points on the ray pr . suppose , for the sake of contradiction , that neither of v and w is right of . at least one of v or w has to be to the right of uaub . these observations imply that vw is an edge of the convex hull of { p , ua , ub , v , w}. however , this means that the crossing of the pseudo - lines v and w is above ua and ub in a , which contradicts the fact that uaub is m. thus , we conclude theorem 8theorem 5 also holds for non - realizable cc systems , i.e. , abstract order types . theorem 5 also holds for non - realizable cc systems , i.e. , abstract order types . we presented two algorithms that only use the information whether a point triple is oriented clockwise or counterclockwise . both , a halving edge through a given point and a convex hull edge crossing a specified ray , can be found in linear time , without being given the coordinate representation . we showed that the algorithms also work for general cc systems ( i.e. , abstract order types ) , and thus answer a long - standing open problem of knuth in the affirmative . note that the parts of the so - called ultimate convex hull algorithm by kirkpatrick and seidel that depend on coordinates are essentially the one that find the convex hull edge on the ray that separates a subproblem into two parts . also , chans output - sensitive algorithm can be implemented in our setting using theorem 5 . both allow to improve the time bound given in for realizable point sets regarding output - sensitivity to o(nlogh ) for h extreme points .

many properties of finite point sets only depend on the relative position of the points , e.g. , on the order type of the set . however , many fundamental algorithms in computational geometry rely on coordinate representations . this includes the straightforward algorithms for finding a halving line for a given planar point set , as well as finding a point on the convex hull , both in linear time . in his monograph axioms and hulls , knuth asks whether these problems can be solved in linear time in a more abstract setting , given only the orientation of each point triple , i.e. , the sets chirotope , as a source of information . we answer this question in the affirmative . more precisely , we can find a halving line through any given point , as well as the vertices of the convex hull edges that are intersected by the supporting line of any two given points of the set in linear time . we first give a proof for sets realizable in the euclidean plane and then extend the result to non - realizable abstract order types .

Introduction Computing a halving edge in linear time Computing a convex hull edge in linear time Realizable point sets Non-realizable sets A general proof of the time bound Conclusion

the ultimate goal of periodontal therapy is the regeneration of periodontal tissues that have been destroyed due to periodontal disease . periodontal regeneration is the reconstruction of the lost tissues as evidenced histologically in the formation of new cementum , new alveolar bone , and functionally oriented periodontal ligament . different modalities have been proposed to obtain regeneration of periodontal tissues employing various bone grafts , bone substitute materials , guided tissue regeneration ( gtr ) , combination of bone grafts or bone substitutes with gtr and growth factors . hydroxyapatites ( has ) represent a family of bone grafting materials with a high degree of biocompatibility that is largely attributable to its presence in natural calcified tissue . preliminary experimental studies have shown that nano - sized ceramics may represent a promising class of bone graft substitutes due to their improved osseointegrative properties . accordingly , a synthetic nanocrystalline hydroxyapatite ( ncha ) bone graft has been introduced for augmentation procedures in intrabony defects . a special feature of nanostructured materials is an extremely high number of molecules on the surface of the material . when the ncha was used as a bone graft substitute , rapid healing of critical size defects was observed in animal experiments and in human applications . ncha has been used for the treatment of metaphyseal fractures in orthopedic surgery , ridge augmentation , and peri - implantitis lesions . platelet - rich plasma ( prf ) is an autologous concentration of platelets in plasma . prp has been used to enhance the clinical outcome obtained by using bone grafts with and without gtr in the treatment of intrabony defects . prf , a second - generation platelet concentrate has been introduced by choukroun et al . in 2001 choukroun 's prf , a second - generation platelet concentrate is an autologous leukocyte and prf material . this is produced in a totally natural manner , without using anticoagulant during blood harvest nor bovine thrombin and calcium chloride for platelet activation and fibrin polymerization . the absence of anticoagulant implies the activation in a few minutes of most platelets of the blood sample in contact with the tube walls and release of the coagulation cascades . prf is a matrix of autologous fibrin , in which are embedded intrinsically a large quantity of platelet and leukocyte cytokines during centrifugation leading to their progressive release over time ( 7 - 11 days ) , as the network of fibrin disintegrates . this study was designed to evaluate the efficacy of ncha bone replacement graft with or without prf , in the treatment of intrabony periodontal defects . in this 6-month follow - up interventional study , a total of 20 systemically healthy patients undergoing periodontal therapy at the department of periodontology , faculty of dentistry , 6 october university and tanta university from february 2013 to december 2013 were selected for the study . intraoral periapical radiographs were taken to confirm the presence of suitable bony defects for the selection of subjects . all participants received full written and verbal information about the study and signed an informed consent form . the inclusion criteria were the presence of two almost identical interproximal intrabony defects , one on either side of the arch based on radiographic observations with clinical probing depth 6 mm in teeth . exclusion criteria for this study included : any systemic disease that affect the periodontium and contraindicate for periodontal surgerypatients are having insufficient platelet count for prf preparation , patients with coagulation defect or anticoagulation treatmentpregnant , lactating mothers , postmenopausal women.people who take antiinflammatory drugs , antibiotics or vitamins within the previous 3 monthspeople who use mouthwashes regularlyheavy smoking ( > 10 cigarettes / day)history of alcohol abuseunacceptable oral hygiene after the re - evaluation of phase i therapy were excluded from the study . any systemic disease that affect the periodontium and contraindicate for periodontal surgery patients are having insufficient platelet count for prf preparation , patients with coagulation defect or anticoagulation treatment pregnant , lactating mothers , postmenopausal women . people who take antiinflammatory drugs , antibiotics or vitamins within the previous 3 months people who use mouthwashes regularly heavy smoking ( > 10 cigarettes / day ) history of alcohol abuse unacceptable oral hygiene after the re - evaluation of phase i therapy were excluded from the study . a general assessment of selected subjects was made through their history , clinical examination and routine investigations . all subjects were treated with the initial phase i therapy involving oral hygiene instructions , scaling and root planning . following phase i therapy the subjects were re - evaluated after 4 weeks , and those who still satisfied the selection criteria were finally taken up for the study . nano - bone ( artoss gmbh friedrich - barnewitz - strabe 3118119 rostock / germany ) . the prf was prepared in accordance with the protocol developed by dohan et al . just prior to surgery , intravenous blood ( by venipuncturing of the antecubital vein ) was collected in 10-ml sterile tube without anticoagulant and immediately centrifuged in centrifugation machine at 3,000 revolutions ( approximately : 400 g)/min for 10 min . blood centrifugation immediately after collection allows the composition of a structured fibrin clot in the middle of the tube , just between the red corpuscles at the bottom and acellular plasma ( platelet - poor plasma [ ppp ] ) at the top . prf was easily separated from red corpuscules base ( preserving a small red blood cell layer ) using a sterile tweezers and scissors just after removal of ppp and then transferred onto glass slide and put another glass slide over the prf to squeeze and transfer it to membrane . i , mucoperiosteal flap elevation followed by the placement of nano - bone with prf was done . in group ii , mucoperiosteal flap elevation , followed by the placement of nano - bone was done [ figure 1 ] . recall appointments were made at 7 days , 30 days , and then at 3 months and 6-month . ( a and b ) reflection of mucoperiosteal flap and nano ha filled in the intrabony defect and covered by prf mrmbrane ( group i ) ; ( c and d ) reflection of mucoperiosteal flap and nano - ha filled in the defect ( group ii ) the periodontal status of the subjects was determined by recording : plaque index ( pi)gingival index ( gi)probing pocket depth ( ppd)clinical attachment level ( cal ) . plaque index ( pi ) gingival index ( gi ) probing pocket depth ( ppd ) clinical attachment level ( cal ) . periapical dental radiographs using long cone paralleling technique were obtained from each patient for the selected site before treatment and at 6-month after treatment . all radiographs were obtained by the same x - ray machine ( orix 70-ardet , italy ) ; using 70 kvp ; 8 ma , and with a fixed exposure time of 0.8 s. the radiographs were developed using automatic developer machine ( durr - automatic , xr 24-ii , italy ) . then , the processed periapical radiographs were digitized using a full page , color flatbed computer scanner ( with optional transparency adaptor ) connected to an ibm compatible personal computer equipped with pentium iv processor . the region of interest was determined in each radiograph as the region that begins 1 mm below the cement - enamel junction and down toward the root apex 7 mm in length . the gray levels were carried out using the computer graphic software adobe photoshop version 7 ( adobe systems incorporated , 345 park avenue , san jose , california 95110 , usa ) . all the results were tabulated and statistically analyzed using computer software named the statistical package for social science ( spss version 16 , chicago , illinois ) . comparison within and between the studied groups performed with independent samples student 's t - test paired t - test and at a level of 5% significance . in this 6-month follow - up interventional study , a total of 20 systemically healthy patients undergoing periodontal therapy at the department of periodontology , faculty of dentistry , 6 october university and tanta university from february 2013 to december 2013 were selected for the study . intraoral periapical radiographs were taken to confirm the presence of suitable bony defects for the selection of subjects . all participants received full written and verbal information about the study and signed an informed consent form . the inclusion criteria were the presence of two almost identical interproximal intrabony defects , one on either side of the arch based on radiographic observations with clinical probing depth 6 mm in teeth . exclusion criteria for this study included : any systemic disease that affect the periodontium and contraindicate for periodontal surgerypatients are having insufficient platelet count for prf preparation , patients with coagulation defect or anticoagulation treatmentpregnant , lactating mothers , postmenopausal women.people who take antiinflammatory drugs , antibiotics or vitamins within the previous 3 monthspeople who use mouthwashes regularlyheavy smoking ( > 10 cigarettes / day)history of alcohol abuseunacceptable oral hygiene after the re - evaluation of phase i therapy were excluded from the study . any systemic disease that affect the periodontium and contraindicate for periodontal surgery patients are having insufficient platelet count for prf preparation , patients with coagulation defect or anticoagulation treatment pregnant , lactating mothers , postmenopausal women . people who take antiinflammatory drugs , antibiotics or vitamins within the previous 3 months people who use mouthwashes regularly heavy smoking ( > 10 cigarettes / day ) history of alcohol abuse unacceptable oral hygiene after the re - evaluation of phase i therapy were excluded from the study . a general assessment of selected subjects was made through their history , clinical examination and routine investigations . all subjects were treated with the initial phase i therapy involving oral hygiene instructions , scaling and root planning . following phase i therapy the subjects were re - evaluated after 4 weeks , and those who still satisfied the selection criteria were finally taken up for the study . nano - bone ( artoss gmbh friedrich - barnewitz - strabe 3118119 rostock / germany ) . the prf was prepared in accordance with the protocol developed by dohan et al . just prior to surgery , intravenous blood ( by venipuncturing of the antecubital vein ) was collected in 10-ml sterile tube without anticoagulant and immediately centrifuged in centrifugation machine at 3,000 revolutions ( approximately : 400 g)/min for 10 min . blood centrifugation immediately after collection allows the composition of a structured fibrin clot in the middle of the tube , just between the red corpuscles at the bottom and acellular plasma ( platelet - poor plasma [ ppp ] ) at the top . prf was easily separated from red corpuscules base ( preserving a small red blood cell layer ) using a sterile tweezers and scissors just after removal of ppp and then transferred onto glass slide and put another glass slide over the prf to squeeze and transfer it to membrane . i , mucoperiosteal flap elevation followed by the placement of nano - bone with prf was done . in group ii , mucoperiosteal flap elevation , followed by the placement of nano - bone was done [ figure 1 ] . recall appointments were made at 7 days , 30 days , and then at 3 months and 6-month . ( a and b ) reflection of mucoperiosteal flap and nano ha filled in the intrabony defect and covered by prf mrmbrane ( group i ) ; ( c and d ) reflection of mucoperiosteal flap and nano - ha filled in the defect ( group ii ) the periodontal status of the subjects was determined by recording : plaque index ( pi)gingival index ( gi)probing pocket depth ( ppd)clinical attachment level ( cal ) . plaque index ( pi ) gingival index ( gi ) probing pocket depth ( ppd ) clinical attachment level ( cal ) . periapical dental radiographs using long cone paralleling technique were obtained from each patient for the selected site before treatment and at 6-month after treatment . all radiographs were obtained by the same x - ray machine ( orix 70-ardet , italy ) ; using 70 kvp ; 8 ma , and with a fixed exposure time of 0.8 s. the radiographs were developed using automatic developer machine ( durr - automatic , xr 24-ii , italy ) . then , the processed periapical radiographs were digitized using a full page , color flatbed computer scanner ( with optional transparency adaptor ) connected to an ibm compatible personal computer equipped with pentium iv processor . the region of interest was determined in each radiograph as the region that begins 1 mm below the cement - enamel junction and down toward the root apex 7 mm in length . the gray levels were carried out using the computer graphic software adobe photoshop version 7 ( adobe systems incorporated , 345 park avenue , san jose , california 95110 , usa ) . all the results were tabulated and statistically analyzed using computer software named the statistical package for social science ( spss version 16 , chicago , illinois ) . comparison within and between the studied groups performed with independent samples student 's t - test paired t - test and at a level of 5% significance . the mean age of the patients in group i was 44.25 8.45 years old , whereas in group ii , it was 39.70 6.36 years old with no significant difference between the two groups ( p > 0.05 ) . in the meantime , the mean baseline values of pi , gi , ppd , and cal and bone density ( bd ) showed no significant difference between the two groups ( p > 0.05 ) . in the present study both treatment modalities achieved a statistically significant reduction of the mean pi and gi scores , which continued up to the end of the 6-month evaluation period when compared to the mean baseline values ( p < 0.01 ) . however , at all evaluation points the reduction in pi and gi scores were no statistically significant different between two groups [ p > 0.01 , table 1 ] . mean values of pi , gi , ppd , cal , among the study groups at baseline and 6 months after treatment and bd among the study groups at baseline and 6-month after treatment furthermore , results of groups i and ii revealed that there was a statistically significant reduction in the mean ppd and cal measurements at 6-month post treatment compared with the mean baseline values . however , at 6-month the reduction in ppd and cal scores was statistically different and more obvious following the prf therapy of the group i compared with group ii [ p < 0.01 , table 1 ] . in both groups , data showed a statistically significant rise in the mean values of bd after 6-month follow - up compared with baseline values ( p < 0.001 ) . at 6-month the group i showed more statistically significant rise in bd values as compared to the group ii [ p < 0.001 ; table 1 and figures 2 and 3 ] . photograph showing the gray level of bone at baseline and after 6 months post treatment in group i photograph showing the gray level of bone at baseline and after 6 month post treatment in group ii in the present study both treatment modalities achieved a statistically significant reduction of the mean pi and gi scores , which continued up to the end of the 6-month evaluation period when compared to the mean baseline values ( p < 0.01 ) . however , at all evaluation points the reduction in pi and gi scores were no statistically significant different between two groups [ p > 0.01 , table 1 ] . mean values of pi , gi , ppd , cal , among the study groups at baseline and 6 months after treatment and bd among the study groups at baseline and 6-month after treatment furthermore , results of groups i and ii revealed that there was a statistically significant reduction in the mean ppd and cal measurements at 6-month post treatment compared with the mean baseline values . however , at 6-month the reduction in ppd and cal scores was statistically different and more obvious following the prf therapy of the group i compared with group ii [ p < 0.01 , table 1 ] . in both groups , data showed a statistically significant rise in the mean values of bd after 6-month follow - up compared with baseline values ( p < 0.001 ) . at 6-month the group i showed more statistically significant rise in bd values as compared to the group ii [ p < 0.001 ; table 1 and figures 2 and 3 ] . photograph showing the gray level of bone at baseline and after 6 months post treatment in group i photograph showing the gray level of bone at baseline and after 6 month post treatment in group ii therapeutic approaches for managing periodontitis involve various modalities to arrest the progression of periodontal tissue destruction , as well as regenerative techniques intended to restore structures destroyed during the disease process . nano - sized hp may have other special properties due to its small size and huge specific surface area . this nano - size leads to a significant increase in protein adsorption and osteoblast adhesion on the nano - sized ceramic . platelet - rich fibrin ( prf ) is in the form of platelet gel and can be used in conjunction with bone grafts , which offers several advantages including promoting wound healing , bone growth and maturation , graft stabilization , wound sealing , and hemostasis and improving the handling properties of graft materials . the present study evaluated the clinical and radiographic outcomes obtained following treatment of intrabony periodontal defects with nano - ha with or without prf . it was designed as a split - mouth investigation to facilitate the comparison of two treatment procedures by eliminating patient - specific characteristics that might have an impact on the results of regenerative surgeries . the split - mouth design has been considered adequate for evaluating regenerative procedures in a recent systematic review . wenzel et al . , reported that , no increased bone fill between 6 and 12 months may support the 6-month radiographic analysis of the present study . in the present study , both treatment modalities achieved a statistically significant reduction in the mean plaque and gi scores at the treated sites during follow - up evaluations compared with baseline scores . at all evaluation periods , the reduction in pi and gi in both groups may be attributed to mechanical oral hygiene procedures . a significant improvement in ppd reduction , cal gain , and radiographic defect fill was observed in both test and control group at 6-month postoperatively compared with baseline which was favoring to the group i. in group ii , the reduction in ppd and the cal gain was in accordance with the previous reported study by kasaj et al . , that evaluated the clinical efficacy of ncha paste in intrabony defects and reported ppd reduction of 3.9 mm 1.2 mm and cal gain of 3.6 mm 1.6 mm . meanwhile , schwarz et al . , evaluated the healing of intrabony peri - implantitis defects following application of two types of ha ; a ncha or a bovine - derived xenograft in combination with a collagen membrane ( bdx1bg ) . postoperative wound healing revealed that nha compromized initial adhesion of the mucoperiosteal flaps in all patients . at 6-month after therapy , showed that cal changed from 7.5 - 1.0 mm to 5.2 - 0.8 mm . at all evaluation points , there was statistical significant reduction in ppd , gain in cal and increased bd in group i compared with group ii . this may be due to the effect of combination technique ( bg + prf ) used in the present study . kili et al . , demonstrated that the combination of ha collagen bone graft with expanded polytetrafluoroethylene membrane resulted in higher ppd reduction ( 5.85 mm ) and greater cal gain ( 3.80 mm ) compared with the test group results . furthermore , this result in agreement with singh et al . , who found that the ncha bone graft in combination with the collagen membrane demonstrated clinical advantages beyond that achieved by open flap debridement alone . it was suggested that intrabony defect configuration influences the results after gtr , and larger amounts of cal gain were reported following gtr treatment . a systematic review concluded that in two - wall intrabony defect models of periodontal regeneration , the additional use of grafting material gave superior histological results of bone repair to barrier membranes alone . clinical trials suggest that the combination of bone graft along with the growth factors in the prf may be suitable to enhance the bd because prf is a rich source of platelet - derived growth factor , transforming growth factors , and insulin - like growth factors . platelet - rich fibrin can serve as a resorbable membrane , which can be used in preprosthetic surgery and implantology to cover bone augmentation site . since the surface of prf membrane is smoother , it can cause superior proliferation of human periosteal cells thereby enhancing bone regeneration . the progressive polymerization mode of coagulation in prf helps in the increased incorporation of the circulating cytokines into the fibrin meshes ( intrinsic cytokines ) which helps in wound healing by moderating the inflammation . shivashankar et al . , used ha and prf barrier membrane in the treatment of large periapical lesion . radiologically , the ha crystals have been completely replaced by new bone at the end of 2 years . they hypothesize that the use of prf in conjunction with ha crystals might have accelerated the resorption of the graft crystals and would have induced the rapid rate of bone formation . simple , easy , fast and cost - effective process of prf preparation without any biochemical involvements hold the major advantage over other derivatives . also the physiologic functional fibrin matrix has the ability to sustain and progressively release growth factors , cytokines and leukocytes in the surrounding tissues as the matrix degrades over time . all these factors help make prf the most significant in fibrin technology and endogenous regenerative therapy . adjunctive use of prf membrane in combination with ncha bone graft resulted in clinically , radiographically and statistically significant compared with ncha bone graft alone , in terms of ppd reduction , cal gain , and increase bd . the combination therapy of prf with commercially available bone grafts is a promising technic that should be used to enhance the regeneration .

background : nano - sized ceramics may represent a promising class of bone graft substitutes due to their improved osseointegrative properties . nanocrystalline hydroxyapatite ( ncha ) binds to bone and stimulate bone healing by stimulation of osteoblast activity . platelet - rich fibrin ( prf ) , an intimate assembly of cytokines , glycan chains , and structural glycoproteins enmeshed within a slowly polymerized fibrin network , has the potential to accelerate soft and hard tissue healing . the present study aims to explore the clinical and radiographical outcome of ncha bone graft with or without prf , in the treatment of intrabony periodontal defects.materials and methods : in a split - mouth study design , 20 patients having two almost identical intrabony defects with clinical probing depth of at least 6 mm were selected for the study . selected sites were randomly divided into two groups . in group i , mucoperiosteal flap elevation followed by the placement of ncha was done . in group ii , mucoperiosteal flap elevation , followed by the placement of ncha with prf was done . clinical and radiographic parameters were recorded at baseline and at 6-month postoperatively.results:both treatment groups showed a significant probing pocket depth ( ppd ) reduction , clinical attachment gain , increase bone density 6-month after surgery compared with baseline . however , there was a significantly greater ppd reduction and clinical attachment gain when prf was added to ncha.conclusion:the ncha bone graft in combination with prf demonstrated clinical advantages beyond that achieved by the ncha alone .

INTRODUCTION MATERIALS AND METHODS Patient selection Materials Platelet-rich fibrin preparation Patient groups Clinical measurements Radiographic examination Statistical analysis RESULTS Clinical results Bone density results DISCUSSION CONCLUSION RECOMMENDATION

as the most common form of dementia , alzheimer disease is characterized by progressive loss of memory and deterioration of cognitive functions . it is predicted that about 75.63 million people would suffer from dementia by 2030 . accordingly , in the present study , the intended remedy was selected and an appropriate pharmacognostical and pharmaceutical evaluations were performed . by searching through the traditional pharmaceutical manuscripts such as qarabadeen - e - salehi , qarabadeen - e - azam , qarabadeen - e - ghaderi and canon of medicine , a simple but proven compound remedy ( frankincense and black pepper ) was selected . related pharmaceutical assessments such as weight variation , hardness , friability , and disintegration tests as well as pharmacognostical evaluations such as microscopic characterization , tlc , gc / ms , ft / ir fingerprints , and radical scavenging activity assessment ( dpph ) were performed . the resulting formulation , as a floating tablet , included 60% of frankincense gum and 15% of black pepper along with appropriate pharmaceutical ingredients ( weight variation : 0.2190.004 g , hardness : 6.500.67 , friability : 0.45% , disintegration time > 30 min ) . microscopic characterization demonstrated stone cells , calcium oxalate crystals , sclereids of endocarp and pitted cells of mesocarp of pepper fruits as well as oil drops of frankincense gum . gc / ms analysis revealed acetyl acetate and trans - caryophyllene as the main constituent . moderate radical scavenging activity ( ic50 > 100 g / ml ) was calculated for the methanol extract of tablets . carrying out and validating a gc method for standardization of the formulated tablet , and having the structure for the effectiveness of these medicinal herbs in alzheimer may be the horizon for a new alzheimer - targeted medicine .

background : as the most common form of dementia , alzheimer disease is characterized by progressive loss of memory and deterioration of cognitive functions . it is predicted that about 75.63 million people would suffer from dementia by 2030 . apart from conventional remedies , the application of herbal medicines is on the rise . there are numerous natural medicaments reported in the traditional manuscript of persian medicine . accordingly , in the present study , the intended remedy was selected and an appropriate pharmacognostical and pharmaceutical evaluations were performed.methods:by searching through the traditional pharmaceutical manuscripts such as qarabadeen - e - salehi , qarabadeen - e - azam , qarabadeen - e - ghaderi and canon of medicine , a simple but proven compound remedy ( frankincense and black pepper ) was selected . a floating tablet was designed and formulated from those herbal components . related pharmaceutical assessments such as weight variation , hardness , friability , and disintegration tests as well as pharmacognostical evaluations such as microscopic characterization , tlc , gc / ms , ft / ir fingerprints , and radical scavenging activity assessment ( dpph ) were performed.results:the resulting formulation , as a floating tablet , included 60% of frankincense gum and 15% of black pepper along with appropriate pharmaceutical ingredients ( weight variation : 0.2190.004 g , hardness : 6.500.67 , friability : 0.45% , disintegration time > 30 min ) . microscopic characterization demonstrated stone cells , calcium oxalate crystals , sclereids of endocarp and pitted cells of mesocarp of pepper fruits as well as oil drops of frankincense gum . tlc fingerprinting showed classes of secondary metabolites related to both components . gc / ms analysis revealed acetyl acetate and trans - caryophyllene as the main constituent . moderate radical scavenging activity ( ic50 > 100 g / ml ) was calculated for the methanol extract of tablets.conclusion:carrying out and validating a gc method for standardization of the formulated tablet , and having the structure for the effectiveness of these medicinal herbs in alzheimer may be the horizon for a new alzheimer - targeted medicine .

Background: Methods: Results: Conclusion:

there are several important reasons for such a focus , but a key issue is no doubt the relationship between poverty and ill - health and premature death , shown not least by several classical and historical investigations [ 1 , 2 ] . the finding of the social gradient is also of interest when going from these historical studies to present discussions about poverty , inequality , and population health , as it indicates that not only the very poorest sections were hit but that relative poverty was also of importance . it is well known that countries with high absolute poverty rates today ( e.g. , world bank indicators of 1 or 2 us dollars a day ) also tend to be those with low life expectancy and high mortality risks . but what is the relationship between relative poverty rates and mortality risks among the richer countries of the world ? assuming that the poorest people in rich countries do not live under absolute poverty , the relationship between variations in relative poverty rates and variations in mortality rates may seem less self - evident . however , this relationship has been at the centre of one of the most debated topics within the field of public health research and social epidemiology in recent decades , namely , the health impact of income inequality . it is actually one foundation of the so - called wilkinson hypothesis , which basically states that it is not the level of affluence as such that matters among rich countries but rather how the pie of total economic resources is distributed . this hypothesis is articulated in relation to the whole social structure , thus stating that it is income inequality as such , not only poverty , that kills . however , most evidence , on both the macrolevel of countries and the microlevel of individuals , suggests a curvilinear association between income and health , which implies that health gains can be made by transferring money from the richer to the poorer . if this is so , it means that not only income inequality but also and even more evident variations in poverty rates should be associated with population health . but can we evidence that cross - national variations in relative poverty rates are related to cross - national variations in survival possibilities in relatively rich countries ? in this study , we conduct a comparative analysis of the relationship between poverty and mortality across 26 developed countries over time . we utilize data from the luxembourg income study to construct age - related poverty rates across countries and time covering the period from around 1980 to 2005 , merged with data on age- and gender - specific mortality data from the human mortality database . it is reasonable to assume that the consequences of poverty differ between gender and age groups . it is also a well - known fact that the causes of death vary by gender and age . for example , it has been shown that there were larger socioeconomic differences in men 's mortality patterns than women 's . it follows that it seems to be a reasonable hypothesis that the poverty and mortality relationship could also be different between women and men . therefore , it is important that we conduct sex- and age - disaggregated analyses . in the next section , we briefly present some of the arguments and empirical evidence of relevance to our study . we then present our results , and the paper ends with a concluding discussion about our findings . as mentioned , the idea that income inequality could influence population health was noted already in the typical curvilinear association of the so - called rodgers curve . partly based on empirical data , rodgers presented a model of how smaller income disparities and relative poverty at societal level are linked to better public health through differential impacts on individual health status among both low- and high - income earners . he argued that the health returns of income diminish at higher income levels , implying that this relationship is curvilinear [ 7 , 8 ] . in the rodgers example ( figure 1 ) , the health of the low - income person x1 is much poorer than that of the high - income person x2 at t1 . redistributing income from x2 to x1 at t2 will result in an unchanged average income ( x- ) , while average health ( y - t2 ) improves . this is simply the result of the health gain among the poor ( yx1 ) being larger than the health loss among the rich ( yx2 ) as a consequence of this income redistribution . rodgers also presented results from cross - national , cross - sectional analysis supporting the specification that countries with lower inequality had higher life expectancy . although rodgers , and later wilkinson , articulated how the whole income distribution could make a difference , it is evident from the hypothesis that what should particularly make a difference is how the relatively poor fare and how large a fraction of the population is at risk of poverty . the topic of income inequality and health has become a small research industry within social epidemiology , with some influences from economics and sociology , and numerous studies have been published , especially on the relationship between income inequality across american states and various health outcomes . one major review was largely in favour of the hypothesis , whereas another was sceptical . a meta - analysis of multilevel studies linking income inequality to mortality and self - rated health lent support to the idea . a recent global study investigating 140 countries also lends support to the hypothesis , but only in low- and middle - income countries . in cross - national analyses , not least with regard to population health and poverty , it has become common procedure to group countries according to their specific mix of welfare production , that is , welfare regime [ 15 , 16 ] . as noted by several authors [ 17 , 18 ] , the welfare modelling business has become a central part of welfare state research , starting with esping - andersen 's famous trichotomy that he labelled on the basis of main political ideologies : the liberal , social - democratic , and conservative / corporatist regimes . the idea behind the regime approach goes beyond the welfare state in the stricter sense by looking at the nexus of the state , markets , and family . while esping - andersen identified three welfare state regimes among the countries he analysed , it has subsequently been common procedure to also include and identify additional clusters of southern and eastern european countries . although our overall aim is to study the link between poverty and mortality , it is of obvious interest to note variations in this relationship by welfare state regime and to adjust our analyses by regime . not least within the news project , initiated in collaboration with the who commission on social determinants of health , a number of studies were produced linking the specific design , generosity and coverage of social policy programmes to overall and age - specific mortality on the one hand , and to morbidity on the other [ 2024 ] . these studies focused on the cash side of the welfare state and supported the idea that cash programmes of the welfare state have been of importance to public health during the second half of the 20th century . these studies did not investigate the role of welfare services , nor did they study any specific mechanisms behind the associations found . however , the ability of these programmes to alleviate poverty was often referred to as a key factor in cross - national variations in mortality rates . of course , the programmes of the welfare state are likely to also influence other more proximal health - related factors that could influence mortality risks . in this study we will explore the relative poverty argument directly , by making use of the best sources for comparative studies on poverty and mortality over a 25-year period . we partly overcome the small - n problem that occurs in most cross - national studies by using multiple waves of data for each country included . although we will not examine the mechanisms , it is still necessary to briefly mention some of the possible multiple pathways linking relative poverty and mortality . overall mortality has decreased in recent decades in developed countries ( with russia as the only exception ) . the question is whether the incidence of relative poverty has delayed or prevented a fall in mortality in the countries included in our analysis . the experience of living in relative poverty may be connected to unhealthy habits and continuous stress , as well as negative consequences more or less directly stemming from a lack of resources , for example , not being able to consume healthy food or live in adequate housing , or moving to a neighbourhood with more safety , better primary health care or better schools and other services . we believe many of these factors may work in a causal chain rather than as contradictory mechanisms . in so far as psychosocial processes are at work , it seems more reasonable to assume that they have a material base than to regard the material and psychosocial as representing two opposite and mutually exclusive poles . our two main data sources are the luxembourg income study ( lis ) and the human mortality database ( hmd ) . the lis is a cross - national harmonized database that includes multiple waves of microdata for a number of countries . it has a focus on income inequality and poverty , but also includes a great deal of information on aspects such as family situation , and employment status . wave 1 started around 1980 with approximate five - year intervals , so that wave 6 of the data is from around 2005 ( for a thorough presentation of the database see ) . the lis is commonly regarded as the best source of cross - national comparisons of poverty and income inequality . the hmd , maintained by the university of california , berkeley , and the max planck institute of demographic research , provides detailed open access mortality and population data for a number of countries for years reaching from the 1800s to around 2010 . currently , the hmd includes information for 37 countries , which are partly the same and partly different to those in the lis database . in our study , we include all countries from the lis that have at least two waves of data from the same original survey source , and for these countries , all lis waves for which mortality data were also available in the hmd for corresponding years . this led to a country sample of 26 rich countries with two to six waves , a total of 122 data points ( see table 1 ) . countries included are australia , austria , belgium , canada , the czech republic , denmark , finland , france , germany , hungary , ireland , israel , italy , luxembourg , the netherlands , norway , poland , russia , the slovak republic , slovenia , spain , sweden , switzerland , taiwan , the united kingdom , and the united states . we investigate four nested models in which the dependent variable is the logged mortality rate and the exposure variable is the poverty rate . mortality rates were assessed for three gender - specific age classes : infants ( aged < 1 year ) , children ( aged 117 years ) , and adults ( aged 2564 years ) . data on deaths and populations at risk were collected for one - year age bands for each country from the hmd for all lis waves , and for three following years of each wave . while infant mortality rates were used as such , age - standardized mortality rates for the age groups 117 and 2564 were calculated to adjust for the different age structures of the countries . in these calculations the age - standardized rates thus represent what the crude rates would be if the populations of the countries had the same age distribution as the european standard population . the age - standardized mortality rates were assessed as deaths per 1,000 person years , over four - year periods ( from each wave until three years later ) , to allow for exposure time . however , for infant mortality , we only took into account the immediate year . in the multivariate regressions , poverty rates were calculated using a standard income poverty head - count measurement in which individuals living in households with equivalent disposable income lower than a certain percentage of median income are regarded as poor . accordingly , we measure income after taking into account welfare state transfers and taxes . in order to be able to compare households of different sizes , each household 's disposable income is divided by the square root of the number of persons in the household . the proportion of poor households will of course be partly determined by where we set the threshold . evidently , the nature of poverty in terms of both the size of income and , for the countries analysed here , its consequences will become more severe the further we move from the national median . in our analyses we have employed a more severe definition than the usual 60% threshold , setting the poverty threshold at 40% of the national median . poverty rates in each country and each wave were calculated separately for children ( aged < 18 ) and working - age adults ( aged 2565 ) . with the data at hand , we can not have a perfect age match between the poverty rates and the mortality rates . thus , the total child poverty rates are used as the exposure for both our child mortality analyses , and there is also a one - year mismatch for the adults . the latter mismatch is highly unlikely to have any effect on our results . as confounders we consider the following variables . the lis wave number is included to allow for time - related changes in poverty and mortality rates . the wave number also is an indicator variable pertaining to the more or less automatic decline in mortality that takes place in all countries . gdp per capita/1,000 us dollars was derived from penn 's world tables that contain information on the gdp per capita levels for all the countries included in our analyses . the gdp levels are adjusted to changes in cost of living across time and space and are given in 2005 us dollars . administrative costs are also included , but the inclusion of the costs for running the schemes is not a major problem as these costs comprise only 24% of all expenditure . a more nuanced way of studying the impact of welfare spending would have been to use disaggregate spending data , that is , to separate cash and in kind benefits used for children , elderly , health care , various income maintenance programs , and so forth . however , this kind of analysis falls outside the scope of this particular paper and is a task for future studies . here we simply assume that the overall social spending level reflects the state 's commitment to citizens ' welfare . and russia and taiwan are not included in this database ; therefore , data for these countries are derived from other sources [ 29 , 30 ] . because data for russia and taiwan are adapted from nonstandard oecd sources , they are not totally comparable . therefore , we have run sensitivity tests with and without these countries . the omission of taiwan did not change the results , while the exclusion of russia had a strong impact . our data set is unbalanced ; that is , data are not available for all countries and all years ; therefore , we also run control analyses for the balanced data . whereas the omission of russia had the strongest impact , the omission of other outliers was not highly significant ( see further discussion below ) . we also include dummy variables for the welfare state regime each country belongs to ( see table 1 ) . the latter variables were added in the model one at time to better investigate their associations . our analytical approach is first to inspect bivariate plots to observe the general pattern of the relationship between age - specific mortality rates and the background variables . we start by looking at developmental pattern in mortality over cross - sections and welfare regimes . thereafter , we proceed to multivariate analyses to observe how the bivariate relationships will change when other variables are included in the regression models . for regression analyses , we used pooled cross - sectional time - series methods . these methods take advantage of the panel structure of the data while taking care of the correlations of data points between waves using panel - corrected standard errors [ 3133 ] . in these analyses , we use country as the panel variable and wave as the time variable . although partially solving the small n - problems , the pooled cross - sectional time - series method results in problems of spatial and longitudinal autocorrelation and heterogeneity . there are a number of regression techniques available to deal with the special problems of analysing pooled data , each with its own weaknesses , and results seem to be highly sensitive to the specific method applied [ 3438 ] . pooled regressions were run using the stata 12 cross - sectional time - series package using prais - winsten regressions . here we tested two possible ways to model the autocorrelation : ( 1 ) the psar(1 ) model uses autoregressive ( ar1 ) autocorrelation that is panel specifically calculated . the positive side is that it is tailored for each panel separately , and the negative side is that it may be unstable if there are few cross - sections ; ( 2 ) the ar(1 ) model uses an autocorrelation structure that is common for all panels . in order to further test the robustness of our results the results were robust for the different methods applied , and although the standard errors varied the interpretations of the results did not . figures 2(a)2(f ) show the magnitude and variability of infant , child , and adult standardized mortality rates by sex in different welfare state regimes and over time . we begin by looking more closely at infant mortality rates ( figures 2(a ) and 2(b ) ) . in the regression models to be shown later we will use logged mortality for girls and boys together , but in these more descriptive figures we show the raw figures for each sex . the box - plots display medians and distributions of country - based and wave - based observations around the median values . the first observation from the box - plot figure is that infant mortality rates among boys are higher than among girls ( 7.99 per 1,000 boys and 6.43 per 1,000 girls , on average across countries and time points ) . while this gender gap holds for all welfare regimes there is regime- and country - based variation in the width of the gap , widest in the postsocialist countries . as can be seen , the mortality rates are the lowest in the nordic group ( on average 4.56 for girls and 5.92 for boys ) and there is relatively small variation between the four countries included in this cluster . the starting levels are already low , and there is a modest absolute decline in infant mortality . on the other end of the continuum , we find the former socialist countries to have both the highest mortality rates and the highest variation between nations , but also the highest absolute decline in infant mortality . there is substantial variation over time as well , and as evident in figure 2(b ) , there is a downward trend over the waves concerning both levels and cross - national variation . bivariate scatterplots between infant mortality rates and the background variables we will later use in our multivariate models are shown in figure 3(a ) . in pooled data , that is , where all cross - sections are merged into one , the relationships between predictors and infant mortality rates are in the expected direction but not always convincingly high . the overall correlation in the pooled data is the highest between infant mortality rate and gdp , indicating that infant mortality is conditioned by the wealth of the nation and all the factors linked to gdp . however , gdp is not only an indicator of economic prosperity but also represents a more general modernization trend that includes better food , better health care , better sanitation , access to clean water , and so forth factors regarded as important in combatting infant mortality . in line with earlier research , we can also note the curvilinearity in the association between economic prosperity and infant mortality . the second strongest correlation in the pooled data is the one between mortality and social spending , representing the magnitude of the public commitment to the social protection of the populace . here as well the pattern is rather constant over cross - sections ( figure 3(a ) ) : the larger the share of gdp that is made up of social spending , the lower the infant mortality rate . contrary to our initial expectations , the link between infant mortality and child poverty rates is also relatively low in the pooled data . whereas relative poverty is rather strongly correlated with mortality in the first and last waves , the correlations in waves 2 and 3 are rather weak . our interim conclusion is that the level of prosperity of the country and the magnitude of the welfare state matter , and that the impact of the welfare state is mirrored in lower levels of child poverty and inequality , which in turn partially combat new - born deaths . an intriguing question is to what extent , if any , these bivariate relationships are robust when they are analysed simultaneously . in table 2 , we present results from regression analyses in which we step - wise include additional variables such as trend ( wave ) , gdp per capita ( 1,000 us dollars in 2005 values ) , social spending and , finally , the welfare state regimes as dummies . in the last model ( 4 ) the nordic welfare regime is used as a reference and is left out of the models . we ran the models separately for infant girls and boys , because the results turned out to be very similar we show them for both sexes combined . however , detailed results of the gender - specific analyses can be found in tables 5(a ) and 5(b ) . in the first model of table 2 , including only the poverty rate and the wave variable , the coefficient for poverty is significant . the coefficient of the association between poverty and logged mortality rate from this model can be statistically interpreted as follows : a one percentage - point increase in child poverty corresponds to about a 2% increase in infant mortality . the introduction of gdp per capita/1,000 us dollars ( model 2 ) does not change the picture . the inclusion of social spending ( model 3 ) , as expected , leads to an attenuation of the poverty estimate by about 40% . the statistical explanation for the strong attenuation of the poverty estimate when social spending is added is the strong association between social spending and poverty rates . so it seems that the welfare state matters for relative poverty , and relative poverty matters for infant mortality . finally , when welfare regimes are introduced ( model 4 ) , the poverty estimate remains about the same . the welfare regimes obviously capture not only different welfare state characteristics but also different levels of economic prosperity , since the coefficient for gdp totally disappears . in model 4 , controlling for poverty , wave , gdp , social spending and welfare regime , infant mortality rates are significantly higher in central european , liberal , and especially postsocialist regime types compared to the benchmarking nordic regime ( the reference category ) , while the southern european and other regimes do not significantly deviate from the nordic one . these regime differences are notable , especially if one bears in mind that they are not captured by differences in poverty , economic prosperity , or social spending . this evident variation between the regime types highlights that the causes of differences in population health statistics are multifactorial , and we are not able to fully capture this with the variables in our regression models . when we move from the new - borns to older children , the risk of death radically diminishes . this is also reflected in the age - standardized mortality rates in the age group 1 to 17 . figures 2(c ) and 2(d ) give the variability in these rates by welfare state regime type and across waves . again , there is an overrepresentation of boys in the death toll ( the average age - standardized mortality rate over countries and time points is 0.22 per 1,000 girls and 0.33 per 1,000 boys aged 117 ) . in the postsocialist regime , the average death rate ( 0.27 among girls , 0.42 among boys ) is about 1.5-fold compared to the low nordic numbers ( 0.17 among girls , 0.26 among boys ) . in this age group , the country group stands out with relatively high mortality rates but also very large variation . as seen in figure 2(d ) , there is a clear trend here as well towards lower death rates in time ( in average , from 0.31 to 0.15 among girls and from 0.49 to 0.21 among boys ) . the fact that we have an unbalanced panel can of course influence the magnitude of this downward trend , but the overall trend is general within all countries . figure 3(b ) shows the crude relations between the pooled data of the age - standardized death rates and the three main explanatory factors . especially social spending has a relatively strong association with child mortality , whereas the associations of gdp and relative child poverty with mortality are more modest . in order to cross - check the extent to which the results are biased by the former communist countries , we ran controls in which the countries in the postsocialist cluster were excluded . in general , correlations between gdp and mortality became weaker , but the signs were not changed . correlations between social spending and mortality became stronger , however , and correlations between poverty and mortality became stronger or remained almost the same . in table 3 we show the results of our pooled cross - sectional time series analysis for this age group for girls and boys together , because the results of gender - specific analyses proved to be almost identical in terms of regression coefficients ( see tables 6(a ) and 6(b ) ) . the analytical strategy is basically the same as for infants , although the logged age - standardized mortality rates are now calculated as the average of the lis years ' mortality plus the following three years ' mortality to allow for exposure time on mortality after our poverty measurements . the basic story for the age group 1 to 17 is also very much the same as what we showed for the infants ( table 2 ) . the poverty estimates , especially in the two first models , and estimates for most of the other variables have similar magnitude as in the case of infant mortality . an important exception to this is the welfare regime . in terms of mortality among children aged 117 , the liberal and southern european regimes fare significantly better compared to the nordic regime after the other covariates are adjusted for . , we can note that the poverty estimate actually doubles when welfare regime is adjusted for ( compare models 3 and 4 ) . we will return to this finding in our final discussion . when comparing adult and mortality rates with child mortality rates , interesting shifts in the rank order of good and bad regimes can be observed . whereas in both groups of children ( figures 2(a)2(d ) ) the nordic welfare cluster displayed the lowest mortality rates , among adults the southern european cluster outperforms the nordic one ( figure 2(e ) ) . the figure reveals the exceptionally high mortality rates among males in the postsocialist countries , where the average age - standardized mortality rate across time points is as high as 10.06 for men and 3.69 for women ; the corresponding figures for the southern european cluster are 4.43 and 1.93 . as in the case of child mortality , there is a general downward trend over time ( figure 2(f ) ) . figure 3(c ) once again displays the well - known curvilinear relationship between mortality and gdp per capita ; the mirror picture of this is the relationship between gdp and life expectancy . neither social spending nor relative adult poverty rate displays any clear - cut relationship with mortality . although the relationship is somewhat different in different waves , the general message is that the bivariate plots basically show no association . results from pooled cross - sectional regressions are shown separately for women ( table 4(a ) ) and men ( table 4(b ) ) . in general , the association between poverty and mortality is weaker in the models for the adult population than for children . starting with the results for women , we can note that poverty remains significantly and positively associated with mortality across all four models . the general picture that the poverty estimate attenuates when social spending is controlled for is also evident for women in the same manner as we saw earlier for infants and children . somewhat oddly , we find that the poverty estimate actually increases when welfare regime type is also adjusted for ( compare model 4 to model 3 ) . scrutinizing the estimate for regime , we note that the association between regime and adult mortality is different to that between regime and infant mortality ( table 2 ) , but somewhat similar to that between regime and child mortality ( table 3 ) . compared to the nordic regime , the central and especially southern european regime types show statistically significantly lower mortality rates , whereas the postsocialist regime shows higher mortality rates among women when poverty , wave , gdp , and social spending are controlled for . turning to the results for men ( table 4(b ) ) , the picture is somewhat less clear . although the poverty estimates as such are not lower than for women , the variability , as evident in the high p - values , is much higher . and , somewhat strangely , the poverty estimate has its largest value and is clearly significant only in the final model . the postsocialist cluster has an extremely high estimate , especially considering all the other covariates we have adjusted for . apart from this cluster we can note that , in comparison to the nordic regime , the southern european , liberal , and other regimes have lower adjusted male mortality rates . this difference between southern and northern europe has also been corroborated by other cross - national research on mortality differences . but here it seems as if these differences , for both women and men , are accentuated by the fact that we control for the other welfare state - related variables . simultaneously , this also accentuates the effects of poverty for both women and men . we have performed a number of sensitivity analyses with regard to the inclusion / exclusion of countries and setting a higher poverty threshold . we also tested the impact of income inequality ( as expressed by the gini coefficient ) . we argue that the 40% poverty threshold comes closer to the absolute poverty level , not least combined with the national wealth indicator ( gdp ) , than the 60% poverty threshold , which comes closer to income inequality measured using the gini coefficient . however , as gini and poverty measures are strongly correlated they can not be used simultaneously as explanatory variables . the correlation between the whole population - level gini and relative poverty rate with 40% threshold is 0.85 , and gini and relative poverty rate with 60% threshold is 0.89 . when it comes to deviant cases we have one country that stands out : russia . during the time span covered by this study , russia had high poverty rates and extreme death risks , especially visible among adult males therefore , when we reran all regressions omitting russia , the estimates changed substantially . by and large our poverty estimates attenuated by about a third for infants , the degree of attenuation varied across the models for children aged 117 , and among adults the poverty estimate became insignificant . this choice was made mainly for theoretical reasons , as we suggest that it is the long - term and broad difference in poverty that matters rather than any yearly fluctuations [ 36 , 41 ] . we realize that models focusing on change would capture unmeasured heterogeneity but , on the other hand , such models also increase the noise - to - signal ratio . in the end , in line with babones in his comparative analysis of income inequality and health , we note that a major complication for any fixed effects model is the remarkable stability for both variables over time . however , it should be noted that some of the fixed effects are still included through the dummies for the lis wave and the welfare state regimes . another methodological concern in our study is the fact that we have an unbalanced panel structure . in other words , we have different countries in different waves . although statistically speaking our method takes this into account , it may still have an influence on our findings . this is an analogy to the finding from a simulation analysis by pop et al . suggesting that the composition of the sample of high - income countries may be crucial . still , in sensitivity analyses we found that a balanced panel gave largely similar results . in summary , it seems that the relative poverty rates are of importance to child mortality for the sample of countries and the period examined . this is also in line with earlier research showing a stronger association between income inequality and infant and child mortality than between income inequality and adult mortality . found evidence of socioeconomic resources in childhood and later in life having both direct and indirect effects on mortality patterns . primarily two models have been suggested in life course epidemiology : accumulation and critical periods during life . poor socioeconomic resources in childhood are associated with morbidity patterns in adulthood , particularly diseases such as stomach cancer and hemorrhagic stroke . the magnitudes of deprivation among children and the effect of the association vary between countries and have also been shown to be influenced by the design of the welfare state , such as choices of social policy / redistribution . the aim of this study was to analyse the effect of relative poverty upon mortality rates among three age groups infants , children , and working - age adults , also stratified by gender . we used a low threshold ( 40% of median ) to measure relative poverty , which thereby measures more severe poverty prevalence . our time period is 19802005 , and we have an unbalanced time series for 26 countries belonging to the rich world but also including postsocialist countries from eastern europe . we have recently seen a number of studies that go beyond the cross - sectional picture between income inequality and mortality [ 14 , 42 , 46 , 47 ] . to our knowledge , this is one of the first studies to go beyond the cross - sectional picture with a focus on poverty rather than inequality . there is ample evidence of profound differences in poverty across welfare regimes [ 4850 ] , suggesting that poverty , welfare regime , and mortality also may be interrelated . our results are basically the following : we find support for the assumption that the prevalence of poverty is of importance . the strength and level of significance vary depending on which additional variables are included in the model . when social spending is included , the poverty estimate for children attenuates by a third . a statistical explanation for this is the strong and robust association between poverty and social spending . when thinking about the order of impacts , one can , with overwhelming empirical support , argue that social spending is causally related to poverty : the higher the spending level in a country , the lower the poverty levels . we anticipated that if we took into consideration the welfare regimes ' belongingness , the relative role of poverty rates would be eaten up . however , for children the effect on the poverty estimate was negligible , and for adults the inclusion of welfare regime fortified the connection between poverty and mortality . this does not influence the poverty and mortality association for children , but it is important to note that the regime type as such has a clear influence on child mortality , even when controlling for gdp and social spending . in other words , this result suggests that there are other regime - specific factors that are important . for adults , interestingly enough , for both women and men we find that the poverty estimate becomes stronger when welfare state regime type is also controlled for . the reason for this is not self - evident , but from earlier research we know that several of the southern european countries are ranked at the top of life expectancy figures in europe and worldwide . we also know that they are less favourably ranked when it comes to poverty rates . in a sense , the regime variable captures whatever it is that is specifically health - promoting in these countries , and the resulting poverty estimate is thereby adjusted for that regime - specific aspect . another intriguing result , then , is that welfare regimes do not treat all age groups similarly . when it comes to the nordic welfare model , it seems to be good for infants and children but is no longer superior in older age groups , and some central and southern european countries outperform it . the results also show exceptionally high mortality rates among males living in the postsocialist countries . this result , in turn , indicates that welfare state and poverty have an impact on mortality , but there are other factors in play , such as drinking and eating habits and the way healthy and unhealthy behaviour is distributed between socioeconomic groups , according to income and education attainment levels . our study is definitely not the final answer to the question of whether or not the prevalence of poverty in relatively rich countries still has an influence on death risks . our study is somewhat different to most of the cross - country studies linking poverty and mortality . they have used either a more worldwide inclusion of countries ( but the question then becomes somewhat different ) or a much smaller sample of countries and have particularly been totally cross - sectional in their design . moreover , we have used age - specific analysis when it comes to both poverty calculations and mortality rates , thereby further specifying the tests . finally , as our study is based on large - scale macrophenomena we obviously have several mediating factors . however , a policy recommendation from our study is that national governments invest in eliminating child poverty . this is likely to have positive population health effects from both a short- and long - term perspective . from cross - national poverty analyses we know that universal , redistributive social policies are key instruments in reducing poverty ; if such policies are also coupled with social investment policies for young children , such as high - quality day care , this not only reduces poverty here and now but is also likely to be a good investment for the future .

a prime objective of welfare state activities is to take action to enhance population health and to decrease mortality risks . for several centuries , poverty has been seen as a key social risk factor in these respects . consequently , the fight against poverty has historically been at the forefront of public health and social policy . the relationship between relative poverty rates and population health indicators is less self - evident , notwithstanding the obvious similarity to the debated topic of the relationship between population health and income inequality . in this study we undertake a comparative analysis of the relationship between relative poverty and mortality across 26 countries over time , with pooled cross - sectional time series analysis . we utilize data from the luxembourg income study to construct age - specific poverty rates across countries and time covering the period from around 1980 to 2005 , merged with data on age- and gender - specific mortality data from the human mortality database . our results suggest not only an impact of relative poverty but also clear differences by welfare regime that partly goes beyond the well - known differences in poverty rates between welfare regimes .

1. Introduction 2. Material 3. Analytical Approach, Methods, and Variables 4. Results and Discussion 5. Conclusions

acute kidney injury ( aki ) is a severe complication of several different clinical conditions . apart from intrinsic renal diseases ( i.e. , glomerulonephritis , acute tubular necrosis , and interstitial nephritis ) or postrenal diseases triggered by an obstruction along the urinary tract , aki development is mainly related with prerenal azotemia due to an inadequate renal blood supply . per se predisposes patients to renal hypoperfusion because of central hypovolemia , arterial hypotension , and the consequent activation of different neurohormonal systems . indeed , aki is a quite frequent occurrence in patients with advanced liver disease and it affects about 1/5 of the hospitalized patients with liver cirrhosis . the international club of ascites has recently further stressed the association between aki and cirrhosis , also adopting the definition by the aki network which defined aki as an increase in serum creatinine ( scr ) 0.3 mg / dl or 50% in 2 measurements 48 hours apart . an additional and well recognized risk factor of aki development is the contrast medium administration in patients undergoing computed tomography . since hepatocellular carcinoma ( hcc ) is an event usually occurring in the course of cirrhosis , cirrhotic patients very often undergo radiological procedures enhanced with the use of contrast media for the early diagnosis of hcc as well as during the follow - up of hcc patients after treatment of cancer lesions . altogether , the above considerations suggest that cirrhotics might be a subset of patients particularly prone to develop contrast - induced aki ( ci - aki ) . the aim of this study was to investigate occurrence and possible predisposing factors of ci - aki in cirrhotic patients undergoing contrast - enhanced computed tomography ( cect ) . one thousand two hundred seventy - nine cirrhotic patients were consecutively hospitalized at the clinical and molecular hepatology division of the university hospital of messina from january 2008 to december 2014 . clinical , biochemical , instrumental , and radiologic data recorded in electronic charts from each of these patients were retrospectively analyzed . according to the scope of the study , 249/1279 patients ( mean age 64 11 years , 165 male ) who had undergone cect were selected on the basis of the availability of scr values evaluated both within 5 days before and 48 hours after cect ( cect group ) . in analogy , 203/1279 cases ( mean age 66 10 years , 132 male ) who had not undergone cect but had been tested twice for scr in 7 days during hospitalization were also included in the study as controls ( control group ) ( table 1 ) . eight hundred twenty - seven of 1279 cases excluded from the analysis were patients lacking double scr checks , patients with an estimated glomerular filtration rate ( egfr ) < 30 ml / min ( calculated by the modification of diet in renal disease-6 formula ) , patients with active bacterial infections , patients with history of recent intake of potentially nephrotoxic drugs ( i.e. , nonsteroidal anti - inflammatory drugs ) or history of exposure to contrast medium within 6 months before admission as well as of liver transplantation . demographic , clinical , and laboratory data of patients exposed ( cect group ) or not exposed ( control group ) to contrast medium . turcotte ( cpt ) and model for end - stage liver disease ( meld ) scores . the contrast iodine medium used for all cect was iopromide ( ultravist ; bayer healthcare pharmaceuticals inc . , whippany , nj , usa ) ( 370 mg / ml , intravenously at a dosage of 1.2 ml per kilogram of body weight ) . the study was conducted in accordance with the declaration of helsinki , and all patients gave their written informed consent to participate in the study . the numerical data are expressed as mean and standard deviations and the categorical variables as count and percentage . comparison between cect and control groups was performed using 2-sample student t test and the test for numerical and for categorical variables , respectively . variables considered were sex , age , etiology of cirrhosis , cpt score , meld , egfr , international normalized ratio , ascites , serum sodium , albumin , bilirubin and creatinine , azotemia , chronic kidney disease ( ckd ) , diabetes , arterial hypertension , hcc , and treatment with diuretics as well as beta - blockers , antihypertensives , and antidiabetics drugs . univariate logistic regression model was estimated on the cumulative study population ( cect and control patients ) in order to identify predictive factors of ci - aki occurrence . variables statistically significant at univariate analysis were then included in the multivariate logistic regression model to identify independent predictive factors of ci - aki occurrence . results of univariate and multivariate analyses are reported as p values , odds ratio ( or ) , and 95% confidence interval ( ci ) . statistical analyses were performed using ibm spss statistics for windows , version 22 ( ibm corp . , armonk the numerical data are expressed as mean and standard deviations and the categorical variables as count and percentage . comparison between cect and control groups was performed using 2-sample student t test and the test for numerical and for categorical variables , respectively . variables considered were sex , age , etiology of cirrhosis , cpt score , meld , egfr , international normalized ratio , ascites , serum sodium , albumin , bilirubin and creatinine , azotemia , chronic kidney disease ( ckd ) , diabetes , arterial hypertension , hcc , and treatment with diuretics as well as beta - blockers , antihypertensives , and antidiabetics drugs . univariate logistic regression model was estimated on the cumulative study population ( cect and control patients ) in order to identify predictive factors of ci - aki occurrence . variables statistically significant at univariate analysis were then included in the multivariate logistic regression model to identify independent predictive factors of ci - aki occurrence . results of univariate and multivariate analyses are reported as p values , odds ratio ( or ) , and 95% confidence interval ( ci ) . statistical analyses were performed using ibm spss statistics for windows , version 22 ( ibm corp . , armonk no significant statistical difference was found between the cetc and the control groups in terms of etiology of the liver disease , cpt classes , presence of hcc , esophageal varices , diabetes , and arterial hypertension ( table 1 ) . in fact , in the cect group , 98/249 patients ( 39.4% ) had hepatitis b virus ( hbv ) ( 29 cases ) or hepatitis c virus ( hcv ) ( 69 cases ) chronic infection , 106 ( 42.6% ) had nonalcoholic fatty liver disease ( nafld)-related or cryptogenic cirrhosis , 35 ( 14% ) had alcoholic cirrhosis , 10 ( 4% ) had autoimmune liver disease or primary biliary cholangitis ( pbc ) . in the control group , 80/203 patients ( 39.4% ) had hbv or hcv chronic infection ( 20 and 60 cases , respectively ) , 88 ( 43.3% ) had nafld or cryptogenic cirrhosis , 27 ( 13.3% ) had alcoholic liver disease , and 8 ( 3.9% ) had autoimmune liver disease or pbc . in the cect group , 143/249 cases ( 57.4% ) belonged to the cpt class a , 88 ( 35.3% ) to cpt class b , and 18 ( 7.2% ) to cpt class c. in the control group , 96 cases ( 47.3% ) belonged to the cpt class a , 84 ( 41.4% ) to cpt class b , and 23 ( 11.3% ) to cpt class c. hcc was present in 86 ( 34.5% ) patients in the cect group and in 53 ( 26.1% ) patients in the control group . esophageal varices were detected in 134 ( 53.8% ) patients of the cect group and in 116 ( 57.1% ) patients of the control group . arterial hypertension was present in 90 ( 36.1% ) patients of the cect group and in 74 ( 36.5% ) patients of the control group . ninety - four ( 37.8% ) patients had diabetes in the cect group , and 89 ( 43.8% ) patients had diabetes in the control group ( table 1 ) . on the contrary , the cect group significantly differed from the control group for presence of ascites ( 70 vs 89 patients , p < 0.001 ) , hepatic encephalopathy ( 50 vs 61 patients , p = 0.01 ) , ckd ( 54 vs 70 patients , p = 0.002 ) , scr ( 0.8 0.3 vs 0.9 0.4 , p < 0.001 ) , and egfr ( 83 30 vs 72 29 , p < 0.001 ) ( table 1 ) . aki developed in 22/249 ( 8.8% ) and in 6/203 patients ( 3% ) of the cect and the control groups , respectively ( p = 0.01 ) . in particular , 20/22 cases ( 90.9% ) had aki stage 1 and 2/22 ( 9.1% ) aki stage 2 in the cect group , whereas 5/6 patients ( 83.3% ) had aki stage 1 and 1 patient had aki stage 2 in the control group . the univariate logistic regression analysis performed on the cumulative population of the cect and control groups showed that aki was significantly associated with contrast medium administration ( p = 0.014 ) , female sex ( p < 0.001 ) , age ( p = 0.04 ) , scr at baseline ( p = 0.008 ) , and egfr ( p = 0.04 ) ( table 2 ) . at multivariate analysis , the use of contrast medium ( or : 3.242 , 95% confidence interval [ ci ] : 1.2558.375 ; p = 0.015 ) , female sex ( or : 0.339 , 95% ci : 0.1390.827 ; p = 0.017 ) , and baseline scr ( or : 0.124 , 95% ci : 0.0160.975 ; p = 0.047 ) maintained statistical significance ( table 2 ) . variables analyzed at univariate and multivariate analyses in the entire study population for possible association with ci - aki . limiting the analysis to the cect group , presence of ascites ( p = 0.024 ) , female sex ( p = 0.001 ) , serum sodium levels ( p = 0.024 ) , and azotemia at baseline ( p = 0.049 ) correlated with ci - aki development at univariate analysis ( table 3 ) . ascites ( or : 2.796 , 95% ci : 1.1097.052 ; p = 0.029 ) , female sex ( or : 0.192 , 95% ci : 0.0730.510 ; p = 0.001 ) , and azotemia at baseline ( or : 1.018 , 95% ci : 1.0011.037 ; p = 0.043 ) maintained the statistical significance at multivariate analysis ( table 3 ) . variables analyzed at univariate and multivariate analysis in the cect group for possible association with ci - aki . reevaluation 3 months after discharge from hospital was available in 17/22 and 6/6 patients who developed aki in the cect and in the control groups , respectively . aki persisted in 10/17 patients ( 58.8% ) and in 1/6 patients ( 16.6% ) in the cect and the control groups , respectively . of note , none of the patients with persistence of worsened kidney function showed signs of liver decompensation . despite the limitations of the retrospective analysis , this study quite clearly indicates that the risk of aki development in cirrhotics is significantly increased when patients undergo computed tomography with intravenous iodinated contrast . moreover , although the ci - aki was not usually severe ( stage 1 in 90% of the cases ) , it seemed to persist over time since the worsening of kidney function was still present 3 months after the cect execution in the majority of cases . the multivariate analysis revealed that presence of ascites , female sex , and increased levels of azotemia but not of creatininemia at baseline were risk factors of ci - aki development . the fact that ascitic patients may be oversensitive in developing aki is not surprising considering that kidney dysfunction is a major factor in ascites occurrence and thus advanced liver disease per se may be considered a clinical pathological condition prone to an acute renal injury . it is more difficult to interpret why female sex and hyperazotemia at baseline may favor ci - aki occurrence . indeed , previous studies had already reported the association between female sex and ci - aki . in their study focused on liver transplanted patients , hilmi et al stressed that all the women enrolled were in menopausal age and thus had lost the beneficial protective effects exerted by estrogens against cardiovascular and renal diseases , and would therefore be more exposed to various kidney insults . of note and in accordance with this hypothesis , increased azotemia values in cases with normal creatininemia are usually considered an indicator of hypercatabolic condition and are indeed quite often present in the advanced phases of cirrhosis . why hyperazotemia at baseline was the only biochemical parameter significantly associated with the subsequent ci - aki development in our series of patients is not easy to explain . one might speculate a hypothetical involvement of hypercatabolism in favoring renal impairment in these patients , and therefore high azotemia levels may , better than hypercreatininemia , indicate basal conditions of kidney dysfunction that predispose to aki induced by contrast medium administration . in conclusion , this study reveals that development of ci - aki is not a rare event in cirrhotic patients , particularly if in women and/or in a decompensated phase with ascites and hyperazotemia . renal impairment occurrence is a complication of cirrhosis and a frequent cause of dramatic worsening of the clinical picture and death . the results of this study suggest caution in performing cect in patients with advanced cirrhosis , and reserving this radiologic approach for cases in which the clinical benefit for the patients of obtaining the information provided by this tool is clear .

abstractcontrast medium administration is one of the leading causes of acute kidney injury ( aki ) in different clinical settings . the aim of the study was to investigate occurrence and predisposing factors of aki in cirrhotic patients undergoing contrast - enhanced computed tomography ( cect).datasets of 1279 consecutively hospitalized cirrhotic patients were retrospectively analyzed . two hundred forty - nine of 1279 patients ( mean age 64 11 years , 165 male ) who had undergone cect were selected on the basis of the availability of serum creatinine ( scr ) values evaluated before and after cect ( cect group ) . in analogy , 203/1279 cases ( mean age 66 10 years , 132 male ) who had not undergone cect and had been tested twice for scr in 7 days were also included as controls ( control group ) . aki network criteria were employed to assess contrast - induced aki ( ci - aki ) development . apart from lack of narrowed double scr measurements , additional exclusion criteria were active bacterial infections , nephrotoxic drugs intake , and estimated glomerular filtration rate < 30 ml / min.aki developed in 22/249 ( 8.8% ) and in 6/203 ( 3% ) of the cect and the control groups , respectively ( p = 0.01 ) . the multivariate logistic regression analysis showed that aki was significantly associated with contrast medium administration ( odds ratio [ or ] : 3.242 , 95% confidence interval [ ci ] : 1.2558.375 ; p = 0.015 ) , female sex ( or : 0.339 , 95% ci : 0.1390.827 ; p = 0.017 ) , and scr values ( or : 0.124 , 95% ci : 0.0160.975 ; p = 0.047 ) . in the cect group , presence of ascites ( or : 2.796 , 95% ci : 1.1097.052 ; p = 0.029 ) , female sex ( or : 0.192 , 95% ci : 0.0730.510 ; p = 0.001 ) , and hyperazotemia ( or : 1.018 , 95% ci : 1.0011.037 ; p = 0.043 ) correlated with ci - aki development at multivariate analysis.ci-aki is a quite frequent occurrence in cirrhotic patients with female sex , presence of ascites , and hyperazotemia being the predisposing factors .

Introduction Patients and methods Statistical analysis Results Discussion

neutrophils are key cells of the innate immune response , protecting against invading infectious agents . during inflammatory events , in addition , they may release the contents of their intracellular granules into the local tissue environment . regulation of neutrophil function is therefore critical to ensure an appropriate balance between protection against infection and bystander host damage . current understanding of inflammatory disease suggests that this balance can be perturbed in disease states . the predominant mechanism by which neutrophil function appears to be controlled is by regulation of lifespan . circulating neutrophils are thought to either die by apoptosis in the circulation or to be targeted back to the bone marrow by upregulated cxcr4 expression where they are killed and recycled . determining the in vivo lifespan of neutrophils in the circulation and how it is regulated is therefore critical to understanding neutrophil production and homeostasis . in parallel , investigation of the regulation of in vivo lifespan of neutrophils in the tissues is essential for understanding how inflammation resolves . modulation of the functional lifespan of the tissue neutrophil by endogenous and exogenous modulators of neutrophil apoptosis may underlie the perpetuation of inflammation and subsequent tissue damage seen in many inflammatory diseases ; it may also be a key target for therapeutics that could limit tissue damage in inflammation while preserving host defense functions of the neutrophil . measures of the lifespan of circulating human neutrophils labeled via a variety of techniques give estimates of neutrophil half - life of 6 hours ( summarized recently in ) . however , recent advances using human neutrophils labeled in vivo report the circulating lifespan to be approximately 5 days , but this has recently been questioned by a number of authors [ 2 , 4 ] . in contrast , it has proved much more difficult to address the arguably more important question of the lifespan of tissue neutrophils . it has not , to date , proved possible to measure this directly , but in vivo labeling studies , for example , using 18fdg [ 5 , 6 ] , suggesting tissue neutrophil lifespan is prolonged compared to circulating neutrophils . the uncertainty as to the in vivo fates of individual cells relates in part to the difficulty in following individual immune cells over the course of their lifespan in vivo . zebrafish are emerging as a powerful model for the understanding of vertebrate immunity , and several important advances have recently been made that demonstrate the unique advantages of the zebrafish system for the study of immunity ( recently reviewed in ) . transgenic zebrafish models allow direct visualisation and tracking of individual cells , and of populations of cells , allowing their fate to be determined in vivo . unlike mammalian systems , zebrafish neutrophils adopt a tissue location constitutively and migrate to sites of inflammation , allowing direct visualisation of the lifespan of tissue neutrophils in vivo . using a novel in vivo zebrafish model , in which the fluorescent protein kaede , notable for its ability to change colour on exposure to light , is expressed in neutrophils , we find a lower bound for tissue neutrophil half - life of approximately 95 hours , in keeping with existing indirect measures . all reagents were from sigma - aldrich ( poole , uk ) unless otherwise stated . the tg(lyz : gal4)i252 , tg(actin : gal4 ) and tg(uas : kaede)s1999 t lines are described elsewhere . for confocal microscopy , a perkin elmer ultraview vox ers 6fr laser confocal imaging system ( perkin elmer inc , usa ) with an inverted olympus ix81 microscope , equipped with six diode laser lines and a yokogawa csu - x1 spinning disk was used to capture images on a 14-bit hamamatsu c9100 - 50 electron multiplying - charged couple device ( em - ccd ) peltier - cooled camera ( hamamatsu photonics inc . ) , through an appropriate filter . a perkin elmer ultraview photokinesis device , attached to the microscope described above , was used to photoconvert the kaede protein using a 405 nm laser line . all photoconversion of samples was performed using an olympus 10x objective lens ( uplansapo na 0.4 ) . the device was calibrated using a glass microscope slide ( menzel - glzer ) covered with fluorescent highlighter ink ( stabilo boss ) as a photo - bleachable substrate ( according to manufacturer 's instructions ) . photoconversion was performed on agarose - mounted larvae using 40% laser power for 120 cycles of the 405 nm laser line . the petri dishes containing the larvae were wrapped in aluminum foil to prevent background photoconversion . at the timepoints indicated , larvae were again mounted in low - melting point agarose and z - stacks taken using a 2x objective lens , and neutrophils counted . for fluorescence microscopy , a nikon eclipse te2000-u inverted compound fluorescence microscope ( nikon uk ltd ) was used with a hamamatsu 1394 orca - era ( hamamatsu photonics inc . ) . images were captured using volocity build 5.3.2 through a 2x nikon plan uw na 0.06 objective . multiple z - stacks were acquired using a prior nanoscan - z 200 m piezo z - axis drive . unless otherwise stated all graphs were generated and statistical analysis performed using graphpad prism 5 software . to accurately monitor the behaviour of individual cells in vivo over time requires the ability to label chosen cells with a stable tag that can consistently be identified over time and that does not influence the parameter being measured . the photoconvertable protein , kaede , is potentially suitable for this use since it can be readily converted from green to red fluorescence by light exposure . this can be achieved at the level of single cells using the laser scanning capacity of confocal microscopes . we aimed to use neutrophil - specific expression of kaede to photoconvert individual neutrophils in vivo and to follow their fate over several days . the minimum amount of laser energy required was identified using a series of optimisation experiments in muscle cells , which do not migrate and , unlike neutrophils , are thought not to be regulated by apoptosis . in fish from a cross of actin : gal4 and uas : kaede , regions of muscle were photoconverted using the photokinesis device on an ultraview spinning disk confocal microscope as detailed in section 2 ( figures 1(a ) and 1(b ) ) . two parameters were tested concerning the photoconversion : number of cycles of photoconversion and power of the 405 nm photoconversion laser . the intensity of red and green fluorescence at each point was measured and tracked over time . the ratio of red to green fluorescence was used to analyse the degree of photoconversion . the degree of photoconversion was increased by a change in the number of cycles of photoconversion up to 180 cycles , after which the increase was not maintained ( figure 1(c ) ) . an increase in the laser power used for photoconversion also gives an increase in the ratio of red to green fluorescence . the increase in ratio is preserved over the range of photoconversion laser power up to 80% , after which there is a fall off of photoconversion efficiency ( figure 1(d ) ) . using these data , and other optimisation experiments ( not shown ) , compromise photoconversion parameters were chosen which most reliably balanced the ability to clearly observe converted cells , with the minimal laser energy delivered , and the shortest duration of photoconversion . more cycles of conversion at lower energies could lead to prolonged experimental protocols , which might have a detrimental influence on the outcome of the experiment . for subsequent experiments levels of photoconversion efficiency were well below the published values of 2000 fold increase in the red to green fluorescence ratio . in the published literature this was not possible in a live in vivo model with kaede expressed in the musculature . using scanning confocal lasers delivers the photoconversion energy concentrated at the centre of an egg timer shape in z , thus assessments of whole - cell fluorescence will include sub - optimally converted tissue , thereby reducing the perceived efficiency of photoconversion . in addition , photoconversion is highly sensitive to irradiation with uv or violet light between 350 and 400 nm . the only wavelength of laser available for photoconversion in our laboratory was the 405 nm laser line . it is clear kaede could potentially provide a powerful tool for tracking individual cells in vivo . however , if kaede is to be used to follow individual cells over long periods of time , it is important that photoconverted kaede remains stable for the timespan of the experiments . it has been reported previously that photoconverted kaede remains stable for months ; however , this is in a purified state and not in vivo . photoconverted kaede needs to remain distinguishable from nonphotoconverted kaede for at least 48 hours , the maximum timespan of these experiments . in order to assess the stability of photoconverted kaede , 3 distinct sections of tissue were photoconverted in actin : gal4 uas : kaede larvae . the mounted larvae were then released from the agarose and then remounted at 24 and 48 hours after photoconversion . the photoconverted tissue was imaged at each timepoint using identical acquisition settings , so as not to create any bias . we observed that photoconverted cells persist over the experiment period of 48 hours ( figures 2(a)2(d ) ) . the intensity of red fluorescence ( from the photoconverted kaede ) was then measured over this time period . the maximum intensity of red fluorescence decreases over the 4 hour timespan following photoconversion ( figure 2(e ) ) . following the initial increase in fluorescence ( photoconversion ) , the intensity was reduced over the subsequent 48 hours . however , the maximum red fluorescence at 48 hours was still significantly higher than before photoconversion . importantly , the photoconverted tissue was easily distinguishable from non - photoconverted tissue at every point over the 48 hour period . the lifespan of a tissue neutrophil in any species has never previously been directly measured . in order to calculate a half - life for tissue neutrophils , photoconversion of limited numbers of tissue neutrophils in unchallenged fish from a cross of lyz : gal4 and uas : kaede was performed using the photokinesis device , and the persistence of these cells measured . neutrophils chosen for study were identified away from the posterior blood island to avoid labeling of dividing neutrophil precursor cells . an increase in photoconverted neutrophil number over the timecourse of the experiment was not observed in any of the larvae . this is suggestive that division of neutrophils was not a major factor during these experiments , although we can not exclude a small contribution from this phenomenon . care was taken to ensure single cells only were photoconverted ; this is particularly important as any overlapping cells would lead to an overestimate of lifespan , and this precludes reliable measurement of the lifespan of neutrophils involved in the inflammatory process where neutrophil density is significantly higher . the fish were imaged at 24 and 48 hours after photoconversion and the number of photoconverted neutrophils remaining were counted ( figure 3(e ) ) . using data acquired from 160 larvae , the half - life of a zebrafish tissue neutrophil during the 48 hour measurement window was found to be in the region of 120 hours ( 117.7 hrs 95% confidence interval 95.67157.8 ) . this is in keeping with tissue neutrophil lifespans inferred from mammalian data . in a rabbit model of lobar streptococcal pneumonia , and in human subjects with pneumonia , neutrophil influx ceased within the first day but metabolically active neutrophils continued to be detected for several days [ 5 , 6 ] . since the measured half - life is longer than the duration of the measurement , this can not be used to infer the behaviour of neutrophils beyond the end of the period of measurement . moreover , this figure does not take into consideration the age of the neutrophil at photoconversion . the thermal energy delivered by the photoconversion process these experiments were therefore repeated using variable laser energies to photoconvert the neutrophils . increased photoconversion energy ( 60% laser power ) led to shorter measured lifespans , but reduced photoconversion energy ( 30% laser power ) did not lead to extended survival ( figure 3(f ) ) . these data suggest that , at these levels of photoactivation energy , the experimental procedure itself has a minimal impact on neutrophil lifespan and that the effect of laser power would be to shorten neutrophil lifespan rather than extend it . for this latter reason , we can be confident therefore that the lifespan of a resting neutrophil is likely to be at least that measured here . while it would be highly interesting to define the lifespan of a neutrophil involved in the inflammatory process , this did not prove possible using this model , as we were unable to remove the possibility of photoconverting multiple cells unintentionally . to our knowledge , a number of measures of mammalian circulating neutrophil lifespan have been made , by labeling ex vivo or in vivo . all measures until recently have given consistent results , with a half - life of 68 hours . this is also in keeping with the clinical observation of the onset of neutropenia following bone marrow ablation . however , recent studies using labelled water and complex mathematical analysis have suggested that human neutrophil lifespans might be as long as 5 days . several authors have argued that these experiments have been misinterpreted , and advances in technology will be required before the true in vivo circulating neutrophil lifespan can be determined without doubt [ 2 , 4 ] . the resting tissue neutrophil in the zebrafish is a relatively long - lived cell ( compared to circulating mammalian neutrophils ) having a half - life of approximately 5 days . this is , as far as we are aware , the first direct measure of tissue neutrophil lifespan in vivo , and is in agreement with indirect and inferred measures from mammalian systems .

neutrophil function is thought to be regulated , in large part , by limitation of lifespan by apoptosis . a number of studies suggest that circulating neutrophils have a half - life of approximately 6 hours , although contradictory evidence exists . measuring tissue neutrophil lifespan , however , is more problematic . it is thought that tissue neutrophils survive longer , perhaps with a half - life in the order of 35 days , but this has never been directly measured . zebrafish are an emerging model organism , with several advantages for the study of vertebrate immunity . in zebrafish , neutrophils constitutively assume tissue locations allowing their direct study in vivo . using a transgenic approach , neutrophils were labelled with a photoconvertible pigment , kaede . photoconversion parameters were optimised and the stability of the kaede confirmed . individual neutrophils were photoconverted by scanning a confocal 405 nm laser specifically over each cell and their survival monitored for 48 hours , revealing an in vivo half - life for zebrafish tissue neutrophils of around 120 hours ( 117.7 hrs , 95% ci 95.67157.8 ) . laser energy did not extend neutrophil lifespan , and we conclude that this represents a lower bound for the lifespan of a resting tissue neutrophil in the developing zebrafish larva . this is the first direct measurement of the lifespan of an in vivo tissue neutrophil .

1. Introduction 2. Methods 3. Results and Discussion 4. Conclusion

a total of 121 older outpatients with type 2 diabetes in naples , italy , were included from 2007 to 2009 . frequency and duration of walking and other leisure - time physical activities were assessed by interview . exclusion criteria , assessed with self - report and medical records , included treatment with steroids or nonsteroidal anti - inflammatory drugs , acute concurrent illness during the 3-month period preceding the investigation , and cerebrovascular diseases . clinical characteristics of patients data are means sd , n , or n ( % ) . subcutaneous interstitial glucose levels were monitored on an ambulatory basis over a period of 3 consecutive days by using continuous subcutaneous glucose monitoring ( csgm ) ( glucoday ; a. menarini diagnostics , florence , italy ) as described previously ( 10 ) . the sensor was inserted on day 0 and removed on day 3 at mid - morning . the data were downloaded to a computer for evaluation of glucose variations , but calculations of glucose variations were limited to data obtained on days 1 and 2 to avoid bias due to both insertion and removal of the sensor and , thus , to insufficient stabilization of the monitoring system . the characteristic glucose pattern of each patient was calculated by averaging the profiles obtained on study days 1 and 2 . standardized meal tests with 24-h sampling comprising three mixed meals were performed on days 1 , 2 , and 3 . after an overnight fast , patients received medications at 0700 h and consumed breakfast 30 min after treatment . lunch and dinner were provided 5 and 10 h after the beginning of breakfast , respectively . the standardized breakfast contained 419 kcal ( 57% carbohydrate , 17% protein , and 26% fat ) , lunch contained 692 kcal ( 66% carbohydrate , 16% protein , and 18% fat ) , and dinner contained 507 kcal ( 41% carbohydrate , 26% protein , and 32% fat ) . before enrollment , all patients underwent carotid ultrasound examination and magnetic resonance imaging ( mri ) for the screening of carotid atherosclerosis and white matter lesions , significant signs of cortical or subcortical atrophy . patients with alterations in mri scans such as white matter lesions or cortical or subcortical atrophy were considered lost to follow - up analysis because morphological brain lesions as evidenced by mri might affect cognitive functioning independently of the changes in metabolic control . all mri evaluations were made by physicians not involved in the study and blinded to the study design . in brief , all patients were investigated in the supine position with the head slightly turned from the sonographer . the carotid arteries were carefully examined for wall changes from different longitudinal and transverse views . the common carotid artery , the carotid bulb , and the internal and external carotid arteries were examined in all subjects . a region 1.5 cm proximal to the carotid bifurcation was identified , and the intimal - media thickness of the far wall was evaluated as the distance between the luminal - intimal interface and the medial - adventitial interface . one transversal and two longitudinal measurements of intimal - media thickness were obtained from 10 contiguous sites at 1-mm intervals , and the average of the 10 measurements were used for the analysis . all ultrasound measurements were performed before enrollment by two trained investigators who were unaware of the study protocol . blood samples for the assay of insulin were collected in edta tubes , and plasma was immediately aliquoted in eppendorf vials and stored at 80c until thawed for assays . plasma insulin was determined by a commercial double - antibody , solid - phase radioimmunoassay ( sorin biomedica , milan , italy ) ( intra - assay coefficient of variation 3.1 + 0.3% ; cross - reactivity vs. proinsulin 0.9% ) . serum glucose , serum lipid , and serum lipoprotein were quantified from fresh samples drawn after participants had been fasting for at least 12 h. the serum glucose level was determined by an enzymatic colorimetric assay using a modified glucose oxidase - peroxidase method ( roche diagnostics , mannheim , germany ) and a roche - hitachi 917 analyzer . commercial enzymatic tests were used for determining serum total and hdl cholesterol and triglyceride ( roche diagnostics ) levels . the mean amplitude of glycemic excursions ( mage ) , which has been described by service et al . ( 11 ) , was used in the present study for assessing glucose fluctuations during 24 h. in particular , we used the glucose profiles obtained from continuous glucose monitoring system data on study days 1 and 2 , i.e. , from continuous monitoring for 48 h. this parameter was designed to quantify major swings of glycemia and to exclude minor ones . for this reason , only increases of > 1 sd of the mean glycemic values were taken into account . calculation of the mage was obtained by measuring the arithmetic mean of the differences between consecutive peaks and nadirs ; measurement in the peak - to - nadir or nadir - to - peak direction was determined by the first qualifying excursion . the measurement of this parameter , which has been proved to be independent of mean glycemia , is of particular interest because the greater the mage , the higher the glycemic instability ( 12 ) . twenty - four to 48 h before csgm , global cognitive function was assessed with the mini - mental state examination ( mmse ) corrected for educational levels of patients ( 13 ) . this cognitive test covers many cognitive skills , and scores range from 0 to 30 . the trail making test ( tmt ) is a visuomotor speeded task that consists of two parts : tmt - a and tmt - b . tmt - a , a visual scanning test , requires one to draw a line connecting consecutive numbers from 1 to 25 . tmt - b adds cognitive flexibility to tmt - a and requires one to draw a line connecting numbers and letters in alternating sequence ( 14 ) . although time - to - completion scores are typically used to examine aspects of attention and executive function , the difference between the two scores ( tmt - b tmt - a [ diff b - a ] ) provides a measure of cognitive efficiency ( 15 ) . the wechsler adult intelligence scale revised digit span is a measure of mental tracking as well as of brief storage and mental manipulation ( 15 ) . the backward digit span ( dsp backward ) requires the participant listen to increasingly longer lists of digits presented for immediate recall in the reverse order presented , whereas the forward digit span ( dsp forward ) requires immediate recall in the exact order presented . the verbal fluency test requires participants to generate as many words as possible in 1 min for a given letter ( f , a , s ) excluding nouns and variations of the same word ( 16 ) . the first - stage screening was based on the mmse . according to italian standards ( 17 ) , participants with an age- and education - adjusted mmse score of > 26 were considered to not have dementia and those with a score of 26 were directed to the second - stage screening that was performed by a geriatrician and a psychologist with long - term experience in the evaluation of older individuals with cognitive problems . the diagnosis of dementia syndrome , independent of etiology was established using a standard evaluation protocol based on dsm - iv criteria ( 18 ) . plasma insulin and triglycerides were log transformed for data analyses and back transformed for data presentation . we calculated the number of patients required for the study to reject the null hypothesis 99% of the time ( i.e. , with a one - tailed type ii error rate of 0.01 ) when r was 0.80 with a two - tailed type i error at the 0.05 level of significance . because this calculation led to a sample size of at least 110 , the number of required patients was set at 121 . a cluster analysis , using the squared sum of z scores , showed whether an overall value obtained by clustering attention and executive function test results was associated with mage . to create such a cluster analysis , we created a cognition composite score of attention and executive functions , as sum of the z scores of tmt - a , tmt - b , diff b - a , dsp a z score indicates the position of an individual value of a variable in the total distribution of the variable in the population and is calculated as follows : ( individual value the analysis transforms the individual test scores to z scores , summing these and restandardizing this sum . multiple regression models were used to explore the relationship between mage and cognition ( cognition composite score and mmse score ) independently of several covariates . the effect of therapy in patients categorized for number of antidiabetes therapies was assessed by anova , and ptrend was calculated . blood samples for the assay of insulin were collected in edta tubes , and plasma was immediately aliquoted in eppendorf vials and stored at 80c until thawed for assays . plasma insulin was determined by a commercial double - antibody , solid - phase radioimmunoassay ( sorin biomedica , milan , italy ) ( intra - assay coefficient of variation 3.1 + 0.3% ; cross - reactivity vs. proinsulin 0.9% ) . serum glucose , serum lipid , and serum lipoprotein were quantified from fresh samples drawn after participants had been fasting for at least 12 h. the serum glucose level was determined by an enzymatic colorimetric assay using a modified glucose oxidase - peroxidase method ( roche diagnostics , mannheim , germany ) and a roche - hitachi 917 analyzer . commercial enzymatic tests were used for determining serum total and hdl cholesterol and triglyceride ( roche diagnostics ) levels . the mean amplitude of glycemic excursions ( mage ) , which has been described by service et al . ( 11 ) , was used in the present study for assessing glucose fluctuations during 24 h. in particular , we used the glucose profiles obtained from continuous glucose monitoring system data on study days 1 and 2 , i.e. , from continuous monitoring for 48 h. this parameter was designed to quantify major swings of glycemia and to exclude minor ones . for this reason , only increases of > 1 sd of the mean glycemic values were taken into account . calculation of the mage was obtained by measuring the arithmetic mean of the differences between consecutive peaks and nadirs ; measurement in the peak - to - nadir or nadir - to - peak direction was determined by the first qualifying excursion . the measurement of this parameter , which has been proved to be independent of mean glycemia , is of particular interest because the greater the mage , the higher the glycemic instability ( 12 ) . twenty - four to 48 h before csgm , global cognitive function was assessed with the mini - mental state examination ( mmse ) corrected for educational levels of patients ( 13 ) . this cognitive test covers many cognitive skills , and scores range from 0 to 30 . the trail making test ( tmt ) is a visuomotor speeded task that consists of two parts : tmt - a and tmt - b . tmt - a , a visual scanning test , requires one to draw a line connecting consecutive numbers from 1 to 25 . tmt - b adds cognitive flexibility to tmt - a and requires one to draw a line connecting numbers and letters in alternating sequence ( 14 ) . although time - to - completion scores are typically used to examine aspects of attention and executive function , the difference between the two scores ( tmt - b tmt - a [ diff b - a ] ) provides a measure of cognitive efficiency ( 15 ) . the wechsler adult intelligence scale revised digit span is a measure of mental tracking as well as of brief storage and mental manipulation ( 15 ) . the backward digit span ( dsp backward ) requires the participant listen to increasingly longer lists of digits presented for immediate recall in the reverse order presented , whereas the forward digit span ( dsp forward ) requires immediate recall in the exact order presented . the verbal fluency test requires participants to generate as many words as possible in 1 min for a given letter ( f , a , s ) excluding nouns and variations of the same word ( 16 ) . the first - stage screening was based on the mmse . according to italian standards ( 17 ) , participants with an age- and education - adjusted mmse score of > 26 were considered to not have dementia and those with a score of 26 were directed to the second - stage screening that was performed by a geriatrician and a psychologist with long - term experience in the evaluation of older individuals with cognitive problems . the diagnosis of dementia syndrome , independent of etiology was established using a standard evaluation protocol based on dsm - iv criteria ( 18 ) . all data are expressed as means sd . plasma insulin and triglycerides were log transformed for data analyses and back transformed for data presentation . we calculated the number of patients required for the study to reject the null hypothesis 99% of the time ( i.e. , with a one - tailed type ii error rate of 0.01 ) when r was 0.80 with a two - tailed type i error at the 0.05 level of significance . because this calculation led to a sample size of at least 110 , the number of required patients was set at 121 . a cluster analysis , using the squared sum of z scores , showed whether an overall value obtained by clustering attention and executive function test results was associated with mage . to create such a cluster analysis , we created a cognition composite score of attention and executive functions , as sum of the z scores of tmt - a , tmt - b , diff b - a , dsp a z score indicates the position of an individual value of a variable in the total distribution of the variable in the population and is calculated as follows : ( individual value the analysis transforms the individual test scores to z scores , summing these and restandardizing this sum . multiple regression models were used to explore the relationship between mage and cognition ( cognition composite score and mmse score ) independently of several covariates . the effect of therapy in patients categorized for number of antidiabetes therapies was assessed by anova , and ptrend was calculated . the study group had mean sd age of 78 6.7 years ( range 8865 years ) , a1c of 7.9 0.3% , and fpg of 153 10.3 mg / dl . a slightly higher number of patients were women , with modest overweight . according to age most of them were affected by comorbidity ( cvd that was not stroke - related ; 13 reported hypercholesterolemia and 30 reported previous hypertension ) ( table 1 ) . no patients examined had carotid plaque > 70% ( four patients had carotid plaque at 2025% without significant alterations in blood flow ) on a carotid ultrasound examination or white matter lesions or significant signs of cortical or subcortical atrophy with an mri scan ( data not show ) . all patients were treated with oral antidiabetes agents : glyburide alone ( 1015 mg / day in 19 patients ) or metformin alone ( 1,700 mg / day in 38 patients ) or a combination of metformin ( 1,700 mg / day ) and glyburide ( 15 mg / day ) ( in 51 patients ) or a combination of metformin ( 1,700 mg / day ) and thiazolidinediones ( 4 mg / day ) ( in 13 patients ) . the mage over 24 h obtained from the continuous glucose monitoring system in the 121 patients was 71 19 mg / dl and the 24-h glycemic value was 176 45 mg / dl . mage was significantly correlated with mmse ( r = 0.83 p < 0.001 ) and with the cognition composite score ( r = 0.68 , p < 0.001 ) ( fig . 1 ) . this relationship persisted after adjustment for the main anthropometric ( bmi and waist - to - hip ratio [ whr ] ) , metabolic ( fpg and 2-h ppg and a1c ) , and/or vascular ( mean arterial blood pressure ) covariables ( data not shown ) . no correlation between mage and fasting insulin was observed ( r = 0.02 , p = 0.1 ) . the independent effects of mage on both the cognition composite and mmse scores were tested in three different multiple linear regression models ( table 2 ) having , respectively , age , sex , bmi , whr , drug intake , physical activity , and mage ( model 1 ) , model 1 + systolic and diastolic blood pressure ( model 2 ) , and model 1 + model 2 + a1c , fasting and postprandial glucose ( model 3 ) as covariates . in the more complex model 3 ( table 2 ) , mage was associated with mmse and cognition composite score ( independently of age , sex , bmi , whr , medication , physical activity , mean arterial blood pressure , fpg , ppg , and a1c ) . this last model explained 77 and 44% variability of mmse and cognition composite score , respectively , whereas mage per se explained 24 and 26% variability of mmse and cognition , respectively . among fpg , ppg , and a1c , only ppg has been found to be independently associated with cognitive function ( table 2 , model 3 ) . all of the analyses performed gave the same results , even after adjustment for education level ( data not shown ) . linear multivariate analyses with mmse and composite score as dependent variable for mmse : r = 0.73 ( model 1 ) ; r = 0.73 ( model 2 ) ; r = 0.77 ( model 3 ) . for composite score : r = 0.40 ( model 1 ) ; r = 0.41 ( model 2 ) ; r = 0.44 ( model 3 ) . sbp , systolic blood pressure ; dbp , diastolic blood pressure . to assess the impact of antidiabetes therapy , all patients were categorized in three groups according to number of antidiabetes drugs used . no differences were observed in the mean values of mage according to antidiabetes treatment : glyburide , 70.2 29 mg / dl ; metformin , 70.1 18 mg / dl ; metformin plus glyburide , 71.7 16 ; or metformin plus thiazolidinediones , 73.8 23 . no differences in ppg , a1c , cognitive composite score , and mmse were found among the study groups , thus showing a null impact of therapy on mmse score and cognition composite score ( data not shown ) . mage was significantly correlated with mmse ( r = 0.83 p < 0.001 ) and with the cognition composite score ( r = 0.68 , p < 0.001 ) ( fig . this relationship persisted after adjustment for the main anthropometric ( bmi and waist - to - hip ratio [ whr ] ) , metabolic ( fpg and 2-h ppg and a1c ) , and/or vascular ( mean arterial blood pressure ) covariables ( data not shown ) . no correlation between mage and fasting insulin was observed ( r = 0.02 , p = 0.1 ) . the independent effects of mage on both the cognition composite and mmse scores were tested in three different multiple linear regression models ( table 2 ) having , respectively , age , sex , bmi , whr , drug intake , physical activity , and mage ( model 1 ) , model 1 + systolic and diastolic blood pressure ( model 2 ) , and model 1 + model 2 + a1c , fasting and postprandial glucose ( model 3 ) as covariates . in the more complex model 3 ( table 2 ) , mage was associated with mmse and cognition composite score ( independently of age , sex , bmi , whr , medication , physical activity , mean arterial blood pressure , fpg , ppg , and a1c ) . this last model explained 77 and 44% variability of mmse and cognition composite score , respectively , whereas mage per se explained 24 and 26% variability of mmse and cognition , respectively . among fpg , ppg , and a1c , only ppg has been found to be independently associated with cognitive function ( table 2 , model 3 ) . all of the analyses performed gave the same results , even after adjustment for education level ( data not shown ) . linear multivariate analyses with mmse and composite score as dependent variable for mmse : r = 0.73 ( model 1 ) ; r = 0.73 ( model 2 ) ; r = 0.77 ( model 3 ) . for composite score : r = 0.40 ( model 1 ) ; r = 0.41 ( model 2 ) ; r = 0.44 ( model 3 ) . to assess the impact of antidiabetes therapy , all patients were categorized in three groups according to number of antidiabetes drugs used . no differences were observed in the mean values of mage according to antidiabetes treatment : glyburide , 70.2 29 mg / dl ; metformin , 70.1 18 mg / dl ; metformin plus glyburide , 71.7 16 ; or metformin plus thiazolidinediones , 73.8 23 . no differences in ppg , a1c , cognitive composite score , and mmse were found among the study groups , thus showing a null impact of therapy on mmse score and cognition composite score ( data not shown ) . our study shows that impairment of cognitive performance in older type 2 diabetic patients may be associated with daily acute glucose fluctuations . in particular , mage excursions were strongly correlated with cognitive functioning , and this relationship was independent of the main markers of sustained hyperglycemia ( a1c , ppg , and fpg ) . even though a number of studies have investigated and compared the roles of the different glycemic indexes participating in diabetic cognitive disorders ( 24 ) , accurate assessment of their respective contributions is still being debated . by using different methods , including epidemiological ( 2 ) , interventional ( 19 ) , or pathophysiological studies ( 5 ) , several authors have demonstrated that a1c is certainly an independent risk factor of decline in cognitive performance in type 2 diabetes . for instance , it has been established that chronic hyperglycemia induces an overproduction of superoxide which , after reacting with nitric oxide , produces subsequent nitrosative stress with generation of metabolic derivatives such as peroxynitrite and nitrotyrosine ( 20 ) . the toxicity of these substances can lead to neuronal damages and , furthermore , to a decline in cognitive performance . in this context , daily glucose fluctuations , more generally , glucose swings such as peaks and troughs , exhibited a more specific triggering effect on oxidative stress than chronic sustained hyperglycemia ( 21 ) . thus , peaks , usually corresponding to maximum values after meals , and troughs , observed over interprandial periods , could lead to continuous production of oxidative stress , impairing cognitive functioning . oxidative stress caused by free radicals damages the endothelial cells in the blood vessels , promotes lipid peroxidation , and plays a central role in pathogenesis of cerebral complications of type 2 diabetes . various studies have shown that increased oxidative stress can lead to microvascular cerebral diseases , e.g. , stroke , cerebral hemorrhage , and brain infarction . the reason for high risk of microvascular cerebral diseases is that brain consumes 20% of the oxygen consumed by the body and has a low concentration of antioxidants and high content of unsaturated fatty acids and catecholamines that are easily oxidized , making it more vulnerable to oxidative damage than any other organ in the body , and this may predispose diabetic patients to development of cognitive impairment ( 22 ) . because the glycemic fluctuations as estimated from mage indexes reflect both upward and downward glucose changes , whereas a1c , ppg , and fpg values are only markers of upward variations , there is a reason to hypothesize that mage indexes are wider integrators of glycemic variations than the a1c , ppg , and fpg values . our results , showing that mage values were associated with cognitive functioning independently of the main markers of glycemic control , we therefore suggest that acute glycemic excursions should be integrated into glycemic disorders that are larger than chronic hyperglycemia , i.e. , into rapid glucose swings including declines from relatively high glucose levels during postprandial periods to low values or even to asymptomatic hypoglycemia , as observed over interprandial periods . as a consequence , low glycemic levels in type 2 diabetes might also evoke a decline in cognitive performance . indeed , because the appropriate concentration of glucose may have a pivotal role on metabolic activity in the brain , the rapid glucose swings from relatively high glucose levels during postprandial periods to low values or even to asymptomatic hypoglycemia and its associated neuroglycopenia may contribute largely to a more rapid decline of metabolic activity in the brain ( 23 ) thus , glucose variations over time , fluctuating from hyperglycemic peaks to glucose nadirs , may affect cognitive function in older individuals , increasing oxidative damage as well as altering the appropriate brain supply of glucose . these observations provide a possible explanation for the independent role of mage on cognitive function with respect to ppg , fpg , and a1c . in summary , the present study demonstrates a significant relationship between acute glucose swings and cognitive performance impairment . a weakness in the present study is its cross - sectional , observational nature , and it is therefore difficult to draw causal relationships . however , because the glycemic disorders are risk factors for mild cognitive impairment and both vascular dementia ( 15 ) and alzheimer disease , the present data open the field for conducting interventional studies with the aim of treating glycemic disorders not only by reducing a1c and mean hyperglycemia ( 24 ) but also by flattening acute glucose fluctuations .

objectivethe mean amplitude of glycemic excursions ( mage ) is a significant determinant of overall metabolic control as well as increased risk for diabetes complications . older individuals with type 2 diabetes are more likely to have moderate cognitive deficits and structural changes in brain tissue . considering that poor metabolic control is considered a deranging factor for cognitive performance in diabetic patients , we evaluated whether the contributions of mage to cognitive status in older patients with type 2 diabetes were independent from the main markers of glycemic control , such as sustained chronic hyperglycemia ( a1c ) , postprandial glycemia ( ppg ) , and fasting plasma glucose ( fpg).research design and methodsin 121 older patients with type 2 diabetes , 48-h continuous subcutaneous glucose monitoring ( csgm ) were assessed . mage and ppg were evaluated during csgm . the relationship of mage to performance on cognitive tests was assessed , with adjustment for age , glycemic control markers , and other determinants of cognitive status . the cognitive tests were a composite score of executive and attention functioning and the mini mental status examination ( mmse).resultsmage was significantly correlated with mmse ( r = 0.83 ; p < 0.001 ) and with cognition composite score ( r = 0.68 ; p < 0.001 ) . moreover , mage was associated with the mmse ( p < 0.001 ) and cognition composite score ( p < 0.001 ) independently of age , sex , bmi , waist - to - hip ( whr ) ratio , drug intake , physical activity , mean arterial blood pressure , fpg , ppg , and a1c.conclusionsmage during a daily period was associated with an impairment of cognitive functioning independent of a1c , fpg , and ppg . the present data suggest that interventional trials in older patients with type 2 diabetes should target not only a1c , ppg , and fpg but also daily acute glucose swings .

RESEARCH DESIGN AND METHODS Laboratory measurements Assessment of glycemic instability Assessment of cognitive functions Statistical analysis RESULTS Relationships among the cognition composite score, MMSE score, and markers of diabetic control Relationship between glucose fluctuation (MAGE) and therapy for diabetes Conclusions

resin - based composite ( rbc ) is the most widely used modern dental restorative material . however , it is also characterized by the risk of complications due to insufficient polymerization of the material and the occurrence of polymerization shrinkage . since photo - polymerized resin composites were introduced , the degree of conversion was acknowledged as vital to the clinical success of these materials . it has been shown that the insufficient polymerization may lead to a decrease in the physical / mechanical and biological properties of resin composites . even so , complications related to polymerization shrinkage stress and curing depth still cause significant reluctance to use them . not only will this polymerization shrinkage stress be trapped within the material itself , but it also will exert forces on the adhesive interfaces of the dentin . therefore , bulk - filling techniques have become more widely used following the development of materials with improved curing , controlled polymerization contraction stresses , and reduced cuspal deflection . in contrast to , the maximum 2-mm increments recommended for conventional resin composites , manufacturers recommend 4 or 5-mm increments of the bulk - fill resin composites . the use of the bulk - fill technique undoubtedly simplifies the restorative procedure and saves clinical time in cases of deep , wide cavities . therefore , the aim of this study is to compare the shear bond strength ( sbs ) of recently introduced two different brands bulk - fill resin composite with the same brand conventional hybrid composites . the null hypotheses to be investigated are that ( 1 ) the sbs values of a bulk - fill composite does not differ from that of a conventional hybrid composites ( 2 ) the sbs values of tetric evoceram ( tbf ) and sonicfill ( sf ) does not show significant difference . after the approval of the ishik university college of dentistry ethical committee with reference number 2014 - 006 for this study , a sample of 60 extracted human premolar teeth were collected following patients verbal consent to include their teeth in the study . this paper describes an in vitro experimental study that involved 60 freshly extracted human third molars that were without cracks , decay , or any other defects . the teeth were removed from the subjects , the remnant connective tissue was removed and the samples were then stored in a 0.5% chloramine - t solution ( fisher chemical , fair lawn , nj , usa ) for 24 h before being washed with a saline solution and stored in distilled water at room temperature throughout the study period . prior to testing , the teeth were cleaned and then the mid - coronal dental was exposed by sectioning the samples using a low - speed diamond disk saw under water coolant ( markus inc . , the teeth were rinsed again before being mounted in acrylic resin ( 2 cm 3 cm 5 cm ) . the surface of the dentin was smoothed using 600 , 800 , and 1200 grit waterproof polishing papers before the teeth were randomly divided into four groups ( n = 15 ) . the total - etch dentine bonding system was utilized on the teeth in all the groups to reduce variability in the results of the investigation . the etch - and - rinse adhesive system adper scotchbond 1xt adhesive ( 3 m espe , st . , paul , mn , usa ) was then used to treat the bonding area of the dentin surfaces in accordance with the manufacturer 's instructions . two commercial bulk - fill composite systems were tested , and two conventional composite that required 2-mm increments was used as control . conventional systems used as a control group was chosen from same brand with bulk - fill composite used . materials used in this study group i : after adhesive application , the specimens were clamped in the ultradent bonding jig ( ultradent products ; south jordan , ut , usa ) , and a column of sf composite resin with 2.0 mm in height and 2.38 mm in diameter was placed by sonic - activation using sf handpiece ( kavo sf system , kerr , usa ) . any excess composite was carefully removed and then cured for 20 s using a 1000 mw / cm intensity light - emitting diode ( led ) curing light ( elipar s10 ; 3 m espe , seefeld , germany)group ii : after adhesive application , the specimens were clamped in the ultradent bonding jig ( ultradent products ; south jordan , ut , usa ) , and a column of conventional hybrid composite resin tbf ( ivoclar , vivadent , ag ) with 2.0 mm in height and 2.38 mm in diameter was placed . two millimeters thickness and each layer were polymerized with 1000 mw / cm intensity led curing light for 20 s ( elipar s10 , 3 m espe , germany)group iii : herculite xrv ultra ( kerr hawe , ca , usa ) universal nanohybrid dental composite was used . the procedures were the same as those in group igroup iv : a high viscosity tbf bulk - fill viscosity ( ivoclar vivadent , usa ) was placed to the preparation about 4 mm thickness and polymerized with the same led curing light . the procedures were the same as those in group i. group i : after adhesive application , the specimens were clamped in the ultradent bonding jig ( ultradent products ; south jordan , ut , usa ) , and a column of sf composite resin with 2.0 mm in height and 2.38 mm in diameter was placed by sonic - activation using sf handpiece ( kavo sf system , kerr , usa ) . any excess composite was carefully removed and then cured for 20 s using a 1000 mw / cm intensity light - emitting diode ( led ) curing light ( elipar s10 ; 3 m espe , seefeld , germany ) group ii : after adhesive application , the specimens were clamped in the ultradent bonding jig ( ultradent products ; south jordan , ut , usa ) , and a column of conventional hybrid composite resin tbf ( ivoclar , vivadent , ag ) with 2.0 mm in height and 2.38 mm in diameter was placed . two millimeters thickness and each layer were polymerized with 1000 mw / cm intensity led curing light for 20 s ( elipar s10 , 3 m espe , germany ) group iii : herculite xrv ultra ( kerr hawe , ca , usa ) universal nanohybrid dental composite was used . the procedures were the same as those in group i group iv : a high viscosity tbf bulk - fill viscosity ( ivoclar vivadent , usa ) was placed to the preparation about 4 mm thickness and polymerized with the same led curing light . the procedures were the same as those in group i. once prepared , the specimens were stored in an incubator at 37c in 100% humidity for 24 h before the sbs of the resin bond was tested using a universal testing machine ( esetron , ankara , turkey ) at a crosshead speed of 1 mm / min . the sbs of the composite resin to dentin was recorded in newtons and calculated in mpa , the cross - sectional area of the composite build - up was taken into account . two separate examiners observed the mode of failure in each specimen under a stereomicroscope ( nz.1902-p ; euromex , arnhem , netherlands ) at 20 magnification and failure modes were classified as either adhesive ( failure at the dentin / composite interface ) , cohesive ( failure within the resin composite or dentin ) , or mixed ( partial adhesive / partial cohesive fracture ) . the statistical evaluation was performed with spss software for windows ( version 20 , spss , chicago , illinois , usa ) . the sbs values were nonnormally distributed , as was shown by shapiro wilk test . therefore , nonparametric tests were performed for pairwise comparisons among groups ( kruskal wallis and mann whitney u tests ) . mean values and standard deviations of all groups are shown in table 2 and figure 1 . the highest mean sbs ( 14.42 4.34 mpa ) was recorded for herculite xrv ultra nanohybrid composite ( group iii ) bonded to dentin specimen , while the lowest mean sbs ( 11.16 2.76 ) was recorded for tbf bulk - fill composite ( group iv ) . this difference between group iii and iv found statistically significant ( p = 0.046 ) . although group iii showed higher bond strength than group i and group ii , this differences was not found statistically significant ( p values between group iii and i , group iii and ii mean sbs values of groups in this study bar graph show mean shear bond strength values of groups in this study between sf ( 12.19 5.48 ) and tbf ( 11.16 2.76 ) bulk - fill composites , the mean bond strength of sf was found higher than that of tbf ; however , no statistically significant differences were observed between two bulk - fill composites . although overall bulk - fill composites showed lower bond - strength when compared with conventional ones , a significant difference was only observed between group iii ( herculite xrv ultra ) and group iv ( tbf bulk - fill ) . furthermore , no significant difference was observed between two conventional composite herculite xrv ultra and tbf ( p = 0.272 ) . the group failure modes were evaluated and are shown in figure 2 . regarding mode of failure , adhesive mode of failure represented mostly observed in group iii ( herculite xrv ultra ) and group iv ( tbf bulk - fill ) , while mix fractures observed in group i ( sf ) and group ii ( tbf ) . furthermore , two samples from bulk - fill groups were evaluated under scanning electron microscopy to see the failing surfaces [ figure 3 ] . distribution according to the type of fracture of the groups scanning electron microscopy evaluation of dentin surfaces after shear testing in bulk - fill composite used groups : ( a ) 80 magnification of an adhesive failing mode in group iv ( tetric evoceram ) ( b ) 80 magnification of a mix failing mode in group i ( sonicfill ) the aim of this study was to investigate and compare the sbs of bulk - fill resin composites and conventional resin composites . the bulk - fill composites sf and tbf , although showed lower sbs values than the conventional composite , a significant difference was only observed between herculite and tbf . evaluated the cervical marginal and internal adaptation of posterior bulk - fill resin composites of different viscosities , before and after thermocycling . they found that sf was showed significantly better gap - free margins when compared tbf bulk - fill . the inferior adaptation to dentine observed in group iii tbf bulk - fill when compared with the other experimental groups could be attributed to the restricted flow of the material in the cavity . previous studies found that samples tested with bulk - fill resin composites demonstrate a better depth of cure than those treated with conventional resin composites . however , in this study , there was no significant difference found between the two bulk - fill systems , despite the fact that sf demonstrated higher sbs than tbf . thus , the second null hypothesis was accepted . a study by alrahlah et al . , also found that sf and tbf demonstrated similar depth of cure with no significant difference between them ( p > 0.05 ) . , sonic energy is applied through a special hand piece to increase the flowability and to further ease the packing of the composite . it was stated that the good depth of cure observed in the sf may be due to a refractive index matching between the resin and filler , which enhances light transmission . a reduction in the refractive index differences between resin and filler improves the degree of conversion , increases the depth of cure and increases color shade matching . the slightly higher bond strength that the sf exhibits in comparison to the tbf could be attributed to the properties of the sf . according to , the data collected in the present study , tbf bulk - fill exhibited similar sbs values as the other conventional resin composites . this finding is aligned with the outcomes of previous studies . in a study by benetti et al . , tbf bulk - fill exhibited a higher depth of cure than the conventional resin composite . furthermore , a higher depth of cure has been previously reported for bulk - fill resin composites , and the differences between the two materials have been attributed to improvements in their initiator system and increased translucency . in an alternative study , sf exhibited a depth of cure that was statistically similar to that of the conventional resin composite tbf . in addition , reported that the use of high viscosity bulk - fill resin composites with reduced polymerization contraction ( sf and tbf bulk - fill ) resulted in a similar gap formation as the conventional resin composite . this finding is partially in agreement with the results of the current study . in the present study , the tbf and tbf bulk - fill systems exhibited statistically similar sbs values as confirmed in different in vitro studies , bulk - fill rbcs might be cured in larger increments , as the degree of cure and the micromechanical properties can be maintained within 4-mm layers at an irradiation time of up to 20 s. thus , layering two consecutive 2-mm increments with tbf or one 4-mm increment with tbf bulk - fill could produce similar mechanical properties as conventional filling techniques . according to the tbf bulk - fill approach , the increased depth of cure was realized by adding a new initiator in addition to the camphoroquinone / amine initiator systems ; that is , ivocerin , as opposed to reducing the filler amount and increasing the filler size as per the process employed with the majority of bulk - fill materials . the efficiency of the initiator is confirmed by the increased depth of cure in tbf bulk - fill compared with its regular nanohybrid rbc pendant tbf because the chemical composition and the filler systems in both materials are comparable . orlowski et al . compared under in vitro conditions , marginal sealing of four different bulk - fill materials composite restorations of class ii . in addition , they also found that a higher marginal integrity and lower penetration of dye in fillings inserted using a sonic - activation condensing device were shown when compared with manual condensation . orlowski stated that statistically significant better marginal integrity of flowable tested materials , sf compared with tbf bulk - fill may be due to their flow consistency during application . peutzfeldt and asmussen showed that the degree of fluidity when applying the composite material influences the marginal adaptation ; increased fluidity of the composite makes it adhere better to the walls of the cavity . although this study has a number of limitations , the results do indicate that the application of bulk - fill composite results in acceptable sbs that is comparable to that achieved via conventional rbcs . as such , bulk - fill composites may represent reliable alternatives to conventional composites . this could be of potential benefit to dental technicians because bulk - fill composites are simpler than conventional composites and can be applied more efficiently . however , further studies are required in this area to better understand how the bond strengths of these adhesive systems behave under clinically acceptable conditions .

objectives : bulk - fill composite materials are being developed for preparation depths of up to 4 mm in an effort to simplify and improve the placement of direct composite posterior restorations . the aim of our study was to compare shear - bond strength of bulk - fill and conventional posterior composite resins.materials and methods : in this study , 60 caries free extracted human molars were used and sectioned parallel to occlusal surface to expose midcoronal dentin . the specimens were randomly divided into four groups . total - etch dentine bonding system ( adper scotchbond 1xt , 3 m espe ) was applied to dentin surface in all the groups to reduce variability in results . then , dentine surfaces covered by following materials . group i : sonicfill bulk - fill , group ii : tetric evoceram ( tbf ) , group iii : herculite xrv ultra , and group iv : tbf bulk - fill , 2 mm 3 mm cylindrical restorations were prepared by using application apparatus . shear bond testing was measured by using a universal testing machine . kruskal wallis and mann whitney u - tests were performed to evaluate the data.results:the highest value was observed in group iii ( 14.42 4.34 ) and the lowest value was observed in group iv ( 11.16 2.76 ) and there is a statistically significant difference between these groups ( p = 0.046 ) . however , there is no statistically significant difference between the values of other groups . in this study , group iii was showed higher strength values.conclusion:there is a need for future studies about long - term bond strength and clinical success of these adhesive and bulk - fill systems .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION Financial support and sponsorship Conflicts of interest

protein lysine methyltransferases ( pkmts , also known as histone lysine methyltransferases ( hkmts ) ) catalyze the transfer of the methyl group from the cofactor s - adenosyl - l - methionine ( sam ) to lysine residues of histone and non - histone substrates , leading to lysine mono- , di- , and/or trimethylation . histone lysine methylation has been increasingly recognized as a major epigenetic gene regulation mechanism in eukaryotic cells . therefore , pkmts as a class of potential drug targets have received considerable attention from the medicinal chemistry and chemical biology community . with the exception of dot1l , pkmts contain an evolutionarily conserved set ( su(var ) , e(z ) , and trithorax ) domain . this catalytic domain consists of a substrate binding groove and a cofactor binding site . a number of selective small - molecule inhibitors of pkmts including g9a / glp , ezh2 , smyd2 , dot1l , and setd2 have been discovered . these inhibitors are competitive with either the peptide substrate or the cofactor sam . in addition , a number of selective inhibitors of protein arginine methyltransferases ( prmts ) , another class of protein methyltransferases , have been reported . some of these inhibitors have subsequently been utilized as valuable tools for investigating the role of the corresponding methyltransferases in various human diseases . setd8 ( also known as set8 , pr - set7 , or kmt5a ( lysine methyltransferase 5a ) ) is the sole methyltransferase that catalyzes monomethylation of histone h4 lysine 20 ( h4k20 ) . setd8 and h4k20me ( h4k20 monomethylation ) have been implicated in regulating a diverse set of biological processes including the dna damage response , dna replication , and mitotic condensation . a recent study has shown that ( 1 ) setd8 is physically associated with twist , a master regulator of emt ( epithelial mesenchymal transition ) , ( 2 ) setd8 and twist are functionally interdependent on promoting emt , ( 3 ) setd8 acts on the promoters of the twist target genes such as n - cadherin via exertion of its h4k20 monomethylation activity , and ( 4 ) setd8 expression is positively correlated with metastasis and the expression of twist and n - cadherin in breast cancer cells . in addition to h4k20 , setd8 methylates many non - histone substrates including the tumor suppressor p53 and proliferating cell nuclear antigen ( pcna ) . the monomethylation of p53 at lysine 382 ( p53k382me1 ) catalyzed by setd8 suppresses p53-mediated transcription activation of highly responsive target genes . the monomethylation of pcna at lysine 248 ( pcnak248me1 ) catalyzed by setd8 stabilizes pcna protein , enhances the interaction between pcna and the flap endonuclease fen1 , and promotes the proliferation of cancer cells to date , nahuoic acid a , a marine natural product , is the only known selective inhibitor of setd8 ( figure 1 ) . this inhibitor is competitive with the cofactor sam and noncompetitive with the peptide substrate . here we report the discovery of unc0379 ( 1 ) , the first substrate - competitive inhibitor of setd8 . compound 1 is a synthetic small - molecule inhibitor that displays inhibitory activity in multiple biochemical assays and is selective for setd8 over 15 other methyltransferases . the binding affinity of compound 1 to setd8 was determined using biophysical assays such as itc ( isothermal titration calorimetry ) and spr ( surface plasmon resonance ) and is largely consistent with its potency in biochemical assays . we describe hit identification , analogue synthesis , structure activity relationship ( sar ) findings , and comprehensive characterization of compound 1 in a number of biochemical and biophysical assays including mechanism of action and selectivity studies . we previously reported that 2,4-diaminoquinazolines are selective , substrate - competitive inhibitors of the lysine methyltransferases g9a and glp . to identify a substrate - competitive inhibitor of setd8 , we cross - screened our quinazoline - based inhibitor set , which consists of > 150 compounds , against setd8 . from this study , we discovered compound 1 as an inhibitor of setd8 ( figure 2 ) . interestingly , compound 1 was originally prepared for targeting l3mbtl1 , a methyllysine reader protein , but showed no appreciable activity for l3mbtl1 . on the other hand , compound 1 displayed inhibitory activity with an ic50 of 7.3 1.0 m ( n = 2 ) in a radioactive biochemical assay that measures the transfer of the tritiated methyl group from h - sam to a peptide substrate catalyzed by setd8 ( figure 2 ) . the inhibitory activity of compound 1 was confirmed in an orthogonal biochemical assay , microfluidic capillary electrophoresis ( mce ) assay . this setd8 mce assay was developed analogously to the previously reported g9a mce assay . compound 1 was identified as an inhibitor of setd8 by cross - screening a quinazoline - based inhibitor set . ( a ) structure of compound 1 . ( b ) concentration response curve of compound 1 in the setd8 radioactive methyl transfer assay . to determine sar for this promising hit , we designed and synthesized a number of analogues that contain various 2- and 4-substituents at the quinazoline core . we synthesized compounds 124 from commercially available 2,4-dichloro-6,7-dimethoxyquinazoline and corresponding amines in good yields ( scheme 1 and tables 1 and 2 ) . using the methods developed previously , we displaced the 4-chloro group with the first set of amines at room temperature and the 2-chloro group with the second set of amines under microwave heating conditions to yield the desired 2,4-diamino-6,7-dimethoxyquinazolines . ( a ) r amines , thf , n , n - diisopropylethylamine , room temperature ; ( b ) r amines , n - buoh , dipea , microwave , 160 c . the synthesized compounds were then evaluated in the setd8 radioactive methyl transfer assay . ic50 values of these compounds in this biochemical assay are summarized in tables 1 and 2 . we first explored the 4-amino group of the quinazoline scaffold ( table 1 ) . reducing the length of the alkyl linker between the two amino groups resulted in the decrease of the potency ( compound 1 versus compounds 24 ) . the distal amino group can be changed from the pyrrolidinyl to piperidinyl or dimethylamino without any potency loss ( compound 1 versus compounds 5 and 6 ) . interestingly , the diethylamino analogue ( compound 7 ) was somewhat less potent than compounds 1 , 5 , and 6 . we also attempted to replace the piperidinyl group with a piperazinyl or n - substituted piperazinyl group ( compound 1 versus compounds 812 ) . however , these structural modifications led to a potency loss , suggesting that an additional basic amino group ( compounds 912 ) or a large substituent ( compound 8) is detrimental to inhibiting setd8 . in addition , we found that the basicity of the pyrrolidinyl group in compound 1 was an important contributor to its setd8 inhibitory activity , as the corresponding amide analogue ( compound 13 ) was about 8-fold less potent than compound 1 . we also explored whether the nh group in compound 1 was potentially engaged in a hydrogen bond interaction and found that the n - methyl analogue ( compound 14 ) was drastically less potent than compound 1 , suggesting that the hydrogen of the secondary amine likely serves as a hydrogen bond donor . we next explored the 2-amino group of the quinazoline scaffold ( table 2 ) . the replacement of the pyrrolidinyl group with either the piperidinyl or azepanyl group resulted in a significant loss of the potency ( compound 1 versus compounds 15 and 16 ) , suggesting a large group is disfavored . on the other hand , the dimethylamino group ( compound 17 ) did not lead to any significant potency loss . the introduction of an additional basic amino group ( compound 15 versus the unsubstituted piperazinyl analogue 18 and the n - methylpiperazinyl analogue 19 ) resulted in a complete loss of the potency . we also explored other amino groups such as n - methyl - n - cyclopentylamine ( compound 20 ) and n - methyl - n - cyclohexylamine ( compound 21 ) . compared with compound 1 , compounds interestingly , removing the methyl group from either compound 20 or 21 led to the complete loss of inhibitory activity ( compounds 22 and 23 ) , suggesting that tertiary amino groups are preferred compared with secondary amino groups . taken together , these results suggest that setd8 inhibitory activity is very sensitive to the 2-substituent . compound 1 bound setd8 with a kd of 18.3 3.2 m ( n = 3 ) ( figure 3 ) . in spr studies , compound 1 behaved as a classic reversible inhibitor with a fast on rate ( ka = 2.18 0.36 10 1/ms ) and a fast off rate ( kd = 7.82 0.87 10 1/s ) ( figure 4 ) . the kd of compound 1 was determined to be 36.0 2.3 m ( n = 3 ) . the binding affinity of compound 1 to setd8 determined by itc and spr is largely consistent with its potency in the biochemical assays . compound 1 binds setd8 with a kd of 18.3 3.2 m ( n = 3 ) in itc studies . we next studied the moa ( mechanism of action ) of the setd8 inhibition by compound 1 via varying concentrations of the h4 peptide substrate or the cofactor sam . as illustrated in figure 5a , ic50 values of compound 1 increased linearly with h4 peptide concentrations . on the other hand , ic50 values of compound 1 remained constant in the presence of increasing concentrations of sam ( figure 5b ) . these results indicate that compound 1 is competitive with the peptide substrate and noncompetitive with the cofactor sam . ( a ) compound 1 is competitive with the peptide substrate , as its ic50 values increased linearly with h4 peptide concentrations . ( b ) compound 1 is noncompetitive with the cofactor sam , as its ic50 values remained constant in the presence of increasing concentrations of sam . to confirm the findings from the moa studies , we tested compound 1 and an inactive control ( compound 14 ) in a peptide displacement assay using fluorescence polarization ( fp ) , which measures effects of inhibitors on displacing the h4k20me ( 124 ) peptide with n - terminus labeled by fluorescein isothiocyanate ( fitc ) . as illustrated in figure 6 , compound 1 effectively displaced the fitc - labeled peptide binding to setd8 with an ic50 of 37.7 7.2 m ( n = 2 ) . on the other hand , our negative control ( compound 14 ) did not displace the peptide in this fp assay . compound 1 effectively displaced the fitc - labeled h4k20me ( 114 ) peptide , while an inactive control ( compound 14 ) did not . we next determined the selectivity of inhibitor 1 for setd8 over 15 other methyltransferases ( figure 7 ) . with the exception of prc2 ( polycomb repressive complex 2 ) , the ic50 values of compound 1 for 14 other methyltransferases including g9a and glp were all above 100 m . for prc2 , compound 1 was active only at the two highest concentrations ( 50 and 100 m ) with an estimated ic50 value greater than 50 m . we discovered the first selective , substrate competitive inhibitor of setd8 by cross - screening our quinazoline - based epigenetic library . our sar studies of this series reveal that while the 4-amino moiety can be modified without a significant loss of potency , modifications to the 2-amino moiety are not well tolerated . we characterized compound 1 in a battery of biochemical , biophysical , moa , and selectivity assays and found that the setd8 inhibitory activity of this compound in biochemical assays was largely consistent with its binding affinity to setd8 determined by itc and spr . our moa studies indicate that this inhibitor is competitive with the peptide substrate and noncompetitive with the cofactor sam . this moa was further supported by our finding that compound 1 effectively displaced the fitc - labeled h4 peptide in a fp assay . importantly , this inhibitor is selective for setd8 over 15 other methyltransferases including g9a and glp , the two pkmts that are known for being potently inhibited by quinazolines . these results provide the first evidence that 2,4-diaminoquinazolines can be modified to yield selective , substrate competitive inhibitors of pkmts other than g9a and glp . hplc spectra for all compounds were acquired using an agilent 6110 series system with uv detector set to 254 nm . samples were injected ( 5 l ) onto an agilent eclipse plus 4.6 mm 50 mm , 1.8 m c18 column at room temperature . a linear gradient from 10% to 100% b ( meoh + 0.1% acetic acid ) in 5.0 min was followed by pumping 100% b for another 2 min with a being h2o + 0.1% acetic acid . mass spectra data were acquired in positive ion mode using an agilent 6110 single quadrupole mass spectrometer with an electrospray ionization ( esi ) source . nuclear magnetic resonance ( nmr ) spectra were recorded at varian mercury spectrometer with 400 mhz for proton ( h nmr ) and 100 mhz for carbon ( c nmr ) . preparative hplc was performed on agilent prep 1200 series with uv detector set to 254 nm . samples were injected onto a phenomenex luna 75 mm 30 mm , 5 m c18 column at room temperature . a linear gradient was used with 10% ( or 50% ) of meoh ( a ) in 0.1% tfa in h2o ( b ) to 100% of meoh ( a ) . high - resolution ( positive ion ) mass spectrometry ( hrms ) for compound 1 was performed using a thermo ltqft mass spectrometer under ft control at 100 000 resolution . to a solution of 2-chloro-6,7-dimethoxy - n-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine ( 24 , 84 mg , 0.17 mmol ) and n - butanol ( 1.5 ml ) were added pyrrolidine ( commercially available , 56 l , 0.68 mmol ) and n , n - diisopropylethylamine ( 89 l , 0.51 mmol ) . the resulting solution was stirred inside a microwave at 160 c for 30 min . after removal of the solvent by rotary evaporation , the residue was redissolved in ch2cl2 and washed with brine . the organic layer was dried , concentrated , and purified by hplc to give the title compound as a tfa salt , white solid ( 70 mg , yield 64% ) . h nmr ( 400 mhz , meoh - d4 ) 7.56 ( s , 1h ) , 7.10 ( s , 1h ) , 3.95 ( s , 3h ) , 3.92 ( s , 3h ) , 3.783.57 ( m , 8h ) , 3.223.16 ( m , 2h ) , 3.103.01 ( m , 2h ) , 2.191.97 ( m , 8h ) , 1.861.73 ( m , 4h ) , 1.551.47 ( m , 2h ) ; c nmr ( 100 mhz , meoh - d4 ) 160.40 , 157.17 , 151.52 , 148.80 , 136.95 , 105.04 , 103.62 , 99.62 , 56.93 , 56.79 , 56.11 , 55.08 ( four carbons ) , 42.48 , 29.31 , 26.87 , 25.20 , 23.95 ( four carbons ) . hrms calcd for c23h35n5o2 + h , 414.2869 ; found , 414.2862 [ m + h ] . 2-chloro-6,7-dimethoxy - n-(2-(pyrrolidin-1-yl)ethyl)quinazolin-4-amine was prepared according to the procedure for making 24 from 2,4-dichloro-6,7-dimethoxylquinazoline , 1-(2-aminoethyl)pyrrolidine ( commercially available ) , n , n - diisopropylethylamine , and thf . to a solution of 2-chloro-6,7-dimethoxy - n-(2-(pyrrolidin-1-yl)ethyl)quinazolin-4-amine ( 72 mg , 0.13 mmol ) and isopropanol ( 0.7 ml ) were added pyrrolidine ( 21 l , 0.26 mmol ) and hcl in dioxane ( 4.0 m , 63 l , 0.26 mmol ) . the resulting solution was stirred inside a microwave at 160 c for 20 min . after removal of the solvent by rotary evaporation , the residue was redissolved in ch2cl2 , washed with brine . the organic layer was dried , concentrated , and purified by hplc to give the title compound 2 as a tfa salt , white solid ( 56 mg , yield 73% ) . h nmr ( 400 mhz , meoh - d4 ) 7.50 ( s , 1h ) , 7.12 ( s , 1h ) , 4.06 ( t , j = 6.0 hz , 2h ) , 3.96 ( s , 3h ) , 3.92 ( s , 3h ) , 3.823.71 ( m , 4h ) , 3.683.56 ( m , 4h ) , 3.223.10 ( m , 2h ) , 2.221.99 ( m , 8h ) . 2-chloro-6,7-dimethoxy - n-(3-(pyrrolidin-1-yl)propyl)quinazolin-4-amine was prepared according to the procedure for making 24 from 2,4-dichloro-6,7-dimethoxylquinazoline , 1-(3-aminopropyl)pyrrolidine ( commercially available ) , n , n - diisopropylethylamine , and thf . compound 3 was prepared according to the procedure for making 2 from 2-chloro-6,7-dimethoxy - n-(3-(pyrrolidin-1-yl)propyl)quinazolin-4-amine ( 66 mg , 0.19 mmol ) , pyrrolidine ( 30 l , 0.37 mmol ) , hcl in dioxane ( 4.0 m , 93 l , 0.37 mmol ) , and isopropanol ( 1.0 ml ) . the title compound 3 was obtained as a tfa salt , brown solid ( 45 mg , yield 40% ) . h nmr ( 400 mhz , meoh - d4 ) 7.53 ( s , 1h ) , 7.10 ( s , 1h ) , 3.95 ( s , 3h ) , 3.91 ( s , 3h ) , 3.833.60 ( m , 8h ) , 3.353.28 ( m , 2h ) , 3.133.02 ( m , 2h ) , 2.252.00 ( m , 10h ) ; c nmr ( 100 mhz , meoh - d4 ) 160.68 , 157.34 , 151.49 , 148.83 , 137.08 , 105.03 , 103.57 , 99.57 , 56.91 , 56.82 , 55.11 ( four carbons ) , 53.95 , 39.75 , 26.51 , 23.96 ( four carbons ) . 2-chloro-6,7-dimethoxy - n-(4-(pyrrolidin-1-yl)butyl)quinazolin-4-amine was prepared according to the procedure for making 24 from 2,4-dichloro-6,7-dimethoxylquinazoline , 1-pyrrolidinebutanamine ( commercially available ) , n , n - diisopropylethylamine , and thf . compound 4 was prepared according to the procedure for making 1 from 2-chloro-6,7-dimethoxy - n-(4-(pyrrolidin-1-yl)butyl)quinazolin-4-amine ( 109 mg , 0.30 mmol ) , pyrrolidine ( 99 l , 1.2 mmol ) , n , n - diisopropylethylamine ( 105 l , 0.60 mmol ) , and n - butanol ( 1.0 ml ) . the title compound 4 was obtained as a tfa salt , white solid ( 144 mg , yield 77% ) . h nmr ( 400 mhz , meoh - d4 ) 7.54 ( s , 1h ) , 7.09 ( s , 1h ) , 3.94 ( s , 3h ) , 3.91 ( s , 3h ) , 3.793.54 ( m , 8h ) , 3.283.19 ( m , 2h ) , 3.123.01 ( m , 2h ) , 2.191.97 ( m , 8h ) , 1.891.79 ( m , 4h ) . hplc purity : > 95% ; tr = 3.02 min . ms ( esi ) : 400 [ m + h ] . 2-chloro-6,7-dimethoxy - n-(5-(piperidin-1-yl)pentyl)quinazolin-4-amine was prepared according to the procedure for making 24 from 2,4-dichloro-6,7-dimethoxylquinazoline , 1-piperidinepentanamine ( commercially available ) , n , n - diisopropylethylamine , and thf . compound 5 was prepared according to the procedure for making 2 from 2-chloro-6,7-dimethoxy - n-(5-(piperidin-1-yl)pentyl)quinazolin-4-amine ( 79 mg , 0.13 mmol ) , pyrrolidine ( 21 l , 0.26 mmol ) , hcl in dioxane ( 4.0 m , 63 l , 0.26 mmol ) , and isopropanol ( 0.7 ml ) . the title compound 5 was obtained as a tfa salt , brown solid ( 58 mg , yield 68% ) . h nmr ( 400 mhz , meoh - d4 ) 7.55 ( s , 1h ) , 7.09 ( s , 1h ) , 3.95 ( s , 3h ) , 3.91 ( s , 3h ) , 3.793.57 ( m , 6h ) , 3.563.47 ( m , 2h ) , 3.123.05 ( m , 2h ) , 2.90 ( td , j = 12.5 , 2.7 hz , 2h ) , 2.222.01 ( m , 4h ) , 1.971.89 ( m , 2h ) , 1.881.70 ( m , 7h ) , 1.581.43 ( m , 3h ) ; c nmr ( 100 mhz , meoh - d4 ) 160.40 , 157.17 , 151.53 , 148.81 , 136.96 , 105.05 , 103.62 , 99.62 , 58.12 , 56.93 , 56.79 , 54.27 ( four carbons ) , 42.50 , 29.32 , 25.29 , 24.92 , 24.24 ( four carbons ) , 22.72 . n-(2-chloro-6,7-dimethoxyquinazolin-4-yl)-n , n - dimethylpentane-1,5-diamine was prepared according to the procedure for making 24 from 2,4-dichloro-6,7-dimethoxylquinazoline , 5-(dimethylamino)amylamine ( commercially available ) , n , compound 6 was prepared according to the procedure for making 2 from n-(2-chloro-6,7-dimethoxyquinazolin-4-yl)-n , n - dimethylpentane-1,5-diamine ( 70 mg , 0.15 mmol ) , pyrrolidine ( 21 l , 0.30 mmol ) , hcl in dioxane ( 4.0 m , 75 l , 0.30 mmol ) , and isopropanol ( 1.0 ml ) . the title compound 6 was obtained as a tfa salt , white solid ( 57 mg , yield 62% ) . h nmr ( 400 mhz , meoh - d4 ) 7.55 ( s , 1h ) , 7.09 ( s , 1h ) , 3.95 ( s , 3h ) , 3.91 ( s , 3h ) , 3.783.54 ( m , 6h ) , 3.163.09 ( m , 2h ) , 2.87 ( s , 6h ) , 2.221.98 ( m , 4h ) , 1.891.72 ( m , 4h ) , 1.581.39 ( m , 2h ) ; c nmr ( 100 mhz , meoh - d4 ) 160.41 , 157.19 , 151.53 , 148.82 , 136.96 , 105.05 , 103.62 , 99.62 , 58.87 , 56.93 , 56.79 , 43.37 ( four carbons ) , 42.48 , 29.32 ( two carbons ) , 25.47 ( two carbons ) , 25.06 . n-(2-chloro-6,7-dimethoxyquinazolin-4-yl)-n , n - diethylpentane-1,5-diamine was prepared according to the procedure for making 24 from 2,4-dichloro-6,7-dimethoxylquinazoline , 5-(diethylamino)pentylamine ( commercially available ) , n , n - diisopropylethylamine , and thf . compound 7 was prepared according to the procedure for making 1 from n-(2-chloro-6,7-dimethoxyquinazolin-4-yl)-n , n - diethylpentane-1,5-diamine ( 62 mg , 0.16 mmol ) , pyrrolidine ( 54 l , 0.64 mmol ) , n , n - diisopropylethylamine ( 113 l , 0.64 mmol ) , and n - butanol ( 0.2 ml ) . the title compound 7 was obtained as a tfa salt , amber solid ( 79 mg , yield 76% ) . h nmr ( 400 mhz , meoh - d4 ) 7.53 ( s , 1h ) , 7.07 ( s , 1h ) , 3.93 ( s , 3h ) , 3.90 ( s , 3h ) , 3.773.54 ( m , 6h ) , 3.22 ( q , j = 7.4 hz , 4h ) , 3.163.09 ( m , 2h ) , 2.212.01 ( m , 4h ) , 1.871.72 ( m , 4h ) , 1.571.45 ( m , 2h ) , 1.30 ( t , j = 7.3 hz , 6h ) . tert - butyl 4-(5-((2-chloro-6,7-dimethoxyquinazolin-4-yl)amino)pentyl)piperazine-1-carboxylate was prepared according to the procedure for making 24 from 2,4-dichloro-6,7-dimethoxylquinazoline , tert - butyl 4-(5-aminopentyl)piperazine-1-carboxylate ( commercially available ) , n , n - diisopropylethylamine , and thf . compound 8 was prepared according to the procedure for making 1 from tert - butyl 4-(5-((2-chloro-6,7-dimethoxyquinazolin-4-yl)amino)pentyl)piperazine-1-carboxylate ( 200 mg , 0.40 mmol ) , pyrrolidine ( 135 l , 1.6 mmol ) , n , n - diisopropylethylamine ( 280 l , 1.6 mmol ) , and n - butanol ( 0.5 ml ) . the title compound 8 was obtained as a tfa salt , yellow solid ( 180 mg , yield 60% ) . h nmr ( 400 mhz , meoh - d4 ) 7.54 ( s , 1h ) , 7.09 ( s , 1h ) , 4.334.08 ( m , 2h ) , 3.95 ( s , 3h ) , 3.91 ( s , 3h ) , 3.773.50 ( m , 8h ) , 3.293.12 ( m , 4h ) , 3.102.90 ( m , 2h ) , 2.212.01 ( m , 4h ) , 1.871.77 ( m , 4h ) , 1.551.49 ( m , 2h ) , 1.47 ( s , 9h ) . to the solution of tert - butyl 4-(5-((6,7-dimethoxy-2-(pyrrolidin-1-yl)quinazolin-4-yl)amino)pentyl)piperazine-1-carboxylate ( 8) in meoh and thf was added tfa at room temperature and stirred overnight at 50 c . after removal of the solvent by rotary evaporation , the residue was purified by hplc to give 14 mg of the title compound 9 as a tfa salt , white solid ( 14 mg , yield 80% ) . h nmr ( 400 mhz , meoh - d4 ) 7.56 ( s , 1h ) , 7.11 ( s , 1h ) , 3.96 ( s , 3h ) , 3.92 ( s , 3h ) , 3.823.49 ( m , 14h ) , 3.233.17 ( m , 2h ) , 2.212.02 ( m , 4h ) , 1.871.78 ( m , 4h ) , 1.561.47 ( m , 2h ) . ms ( esi ) : 429 [ m + h ] . to the solution of 6,7-dimethoxy - n-(5-(piperazin-1-yl)pentyl)-2-(pyrrolidin-1-yl)quinazolin-4-amine ( 9 , 80 mg , 0.12 mmol ) in meoh ( 1.0 ml ) were added formaldehyde ( commercially available , 39 l , 1.4 mmol ) , acetic acid ( 80 l , 1.4 mmol ) , and sodium cyanoborohydride ( 44 mg , 0.7 mmol ) at 0 c . after removal of the solvent by rotary evaporation , the residue was purified by hplc to give the title compound 10 as a tfa salt , gray solid ( 25 mg , yield 31% ) . h nmr ( 400 mhz , meoh - d4 ) 7.56 ( s , 1h ) , 7.10 ( s , 1h ) , 3.96 ( s , 3h ) , 3.92 ( s , 3h ) , 3.813.53 ( m , 14h ) , 3.263.19 ( m , 2h ) , 2.97 ( s , 3h ) , 2.222.02 ( m , 4h ) , 1.881.77 ( m , 4h ) , 1.561.46 ( m , 2h ) . compound 11 was prepared according to the procedure for making 10 from 6,7-dimethoxy - n-(5-(piperazin-1-yl)pentyl)-2-(pyrrolidin-1-yl)quinazolin-4-amine ( 9 , 80 mg , 0.12 mmol ) , acetaldehyde ( commercially available , 56 l , 1.4 mmol ) , acetic acid ( 80 l , 1.4 mmol ) and sodium cyanoborohydride ( 44 mg , 0.7 mmol ) and meoh ( 1.0 ml ) . the title compound 11 was obtained as a tfa salt , gray solid ( 74 mg , yield 90% ) . h nmr ( 400 mhz , meoh - d4 ) 7.55 ( s , 1h ) , 7.10 ( s , 1h ) , 3.95 ( s , 3h ) , 3.92 ( s , 3h ) , 3.813.55 ( m , 14h ) , 3.353.26 ( m , 2h ) , 3.263.20 ( m , 2h ) , 2.182.02 ( m , 4h ) , 1.881.78 ( m , 4h ) , 1.561.48 ( m , 2h ) , 1.37 ( t , j = 7.3 hz , 3h ) . compound 12 was prepared according to the procedure for making 10 from 6,7-dimethoxy - n-(5-(piperazin-1-yl)pentyl)-2-(pyrrolidin-1-yl)quinazolin-4-amine ( 9 , 80 mg , 0.12 mmol ) , acetone ( commercially available , 103 l , 1.4 mmol ) , acetic acid ( 80 l , 1.4 mmol ) and sodium cyanoborohydride ( 44 mg , 0.7 mmol ) and meoh ( 1.0 ml ) . the title compound 12 was obtained as a tfa salt , brown solid ( 61 mg , yield 73% ) . h nmr ( 400 mhz , meoh - d4 ) 7.56 ( s , 1h ) , 7.10 ( s , 1h ) , 3.96 ( s , 3h ) , 3.92 ( s , 3h ) , 3.823.48 ( m , 15h ) , 3.243.18 ( m , 2h ) , 2.202.03 ( m , 4h ) , 1.881.78 ( m , 4h ) , 1.561.47 ( m , 2h ) , 1.40 ( s , 3h ) , 1.38 ( s , 3h ) . 5-((tert - butoxycarbonyl)amino)pentanoic acid ( commercially available , 0.93 g , 4.3 mmol ) and pyrrolidine ( 238 l , 2.9 mmol ) were dissolved in 23 ml of dmf . to this solution were added n , n - diisopropylethylamine ( 2.5 ml , 14.5 mmol ) and hatu ( 2.18 g , 5.8 mmol ) . the resulting solution was stirred at 50 c for 3 h. after the mixture was cooled , tlc indicated the completion of the reaction . after removal of the solvent by rotary evaporation , the residue was redissolved in ch2cl2 , washed with brine . the organic layer was dried , concentrated , and purified by isco to give tert - butyl ( 5-oxo-5-(pyrrolidin-1-yl)pentyl)carbamate . to the solution of tert - butyl ( 5-oxo-5-(pyrrolidin-1-yl)pentyl)carbamate in meoh and thf after removal of the solvent by rotary evaporation , the product 5-amino-1-(pyrrolidin-1-yl)pentan-1-one obtained was used for the next step without further purification . 5-((2-chloro-6,7-dimethoxyquinazolin-4-yl)amino)-1-(pyrrolidin-1-yl)pentan-1-one was prepared according to the procedure for making 24 from 2,4-dichloro-6,7-dimethoxylquinazoline , 5-amino-1-(pyrrolidin-1-yl)pentan-1-one , n , n - diisopropylethylamine , and thf . compound 13 was prepared according to the procedure for making 1 from 5-((2-chloro-6,7-dimethoxyquinazolin-4-yl)amino)-1-(pyrrolidin-1-yl)pentan-1-one ( 87 mg , 0.22 mmol ) , pyrrolidine ( 74 l , 0.88 mmol ) , n , n - diisopropylethylamine ( 154 l , 0.88 mmol ) , and n - butanol ( 0.25 ml ) . the title compound 13 was obtained as a tfa salt , brown solid ( 16 mg , yield 13% ) . h nmr ( 400 mhz , meoh - d4 ) 7.57 ( s , 1h ) , 7.09 ( s , 1h ) , 3.96 ( s , 3h ) , 3.93 ( s , 3h ) , 3.803.59 ( m , 6h ) , 3.48 ( t , j = 6.8 hz , 2h ) , 3.40 ( t , j = 6.9 hz , 2h ) , 2.41 ( t , j = 7.0 hz , 2h ) , 2.202.03 ( m , 4h ) , 2.011.93 ( m , 2h ) , 1.911.84 ( m , 2h ) , 1.831.71 ( m , 4h ) . 2-chloro-6,7-dimethoxy - n - methyl - n-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine was prepared according to the procedure for making 24 from 2,4-dichloro-6,7-dimethoxylquinazoline , n - methyl-5-(pyrrolidin-1-yl)pentan-1-amine ( synthesized according to the precedures preported previously),n , n - diisopropylethylamine , and thf . compound 14 was prepared according to the procedure for making 2 from 2-chloro-6,7-dimethoxy - n - methyl - n-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine ( 50 mg , 0.13 mmol ) , pyrrolidine ( 21 l , 0.26 mmol ) , hcl in dioxane ( 4.0 m , 65 l , 0.26 mmol ) , and isopropanol ( 0.7 ml ) . the title compound 14 was obtained as a tfa salt , white solid ( 25 mg , yield 30% ) . h nmr ( 400 mhz , meoh - d4 ) 7.47 ( s , 1h ) , 7.17 ( s , 1h ) , 3.97 ( s , 3h ) , 3.91 ( s , 3h ) , 3.903.85 ( m , 2h ) , 3.753.60 ( m , 6h ) , 3.57 ( s , 3h ) , 3.243.17 ( m , 2h ) , 3.113.01 ( m , 2h ) , 2.222.06 ( m , 6h ) , 2.051.97 ( m , 2h ) , 1.961.87 ( m , 2h ) , 1.861.77 ( m , 2h ) , 1.551.45 ( m , 2h ) ; c nmr ( 100 mhz , meoh - d4 ) 162.30 , 157.06 , 150.22 , 147.38 , 139.69 , 109.50 , 104.02 , 99.83 , 56.97 , 56.79 , 56.04 ( two carbons ) , 55.09 ( two carbons ) , 54.45 ( two carbons ) , 41.10 , 27.43 , 26.91 ( two carbons ) , 25.08 ( two carbons ) , 23.97 ( two carbons ) . compound 15 was prepared according to the procedure for making 2 from 2-chloro-6,7-dimethoxy - n-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine ( 24 , 70 mg , 0.19 mmol ) , piperidine ( commercially available , 37 l , 0.38 mmol ) , hcl in dioxane ( 4.0 m , 95 l , 0.38 mmol ) , and isopropanol ( 1.0 ml ) . the title compound 15 was obtained as a tfa salt , light yellow solid ( 101 mg , yield 83% ) . h nmr ( 400 mhz , meoh - d4 ) 7.54 ( s , 1h ) , 7.09 ( s , 1h ) , 3.94 ( s , 3h ) , 3.91 ( s , 3h ) , 3.883.82 ( m , 4h ) , 3.693.61 ( m , 4h ) , 3.223.16 ( m , 2h ) , 3.103.01 ( m , 2h ) , 2.202.08 ( m , 2h ) , 2.071.96 ( m , 2h ) , 1.851.69 ( m , 10h ) , 1.551.46 ( m , 2h ) ; c nmr ( 100 mhz , meoh - d4 ) 160.55 , 157.21 , 152.43 , 149.01 , 137.00 , 104.87 , 103.58 , 99.79 , 56.90 , 56.81 , 56.08 , 55.06 ( two carbons ) , 47.16 ( two carbons ) , 42.56 , 29.29 , 26.87 , 26.69 ( two carbons ) , 25.19 , 25.13 , 23.95 ( two carbons ) . compound 16 was prepared according to the procedure for making 2 from 2-chloro-6,7-dimethoxy - n-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine ( 24 , 70 mg , 0.19 mmol ) , hexamethyleneimine ( commercially available , 42 l , 0.38 mmol ) , hcl in dioxane ( 4.0 m , 95 l , 0.38 mmol ) , and isopropanol ( 1.0 ml ) . the title compound 16 was obtained as a tfa salt , light yellow solid ( 35 mg , yield 28% ) . h nmr ( 400 mhz , meoh - d4 ) 7.56 ( s , 1h ) , 7.18 ( s , 1h ) , 3.95 ( s , 3h ) , 3.92 ( s , 3h ) , 3.903.70 ( m , 4h ) , 3.703.61 ( m , 4h ) , 3.223.16 ( m , 2h ) , 3.103.01 ( m , 2h ) , 2.192.08 ( m , 2h ) , 2.071.97 ( m , 2h ) , 1.951.86 ( m , 4h ) , 1.851.75 ( m , 4h ) , 1.691.61 ( m , 4h ) , 1.561.47 ( m , 2h ) ; c nmr ( 100 mhz , meoh - d4 ) 160.40 , 157.23 , 152.91 , 148.99 , 137.10 , 104.89 , 103.68 , 99.85 , 56.91 , 56.80 , 56.10 , 55.09 ( two carbons ) , 49.16 ( two carbons ) , 42.59 , 29.47 , 28.58 ( three carbons ) , 27.85 , 26.91 , 25.23 , 23.95 ( two carbons ) . ms ( esi ) : 442 [ m + h ] . to a solution of pd(oac)2 ( 2 mg , 0.01 mmol ) , ( + ) -binap ( 6 mg , 0.01 mmol ) , and thf ( 0.5 ml ) were added 2-chloro-6,7-dimethoxy - n-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine ( 24 , 46 mg , 0.10 mmol ) , dimethylamine hydrochloride ( commercially available , 10 mg , 0.12 mmol ) , and cs2co3 ( 73 mg , 0.24 mmol ) . the resulting solution was stirred inside a microwave at 140 c for 30 min . after removal of the solvent by rotary evaporation , the residue was redissolved in ch2cl2 , washed with brine . the organic layer was dried , concentrated , and purified by hplc to give 7.0 mg of the title compound 17 as a tfa salt , white solid ( yield 13% ) . h nmr ( 400 mhz , meoh - d4 ) 7.57 ( s , 1h ) , 7.15 ( s , 1h ) , 3.97 ( s , 3h ) , 3.92 ( s , 3h ) , 3.71 ( t , j = 7.1 hz , 2h ) , 3.683.60 ( m , 2h ) , 3.31 ( s , 6h ) , 3.233.16 ( m , 2h ) , 3.103.01 ( m , 2h ) , 2.212.09 ( m , 2h ) , 2.071.96 ( m , 2h ) , 1.871.75 ( m , 4h ) , 1.561.48 ( m , 2h ) ; c nmr ( 100 mhz , meoh - d4 ) 160.39 , 157.35 , 153.70 , 149.10 , 137.07 , 104.92 , 103.55 , 99.79 , 56.93 , 56.82 , 56.13 , 55.14 ( two carbons ) , 42.57 ( two carbons ) , 37.96 , 29.36 , 26.92 , 25.23 , 23.96 ( two carbons ) . boc - protected compound 18 was prepared according to the procedure for making 1 from 2-chloro-6,7-dimethoxy - n-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine ( 24 , 56 mg , 0.11 mmol ) , 1-boc - piperazine ( commercially available , 82 mg , 0.44 mmol ) , n , n - diisopropylethylamine ( 57 l , 0.33 mmol ) , and n - butanol ( 0.7 ml ) . to the resulting mixture after removal of the solvent by rotary evaporation , the residue was purified by hplc to give 40 mg of the title compound 18 as a tfa salt , white solid ( yield 55% , two steps ) . h nmr ( 400 mhz , meoh - d4 ) 7.62 ( s , 1h ) , 7.16 ( s , 1h ) , 4.224.14 ( m , 4h ) , 3.96 ( s , 3h ) , 3.93 ( s , 3h ) , 3.71 ( t , j = 7.0 hz , 2h ) , 3.693.61 ( m , 2h ) , 3.483.38 ( m , 4h ) , 3.233.16 ( m , 2h ) , 3.113.01 ( m , 2h ) , 2.202.09 ( m , 2h ) , 2.071.96 ( m , 2h ) , 1.861.73 ( m , 4h ) , 1.571.48 ( m , 2h ) . compound 19 was prepared according to the procedure for making 1 from 2-chloro-6,7-dimethoxy - n-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine ( 24 , 56 mg , 0.11 mmol ) , 1-methylpiperazine ( commercially available , 49 l , 0.44 mmol ) , n , n - diisopropylethylamine ( 57 l , 0.33 mmol ) , and n - butanol ( 0.7 ml ) . the title compound 19 was obtained as a tfa salt , gray solid ( 54 mg , yield 73% ) . h nmr ( 400 mhz , meoh - d4 ) 7.62 ( s , 1h ) , 7.16 ( s , 1h ) , 3.96 ( s , 3h ) , 3.93 ( s , 3h ) , 3.903.24 ( m , 12h ) , 3.223.16 ( m , 2h ) , 3.103.02 ( m , 2h ) , 2.99 ( s , 3h ) , 2.192.10 ( m , 2h ) , 2.071.96 ( m , 2h ) , 1.861.75 ( m , 4h ) , 1.561.47 ( m , 2h ) . compound 20 was prepared according to the procedure for making 1 from 2-chloro-6,7-dimethoxy - n-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine ( 24 , 56 mg , 0.11 mmol ) , n - methylcyclopentanamine ( commercially available , 44 mg , 0.44 mmol ) , n , n - diisopropylethylamine ( 57 l , 0.33 mmol ) , and n - butanol ( 0.7 ml ) . the title compound 20 was obtained as a tfa salt , yellow solid ( 40 mg , yield 54% ) . h nmr ( 400 mhz , meoh - d4 ) 7.57 ( s , 1h ) , 7.18 ( s , 1h ) , 5.155.01 ( m , 1h ) , 3.96 ( s , 3h ) , 3.92 ( s , 3h ) , 3.723.61 ( m , 4h ) , 3.233.16 ( m , 2h ) , 3.14 ( s , 3h ) , 3.103.01 ( m , 2h ) , 2.192.10 ( m , 2h ) , 2.051.93 ( m , 4h ) , 1.891.68 ( m , 10h ) , 1.561.47 ( m , 2h ) ; c nmr ( 100 mhz , meoh - d4 ) 160.35 , 157.29 , 153.54 , 149.07 , 137.09 , 104.90 , 103.75 , 99.90 , 58.92 , 56.92 , 56.80 , 56.10 , 55.10 ( three carbons ) , 42.62 , 30.41 , 29.65 ( two carbons ) , 29.39 , 26.93 , 25.28 , 25.25 , 23.95 ( two carbons ) . compound 21 was prepared according to the procedure for making 1 from 2-chloro-6,7-dimethoxy - n-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine ( 24 , 56 mg , 0.11 mmol ) , n - methylcyclohexylamine ( commercially available , 44 mg , 0.44 mmol ) , n , n - diisopropylethylamine ( 57 l , 0.33 mmol ) , and n - butanol ( 0.7 ml ) . the title compound 21 was obtained as a tfa salt , brown solid ( 47 mg , yield 62% ) . h nmr ( 400 mhz , meoh - d4 ) 7.56 ( s , 1h ) , 7.18 ( s , 1h ) , 4.654.49 ( m , 1h ) , 3.95 ( s , 3h ) , 3.92 ( s , 3h ) , 3.713.61 ( m , 4h ) , 3.233.16 ( m , 2h ) , 3.14 ( s , 3h ) , 3.103.01 ( m , 2h ) , 2.212.08 ( m , 2h ) , 2.071.98 ( m , 2h ) , 1.971.90 ( m , 2h ) , 1.861.75 ( m , 6h ) , 1.711.60 ( m , 2h ) , 1.561.42 ( m , 4h ) , 1.401.17 ( m , 2h ) ; c nmr ( 100 mhz , meoh - d4 ) 160.35 , 157.24 , 153.14 , 149.04 , 137.14 , 104.89 , 103.79 , 99.93 , 57.59 , 56.91 , 56.80 , 56.08 , 55.09 ( three carbons ) , 42.68 , 30.85 ( two carbons ) , 30.09 , 29.40 , 26.93 ( two carbons ) , 26.38 , 25.34 , 23.95 ( two carbons ) . compound 22 was prepared according to the procedure for making 1 from 2-chloro-6,7-dimethoxy - n-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine ( 24 , 56 mg , 0.11 mmol ) , cyclopentylamine ( commercially available , 44 l , 0.44 mmol ) , n , n - diisopropylethylamine ( 57 l , 0.33 mmol ) , and n - butanol ( 0.7 ml ) . the title compound 22 was obtained as a tfa salt , light yellow solid ( 41 mg , yield 57% ) . h nmr ( 400 mhz , meoh - d4 ) 7.52 ( s , 1h ) , 6.95 ( s , 1h ) , 4.414.28 ( m , 1h ) , 3.95 ( s , 3h ) , 3.90 ( s , 3h ) , 3.733.60 ( m , 4h ) , 3.233.16 ( m , 2h ) , 3.102.99 ( m , 2h ) , 2.201.98 ( m , 6h ) , 1.881.75 ( m , 6h ) , 1.731.60 ( m , 4h ) , 1.561.46 ( m , 2h ) . compound 23 was prepared according to the procedure for making 1 from 2-chloro-6,7-dimethoxy - n-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine ( 24 , 56 mg , 0.11 mmol ) , n - cyclohexylamine ( commercially available , 50 l , 0.44 mmol ) , n , n - diisopropylethylamine ( 57 l , 0.33 mmol ) , and n - butanol ( 0.7 ml ) . the title compound 23 was obtained as a tfa salt , brown semisolid ( 45 mg , yield 61% ) . h nmr ( 400 mhz , meoh - d4 ) 7.50 ( s , 1h ) , 6.91 ( s , 1h ) , 4.003.85 ( m , 1h ) , 3.94 ( s , 3h ) , 3.89 ( s , 3h ) , 3.703.61 ( m , 4h ) , 3.233.15 ( m , 2h ) , 3.103.01 ( m , 2h ) , 2.192.10 ( m , 2h ) , 2.061.99 ( m , 3h ) , 1.881.75 ( m , 7h ) , 1.541.28 ( m , 8h ) . to the solution of 2,4-dichloro-6,7-dimethoxyquinazoline ( commercially available , 1.00 g , 3.86 mmol ) in thf ( 9.5 ml ) was added 5-(pyrrolidin-1-yl)pentan-1-amine ( commercially available , 1.33 g , 8.49 mmol ) , followed by the addition of n , n - diisopropylethylamine ( 612 l , 3.51 mmol ) . and the resulting mixture was stirred at room temperature for 6 h until tlc showed that the starting material had disappeared . water was added to the reaction mixture , and the resulting solution was extracted with ethyl acetate . the organic layer was washed with brine , dried , and concentrated to give the crude product , which was purified on isco using 24 g silica gel column , eluting with hexane ethyl acetate to give 754 mg of the title compound 24 as a yellow semisolid ( yield 52% ) . h nmr ( 400 mhz , meoh - d4 ) 7.61 ( s , 1h ) , 6.99 ( s , 1h ) , 3.98 ( s , 3h ) , 3.96 ( s , 3h ) , 3.73 ( t , j = 7.2 hz , 2h ) , 3.693.61 ( m , 2h ) , 3.243.16 ( m , 2h ) , 3.113.01 ( m , 2h ) , 2.202.09 ( m , 2h ) , 2.071.96 ( m , 2h ) , 1.871.76 ( m , 4h ) , 1.571.47 ( m , 2h ) ; c nmr ( 100 mhz , meoh - d4 ) 161.38 , 157.90 , 152.68 , 151.65 , 141.15 , 107.16 , 103.64 , 102.16 , 57.02 , 56.99 , 56.08 , 55.12 ( two carbons ) , 42.73 , 29.27 , 26.64 , 24.82 , 23.95 ( two carbons ) . radioactive assay was developed to screen our chemical library for small molecule inhibitors . methylation ( 10 l ) reactions were carried out in a buffer containing 50 mm tris - hcl ( ph 8.0 ) , 10 mm gsh , 0.1%triton x-100 , at room temperature using 50 nm setd8 , 1.5 m tritium labeled sam ( catalog no . net155v250uc , perkinelmer ) , and 5 m biotinylated h4 ( 124 ) peptide substrate ( sgrgkggkglgkggakrhrkvlrdk - biotin ) in 384-well plates in the presence of 50 m compounds . the reactions were then quenched by addition of equal volume of 7.5 m guanidine hydrochloride after a 1 h incubation . then 40 l of buffer ( 20 mm tris - hcl , ph 8.0 ) was added into the quenched samples , and all samples were then transferred into a streptavidin / scintillant - coated microplate ( catalog no . the amount of methylated peptide was quantified by tracing the radioactivity ( counts per minute ) as measured after 1 h using a topcount plate reader ( perkinelmer ) . for ic50 values determination , the compounds were serially diluted 2-fold in dmso for a total of 11 concentrations , beginning at 0.25 mm and tested in the same condition . inhibition of setd8 methyltransferase activity was analyzed by monitoring decrease in methylation of the fluorescein labeled peptide , tw21 ( nh2-lgkggakrhrkvlrdniqgitk(5fam)-oh ) , essentially as described previously . the test compounds were solubilized in 100% dmso to 10 mm and then plated in greiner 384-well polypropylene plates using 3-fold dilution scheme over 10 points spanning the concentration range from 3 mm to 0.15 m using tecan genesis liquid handler . then 1 l of the serial dilution was transferred into compound dilution plate using nanoscreen multimek liquid handling robot . prior to performing the assay the compounds were diluted 10-fold in 1 assay buffer ( 20 mm tris , ph 8.0 , 25 mm nacl , 2 mm dtt , and 0.05% tween-20 ) , and an amount of 2.5 l of the resulting dilution was transferred into assay plate by nanoscreen multimek liquid handling robot . to this plate 20 l of 50 nm setd8 and 2 m tw21 peptide cocktail in 1 assay buffer were added using multidrop liquid dispenser . following a 10 min incubation of the compounds with the enzyme / peptide mix , the reaction was initiated by adding 2.5 l of 150 m sam in 1 buffer . for 100% inhibition controls 1 the reaction was allowed to proceed at room temperature for 120 min , and then the reaction was terminated by adding 35 l of 0.08 ng/l endo - lysc protease solution . following an additional 1 h incubation the plate was read on a caliper life sciences ez reader ii using upstream voltage 500 v , downstream voltage 1800 v , and pressure of 1.5 psi . all itc measurements were performed at 25 c using an autoitc200 microcalorimeter ( microcal / ge healthcare ) . the calorimeter cell ( volume 200 l ) was loaded with setd8 protein in the full salt dialysis buffer ( 150 mm nacl ) at a concentration of 100 m . the syringe was loaded with compound 1 ( dissolved in the same buffer ) at a concentration of 1 mm . a typical injection protocol included a single 0.2 l first injection followed by 26 1.5 l injections of the compound into the calorimeter cell . the spacing between injections was kept at 180 s and the reference power at 8 cal / s . a control experiment was performed by titrating compound 1 into buffer under identical settings to determine the heat signals that arose from compound dilution ; these were subtracted from the heat signals of protein the data were analyzed using origin for itc , version 7.0 , software supplied by the manufacturer and fitted well to a one - site binding model . the interaction between compound 1 and protein setd8 was further explored using a proteon xpr36 biosensor ( bio - rad laboratories , inc . ) at 25 c . pbs buffer ( phosphate buffered saline , ph 7.4 ) supplemented with 0.005% tween-20 was used as the running buffer . a glh ( catalog no . sensor chip was first activated by flowing a mixture of 20 mm sulfo - nhs and 20 mm edc over the chip surface for 5 min at a flow rate of 30 l / min . setd8 was then diluted to 20 and 10 g / ml in 5 mm naoac , ph 5.0 , and immobilized onto two ligand channels ( 30 l / min for 2 min ) . the surface was then deactivated by flowing 1 m ethanolamine for 5 min at a flow rate 60 l / min . a blank injection of the running buffer was made , after which four concentrations of the compound in the running buffer ( 100 , 33.3 , 11.1 , and 3.7 m ) and a running buffer were injected simultaneously at a flow rate of 50 l / min for 60 s. the sensorgrams obtained at the four concentrations of the compound were fit simultaneously after subtracting a ligand reference ( inner spot ) and a double compound reference ( buffer ) using a langmuir model to obtain on ( ka ) and off ( kd ) rates . the kinetic kd was calculated based on the on and off rates for three replicates . ic50 values were determined for compound 1 at varying concentrations of sam , 50 nm setd8 , 200 m peptide h4 ( 124 ) or at varying concentrations of substrate h4 ( 124 ) peptide , 50 nm of setd8 , 250 m sam . the reaction mixtures were incubated 15 min at 23 c . to stop the enzymatic reactions , an equal volume of 7.5 m guanidine hydrochloride then 10 l of mixture was spotted onto a square of sam biotin capture membrane ( catalog no . v2861 , promega ) , allowed absorption for 5 min at room temperature , washed with 2 m of nacl solution several times followed by two deionized water wash , and dried , and scintillation liquid was added and cpm ( counts per minute ) were read using the scintillation counter . ( sgrgkggkglgkggakrhrkme1vlrd ) with n - terminus labelled by fitc was ordered from tufts university core services ( boston , ma ) . the sample was prepared in a buffer containing 50 mm tris - hcl ( ph 8.0 ) , 10 mm gsh , 0.01% triton x-100 . 50 nm peptide was incubated with 20 m setd8 protein , 1 mm s - adenosyl - l - homocysteine ( sah ) , and different concentrations of compounds . the fp measurement was performed in black , 384-well pcr plate ( catalog no . 47744 - 828 , vwr ) , and signal was read with a synergy h4 microplate reader ( biotek ) . the polarization values in millipolarization units were measured at an excitation wavelength of 485 nm and an emission wavelength of 528 nm . selectivity of compound 1 against a panel of methyltransferases was assessed as previously reported . in brief , the effect of compound 1 on activity of g9a , setdb1 , glp , suv39h2 , setd7 , prmt3 , prmt5-mep50 complex , prmt1 , suv420h1 , suv420h2 , smyd2 , dnmt1 , prc2 complex , mll1 complex , and dot1l was assessed by monitoring the incorporation of tritium - labeled methyl group to lysine or arginine residues of peptide substrates using radioactive assay . assays were performed in a 20 l reaction mixture containing h - sam ( catalog no . net155v250uc , perkin elmer ) at substrate concentrations close to km values for each enzyme . compound concentrations from 100 nm to 100 m were used in all selectivity assays . to stop the enzymatic reactions , 7.5 m guanidine hydrochloride was added , followed by 180 l of buffer ( 20 mm tris , ph 8.0 ) , mixed , and then transferred to a 96-well flashplate ( catalog no . , the reaction mixtures in flashplates were incubated for 1 h and the cpm were measured using topcount plate reader ( perkinelmer ) . the cpm in the absence of compound for each data set were defined as 100% activity . in the absence of the enzyme , for dnmt1 the dsdna substrate was prepared by annealing two complementary strands ( biotintlated forward strand b - gagcccgtaagcccgttcaggtcg and reverse strand cgacctgaacgggcttacgggctc ) , synthesized by eurofins mwg operon . for dot1l , a filter - based assay was used . in this assay , 20 l of reaction mixtures was incubated at room temperature for 1 h , 100 l of 10% trichloroacetic acid ( tca ) was added , mixed , and transferred to filter plates ( catalog no . plates were centrifuged at 2000 rpm ( allegra x-15r ; beckman coulter , inc . ) for 2 min followed by two additional 10% tca washes and one ethanol wash ( 180 l ) followed by centrifugation . plates were dried , and 100 l of microscint - o ( catalog no . 6013611 , perkinelmer ) was added to each well , centrifuged , and removed . then 70 l of microscint - o was added again , and cpm were measured using topcount plate reader .

the lysine methyltransferase setd8 is the only known methyltransferase that catalyzes monomethylation of histone h4 lysine 20 ( h4k20 ) . monomethylation of h4k20 has been implicated in regulating diverse biological processes including the dna damage response . in addition to h4k20 , setd8 monomethylates non - histone substrates including proliferating cell nuclear antigen ( pcna ) and promotes carcinogenesis by deregulating pcna expression . however , selective inhibitors of setd8 are scarce . the only known selective inhibitor of setd8 to date is nahuoic acid a , a marine natural product , which is competitive with the cofactor . here , we report the discovery of the first substrate - competitive inhibitor of setd8 , unc0379 ( 1 ) . this small - molecule inhibitor is active in multiple biochemical assays . its affinity to setd8 was confirmed by itc ( isothermal titration calorimetry ) and spr ( surface plasmon resonance ) studies . importantly , compound 1 is selective for setd8 over 15 other methyltransferases . we also describe structure activity relationships ( sar ) of this series .

Introduction Results and Discussion Conclusions Experimental Section

large - scale clinical trials have created a robust evidence base to inform much of what is now standard acute - stroke practice.13 the classical clinical trial is designed to test efficacy of a particular intervention over a comparator , for example , placebo or usual care . to facilitate comparison between the groups requires a standard measure of outcome that is relevant and suited to the clinical question , valid for the population studied , and meaningful to the research team . in those trials that describe interventions designed to impact on quantifiable physiological variables , such as glycemia or blood pressure , choice of end - point assessment choice of assessment strategy is more challenging for a chronic , nonprogressive , or variably progressive disorder with potential multisystem effects such as cerebrovascular disease . hard clinical end points such as stroke mortality or stroke recurrence are useful , but do not fully capture the potential devastating effect of a disabling but survivable stroke . as stroke represents the leading global cause of adult disability,4 an important consideration for any study of stroke interventions this is recognized by regulatory authorities , who now recommend a measure of functional recovery / disability as primary or coprimary end point for stroke intervention trials . although the focus of this review will be functional assessment tools for stroke trials , these instruments also have utility in clinical practice . as functional assessment scales give a numerical value to abstract concepts such as disability , they can be used to objectively quantify deficits and track change over time . in clinical practice , an appreciation of how to describe stroke recovery in terms of common stroke scales allows for development of a common language between professionals caring for stroke survivors that facilitates comparisons of patients and services . within a single review , it would be impossible to review all stroke - specific and generic scales that may be needed in a stroke survivor s journey ( figure 1 ) . for the interested reader , we recommend a number of reference works.57 we recognize there is also extensive literature on assessment strategies for cognitive function poststroke . we will not review cognitive testing , suffice to say that there are a multitude of tools available with little consistency in choice of assessment.8 a large number of stroke - assessment scales are described , with novel scales frequently appearing ( and often subsequently disappearing ) in the literature . for those who are new to functional assessment , the large and varied nature of available scales and tools may seem daunting . the world health organization s international classification of functioning , disability and health ( who - icf)9 gives a conceptual framework that can aid classification of the scales and help decide on the appropriate measure for a particular purpose . who - icf describes levels of pathology ( in this case , the stroke lesion ) , impairments ( the direct loss of function ) , activity limitation ( formerly called disability ) , and societal participation ( formerly called handicap ) . the who - icf grades do not exist in isolation ; they interact and often create feedback loops . for example , an ischemic stroke ( pathology ) may cause a hemianopia ( impairment ) ; this may lead to poor mobility ( activity limitation ) and may restrict the stroke survivor from driving ( societal participation limitation ) . these problems may result in a fall with soft - tissue injury ( impairment ) , and fear of falling may cause the stroke survivor to forgo usual hobbies and activities ( societal participation limitation ) ( figure 2 ) . measures of pathology ( for example , size of infarct on imaging ) or impairment ( for example the medical research council motor assessment scale ) are straightforward to perform and interpret , but give little useful information on how stroke affects the individual . for this reason , impairment scales are often used in early phase trials . for phase iii studies , activity measures or measures of participation although not part of the who - icf , a further concept of quality of life ( qol ) is also described , and tools exist for its measurement . measures of qol give a far more detailed assessment , but as a result can be more burdensome to the patient and are often more difficult to interpret ( figure 3 ) . clinimetrics is the study of properties of clinical assessment tools;10 the term is derived from the theory of psychometrics.11 classical test theory describes important properties such as validity and reliability.12 other important factors for clinical scales are acceptability , both to patient and to assessor , and responsiveness to change . although in psychometrics , classical test measures are increasingly being superseded by contemporary theories of item response , the measures of validity , reliability , and responsiveness remain important for understanding clinical scales , and we will discuss them in turn . the clinimetric property of validity seeks to assess whether a scale measures the concept it purports to measure . adequate validity is essential for a stroke scale to have clinical utility , as a functional assessment tool that does not measure function is meaningless . validity can be assessed in various complementary ways.57 there is no gold standard for poststroke function , so assessment of criterion validity , where a scale is compared to a reference standard , is not possible . however , concurrent validity can be applied to a stroke scale by comparing it with another measure that purports to measure a similar construct ; for example , comparing a novel impairment scale with an established scale . face validity is an assessment of whether a priori the scale should measure the concept of interest , usually assessed by experts in the field . content validity asks whether the various items of a scale can adequately describe the concept of interest . prognostic or predictive validity for a stroke scale may be examined by , for example , studying if an impairment scale is associated with longer - term stroke outcomes . important reliability measures include the reproducibility of repeat scoring by the same observer ( intraobserver reliability or test retest reliability ) and between scorers ( interobserver variability ) . whether all items within a scale measure the same construct is a further measure of reliability , usually termed internal consistency . in contemporary stroke trials , where many thousands of stroke survivors may be assessed by hundreds of international research teams , reliability of assessment is clearly paramount . whereas validity of a scale is inherent , reliability of assessment may be modified . various methods to improve consistency of assessment are employed in large - scale trials , including training in use of scales , certification exams , and use of standardized protocols . while validity is relative , reliability can be objectively described . there is no consensus on the optimal method to measure reliability , although kappa statistics are frequently used in the biomedical literature to assess agreement . a kappa of 0 would imply no agreement other than that expected by chance , and perfect agreement is scored as 1.0 . traditionally , a kappa greater than 0.6 is taken as sufficient agreement to justify use of a scale . various forms of statistical weighting of kappa values can be used to give a measure of the degree of difference between raters.13,14 increasingly , more sophisticated analyses , such as that of bland altman , are being used to assess reliability.15 responsiveness can be thought of as the ability to detect meaningful change over time . meaningful change is clearly a subjective term , and will vary with the context in which the scale is used . the issue of responsiveness and the ability to detect small but meaningful change is especially important for a condition with high incidence and prevalence , such as stroke . if a scale does not pick up change in function , treatment effects that are modest for the individual but potentially important at a population level could be missed . the ideal scale would be easy and quick to administer , acceptable to patients and researchers , valid for its chosen purpose , reliable , and responsive to meaningful clinical change . there is no ideal stroke measure that fulfills all these criteria ( nor is there ever likely to be ) . although some guidance on stroke assessment for trials is emerging , debate continues as to the relative strengths and limitations of differing assessment strategies , and there is no consensus as to the optimal outcome measure(s ) for use . the stroke literature describes a variety of instruments , generic and specific to stroke , for functional assessment of recovery . a recent analysis of tools used in stroke trials suggests substantial heterogeneity in choice of assessment measure and in method of application.16 use of bespoke , nonvalidated assessments is still seen , although less commonly than previously . certain assessments are used more frequently than others and are increasingly recommended by specialist societies.17 for the non - stroke specialist , a basic knowledge of the more prevalent stroke scales will allow for improved understanding and critical analysis of stroke studies . we will describe three common stroke assessments : the national institutes of health stroke scale ( nihss ) , the modified rankin scale ( mrs ) and the barthel index ( bi ) . for each scale , we will discuss history , development , and application , and use the scales to further discuss the importance of clinimetric properties . the scientific study of assessment scales , particularly stroke assessment , is rapidly expanding and it would be impossible to comprehensively cover all areas . in this review , we will not describe the optimal analysis of functional scales for stroke trials . debate continues as to the relative merits of various statistical techniques , including dichotomization and use of the complete range of a scale , with the differing approaches having vocal proponents.18,19 equally , we will not consider the literature on outcome assessment in animal models of stroke.20,21 the nihss is a 15-item scale that standardizes and quantifies the basic neurological examination , paying particular attention to those aspects most pertinent to stroke . the nihss provides an ordinal , nonlinear measure of acute stroke - related impairments by assigning numerical values to various aspects of neurological function.22 the scale incorporates assessment of language , motor function , sensory loss , consciousness , visual fields , extraocular movements , coordination , neglect , and speech.22 it is scored from 0 ( no impairment ) to a maximum of 42 . a standardized approach to assessment , starting with fundamental assessments such as level of consciousness , is recommended , and guidance is given on how to score where the stroke survivor is not able to respond to commands . the nihss was developed in the early 1980s as a research tool to allow consistent reporting of neurological deficits in acute - stroke studies , particularly the early trials of thrombolysis and putative neuroprotectants.22 the nihss was developed through a robust consensus approach , taking the most informative measures from existent stroke - examination scales ( toronto stroke scale , oxbury initial severity scale , and cincinnati stroke scale ) and creating a composite scale that was further reviewed by a panel of stroke researchers and amended ( further items were added to ensure the assessment was as comprehensive as possible ) . the resulting scale was piloted and refined in a controlled trial of naloxone in acute stroke . it has since been used as primary or coprimary end point in landmark trials of thrombolytic agents and is commonly used in clinical acute - stroke practice . using a factor - analysis process , utility of individual components of the nihss has been assessed.23 this work has formed the basis for development of the modified nihss or mnihss , which removed components deemed unreliable.24 the resulting 11-point mnihss has been prospectively assessed , and improved reliability is described.25 as the standard nihss is already fairly quick to perform and reliable , it is debatable whether a shorter scale is needed , and at present the mnihss is not frequently used in trials or practice . further amendments to the nihss have been described to facilitate use of the scale in prehospital settings.26 a pediatric nihss ( pednihss ) is also described.27 the nihss has many advantages as a stroke outcome - assessment tool . it is relatively straightforward and takes around 6 minutes to perform , with no need for additional equipment . in the acute - stroke environment , it has been suggested that a change in the nihss of more than 2 points represents clinically relevant early improvement or deterioration.28 nihss scores are reliable across observers , and this has been demonstrated both in cohorts of neurology - trained and non - neurologist raters . the availability of a reliable method for neurological exam that is suitable for nonspecialists is a particular strength of the nihss . reliability and validity has also been demonstrated for remote nihss assessment via telemedicine.29 the interobserver reliability of the nihss is further improved by the various training materials available . training resources now exist , such as dvds and online educational aids , as well as pocket - sized nihss summary scales . practitioners can undergo certification to demonstrate their proficiency in assessment and interpretation of the nihss.30 content validity of the nihss has been demonstrated , although high internal consistency suggests that certain items of the nihss may be redundant . the nihss has predictive validity , as initial score is a robust predictor of in - hospital complication and outcome at 3 months.31,32 correlations with objective measures of stroke severity , such as size of infarct on imaging , provide further evidence of nihss validity.23,33,34 compared with bi and mrs , the nihss is the more sensitive outcome score , requiring potentially smaller sample sizes to detect relevant therapeutic effects.23,35 the nihss is responsive to change and can measure impairment throughout the expected range of stroke severity.36 a criticism of the nihss relates to its validity in certain nondominant - hemisphere stroke syndromes . it is well recognized that an individual can score 0 on the nihss , despite having evidence of ischemic stroke , particularly in the posterior circulation territory.37 examination of the component subscales of the nihss reveals a focus on limb and speech impairments and relatively little attention to , for example , cranial nerve lesions . similarly , when the nihss is used to predict dependent living , lower scores are seen in posterior circulation events compared to anterior circulation.38 there are radiological correlates , when quantifying extent of cerebral damage for a specified nihss score , the median volume of right - hemisphere strokes is larger than the volume of left - hemisphere strokes , suggesting nondominant strokes are required to be more severe to reach the same grading on the nihss.39 as an impairment scale , the nihss can give only limited information on how stroke has affected the individual stroke survivor . excellent outcome from stroke ; a hemianopia that precludes driving and may necessitate loss of employment would score nihss 1 , but for the individual this may not seem an excellent result . adapted from the maryland disability index , the bi authors florence i mahoney and dorothea w barthel intended their scale for use as a simple index of independence , useful in scoring improvement in rehabilitation.40 first described in the 1950s and published in 1965 , the bi was developed to assist in discharge planning from long - term care wards . with time , the bi has been adopted by other disciplines and is a recommended assessment in older adult care.41 the bi is the most commonly used functional measure in stroke - rehabilitation settings and the second most commonly used functional outcome measure across stroke trials.16,42 many scales have been described that take the name some authors have sought to modify or adapt the bi from the original ; these include reducing the number of items,43 extending it with the addition of cognitive and social domains,44 and attempts to further subdivide the outcomes to include different degrees of assistance.45 however , each of these requires independent validation , as it is known that even comparatively minor adaptations alter the validity of a tool and accuracy of responses.46 for consistency , it is recommended that a single bi measure is used ; the scale as described by wade and collin47 has been used in many trials . scores range from 0 and 100 , with a higher score indicating greater independence ( table 1 ) . while this can be useful for statistical analysis , it is more informative in practice to present the scores for the individual domains . an unresolved issue for trials is how to define a good bi outcome , with significant heterogeneity within the published literature48 and attempts to subcategorize , based on total score.49,50 a popular interpretation of bi scores is that subjects with bi > 80 are generally independent and should be able to return home ; while subjects with bi < 40 are very dependent.51 other interpretations of favorable and unfavorable bi outcomes have been described : statistical modeling looking at differing bi scores as a trial end point suggested a score of 95/100 was the optimal descriptor of an excellent outcome and that 75/100 was the best cut point for defining a poor outcome.52 validity of bi is well described . the scale is recognized as a valid prognostic tool following stroke , in particular as predictor of recovery , level of care required,53 and duration of rehabilitation required following stroke.54 bi scores correlate with other stroke - assessment scales,55 including other more detailed adl scales.56 interobserver reliability is usually quoted as a strength of the bi , and reliability has been demonstrated in nonstroke populations.57 systematic review of reliability of bi in stroke also suggests reasonable reliability , although few multicenter reliability studies are available.58 the original bi is not without its limitations . as a scale of primarily physical function , it does not reflect the burden on the individual of communication and cognitive deficits that can result from a stroke event.59 for clinical trials , the bi lacks a result to represent stroke mortality , and this can complicate analysis of results . however , the major limitation of the bi for clinical trial use is its responsiveness to change . although in certain stroke - care settings , the bi is as sensitive to change as other scales,60 a score must be able to represent changes throughout the entire spectrum of potential functional outcomes . it is in this regard that the foor and ceiling effects of the bi become apparent.50 floor and ceiling describes the phenomenon by which the score does not change from minimum or maximum despite clinical change.61 for example , a stroke patient in a neurointensive care setting can make significant gains but still score a total 0 on the bi ; conversely , a patient who is discharged from hospital and independent may still have substantial functional problems but will score 100 on the bi . given this limitation , the bi may be best suited to stroke survivors requiring inpatient rehabilitation , while other scales may be needed to assess functional change in those with more major or minor stroke symptoms.62 the bi can be considered as a measure of basic adl ( self - care and mobility ) . extended activities of daily living ( e - adl ) measures.63 the term instrumental adl was first used in lawton and brody s work , and a lawton i - adl scale is described.64 a validated measure that has been used with stroke survivors is the nottingham extended adl scale , which asks participants to reflect their actual activities over the preceding weeks , rather than simply what they have the capability to do.65,66 the nottingham extended adl scale compares favorably to the bi , and is less susceptible to the ceiling effects described.67 the mrs is a 6-point , ordinal hierarchical scale that describes global disability with a focus on mobility ( table 2 ) . the original rankin scale was developed by the scottish physician john rankin to describe the positive outcomes he was achieving in his prototypic stroke unit.68 although not originally intended as an assessment for clinical trials , a slightly modified version of rankin s eponymous scale was used as end point in the first multicenter stroke trial ( the uk tia study).69 since this time , the mrs has grown in popularity and is now the most commonly used functional measure in stroke trials , and has been the primary or coprimary outcome in most recent large - scale stroke trials.16 a further variation of the mrs , the oxford handicap scale , has been described but is not commonly used by trialists . in contemporary stroke studies , the mrs is often used both as a measure of premorbid ability to assist in selection of patients and as final outcome measure . the mrs has many potential strengths , and it is acceptable to patient and assessor , with nonstandardized interviews taking around 5 minutes to complete.70 concurrent validity is demonstrated by strong correlation with measures of stroke pathology ( for example , infarct volumes ) and agreement with other stroke scales.71,72 the six potential scores on the mrs ( 05 ) describe a full range of stroke outcomes , with a score of 6 usually added to denote death . with a limited number of scores , the mrs may be less responsive to change than some other scales ; however , a single - point change on the mrs will always be clinically relevant . the principle limitation of the mrs is its reliability , with the potential for substantial interobserver variability . a study describing the interobserver variability of the mrs is available ; indeed , in the first clinical studies that used the mrs as end point , the trialists described interobserver variability for a third of subjects interviewed by paired assessors.73 a systematic review and meta - analysis of studies describing interobserver variability of the mrs reports pooled reliability across ten published studies ( n = 587 patients ) of kappa = 0.46.74 those studies that assessed mrs reliability with multiple raters and centers ( ie , similar to a contemporary clinical trial ) revealed a worryingly low agreement of kappa = 0.21.75 this level of inconsistency will impact on the validity of the trial results and conclusions . the statistical noise created by the interobserver variability will increase the possibility of a type ii error , ie , a beneficial treatment effect is missed . it has been postulated that problems with mrs reliability may have partly explained a series of unexpected neutral results in large - scale neuroprotectant studies . there are published examples of nonstroke studies whose results were fundamentally altered when statistical analysis accounted for observer variation.76 recognizing the problems of reliability in standard mrs assessments , trialists have explored various interventions to improve consistency in scoring . usual mrs interviews are unstructured , and researchers vary considerably in their length of interview and number of questions asked . more structured approaches to assessment have been described , from a comprehensive scripted interview75 to use of anchoring questions that require a yes / no answer.77 the groups that developed these assessments describe substantial improvements in reliability . however , improvements have not been seen when the structured interviews have been tested by independent centers.78 training in use of the mrs can also offer potential to improve consistency . as with the nihss and bi , an online training resource is available with an accompanying certification exam.79 a further trial modification that may improve reliability is to record mrs interviews and have a remote consensus grading by experienced stroke trialists . two other modifications to mrs assessment are commonly used and deserve some discussion : using proxies to substitute for stroke survivors in the mrs interview and calculating a prestroke mrs . stroke survivors often have physical , language , or cognitive impairments that may complicate a standard face - to - face interview . in this situation , an informant who knows the patient often supplements the interview or substitutes it completely . while this approach makes intuitive sense , we should not assume validity , and clinimetric analysis is still required . a recent systematic review of proxy stroke scales ( the mrs was not included ) suggested that the properties of certain proxy - based assessments may differ from equivalent standard assessments.80 a study of proxy mrs described suboptimal reliability and validity , and recommended that direct mrs interview with the patient should be the preferred assessment if possible.81 in stroke trials , traditional statistical analyses assess numbers achieving a good functional outcome . to improve trial power , prestroke mrs has been used in many landmark stroke trials , where prestroke mrs > 2 is used as the exclusion criterion during participant selection . the wording of the mrs grades is not suited to such prestroke assessment , and it is perhaps unsurprising that when formally assessed , prestroke mrs had only moderate reliability and validity.82 in view of improving longer - term survival and functional outcomes following stroke,83 it could be argued that assessments against participation or qol will become increasingly important.84 certainly evaluations of health - related qol in stroke survivors can provide a rich description of the multifaceted effects of a stroke , providing insights above those recorded with traditional impairment and activity measures.85 measuring health - related qol in stroke presents particular challenges . important predictors and components of qol following stroke will vary at different periods following the event.86 thus , we must balance having a suitably comprehensive assessment that is sensitive to the nuances of qol against the time and burden required for this assessment . carer / family - based assessments of the patient s qol are often biased , with the proxies reporting poorer outcomes than the subject.87 various qol scales have been proposed , some generic and some specific to stroke / brain injury . qol scales should be subject to the same rigor of clinimetric assessment as any other scale . it is evident from the published literature that for qol there is a propensity to generate new scales rather than validating existing ones.88,89 it has been argued that qol can be assessed by asking just two questions assessing dependency and problems.90 an alternative approach is to apply existing health - related qol scales or to use disease - specific scores . the short form 36 ( sf-36 ) is a generic scale intended for patient completion that assesses eight domains of health - related qol derived from the medical outcomes study ( table 3).91 although the sf-36 is validated for stroke patients,92 noncompletion bias and marked floor and ceiling effects may limit its utility.93,94 the generic qol scale , euro - qol , was developed based on the findings of an international postal survey.95 the self - completion questionnaire requires assessment across five domains complemented by a visual analog scale ( table 3).96 euroqol has been validated in stroke populations.97 however , noncompletion bias is recognized : in one study , only 61% of stroke survivors could complete the scale without external assistance.97 the stroke - specific qol scale was developed based on interviews with stroke survivors.98 it is based on twelve domains ( table 3).93 the scale is validated in stroke populations , and values for minimal detectable change and clinically important difference99 are established . many assessment tools , spanning various functional domains , are available to clinicians and researchers working with stroke survivors . we have given a favor of the marked heterogeneity in use of assessment scales . lack of consistency in outcome assessment has hindered comparative research and meta - analysis , and so we would recommend that future researchers use a common set of outcome assessments . no perfect stroke - assessment scale exists , and in this review we have deliberately avoided suggestions that one scale is better than an other . we have focused on the three most commonly used stroke scales ( mrs , bi , nihss ) as exemplars . these scales have been validated , are familiar to many , and have proven utility , with each suited to differing assessment scenarios . assessment , we would recommend continuing use of the three core assessment scales : the mrs as an outcome if the study is describing global disability , the nihss for studies looking at neurological impairment , and the bi for studies looking at basic adl . trialists and clinicians can supplement these core assessments with specific tools suited to the clinical scenario / research question . increasing awareness of the importance of clinimetric properties has highlighted deficiencies and potential limitations with stroke functional assessment . clinicians and researchers should always select their assessment tool(s ) based on the question of interest and the evidence base around clinimetric properties . where , as is often the case , the research around clinimetric properties of a scale is sparse , we would encourage researchers to design and conduct their own clinimetric studies .

as stroke care has developed , there has been a need to robustly assess the efficacy of interventions both at the level of the individual stroke survivor and in the context of clinical trials . to describe stroke - survivor recovery meaningfully , more sophisticated measures are required than simple dichotomous end points , such as mortality or stroke recurrence . as stroke is an exemplar disabling long - term condition , measures of function are well suited as outcome assessment . in this review , we will describe functional assessment scales in stroke , concentrating on three of the more commonly used tools : the national institutes of health stroke scale , the modified rankin scale , and the barthel index . we will discuss the strengths , limitations , and application of these scales and use the scales to highlight important properties that are relevant to all assessment tools . we will frame much of this discussion in the context of clinimetric analysis . as they are increasingly used to inform stroke - survivor assessments , we will also discuss some of the commonly used quality - of - life measures . a recurring theme when considering functional assessment is that no tool suits all situations . clinicians and researchers should chose their assessment tool based on the question of interest and the evidence base around clinimetric properties .

Why measure functional outcomes in stroke trials? Which functional measure to use Clinimetric properties of scales National Institutes of Health Stroke Scale Barthel Index Modified Rankin Scale Quality of life Conclusion

the benefits of physical exercise on cognitive function in the elderly have been demonstrated in many studies . several large - scale longitudinal studies showed that older people who have a high level of physical activity , have a significantly lower risk of developing alzheimer s disease and cognitive impairment.17 the results of a meta - analysis of 18 studies investigating the effectiveness of aerobic exercise concluded that fitness training could enhance the cognitive functioning of the elderly.8 this study also showed that a short duration , moderate - level training program could create an optimal effect on cognitive functions in the elderly . another meta - analysis investigating the change of duration and intensity of physical activity conducted by van gelder et al found that elderly people who participated in physical exercise for an average of 30 minutes per day or more could postpone their cognitive decline.9 however , studies on the benefits of physical training have focused closely on aerobic exercise such as walking , and strength exercise , such as weight lifting.4,6,7,1012 these aerobic and strength exercises require the participants to be highly mobile . the elderly with low mobility , or who are hospitalized , might have difficulty enjoying the full benefit of the exercise because of their limited locomotive ability . therefore exercise with reduced locomotion requirement , could provide the benefits of aerobic exercise to the elderly with restricted mobility . recently , there has been growing research interest in the therapeutic effects of mind body exercise.13,14 tai chi chuan , commonly known as tai chi , is a typical example of mind body exercise ; it is characterized by slow motion and emphasizes the conscious control of body movements , ie , it requires less locomotive mobility and is deemed appropriate for most elderly people.15 research has shown that the cognitive functions of the elderly could be well preserved with the aid of such mind body exercise , in a way similar to typical physical exercise.3 exercises with lower requirements of locomotive ability , such as coordination training ( ct ) and towel exercise ( te ) , are needed for the elderly with poor mobility . both ct and te require low locomotive ability , and thus are suitable for most elderly . the literature review showed that ct and te may also be beneficial for the cognitive functioning of the elderly . the purpose of this study was to compare the effectiveness of ct and te on the cognitive functioning and physical mobility of the elderly , with the aim of developing an exercise with a low mobility requirement , to benefit the cognitive functioning of the elderly . we hypothesized that the elderly in the ct group would show significant improvement in the cognitive measures compared with the elderly in the te group . forty elderly ( three male , 37 female ) with normal cognition were recruited from two elderly centers of the hong kong lutheran social service , aged 6690 ( mean = 79.0 , sd = 5.8 ) . targeted participants were asked to take the chinese version of mini - mental state examination ( cmmse ) as one of the screening criteria , and those who scored 18 were eligible for this study.16 other than that , there was no other inclusion or exclusion criterion in recruitment . the ethics approval of this study was obtained from the survey and behavioural research ethics committee of the chinese university of hong kong . participants confirmed their agreement to participate in this study by signing informed consent before the exercise began . a physiotherapist from the jockey club centre for positive ageing ( jccpa , see http://www.jccpa.org.hk ) developed an 8-week exercise program , called coordination training ( ct ) , which is a simplified version of tai chi . it was easy for the elderly to learn , and required a relatively low level of mobility to practice . the eleven movements included coordination of fingers , hands , eyes , and legs . a brief description of the eleven movements is set out in table 1 . the elements of movement 4 are tabulated in table 2 and graphically represented in figure 1 as an example . movement 4 helped to train participants coordination of upper limbs , and was intended to imitate the movements of tai chi . the training protocol of te was developed by the leisure and cultural services department , the government of the hong kong special administrative region in 2005.17 similar to movement 4 in ct , te was a type of stretching exercise mainly to train upper limb and bilateral arm movements , but utilize a towel as a tool . it was strongly promoted by the government because it was easy for elderly people with various locomotive abilities to master.18 te benefited the elderly by improving circulation and helping to control weight , and aimed to reduce the chance of falling.19 for the sake of convenience of participation and better monitoring of participants progress , those in one center were allocated to practice ct , and those in another center were allocated to practice te . te was chosen to compare with ct because these exercies were similar in a number of ways . both exercises required subjects to follow instructions , and to coordinate upper limb and bilateral arm movements . ct and te were conducted for 8 consecutive weeks , with one 40-minute session per week . both groups had a 10-minute warm - up period at the beginning and a 10-minute cool - down period at the end of the session to prevent injury . the remaining 20 minutes would be taken up with the actual ct or te exercise . both exercise groups were conducted by qualified instructors trained by the physiotherapist , mentioned above . for ct , there were three levels of difficulty : easy , medium , and difficult ( see table 2 ) . the level of difficulty was increased mainly by reducing the rest time ( demanding higher concentration as well as physical strength of participants ) , and by closing the eyes when performing the actions ( demanding higher psychomotor balance of participants ) . in this study , when the participants self - reported being able to handle the movement comfortably , which was confirmed by the trainer , they were required to practice the movement at an advanced difficulty level in order to avoid the ceiling effect.19 assessment tools including chinese mini - mental state examination ( cmmse ) , chinese dementia rating scale ( cdrs ) , and timed up - and - go test ( tug ) were administered to participants in both groups before and after the training sessions by trained occupational therapists and clinical psychologists . general cognitive status was assessed using the cmmse , which was translated and validated by chiu et al in the hong kong chinese population.20 the full mark was 30 . it examined five different aspects of cognitive ability , namely , attention , initiation - perseveration , construction , conceptualization , and memory . the maximum score of the unadjusted scale was 144 , with the cronbach s alpha of 0.89 . good psychometric properties were observed in both the original drs and the chinese version.21,22 tug was a good instrument to measure the general physical mobility of participants , and thus was administrated in this study to measure the effects of relevant exercises.23 the longer time spent to finish tug ( slower ) , the poorer the performance of participants , and vice versa . spss software v 15 ( ibm corp , somers , ny ) was used for data analyses . independent sample t - tests were conducted to compare the pre - test scores ( obtained in pre - test period ) between ct and te groups . paired sample t - tests were performed to compare the post - test scores ( obtained in the ninth week , after the 8-week exercise period ) with the pre - test scores in each group . analysis of covariance ( ancova ) was used to compare the scores of cmmse , cdrs , and tug of the two groups after the training program , using participants age and the pre - test scores as covariates . forty elderly ( three male , 37 female ) with normal cognition were recruited from two elderly centers of the hong kong lutheran social service , aged 6690 ( mean = 79.0 , sd = 5.8 ) . targeted participants were asked to take the chinese version of mini - mental state examination ( cmmse ) as one of the screening criteria , and those who scored 18 were eligible for this study.16 other than that , there was no other inclusion or exclusion criterion in recruitment . the ethics approval of this study was obtained from the survey and behavioural research ethics committee of the chinese university of hong kong . participants confirmed their agreement to participate in this study by signing informed consent before the exercise began . a physiotherapist from the jockey club centre for positive ageing ( jccpa , see http://www.jccpa.org.hk ) developed an 8-week exercise program , called coordination training ( ct ) , which is a simplified version of tai chi . it was easy for the elderly to learn , and required a relatively low level of mobility to practice . the elements of movement 4 are tabulated in table 2 and graphically represented in figure 1 as an example . movement 4 helped to train participants coordination of upper limbs , and was intended to imitate the movements of tai chi . the training protocol of te was developed by the leisure and cultural services department , the government of the hong kong special administrative region in 2005.17 similar to movement 4 in ct , te was a type of stretching exercise mainly to train upper limb and bilateral arm movements , but utilize a towel as a tool . it was strongly promoted by the government because it was easy for elderly people with various locomotive abilities to master.18 te benefited the elderly by improving circulation and helping to control weight , and aimed to reduce the chance of falling.19 for the sake of convenience of participation and better monitoring of participants progress , those in one center were allocated to practice ct , and those in another center were allocated to practice te . te was chosen to compare with ct because these exercies were similar in a number of ways . both exercises required subjects to follow instructions , and to coordinate upper limb and bilateral arm movements . ct and te were conducted for 8 consecutive weeks , with one 40-minute session per week . both groups had a 10-minute warm - up period at the beginning and a 10-minute cool - down period at the end of the session to prevent injury . the remaining 20 minutes would be taken up with the actual ct or te exercise . both exercise groups were conducted by qualified instructors trained by the physiotherapist , mentioned above . for ct , there were three levels of difficulty : easy , medium , and difficult ( see table 2 ) . the level of difficulty was increased mainly by reducing the rest time ( demanding higher concentration as well as physical strength of participants ) , and by closing the eyes when performing the actions ( demanding higher psychomotor balance of participants ) . in this study , when the participants self - reported being able to handle the movement comfortably , which was confirmed by the trainer , they were required to practice the movement at an advanced difficulty level in order to avoid the ceiling effect.19 assessment tools including chinese mini - mental state examination ( cmmse ) , chinese dementia rating scale ( cdrs ) , and timed up - and - go test ( tug ) were administered to participants in both groups before and after the training sessions by trained occupational therapists and clinical psychologists . general cognitive status was assessed using the cmmse , which was translated and validated by chiu et al in the hong kong chinese population.20 the full mark was 30 . it examined five different aspects of cognitive ability , namely , attention , initiation - perseveration , construction , conceptualization , and memory . the maximum score of the unadjusted scale was 144 , with the cronbach s alpha of 0.89 . good psychometric properties were observed in both the original drs and the chinese version.21,22 tug was a good instrument to measure the general physical mobility of participants , and thus was administrated in this study to measure the effects of relevant exercises.23 the longer time spent to finish tug ( slower ) , the poorer the performance of participants , and vice versa . spss software v 15 ( ibm corp , somers , ny ) was used for data analyses . independent sample t - tests were conducted to compare the pre - test scores ( obtained in pre - test period ) between ct and te groups . paired sample t - tests were performed to compare the post - test scores ( obtained in the ninth week , after the 8-week exercise period ) with the pre - test scores in each group . analysis of covariance ( ancova ) was used to compare the scores of cmmse , cdrs , and tug of the two groups after the training program , using participants age and the pre - test scores as covariates . forty people ( three males , 37 females ) aged 66 to 90 years ( mean = 79.0 , sd = 5.8 ) were recruited . the average ages of the elderly in the ct and te groups were 77.7 6.0 and 80.3 5.5 , respectively . no significant difference was found in demographic features or cognitive and physical functioning test scores between the two groups . comparisons of participants pre - test ( baseline ) and post - test cognitive functioning by cmmse amd cdrs scores and physical mobility by tug scores are shown in table 4 . paired t - tests showed that the cdrs scores of the ct group had improved significantly from 114.8 15.5 at pre - test to 119.3 18.0 at post - test ( cdrs t(17 ) = 2.25 , p = 0.045 ) . the cdrs scores of the te group improved slightly from 114.9 14.8 at pre - test to 116.9 12.5 at post - test . no significant change was found in cmmse ( t(18 ) = 0.931 , p = 0.368 ) , and tug ( t(17 ) = 0.334 , p = 0.747 ) in ct group , as well as cmmse ( t(19 ) = 0.665 , p = 0.516 ) , cdrs ( t(19 ) = 0.891 , p = 0.384 ) and tug ( t(19 ) = 1.908 , p = 0.086 ) in the te group . different ancova ( between - subject factor : group [ ct , te ] and covariates : age and the pre - test scores ) models show the following findings . for cmmse , the covariate age ( f(1,28 ) = 0.17 , p = 0.690 , p = 0.003 ) and the exercise groups ( f(1,28 ) = 3.41 , p = 0.570 , p = 0.139 ) were not significantly related to the cmmse post - test scores . only the covariate pre - test scores of cmmse were significantly related to the post - test scores ( f(1,28 ) = 16.32 , p < 0.001 , p = 0.428 ) . for cdrs , exercise groups were not significantly related to the cdrs post - test scores ( f(1,28 ) = 0.02 , p = 0.904 , p = 0.001 ) . only the covariate age ( f(1,28 ) = 9.14 , p = 0.005 , p = 0.462 ) and the covariate pre - test scores of cdrs ( f(1,28 ) = 59.12 , p < 0.001 , p = 0.738 ) were significantly related to the cdrs post - test scores . for tug , the covariate age ( f(1,26 ) = 0.01 , p = 0.940 , p = < 0.001 ) and the exercise groups ( f(1,26 ) = 0.11 , p = 0.740 , p = 0.005 ) were not significantly related to the tug post - test scores . only the covariate pre - test scores of tug were significantly related to the tug post test scores ( f(1,26 ) = 83.50 , the above findings served to compare the effectiveness of the two exercise programs , coordination training ( ct ) and towel exercise ( te ) , in improving cognitive functioning and physical mobility in the elderly . the results showed that ct group participants had significant improvements in global cognition after the 8-week exercise program . ct group gained significant improvement in cdrs scores after the exercise training , while the te group participants did not . the lack of significant group difference in the changes in cdrs might be caused by the small sample size . further investigation of the effectiveness of ct is recommended following this prospective study , through a large - scale clinical trial with appropriate numbers of samples in each group to detect the group differences . for the physical mobility measure , te tended to improve mobility while ct did not . this pattern was probably expected , because ct was designed to improve cognition , not mobility . the insignificant difference in physical mobility measure might suggest that ct , which required less in mobility , had a similar effect to te , a common physical exercise , on the cognitive and physical functioning of the elderly population . body exercise can improve cognitive functions and other health indicators , although the role of physical exercise in modulating cognitive decline is complex . the improvements can be described through ( 1 ) psychosocial indicators and ( 2 ) physiological responses . practicing regular physical exercise was found to be associated with better cognitive test performance and decreased arousal.3,24 a moderate exercise program followed twice a week significantly slowed , by one - third , the progressive deterioration in ability to perform activities of daily living in people with alzheimer s disease living in nursing homes.25 mind body exercises produce effects similar to those of regular cardiovascular exercises , suggesting an alternative model of exercise for the elderly , who are less able to exercise vigorously , to lower the risk of sport - related injuries and cardiac hazards.15 elderly people with the habit of regular physical exercise have been shown to be associated with socialization and environmental enrichment , which may also help attenuate the rate of cognitive decline.3 tai chi , a well - known mind body exercise , employs cognitive tools of both visualization and focused internal awareness to strengthen , relax , and integrate the body and mind.26 tai chi can also improve locomotion balance in seniors.27,28 a study evaluating a tai chi program called taiji ( tai chi ) buddies program found that the program encouraged social participation and supported partner involvement , which may have a positive influence on exercise persistence and the health and well - being of the support partner.28 a 12-week tai chi exercise program has been found adequate to reduce perceived stress and improve mood state , as well as increase perceived social support.29 the findings of this research showed that ct exercise , a simplified form of tai chi developed in this study specifically for the elderly with low activity , shares similar advantages , improving cognitive functions . body exercise enhances cardiovascular function , muscle strength , body balance , and physical function ; these improvements have a positive correlation with reduced stress , anxiety , and depression , resulting in an improved quality of life.24,30,31 a study utilizing electroencephalogram ( eeg ) recorded an increased cordance value at left hemisphere ( a sign of enhanced cerebral perfusion ) in a patient with chronic epilepsy after practicing dejian mind body intervention ( one of the components being mind body exercise).32 the changes in brain activities reflected by eeg underlie the observed improvements in cognitive functions.32 in addition , practicing mind - body exercise , which exerts similar effects to aerobic exercise , helps to increase volume in both gray and white matters primarily located in prefrontal and temporal cortices brain areas which are involved in age - related deterioration , as observed by mri images.33 as demonstrated by animal models , exercise - induced up - active pathways are associated with enhancement of several neurotransmitter systems afferent to the hippocampus , including the norepinephrine , serotonin , acetylcholine , and -aminobutyric acid systems , which are important to hippocampal function.34 these changes in brain activities and functioning demonstrate that regular , moderate physical exercise has beneficial effects on brain health . the findings of this study are consistent with previous reports that have shown that subjects practicing regular physical exercise are associated with better cognitive test performance , and there is a positive correlation between cardiovascular and mind body exercise and cognitive function among the chinese elderly.3,15 these exercises , however , might not be effective for the elderly suffering from moderate and severe dementia , who are likely to be immobile or even bed - bound . exercise applied in this study , which requires a lesser level of physical movement , sheds light on improving cognitive functions for dementia patients who may find difficulty undertaking regular physical exercise because they are physically less active or less mobile . additional , large - scale randomized control studies are recommended to elaborate on the efficacy of mind body exercise on cognitive functioning . the limitations of the study include the small sample size , and the absence of a control group ( without any exercise ) . participants in this study self - reported a habit of performing regular physical activities , and thus they are likely to be more health conscious with a lower cardiovascular burden.3 mind body exercise can improve cognitive functions and other health indicators , although the role of physical exercise in modulating cognitive decline is complex . the improvements can be described through ( 1 ) psychosocial indicators and ( 2 ) physiological responses . practicing regular physical exercise was found to be associated with better cognitive test performance and decreased arousal.3,24 a moderate exercise program followed twice a week significantly slowed , by one - third , the progressive deterioration in ability to perform activities of daily living in people with alzheimer s disease living in nursing homes.25 mind body exercises produce effects similar to those of regular cardiovascular exercises , suggesting an alternative model of exercise for the elderly , who are less able to exercise vigorously , to lower the risk of sport - related injuries and cardiac hazards.15 elderly people with the habit of regular physical exercise have been shown to be associated with socialization and environmental enrichment , which may also help attenuate the rate of cognitive decline.3 tai chi , a well - known mind body exercise , employs cognitive tools of both visualization and focused internal awareness to strengthen , relax , and integrate the body and mind.26 tai chi can also improve locomotion balance in seniors.27,28 a study evaluating a tai chi program called taiji ( tai chi ) buddies program found that the program encouraged social participation and supported partner involvement , which may have a positive influence on exercise persistence and the health and well - being of the support partner.28 a 12-week tai chi exercise program has been found adequate to reduce perceived stress and improve mood state , as well as increase perceived social support.29 the findings of this research showed that ct exercise , a simplified form of tai chi developed in this study specifically for the elderly with low activity , shares similar advantages , improving cognitive functions . body exercise enhances cardiovascular function , muscle strength , body balance , and physical function ; these improvements have a positive correlation with reduced stress , anxiety , and depression , resulting in an improved quality of life.24,30,31 a study utilizing electroencephalogram ( eeg ) recorded an increased cordance value at left hemisphere ( a sign of enhanced cerebral perfusion ) in a patient with chronic epilepsy after practicing dejian mind body intervention ( one of the components being mind body exercise).32 the changes in brain activities reflected by eeg underlie the observed improvements in cognitive functions.32 in addition , practicing mind - body exercise , which exerts similar effects to aerobic exercise , helps to increase volume in both gray and white matters primarily located in prefrontal and temporal cortices brain areas which are involved in age - related deterioration , as observed by mri images.33 as demonstrated by animal models , exercise - induced up - active pathways are associated with enhancement of several neurotransmitter systems afferent to the hippocampus , including the norepinephrine , serotonin , acetylcholine , and -aminobutyric acid systems , which are important to hippocampal function.34 these changes in brain activities and functioning demonstrate that regular , moderate physical exercise has beneficial effects on brain health . the findings of this study are consistent with previous reports that have shown that subjects practicing regular physical exercise are associated with better cognitive test performance , and there is a positive correlation between cardiovascular and mind body exercise and cognitive function among the chinese elderly.3,15 these exercises , however , might not be effective for the elderly suffering from moderate and severe dementia , who are likely to be immobile or even bed - bound . exercise applied in this study , which requires a lesser level of physical movement , sheds light on improving cognitive functions for dementia patients who may find difficulty undertaking regular physical exercise because they are physically less active or less mobile . additional , large - scale randomized control studies are recommended to elaborate on the efficacy of mind body exercise on cognitive functioning . the limitations of the study include the small sample size , and the absence of a control group ( without any exercise ) . participants in this study self - reported a habit of performing regular physical activities , and thus they are likely to be more health conscious with a lower cardiovascular burden.3 this prospective study attempted to provide evidence for the potential benefits of a customized coordination training exercise to improve the cognitive functioning of the elderly . the findings demonstrate that low physical level exercise similar to tai chi for example is beneficial for cognitive function and helps maintain the physical mobility of the elderly . the findings also give insight into developing further exercise regimes , which are more suitable for elderly people with a limited level of physical fitness or who are hospitalized .

background : studies on the effect of a low intensity coordination exercise on the elderly with limited mobility are sparse . this prospective study attempted to compare the effectiveness of a customized coordination exercise and a strength exercise in improving the cognitive functioning and physical mobility on the elderly.methods:participants from two centers for the elderly were allocated to practice either an 8-week coordination training ( ct ) program or an 8-week towel exercise ( te ) program . the chinese mini - mental state examination and chinese dementia rating scale ( cdrs ) were used to measure cognitive functioning of participants , and timed up - and - go test for physical mobility . these assessments were administered before and after the program.results:paired t - tests showed that the cdrs scores of the ct group improved significantly from 114.8 at pre - test to 119.3 after training ( p = 0.045 ) . the cdrs scores of the te group also improved from 114.9 at pre - test to 116.9 after training.conclusion:findings from this prospective study demonstrated that low - intensity level mind - body exercise could be beneficial to the cognitive functioning of older adults .

Introduction Method Subjects Coordination training (CT) Towel exercise (TE) Procedure Instruments Statistical analysis Results Discussion Mindbody exercise to improve cognitive function Psychosocial indicators Physiological responses to mindbody exercise Limitations of this study Conclusion

ovarian cancer accounts for 4% of all cancers in women , with over 200,000 new diagnoses each year world wide . in early cancers ( figo stage 1 and 2 ) , the survival is 8090% compared with 25% in late cancers ( figo stage 3 and 4 ) . no effective screening test exists so the main prospect for early diagnosis is improved identification of symptomatic cancer . the eurocare-4 study on cancer survival covering the period up to 2002 reported that england had the worst five - year survival rate for ovarian cancer at 30.2% , with united kingdom being marginally better , however , still less compared to the european average of 36.5% . ovarian cancer is accepted as a silent killer probably because it is believed that majority of patients are diagnosed in late stage , and that in early stage disease no symptoms are evident . however , over the last decade there has been a lot of research in the symptom - based detection of ovarian cancer [ 59 ] . it has been shown that the patients with ovarian cancer may have symptoms for at least several months before their diagnosis [ 59 ] . additionally , they may experience symptoms more frequently , severely , and persistently than women without the disease [ 10 , 11 ] . in the uk , patients experiencing unusual symptoms are likely to see their primary care clinician , and it is believed that the ovarian cancer symptoms often go unreported and unrecognised for several months before diagnosis [ 3 , 5 , 12 ] . recognition of certain symptoms by patients and clinicians may identify those suffering from ovarian cancer at an early stage [ 13 , 14 ] . awareness of the ovarian cancer symptoms and risks amongst women in general population is low . additionally , the predictive value of individual symptom in detection of ovarian cancer remains very low and presenting symptoms of ovarian cancer overlaps with those of more common abdominal disease and gastrointestinal disease . the difficulty for the primary care physicians is to decide which patients to be referred urgently for specialist opinion . not surprisingly , half of the women with ovarian cancer are not referred directly to the gynaecological cancer clinics thus possibly resulting in a delay in the diagnosis . thus , it is important that the primary care clinicians , who are the first contact for the patients with possible ovarian cancer , are aware of the current research on changing symptomatology of ovarian cancer as well as the risk factors related to ovarian cancer . the objective of the current survey was to assess the knowledge , perception , and understanding of general practitioners in south east essex with regard to ovarian cancers . ethical approvalas the study reflects opinion of the participants , ethical approval was not required . as the study reflects opinion of the participants , ethical approval was not required . we report the results related to the role of symptoms and the family history in detection of ovarian cancer . we report the results related to the role of symptoms and the family history in detection of ovarian cancer . general practices ( n = 132 ) in south east essex area . sampling methodpurposive sampling , that is , individuals are selected because they met specific criteria ( e.g. , they are general practitioners in a specific region of uk ) . purposive sampling , that is , individuals are selected because they met specific criteria ( e.g. , they are general practitioners in a specific region of uk ) . questionnaires were sent by post along with a covering letter and a self - addressed stamped return envelope within the study period from july 2008 to june 2009 . the covering letter explained the purpose of the survey and gave a brief account of recent advances in ovarian cancer . the details of the general practitioners and address of the surgery were obtained from the gp network . questionnaires were sent by post along with a covering letter and a self - addressed stamped return envelope within the study period from july 2008 to june 2009 . the covering letter explained the purpose of the survey and gave a brief account of recent advances in ovarian cancer . the details of the general practitioners and address of the surgery were obtained from the gp network . in this cohort , 66.4% of the respondent gps were male while 33.6% were female gps . about 41% respondents worked in a training practice while 59% respondents worked in a nontraining practice . out of 108 respondents ( 2 did not answer the question ) , 30 had experience of being involved in more than 5 cases of ovarian cancer so far in their career , while 12% of the respondent gps were never been involved with a case of ovarian cancer . all respondent gps answered correctly that the smear test does not detect ovarian cancer ( table 1 ) . only 6.4% respondent gps thought that most women diagnosed with early stage disease are reporting symptoms . more than half correctly thought that early clinical diagnosis is possible ; however , only one fourth ( 26.4% ) of the respondent gps thought that women with ovarian cancer are more likely to experience very frequent , sudden onset , and persistent symptoms ( table 1 ) . in a prospective case control study , goff et al . found that the ovarian cancer patients typically have a symptom frequency of 15 to 30 times per month . when asked about the frequency of symptoms in ovarian cancer ( table 2 ) , only about 20% respondent gps thought that the symptoms are in frequency of 1230 times a month . family history of breast / ovarian cancer is the single greatest risk factor , which explains 5% to 15% of cases of ovarian cancer [ 16 , 17 ] . when asked about the importance of family history of breast and ovarian cancer , majority ( 96.4% ) of the respondent gps were aware of the importance of family history of ovarian cancer , while 80.9% were aware that a family history of breast cancer is also important . gps were asked to score individual symptoms for their relevance to possible ovarian cancer from 0 ( not relevant ) to 10 ( most relevant ) . the most important symptoms for gps when it comes to suspecting ovarian cancer were ( see figure 1 ) abdominal swelling ( mean sd , 8.19 2.33 ) , pelvic pain ( 7.46 2.26 ) , and abdominal bloating ( 7.01 3.1 ) . these symptoms scored higher than bleeding per vaginum ( 5.39 3.18 ) , vaginal discharge ( 3.25 2.9 ) , altered bowel habits ( 4.5 2.89 ) , and indigestion ( 3.73 2.98 ) . ovarian cancer is not common and one study reported that on an average , a gp is likely to see only one case of ovarian cancer every 5 years in the uk . there has been an increase in the research interest for screening of ovarian cancer with majority of research being focused on use of biomarkers and pelvic ultrasound with multimodal assessments for early detection of ovarian cancer . over the last decade or so , research has also been intensified on symptom based detection of ovarian cancer with the potential advantage of early detection and timely treatment . a systematic review has estimated that 93% ( 95% ci : 92% to 94% ) of women experienced symptoms before diagnosis of ovarian cancer . the knowledge of symptoms and risk factors of ovarian cancer amongst women in the general population is low ; however , it is clear that women with ovarian cancer do experience symptoms and report it to clinicians . a retrospective cohort study of 100 patients from australia showed that 90% of the patients with early stage disease reported at least one symptom . the challenge for a general practitioner in primary care is to distinguish the symptoms of ovarian cancer from those of other conditions , such as irritable bowel syndrome or other gastrointestinal disease . few studies have looked at the predictive value of symptoms in detection of ovarian cancer . in the current survey in primary care , respondent gps have been able to identify three symptoms as relevant with higher mean symptom scores in comparison to remaining set of 11 other symptoms ( figure 1 ) . these symptoms are abdominal swelling ( 8.19 2.33 ) , abdominal bloating ( 7.01 3.01 ) , and pelvic pain ( 7.46 2.26 ) . however , the mean scores were lower for the gastrointestinal symptoms such as altered bowel habit ( 4.50 2.89 ) , indigestion ( 3.73 2.98 ) and feeling full quickly ( 5.36 3.07 ) . thus , gps in the survey appeared to attach less significance to gastrointestinal symptoms , possibly explaining the reason for higher number of ovarian cancers being referred to other specialties initially . the current observation may suggest that to diagnose the ovarian cancer , equal importance should be given to abdominal , gastrointestinal , and constitutional symptoms . in a retrospective survey conducted in 2000 by goff and colleagues , 77% reported abdominal symptoms ( bloating , pain , and increased size ) ; 70% gastrointestinal symptoms ( indigestion , constipation , and nausea ) ; 58% symptoms involving pain ( abdominal pain , pain with intercourse , and back pain ) ; 50% constitutional symptoms ( fatigue , anorexia , and weight loss ) ; 34% urinary symptoms ( frequency or incontinence ) ; 26% pelvic symptoms ( bleeding , a palpable mass ) . goff and colleagues developed a symptom index in which four symptoms were considered significant . these symptoms are bloating / increase in abdominal size , pelvic / abdominal pain , difficulty eating / feeling full quickly , and frequent or urgent urination . in a study by hamilton and colleagues , symptoms of abdominal distension , urinary frequency , and women with ovarian cancer experience symptoms more frequently , severely , and persistently than women without the disease . olson and colleagues found that bloating , fullness , and abdominal pressure were significantly more likely to be experienced continuously by women with cancer when compared with controls ( 62% versus 36% ) . one of the findings of the current survey is that only 26.4% respondent gps thought that the patient with ovarian cancer are more likely to have frequent , sudden , and persistent symptoms , with only about 20% saying the symptoms are very frequent ( 1230 times a month ) . about one - fifth of the respondent gps were either unsure or not knowing the importance of family history of breast cancer . in the pathfinder study , 23% of the male gps and 4% of female gps were not aware of the importance of the family history of breast cancer . in another questionnaire survey of the gps referring patients to family cancer clinic for breast / ovarian cancer , it was demonstrated that many gps need help to recognise which patients to be referred to the family cancer clinic , with one in four referrals of patients with low risk family history . a further study showed that only 26% of the respondent gps were able to name the three most important criteria used for risk assessment . it is recommended that any woman with symptoms suggestive of ovarian cancer should have a careful pelvic examination . the national institute for health and clinical excellence ( nice , uk ) referral guidelines for suspected cancer in 2005 suggested that any woman with a palpable abdominal or pelvic mass on examination that is not obviously uterine fibroids or not of gastrointestinal or urological origin should have an ultrasound scan . if the scan is suggestive of cancer , or if ultrasound is not available , an urgent referral should be made . in our survey , male gps were more likely ( x = 8.5 , p = 0.01 ) to feel uncomfortable suggesting vaginal examination . similarly , in the pathfinder study , only 68% gps performed vaginal examination before referring a patient with suspected ovarian cancer . many clinicians believe that vaginal examination is a dying skill , uncomfortable , helps only little in terms of diagnosis , and less accurate than ultrasound . there is also increasing fear of patient dissatisfaction compounded by the nonavailability of the chaperone at the time of examination . there is an increasing emphasis on the use of chaperone during intimate examinations by the royal colleges , the general medical council , and the defence organisations . although the detection rate of ovarian cancer by clinical examination is not very high , a fear to carry out vaginal examinations may result in increase in the number of referrals for pelvic ultrasound , with no obvious benefit . in fact , a large us randomized trial found some harm to women who were screened annually with a transvaginal ultrasound exam and a ca-125 blood test compared with a usual care control group . it is important to note that nice , uk has since updated the guidance for recognition and initial management of ovarian cancer in 2011 , which now suggests that those patients identified by examination to have ascites or abdominal or pelvic mass should be referred urgently . as our survey was carried out before publication of the new nice guidance , it would be of great interest to repeat the survey to assess the change in practice in primary care in light of the new nice guidance on ovarian cancer . we aim to carry out a repeat survey as soon as the funding becomes available . our study highlights the importance of regular updates and information as a tool to keep abreast with current research evidence . there is a need for regular physician updates with discussion on recent evidence and research to dissipate the knowledge among the primary care clinicians . gynaecological oncology centres with interested charities should work with primary care clinicians to increase the awareness of risk factors for ovarian cancer and current research in symptom based detection of ovarian cancer amongst health care professionals . one of the limitations of this survey is the relatively low response rate ( 27.4% ) compared to other postal questionnaire surveys of health care professionals in primary care [ 33 , 34 ] . nevertheless , the number of responses we received constituted a large sample size to inform conclusions . kelley and colleagues also noted in their article that postal questionnaires usually have low response rate of about 20% depending on the content and length of questionnaire . for this reason , a large sample size is required to ensure that the demographic profile of survey respondents reflects that of the survey population and to provide sufficiently large dataset for analysis . in spite of the above - mentioned shortfalls , the current questionnaire - based survey has given some very important messages with regard to clinician 's perception on knowledge and awareness of ovarian cancer symptoms and risk factors . majority of the respondent primary care clinicians were well aware of the common symptoms that may suggest an underlying ovarian cancer . however , the relevance of gastrointestinal symptoms such as altered bowel habits , feeling full quickly , and indigestion were not identified . as about 10% of ovarian cancers are genetically linked , it is absolutely vital that all health care professionals are aware of the importance of family history of breast and ovarian cancer . with increasing evidence that almost all patients with ovarian cancer have symptoms , and they report them to their clinicians , the onus is on clinicians to identify and refer the patients urgently in a timely manner . regular updates would keep the clinicians aware of the ongoing research in the field as new evidence become available more rapidly .

in spite of the increased awareness of ovarian cancer symptoms , the predictive value of symptoms remains very low . the aim of this paper is to obtain the views of general practitioners ( gps ) in relation to symptom - based detection of ovarian cancer and to assess their knowledge for family history of breast and/or ovarian cancer as a predisposing factor for ovarian cancer . in this questionnaire survey , postal questionnaires were sent to 402 gps in 132 primary care clinics , out of which we obtained 110 replies ( 27.4% ) . approximately 26% of respondent gps thought that the symptoms were more likely to be frequent , sudden , and persistent , and one - fifth were unsure of the importance of family history of breast cancer in relation to ovarian cancer . the participant gps scored a set of symptoms for their relevance to ovarian cancer from 0 ( not relevant ) to 10 ( most relevant ) . the highest scored symptoms were abdominal swelling ( mean sd , 8.19 2.33 ) , abdominal bloating ( 7.01 3.01 ) , and pelvic pain ( 7.46 2.26 ) . there was a relative lack of awareness for repetitive symptoms as well as gastrointestinal symptoms as an important feature in a symptom - based detection of ovarian cancer .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Limitations 6. Conclusion

a double - orifice mitral valve ( domv ) is a rare congenital malformation of the tensor apparatus such as the chordae tendineae and papillary muscles1 ) . since this was first described by greenfield in 1876 , more than 200 cases of domv have been reported2 ) . domv rarely occurs as an isolated anomaly : this disease is generally associated with a variety of other cardiac anomalies such as coarctation of the aorta , a bicuspid aortic valve , ebstein 's anomaly , and most commonly , atrioventricular septal defects1 , 3 ) . there are various hemodynamic effects for domv and the functioning of mitral leaflets is normal in most cases , but these leaflets can be regurgitant or stenotic4 ) . we present here an unusual case of a 75-year - old woman who had congenital domv that was accompanied by mitral regurgitation due to the flail leaflet . to our knowledge , this is the first described case of domv with a flail leaflet in korea . a 75-year - old woman was referred to our hospital because of her mild exertional dyspnea and cardiac murmur . she had a long history of hypertension : 5 years earlier , she underwent a coronary angiographic study at our hospital because of her chest pain ; no significant stenosis was found except for some minimal narrowing that was noted at the middle portion of the left anterior descending artery . during the same period , the precordial echocardiographic study revealed a slight left atrial enlargement and mild mitral regurgitation , but the quality of imaging resolution was poor and any further evaluation was not performed . the patient reported that she had been doing well until a few weeks earlier when she started suffering from a shortness of breath during mild exercise . three days before her referral to the hospital , she had visited a general practitioner to get an evaluation of her symptoms . the doctor heard the murmur during the examination of the heart and he found blunting of the right costophrenic angle on the chest x - ray , so he referred her to us for further evaluation . at the time of her second presentation , the patient had light dyspnea and a harsh pansystolic murmur ( grade 3/6 ) echocardiography ( vivid 7 , ge ) revealed left ventricular hypertrophy and dilatation of the left atrium . there was also a very eccentric mitral regurgitation , but the morphology of the valve and the severity of the mitral regurgitation could not be precisely determined due to the poor image quality of the patient 's test results . transesophageal echocardiography ( tee ) clearly showed that the mitral valve was composed of two distinct orifices that were separated by a central fibrous bridge . it is interesting that each orifice had its own chordae tendineae tethered to a different papillary muscle ( figure 1a , 1b ) . the transgastric short axis view revealed a larger posteromedial orifice and a smaller anterolateral orifice ( figure 2 ) . the posteromedial orifice was competent without any evidence of regurgitation or stenosis . at the level of anterolateral orifice , the color doppler revealed moderate to severe eccentric regurgitation due to the flail posterior leaflet ( figure 3a , 3b ) . no other congenital cardiac anomalies were noted except for the persistent left superior vena cava that was demonstrated by injecting agitated saline at the antecubital vein of the left arm ( figure 4 ) . the patient became asymptomatic with the administration of angiotensin - converting enzyme inhibitor and diuretics . she was scheduled for long term follow - up and prophylaxis was recommended for any potential infectious endocarditis . domv consists of two anatomically distinct mitral orifices that are divided by an accessory bridge of fibrous connective tissue . however , it is conceivable that the occurrence of abnormal differentiation of the mesenchymal endocardial cushion tissue into chordae instead of the leaflet tissue can result in such a defect1 ) . the domv tensor apparatus is always abnormal and in the most common form , each orifice is separately attached to their individual , single papillary muscle , and this creates a kind of double parachute mitral valve , as was observed in our case . trowitzsch et al . suggested it possible to distinguish three types of domv by sweeping the transducer in a cross - sectional view from the apex toward the base of the heart4 ) . our case could be classified as the complete bridge type in which two separate , complete orifices were seen at all levels of the mitral valve leaflets . although most of these cases are detected in childhood , domv has recently been reported on in adulthood or even in the elderly population , like our case5 ) . in korea , there are 3 case reports of domv , and two of these defects were found in children6 , 7 ) and the other was found in a 42-year - old adult8 ) . our current case is the first described case of domv in an elderly korean patient , and this patient 's heart defect was especially accompanied by the flail leaflet . to get a better picture of this defect , we used an appropriate precordial echocardiographic series of scan planes that were derived from various transducer positions ; this series of scans can usually be readily obtained in pediatric patients and the high resolution of the images is generally observed . thus , the multiplane transesophageal approach with color flow mapping is superior to the precordial imaging for assessing the anatomical and functional status of this heart defect and for identifying any coexisting malformations , especially in adults or in the elderly patients9 - 11 ) . the usefulness of three - dimensional echocardiography for helping define the spatial location and the extent of the deformities in domv has been recently reported12 ) . the clinical implications for this anomaly depend upon the severity of the regurgitation and also on the presence of any stenosis or associated malformations . the clinical features of this case suggest that this congenital domv had a relatively normal function for many years . compared with the echocardiographic study that was conduced 5 years earlier , the mitral valve became flail later in life and it was recently aggravated to allow moderate to severe mitral regurgitation , and so the patient developed her symptoms . domv has an unusual importance to surgeons because it requires the physician to decide whether or not to replace or repair the valve , and domv is usually associated with other cardiac abnormalities . in spite of these difficulties , the mitral valve was successfully repaired in two similar reported cases of domv with flail leaflet13 , 14 ) . one case of domv with severe mitral regurgitation due to a partial flail leaflet was recently reported , and in this case the mitral valve was replaced with a mechanical prosthesis15 ) . in our case , the patient had a history of hypertension and there was also some evidence of volume overload on the chest x - ray , and so we administered diuretics and angiotensin - converting enzyme inhibitor to lower the blood pressure and the filling pressures . this case demonstrates that careful examination is needed even in the elderly patients with mitral regurgitation , and if two separated orifices are present that are supplied by their own chordae from a different papillary muscle , then domv should be suspected and the patient should be assessed by using tee . further , this case remind us that domv is anatomically complex disease , it is commonly associated other cardiac abnormalities and a precise anatomical and functional assessment is required , especially in those cases in which surgical repair or valve replacement is needed .

we report here on a case of double - orifice mitral valve with mitral regurgitation in a 75-year - old female who had complaints of mild dyspnea . transthoracic and transesophageal echocardiography showed two orifices that were supplied by their own chordae from a different papillary muscle . color doppler echocardiography revealed moderate to severe mitral regurgitation due to the flail posterior leaflet of the anterolateral orifice . except for the persistent left superior vena cava , no other congenital anomaly was demonstrated . the patient became asymptomatic with the administration of angiotensin - converting enzyme inhibitor and diuretics , and she has been scheduled for long term follow - up .

INTRODUCTION CASE REPORT DISCUSSION

the pathological hallmarks of pd include progressive loss of nigro - striatal dopaminergic neurons and the presence of -synuclein - containing lewy bodies in the substantia nigra pars compacta ( snpc ) and other sites of the brain . in contrast , mutations in different genes and environmental factors collectively account for most of the sporadic pd . there is ample evidence to suggest that it most likely results from an elaborate interplay of various factors : genetic predispositions , modifying effects by susceptible alleles , environmental exposures , gene environment interactions , and their direct impact on the developing and aging brain . several pathways have been linked to pd pathogenesis including the presence of inflammation in the snpc , oxidative stress , mitochondrial dysfunction , accumulation of atypical or misfolded protein , malfunction of ubiquitin - proteasome pathway , impairment of autophagolysosomes , and alterations of synaptic function and endosomal trafficking . more recently , the role of inflammation in the pathogenesis of pd has gained rising attention . pathology of substantia nigra of postmortem pd has shown cd8 and cd4 t - cell infiltration , accumulations of microglia cells and astrocytes , and alterations in glial cell morphology and function . . direct injection of -synuclein into the substantia nigra resulted in the upregulation of mrna expression of proinflammatory cytokines and microglial activation . microglia are the resident innate immune cells in the central nervous system and produce several factors ( interleukins [ ils ] , tumor necrosis factor - alpha [ tnf- ] , nitric oxide [ no ] , prostaglandin e2 [ pge2 ] , matrix metalloproteinases [ mmps ] , etc ) . among these factors produced by activated microglia , accumulating evidence suggests that mmps are involved in the neuropathological processes such as inflammation , blood brain barrier ( bbb ) damage and neuronal cell death , which lead to central nervous system disorders such as pd . inducers of mmp expression and activity , such as cytokines , no , and reactive oxygen species are implicated in the pathophysiology of pd . tissue inhibitors of metalloproteases ( timps ) have inhibitory actions against most mmps with some predilections : timp-1 mainly inhibits mmp-9 , whereas timp-2 inhibits mmp-2 and , paradoxically , contributes to activation of pro - mmp-2 . in the 4 main categories of mmp family , mmp-3 ( one of the stromelysins ) has been reported to influence pathogenesis of pd by generation of specific aggregation - enhancing -synuclein fragments resulting from limited proteolysis . mmp-3 was induced and activated in dopaminergic cells upon stress conditions . in the postmortem brains of pd patients , -synuclein and mmp3 mmp-3 contributes to the loss of dopaminergic neurons in a mouse model of pd with bbb damage and infiltration of peripheral immune cells . in addition , gelatinases ( mmp-9 and mmp-2 ) have been shown to be related to pd . reduced mmp-2 and increased timp-1 levels were shown in substantia nigra of postmortem brain of pd . increased timp-1 levels in cerebrospinal fluid ( csf ) of pd patients were also shown . although these findings pointed towards a possible link between mmps and timps and pathogenesis of pd , the associations between genetic polymorphisms of the mmp / timp pathway and the susceptibility to pd are largely unknown in the taiwan population . a prior report showed no association between mmp-3 1171 ( 5a/6a ) and pd risks in finns ; however , the sample number was small . a significant association between the 1562 c > t polymorphism in the mmp-9 gene and risk of pd has been reported in chinese . the study herein is a case control study that examines whether the single nucleotides polymorphisms ( snps ) of mmp-3 , gelatinase ( mmp-2 and mmp-9 ) , and their counter - proteins ( timp-2 and timp-1 ) are associated with pd susceptibility in the taiwan population . patients ( mean age at onset 61.0 11.5 years , age at recruitment 68.4 10.8 years , 49.6% women ) diagnosed with pd were recruited from the neurology clinics of chang - gung memorial hospital ( cgmh ) . all patients were diagnosed with probable sporadic pd according to the united kingdom pd society brain bank clinical diagnostic criteria . controls were recruited from unrelated healthy adult volunteers ( age at recruitment 67.4 8.1 years , 50.3% women ) matched for age , gender , and ethnicity . we selected a promoter variant rs2285053 ( 735 c > t ) which increased mmp-2 transcription . the common polymorphism rs3025058 ( 1171 5a/6a ) in the promoter of mmp-3 gene affected the mmp-3 gene expression , in which the 5a allele was associated with higher transcriptional activity compared to 6a allele . the snps of mmp-9 , located at 20q13 , were selected based on international hapmap data on ncbi build 36 assembly for asian population and our prior experience , including rs3918241 ( 1831 t > a , promoter ) , rs17576 ( g > a , missense variant r279q , exon6 ) , and rs3787268 ( g > a , intron ) . for the timp-1 gene ( cytogenetic location at xp11.23 ) , we selected rs4898 ( t > c , synonymous , f124f , exon5 ) which is a strong tag snp for han chinese . for the timp-2 gene ( cytogenetic location at 17q25.3 ) , we selected timp-2 rs7503607 ( 269 g > t ) which is 8 base pairs away from 261 g > a and fits the condition for taqman snp assays . polymorphisms were genotyped by the taqman snp assays using the abi prism 7900ht sequence detection system ( table 1 ) . all the snps are in hardy weinberg equilibrium with significance level set at 0.05 to control snp quality . primers for genotyping of single nucleotides polymorphisms ( snps ) using the taqman snp assays the differences in allele frequencies of snps between pd patients and controls were analyzed by the test and fisher exact test where appropriate . multivariable logistic regression was used to analyze the phenotype - genotype associations of pd first under the additive genetic model and then the recessive model based on the distribution of genotypes . control study , at the 0.05 significance level , we had power > 0.8 to identify an association of each genetic variant with pd susceptibility when the per - allele genetic effect was greater than an odds ratio of 1.4 . analyses were performed using sas software version 9.1.3 ( sas institute , cary , nc ) . patients ( mean age at onset 61.0 11.5 years , age at recruitment 68.4 10.8 years , 49.6% women ) diagnosed with pd were recruited from the neurology clinics of chang - gung memorial hospital ( cgmh ) . all patients were diagnosed with probable sporadic pd according to the united kingdom pd society brain bank clinical diagnostic criteria . controls were recruited from unrelated healthy adult volunteers ( age at recruitment 67.4 8.1 years , 50.3% women ) matched for age , gender , and ethnicity . we selected a promoter variant rs2285053 ( 735 c > t ) which increased mmp-2 transcription . the cytogenetic location of mmp-3 is at 11q22 . the common polymorphism rs3025058 ( 1171 5a/6a ) in the promoter of mmp-3 gene affected the mmp-3 gene expression , in which the 5a allele was associated with higher transcriptional activity compared to 6a allele . the snps of mmp-9 , located at 20q13 , were selected based on international hapmap data on ncbi build 36 assembly for asian population and our prior experience , including rs3918241 ( 1831 t > a , promoter ) , rs17576 ( g > a , missense variant r279q , exon6 ) , and rs3787268 ( g > a , intron ) . for the timp-1 gene ( cytogenetic location at xp11.23 ) , we selected rs4898 ( t > c , synonymous , f124f , exon5 ) which is a strong tag snp for han chinese . for the timp-2 gene ( cytogenetic location at 17q25.3 ) , we selected timp-2 rs7503607 ( 269 g > t ) which is 8 base pairs away from 261 g > a and fits the condition for taqman snp assays . polymorphisms were genotyped by the taqman snp assays using the abi prism 7900ht sequence detection system ( table 1 ) . all the snps are in hardy weinberg equilibrium with significance level set at 0.05 to control snp quality . the differences in allele frequencies of snps between pd patients and controls were analyzed by the test and fisher exact test where appropriate . multivariable logistic regression was used to analyze the phenotype - genotype associations of pd first under the additive genetic model and then the recessive model based on the distribution of genotypes . control study , at the 0.05 significance level , we had power > 0.8 to identify an association of each genetic variant with pd susceptibility when the per - allele genetic effect was greater than an odds ratio of 1.4 . analyses were performed using sas software version 9.1.3 ( sas institute , cary , nc ) . the allele frequency distributions of the examined polymorphisms in pd patients and controls are displayed in table 2 . minor allele frequency ( maf ) of timp-1 rs4898 ( 36.0% ) were significantly lower in the male pd patients , compared with that in the male controls ( 51.2% ) ( test , p = 0.004 ) . the frequency of minor allele in all of the other examined genetic variants was not different between pd patients and controls . the distributions of genotypes of the candidate variants and the associations of individual genetic variant with pd risk are displayed in table 3 . when adjusted with gender and age of onset , we found that mmp-9 rs17576 aa genotype was associated with pd susceptibility in a recessive fashion ( odds ratios [ or ] = 2.28 , 95% confidence intervals [ 95% ci ] = 1.124.62 , p = 0.02 ) . in men , timp-1 rs4898 c allele was associated with a protective effect on pd ( or = 0.75 , 95% ci = 0.60 to 0.94 , p = 0.014 ) . we did not find association between the examined variants of mmp-2 , mmp-3 , and timp-2 and pd susceptibility . in addition , pairwise haplotype analysis of the 3 polymorphisms of mmp-9 showed no additional information regarding pd susceptibility . comparison of minor allelic frequency between parkinson disease ( pd ) cases and controls the distributions of genotypes of the candidate variants and the associations of individual genetic variant with pd risk this is the first study showing associations of mmp-9 and timp-1 variants with pd susceptibility . for mmp-9 , a prior study showed a significant association between 1562 c > t ( rs3918242 ) polymorphism in the mmp-9 gene and pd risk in chinese . although we did not find association between pd risk and rs3918241 , the selected polymorphism at mmp-9 promoter , we discovered association between rs17576 aa genotype ( missense variant r279q , exon 6 ) and pd risk . for the timp1 gene , the tag snp rs4898 is considered to represent a complete haplotype block covering the whole timp1 gene , based on international hapmap data on ncbi build 36 assembly for asian population . we found that carriers of minor allele t of timp1 rs4898 might be protected from pd risk in the male group . for mmp-2 and timp-2 , we did not find associations between the selected polymorphisms and pd . for mmp-3 , this study supported the prior finns research which demonstrated no association between mmp-3 and pd . because the significance of the discovered associations is weak , further replication study with larger sample size is needed to confirm our findings . recently , increasing attention has been drawn to the role of inflammation in the pathogenesis of pd . metalloproteinases are a large family of important proteases that include mmps and proteins with a disintegrin and metalloproteinase domains ( adams ) . mmps produced by activated microglia are proinflammatory factors and have been implicated to contribute to the pathogenesis of neurodegenerative diseases including pd . microglia stimulated by alpha - synuclein induced the expression of mmp-1 , -3 , -8 , and -9 and inhibition of mmp-3 , -8 , or -9 suppresses the production of no and other proinflammatory cytokines in primary microglia . 6-hydroxydopamine ( 6-ohda ) and 1-methyl-4-phenylpyridinium ( mpp ) increased mmp-9 gene expression by inducing nuclear factor kappa - light - chain - enhancer of activated b cells ( nf-b ) binding to the mmp-9 promoter in human neuroblastoma cells . all of these suggest the expression of mmps may contribute the pathogenesis of pd and expression of mmps may influence the risk of pd . the promoter regions of the inducible genes encoding mmps generally contain binding sites for transcription factors such as activator proteins and nf-b . activation of the nf-b that controls target genes encoding proinflammatory cytokines , adhesion molecules , chemokines , and inducible enzymes , has been shown in pd brain . reduced mmp-2 and increased timp-1 have been shown in substantia nigra of postmortem brain from pd patients . increased timp-1 levels in csf of pd patients our study further provides evidence of link between mmps / timps and pd , although this study demonstrates only modest significant association of mmp-9 and timp-1 polymorphisms with pd susceptibility . missense variation of rs17576 causes change in the catalytic domain and pexin - like domain of the mmp-9 enzyme , leading to polarity and functional change , which may thus contribute to enhanced inflammatory process . first , the protective genetic effect of rs4898 c allele of timp1 and the risk imposed by rs17576 aa genotype of mmp-9 on pd were not strong , and it is worth mentioning that the weak significance of the discovered associations might not survive during statistic correction of multiple testing . in addition , this study does not exclude association of pd with other snps within genes mmp2 , mmp3 , and timp2 . finally , the biological relevancies of the rs4898 c allele of timp1 and aa genotype of mmp-9 are not clear , which remains to be investigated . further replicated studies with large sample size are needed to confirm our results before these candidate snps can be viewed as independent predictors of pd . in summary , this is the first study that demonstrated modest association of mmp-9 rs17576 aa genotype with pd susceptibility and a protective effect of timp-1 rs4898 c allele on pd . the mmp / timp pathway posing a risk factor for pd may not be disease - specific , given that these polymorphisms could be risk factors for other medical conditions . further functional studies are needed to clarify the pathophysiology underlying the association between mmp-9 and timp-1 and pd risk and provide the additional functional information to support our findings .

abstractmatrix metalloproteinases ( mmps ) function in the degradation of extracellular matrix and are considered to play a role in the pathogenesis of neurodegenerative diseases including parkinson disease ( pd ) . mmps activities are modulated by tissue inhibitors of metalloproteinases ( timps ) . this study examined whether the genetic polymorphisms of mmp-3 , gelatinase ( mmp-2 and mmp-9 ) , timp-2 , and timp-1 were associated with pd in taiwan.a total of 359 pd patients and 332 controls were enrolled . the candidate genetic variants included mmp-2 rs2285053 ( 735 c > t ) , mmp-3 rs3025058 ( 1171 5a > 6a ) , mmp-9 rs3918241 ( 1831 t > a ) , rs17576 ( g > a , r279q ) , and rs3787268 ( g > a , intron ) , timp-1 rs4898 ( t > c , f124f ) , and timp-2 rs7503607 ( 269 g > t ) . associations were tested by logistic regression , adjusted with gender and age at onset.minor allele frequency of timp-1 rs4898 ( 36.0% ) was significantly lower in the male pd patients than in the male controls ( 51.2% ) ( 2 test , p = 0.004 ) . when adjusted with gender and age at onset , mmp-9 rs17576 aa genotype was associated with pd susceptibility in a recessive fashion ( odds ratios [ or ] = 2.28 , 95% confidence intervals [ 95% ci ] = 1.124.62 , p = 0.02 ) . in males , timp-1 rs4898 c allele was associated with a protective effect on pd ( or = 0.75 , 95% ci = 0.600.94 , p = 0.014 ) . we did not find association between the examined genetic variants of mmp-2 , mmp-3 , and timp-2 and pd susceptibility.this is the first study that demonstrated a protective effect of timp-1 rs4898 c allele on male pd and a modest association of mmp-9 rs17576 aa genotype with pd susceptibility in the taiwan population . further replication is needed for confirmation .

INTRODUCTION Methods Subjects Polymorphism Selection and Detection Statistical Analysis and Power Estimation RESULTS DISCUSSION

several biochemical and physiological studies have demonstrated the importance of calcium in regulating vascular and myocardial contraction , activating membrane receptors during cellular signal transduction , releasing many hormones by exocytosis , controlling several transport processes and promoting thrombus formation as co - factor iv ( 1 - 4 ) . total serum calcium exists in three forms : 1 ) ionized , normally 50% of the total ; 2 ) bound to plasma proteins such as albumin , usually 40% of the total ; and 3 ) complexed to anions such as lactate and phosphate , usually 10% of the total . initial ionized calcium ( ica ) , the physiologically active form of calcium found in the blood is regulated by homeostasis ( 5 ) . hypocalcemia has been reported in critically ill patients , most commonly in association with septic condition ( 6 ) . it may vary from an asymptomatic biochemical abnormality to a severe life - threatening condition depending on the duration , severity , and rapidity of development . the causes of hypocalcemia arise either from increased loss of calcium from the circulation or from insufficient entry of calcium into the circulation . it is well recognized that all pathophysiologic changes in shock and trauma have their basis at the cellular and molecular levels . a recent study observed hypocalcemia in 88% of critically ill patients , and a correlation between decreased calcium levels and increased mortality ( 6 ) . however , the relationship between hypocalcemia and mortality risk in trauma patients has not been well defined . base deficit , systemic inflammatory response syndrome ( sirs ) score , and triage - revised trauma score ( t - rts ) are three well - known predictors for the mortality in trauma patients as well as triage tools . therefore , the purpose of the present study was to assess the usefulness of initial ica in predicting mortality , and evaluate its superiority over these three triage tools in the trauma population . arterial blood gas analysis ( abga ) was performed on all trauma patients satisfying the following inclusion criteria in our emergency medical center ( emc ) : 1 ) altered mental status ( glasgow coma scale [ gcs ] score < 13 ) ; 2 ) hemodynamic instability ( initial systolic blood pressure [ sbp ] < 90 mmhg or heart rate > 100 beats per minute ) ; 3 ) respiratory compromise ( < 10 or > 29 breaths per minute ) ; 4 ) severe craniofacial fractures with extensive hemorrhage and/or airway compromise ; 5 ) flail chest ; 6 ) any penetrating injuries to the head , neck , torso , or extremities proximal to the elbow and knee ; 7 ) limb paralysis ; 8) amputation proximal to wrist and ankle ; 9 ) two or more proximal long bone fractures ; 10 ) pelvic bone fractures ; 11 ) falls of > 6 meters ; or 12 ) high speed auto crash , roll - over , or pedestrian run over . the following patients were excluded in this study : 1 ) more than 24 hr of time interval from injury onset to arrival on emc ; 2 ) known underlying liver cirrhosis ; 3 ) known underlying chronic renal failure ; 4 ) known parathyroid disease ; 5 ) current treatment for malignancy ; and 6 ) age younger than 16 years . of 278 consecutive trauma patients admitted to our emc from january to december , 2005 who underwent abga , 23 lost to follow - up ( 18 were transferred to other hospitals and 5 had omitted data ) . arterial blood gas , complete blood cell count , gcs score , and vital signs were measured to obtain ica , base deficit , sirs score , and t - rts . abga was performed by an emergency physician within 10 min after arrival at the emergency department ( blood gas analyzer gem premier 3000 , lexington , ma , u.s.a . ) . serum ph , ica , arterial oxygen pressure ( pao2 ) , arterial carbon dioxide pressure ( paco2 ) , serum bicarbonate , base deficit , and arterial oxygen saturation ( sao2 ) levels were automatically measured by abga . of the two values of ica , i.e. , uncorrected and corrected to ph=7.40 , presented in the abga results , the former was used because it seemed to reflect the biochemical and physiological status of patient more closely . the latter was automatically calculated by following equation : corrected ica = uncorrected ica 10 . the measurement 's coefficient of variation was 2.5% and the ica normal range was 1.15 - 1.35 sirs score was calculated by using body temperature , pulse rate , respiratory rate or paco2 , and white blood cell count , and ranged from 0 to 4 . the t - rts is a compound indicator consisting of gcs score , sbp , and respiratory rate , and ranges from 0 to 12 ( 8) . in addition , the following data were obtained in this study : age , sex , mechanism of injury , amount of intravenous fluid ( crystalloid or colloid ) administered in the prehospital phase of care , transfusion amount ( before and after arrival in the emc ) , injury severity score ( iss ) , revised trauma score ( rts ) , emergency operation , infection , and survival . most of the above data had been measured before discharge from the emc and collected prospectively , but the following data had been done retrospectively : transfusion amount after arrival in the emc , iss and infection . furthermore , the abilities of ica and the other three indicators to predict mortality were compared in the following aspects . first , the areas under the curves ( aucs ) on receiver operating characteristic ( roc ) curve analysis of these indicators were obtained to assess their discriminative power for mortality prediction . second , the sensitivities , specificities , and accuracies of these indicators were determined by constructing a contingency table according to survival after these indicators were transformed into dichotomous variables based on severity . sirs score was easily converted into a dichotomous variable via the above definition ( 2 ) . however , having no definite criteria on major trauma , the other indicators were assessed by obtaining the cut - off point with the best separation between survivors and non - survivors on roc curve analysis . , chicago , il , u.s.a . ) and medcalc ( medcalc 9.3 version , medcalc inc . , univariate analysis was performed by using the student 's t test for continuous variables or the chi - square test for categorical variables . all variables found to be significant by univariate analysis then underwent multivariate logistic regression analysis . in addition , the amounts of intravenous fluid ( crystalloid or colloid ) and transfusion administered before arrival in emc were adjusted for multivariate analysis because of the possible effect on ica ( 9 - 11 ) . the differences between the aucs of ica , base deficit , sirs score , and t - rts were determined by using the nonparametric method proposed by hanley and mcneil ( 12 ) . the differences between the sensitivities , specificities , and accuracies of these indicators were determined by using the mcnemar test . all tests for significance were two - tailed with an alpha level of 0.05 . type i error was corrected by the bonferroni 's method for comparisons of 3 or more variables . arterial blood gas analysis ( abga ) was performed on all trauma patients satisfying the following inclusion criteria in our emergency medical center ( emc ) : 1 ) altered mental status ( glasgow coma scale [ gcs ] score < 13 ) ; 2 ) hemodynamic instability ( initial systolic blood pressure [ sbp ] < 90 mmhg or heart rate > 100 beats per minute ) ; 3 ) respiratory compromise ( < 10 or > 29 breaths per minute ) ; 4 ) severe craniofacial fractures with extensive hemorrhage and/or airway compromise ; 5 ) flail chest ; 6 ) any penetrating injuries to the head , neck , torso , or extremities proximal to the elbow and knee ; 7 ) limb paralysis ; 8) amputation proximal to wrist and ankle ; 9 ) two or more proximal long bone fractures ; 10 ) pelvic bone fractures ; 11 ) falls of > 6 meters ; or 12 ) high speed auto crash , roll - over , or pedestrian run over . the following patients were excluded in this study : 1 ) more than 24 hr of time interval from injury onset to arrival on emc ; 2 ) known underlying liver cirrhosis ; 3 ) known underlying chronic renal failure ; 4 ) known parathyroid disease ; 5 ) current treatment for malignancy ; and 6 ) age younger than 16 years . of 278 consecutive trauma patients admitted to our emc from january to december , 2005 who underwent abga , 23 lost to follow - up ( 18 were transferred to other hospitals and 5 had omitted data ) . arterial blood gas , complete blood cell count , gcs score , and vital signs were measured to obtain ica , base deficit , sirs score , and t - rts . abga was performed by an emergency physician within 10 min after arrival at the emergency department ( blood gas analyzer gem premier 3000 , lexington , ma , u.s.a . ) . serum ph , ica , arterial oxygen pressure ( pao2 ) , arterial carbon dioxide pressure ( paco2 ) , serum bicarbonate , base deficit , and arterial oxygen saturation ( sao2 ) levels were automatically measured by abga . of the two values of ica , i.e. , uncorrected and corrected to ph=7.40 , presented in the abga results , the former was used because it seemed to reflect the biochemical and physiological status of patient more closely . the latter was automatically calculated by following equation : corrected ica = uncorrected ica 10 . the measurement 's coefficient of variation was 2.5% and the ica normal range was 1.15 - 1.35 sirs score was calculated by using body temperature , pulse rate , respiratory rate or paco2 , and white blood cell count , and ranged from 0 to 4 . the t - rts is a compound indicator consisting of gcs score , sbp , and respiratory rate , and ranges from 0 to 12 ( 8) . in addition , the following data were obtained in this study : age , sex , mechanism of injury , amount of intravenous fluid ( crystalloid or colloid ) administered in the prehospital phase of care , transfusion amount ( before and after arrival in the emc ) , injury severity score ( iss ) , revised trauma score ( rts ) , emergency operation , infection , and survival . most of the above data had been measured before discharge from the emc and collected prospectively , but the following data had been done retrospectively : transfusion amount after arrival in the emc , iss and infection . furthermore , the abilities of ica and the other three indicators to predict mortality were compared in the following aspects . first , the areas under the curves ( aucs ) on receiver operating characteristic ( roc ) curve analysis of these indicators were obtained to assess their discriminative power for mortality prediction . second , the sensitivities , specificities , and accuracies of these indicators were determined by constructing a contingency table according to survival after these indicators were transformed into dichotomous variables based on severity . sirs score was easily converted into a dichotomous variable via the above definition ( 2 ) . however , having no definite criteria on major trauma , the other indicators were assessed by obtaining the cut - off point with the best separation between survivors and non - survivors on roc curve analysis . chicago , il , u.s.a . ) and medcalc ( medcalc 9.3 version , medcalc inc . , univariate analysis was performed by using the student 's t test for continuous variables or the chi - square test for categorical variables . all variables found to be significant by univariate analysis then underwent multivariate logistic regression analysis . in addition , the amounts of intravenous fluid ( crystalloid or colloid ) and transfusion administered before arrival in emc were adjusted for multivariate analysis because of the possible effect on ica ( 9 - 11 ) . the differences between the aucs of ica , base deficit , sirs score , and t - rts were determined by using the nonparametric method proposed by hanley and mcneil ( 12 ) . the differences between the sensitivities , specificities , and accuracies of these indicators were determined by using the mcnemar test . all tests for significance were two - tailed with an alpha level of 0.05 . type i error was corrected by the bonferroni 's method for comparisons of 3 or more variables . the mean age of the study population was 47.216.0 yr with a range from 16 to 90 yr . the mean iss was 18.59.2 ( range 4 - 75 ) and mean rts was 7.081.39 ( range 0 - 7.84 ) . blunt trauma was the predominant mechanism of injury at 95.3% ( 243 patients ) , with penetrating injury accounting for only 4.7% . traffic accident injuries were the most common at 60.0% , followed by injuries due to falls at 25.5% , other blunt traumas at 9.8% , and stab injuries 4.7% . age , sex , and mechanism of injury were not associated with mortality ( table 1 ) . univariate analysis confirmed the following to be correlated with mortality : ica , gcs score , serum bicarbonate , base deficit , sao2 , initial sbp , pulse rate , body temperature , sirs score , t - rts , emergency operation , transfusion amount , iss , and rts ( p<0.05 , table 2 ) . on roc curve analysis , the ica cut - off point for mortality prediction was 0.88 mm / l ( fig . the patients were divided into three groups according to this ica cut - off point and the recognized cut - off point for normal condition : 1 ) normal ica concentration ( 1.15 the frequencies of these groups were 7 ( 2.7% ) , 195 ( 76.5% ) , and 53 ( 20.8% ) , respectively . the severity of ionized hypocalcemia was significantly associated with mortality ( p=0.003 , table 3 ) . the cut - off points of the base deficit and t - rts were -6.3 mm / l and 11 , respectively . the cut - off point of sirs score was determined by the inherent sirs score definition of 2 or more . based on these cut - off points , the four indicators were transformed into dichotomous variables , after which the other significant factors as well as amounts of intravenous fluid and blood transfusion administered in the pre - hospital phase were adjusted for multivariate analysis . multivariate logistic regression analysis confirmed ica ( 0.88 mm / l ) , gcs score , and transfusion amount after arrival in the emc to be associated with mortality ( p<0.05 , table 4 ) . the auc of t - rts for mortality prediction was 0.8750.043 ( 95% confidence interval [ ci ] ) and it exhibited excellent discrimination . those of ica and sirs score were 0.6070.062 ( 95% ci ) and 0.6940.059 ( 95% ci ) , respectively , with poor discrimination ( fig . the auc of ica was not different from that of sirs , but smaller than those of the other predictors ( p<0.05 ) . the sensitivities of ica , base deficit , sirs score , and t - rts were 82.9% , 76.4% , 67.1% , and 74.5% , their specificities were 41.0% , 64.1% , 64.1% , and 87.2% , and their accuracies were 76.5% , 74.5% , 66.7% , and 76.5% , respectively ( table 5 ) . the sensitivity of ica was higher than that of sirs score , but the specificity of ica was lower than that of t - rts ( p<0.01 ) . ionized hypocalcemia is a common finding in the intensive care unit ( icu ) , particularly in patients with sepsis , major trauma or pancreatitis ( 4 , 6 , 13 ) . it has been shown to be of prognostic value due to its relation with mortality in critically ill patients ( 6 , 10 , 13 - 15 ) . insufficient secretion or inhibited action of parathyroid hormone , decreased vitamin d3 production , and increased calcium deposition , both intra- and extra - cellularly , have all been suggested to be involved in the pathogenesis of hypocalcemia ( 4 ) . , calcium plays a critical role , but few studies have attempted to clearly define the consequences of low ica concentrations such as compromised hemodynamics . the contractile function of the heart is compromised during hypocalcemia but rapid and reliable recovery is achieved by calcium administration ( 16 ) . frank cardiac failure and a prolonged qt interval have been observed at ica levels of approximately 0.5 mm / l ( 17 ) . in addition , blood coagulation may be compromised due to hypocalcemia at ica levels of < 0.6 - 0.7 mm / l ( 18 ) . hastbacka and pettila ( 19 ) measured ica in a cohort of 941 consecutive , critically ill patients . mm / l ) in 85% of patients at icu admission . in their study , they first defined the cut - off point for severe ionized hypocalcemia as 0.9 mm / l , but did not present clear evidence for this definition . our study results supported an ica cut - off point for mortality prediction of 0.88 mm / l , with a lower level indicating severe ionized hypocalcemia . as expected , our criterion of severe ionized hypocalcemia was similar to theirs . vivien et al . ( 10 ) measured ica in a cohort of 212 consecutive , severe trauma patients . they found mild ( 0.90 - 1.14 mm / l ) and severe ( < 0.90 mm / l ) ionized hypocalcemia in 64% and 10% of patients at hospital admission , respectively . their study results indicated a progressive increase in mortality with decreasing ica levels , in agreement with our own results ( table 3 ) . in the present study , severe ionized hypocalcemia , low gcs score , and large transfusion amount received after arrival in the emc were significantly associated with mortality on multivariate logistic regression analysis . such a correlation of severe ionized hypocalcemia to mortality was also shown by previous studies using multivariate analysis ( 19 , 20 ) . several studies have reported that ica concentration might be influenced by intravenous fluid ( crystalloid or colloid ) or blood transfusion . fulgenico et al . ( 9 ) reported that the amount of crystalloids administrated to the patient after brain death was significantly correlated with plasma ionized calcium concentration . vivien et al . ( 10 ) demonstrated that the volume of colloids administered was significantly and negatively correlated with ica concentration . another study found that elevations in circulating citrate levels and speed of transfusion were correlated with decreases in ica concentration during blood transfusion ( 11 ) . based on these reported findings , we included the amounts of these factors administrated in the prehospital phase of care in the multivariate regression , even though they were not associated with mortality on univariate analysis . however , the result was same as that of multivariate regression analysis with these factors excluded . this unexpected result was thought to be due to the lack of any significant association of ica concentration with these factors on correlation analysis and/or to the small patient population underwent blood transfusion ( eight cases ) and colloid infusion ( only one case ) in the prehospital phase ( data not shown ) . as aforementioned however , this may not be reflected in a sufficient discriminative power of ica for mortality prediction ( 21 , 22 ) . we therefore performed two discriminative analyses : 1 ) corresponding statistics of classification tabulations , i.e. , sensitivities , specificities and accuracies ; and 2 ) auc by roc analysis . only one previous study by hastbacka and pettila performed such discriminative analyses for ica mortality prediction ( 19 ) . the discrimination of roc analysis in their study was an auc of 0.636 ( 95% ci 0.591 - 0.681 ) , while the sensitivity and specificity of severe ionized hypocalcemia were 98% and 7% for mortality , respectively . the discrepancies of the sensitivities and specificities between the two studies seem to have been due to differences in patient selection : all subjects in our study were trauma patients , whereas only 3% in their study were . we recently reported that base deficit , t - rts , and sirs score were associated with mortality and that the first two were significant mortality predictors , despite their different discriminative powers in the following order : t - rts > base deficit > sirs score ( 23 ) . however , no study has compared the discriminative powers of ionized hypocalcemia and these predictors before the present study . in our study , using corresponding statistics of classification tabulations for mortality , the discriminative power of ica was the same as or inferior to that of base deficit and t - rts , except for sirs score . moreover , discrimination by roc analysis for mortality prediction revealed that auc of ica was 0.607 , which was considered a poor discrimination in general . on the other hand , the aucs of base deficit ( 0.736 ) and t - rts ( 0.875 ) represented acceptable and excellent discrimination , respectively , as in our previous study ( 23 ) . abga requires only one puncture for blood sampling and can be performed within a few minutes . all the obtained results including ica and base deficit , can be easily utilized without any modification . however , sirs score and t - rts are not single factors , but are compound factors consisting of several factors that require certain modification by recoding . in addition , the former shows little variation because they comprise instrument - measured data , whereas the latter may suffer from greater variation due to partial or complete human measurement , i.e. , doctors , nurses , or emergency medical technicians . in a recent study , gcs score and its components , one of the three parts of the t - rts compound indicator , were found to have only a moderate degree of interrater agreement ( 24 ) . unfortunately , despite its several advantages , ica suffered from the fatal disadvantage of a low discriminative power , which is the most important property for mortality predictor . the limitation of this study was a possible selection bias in selecting the patient population , which may have resulted from the small sample size and the single center approach . therefore , we suggest that a multi - center or randomized trial be conducted in the future to avoid these biases and confirm our results . in conclusion , ica was a significant risk factor associated with mortality , but with a poorer discriminative power for mortality prediction and triage than previous mortality predictors , especially t - rts . the ica predictor is a single factor , whereas t - rts is a compound indicator consisting of three factors ( gcs score , sbp , and respiratory rate ) which have been recognized as mortality predictors . considering the difficulty and complexity in measuring t - rts , its superiority to ica as a mortality predictor is understandable . if a new predictor combining ica with the other significant factors known to be associated with mortality can be developed , we expect that it may be a superior mortality predictor than t - rts .

ionized hypocalcemia is a common finding in critically ill patients , but the relationship between ionized hypocalcemia and mortality risk in trauma patients has not been well established . the aim of this study was to assess the usefulness of initial ionized calcium ( ica ) in predicting mortality in the trauma population , and evaluate its superiority over the three other triage tools : base deficit , systemic inflammatory response syndrome ( sirs ) score , and triage - revised trauma score ( t - rts ) . a proand retrospective study was performed on 255 consecutive trauma patients admitted to our emergency medical center from january to december , 2005 , who underwent arterial blood gas analysis . multivariate logistic regression analysis confirmed ica ( 0.88 mm / l ) , low glasgow coma scale score , and a large transfusion amount to be significant risk factors associated with mortality ( p<0.05 ) . the sensitivities of ica , base deficit , sirs score , and t - rts were 82.9% , 76.4% , 67.1% , and 74.5% , and their specificities were 41.0% , 64.1% , 64.1% , and 87.2% , respectively . receiver operating characteristic curve analysis determined the areas under the curves of these parameters to be 0.6070.062 , 0.7360.056 , 0.6940.059 , and 0.875 0.043 , respectively ( 95% confidence interval ) . although initial ica ( 0.88 mm / l ) was confirmed as a significant risk factor associated with mortality , it exhibited a poorer discriminative power for mortality prediction than other predictors , especially t - rts .

INTRODUCTION MATERIALS AND METHODS Patient population Data collection and assessment Statistical analysis RESULTS DISCUSSION

parkinson s disease ( pd ) is a synucleinopathy with heterogeneous progression of motor and non - motor dysfunction . in fact , several well - designed studies provided evidence that pd patients with the postural instability and gait disturbance ( pigd ) phenotype of motor symptoms showed a rapid progression of functional disability and cognitive deficit compared with patients with the tremor - dominant ( td ) motor phenotype [ 1 - 5 ] . although the mechanisms of the inherent heterogeneous progression of pd are still largely unknown , the heterogeneity of the disease may be associated with alterations of neural connectivity between the motor and cognitive control areas of the brain . the early development of dementia in pd patients is a major risk factor for poor prognosis and high mortality . therefore , the early detection of patients who are likely to develop dementia rapidly is crucial . it has been established that the overall prevalence of cognitive dysfunction without functional deficit sufficient for the diagnosis of dementia ( i.e. , cognitive impairment ) in pd is approximately 30% , and ~80% of patients with pd will develop overt dementia over 20 years after disease onset . there are currently no proven underlying pathogenic mechanisms of cognitive decline in pd patients . furthermore , several well - designed clinical studies to identify biochemical , imaging and genetic biomarkers of pd are emerging . among the large multicenter longitudinal pd biomarker studies , the parkinson progression marker initiative ( ppmi ) is the largest study to homogeneously enroll drug - nave pd patients at very early stages of the disease . the median duration of disease ( from diagnosis to enrollment ) was only 4.2 months ( range , 0.0338.83 ) , and the hoehn and yahr stage ( h&y ) of 99.5% of ppmi patients is i or ii . the primary objective of the ppmi study was to identify the biomarkers that predict pd progression . this review briefly provides evidence of the heterogeneous progression in the cognitive decline of pd patients , discusses the pathophysiologic mechanisms related to heterogeneous cognitive decline , and summarizes recent advances in the development of cerebrospinal fluid ( csf ) biomarkers to predict disease progression in the ppmi study . the existence of subgroups within pd with distinct clinical patterns of motor and non - motor symptoms is widely accepted . the clinical heterogeneity of pd may be associated with a variability in pathogenic mechanisms that may be controlled by inherited and environmental factors ( figure 1 ) . based on the motor symptoms of pd patients , formulas were developed to define the motor phenotypes using movement disorder society unified parkinson s disease rating scale ( mds - updrs ) , a revision of the original updrs . the motor phenotypes are most often classified by calculating the ratio between the scores of tremor - related and balance / gait / posture - related items in mds - updrs . using this system , however , despite evidence that the early development of cognitive deficits is significantly associated with pigd or non - td motor phenotypes , the motor phenotype of pd , particularly at a very early stage , might not yet be fully differentiated into two defined phenotypes ( i.e. , indeterminate type not specified as td or pigd ) . therefore , whether the motor phenotype is useful in predicting the development of dementia in pd patients with very early stage disease and/or with pd medication should be further evaluated . among the clinical symptoms that progress heterogeneously , the predictability of cognitive decline in pd is currently evaluated by neuropsychological , neuropathologic , neuroimaging and biologic biomarkers . the neuropsychological assessment of pd patients will be a tool to help predict the development of dementia in pd patients . in fact , patients who meet the criteria for mild cognitive impairment are more likely to develop dementia . the most common cognitive symptoms are attention deficits , executive functioning and visuospatial processing , and these variable profiles of cognitive dysfunction may be caused by the heterogeneous nature of the underlying neuropathology [ 19 - 21 ] . several studies suggested that a specific domain of memory and cognitive function or the malfunctioning of a specific region were associated with a rapid progression of cognitive deficit , although it remains to be elucidated whether a specific profile reflects the heterogeneous progression of pd dementia . for example , frontal cortex dysfunction assessed by executive difficulties is an early phenomenon , while visuospatial and semantic memory dysfunction , which reflect temporal and parietal involvement , are risk factors for parkinson s disease dementia ( pdd ) . although it is not sufficient , the measurement of csf alpha - synuclein ( -syn ) , dj-1 , tau , phosphorylated tau at thr181 ( p - tau ) or fms - related tyrosine kinase 3 ligand can differentiate pd patients from healthy controls ( hc ) . indeed , the level of csf -syn and tau proteins in pd patients was significantly lower than those in age - matched hc , with a marked overlap between groups . the mechanisms associated with lower levels of csf -syn in pd remain to be elucidated . the accumulation of -syn in the brain similar to amyloid ( a ) in alzheimer s disease ( ad)may be a mechanism for the reduction of csf -syn . although it is necessary to characterize the immunoassay platform , the measurement of -syn oligomers in csf improves diagnostic utility . interestingly , the level of tau proteins [ total tau ( t - tau ) and p - tau ] in the csf of pd patients was also lower than controls , although not all studies replicated this finding . taken together , the level of -syn and other proteins in csf may be useful in diagnosing pd , although it is too early to make definitive conclusions . revealed that the progression of -syn pathology throughout the brain is not random but follows a stereotypical caudal - to - rostral ascending progression ; however , not all neuropathological studies agreed with that topology . however , the detailed topographic patterns of the spread of -syn among pd patients are not homogeneous . the specific topographical pattern of lewy pathology ( i.e. , global involvement of cortical and limbic areas with lewy bodies and lewy neurites ) is significantly associated with cognitive deficits in pd , which suggests the underlying dementia - prone pattern in the spread of lewy pathology . although it is not clear which factors regulate the topographic spread of lewy pathology , human post - mortem studies suggested the cortical and limbic involvement of -syn pathology as a neuropathologic substrate were strongly correlated with pdd . furthermore , recent advances in the understanding of the neuropathologic substrates of pdd suggested that the interaction between -syn and ad pathology ( i.e. , a and tau pathology ) may regulate disease severity and progression [ 32 - 34 ] . provided evidence that the alzheimer s signature in csf ( lower level of csf a1 - 42 ) was significantly associated with more rapid cognitive decline in pd , and this finding was replicated by other studies [ 36 - 38 ] . the association of the ad - like csf signature with the rapid progression of cognitive dysfunction supported the hypothetical model that cross - seeding -syn and a or tau accelerate neurodegenerative pathology and disease progression . in support of this assertion , transgenic mice overexpressing human -syn ( wild type or ala53thr mutant ) with mutant forms of tau or amyloid precursor protein show greater neurodegeneration and functional deficits than mice overexpressing ad - associated proteins alone . furthermore , in vitro observation of enhanced fibril formation via cross - seed [ 41 - 43 ] and human studies in pd patients with the ala53thr snca mutation supported the contribution of ad pathology to the disease progression of pd . the rapid progression of cognitive deficits in pd patients could not be exclusively determined by pathological substrates of ad ; however , these previous studies in vitro , in animal models and in clinical cohorts suggested the increasingly important role of ad pathology in the development of pdd . for the prediction of cognitive progression in pd , genetic factors associated with neuropathological substrates of ad and/or pd may be an important contributor to cognitive deficits , along with -syn pathology . for example , genetic factors ( e.g. , mutation in -glucocerebrosidase ) associated with the hereditary form of pd are a genetic predictor of pdd . the apolipoprotein e ( apoe ) e4 allele , which has been widely accepted as a risk factor for ad , may confer an increased risk of rapid cognitive decline in pd . in contrast , the association of the apoe 4 allele with pdd was lost after adjustment for csf a1 - 42 level . in a large - scale study with autopsied subjects , however , the apoe 4 allele frequency was significantly higher not only in the ad group but also in the dementia with lewy bodies and pdd groups compared to the control group . therefore , the apoe 4 allele in pd may be a genetic risk factor for the cognitive deficits associated with pathways that are shared with and diverge from a-related pathogenesis . the existence of subgroups within pd with distinct clinical patterns of motor and non - motor symptoms is widely accepted . the clinical heterogeneity of pd may be associated with a variability in pathogenic mechanisms that may be controlled by inherited and environmental factors ( figure 1 ) . based on the motor symptoms of pd patients , formulas were developed to define the motor phenotypes using movement disorder society unified parkinson s disease rating scale ( mds - updrs ) , a revision of the original updrs . the motor phenotypes are most often classified by calculating the ratio between the scores of tremor - related and balance / gait / posture - related items in mds - updrs . using this system , however , despite evidence that the early development of cognitive deficits is significantly associated with pigd or non - td motor phenotypes , the motor phenotype of pd , particularly at a very early stage , might not yet be fully differentiated into two defined phenotypes ( i.e. , indeterminate type not specified as td or pigd ) . therefore , whether the motor phenotype is useful in predicting the development of dementia in pd patients with very early stage disease and/or with pd medication should be further evaluated . among the clinical symptoms that progress heterogeneously , the predictability of cognitive decline in pd is currently evaluated by neuropsychological , neuropathologic , neuroimaging and biologic biomarkers . the neuropsychological assessment of pd patients will be a tool to help predict the development of dementia in pd patients . in fact , patients who meet the criteria for mild cognitive impairment are more likely to develop dementia . the most common cognitive symptoms are attention deficits , executive functioning and visuospatial processing , and these variable profiles of cognitive dysfunction may be caused by the heterogeneous nature of the underlying neuropathology [ 19 - 21 ] . several studies suggested that a specific domain of memory and cognitive function or the malfunctioning of a specific region were associated with a rapid progression of cognitive deficit , although it remains to be elucidated whether a specific profile reflects the heterogeneous progression of pd dementia . for example , frontal cortex dysfunction assessed by executive difficulties is an early phenomenon , while visuospatial and semantic memory dysfunction , which reflect temporal and parietal involvement , are risk factors for parkinson s disease dementia ( pdd ) . although it is not sufficient , the measurement of csf alpha - synuclein ( -syn ) , dj-1 , tau , phosphorylated tau at thr181 ( p - tau ) or fms - related tyrosine kinase 3 ligand can differentiate pd patients from healthy controls ( hc ) . indeed , the level of csf -syn and tau proteins in pd patients was significantly lower than those in age - matched hc , with a marked overlap between groups . the mechanisms associated with lower levels of csf -syn in pd remain to be elucidated . the accumulation of -syn in the brain similar to amyloid ( a ) in alzheimer s disease ( ad)may be a mechanism for the reduction of csf -syn . although it is necessary to characterize the immunoassay platform , the measurement of -syn oligomers in csf improves diagnostic utility . interestingly , the level of tau proteins [ total tau ( t - tau ) and p - tau ] in the csf of pd patients was also lower than controls , although not all studies replicated this finding . taken together , the level of -syn and other proteins in csf may be useful in diagnosing pd , although it is too early to make definitive conclusions . . revealed that the progression of -syn pathology throughout the brain is not random but follows a stereotypical caudal - to - rostral ascending progression ; however , not all neuropathological studies agreed with that topology . however , the detailed topographic patterns of the spread of -syn among pd patients are not homogeneous . the specific topographical pattern of lewy pathology ( i.e. , global involvement of cortical and limbic areas with lewy bodies and lewy neurites ) is significantly associated with cognitive deficits in pd , which suggests the underlying dementia - prone pattern in the spread of lewy pathology . although it is not clear which factors regulate the topographic spread of lewy pathology , human post - mortem studies suggested the cortical and limbic involvement of -syn pathology as a neuropathologic substrate were strongly correlated with pdd . furthermore , recent advances in the understanding of the neuropathologic substrates of pdd suggested that the interaction between -syn and ad pathology ( i.e. , a and tau pathology ) may regulate disease severity and progression [ 32 - 34 ] . using csf biomarkers , siderowf et al . provided evidence that the alzheimer s signature in csf ( lower level of csf a1 - 42 ) was significantly associated with more rapid cognitive decline in pd , and this finding was replicated by other studies [ 36 - 38 ] . the association of the ad - like csf signature with the rapid progression of cognitive dysfunction supported the hypothetical model that cross - seeding -syn and a or tau accelerate neurodegenerative pathology and disease progression . in support of this assertion , transgenic mice overexpressing human -syn ( wild type or ala53thr mutant ) with mutant forms of tau or amyloid precursor protein show greater neurodegeneration and functional deficits than mice overexpressing ad - associated proteins alone . furthermore , in vitro observation of enhanced fibril formation via cross - seed [ 41 - 43 ] and human studies in pd patients with the ala53thr snca mutation supported the contribution of ad pathology to the disease progression of pd . the rapid progression of cognitive deficits in pd patients could not be exclusively determined by pathological substrates of ad ; however , these previous studies in vitro , in animal models and in clinical cohorts suggested the increasingly important role of ad pathology in the development of pdd . for the prediction of cognitive progression in pd , genetic factors associated with neuropathological substrates of ad and/or pd may be an important contributor to cognitive deficits , along with -syn pathology . for example , genetic factors ( e.g. , mutation in -glucocerebrosidase ) associated with the hereditary form of pd are a genetic predictor of pdd . the apolipoprotein e ( apoe ) e4 allele , which has been widely accepted as a risk factor for ad , may confer an increased risk of rapid cognitive decline in pd . in contrast , the association of the apoe 4 allele with pdd was lost after adjustment for csf a1 - 42 level . in a large - scale study with autopsied subjects , however , the apoe 4 allele frequency was significantly higher not only in the ad group but also in the dementia with lewy bodies and pdd groups compared to the control group . therefore , the apoe 4 allele in pd may be a genetic risk factor for the cognitive deficits associated with pathways that are shared with and diverge from a-related pathogenesis . the development of reliable and validated biomarkers for heterogeneous pd progression is a critical unmet need . validated pd progression markers are essential to accelerate research into pd pathogenesis , and the development of disease - modifying therapeutics ( dmt ) and would dramatically improve patient care . there are several important prerequisites for the development of valid biochemical progression biomarkers : the establishment of standardized protocols for the acquisition , transfer and analysis of biospecimens ; the optimization and verification of bioassays ; a sufficient longitudinal follow - up period to track heterogeneous progression ; and the recruitment of drug - nave patients at baseline . ppmi is a five - year observational , international , longitudinal study that aimed to identify biomarkers of pd progression that involve the collaborative effort of pd researchers with expertise in biomarker development , the clinical study of pd , bioinformatics , statistics and data management . analogous to the alzheimer s disease neuroimaging initiative ( adni ) , the ppmi is a public - private partnership , sponsored by the michael j fox foundation with industry partnership . the overall objective of the ppmi study was to identify the clinical , imaging , and biologic markers of pd progression for use in clinical trials of dmt . approximately 400 drug - nave pd patients at the early stage , and 200 age - matched hc were planned to be enrolled from 24 clinical sites in the united states , europe and australia ( figure 2 ) . the number of subjects was calculated with the power to detect a difference in prevalence of 13% ( for a dichotomous endpoint ) and a standardized mean difference of 0.24 ( for a continuous end - point ) . all pd patients were at the early stage ( diagnosis within 2 years and h&y stage < 2 ) and untreated with pd medication , as described in detail elsewhere and on the ppmi website ( http://www.ppmi-info.org/study-design/ ) . the longitudinal collection of biospecimens , including blood , csf and urine , is an essential component to discovering biological markers that are able to track disease progression . in particular , the collection , processing , aliquoting and storage of csf were remarkably standardized in the adni study . this review discusses the baseline csf biomarkers ( a1 - 42 , t - tau , p - tau , and -syn ) data of the ppmi cohort . the partial baseline csf results ( n = 102 ; pd = 63 , hc = 39 ) were published in 2013 . the initial data showed several interesting findings ; the lower levels of csf a1 - 42 and p - tau were significantly associated with the pigd phenotype in multiple logistic regression analysis with adjustment for confounders ; the level of -syn was significantly correlated with the level of t - tau and p - tau , and the levels of -syn and t - tau were associated with motor severity . a recent analysis of the full baseline dataset showed consistent results ( n = 660 ; pd = 412 , hc = 189 , subjects without evidence of dopamine deficit = 59 ) , but some results could not replicate the pilot findings . for example , the level of csf a1 - 42 or p - tau was not associated with motor phenotype , but the csf -syn level in pd patients with the non - td phenotype was significantly lower than pd patients with the td phenotype . in addition , there were no csf biomarkers that were significantly associated with motor severity when multivariate regression analysis with the adjustment of confounding factors was applied , although a low level of p - tau was marginally associated with disease severity . however , the strong correlation between the level of -syn and t - tau or p - tau in both pd and hc was replicable . consistent with the pilot study , the levels of csf -syn , t - tau , and p - tau , but not a1 - 42 , were significantly lower in pd compared to hc , while the diagnostic utility of each biomarker was limited due to a large overlap . the lower level of csf -syn in pd relative to hc implicates the accumulation of -syn in the brain of pd patients , analogous to the finding of lower levels of csf a1 - 42 in ad patients compared to hc . the mechanism of a reduction in tau proteins in pd compared with hc is unclear ; however , a possible interpretation is that the interaction between tau proteins and -syn may limit the release of tau proteins into csf . in connection with this , previous studies using in vitro , animal models [ 49 - 51 ] or postmortem brains of pd reported that the -syn pathology in the brain is accompanied by increased levels of hyperphosphorylated tau proteins and tau - positive tangles , and -syn positive lewy bodies may co - localize in the same neuron . the genome - wide association study also supported this hypothesis that mapt and snca , which encode tau and -syn , respectively , showed a genetic association with pd . therefore , the extent of the direct or indirect interaction between tau phosphorylation and -syn accumulation or the pattern of topological distribution of these pathogenic proteins may contribute to the heterogeneous progression of pd . although future long - term longitudinal observations in the ppmi cohort will be required to test the predictive performance of the csf biomarkers , the baseline data in this large cohort suggest that csf biomarkers in early pd patients already reflect disease heterogeneity and may have predictive value for disease progression . our findings of the association of csf biomarkers with cognitive function in the ppmi cohort was not consistent with other studies [ 26,35,37,56 - 60 ] . for example , the association of a higher csf -syn level with worsening cognitive decline was observed in the deprenyl and tocopherol antioxidative therapy of parkinsonism study . in contrast , the lower csf -syn level was associated with more severe neuropsychological function , including semantic fluency , visuospatial cognition and executive functioning in the ppmi cohort , which indicated that -syn pathology contributes to early cognitive impairment in pd . in addition , multivariate regression analysis of the ppmi baseline data did not fully reproduce the previous findings that the lower level of csf a1 - 42 was associated with cognitive impairment in pd . the lower level of a1 - 42 was significantly associated with processing speed / attention assessed by the symbol digit modality test ( sdmt ) but not with other cognitive functions , including the global cognitive function test and montreal cognitive assessment , in the ppmi cohort . instead , when the clinical variables of the group with the highest quintile levels of csf biomarkers were compared with those of the group with the lowest quintile levels , the csf a1 - 42 level showed significant associations with semantic fluency and sdmt score , and the t - tau / a1 - 42 ratio showed significant associations with memory ( total recall and delayed recall measured by hopkins verbal learning test - revised score ) , semantic fluency , sdmt and wechsler memory scaleiii letter - number sequencing score . it should be noted that the ppmi cohort included patients with very early stage and drug - nave disease at baseline ; therefore , whether csf biomarkers in early pd are associated with the risk of future cognitive decline and pdd should be determined in longitudinal analyses . a recent study that observed a group of ppmi pd patients ( n = 341 ) for 2 years found a significant association of lower baseline csf a1 - 42 level with higher odds of cognitive impairment , even though the baseline csf biomarker data showed a slight association of csf a1 - 42 with cognitive dysfunction in multivariate analysis . the discrepancy among studies in the association of csf biomarkers with clinical variables may be due to several demographic , biological and analytical factors , including but not limited to the different ages among cohorts , the contamination of blood in csf , the mixed pathology or disease stage of studied patients , and different immunoassay platforms . therefore , we should carefully interpret the results for the association of csf biomarkers with clinical variables . the development of reliable and validated biomarkers for heterogeneous pd progression is a critical unmet need . validated pd progression markers are essential to accelerate research into pd pathogenesis , and the development of disease - modifying therapeutics ( dmt ) and would dramatically improve patient care . there are several important prerequisites for the development of valid biochemical progression biomarkers : the establishment of standardized protocols for the acquisition , transfer and analysis of biospecimens ; the optimization and verification of bioassays ; a sufficient longitudinal follow - up period to track heterogeneous progression ; and the recruitment of drug - nave patients at baseline . ppmi is a five - year observational , international , longitudinal study that aimed to identify biomarkers of pd progression that involve the collaborative effort of pd researchers with expertise in biomarker development , the clinical study of pd , bioinformatics , statistics and data management . analogous to the alzheimer s disease neuroimaging initiative ( adni ) , the ppmi is a public - private partnership , sponsored by the michael j fox foundation with industry partnership . the overall objective of the ppmi study was to identify the clinical , imaging , and biologic markers of pd progression for use in clinical trials of dmt . approximately 400 drug - nave pd patients at the early stage , and 200 age - matched hc were planned to be enrolled from 24 clinical sites in the united states , europe and australia ( figure 2 ) . the number of subjects was calculated with the power to detect a difference in prevalence of 13% ( for a dichotomous endpoint ) and a standardized mean difference of 0.24 ( for a continuous end - point ) . all pd patients were at the early stage ( diagnosis within 2 years and h&y stage < 2 ) and untreated with pd medication , as described in detail elsewhere and on the ppmi website ( http://www.ppmi-info.org/study-design/ ) . the longitudinal collection of biospecimens , including blood , csf and urine , is an essential component to discovering biological markers that are able to track disease progression . in particular , the collection , processing , aliquoting and storage of csf were remarkably standardized in the adni study . this review discusses the baseline csf biomarkers ( a1 - 42 , t - tau , p - tau , and -syn ) data of the ppmi cohort . the partial baseline csf results ( n = 102 ; pd = 63 , hc = 39 ) were published in 2013 . the initial data showed several interesting findings ; the lower levels of csf a1 - 42 and p - tau were significantly associated with the pigd phenotype in multiple logistic regression analysis with adjustment for confounders ; the level of -syn was significantly correlated with the level of t - tau and p - tau , and the levels of -syn and t - tau were associated with motor severity . a recent analysis of the full baseline dataset showed consistent results ( n = 660 ; pd = 412 , hc = 189 , subjects without evidence of dopamine deficit = 59 ) , but some results could not replicate the pilot findings . for example , the level of csf a1 - 42 or p - tau was not associated with motor phenotype , but the csf -syn level in pd patients with the non - td phenotype was significantly lower than pd patients with the td phenotype . in addition , there were no csf biomarkers that were significantly associated with motor severity when multivariate regression analysis with the adjustment of confounding factors was applied , although a low level of p - tau was marginally associated with disease severity . however , the strong correlation between the level of -syn and t - tau or p - tau in both pd and hc was replicable . consistent with the pilot study , the levels of csf -syn , t - tau , and p - tau , but not a1 - 42 , were significantly lower in pd compared to hc , while the diagnostic utility of each biomarker was limited due to a large overlap . the lower level of csf -syn in pd relative to hc implicates the accumulation of -syn in the brain of pd patients , analogous to the finding of lower levels of csf a1 - 42 in ad patients compared to hc . the mechanism of a reduction in tau proteins in pd compared with hc is unclear ; however , a possible interpretation is that the interaction between tau proteins and -syn may limit the release of tau proteins into csf . in connection with this , previous studies using in vitro , animal models [ 49 - 51 ] or postmortem brains of pd reported that the -syn pathology in the brain is accompanied by increased levels of hyperphosphorylated tau proteins and tau - positive tangles , and -syn positive lewy bodies may co - localize in the same neuron . the genome - wide association study also supported this hypothesis that mapt and snca , which encode tau and -syn , respectively , showed a genetic association with pd . therefore , the extent of the direct or indirect interaction between tau phosphorylation and -syn accumulation or the pattern of topological distribution of these pathogenic proteins may contribute to the heterogeneous progression of pd . although future long - term longitudinal observations in the ppmi cohort will be required to test the predictive performance of the csf biomarkers , the baseline data in this large cohort suggest that csf biomarkers in early pd patients already reflect disease heterogeneity and may have predictive value for disease progression . our findings of the association of csf biomarkers with cognitive function in the ppmi cohort was not consistent with other studies [ 26,35,37,56 - 60 ] . for example , the association of a higher csf -syn level with worsening cognitive decline was observed in the deprenyl and tocopherol antioxidative therapy of parkinsonism study . in contrast , the lower csf -syn level was associated with more severe neuropsychological function , including semantic fluency , visuospatial cognition and executive functioning in the ppmi cohort , which indicated that -syn pathology contributes to early cognitive impairment in pd . in addition , multivariate regression analysis of the ppmi baseline data did not fully reproduce the previous findings that the lower level of csf a1 - 42 was associated with cognitive impairment in pd . the lower level of a1 - 42 was significantly associated with processing speed / attention assessed by the symbol digit modality test ( sdmt ) but not with other cognitive functions , including the global cognitive function test and montreal cognitive assessment , in the ppmi cohort . instead , when the clinical variables of the group with the highest quintile levels of csf biomarkers were compared with those of the group with the lowest quintile levels , the csf a1 - 42 level showed significant associations with semantic fluency and sdmt score , and the t - tau / a1 - 42 ratio showed significant associations with memory ( total recall and delayed recall measured by hopkins verbal learning test - revised score ) , semantic fluency , sdmt and wechsler memory scaleiii letter - number sequencing score . it should be noted that the ppmi cohort included patients with very early stage and drug - nave disease at baseline ; therefore , whether csf biomarkers in early pd are associated with the risk of future cognitive decline and pdd should be determined in longitudinal analyses . a recent study that observed a group of ppmi pd patients ( n = 341 ) for 2 years found a significant association of lower baseline csf a1 - 42 level with higher odds of cognitive impairment , even though the baseline csf biomarker data showed a slight association of csf a1 - 42 with cognitive dysfunction in multivariate analysis . the discrepancy among studies in the association of csf biomarkers with clinical variables may be due to several demographic , biological and analytical factors , including but not limited to the different ages among cohorts , the contamination of blood in csf , the mixed pathology or disease stage of studied patients , and different immunoassay platforms . therefore , we should carefully interpret the results for the association of csf biomarkers with clinical variables . not all pd patients develop dementia ; however , dementia is a frequent non - motor complication in pd with heterogeneous features . genetic , demographic and environmental factors may be related to the heterogeneous progression of cognitive decline in pd patients . thus , understanding the heterogeneity would provide insight into the pathogenic mechanism of pdd development , which is important for developing therapeutics as well as patient care . there are few studies on the association of heterogeneous cognitive decline with specific molecular signatures or pathogenesis in pd patients with a large number of subjects and in early stages of the disease . the evidence of molecular interactions between -syn and a1 - 42 and/or tau in the development of pdd in post - mortem samples implicate the necessity of the longitudinal observation of csf and imaging biomarkers in pd . in addition , the development of biomarkers for the early diagnosis of pd is an unmet need . because pd is not a disease with homogeneous features , the development of biomarkers of the heterogeneity in motor and non - motor dysfunction will provide the molecular basis for individualized therapeutics . finally , the combination of biochemical , imaging and genetic biomarkers rather than individual biomarkers may better accomplish this aim . to this end , the development of novel , promising and valid biochemical biomarkers and -syn imaging technologies is necessary .

parkinson s disease ( pd ) is a neurodegenerative disease with heterogeneous pathological and clinical features . cognitive dysfunction , a frequent non - motor complication , is a risk factor for poor prognosis and shows inter - individual variation in its progression . of the clinical studies performed to identify biomarkers of pd progression , the parkinson s progression markers initiative ( ppmi ) study is the largest study that enrolled drug - nave and very early stage pd patients . the baseline characteristics of the ppmi cohort were recently published . the diagnostic utility of cerebrospinal fluid ( csf ) biomarkers , including alpha - synuclein ( -syn ) , total tau , phosphorylated tau at thr181 , and amyloid 1 - 42 , was not satisfactory . however , the baseline data on csf biomarkers in the ppmi study suggested that the measurement of the csf biomarkers enables the prediction of future cognitive decline in pd patients , which was consistent with previous studies . to prove the hypothesis that the interaction between alzheimer s pathology and -syn pathology is important to the progression of cognitive dysfunction in pd , longitudinal observational studies must be followed . in this review , the neuropathological nature of heterogeneous cognitive decline in pd is briefly discussed , followed by a summarized interpretation of baseline csf biomarkers derived from the data in the ppmi study . the combination of clinical , biochemical , genetic and imaging biomarkers of pd constitutes a feasible strategy to predict the heterogeneous progression of pd .

INTRODUCTION EVIDENCE OF COGNITIVE HETEROGENEITY IN PD Clinical characteristics associated with cognitive heterogeneity Neuropathologic substrates associated with cognitive heterogeneity PARKINSONS PROGRESSION MARKERS INITIATIVE Overview Association of CSF biomarkers with clinical features PERSPECTIVE

henoch schonlein purpura ( hsp ) is an immune complex mediated small vessel vasculitis involving iga deposition in the capillaries of the kidney , skin , and gastrointestinal tract . medications , vaccinations , infections , tumors , and insect bites have been mentioned as causes of hsp . we report a rare case of hsp following an insect bite in a 26-year - old woman , who , in succession , had a nodular rash on the elbows , erythema nodosum , and palpable purpura . a 26-year - old farm laborer presented to our outpatient department ( opd ) with a nodular rash that had developed on both elbows [ figure 1a and b ] following an insect bite while she sleeping . she had pruritus over the affected areas and her lower limbs as well , but without any rash [ figure 1c ] . two days later , she presented to the opd with complaints of tender and erythematous nodules on the legs [ figure 1d ] . her investigations revealed the following : hemoglobin 10.9 g / dl , total leukocyte count 10.6 10/l with 76% neutrophilia , erythrocyte sedimentation rate 40 mm / h , urea 9.94 mmol / l , creatinine 44 mol / l , platelets 284 10/l , and 40 - 50 rbcs / hpf on urinalysis without proteinuria . she was unwilling to be admitted and was , therefore , sent home and was prescribed acetaminophen and chlorpheniramine . she came back 1 week later with a purpuric rash on her lower limbs [ figure 1e ] , diffuse abdominal pain , and arthralgias of the knees , ankles , and elbows . examination showed non - palpable purpura , pedal edema , tender peri - umbilical region , and an otherwise normal systemic examination . her urea and creatinine were 12.07 mmol / l and 52.8 mol / l , respectively . her electrocardiogram and liver function tests were normal , while ultrasonogram showed minimal free fluid in the pelvis . her immunological profile was as follows : rheumatoid factor negative , antistreptolysin o ( aso ) titer < 200 iu , antinuclear antibody 0.6 u ( < 1.0 u ) , complement c3 0.94 testing for cytoplasmic- antineutrophil cytoplasmic antibodies ( c - anca ) could not be done since the patient refused to undergo any further investigations . she was initiated on methylprednisolone 8 mg daily , ranitidine , and hydroxyzine , and over the next 3 days , her signs gradually subsided . ( a , b ) nodular rash around the left and right elbows developed few hours after the insect bite ; ( c ) absence of any rash in the lower limbs during the first visit ; ( d ) erythema nodosum bilaterally 48 h after the first visit ; ( e ) purpuric rash in both lower limbs 1 week after the second visit vasculitic disorders are classified according to whether the small , medium , or large arteries are involved . hsp , urticarial vasculitis , cryoglobulinemic vasculitis , and cutaneous small vessel vasculitis are referred to as small vessel vasculitides . johann lukas schonlein and his pupil edouard heinrich henoch contributed to the recognition of this entity . adults may or may not have more severe kidney disease depending upon the series studied . the capillaries , post - capillary venules , and non - muscular arterioles are inflamed . many viruses and bacteria have been implicated , but in the majority of cases , none have been found . barr virus , and vaccinations related to measles and enteric fever have been reported as etiologies . abnormalities in hsp include dysregulation of interleukin ( il)-1 homoeostasis and homozygous and heterozygous mutations of mediterranean fever ( mefv ) gene that is involved in caspase-1 activation . disease susceptibility arises from particular human leukocyte antigen ( hla ) types which influence iga function and/or clearance or those influencing immunomodulation . features in descending order of frequency are purpura , arthritis , abdominal pain , nephritis , and gastrointestinal bleeding . also , 40 - 50% patients have renal involvement in the form of either hematuria or proteinuria nodules as a manifestation of vasculitis are more common with medium vessel vasculitides , whereas purpura , papules , vesicles , and urticaria are commoner with small vessel vasculitides . our patient had a nodular rash at onset , a feature which had not been previously described . subcutaneous nodules can be seen in hsp , but are more common in other conditions such as rheumatoid arthritis ( ra ) , systemic lupus erythematosus ( sle ) , and rheumatic fever . these subcutaneous nodules , as in ra , develop at pressure sites like the elbow , as was seen in our patient . erythema nodosum has been reported in only one instance of hsp and that too in a child . this occurred 2 weeks prior to purpura and improved with clarithromycin that was administered for mycoplasma pneumoniae infection . sequential development of three morphological patterns ( erythema nodosum , erythema marginatum , and purpura ) of rash was described in this child . this is only the second account of a similar case with three different patterns of rash occurring in succession and the first in which a nodular rash is a precursor of hsp . tissue biopsies are useful when the presentation is atypical . but in our case , the patient refused biopsies on two occasions . other manifestations involve the heart , liver , lung , nervous system , pancreas , and adrenals . systemic lupus , disseminated intravascular coagulation , and septicemia should then be considered in the differential diagnosis . based on the hsp eular / printo / pres ankara 2008 classification , our patient had 3/4 criteria of the optional criteria . the disease generally lasts for less than a month , with half of the patients having at least one recurrence , usually milder . about 45 - 80% of adults can have renal involvement , and the risk of progression to chronic kidney disease is 30% . in conclusion , we have described here a unique sequential pattern of rashes in hsp occurring after an insect bite that improved with steroids . clinicians must be aware that hsp may present with several patterns of rashes in succession . also , nodular rash and erythema nodosum could precede typical purpuric lesions in hsp .

we describe a 26-year - old woman who presented with a nodular rash on the elbows following an insect bite . two days later , she developed erythema nodosum . both these lesions were treated symptomatically . one week later , she had purpura , abdominal pain , hematuria , and arthralgias , following which steroids were administered . her investigations revealed only microscopic hematuria that disappeared with therapy . this pattern of sequential appearance of rash and a nodular morphology are both unique features not previously reported .

INTRODUCTION CASE REPORT DISCUSSION

the index case - patient was an 87-year - old woman with congestive heart failure who was referred from a disaster medical assistance team and admitted to our hospital on april 6 . she reported leg edema starting at the end of february and a cough beginning in early march . on march 11 , the day of the earthquake and resulting tsunami , she spent a night in a shrine near her home , which had been completely destroyed . she stayed at a disaster shelter with family members and other evacuees on march 1215 ( 3 days ) and then moved to her daughter s home . she reported that she experienced fever , headache , general malaise , appetite loss , terrible cough , sputum , and dyspnea on april 4 ; on april 6 , she visited the disaster medical assistance team . chest radiograph and computed tomography scan were performed , and results revealed extensive infiltrative shadows with air bronchograms in the right lung ; results were normal for the left lung . pneumonia was diagnosed , and an empirical therapy of intravenous antimicrobial drugs was initiated , pending further evaluation for pulmonary tuberculosis . sputum smear testing showed acid - fast bacilli ( afb ) graded gaffky 2 ( grade 1 + on the world health organization scale ) ( 4 ) . the patient was placed in a negative - pressure single room and treated with a 3-drug regimen of isoniazid , rifampin , and ethambutol . the patient improved and was discharged on june 17 after sputum smears were repeatedly negative for afb . she continued to receive directly observed treatment at our outpatient clinic and completed 9 months of treatment . the shelter at which the patient stayed after the earthquake was small ( 60 m ) , and 50 evacuees stayed there at the time she was there . mask supply was insufficient , and most persons did not wear masks or did not wear them properly . obtaining information on persons who had contact with the index case - patient was difficult because many evacuees were exhausted from stress or had moved to secondary shelters or relatives home by the time we visited the shelter . in cooperation with a manager of the shelter and local government , a contact investigation for the index case - patient patient was conducted during june august 2011 ( 24 months after the last possible exposure ) to identify ltbi ; a total of 62 contact persons were found . three contacts ( an infant and children < 7 years of age ) had a tuberculin skin test ( tst ) , and the remaining 57 contacts ( persons > 7 years of age ) underwent whole - blood interferon- release assay ( igra ) testing by using quantiferon - tb gold in - tube ( cellestis , chadstone , victoria , australia ) , as described ( 5 ) . two of 3 contacts tested by tst were positive for tuberculin purified protein derivative ( ppd ) ; 9 of 57 contacts tested by igra were positive ( table ) . a 2-month - old infant , a family member of the index case - patient , had been initially tested in may and was ppd negative but received isoniazid therapy for ltbi because the infant had close and frequent contact with the index case - patient . two months after the 6 months of treatment was completed ( 8 months after treatment was initiated ) , results of a repeat tst on this infant were positive . * a complete list of contact persons is available in the expanded table online ( wwwnc.cdc.gov/eid/article/19/5/12-1137-t1.htm ) . contact persons were 50 evacuees ( 3 family members and 47 others ) at the shelter , 8 family members at the index case - patient s daughter s home , 2 health care personnel ( rescue worker and doctor ) who rode with the patient in an ambulance , and 2 patients admitted to the same room as the index case - patient in the hospital . tb , tuberculosis ; na , not available ; igra , interferon- release assay ; tst , tuberculin skin test ; ltbi , latent tuberculosis infection ; border , borderline . tst or igra results were not available for 2 contacts ; 1 refused to receive igra , and 1 did not undergo testing because of advanced age . igra results were evaluated according to the japanese guideline for using the quantiferon - tb gold in - tube ( 4 ) . family member of index case - patient . for ppd- or igra - positive contacts , medical examinations and chest radiographs were performed , but no results characteristic of pulmonary tb were found . after a physician explained risks and benefits of prophylaxis to the contacts ( or parents ) , 8 contacts ( 7 evacuees and 1 family member ) received prophylactic treatment for ltbi ; the other contacts received follow - up chest radiography . one year after the earthquake , no active tb cases had been observed among the contacts . we detected ltbi among evacuees who were exposed to a patient with active tb at a shelter after the 2011 great east japan earthquake . refugees and populations displaced after natural disasters are particularly vulnerable to tb in developing countries because crowded living conditions and poor nutritional status can facilitate the development and the transmission of tb ( 6,7 ) . however , as seen in this report and others ( 8) , displaced populations in industrialized countries may also be vulnerable to communicable diseases after natural disasters . persons in shelters who have tb or suspected tb should be transferred to a medical facility as soon as the illness is detected because isolation and respiratory protection for airborne diseases such as tb is very difficult to implement in shelters ( 9 ) . in our case , some physicians and nurses who saw the index patient did not consider the diagnosis of tb or could not perform afb testing , which may have delayed time to tb diagnosis and resulted in tb spread in the shelter . health care personnel working in disaster relief must suspect and rapidly diagnose tb and then conduct contact investigations in collaboration with local public health departments . signs and symptoms and clinical characteristics of tb in the elderly may be atypical ( 10 ) , so continuous medical education and training are needed to maintain the competence of health care personnel to prevent , diagnose , and treat tb in the elderly . in this investigation , tst or igra results were positive ( indicating ltbi ) in 11 ( 18.3% ) of 60 contacts ; 10 ( 20% ) of 50 evacuees at the shelter had positive results . a previous study in japan found that the igra - positive rate was 7.1% for those 4069 years of age in the general population ( 11 ) . japan is considered a middle - burden tb country and has a bacille calmette - gurin vaccination program ; for these reasons , igra is more useful than tst in ltbi screening and contact tracing . adherence rates for ltbi treatment were low ( 19% ) at a tb clinic in new orleans after hurricane katrina ( 8) . this finding indicates a challenging environment for tb control activities after a natural disaster and suggests an increased risk for transmission because of migration and overcrowding . disrupted health care services , poor access to tb control programs , and difficulty in patient management may lead to poor treatment adherence , which could result in the emergence of drug - resistant tb strains . however , all ( 8/8 , 100% ) patients with ltbi who initiated treatment in our investigation adhered to and completed the regimen . our success in postdisaster tb control measures at this shelter can be attributed , in part , to the efforts of public health nurses in providing education and directly observed treatment despite limited resources and poor health care access in the affected area . medical institutions and public health departments should work to cooperatively and collaboratively assist shelter in implementing tb care and control activities for evacuees after natural disasters .

tuberculosis was diagnosed in a person who had stayed in a shelter after the 2011 great east japan earthquake . a contact investigation showed that the prevalence of latent tuberculosis infection among other evacuees at the shelter was 20% . our report underscores the importance of tuberculosis prevention and control after natural disasters .

The Study Conclusions

worldwide , 1 in 5 men over the age of 50 is likely to have osteoporosis . although osteoporosis is less common in men than women , 2530% of all hip fractures are in men and the risk of mortality after osteoporotic fractures is greater in men than in women . the 10-year probability of major osteoporotic fractures increases with age and is particularly high in patients over 75 years old [ 1 , 2 ] . because of growth in the population of older people , the number of hip fractures is estimated to be 1.1 million in men by 2025 . osteoporotic fractures are associated with considerable morbidity and enormous health care costs . in 2005 , bisphosphonates and teriparatide are indicated for use in men with osteoporosis , and denosumab is indicated to increase bmd in men with osteoporosis at high risk for fracture . although denosumab is tolerable and efficacious in men , evidence suggesting economic value is also important . as the us healthcare system continues to evolve , us payers increasingly demand this type of economic information to support value driven decisions about therapeutic options . denosumab has been demonstrated to be a cost - effective strategy compared to bisphosphonates and strontium ranelate in postmenopausal osteoporotic women in both sweden and the us , as well in osteoporotic men in sweden [ 7 , 8 ] . although denosumab was reported to be cost - effective in older osteoporotic men in sweden , it is critical to evaluate the cost - effectiveness of denosumab in the us given the differences in the population characteristics , fracture rates , and healthcare reimbursement environment . therefore , we evaluated the cost - effectiveness of denosumab in elderly osteoporotic men in the us and compared it to alendronate , risedronate , ibandronate , zoledronate , and teriparatide . a previously published lifetime cohort markov model was adapted for this analysis ; the basic analysis methods and assumptions have been previously described [ 7 , 8 , 15 ] . since fractures are more common in elderly men , the population of interest was men 75 years and older . the patient characteristics included in the model were reflective of a subgroup analysis of the more elderly participants enrolled in adamo ( a multicenter , randomized , double - blind , placebo - controlled study to compare the efficacy and safety of denosumab 60 mg every six months versus placebo in males with osteoporosis ) , with mean age of 78 years , with a femoral neck bmd t - score of 2.12 and prevalent vertebral fractures in 23% [ 16 , 17 ] . since there is a paucity of well - powered trials reporting fracture risk reduction in osteoporotic men , data from postmenopausal osteoporosis ( pmo ) trials were used for the analyses ( see table 1 ) . this approach was used because bmd improvements in response to interventions have consistently been shown to be similar across populations of osteoporotic men and women [ 16 , 1822 ] . for instance , in patients on denosumab who were 75 years old , the percentage change from baseline to month 12 in lumbar spine bmd was comparable between women in the freedom trial ( placebo : 0.7 ( 95% ci 0.11.4 ) versus denosumab : 4.8 ( 95% ci 4.15.6 ) ) and men in the adamo trial ( placebo : 1.0 ( 95% ci 0.52.5 ) versus denosumab : 4.8 ( 95% ci 3.36.4 ) ) [ 1618 ] . it is reasonable to assume that similar changes in bmd in men and women will reflect similar effects on fracture risk reduction . this assumption was substantiated in a recent clinical trial in which bmd change and vertebral fracture risk reduction from bisphosphonate therapy in men were similar to parallel studies in women . moreover , in recognition that therapy - induced fracture risk reduction is likely to be similar in men and women , regulatory agencies routinely approve osteoporosis treatments for fracture reduction in men when bmd improvements in men are similar to those in women . in the absence of evidence for fracture reduction for a particular treatment at a particular skeletal site , 0% fracture risk reduction was assumed . in the model , patients received treatment up to 5 years except for teriparatide which is only indicated for 2 years of treatment . the probability of treatment discontinuation within the first three years for the comparators was estimated using persistence data obtained from weycker et al . and persistence rates were based on a composite estimate of pmo patients taking oral bisphosphonates and then adjusted for men using the landfeldt et al . the persistence rate for denosumab was estimated based on daps ( denosumab adherence preference satisfaction ) , which found patients on denosumab were 50% less likely to discontinue treatment ( p = 0.029 ) than those given alendronate . the other injectable osteoporosis treatments , teriparatide and zoledronic acid , were assumed to have the same persistence as denosumab ( supplemental table 1 ) . although antifracture efficacy is likely to persist for a period of time ( offset time ) after a treatment is stopped , there have been very few studies that report offset time and there is a lack of consensus on the duration of offset time [ 2832 ] . the duration of offset time is likely to affect the number of incident fractures and mortality , and consequently costs and quality of life . thus , in the current analyses , offset time was assumed to be equal to up to 2 years across all therapies in the base - case . however , given that some prior models have used offset time up to 5 years for bisphosphonates , a sensitivity analysis was also conducted . in the sensitivity analyses , a 1- or 2-year offset times were applied for denosumab , up to 2.5 years for teriparatide , and up to 5 years for all other comparators . furthermore , in the model , it was assumed that offset time could not exceed the treatment duration . for example , if patients on oral bisphosphonates discontinued treatment by year 1 , then their offset time was assumed to be 1 year . on the other hand , if patients on oral bisphosphonates received treatment for a full 5 years , then their offset time was assumed to be 2 years in the base - case and 5 years in the sensitivity analysis . patients that drop out in the first 6-month markov cycle did not receive any offset time . the incidence of hip and clinical vertebral and other nonhip , nonvertebral ( nhnv ) osteoporotic fractures in untreated men were derived from melton iii et al . and cooper et al . [ 33 , 35 ] and are shown in table 2 . an explanation of the derivation methodology can be found in a previously published economic analysis . in the absence of age - specific prevalence of morphometric vertebral fracture in the model , a constant risk of morphometric vertebral fracture patients with osteoporotic fractures have a higher mortality compared to the general population . in the model , the age - specific baseline mortality in the us normal population for men in 2010 was applied to the relative risk of mortality after a fracture in swedish population because us data were not available . it was assumed that mortality in the first year after fracture would be higher than in subsequent years for hip and vertebral fractures . nhnv osteoporotic fractures were assumed to only have an increased risk of mortality in the first year of fracture . the relative risk of mortality in men who have a fracture was estimated from johnell et al . and applied to the background mortality of the normal population . relative risks of mortality related to fractures are shown in supplemental table 2 ( for further methods detail , see parthan et al . ) . the effect of hip fracture on quality of life , in the first year and subsequent years , was based on a meta - analysis . the effect on quality of life from vertebral fracture in the first year it was assumed that the utility multiplier during the second and following years for a clinical vertebral fracture was 0.93 . the disutility associated with nhnv fractures in the first year was derived from borgstrm et al . the model assumed that the nhnv fractures did not have any impact on patients ' quality of life in the second and subsequent years . the fracture - specific utility multipliers as shown in table 3 were used together with the baseline utility values for normal us men . the model included costs associated with the drug intervention , costs of treating fractures , drug administration , and monitoring costs and long - term care costs ( see table 4 ) . age - specific fracture costs by fracture site were derived from brenneman et al . and tosteson et al . the tosteson study includes costs for hip fracture patients in both men and women and was used to estimate the costs in the subsequent years following fracture . costs associated with long - term care were considered in the model because many people with a hip fracture are discharged to a long - term care facility . since there were no published data on cost of nursing home care in men , the costs were estimated using data from women . patients with vertebral and nhnv fractures were assumed not to be associated with any long - term costs . the model was used to estimate both cost and outcomes over a lifetime horizon for each treatment strategy . total costs included costs of treatment intervention ( both drug and administration costs and osteoporosis management costs ) , direct medical costs for all fracture types , and long - term care costs of a nursing home ( as a result of hip fracture ) . total qalys ( quality - adjusted life - years ) were calculated using the product of the utility weights for each health state and the time spent in that health state and summed for all health states over the patient 's lifetime . total lys ( life - years ) were calculated by adding all the time the patients spent in a nondeath health state . incremental cost - effectiveness ratios ( icers ) were reported as the cost per qaly gained and cost per ly saved . the model also reported the 10-year incidence of all fracture types for each treatment strategy . as is the standard in health economic methodology , treatment strategies were rank ordered by increasing cost and icers were calculated successively for each next most costly strategy . dominated strategies , those with both higher costs and lower efficacy than a comparator , parameters were varied using published confidence intervals or standard errors , where available , and by 25% above and below their base - case values when not available . since zoledronate has lost exclusivity , the drug acquisition cost was reduced by 35% and 65% of the current price in sensitivity analyses . as risedronate is expected to lose exclusivity in 2014 , a similar analysis was done using the estimated generic price of risedronate . a probabilistic sensitivity analysis ( psa ) the psa was performed by simultaneously drawing from appropriate distribution functions for each model parameter according to their means and standard errors . this process of drawing parameters and running the model was repeated 1,000 times and the results are presented graphically . the parameters included in the psa were efficacy of denosumab and the comparators , costs of fractures , utilities , the daps ratio , and proportion of patients going to long - term care after hip fracture . results of the multiway cost - effectiveness analysis show that generic alendronate had the lowest costs followed by denosumab ( table 5 ) . compared to generic alendronate , the lifetime costs associated with denosumab were approximately $ 900 higher per patient . denosumab had lower costs and higher qalys per patient than all other comparators , which meant it dominated the other comparators . compared to all other therapies , patients on denosumab had the lowest 10-year risks of hip fractures in the model ( table 6 ) . figure 2 displays the disaggregated costs . across most treatment strategies , costs associated with long - term care accounted for the majority of the lifetime costs . the icer for denosumab versus generic alendronate is most sensitive to changes in the relative risk of hip fracture with denosumab . when this risk is lowered to 0.18 , denosumab dominates generic alendronate . when this risk is increased to 0.78 , the icer for denosumab relative to alendronate other sensitive parameters include the relative risk of hip fracture with alendronate , the drug cost of denosumab , and the unit cost of a day in the nursing home ( figure 3 ) . using an estimated generic price for zoledronate and risedronate ( assumed to be 35% and 65% reductions of the base - case costs , resp . ) , results did not change ; denosumab dominated zoledronate and risedronate . similarly , results were mostly unchanged when offset times were varied ; the icer for denosumab compared to generic alendronate was $ 22,000 and denosumab dominated all other comparators . in sensitivity analyses , when the offset time for denosumab was reduced from 2 years to one year and all other comparators remained at 2 years , results were similar ( icer = $ 29,500 ) . the probability of denosumab being cost - effective compared to the other osteoporotic treatment strategies , including generic alendronate , at a threshold of $ 100,000 per qaly was 85.8% . a cost - effectiveness acceptability curve for the probabilistic sensitivity analyses is illustrated in figure 4 . in this study , the cost - effectiveness of denosumab compared to other osteoporotic treatments was evaluated in men who were similar to the average elderly patient characteristics in the adamo trial . denosumab had an icer of $ 16,900 compared to generic alendronate and dominated all other treatment strategies included in the study . compared to all other treatments , the probability of denosumab being cost - effective at a threshold of $ 100,000 per qaly was 85.8% . results were most sensitive to changes in the relative risk of hip fracture on denosumab , the relative risk of hip fracture with alendronate , the drug cost of denosumab , and the unit cost of a day in the nursing home . the economic benefits of denosumab are probably more pronounced in the elderly population , as hip and vertebral fractures are more common , leading to higher economic costs , morbidity , and mortality . denosumab was cost - effective using our base - case model . when assumptions and inputs were varied in sensitivity analyses to reflect areas of uncertainty , the results were basically unchanged . this indicates that the simple unit cost of a drug should be only one of several factors used in deciding the most appropriate therapy . other considerations , such as persistence and efficacy across all fracture types , must be taken into account to recognize the full economic value . with the exception of the cost - effectiveness study in elderly swedish men , which used the markov model structure used in the current analysis , we do not know any other published studies that evaluated the cost - effectiveness of different osteoporotic treatments in older men with osteoporosis . in the study of costs in sweden , denosumab was compared to generic alendronate , generic risedronate , ibandronate , strontium ranelate , zoledronate , and teriparatide . this analysis of a cost - effectiveness model based in the us is important despite the previous report in the swedish context . there are differences in population characteristic , generic availability , and healthcare costs between sweden and the us that could influence cost - effectiveness estimates and suggest the need for independent analyses . country - specific data were used for each model and included inputs of background population mortality , background population utility , and background population fracture risk , as well as direct medical costs of fractures , monitoring , and treatments . patients in the us were only at risk of premature discontinuation for the first 3 years while swedish patients were at risk for 4 years . despite those differences , findings from the current study and the previous swedish study are similar ; in both , denosumab was a cost - effective treatment in older osteoporotic men . while the population fracture risk , treatment options , and discontinuation patterns differ across countries , denosumab is still the most effective treatment . the cohort markov model assumes a hierarchical structure ; that is , once patients have experienced a fracture , they can not have another milder fracture type . patients from the posthip fracture state can either sustain another hip fracture , but they can not experience a vertebral fracture or a nhnv osteoporotic fracture . patients with vertebral fractures can only incur new vertebral fractures or hip fractures , but not nhnv osteoporotic fractures . because of this hierarchical structure , the number of milder fractures in the cohort is likely the model also assumed that patients with vertebral and nhnv osteoporotic fractures do not incur costs beyond the first year of fracture ; this may slightly underestimate fracture costs . the relative risks reported for nonvertebral fractures , which may include hip as well as nhnv fractures , were applied for nhnv fractures ; this might slightly overestimate the number of nhnv fractures . published data concerning the rate of drug - specific discontinuation was only available for the first 3 years of treatment . in the current analysis ( except for teriparatide ) , patients remaining on therapy after 3 years were assumed to continue until planned termination at 5 years . this assumption is supported by long - term studies of discontinuation rates of osteoporosis medications ( considered as a group ) indicating they are the highest shortly after the initiation of treatment , after which these rates remain stable for 5 or more years [ 47 , 48 ] . discontinuation rates for oral medications were taken from a registry study , but registry data were not available for injectable medications . therefore , the model used a hazard ratio from the daps study to calculate the discontinuation of denosumab and other injectable treatments . using this methodology , our model predicts 73.6% of patients are persistent with denosumab at one year . this is consistent with two recent denosumab studies , one prospective and one retrospective , which found 82% persistence at one year and 70% persistence at eight months , respectively . teriparatide is a daily injection , while denosumab and zoledronic acid are 6-month and annual injections , respectively . . shows that 1-year persistence rates between denosumab and teriparatide are similar . due to lack of additional data , we assumed the persistence rate for teriparatide to be equal to denosumab at 2 years as well . although patients are likely to discontinue teriparatide treatment after 18 months , it is more conservative to assume persistence equal to denosumab at 2 years . also , in applying the same hr to real - world data for all injectable treatments ( denosumab , teriparatide , and zoledronic acid ) , the model minimizes the potential bias . first , to most accurately model the effects of denosumab in men , the model 's target population was reflective of the elderly men in the adamo trial , but it may not represent all male osteoporotic patients . second , in the real - world setting , patients may receive sequential treatments such as receiving alendronate after discontinuing teriparatide . however , the current model does not take into account pretreated patients or sequential treatments . nevertheless , the model structure used in the analyses has been widely used in osteoporosis cost - effectiveness research ( jnsson et al . 2011 , borgstrm et al . 2006 , examined sequential treatment ( using teriparatide followed by alendronate ) and assumed that the reduction in the risk of fracture was equal to a patient that had not been pretreated . third , it was assumed here that generic and branded alendronate would have comparable efficacy and safety data . this may affect adherence poorly and thus lead to poorer fracture outcomes , which could impact the cost - effectiveness results . finally , in the absence of adequate efficacy data in treatment trials in osteoporotic men , fracture reduction rates for the base - case model were derived from studies of pmo . we believe this is reasonable because there is little theoretical reason to suspect treatments will have different effects in men and women , bmd improvements have been shown to be similar across trials in men and women , and the fracture reduction data that are available ( e.g. , boonen et al . ) indicate similar effects regardless of sex . the results from this economic analysis suggest that denosumab is a cost - effective option compared to other existing treatments for older osteoporotic men in the us . even though alendronate is a low cost generic therapy , using a threshold of $ 100,000 per qaly , denosumab was cost - effective compared to generic alendronate . when the prices of zoledronate and risedronate were reduced by 35% and 65% , denosumab was still dominant . the differences in fracture risk reduction and improved persistence with denosumab are the largest drivers for denosumab being cost - effective compared to the other strategies . this analysis illustrates that the selection of treatment for men with osteoporosis should consider factors in addition to simple per dose costs . the significance of selecting the most appropriate osteoporosis treatment may be especially important for planning the overall costs per patient to a health care system payer .

purpose . to evaluate the cost - effectiveness of denosumab versus other osteoporotic treatments in older men with osteoporosis from a us payer perspective . methods . a lifetime cohort markov model previously developed for postmenopausal osteoporosis ( pmo ) was used . men in the model were 78 years old , with a bmd t - score of 2.12 and a vertebral fracture prevalence of 23% . during each 6-month markov cycle , patients could have experienced a hip , vertebral or nonhip , nonvertebral ( nhnv ) osteoporotic fracture , remained in a nonfracture state , remained in a postfracture state , or died . background fracture risks , mortality rates , persistence rates , health utilities , and medical and drug costs were derived from published sources . previous pmo studies were used for drug efficacy in reducing fracture risk . lifetime expected costs and quality - adjusted life - years ( qalys ) were estimated for denosumab , generic alendronate , risedronate , ibandronate , teriparatide , and zoledronate . results . denosumab had an incremental cost - effectiveness ratio ( icer ) of $ 16,888 compared to generic alendronate and dominated all other treatments . results were most sensitive to changes in costs of denosumab and the relative risk of hip fracture . conclusion . despite a higher annual treatment cost compared to other medications , denosumab is cost - effective compared to other osteoporotic treatments in older osteoporotic us men .

1. Introduction 2. Methods 3. Results 4. Discussion

in our daily clinical work we have noted an increasing number of cosmetic surgeries performed abroad in eastern and southern europe for financial reasons , similar to american lipotourism , or liposurgery performed abroad , mostly in latin america and the caribbean . in our opinion this cosmetic - surgery tourism will lead to an increasing number of cases of rare infections in europe , as has been observed in the united states [ 13 ] . we report a case of a 30-year - old woman , a german of turkish origin , who was admitted to our hospital in february 2014 for recurrent infections of the abdominal wall . three months after surgery , in january 2013 , she first noticed skin lesions near the incision lines . in the meantime , before she was admitted to our hospital , she had consulted several physicians regarding various abscesses of the left abdominal wall , but the abscesses always recurred after a short period of time . the patient was a nonsmoking woman with a normal body mass index of 21 kg / m and without a history of any serious disease or immunosuppression . abdominal examination revealed extensive phlegmon and several locular abscesses in the abdominal wall ( fig . we decided to relieve the largest abscess under local anesthesia , took a swab sample from an inner wound for microbiologic analysis , initiated antibiotic therapy with clarithromycin 500 mg twice a day and scheduled an extensive surgical debridement of the wounds with the patient under general anesthesia . before surgery we performed magnetic resonance tomography ( mrt ) to exclude any deeper infections of the abdominal wall and to estimate the extent of the infection . the mrt revealed no infiltrations of the abdominal muscles ; the two largest abscesses measured 9 1 cm and 5 2 cm . during the inpatient treatment we performed a surgical debridement of the wound and initiated a vacuum - assisted closure ( vac ) therapy . in the following the patient was discharged with inconspicuous wounds and in overall good health . in the meantime antimicrobial susceptibility testing by the gradient diffusion method found the following minimum inhibitory concentrations : amikacin 1.0 g / ml , levofloxacin 0.125 g / ml , moxifloxacin 0.047 g / ml , clarithromycin 1.5 g / ml , linezolid > 256 g / ml , rifampin > 32 g / ml , tetracycline 0.064 g / ml , imipenem 4 g / ml , meropenem 3 g / ml , ampicillin > 256 g / ml and amoxicillin / clavulanic acid > 256 g / ml . two weeks after discharge the patient again presented with abdominal wall pain and indurations of the skin ( fig . we reinitiated antibiotic therapy with clarithromycin 500 mg twice a day and reevaluated the surgical and medical treatment options in close cooperation with the institute of medical microbiology of the university hospital mnster . the swab sample taken from the wound at this time again grew m. fortuitum . additionally , multiple flora were identified , including prevotella bergensis , actinomyces europaeus , staphylococcus epidermidis , micrococcus luteus , lactobacillus sp . and because of the continuous progression of the disease over the last months and the proximity to the internal abdominal organs , interdisciplinary discussion led to the conclusion that the case was a potentially life - threatening illness . it was decided that inpatient treatment with radical debridement of the infected abdominal soft tissue , in combination with targeted antimicrobial therapy according to the results of susceptibility testing , was necessary . for antimicrobial therapy we decided to treat the patient intravenously for 14 days with amikacin ( 15 mg / kg ) and moxifloxacin 400 mg once per day , clarithromycin 500 mg twice a day and ampicillin / sulbactam 3 g every 8 hours . after that she received oral antimicrobial therapy with moxifloxacin 400 mg once a day and clarithromycin 500 mg twice a day for 3 months . we began the hospital treatment with this extended antibiotic therapy and radical debridement ( fig . 1c ) , initiating vac therapy followed by several revisions with continued vac therapy to prepare the wound for skin grafting . the patient was discharged from hospital with prescribed oral antibiotics and was regularly followed up . at the 1-year follow - up there was no sign of reinfection , and no pathologic findings were found in the blood tests . m. fortuitum is a rapidly growing mycobacterium that can cause severe infections leading to unsuccessful wound healing , wound dehiscence and infection recurrence . suspicion arises with a lack of response to conventional antibiotic regimens and if standard bacterial cultures remain negative . m. fortuitum is found in lakes , rivers , tap water , wastewater , and dust and dirt , and it can infect a wound when exposed to contaminated tap water . hospital - acquired disease caused by poor hygiene of sanitary facilities has previously been reported , but these infections usually present as disseminated skin lesions and soft tissue lesions , predominantly occurring in the setting of severe immunosuppression , especially in aids [ 68 ] . it can be the cause of multiple types of infections such as sternal wound infections after cardiothoracic surgery or after breast augmentation surgery , e.g. due to contamination of the wound with contaminated tap water . recent outbreaks have also been described in immunocompetent hosts after use of contaminated whirlpool foot baths in nail salons . m. fortuitum infections after liposurgery have been reported in different continents but to our knowledge not yet in europe . there have been reported outbreaks of mycobacterium abscessus wound infections in lipotourists from the united states who underwent abdominoplasty in the dominican republic . travelling to foreign countries , with their supposedly lower costs for cosmetic surgery , is relatively common in the united states ; these cosmetic surgeries are performed mostly in latin america and the caribbean [ 13,11 ] . in recent years this kind of tourism seems to have recruited an increasing number of patients in europe too , which may confront physicians with uncommon disease patterns , especially physicians in private practice and those practicing in general medicine . therefore , it is important to execute a full history of the patient and to know the significant signs of this rare infection . in particular , a negative standard bacterial culture , a lack of response to conventional antibiotic regimens and infection recurrence , particularly months after surgery , should set physicians ' alarm bells ringing . we report a successful surgical and antibiotic treatment of a m. fortuitum infection after abdominoplasty . in our case awareness among physicians will , we hope , result in faster identification and treatment of these cases . it is important to make patients appreciate the higher standards of hygiene and the more skilled performance of these procedures even though they are associated with higher cost . bargain hunters should be made aware that in the end the price of their abdominoplasty may be higher than expected .

we report a case of a 30-year - old woman who experienced recurrent infections of the abdominal wall after travelling to turkey from germany to undergo abdominoplasty for aesthetic reasons . the patient 's mycobacterium fortuitum infection was successfully treated by surgery and antibiotic therapy . surgical tourism in this case , lipotourism is resulting in an increasing number of patients in europe who may present uncommon disease patterns .

Introduction Case report Discussion Conflict of interest

percutaneous nephrolithotomy ( pnl ) is a minimally invasive surgical modality for the management of most renal stones . technological advancements and refinements have contributed to further lowering the morbidity associated with this procedure . such refinements include the use of a smaller working sheath and nephroscope ( mini pnl ) , sealing of the percutaneous access tract with hemostatic agents [ 2 - 4 ] , substituting general anesthesia with regional blocks ( ambulatory spinal tubeless pnl ) , and avoidance of a nephrostomy tube ( tubeless pnl ) . tubeless pnl has been known to be comparable to standard pnl in hemorrhagic and postoperative complications . this modification in technique allows earlier discharge from the hospital , reduction in postoperative pain , and more rapid recovery . in most tubeless pnl procedures , internal drainage is provided with a double - j stent or temporary ureteral catheter . in those cases however , in totally tubeless pnl , internal drainage is not provided . in the published data , there are few studies that include totally tubeless pnl [ 8 - 10 ] , and to our knowledge , there are no published studies associated with totally tubeless pnl in korea . we have performed totally tubeless pnl without inserting ureteral stents in some patients since 2008 . the results have shown that totally tubeless pnl does not differ from standard pnl in terms of complications and , moreover , that it is superior in terms of hospitalization and postoperative pain [ 8,11 - 14 ] . this study aimed to compare the totally tubeless and standard pnl procedures as well as to identify cases appropriate for totally tubeless pnl . at this hospital , 65 patients were diagnosed with renal stones , with or without ureter stones , between march 2008 and february 2012 . exclusions were made for 8 cases for the following reasons : serious hemorrhage occurring during surgery , the need to perform secondary pnl owing to a large burden of remnant stones , and undergoing percutaneous multiple tracts . standard pnl and totally tubeless pnl were performed on 30 and 27 patients , respectively . at first , standard pnl or totally tubeless pnl was performed according to our preference , but the former has not been performed since may 2011 . first of all , the percutaneous tract was acquired by the insertion of a guidewire to the affected kidney preoperatively in all cases , and the surgery was performed under general anesthesia . with the patient in the lithotomy position , the 6-fr upj occlusion balloon catheter ( cook medical , bloomington , il , usa ) was inserted retrogradely , and hydronephrosis was induced by a balloon occlusion at the ureteropelvic junction . following the placement of a 16-fr foley catheter , the patient was turned to the prone position , and the percutaneous tract was dilated by using the ultraxxtm nephrostomy balloon ( unb-10 - 15 , cook medical ) . then , the tract was secured by the placement of a 28-fr amplatz sheath , and the surgery was performed with a 26-fr rigid nephroscope ( karl storz , tuttlingen , germany ) . the calculus was crushed and removed with the use of a pneumatic lithoclast ( karl storz ) or an ultrasonic lithotriptor ( karl storz ) . after completing the surgery , the malecot catheter was kept for 3 to 5 days postoperatively until the hematuria recovered . in the case of totally tubeless pnl the surgical site was sutured after being compressed for about 10 minutes , and the patient was released from the hospital after hematuria took a favorable turn . patients who complained of pain after surgery were given intramuscular injections of tramadol hcl ( 50 mg ) . multiple renal stones were defined as the detection of at least two calculi , and a febrile urinary tract infection , one of the postoperative complications , as a rise in body temperature to 38 degrees celsius . a comparison was made between the two groups in clinical values , such as patients ' characteristics , stone characteristics , operation time , transfusion rate , blood loss , changes in serum creatinine levels , length of hospitalization , analgesia requirements , stone - free rate , perioperative complications , and auxiliary treatment . stone volume was calculated by using the formula of a sphere , with the mean radius of a major axis and a minor axis ( stone volume=4/3 [ major axis+minor axis/4 ] ) . the stone - free rate was defined as all cases in which the stone disappeared on the computed tomography or simple x - ray after pnl . mann - whitney u test and the fisher 's exact test were used as appropriate . a total of 57 patients undergoing pnl for renal stones , with or without ureter stones , completed the study protocol : 30 patients in the standard group and 27 patients in the totally tubeless group . there were no significant statistical differences in patient age , gender distribution , body mass index , stone size , or stone laterality ( table 1 ) . the stone - free rates were 73.3% and 77.8% in the standard group and totally tubeless group , respectively , with no significant statistical difference . the mean operation time was slightly longer in the standard group ( 148.5 minutes ) than in the totally tubeless group ( 128.7 minutes ) , but there was no statistically significant difference . there was no significant difference between the two groups with regard to serum creatinine change or blood loss . however , the length of hospitalization in the totally tubeless group was significantly shorter than in the standard group , and analgesic requirements favored the totally tubeless group with statistical significance ( table 2 ) . there were no adjacent organ injuries during the operation in the two groups , and the postoperative complication rates were similar . the transfusion rates were 7% ( 2/30 ) and 4% ( 1/27 ) in the standard and totally tubeless groups , respectively , with no significant statistical difference . postoperative hydronephrosis was 0% ( 0/30 ) and 7% ( 2/27 ) in the standard and totally tubeless groups , respectively , with no significant statistical difference ( table 3 ) . there were 14 cases with remnant stones managed by extracorporeal shock wave lithotripsy ( eswl ) or ureteroscopic stone removal ( urs ) . there were 2 cases of postoperative hydronephrosis in the totally tubeless pnl group , and both of them had residual stones . one patient ( 3% ) in the standard pnl group underwent selective renal angioembolization because of pseudoaneurysm . pnl has been accepted as a standard procedure for the management of large renal stones [ 19 - 22 ] . it provides reliable urinary drainage , it provides hemostatic tamponade to the fresh percutaneous renal tract , and it provides continuous access to the renal collecting system should a secondary percutaneous procedure be required . despite these obvious and important advantages , however , nephrostomy tubes , especially in the vicinity of a rib , are thought to contribute to postoperative pain and morbidity . reported that hospitalization could be curtailed and the use of analgesics could be reduced by applying a small - diameter nephrostomy tube ( pnt ) after pnl and that such a tube was not different from large - diameter ones in terms of changes in the hemoglobin level . on the basis of this study , many researchers have insisted on the uselessness of pnt , since wickham et al . thereafter , bellman et al . challenged the necessity of placing a nephrostomy tube after a pnl procedure in 50 patients . in that study the hospitalization time , analgesia requirements , time to return to normal activities , and cost were significantly lower with this technique . the authors concluded that tubeless pnl is a safe procedure that offers numerous advantages over the routine placement of a nephrostomy tube . in korea , kwon and kim compared perioperative outcomes between standard pnls and tubeless pnls with ureteral stents in 2007 and reported that the latter was more effective for curtailing hospitalization . karami and gholamrezaie compared 30 totally tubeless patients with 30 standard pnl patients and reported that avoiding pnt and removing the ureteral catheter at the end of the procedure in selected patients was safe and was associated with a significantly decreased length of hospitalization and analgesic requirements . likewise , bdesha et al . reported that hospitalization was curtailed in 40 patients on whom pnt placements were not performed . crook randomly performed standard pnl and totally tubeless pnl on 50 patients with renal stones and reported that there were no significant intergroup differences in hemorrhage , infection , blood transfusion , or clinical values , but that the hospitalization time was shorter in the totally tubeless pnl group than in the standard pnl group . in our study , 73.3% of patients in the standard pnl group and 77.8% of patients in the totally tubeless group were stone - free . perioperative blood loss , transfusion , and the complication rate in the totally tubeless group were also comparable to the standard pnl group . meanwhile , the length of hospitalization and analgesic requirements were significantly decreased in the totally tubeless group . moreover , the procedure for removal of the stent should not be necessary in the totally tubeless group as opposed to the tubeless with internal stent drainage patients . totally tubeless pnl reduced the additional postoperative cost and discomfort associated with removal of the stent . the possible limitation of the tubeless procedure is that it precludes secondary procedures for the treatment of residual stones . however , alternatively , residual calculi can be safely managed by eswl or retrograde intrarenal surgery by use of flexible ureteroscopy . we managed 12 cases of residual calculi with eswl , and the other two patients were managed by urs . nephrostomy tube placement , at the end of the standard pnl procedure , is thought to prevent these complications . a concern of many urologists with the tubeless technique is the lack of a tamponade effect in the nephrostomy tract . despite this , tubeless pnl retains its role in selected patients with renal stones who are undergoing uncomplicated pnl . however , a nephrostomy tube should be placed if serious disruption or significant laceration of the collecting system is noted . also , if significant intrarenal bleeding is found and endoscopic visualization is impossible , a nephrostomy tube should be inserted . the tube is then clamped , allowing the pelvicaliceal system to be tamponaded . with the intent of reducing postoperative discomfort and pain , hospital stay , and cost we believe that this procedure will be acceptable only when safety has not been sacrificed . we believe that uncomplicated percutaneous nephrolithotripsy can be performed without leaving a nephrostomy tube or ureteral stent . we also believe that the major advantage for patients undergoing totally tubeless pnl is the absence of stent - related flank pain and dysuria . the results of the present study showed that totally tubeless pnl did not differ greatly from standard pnl in the consideration of effectiveness and safety and that it curtailed length of hospitalization and reduced the analgesia requirement . although prospective and larger - scale studies may be needed to confirm the result of this study , totally tubeless pnl may be an alternative for the management of renal stones in selected patients .

purposeseveral recent studies have reported the benefits of tubeless percutaneous nephrolithotomy ( pnl ) . postoperatively , tubeless pnl patients have an indwelling ureteral stent placed , which is often associated with stent - related morbidity . we have performed totally tubeless ( tubeless and stentless ) pnl in which no nephrostomy tube or ureteral stent is placed postoperatively . we evaluated the safety , effectiveness , and feasibility of totally tubeless pnl.materials and methodsfrom march 2008 to february 2012 , 57 selected patients underwent standard or totally tubeless pnl . neither a nephrostomy tube nor a ureteral stent was placed in the totally tubeless pnl group . we compared patient and stone characteristics , operation time , length of hospitalization , analgesia requirements , stone - free rate , blood loss , change in creatinine , and perioperative complications between the standard and totally tubeless pnl groups.resultsthere were no significant differences in preoperative patient characteristics , postoperative complications , or the stone - free rate between the two groups , but the totally tubeless pnl group showed a shorter hospitalization and a lesser analgesic requirement compared with the standard pnl group . blood loss and change in creatinine were not significantly different between the two groups.conclusionstotally tubeless pnl appears to be a safe and effective alternative for the management of renal stone patients and is associated with a decrease in length of hospital stay .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSIONS

congenital hereditary endothelial dystrophy ( ched ) is a rare corneal dystrophy causing bilateral diffuse corneal clouding due to an abnormal endothelium and descemet 's membrane ( dm ) . traditionally , ched has been managed using penetrating keratoplasty ( pkp ) ; however , pkp in children has its own difficulties . major reasons for delaying pkp in children with ched include low scleral rigidity and positive vitreous pressure resulting in a higher rate of intraoperative complications , suture induced astigmatism and amblyopia , suture complications , need for multiple examinations under anesthesia ( eua ) , and traumatic wound dehiscence . descemet 's stripping automated endothelial keratoplasty ( dsaek ) is currently the treatment of choice for corneal endothelial disease in adults . advantages of dsaek over pkp include surgery in a closed system , fewer sutures and less astigmatism as well as better preservation of globe integrity and protection against trauma . however , there are a few reports evaluating the efficacy of dsaek for ched in pediatric subjects . herein , we report a case of ched with severe corneal clouding who underwent successful operation employing a modified dsaek technique . a 19-year - old male was referred to our clinic with severe bilateral corneal clouding and nystagmus since early childhood . best corrected visual acuity ( bcva ) was hand motions ( hm ) in both eyes . slit lamp examination revealed severe corneal cloudiness precluding visualization of the anterior chamber ( ac ) and iris details in both eyes [ figure 1 ] . fundus examination and specular microscopy were not possible due to corneal edema but b - scan ultrasonography was unremarkable . central corneal thickness ( cct ) was > 1000 using an ultrasonic pachymeter ( pachymeter sp 3000 , tomey , nagoya , japan ) . the right eye of a 19-year - old male with nystagmus and severe diffuse corneal clouding indicative of congenital hereditary endothelial dystrophy . considering poor visualization of the ac and the risk of lens damage , some modifications were made in the standard technique to decrease the rate of intraoperative complications . preoperatively , topical pilocarpine 2% was used to induce miosis and decrease the risk of inadvertent lens damage [ figure 2a ] . with the surgeon sitting temporally , the corneal epithelium was removed although it did not improve the surgeon 's view of the ac . at the 11 oclock position of the cornea , a 1 mm side port incision was created ; an ac maintainer was inserted and turned on . a vertical incision at the corneal reference mark was made at 3 oclock using a 15 blade [ figure 2b ] . due to poor visualization , dm was not stripped . a 100 nylon suture ( sharpoint 100 nylon , 3/8 circle needle , angiotech pharmaceuticals , inc . usa ) was introduced into the ac with the swaged end of the needle entering first [ figure 2c ] . it was pulled out through the temporal incision using a reverse sinsky hook by engaging the loop between the swage and the thread [ figure 2d and e ] . a precut donor cornea was punched 8 mm in diameter using a disposable punch ( hessburg - barron punch , katena products inc , denville , nj , usa ) . the needle was passed through the fold line at half thickness [ figure 2f ] and the knot was tied in a long loop for easy removal of the thread out of the button [ figure 2 g and h ] . the temporal incision was then enlarged to 5 mm and the suture pull - through technique was used to insert the button through the ac with the stromal side up [ figure 2i l ] . the thread was cut and removed from the lenticule [ figure 2 m ] . after graft unfolding , a large air bubble was injected into the ac to keep the graft adherent to the overlying stroma [ figure 2n ] . partial decompression of the ac was done and the patient was positioned face up for 2 hours . surgical technique of modified descemet 's stripping automated endothelial keratoplasty ( dsaek ) : preoperatively there was severe corneal cloudiness ( a ) , after placing an anterior chamber ( ac ) maintainer , a vertical corneal incision was made at 3 oclock ( b ) , a 10/0 nylon suture was introduced into the ac with the swaged end of the needle entering first ( c ) , the needle was pulled out through the temporal incision using a reverse sinsky hook ( d and e ) , the needle was passed through the fold line of an 8-mm donor disc at half thickness ( f ) , the thread was tied in a long loop ( g and h ) , the disk was pulled into the ac by the 10/0 nylon suture ( i - l ) , the graft was unfolded ( m ) and kept adherent to overlying stroma by injection of an air bubble ( n ) . on the first postoperative day , the graft was well centered . the patient was given chloramphenicol eye drop 4 times a day for 1-week and betamethasone 1% eye drop every 2 hours which was tapered gradually over 1-month . bcva at 4 months was counting fingers at 4 m and cct was decreased to 680 . due to residual corneal opacity , specular microscopy was not possible [ figure 3 ] . the same eye 4 months after dsaek shows a marked decrease in corneal edema . conventional pkp , as the traditional treatment for ched , has a high risk of failure and complications in younger subjects . low scleral rigidity and positive vitreous pressure may lead to devastating intraoperative complications such as suprachoroidal hemorrhage in children undergoing pkp . postoperatively , children show more fibrin reaction . suture related problems including infection and graft rejection due to loose sutures , astigmatism and amblyopia , traumatic wound dehiscence and the need for multiple euas are the reasons for which surgeons defer pkp as long as possible in children with ched . in adults , dsaek is the treatment of choice for endothelial dysfunction . it has higher safety and efficacy due to better preservation of globe integrity , elimination of corneal suture - related problems including astigmatism and infection , and faster visual recovery . these advantages are especially important in pediatric patients ; however , there are only a few reports of dsaek in pediatric subjects . positive vitreous pressure with shallow ac and phakic status of children 's eyes which increase the risk of lens damage are major concerns in these eyes . pineda et al reported the first attempt of dsaek in a 7-year - old boy which was converted to pkp due to technical difficulty . mittal et al reported the first successful dsaek in a 19-year - old patient with ched . bellucci et al were the first to report successful endothelial keratoplasty in both eyes of a 3 months baby with ched . busin et al reported successful results of dsaek in 15 eyes of 8 patients with mean age of 9 years ( range , 6 months to 30 years ) . they performed standard dsaek using the busin glide with the 3 and 9 oclock incisions moving 1 mm superiorly to protect the lens by iris . in 6 eyes of 3 patients owing to rapid restoration of corneal clarity in this series , they recommended the technique to be performed at an earlier age . in a study by asher et al , five ched patients with mean age of 7.8 ( range , 512 ) years underwent successful dsaek with reduced postoperative complication compared to pkp . they used a microcapsulorhexis forceps and a light pipe to improve visualization of dm and inserted the lenticule into the ac by passing the sheet 's glide across the pupil to protect the crystalline lens . they could not strip dm due to its firm attachment and used the busin glide and forceps to pull the disc into the ac . although the results of dsek as an alternative to pkp for ched are encouraging , one may face several technical difficulties during surgery . due to firm adhesion of dm to the posterior stroma in cases of ched especially during the 1-year of life , dm does not peel off as easily as in older subjects and fuchs dystrophy and pseudophakic bullous keratopathy . shallow and poorly visualized acs as well as phakic status of the eye are additional challenges during the surgery . in our patient , we did not strip dm due to poor visibility , and did not use a busin glide to prevent accidental lens damage . instead , a modified suture pull - through technique was employed with fewer instruments being introduced into the ac . by continued evolution and improving dsaek technique

a 19-year - old male with congenital hereditary endothelial dystrophy ( ched ) presented with severe bilateral corneal clouding precluding any view of the intraocular structures . he underwent modified descemet 's stripping automated endothelial keratoplasty ( dsaek ) technique including a suture pull - through technique to prevent lens damage . surgery resulted in progressive clearing of the cornea and decreased corneal thickness . visual acuity increased from hand motions preoperatively to counting fingers at 4 m after 4 months . dsaek can be successfully performed in phakic eyes with ched as an alternative to penetrating keratoplasty . it has the advantage of less wound problems and better preservation of globe integrity especially in children .

INTRODUCTION SURGICAL TECHNIQUE DISCUSSION Video available at

bed was added to the diagnostic and statistical manual of mental disorders only in the 2013 edition ( dsm-5).2 however , similar patterns of signs and symptoms have been reported in the medical literature since 1932 , when german psychoanalyst moshe wulff described an eating disorder characterized by binge eating , depression , and disgust with one s body.3 dsm-5 criteria for a bed diagnosis include at least one binge episode per week without any compensatory purging behavior ( which would then lead to a bulimia nervosa diagnosis ) . binges must involve an objectively large amount of food , consumed within two hours , and accompanied by a feeling of loss of control . loss of control is what distinguishes a binge from simple overeating , and similar constructs exist in substance use disorders . loss of control can take many forms , but there are commonalities in patients included in the dsm-5 that are necessary criteria for a bed diagnosis : being unable to stop consuming food despite a strong desire to stop , a feeling of fullness , eating alone because of being embarrassed about how much one is eating , or even a sense that the food s taste is no longer appealing bed patients frequently report that their binge foods are foods that they view as forbidden or unhealthy . one of wulff s patients , for example , described secretly eating large quantities of sweets , bread , and pastries because they were restricted from her daily diet due to medical obesity . the worse [ for me ] , the better , she explained . in severe binges , the drive for overindulgence may cause patients to consume raw pancake batter , entire loaves of bread , frozen fish sticks , or other bulk foods , however lacking in taste the patient often plans secret eating in advance , and carries it out late in the day and typically experiences disgust , depression , and guilt afterwards . b , a 57-year - old african - american woman , reported significant struggles with food prior to entering treatment , and stated that she often thought about eating all day long . b said that she visited the grocery store several times a week , ate directly from bags or containers , and often consumed strange combinations of flavors , such as licorice , bread , peanuts , and beef jerky . did nt even want those foods but could nt stop eating them pointed to a loss of control . b also reported frequently eating despite not being hungry , in order to fill a void . she has tried to combat the resulting significant weight gain through a variety of fad diets , wellness programs , and gastric bypass surgery . this has led to extreme weight fluctuations over 25 years , including a recent episode in which she lost 75 pounds on a crash diet . however , failing to address the psychopathology underlying her bingeing , she gained all that weight back . people who meet the criteria for bed are more likely to be in the obese or overweight ranges , and to report struggling with their weight as children . compared to healthy controls , those diagnosed with bed reported more frequent family histories of depression , greater vulnerability to obesity , more exposure to negative comments about shape or weight , greater perfectionism , and higher negative self - evaluation . compared to obese individuals who do not binge , those diagnosed with bed reported greater weight and shape concerns , more personality disturbance , more mood / anxiety disorders , and a lower overall quality of life . if we treat bed patients only with weight loss interventions , we wo nt target the actual problem , as b s case suggests . while bed may occur in normal weight individuals , the patient in such cases is typically in the early stages of the disorder . for early bed patients , prompt intervention may stop the binge - eating behavior before medical and psychological consequences become irreversibly severe . indeed , binge - eating is often viewed as emotion - driven eating , done in response to anxiety , depression , and/or boredom.4 this has certainly been the case for b , who reports difficulty connecting to others since childhood as well as identifying and allowing herself to experience emotions . even in healthy individuals , eating is a complex process , involving not just physiological but also psychological and emotional processes . we eat not just because we need sustenance but also because food tastes good , we re with friends who are also eating , and/or we re bored and food is available . three neural pathways interact to drive eating behavior : one codes for the perceived salience , or importance , of a food stimulus ; another codes for the rewarding sensation of actual eating ; and the third helps us control our consumption based on considerations of both short and long - term outcomes , such as weight gain . basic sensory information about food is processed by a brain region called the insula , along with the frontal operculum . the insula also plays a role in networks that determine salience . to identify and evaluate the rewarding properties of the food , closely connected brain regions collectively called the ventral striatum , including the nucleus accumbens and related regions , such as the putamen , and caudate , are called into action . finally , the circuitry that helps us control our responses to food includes the dorsal caudate and dorsal acc , ventrolateral pfc , and parietal cortex.5 together , these pathways combine , in effect , to weigh the salience of a stimulus , its reward value , and the longer - term consequences of consuming it , and thereby determine eating behavior . generally , overeating is attributed to an elevated experience of reward , a reduced ability to inhibit the drive to eat , or some combination of the two . typically , studies of these pathways in bed patients compare the latter to weight - matched controls as well as lean participants . while some of the research is conflicting , overall we see decreased inhibitory control and increased sensitivity to reward . if we start to parse out different types of self - control , bed is associated with a range of deficits . individuals with bed tend to do worse on tasks related to motor inhibition and attention , and these deficits seem to be related to binge eating severity rather than obesity.6 while it s unclear whether increasingly severe binge eating leads to inhibitory control problems or vice versa , these impairments certainly help maintain the disordered eating . if individuals are more susceptible to impulsive decision - making , their vulnerability to binge - eating increases , and breaking the cycle of binge eating becomes more difficult . however , we ca nt just tell bed patients that they need to make better choices and exert more willpower , given the differences in the neurobiology that underlie inhibition . compared to both lean and weight - matched control participants , bed patients appear to have abnormally low activity in impulse - control related frontal brain regions . a recent neuroimaging study asked bed participants to complete a task in which they had to resist reading a word in favor of naming the color of the word s printed type a classic test of inhibitory control.7 the study showed reduced activation in the ventrolateral pfc , inferior frontal gyrus , and the insula . further , the more impairment that bed participants had in recruiting those neural pathways involved in self - control , the worse they were at dietary restraint . studies of the relationship of reward sensitivity to bed are more numerous , and typically point to an elevation in the brain response to both food and non - food reinforcement . functional magnetic resonance imaging ( fmri ) research has shown links between aberrant brain activation and behavioral tasks of delaying gratification as well as self - report measures of sensitivity to reward . some fmri studies have lumped bed patients with non - bingeing obese subjects , and unsurprisingly have reported inconsistent findings . overall , findings have tended to indicate increased reward sensitivity , particularly just after having eaten . those studies that have looked at more pure samples of bed patients have found exaggerated responses in the orbitofrontal cortex to food reward compared to obese or lean controls.8 if we distinguish between viewing images of rewarding things , and anticipating or receiving actual rewarding things , the findings again tend to vary . during the anticipation of monetary rewards , for example , bed subjects show less activity in the ventral striatum compared to obese non - bingeing subjects though they show no significant difference on this measure from lean control subjects.9 wang and colleagues10 have demonstrated , using positron electron tomography ( pet ) , that seeing , smelling , and tasting a food ( but not eating it ) significantly increases dopamine in the caudate in bed participants . dopamine is a neurotransmitter that helps mediate the motivation to eat , and in the dorsal striatum is associated with habit learning , in which behavior becomes automatic and no longer necessarily linked to pleasurable outcomes . the wang study linked higher caudate dopamine levels to binge eating severity rather than to weight , supporting the idea that separate brain circuits underlie eating pathology and the development of obesity . considering the two prior findings , in the context of the relevant literature , we could speculate that participants do not fully anticipate the effect that eating will have on their psyche , eating only out of habit . thus , they become overwhelmed upon receiving the food , potentially driving the loss of control that seems central to binge eating . while the research in bed is still limited , similar results suggesting a blunted anticipatory response to reward has also been seen in substance abuse . a recent meta - analysis suggests that bed patients may demonstrate slightly elevated harm - avoidance ( a measure of anxiety , inhibition and inflexibility ) and potentially novelty - seeking ( a facet of impulsivity).11 other studies have shown that impulsivity specifically negative urgency , or the tendency to act impulsively when distressed may be related to the emergence of binge eating.12 this seems consistent with the emotional dysregulation that is typically reported in this population overall , these two findings suggest that some level of impulsivity or harm avoidance may predispose some people to binge - eat . there are a number of empirically based treatment approaches for bed that share the goal of reducing binge - eating episodes and the accompanying psychopathology . the gold standard is cognitive - behavioral therapy ( cbt ) , which targets maladaptive eating behaviors through a combination of self - monitoring , normalizing eating patterns , and building behavioral and cognitive coping skills . cognitive strategies involve identifying and restructuring cognitive distortions that help maintain binge - eating behaviors . for instance , the thought that i ve already broken my diet with this slice of pizza , so i might as well have the whole pie is an example of all or nothing thinking , and can be reframed as , i may have had a slice of pizza , but i can still eat healthily the rest of the day . however , some research indicates that only 50 percent of bed patients who complete cbt treatment experience lasting improvement , and an estimated 33.3 percent of patients continue to meet criteria for eating disorders five years after beginning therapy.13 these are dismal numbers , but there is evidence that a longer course of treatment may show better results.14 given that binge eating is widely seen as a means of managing unwanted emotions , some treatments have targeted patients emotional regulation abilities . for example , dialectic - behavior therapy ( dbt ) is a cognitive - behavioral treatment approach , originally developed for borderline personality disorder that focuses on mindful awareness and tolerance of emotion , building coping skills , and interpersonal effectiveness . in studies of dbt s effectiveness , most participants significantly decreased their binge - eating behavior.15 while differences compared to a control group that received nonspecific treatments were not significant after follow - up , an additional study of dbt - based guided self - help suggests that persistence of binge - eating abstinence is influenced by changes in emotional regulation.16 pharmacological treatments that target brain chemistry directly have shown mixed success . a meta - analysis of pharmacotherapy for bed suggests a medium effect of antidepressant use for the reduction of binge - eating behavior.17 studies suggest that combining pharmacotherapy with cbt or interpersonal therapy ( ipt ) does result in a significantly improved response rate , but combination treatments may not be any better than psychotherapy alone . in general , for prospective bed drug therapies ; there has been a relative lack of controlled clinical trials in large samples of patients . lisdexamfetamine ( vyvanse ) , an appetite suppressing amphetamine , is currently the only medication that is fda - approved specifically for treating bed . like other stimulants , lisdexamfetamine works by increasing extracellular dopamine and norepinephrine , and while the mechanism of action is not definitively known , it is possible that increasing synaptic dopamine in the striatum may weaken or reduce the characteristic under - response to anticipation of palatable food seen in bed . clinical trial results indicate that it leads to the cessation of binge - eating behavior in up to 50 percent of treated subjects.18 however , there are significant side effects , experienced by over 80 percent of participants on the medication , and there is a significant risk of abuse and dependence . furthermore , it s unclear that lisdexamfetamine works for people who have depression or other medical issues related to obesity as most bed patients do . psychological and behavioral treatments are necessary to fully address the complex psychological and medical syndrome associated with bed . if pharmacotherapy is not a magic bullet , how can we improve cognitive behavioral treatment to target the neurobiology ? . it may be difficult , but preliminary research in obesity suggests the possibility of habituating patients to food through repeated exposure without actual consumption , thereby reducing cravings.19 the same research suggests that control over eating behavior may be strengthened by a combination of stimulus control such as minimizing exposure to binge foods , changing environmental cues for binge eating , and reducing vulnerability factors for binge eating , such as extended periods of time alone and inhibitory training . both approaches may help individuals develop the needed skills to resist urges to initiate binges or stop them once they ve started . we might also consider working with the temperament traits that promote binge eating rather than against them . if individuals with bed are more reward - sensitive , then frequent and salient rewards for abstinence during therapy may be more effective than punishments for lapses . rewarding social experiences that do nt involve food may also reduce reliance on food , as well as potentially reducing any underlying depression . we propose that further advances in bed treatment can come from behavioral interventions that target bed s apparent neurobiological mechanisms . anecdotally , this strategy appears to be working for b : she has spent four months in a partial hospitalization program using dbt and cbt treatment to advance her learning skills and become more mindful of her emotions , as well as better tolerate distress and improve interpersonal relationships . while she hasnt lost any weight , she has binged only a handful of times . meanwhile , she s learning to cook for herself and eat regularly , rather than depriving herself or following fad diets . she s also worked significantly on regulating her emotions : learning other ways of dealing with emotions improved my life one - hundred percent . if i lose weight because of it , that is a bonus . if not , at least i have my life back .

editor s note : who hasnt dipped into that pint of hagen - dazs with the best of intentions and ended up finishing the entire container ? knowing where the line is when it comes to out - of - control impulse consumption is at the heart of binge - eating disorder ( bed ) , a newly recognized mental condition that effects affects millions of people and that we are just beginning to better understand from both a neurobiological and clinical standpoint .

What Makes a Binge a Binge? Lessons from Neurobiology Binge Eating Treatment

historically , htt was initially identified as a caspase substrate and it was the first example of a protein associated with a neurodegenerative disorder cleaved during apoptosis . caspases are highly conserved cysteine - aspartic proteases associated primarily with apoptotic cell death and essential for the processing of a large number of substrates . proteolytic fragments processed by caspases are detectable in brains of hd patients and hd mice before the loss of neurons in the striatum , with the cleavage efficiency dependent on the polyq tract length . blocking htt cleavage by site - directed mutagenesis or by pharmacological approaches reduces cytotoxicity in cultured cells . in line with these findings , mice overexpressing a caspase-6 non - cleavable mutant htt have milder neuropathological defects and are protected against excitotoxic stimulation compared with mice carrying the cleavable mutant htt . this strongly suggests that caspase - dependent proteolytic cleavage of the aberrant protein might be a key step in the toxic events during hd , and that htt functions as prosurvival factor . htt is also a substrate of calcium - activated proteases , that is , calpains . calpains belong to the family of cysteine proteases typically activated by the elevation of intracellular ca levels , either in response to plasma membrane depolarization or in response to ca release from the intracellular stores . in mice overexpressing mutant htt , increased glutamate release from afferent neurons enhances nmda - r activity . this leads to an intracellular ca increase and therefore activation of calpains , which in turn cleave the htt protein into a series of proteolytic products that promote nmda - r - mediated excitotoxicity . moreover , calpains can modulate htt homeostasis via the catabolic process of autophagy . as shown by recent rnai and chemical compound screenings in cultured cells , inhibition of calpains another rnai screening study has also shown that small htt fragments can be generated by the proteolytic activity of some matrix metalloproteinases ( mmps ) . the activation of the mmps and the resulting cleavage of htt were confirmed in samples from hd mouse models . reduced mmp activity , especially mmp-10 and mmp-14 , correlates with lower amount of proteolytic fragments and , as a result , suppression of neuronal degeneration induced by mutant htt in cellular model systems as well as in drosophila . collectively , these findings suggest that protease inhibition might be a beneficial therapeutic approach for hd as it delays the formation of htt - containing intracellular aggregates . autophagy is a cellular catabolic process that seems to have an important role in the pathogenesis of cancer as well as in neurodegenerative disorders . the process of autophagy involves the formation of a double - membrane structure ( autophagosome ) that then encloses a portion of cytosol and delivers its cargo content to the lysosomes for digestion . autophagy occurs at constant low levels in all cells as part of ongoing cellular protein quality control and organelle turnover . however , it also has a primary role in the response to nutrient deprivation as it sustains metabolic functions by providing energy and metabolites to the cells . in different experimental settings , autophagy activation blocks detrimental processes and therefore facilitates cell stress resilience and survival . furthermore , autophagy is one of the primary degradation pathways for various aggregate - prone proteins associated with neurodegenerative diseases . as the tight regulation of autophagy is essential for cellular homeostasis , it is not surprising that autophagic dysfunction can cause metabolic stress and cell death mainly through apoptosis resulting from mitochondrial deficiency or via cleavage of atg proteins . among several key regulators of autophagy , the target of rapamycin ' ( tor ) senses energy status and the availability of the nutrients within the cell through the upstream class i phosphoinositol 3-kinase ( pi3k ) , the serine / threonine kinase akt and the 5-amp - activated protein kinase ( ampk ) . inhibition of the tor complex promotes the recruitment of beclin-1 and atg proteins involved in the formation of the mature autophagosome . the modulation of autophagy is therapeutically promising in hd : the inhibition of tor by rapamycin enhances the clearance of mutant htt - containing aggregates via the autophagy - lysosome pathway ( figure 1 ) . similarly , drugs that block a rise in intracellular ca , such as -type ca channel antagonists , decrease the activity of calpains and result in the indirect activation of autophagy , likely by preventing the degradation of beclin-1- and atg - related proteins . although calpain inhibition promotes autophagy in - vitro and in zebrafish , it still remains to be determined whether it can be effective against hd in in - vivo mammalian models or in clinical settings . autophagy induction clearly represents an appealing approach for hd treatment ; however , the therapeutic window remains to be determined as mutant htt has a negative effect on the sequestration of the autophagic cargo . although the autophagosomes seem to form and fuse to the lysosomes efficiently , there is a failure in the recognition of targeting signals , such as p62 or polyubiquitin , that results in delayed engulfment of cytosolic macromolecules and damaged organelles . several strategies have been suggested to improve the clearance of htt - containing aggregates by autophagy . one of them is based on the observation that histone deacetylase inhibitors block the polyq protein - dependent neuronal degeneration in drosophila . in this case , the acetylation of mutant htt facilitates the recruitment of the protein to the autophagosome and therefore increases the removal of toxic species within the cells . more recent evidence demonstrates that htt - mediated neuronal loss in drosophila can be suppressed by genetic or pharmacological inhibition of nad - dependent class iii deacetylases sirtuins . as pharmacological manipulation of sirtuins by resveratrol has been proposed to activate several pathways , including autophagy , these studies are of particular interest from a potential therapeutic standpoint . loss of proteostasis is a hallmark of several neurodegenerative disorders such as pd , ad and hd . in all of these disorders , aggregate - prone proteins trigger the formation of insoluble intracellular or extracellular aggregates as a result of environmental stress or metabolic changes . whether the fibrillar protein aggregates are pathogenic or have protective roles , remains controversial . in nematodes and in mice , loss - of - function or decreased insulin / insulin - like growth factor 1 ( igf-1 ) signaling prevent the proteotoxicity caused by aggregate - prone peptides . the insulin / igf-1 signaling pathway is an evolutionarily conserved process that stimulates cellular growth according to nutrient availability . the activation of the receptor leads to the potent activation of the downstream target pi3k and akt , which coordinates multiple cellular processes such as proliferation , energy metabolism and survival . together with tor , akt integrates the extracellular inputs with the intracellular status and tunes the cellular responses accordingly . in caenorhabditis elegans , loss - of - function mutations of the sole insulin / igf-1 receptor daf-2 extend the lifespan to more than twofold . genetic studies in c. elegans have revealed that the shift of polyq - containing proteins from the soluble to the aggregate form is time - dependent . loss - of - function of the pi3k age-1 not only extends the lifespan of nematodes but also significantly delays polyq aggregation and toxicity . these protective effects are determined by increased expression of stress - response genes , such as heat shock proteins under the control of the transcription factors daf-16 and hsf-1 . interestingly , overexpression of full - length , but not of truncated , htt lowers the expression of plasma igf-1 levels and , as result , affects body weight in mice . a decrease in igf-1 expression has also been observed in different tissues of hd patients , which indicates that htt loss - of - function can modulate igf-1 signaling over time . in primary dissociated neurons expressing mutant htt , treatment with igf-1 induces specific activation of akt and the direct phosphorylation of htt , which results in a reduced number of htt - containing intracellular inclusions and therefore neuroprotection . thus , these findings suggest that igf-1 signaling and htt can apparently influence each other , although it still remains elusive whether this cross - talk potentiates or prevents detrimental cascades , including apoptosis . modification of proteostasis by the insulin / igf-1 signaling pathway is not the only process , which affects htt homeostasis . recent screenings in c. elegans identified the evolutionarily conserved protein moag-4/serf1 - 2 as a modifier of protein aggregation during ageing . loss - of - function or silencing of moag-4 suppress the formation of aggregates in animals carrying mutant huntingtin , -synuclein or -amyloid . whether moag-4/serf1 - 2 and the interplay with other prosurvival pathways are relevant in hd remains to be explored , nevertheless the modulation of proteostasis remains a promising approach for the treatment of neurodegenerative disorders . energetic disturbances in hd is well described by post mortem , in - vitro and in - vivo evidences . the high metabolic rate of excitable cells such as neurons makes them strongly reliant upon mitochondrial functions . mitochondria are highly motile organelles that control dendritic spine formation and synaptic activity by buffering intracellular ca rise underneath the plasma membrane . mutant htt has been shown to affect mitochondrial morphology and the bioenergetic status by altering the balance between mitochondrial fusion and fission under the control of the dynamin - related protein 1 or the interaction with other mitochondria - associated proteins . alterations in mitochondria dynamics are reflected in deficits of the electron transport chain and of cellular respiration . the use of energy - related supplements , such as creatine , has been attempted in some clinical trials in order to correct mitochondrial defects in hd patients . as a result of extensive mitochondrial depolarization , neurons exposed to prolonged ca mutant htt affects glutamatergic signals as a result of altered neurotransmitter release and activity of the glutamate - ionotropic receptors at the plasma membrane ( figure 1 ) . in addition , aberrant htt with the expanded polyq tract inhibits the expression of the transcriptional co - activator pgc-1 , therefore compromising mitochondrial biogenesis and respiration . thus , the combination of the two effects alteration of ca influx and diminished capability of ca clearance by mitochondria seriously increases the susceptibility of striatal cells expressing mutant htt to excitotoxic insults . for this reason , agents that can affect glutamatergic signaling ( i.e. nmda receptor antagonists - like memantine ) have been undergoing clinical trials . similarly , other downstream targets that affect nmda signaling and the excitotoxic neuronal demise might have some potential applications for the treatment of hd . mitochondrial dysfunction resulting from ca overload , prolonged membrane depolarization or impairment of the electron transfer chain is the main source of intracellular reactive oxidative species . under certain circumstances , enhanced production of oxidative stress triggers neuroinflammatory responses by activation of the inflammasome in a cell - autonomous or non - autonomous manner . neuroinflammatory processes are key determinants of neurodegenerative disorders characterized by aggregate - prone proteins , as in the case of pd and ad . although the activation of inflammatory responses can be triggered by a variety of toxic species , the evidence indicates that most of the common neurodegenerative disorders have converging mechanisms that amplify the detrimental cascades . remarkably , in the majority of the brain pathologies , neuroinflammation is a presymptomatic event and similar patterns have been shown in unrelated pathologies . in case of hd , the expression of mutant htt in glial cells affects the buffering capacity by altering the expression of the glutamate transporters , thus precluding the uptake of glutamate and enhancing neuronal excitotoxicity . it has been shown that mutant htt can lower the expression and release of glial chemokine , which can be neuroprotective under different circumstances . whether targeting excessive activation of immune responses can be beneficial to hd remains to be determined , although it is tempting to consider it as a feasible possibility . the identification of the htt gene has contributed enormously to our understanding of the multiple pathogenic mechanisms involved in the onset of hd and in the selectively enhanced vulnerability of a subset of neurons to the mutant htt . as discussed in this review , hd is a monogenic disease that results in a gain - of - function of the mutant form and in the loss - of - functions of the wild - type protein , which together severely compromise cellular homeostasis in a complex manner . to date , there is no cure for hd and most of the treatments available only help to alleviate some of the movement and psychiatric symptoms associated with the pathology . as mutant htt is not considered to be an ideal pharmacological target due to its myriad biological functions , other biochemical pathways , such as those that prevent the abnormal accumulation of unfolded proteins , represent an encouraging alternative for the treatment of this neurodegenerative disorder . the identification and characterization of additional detrimental processes underlying cellular deficits in hd patients might provide new efficient and beneficial targets for neuroprotective intervention .

huntington 's disease ( hd ) is a complex and severe disorder characterized by the gradual and the progressive loss of neurons , predominantly in the striatum , which leads to the typical motor and cognitive impairments associated with this pathology . hd is caused by a highly polymorphic cag trinucleotide repeat expansion in the exon-1 of the gene encoding for huntingtin protein . since the first discovery of the huntingtin gene , investigations with a consistent number of in - vitro and in - vivo models have provided insights into the toxic events related to the expression of the mutant protein . in this review , we will summarize the progress made in characterizing the signaling pathways that contribute to neuronal degeneration in hd . we will highlight the age - dependent loss of proteostasis that is primarily responsible for the formation of aggregates observed in hd patients . the most promising molecular targets for the development of pharmacological interventions will also be discussed .

Proteolytic Cleavage of HTT Autophagy Ageing Modifiers as Regulators of Proteostasis Mitochondrial Deficiency, Excitotoxicity and Inflammation Concluding Remarks

3-hydroxy-3-methylgutaryl coenzyme a ( hmg - coa ) reductase inhibitors ( statins ) are cholesterol - lowering drugs which work by blocking the rate - limiting step in the cholesterol synthesis pathway ( fig . 1 ) . stains are the most frequently and widely used medication in the treatment of cardiovascular disease , diabetes , and cancer to reduce cholesterol levels ( e.g. , ldl - cholesterol ) by inhibiting the formation of mevalonate ( a precursor to cholesterol ) , ubiquinone ( coenzyme q ) , and other compounds . although statins have a number of beneficial effects including a lipid - lowering effect , improved endothelial function , anti - inflammation , and insulin sensitivity , statins , particularly lipophilic statins ( e.g. , simvastatin , atorvastatin , cerivastatin , and lovastatin ) , also cause adverse side effects in skeletal muscle ranging from mild to moderate muscle fatigue , weakness , and pain to fatal rhabdomyolysis [ 46 ] . in fact , considering that the occurrence of less adverse side effects is not reported , the incidence of statin - induced myopathy may be 510% , and concerns about the safety of statins on skeletal muscle are expected to increase . however , the underlying mechanisms by which statins induce skeletal muscle side effects have not been clearly determined . therefore , this review primarily focuses on statin - induced myopathy and the potential mechanisms of statin - associated myopathy . in addition , this review provides an overview of the role of exercise in stain - induced myopathy . statins , widely prescribed cholesterol - lowering drugs for the treatment of dyslipidemia and cardiovascular disease , are associated with skeletal muscle - related complaints or myopathies . apoptosis is programmed cell death that is highly regulated and executed via the activation of caspase dependent or independent signaling . in general , apoptosis plays an important role in governing development , growth , and repair in cells . however , excessive apoptosis may be associated with dysfunction , disease , and myopathy in skeletal muscle . it has been reported that statin treatment can induce apoptosis in skeletal muscle in both human [ 912 ] and rodent [ 1316 ] models . for example , simvastatin treatment ( 5 m ) during 48 hours increased protein levels of proapoptotic protein bax and apoptosis marker tunel - positive nuclei in primary human skeletal muscle cells . furthermore , kobayashi et al . showed that cerivastatin treatment ( 100 m ) during 2472 hours elevated apoptosis in rhabdomyosarcoma cells from human subjects . mitochondria play a central role in regulating homeostasis as well as inducing apoptosis in skeletal muscle . therefore , mitochondrial dysfunction is associated with the increase in the susceptibility to apoptosis and oxidative stress in skeletal muscle . previous studies showed that statins might impair mitochondrial function in the skeletal muscles of humans [ 1723 ] and animals , leading to myopathy . for example , patients with hypercholesterolemia taking simvastatin ( 80 mg / day ) for 8 weeks displayed a decrease in mitochondrial respiratory chain enzyme and citrate synthase activities . stains also inhibit the synthesis of ubiquinone ( coenzyme q10 ) , a major electron carrier in the mitochondrial respiratory chain . however , statin treatment does not appear to consistently affect mitochondrial function in the whole body . . showed that fat oxidation and respiratory exchange ratio ( rer ) did not change in patients with hypercholesterolemia taking atorvastatin ( 40 mg / day ) for 8 weeks . although numerous studies on statin - associated myopathy have been reported in animals and humans , the molecular mechanisms of statin - induced myopathy have not been completely elucidated . a variety of hypotheses regarding potential mechanisms of statin - induced myopathy have been proposed to gain insight into myopathy in skeletal muscle , including ( a ) deficiency of ubiquinone , ( b ) reactive oxygen species ( ros ) production , and ( c ) induction of apoptosis . ubiquinone is located in the mitochondrial respiratory chain , where it plays an essential role in transferring electrons from complex i and ii to complex iii associated with oxidative phosphorylation and energy production . in addition , ubiquinone acts as a potent antioxidant in the inner mitochondrial membrane by scavenging free radicals . however , it has been shown that statins reduced levels of ubiquinone in muscle and blood ( fig . the rationale of statin - induced decrease in ubiquinone is the fact that statins can inhibit the biosynthesis of ubiquinone as well as cholesterol in the cholesterol synthesis pathway as shown in fig . 1 . for example , blood and muscle concentrations of ubiquinone were decreased after short- and long - term treatment with statins , which suggests that deficiency of ubiquinone in mitochondria may impair cellular respiration resulting in skeletal myopathy and that supplementation with ubiquinone may be an appropriate therapy to counteract adverse side effects of statin treatment . in particular , superoxide ( o2 ) free radicals are generated from complex i ( mainly ) and complex iii in the electron transport system and changed to hydrogen peroxide ( h2o2 ) . it has been recently reported that statin treatment increased oxidative stress in human skeletal muscle cells and fibers ( fig . , we recently found that simvastatin treatment induced mitochondrial oxidative stress as indicated by increases in o2 and h2o2 production as well as impaired oxygen consumption supported by complex i substrates ( glutamate + malate ) . in addition , it has been suggested that statin - induced myopathy is associated with apoptosis in skeletal muscle . as mentioned above , statins induce apoptosis in skeletal muscle , which may be an essential factor causing myopathy experienced by patients taking stains . in general , apoptosis is induced through three major apoptotic signaling pathways : the ( a ) mitochondrial - driven pathway , ( b ) cytokines / fas - driven pathway , and ( c ) endoplasmic reticulum ( er)/ca - driven pathway . however , statin - induced apoptosis in skeletal muscle may be mitochondrial - mediated as indicated by an increase in bax , release of cytochrome c , active caspase-9 , and caspase-3 by statin treatment . in particular , the increase in ros ( e.g. , o2 and h2o2 ) generation with statin treatment may play an important role in opening the mitochondrial permeability transition pore ( mptp ) , which results in caspase dependent ( e.g. , cytochrome c and caspase-9 ) or independent ( e.g. , apoptosis inducing factor [ aif ] and endog ) apoptosis in skeletal muscle ( fig . 3 ) , suggesting that statin - induced oxidative stress triggers mitochondrial - mediated apoptosis . for example , kwak et al . demonstrated that simvastatin treatment induced apoptosis as well as oxidative stress in differentiated skeletal muscle cells . exercise is regarded as one of the most cost effective ways to prevent metabolic and cardiovascular diseases and is recommended to patients as a lifestyle intervention to supplement drug therapy . however , the benefit / risk of exercise with statin therapy has not been thoroughly investigated . to date , the effects of exercise frequency , intensity , time or type on the risk of statin - induced myopathy have not been well studied . most studies of the interactions of exercise and statin therapy include an acute / single exercise and indirect measures of muscle damage ( i.e. , blood creatine kinase [ ck ] levels ) . in contrast to statin - induced myopathy , chronic exercise training has the potential to counteract statin - induced side effects in skeletal muscle . for example , endurance exercise training increases mitochondrial biogenesis and mitochondrial respiration , and decreases oxidative stress and apoptosis in skeletal muscle . however , previous studies have shown inconsistent findings regarding the effects of exercise on statin - induced myopathy . while some studies reported that exercise seemed to increase the risk of statin - induced myopathy [ 3337 ] , others suggested that exercise did not affect statin - induced myopathy [ 33,3842 ] . for example , 12 weeks of aerobic exercise training in combination with simvastatin ( 40 mg / day ) decreased cardiorespiratory fitness and muscle citrate synthase activity in obese subjects . in addition , 2 weeks of treadmill exercise increased muscle damage in rats taking cerivastatin ( 0.51.0 mg / kg / day ) for 2 weeks . in contrast , 10 weeks of endurance and resistance exercise training did not affect serum ck in hypercholesterolemic patients taking rosuvastatin ( 10 mg / day ) for 20 weeks . furthermore , meador and huey showed that 4 weeks of wheel running exercise with cerivastatin treatment ( 1 mg / kg / day ) for 2 weeks prevented statin - associated force loss and increased fatigability in mice , suggesting that exercise prior to statin treatment can protect against statin - induced muscle dysfunction . table 2 shows a summary of studies examining the effects of exercise on statin - induced myopathy in human and animal models . although the mechanisms of statin - induced skeletal myopathy have not been determined , the mechanisms may be associated with ubiquinone deficiency , oxidative stress , and apoptosis . however , the underlying molecular and cellular mechanism by which statins affect mitochondrial function and apoptosis in skeletal muscle remains unknown . furthermore , it is not clear whether exercise exacerbates statin - associated myopathy in skeletal muscle . therefore , further studies of patients taking statins with different kinds of exercise are warranted to develop new strategies for statin - associated mitochondrial dysfunction and apoptosis leading to skeletal myopathy .

statins are widely used drugs to lower cholesterol levels and to reduce the risk of cardiovascular disease . however , it has been reported that statins are associated with adverse side effects of skeletal myopathy . statin treatment can impair mitochondrial function and induce apoptosis in skeletal muscle in both human and animal models . ubiquinone plays an essential role in transferring electrons in the mitochondrial electron transfer chain for oxidative phosphorylation . however , statin treatment reduces ubiquinone levels in the cholesterol synthesis pathway , which may be associated with mitochondrial dysfunction . in addition , reactive oxygen species ( ros ) production and apoptosis induced by statins may provide cellular and molecular mechanisms in skeletal myopathy . exercise is the most effective therapy to prevent metabolic and cardiovascular diseases . however , whether exercise provides a benefit to or exacerbation of statin - induced myopathy in skeletal muscle remains poorly investigated . this review will briefly provide a comprehensive summary regarding the effects of statins on skeletal myopathy , and discuss the potential mechanisms of statin - induced myopathy and the role of exercise in statin - induced myopathy in skeletal muscle .

INTRODUCTION EFFECTS OF STATINS ON SKELETAL MYOPATHY POTENTIAL MECHANISMS OF STATIN-INDUCED MYOPATHY ROLE OF EXERCISE IN STAIN-INDUCED MYOPATHY: FRIEND OR FOE? CONCLUSIONS

if cilia provide information that serves to retain cells in their functioning differentiated g0 state , then defects in this pathway are predicted to cause proliferative disorders : cancer , cystic diseases , and fibroses of various sorts . to date , the best case for such a role for cilia comes from studies on the polycystic kidney diseases ( pkds ) . a growing body of evidence indicates that dysfunctional ciliary signaling is the proximal cause of cyst development . consequently , mutant genes that trigger development of the pathology are candidates for players in the normal pathways of communication between cilia and the cell cycle regulatory machinery . renal cysts are a devastating feature of a wide range of diseases , many of which have multi - organ pathology . monoclonal cysts form from epithelial cells in the nephron , which proliferate and detach from their neighbors , eventually leading to end stage renal disease ( wilson , 2004 ) . the idea that defective cilia are the proximal cause for pkd originated with the discovery that the causative gene of the mouse orpk pkd model , polaris , is homologous to a gene essential for ciliary assembly in chlamydomonas , ift88 ( pazour et al . , 2000 ) . many proteins associated with pkd and related diseases or syndromes have since been shown to localize to cilia and basal bodies , and/or shown to play roles in ciliogenesis ( badano et al . a direct causal connection between cilia and proliferation has been controversial because many of the implicated proteins are not exclusively ciliary . however , the idea that dysfunctional ciliary signaling is the proximal cause of aberrant cell proliferation in the kidney is strengthened by several recent lines of evidence . the polycystins pc-1 and pc-2 ( products of pkd1 and pkd2 ) are subunits of a mechano - sensitive calcium channel that has been implicated as a flow sensor for the epithelial cells of kidney tubules ( boletta and germino , 2003 ) . postulated mechanisms by which pc-1/pc-2 might retain the differentiated epithelial cells in g0/g1 include activation of the cyclin kinase inhibitor p21(waf1 ) via jak - stat ( bhunia et al . , 2002 ) and blockade of camp - stimulated cell proliferation via atk - mediated inhibition of b - raf ( yamaguchi et al . , 2004 ) . calcium - induced changes in proliferative state require sustained ca changes in order to affect gene transcription ; current data implicates both the calcineurin nfat pathway ( puri et al . , 2004 ) and ap-1 ( bhunia et al . , 2002 ; it is intriguing to note that pc-1 may mediate some of its effects by regulated cleavage and nuclear translocation ( chauvet et al . , 2004 ) . it will be interesting to learn whether the cleaved product of pc-1 travels to the nucleus with kap : in the sea urchin , the kap component of the kinesin-2 motor necessary for anterograde ift moves into the nucleus as cilia resorb before mitosis ( morris et al . , 2004 ) . nuclear kap may serve as a signal to the cell that the cilia have indeed been resorbed and cell division may now proceed . another cystogenic protein , inversin , which localizes to centrioles and cilia , binds both calmodulin and apc2 of the anaphase - promoting complex ( morgan et al . , 2002a , b ) , thus providing another potential link between the sensory function of the primary cilium and the regulation of the cell cycle . beyond the kidney , other pathways important for cell growth or differentiation have been found to involve cilia ( pazour and witman , 2003 ) ; for example , in neuronal cells , somatostatin receptor 3 is targeted to primary cilia ( handel et al . , 1999 ) . mouse knockouts of ift genes essential for ciliary assembly are embryonic lethal , with phenotypes reminiscent of mutations in the hedgehog pathway , suggesting that the hedgehog receptors localize to cilia ( huangfu et al . , 2003 ) . in nih 3t3 cells , the tyrosine kinase receptor pdgfr , activation of which is sufficient for a quiescent cell to reenter the cell cycle , is expressed specifically on the primary cilium ( christensen et al . , 2004 ) . surprisingly , bovine insulin promotes the growth of low - density cultures of the ciliate tetrahymena ( christensen , 1993 ) . the insulin signal may be received by an insulin receptor - related tyrosine kinase which localizes to the tetrahymena cilia ( christensen et al . , 2003 ) . antennae for growth signals may be , like cilia themselves , a primitive condition of the eukaryotes . all cells lose their cilia by one of two mechanisms : resorption or deflagellation / deciliation . resorption is the process by which the cilium is gradually retracted into the cell , and usually occurs in advance of cell division . deflagellation is the shedding of flagella that occurs in response to a wide range of stimuli . it involves the precise severing of the nine outer doublet microtubules at the base of the flagellum , but distal to the transition zone between the basal body and the flagellum - proper , at a site known as the site of flagellar autotomy ( sofa ; mahjoub et al . , 2004 ) . deflagellation is a common cellular response : sea urchin embryos , scallop gills , rabbit oviduct , porcine respiratory tissue , and rat cerebral ependymal cells all deciliate in response to stress ; cells regenerate their cilia when the stressful stimulus is removed ( quarmby , 2004 ) . the fa2 gene was uncovered in a genetic screen for chlamydomonas mutants defective in deflagellation ( finst et al . , 1998 ) . fa2p is essential for calcium - activated axonemal microtubule severing during deflagellation , and , as it turns out , it also plays a role during cell cycle progression ( mahjoub et al . , 2002 ) . fa2p is a member of the nima - related kinase family , which is represented by at least eleven genes in humans ( the nima - related expressed kinases ; neks ) . nek family members are known as cell cycle kinases ( o'connell et al . , 2003 ) , thus the discovery of a nek having a ciliary function was provocative . fa2p localizes specifically to the sofa region of the cilium of interphase cells ( fig . although fa2p 's ciliary function is directly related to axonemal severing , localization of the protein shows interesting changes during premitotic flagellar resorption and during ciliogenesis . during resorption , fa2p relocates from the sofa to the proximal end of the basal bodies ; during mitosis , it is associated with the polar region of the mitotic spindle . as the cells exit mitosis , fa2p accumulates at the proximal end of the basal bodies and moves out to the sofa as soon as ciliogenesis is initiated ( mahjoub et al . , 2004 ) . when expressed in imcd-3 cells ( derived from murine kidney ) , gfp - tagged chlamydomonas fa2p shows an intriguing pattern of localization . in a confluent culture , fa2p is observed lying on the presumptive ciliary sofa and at the base of both centrioles , one of which is serving as the basal body ( mahjoub et al . , 2004 ) . during mitosis , fa2p is associated with the duplicated centrioles and then with the polar region of the mitotic spindle in the mouse cells , as it is in chlamydomonas . perhaps a functional homologue of fa2p facilitates the timing of the final break between daughter cells via triggering severing of the acetylated microtubules . ( a ) fa2p - ha localizes to the sofa region of the proximal axoneme ( arrowheads ) and also associates with basal bodies . indirect immunofluorescence images visualized by anti - ha ( red ) , anti-tubulin ( blue ) , and anti - centrin ( green ) . we do not yet know how fa2p mediates its effects on microtubule severing during deflagellation , or on the g2/m transition . one possibility for the delay in entry into mitosis is that it is a consequence of inefficient flagellar resorption , relating to the ciliary function of fa2p . although deflagellation has been considered a distinct pathway from premitotic flagellar resorption , recent evidence indicates that these two mechanisms of flagellar loss share important signaling components ( parker and quarmby , 2003 ; pan et al . , 2004 ) . it is also possible that fa2p independently affects deflagellation and progression through the cell cycle : a presumptive kinase - dead fa2p localizes correctly to the sofa , but does not rescue the deflagellation defect of fa2 cells ; this same mutant protein provides full rescue of the g2/m delay ( mahjoub et al . , 2004 ) . cnk2p is another member of the chlamydomonas nek family , and it is the second nek protein shown to be axonemal ( fig . 1 b ; bradley and quarmby , 2005 ) . although fa2p is specifically localized to the sofa , cnk2p is found along the entire length of the axoneme . the roles of cnk2p in the cilia and in cell cycle regulation are also distinct from fa2p . when wild - type chlamydomonas cells pass the commitment point of the cell cycle , two decisions are made : whether to divide and if so , how many times . cells then undergo a rapid succession of alternating m / s phases , dividing one , two , or three times , depending on the size of the cell when it passed the commitment point ( pickett - heaps , 1975 ) . cells with altered cnk2p expression are defective at assessing their size at the commitment point : an increase in the amount of cnk2p results in small cells , while a decrease in cnk2p results in large cells . these same manipulations of cnk2p levels produce cells with short and long flagella , respectively . flagellar length is normally tightly controlled , at least in part by a balance in the rates of assembly and disassembly ( marshall , 2004 ) . our data indicate that cnk2p may play a role in flagellar disassembly ; whether this role is independent of cell size assessment is unknown . in tetrahymena , at least four neks localize to cilia and affect ciliary length ( j. gaertig , personal communication ) . the relationship between the disassembly that contributes to length control , premitotic flagellar resorption and the assessment of cell size are all important connections that remain to be established . we speculate that the nek family provides an important general connection between cilia and the regulation of cell cycle progression . in all organisms where they have been studied , nima and its brethren , the neks , we have noted that this family is expanded in lineages with ciliated cells ( bradley et al . , 2004 ) , but the only direct ciliary connection so far in vertebrates comes via studies of pkd models : the causative genes of two mouse pkd models are neks . study of kat mutant mice established that nek1 carries the causative mutation in this model of autosomal recessive pkd ( upadhya et al . , 2000 ) . hnek1 has been found to bind to other cystogenic proteins including kinesin-2 , which is also required for ciliogenesis ( surpili et al . , 2003 ) . nek8 carries the causative mutation in the juvenile cystic kidney mouse model , and morpholinos to zebrafish nek8 cause kidney cysts in that organism ( liu et al . , a kinase domain mutation of the human orthologue of nek8 affects cell cycle progression , probably at the g2/m checkpoint . it is currently unknown whether nek1 , nek8 , or any other mammalian neks , localize to cilia , but the work in chlamydomonas suggests that mammalian neks will be found in cilia . it is interesting to consider that if cilia are indeed sending signals that regulate cell cycle progression , by physical necessity these signals must pass near or through the centrosome , which is a gathering place for all manner of cell cycle regulating proteins ( doxsey , 2001 ; badano et al . , 2005 ) . we are intrigued by the possibility that signals from the cilium are mediated by calcium . calcium is implicated in both exit from g0 and at g1/s ( means et al . , 1999 ) , as well as ciliary disassembly ( quarmby , 2004 ) . it is clear that there is a relationship between cilia , cell size , and cell cycle progression . the extent to which cilia send signals that regulate cell cycle progression ( and vice versa ) is not yet known , but we predict that this area of research will provide fertile ground for the discovery of new players in the regulation of cell proliferation and differentiation . available data indicates that most vertebrate cells are ciliated and that the genesis and disassembly of these cilia is coordinated with progression through the cell cycle . we are only beginning to understand how this coordination is achieved , but its significance may be profound .

a recent convergence of data indicating a relationship between cilia and proliferative diseases , such as polycystic kidney disease , has revived the long - standing enigma of the reciprocal regulatory relationship between cilia and the cell cycle . multiple signaling pathways are localized to cilia in mammalian cells , and some proteins have been shown to act both in the cilium and in cell cycle regulation . work from the unicellular alga chlamydomonas is providing novel insights as to how cilia and the cell cycle are coordinately regulated .

Dysfunctional cilia and pathologies of cell proliferation Clues from The NIMA-related kinases may be an important link Concluding remarks

approximately 2 years prior to her initial neurological evaluation , a 12-year - old girl developed both urinary tract infections in the context of recurrent stress - induced and nocturnal urinary incontinence . one year prior to her presentation , she began to develop recurrent oral ulcers , at the time thought to be cold sores . eight months prior to her presentation , she began to experience intermittent back pain and blurred vision , sporadic abdominal pain , and progressive clumsiness in her lower extremities that caused frequent falls . two weeks prior to her initial visit at our institution , she was admitted to a psychiatric unit after a suicide attempt . due to her progressive symptoms , she was referred to our pediatric neurology clinic for evaluation . at her initial visit , her examination was notable for asymmetric spasticity ( right greater than left ) in her lower extremities with prolonged ankle clonus and bilateral extensor plantar responses . her gait was unsteady , with persistent inversion and circumduction of the right foot , and she was unable to perform a tandem gait maneuver . her initial visual examination demonstrated normal acuity , pupillary responses , and extraocular movements . no rash , mucosal lesions , or joint symptoms were noted . a brain and spinal magnetic resonance imaging ( mri ) with contrast was performed and revealed innumerable contrast enhancing , punctuate lesions throughout her entire cerebrum , brain stem , and spinal cord . left , axial slice at the level of the brain stem and cerebellum and on the right , sagittal view of spine . the differential for her symptoms and radiographic findings was broad and included neurosarcoidosis , primary central nervous system lymphoma , central nervous system infection , primary demyelinating diseases , and central nervous system vasculitis . extensive evaluation for infectious , oncologic , and rheumatologic etiologies was negative except for a positive urine culture ( > 100 000 colony - forming unit of escherichia coli ) , positive antinuclear antibody ( 1:320 , speckled pattern ) , abnormal cerebrospinal fluid indices ( 20 nucleated cells / high - powered field with 97% lymphocytes a persistent finding over repeat lumbar punctures , protein 65 mg / dl , and glucose 58 mg / dl ) , and cerebrospinal fluid angiotensin - converting enzyme level of 7 units / l . a summary of her evaluation is presented in table 1 . summary of diagnostic workup . note : bold items indicate notable findings her visual complaints evolved from a nonspecific blurring to loss of perceived acuity that impacted her ability to read . an ophthalmologic examination subsequently revealed vitritis , papillitis , and leakage or extravasation of fluorescein dye during the angiogram consistent with vasculitis as shown in figure 2 . no dermatologic lesions were identified . given the negative neoplastic and infectious workup , therapy with 2 mg / kg of methylprednisolone was initiated for empiric treatment of a primary central nervous system vasculitis . fluorescein retinal angiography os . arrows highlight extravasation of fluorescein dye . within 3 days of therapy initiation , an improvement in both her gait and vision occurred . one month after steroid initiation , a repeat mri demonstrated that the punctuate lesions previously seen throughout the brain and spinal cord were no longer contrast enhancing . four months after the start of steroid treatment , the vitritis and papillitis had resolved , she was able to walk a longer distance with less effort and fatigue , and her incontinence had improved substantially . unfortunately , 2 months after cessation of steroids her gait abnormalities , visual disturbances , arthralgias , and urinary incontinence abruptly worsened , prompting a repeat mri scan that revealed progression of her contrast - enhancing spinal and brain lesions as compared to the initial study . given the severity of her symptoms , brain , bone marrow , and conjunctival biopsies were performed . three separate central nervous system biopsy specimens were obtained from the dura , parenchyma , and ependymal lining . however , the ependymal biopsy demonstrated atypical areas of well - demarcated inflammation ( reactive astrocytes , lymphocytes , macrophages , and activated microglia ) and proportional loss of axons and myelin in a perivascular distribution but without clear evidence of vasculitis as shown in figure 3 . luxol fast blue / periodic acid schiff 10. marked demyelination on the left of the line compared to the normal white matter on the right . on the left , the inflammation extends from these vessels ( arrow ) and is somewhat clustered around these areas . given the evidence of neuroinflammation on biopsy , an empiric course of intravenous immunoglobulin was initiated . despite treatment , plasma exchange was then performed a total of 7 times with incremental improvement in her symptoms after each treatment . given the constellation of her symptoms ( visual and gait disturbances , arthralgia , and psychiatric problems ) , ophthalmologic ( vitritis , papillitis , and uveitis ) and biopsy findings ( proportional loss of myelin and axons in an inflammatory background ) , and history of recurrent oral ulcers , a presumptive diagnosis of neuro - behet disease was made . twenty - four months after starting azathioprine , she regained her original lower extremity strength and visual acuity , has no complaints of abdominal pain , and has not had any further gait disturbance . behet proposed that the herpes virus was the cause of the disease and indeed there is evidence showing a greater presence of herpes simplex virus dna in saliva in patients with behet disease , although nearly 60% of patients with behet disease had no herpes simplex virus isolated . an autoimmune model for the disease has also been proposed after the observation of cd4 + t cells present in perivascular infiltrates and increased circulating levels of interleukin 8 . the autoimmune proposal was bolstered after gene sequencing revealed a candidate gene for behet disease to be located between the coding regions for hla b and tumor necrosis factor . behet disease can also be classified as an autoinflammatory disease with a degree of symptom overlap with another autoinflammatory disease , familial mediterranean fever . indeed , one study of patients with behet disease revealed a higher than expected mutation rate in the gene associated with familial mediterranean fever , mefv . the presence of neutrophils in the pathologic lesions of behet disease further supports the important role of the innate immune system in the development of this disease . the most common symptoms of behet disease in adult and pediatric cases are oral aphthous ulceration ( 95%-100% ) and uveitis ( 30%-75% ) . a broad spectrum of other manifestations have been described , including rashes , arthritis , arterial and venous vasculitis , and central nervous system lesions . when compared to adults , children are less likely to have genital ulcers and vascular lesions but are more likely to have arthralgia and central nervous system symptoms . in 1990 , the international study group for behet disease published criteria for the diagnosis of behet disease requiring the presence one mandatory criteria ( recurrent oral apthous ulcers ) and at least 2 minor criteria , which are listed in table 2 . recurrent oral apthous ulcers ( at least 3occurrences in a 12-month period recurrent genital ulcers skin lesions ( ie , erythema nodosum ) positive pathergy test the spectrum of central nervous system findings in neuro - behet disease can vary widely . metreau - vastel et al described a series of 12 children with neuro - behet disease in 2010 . in this report , they describe focal neurologic deficits as the most common symptom , occurring in 4 of 12 patients . recurrent meningoencephalitis and rhombencephalitis were the second most common findings , each occurring in 2 of 12 patients . nonspecific psychiatric symptoms have been described in other cases , including changes in affect , auditory and visual hallucinations , and suicidal behavior . no standardized treatment has been proposed for behet disease or neuro - behet disease as the presentation and involved organ systems vary widely . the european league against rheumatism ( eular ) published a set of guidelines , based on an analysis of published literature , for the treatment of behet disease organized by affected organ system . in these guidelines , cyclosporine a was described as a highly effective agent for the treatment of ocular disease . however , as later noted , cyclosporine a has been shown to potentiate neurologic symptoms in several cases of behet disease and so should not generally be utilized in patients having behet disease with preexisting central nervous system symptoms . although , no randomized , controlled trial has been conducted for the treatment of neuro - behet disease , azathioprine , corticosteroids , and methotrexate have been used in published reports . in addition , more recent reports have described the off - label use of antitumor necrosis factor agents ( ie , infliximab , etanercept , and adalimumab ) with promising results . due to its use in the treatment of lupus - related neuropsychiatric symptoms and a relatively good side effect profile , we chose to utilize azathioprine as a steroid - sparing agent in our patient and were able to achieve an excellent outcome .

we describe a case of neuro - behet disease diagnosed in a 12-year - old girl . this patient presented with recurrent oral ulcers , incontinence , spastic gait , blurry vision , and asymmetrical lower extremity hypertonia . extensive testing revealed punctate lesions through the central nervous system , vitritis , papillitis , and uveitis . a thorough infectious and neoplastic workup was negative . she was treated with pulse steroids and azathioprine with gradual improvement in her gait and ophthalmologic findings . although rare , primary neuro - behet should be considered in pediatric patients with neurologic abnormalities and recurrent aphthous ulcers without other explanation .

Case Report Discussion

digital gene expression sequencing , namely dge - seq , refers to the use of high - throughput sequencing technologies to sequence cdna in order to get information about rna content of a sample ( 1 ) . it can provide researchers with a powerful tool to obtain unbiased and unparalleled information about gene transcripts 2 , 3 . currently , computational methods are being developed to identify and annotate these transcripts with alternative splice forms 4 , 5 . although most dge - seq studies have identified expression outside of known loci ( in intronic or intergenic regions ) 6 , 7 , 8 , 9 , 10 , few attempts have been made to ab initio define the read - enriched regions ( rers ) in detail and compare them with known gene models . here , we present gene2dge , a free perl software package for rer detection and gene model update . this novel method consists of rer definition based on read clustering followed by annotation comparison with known gene models . the input of gene2dge is the file of mapped reads from rna - seq data and a gene annotation file of the corresponding genome . in addition , a cmap file needs to be prepared for application to different species to correct the chromosome numbers . the output of gene2dge includes a text file containing a set of rers and a series of text files containing annotated information of the eligible rers . the gene2dge package is freely available at http://bighapmap.big.ac.cn/. we developed gene2dge as an ab initio tool to annotate the transcriptome using mapped reads from the solid platform ( applied biosystems ) and annotation information downloaded from ensembl . first , we filter the uniquely mapped reads from the aligned results of the solid whole transcriptome pipeline . a uniquely mapped read is defined as one with a max scoring alignment to the genome scoring at least 24 and at least four higher than any of the other alignments of that read to the genome ( 11 ) . considering the restrictions of computer memory , this process will be performed for each chromosome in order , so it is relatively convenient for use on any personal computer . second , based on uniquely mapped reads , we construct the rers by grouping overlapped reads with a number greater than a threshold ( at least four reads ) ( 12 ) . we list each rer including start position , end position and the number of mapped reads . maximal distance between rers , defined by the start positions of rers minus the start positions of the first one upstream . it can be customized according to the specific requirement of the experiment ( the default value is 50 bp ) . finally , we compare the rers to existing gene models , and generate a catalogue of candidate genes with new annotation information , including exon extension , possible additional exons , and novel genes . the file of existing gene models in gtf format can be downloaded from the ensembl website for the candidate species . we picked out eligible rers and then checked their overlap with known gene models . as a result , a series of annotated files will be output and then can be used in further analysis . we applied gene2dge to the rna - seq data from the mouse blastomere dataset obtained from a single - cell whole transcriptome ( 13 ) . the mrna - seq short reads were analyzed using whole - transcriptome software tools ( applied biosystems , http://www.solidsoftwaretools.com/ ) . the reads generated were mapped to the mouse genome ( mm9 , ncbi build 37 ) . we got more than 6.6 million reads that could be uniquely aligned to the mouse genomic reference ( uniquely mapped reads ) . based on ensembl annotation ( ncbi m37.61 ) , 89% reads ( 5.9 million ) were mapped to annotated regions in exons including coding sequences ( cds ) and untranslated regions ( utr ) , which is significantly higher than those mapped to intronic ( 0.3 million , 5% ) and intergenic ( 0.4 million , 6% ) regions ( figure 1a ) . across the mouse genome , 98,532 rers were identified and each contained more than 4 reads . a total of 62.3% of rer boundaries were within 10 bp of the ends for the corresponding exons ( figure 1b ) . meanwhile , we identified 2,217 exon ends with remarkable extension into un - annotated regions ( > 50 bp ) , suggesting that the mouse transcriptome was more complex than we expected . the transcript levels for rers overlapping with known exons ( exonic rers ) were significantly higher than those of novel rers ( mann - whitney u test , p<10 ) . we detected 12,277 expressed transcripts ( with at least 1 rer across the genic region ) , in which 11,261 ( 92% ) transcribed genes contained at least one exonic rer . for the 72,628 ( 74% of all 98,532 rers ) exonic rers , we found that the known gene models were well defined by the ab initio method . for example , read distribution on chr 7 ( 56900000 - 57200000 ) revealed sharp boundaries of rer regions ( figure 2 ) . furthermore , we detected a certain proportion of rers ( 25,904 , 26% of all rers identified ) , which are located outside of the annotated regions in this transcriptome dataset . among them , 13,291 intronic rers ( about 13% of all ) were identified in 4,449 genes , indicating possible additional exons . interestingly , about 1,016 genes ( 23% ) only had transcripts detected in the intronic regions but not in the exonic regions . as a result , we renewed 4,788 gene models , which account for 39% of 12,277 transcribed genes in total . the remaining 12,613 rers are located in the intergenic regions , suggesting possible presence of novel genes outside of the existing gene models . we developed gene2dge as an ab initio tool to annotate the transcriptome using mapped reads from the solid platform ( applied biosystems ) and annotation information downloaded from ensembl . first , we filter the uniquely mapped reads from the aligned results of the solid whole transcriptome pipeline . a uniquely mapped read is defined as one with a max scoring alignment to the genome scoring at least 24 and at least four higher than any of the other alignments of that read to the genome ( 11 ) . considering the restrictions of computer memory , this process will be performed for each chromosome in order , so it is relatively convenient for use on any personal computer . second , based on uniquely mapped reads , we construct the rers by grouping overlapped reads with a number greater than a threshold ( at least four reads ) ( 12 ) . we list each rer including start position , end position and the number of mapped reads . in addition maximal distance between rers , defined by the start positions of rers minus the start positions of the first one upstream . it can be customized according to the specific requirement of the experiment ( the default value is 50 bp ) . finally , we compare the rers to existing gene models , and generate a catalogue of candidate genes with new annotation information , including exon extension , possible additional exons , and novel genes . the file of existing gene models in gtf format can be downloaded from the ensembl website for the candidate species . we picked out eligible rers and then checked their overlap with known gene models . as a result , a series of annotated files will be output and then can be used in further analysis . we applied gene2dge to the rna - seq data from the mouse blastomere dataset obtained from a single - cell whole transcriptome ( 13 ) . the mrna - seq short reads were analyzed using whole - transcriptome software tools ( applied biosystems , http://www.solidsoftwaretools.com/ ) . the reads generated were mapped to the mouse genome ( mm9 , ncbi build 37 ) . we got more than 6.6 million reads that could be uniquely aligned to the mouse genomic reference ( uniquely mapped reads ) . based on ensembl annotation ( ncbi m37.61 ) , 89% reads ( 5.9 million ) were mapped to annotated regions in exons including coding sequences ( cds ) and untranslated regions ( utr ) , which is significantly higher than those mapped to intronic ( 0.3 million , 5% ) and intergenic ( 0.4 million , 6% ) regions ( figure 1a ) . across the mouse genome , a total of 62.3% of rer boundaries were within 10 bp of the ends for the corresponding exons ( figure 1b ) . meanwhile , we identified 2,217 exon ends with remarkable extension into un - annotated regions ( > 50 bp ) , suggesting that the mouse transcriptome was more complex than we expected . the transcript levels for rers overlapping with known exons ( exonic rers ) were significantly higher than those of novel rers ( mann - whitney u test , p<10 ) . we detected 12,277 expressed transcripts ( with at least 1 rer across the genic region ) , in which 11,261 ( 92% ) transcribed genes contained at least one exonic rer . for the 72,628 ( 74% of all 98,532 rers ) exonic rers , we found that the known gene models were well defined by the ab initio method . for example , read distribution on chr 7 ( 56900000 - 57200000 ) revealed sharp boundaries of rer regions ( figure 2 ) . furthermore , we detected a certain proportion of rers ( 25,904 , 26% of all rers identified ) , which are located outside of the annotated regions in this transcriptome dataset . among them , 13,291 intronic rers ( about 13% of all ) were identified in 4,449 genes , indicating possible additional exons . interestingly , about 1,016 genes ( 23% ) only had transcripts detected in the intronic regions but not in the exonic regions . as a result , we renewed 4,788 gene models , which account for 39% of 12,277 transcribed genes in total . the remaining 12,613 rers are located in the intergenic regions , suggesting possible presence of novel genes outside of the existing gene models . here we have developed an exploratory tool , gene2dge , which can be employed to determine the rers and improve genome annotation . the package and methods can be applied to analyze other sources of any mapped short read counts from rna - seq data , such as results of sequencing by ab solid platform and illumina solexa platform . moreover , gene2dge can be used on any personal computer with a low requirement for computer memory capacity , since data are processed for all chromosomes in order with one chromosome at a time . in this study , we provide an example of gene2dge usage to illustrate its application in transcriptome analysis . gene2dge has also been applied to analyze datasets from other mouse tissues or tissues from other species ( data not shown ) . all these results indicate that gene2dge is a suitable tool for the renewal of known gene models by ab initio prediction in transcriptome dissection . dz , jl , yw , qz , xl and gl collected the dataset and participated in data analysis and visualization . dz , jl , yw , qz , xl and gl collected the dataset and participated in data analysis and visualization .

for transcriptome analysis , it is critical to precisely define all the transcripts across the whole genome . more and more digital gene expression ( dge ) scannings have indicated the presence of huge amount of novel transcripts in addition to the known gene models . however , almost all these studies still depend crucially on existing annotation . here , we present gene2dge , a perl software package for gene model renewal with dge data . we applied gene2dge to the mouse blastomere transcriptome , and defined 98,532 read - enriched regions ( rers ) by read clustering supported by more than four reads for each base pair . taking advantage of this ab initio method , we refined 2,104 exonic regions ( 4% of a total of 48,501 annotated transcribed regions ) with remarkable extension into un - annotated regions ( > 50 bp ) . for 5% of uniquely mapped reads falling within intron regions , we identified 13,291 additional possible exons . as a result , we renewed 4,788 gene models , which account for 39% of a total of 12,277 transcribed genes . furthermore , we identified 12,613 intergenic rers , suggesting the possible presence of novel genes outside the existing gene models . in this study , therefore , we have developed a suitable tool for renewal of known gene models by ab initio prediction in transcriptome dissection . the gene2dge package is freely available at http://bighapmap.big.ac.cn/.

Introduction Implementation Application Conclusion Authors contributions Competing interests

linagliptin ( tradjenta , boehringer ingelheim , ridgefield , ct , usa ) is a newly approved medication for the treatment of type 2 diabetes mellitus.1 this agent is a potent inhibitor of the serine protease enzyme , dipeptidyl peptidase-4 ( dpp-4 ) , which is responsible for rapid degradation of two incretin hormones , glucagon - like - peptide 1 ( glp-1 ) and glucose insulinotropic polypeptide ( gip ) . glp-1 and gip have distinct physiologic actions in the regulation of glucose that would make their augmentation attractive in the patient with type 2 diabetes due to a propensity to achieve decreased levels of both hormones.2 glp-1 is secreted from intestine endocrine l - cells in response to glucose and is responsible for stimulation of insulin release from the pancreas in a glucose - dependent manner . glp-1 inhibits the release of glucagon , thereby decreasing hepatic gluco - neogenesis and insulin inhibition . glp-1 decreases gastric emptying , delaying arrival of glucose into the vasculature , and works centrally in the brain by increasing satiety with a decrease in food intake . lastly , glp-1 can increase -cell mass by decreasing apoptosis and by increasing proliferation and neogenesis of -cells.3 however , this has only been shown in animal models , with no evidence of this noted in humans as yet.4 gip is secreted from the k - cells of the intestine wall , stimulates insulin secretion from the pancreas , and has been shown to decrease cellular death and increase regeneration of -cells.3 linagliptin has been shown to be a potent long - acting dpp-4 inhibitor . an in vitro study showed that linagliptin inhibited dpp-4 with a 50% inhibition concentration ( ic50 ) of about 1 nm , compared with sitagliptin ( 19 nm ) , alogliptin ( 24 nm ) , saxagliptin ( 50 nm ) , and vidagliptin ( 62 nm).5 linagliptin has an elimination half - life of 131 hours,6 and achieves steady - state concentrations after three doses of 5 mg daily.1 linagliptin has also been shown to inhibit dpp-4 activity by more than 80% over 24 hours.68 the presence of these characteristics allows for once - daily oral dosing.7 linagliptin undergoes primarily hepatic elimination , with approximately 85% of the drug excreted unchanged in the feces.9 despite having a predominately hepatic route of elimination , the main metabolite is pharmacologically inactive.1 the overall pharmacokinetic profile of linagliptin may avoid the need to adjust the dose in patients with renal or hepatic impairment . the recommendations provided by the package insert indicate no dose adjustments are required for renal or hepatic impairment.1 multiple therapies have now been introduced to the market that target the incretin hormone system . current guidelines recommend that these treatments be considered as part of a patient - centered approach and be used as a component of a two - drug or three - drug regimen in conjunction with metformin if a patient does not meet their individualized glycosylated hemoglobin ( hba1c ) goal.10 a medline search was performed using the keywords linagliptin , dpp-4 inhibitor , and type 2 diabetes for articles published through july 2012 . the literature search was limited by the following criteria : publication in the english language , clinical trials , randomized controlled trials , and research conducted in humans ( figure 1 ) . here we summarize the available data with a focus on the clinical utility and tolerability of linagliptin . this phase iia study conducted by forst et al followed a randomized , double - blind , within - dose level , parallel , placebo - controlled design and examined the pharmacokinetic and pharmacodynamic properties of linagliptin in patients with type 2 diabetes after 4 weeks of treatment.11 participants enrolled in this study were either treatment - nave or had received up to two oral antidiabetic therapies other than a thiazolidinedione . participants were 2170 ( median 62 ) years of age , had a body mass index of 18.535 kg / m , and had an hba1c 8.5% for treatment - nave and/or one oral antidiabetic therapy , and 8.0% for patients treated with two oral antidiabetic therapies . the hba1c for the total cohort of 77 patients was 7.0% . in participants receiving an oral antidiabetic therapy , eligible patients were randomly assigned to receive linagliptin 2.5 mg ( n = 26 ) , 5 mg ( n = 16 ) , 10 mg ( n = 19 ) , or placebo ( n = 16 ) . statistically significant decreases in mean hba1c from baseline were observed at the end of the 4-week period for all the linagliptin groups compared with placebo . the placebo - corrected mean change in hba1c was 0.31% for linagliptin 2.5 mg , 0.37% for linagliptin 5 mg , and 0.28% for linagliptin 10 mg ( p = < 0.025 ) . statistically significant decreases in fasting plasma glucose and postprandial plasma glucose were also observed from baseline to the end of the study period for all linagliptin doses ( see table 1 ) . another randomized , double - blind , parallel - group study comparing treatment with either linagliptin 5 mg or placebo for 24 weeks in patients with type 2 diabetes was conducted by del prato et al.12 patients were aged 1880 ( mean 55.7 ) years with a body mass index 40 kg / m , and were either treatment - nave or previously treated with one oral antidiabetic therapy other than a thiazolidinedione . pretreated patients underwent a 6-week washout period , with the last 2 weeks being an open - label placebo run - in . treatment - nave patients entered directly into the 2-week placebo run - in period . hba1c levels had to be between 6.5% and 9.0% in non - treatment - naive patients or between 7.0% and 10% in treatment - nave patients . eligible patients were then randomized to receive treatment with linagliptin 5 mg or placebo for 24 weeks . the adjusted mean difference in the change of hba1c comparing linagliptin and placebo was 0.69% ( p < 0.0001 ) . treatment with linagliptin also resulted in significant decreases in fasting plasma glucose and postprandial plasma glucose compared with placebo ( see table 1 ) . taskinen et al performed a randomized , double - blind , placebo - controlled , multicenter , parallel - group study in 701 patients with type 2 diabetes aged 1880 years.13 subjects included had a mean age of 56.5 years , a body mass index 40 kg / m , and a mean baseline hba1c of 8.1% . subjects eligible for inclusion needed to have received metformin at a dose 1500 mg / day ( or the maximum tolerated dose ) and not more than one other oral antidiabetic therapy . in patients who had previously been treated with metformin monotherapy , hba1c had to be 7.0%10.0% at screening ; for patients treated with an additional medication , a1c had to be 6.5%9.0% . patients taking antidiabetic therapy in addition to metformin were instructed to stop the medication and then underwent a 6-week washout period that included an open - label placebo run - in phase in the last 2 weeks . for patients taking metformin monotherapy at enrolment , all eligible patients continued their usual dose of metformin and were then randomized to treatment with either linagliptin 5 mg once daily or placebo for 24 weeks . the primary endpoint was the change from baseline hba1c , adjusted for baseline hba1c and the use of monotherapy versus combination therapy at enrolment , after 24 weeks of treatment . at the end of the study , linagliptin reduced the mean hba1c level by 0.49% , whereas hba1c in the placebo group rose by 0.15% ( p linagliptin also led to significant reductions versus placebo in both fasting plasma glucose and postprandial plasma glucose ( p < 0.0001 , see table 2 ) . haak et al conducted a 24-week , randomized , double - blind , placebo - controlled phase iii trial in 791 patients who were either treatment - nave or had been treated with one other antidiabetic therapy.15 eligible patients were 1880 years of age , had a diagnosis of type 2 diabetes , and had a body mass index of 40 kg / m . in treatment - nave participants , hba1c had to be 7.5% and < 11% , and for patients pre - treated with one antidiabetic therapy had to be 7.0% to 10.5% . patients pretreated with one antidiabetic therapy entered a 4-week washout period followed by a 2-week placebo run - in period that all patients participated in . subjects were then treated for 24 weeks with one of two free combinations of linagliptin ( linagliptin 2.5 mg twice daily + metformin 500 mg twice daily or 1000 mg twice daily ) or placebo , linagliptin 5 mg once daily , metformin 500 mg twice daily , or metformin 1000 mg twice daily monotherapy . the primary endpoint was change in hba1c from baseline to 24 weeks of treatment , adjusted for baseline hba1c and previous oral antidiabetic therapy . mean baseline hba1c values were similar for all treatment groups , with an overall mean of 8.7% . the adjusted placebo - corrected mean ( 95% confidence interval ) changes in hba1c were 1.7% ( 2.0% , 1.4% ) for linagliptin + metformin 1000 mg ; 1.3% ( 1.6 , 1.1 ) for linagliptin + metformin 500 mg ; 1.2% ( 1.5% , 0.9% ) for metformin 1000 mg ; 0.8% ( 1.0 , 0.5 ) for metformin 500 mg ; and 0.6% ( 0.9% , 0.3% ) for linagliptin monotherapy ( all p < 0.0001 ) . significant reductions in fasting plasma glucose from baseline to the end of the study period were seen with combination therapies relative to metformin monotherapy . the placebo - corrected changes in fasting plasma glucose from baseline were also statistically significant for each group . this study did not assess changes in postprandial plasma glucose ( see table 2 ) . this randomized , placebo - controlled , double - blind , parallel - group study enrolled subjects with type 2 diabetes receiving metformin 1500 mg / day ( or the maximum tolerated dose ) and the maximum tolerated dose of sulfonylurea.16 patients were 1880 ( mean 58.1 ) years of age , with a body mass index 40 kg / m and hba1c 7.0% and 10.0% ( mean 8.14% ) . following a 2-week placebo run - in , a total of 1055 participants were randomized to treatment with linagliptin 5 mg once daily or placebo , in addition to the established background therapy of metformin in combination with a sulfonylurea . the primary endpoint was the change in hba1c levels between baseline and 24 weeks , stratified by baseline hba1c value . after 24 weeks , linagliptin was superior to placebo for the adjusted mean change in hba1c from baseline . the linagliptin placebo - corrected adjusted mean change from baseline was 0.62% ( p < 0.0001 ) . linagliptin also produced greater reductions in fasting plasma glucose than placebo at week 24 ( p < 0.0001 , see table 2 ) . this randomized , double - blind , parallel - group , active - controlled , noninferiority trial was conducted by gallwitz et al in 1519 patients with type 2 diabetes , aged 1880 years , and a body mass index of 40 kg / m.17 eligible subjects were receiving metformin 1500 mg / day ( or the maximum tolerated dose ) alone with an hba1c of 6.5%10.0% or 6.0%9.0% on metformin and one other oral antidiabetic therapy . mean baseline hba1c and age were 7.7% and 59.8 years in each group , respectively . participants receiving metformin and one additional antidiabetic therapy entered a 6-week wash - out period followed by a 2-week open - label placebo run - in . those receiving metformin monotherapy entered directly into a 2-week , open - label , placebo run - in period . subjects who met the inclusion criteria were then randomly assigned to treatment with linagliptin 5 mg once daily or glimepiride at an initial dose of 1 mg daily added to the current dose of metformin . the primary endpoint was the change in hba1c from baseline to week 104 , and was stratified by baseline hba1c and previous antidiabetic therapy use . after 2 years of treatment , linagliptin was noninferior to glimepiride in reducing hba1c . the difference between the treatment groups met the noninferiority criteria and was 0.20% ( p < 0.125 ) . as add - on to metformin , both linagliptin and glimepiride caused significant reductions in fasting plasma glucose and postprandial plasma glucose . the treatment differences for reductions in fasting and postprandial plasma glucose , respectively , were 6.31 mg / dl ( p = 0.012 ) and 9.73 mg / dl ( p = 0.0918 , see table 2 ) . the 12-week , multicenter , randomized , double - blind , placebo - controlled , five parallel - group study conducted by forst et al included patients with type 2 diabetes aged 2175 ( mean 60 ) years with a body mass index of 2540 kg / m.14 patients were eligible if they were pretreated with metformin alone ( baseline hba1c levels had to be 7.5%10% ) or treated with metformin and one other oral antidiabetic therapy other than a thiazolidinedione ( baseline hba1c levels had to be 7.0%9.0% ) . eligible patients who had already received metformin monotherapy entered a 2-week open - label run - in phase . patients who received metformin plus one other antidiabetic therapy entered a 6-week washout period , with the last 2 weeks being an open - label run - in phase . three doses of linagliptin ( 1 , 5 , and 10 mg once daily ) were explored when added to metformin . there was also an open - label treatment arm where patients were randomized to receive glimepiride ( 1 , 2 , or 3 mg once daily ) as add - on therapy to metformin . the mean placebo - corrected lowering of hba1c levels was 0.39% for linagliptin 1 mg ( p = 0.005 ) , 0.75% for 5 mg ( p < 0.001 ) , and 0.73% for 10 mg the change in mean placebo - corrected hba1c from baseline was 0.90% for glimepiride . the reduction in hba1c with open - label glimepiride was numerically greater versus linagliptin , but not statistically significant . fasting plasma glucose reductions were also found to be significantly greater with all doses of linagliptin than with placebo at week 12 . postprandial plasma glucose changes were not addressed in this study ( see table 2 ) . this randomized , double - blind , placebo - controlled , multicenter , parallel - group study was conducted by gomis et al in 389 patients with type 2 diabetes and aged 1880 ( mean 57.5 ) years.18 at baseline , the patients had hba1c concentrations of 7.5%11.0% ( mean 8.6% ) and a body mass index 40 kg / m . patients pretreated with oral antidiabetic therapies underwent a 6-week washout period that included an open - label placebo run - in phase in the last 2 weeks . for treatment - nave patients , only the 2-week run - in phase eligible subjects were then randomized to receive pioglitazone 30 mg once daily and linagliptin 5 mg once daily or pioglitazone 30 mg once daily and placebo for 24 weeks . the primary endpoint was change from baseline hba1c , adjusted for baseline hba1c and baseline antidiabetic therapy , after 24 weeks of treatment . at the end of the study , the adjusted mean change in hba1c from baseline for linagliptin plus pioglitazone was 1.06% compared with 0.56% for placebo plus pioglitazone . changes in fasting plasma glucose were assessed as a secondary endpoint , showing a significantly greater reduction for linagliptin plus pioglitazone than for placebo plus pioglitazone . changes in postprandial plasma glucose were not addressed in this study ( see table 2 ) . a 78-week open - label extension conducted by gomis et al evaluated participants who had previously completed one of the four 24-week , randomized , double - blind , placebo - controlled parent trials.19 these subjects received either linagliptin monotherapy , linagliptin plus metformin , linagliptin plus metformin and sulfonylurea , or linagliptin plus pioglitazone . all patients receiving one of these treatments during a previous trial continued the same treatment for an additional 78 weeks ( n = 1532 ) . those patients previously treated with placebo were switched to linagliptin monotherapy ( n = 589 ) . overall , the cohort of patients had a mean age of 57.7 years and mean baseline hba1c of 7.5% . this extension study was conducted primarily to assess the long - term safety and tolerability of linagliptin . secondary efficacy outcomes evaluated the changes in hba1c and fasting plasma glucose from baseline to 102 weeks . in participants randomized to treatment with linagliptin in the four previous trials , the mean change from baseline hba1c during the initial 24 weeks of treatment was 0.8% . this was maintained over the 78 weeks of the extension study , with a change from baseline hba1c of 0.8% . the largest observed reduction in hba1c from baseline to week 102 was in the group receiving linagliptin plus pioglitazone at 1.5% . this was followed by those patients receiving metformin and metformin plus a sulfonylurea in combination with linagliptin ( 0.7% ) . lastly , patients receiving linagliptin monotherapy showed a reduction of 0.5% at week 102 . similarly , fasting plasma glucose values already reduced during the previous trials further decreased during the extension period . in subjects randomized to placebo in the previous trials and switched to linagliptin monotherapy in the extension phase , the change in mean hba1c was 0.90% . fasting plasma glucose values also decreased from baseline over the study period ( see table 2 ) . most adverse events with linagliptin were considered to be mild to moderate in nature . adverse reactions that occurred in 2% of patients treated with linagliptin included nasopharyngitis , diarrhea , cough , urinary tract infection , and hypertriglyceridemia ( in combination with sulfonylurea therapy ) , hyperlipidemia , and weight increase ( in combination with pioglitazone).1 weight changes were reported or addressed in each of the studies above . no significant changes with regard to body weight were found when linagliptin was given as monotherapy . with regard to sulfonylurea therapy , two of the studies revealed an increase in body weight in patients treated with glimepiride versus those receiving linagliptin.14,17 however , in a study in which all patients received metformin and sulfonylurea therapy and were then randomized to placebo or linagliptin , no significant changes in body weight were seen.16 when patients received pioglitazone and either placebo or linagliptin , both groups showed an increase in body weight from baseline . the amount of weight gain was larger in patients receiving linagliptin , but the mean weight for patients receiving linagliptin was lower than that in patients receiving placebo at baseline.18 in general , linagliptin showed a low propensity to cause hypoglycemia . when used as monotherapy , no patients experienced hypoglycemia in the two studies reviewed.11,15 one study reviewing linagliptin as monotherapy versus placebo reported hypoglycemia occurring in one patient in each group.12 when combined with metformin and sulfonylurea , a higher percentage of patients receiving linagliptin experienced hypoglycemia versus placebo . however , a smaller percentage of patients experienced severe hypoglycemia when compared with placebo.16 three studies discussed or reported the occurrence of pancreatitis . one study reported zero cases15 while another study reported one case of pancreatitis in a patient receiving linagliptin.17 a 78-week , open - label extension study , which included 2121subjects , reported four cases of pancreatitis in patients who had received linagliptin for a total of 102 weeks , with two cases being acute and two chronic . this was an incidence of 0.2% in the overall treated set.19 according to the prescribing information , pancreatitis was reported more often in patients treated with linagliptin ( 21.9 per 10,000 patient years ) versus placebo ( eight per 10,000 patient years).1 one study prospectively assessed cardiovascular safety for linagliptin versus sulfonylurea ( e.g. glimepiride ) . major cardiovascular events occurred in 2% of patients treated with linagliptin and 3% treated with glimepiride ( p = 0.0213 ) . this finding was mainly attributable to a significantly lower number of nonfatal strokes with linagliptin compared with glimepiride , without any relation to hypoglycemia.17 this phase iia study conducted by forst et al followed a randomized , double - blind , within - dose level , parallel , placebo - controlled design and examined the pharmacokinetic and pharmacodynamic properties of linagliptin in patients with type 2 diabetes after 4 weeks of treatment.11 participants enrolled in this study were either treatment - nave or had received up to two oral antidiabetic therapies other than a thiazolidinedione . participants were 2170 ( median 62 ) years of age , had a body mass index of 18.535 kg / m , and had an hba1c 8.5% for treatment - nave and/or one oral antidiabetic therapy , and 8.0% for patients treated with two oral antidiabetic therapies . the hba1c for the total cohort of 77 patients was 7.0% . in participants receiving an oral antidiabetic therapy , eligible patients were randomly assigned to receive linagliptin 2.5 mg ( n = 26 ) , 5 mg ( n = 16 ) , 10 mg ( n = 19 ) , or placebo ( n = 16 ) . statistically significant decreases in mean hba1c from baseline were observed at the end of the 4-week period for all the linagliptin groups compared with placebo . the placebo - corrected mean change in hba1c was 0.31% for linagliptin 2.5 mg , 0.37% for linagliptin 5 mg , and 0.28% for linagliptin 10 mg ( p = < 0.025 ) . statistically significant decreases in fasting plasma glucose and postprandial plasma glucose were also observed from baseline to the end of the study period for all linagliptin doses ( see table 1 ) . another randomized , double - blind , parallel - group study comparing treatment with either linagliptin 5 mg or placebo for 24 weeks in patients with type 2 diabetes was conducted by del prato et al.12 patients were aged 1880 ( mean 55.7 ) years with a body mass index 40 kg / m , and were either treatment - nave or previously treated with one oral antidiabetic therapy other than a thiazolidinedione . pretreated patients underwent a 6-week washout period , with the last 2 weeks being an open - label placebo run - in . treatment - nave patients entered directly into the 2-week placebo run - in period . hba1c levels had to be between 6.5% and 9.0% in non - treatment - naive patients or between 7.0% and 10% in treatment - nave patients . eligible patients were then randomized to receive treatment with linagliptin 5 mg or placebo for 24 weeks . the adjusted mean difference in the change of hba1c comparing linagliptin and placebo was 0.69% ( p < 0.0001 ) . treatment with linagliptin also resulted in significant decreases in fasting plasma glucose and postprandial plasma glucose compared with placebo ( see table 1 ) . taskinen et al performed a randomized , double - blind , placebo - controlled , multicenter , parallel - group study in 701 patients with type 2 diabetes aged 1880 years.13 subjects included had a mean age of 56.5 years , a body mass index 40 kg / m , and a mean baseline hba1c of 8.1% . subjects eligible for inclusion needed to have received metformin at a dose 1500 mg / day ( or the maximum tolerated dose ) and not more than one other oral antidiabetic therapy . in patients who had previously been treated with metformin monotherapy , hba1c had to be 7.0%10.0% at screening ; for patients treated with an additional medication , a1c had to be 6.5%9.0% . patients taking antidiabetic therapy in addition to metformin were instructed to stop the medication and then underwent a 6-week washout period that included an open - label placebo run - in phase in the last 2 weeks . for patients taking metformin monotherapy at enrolment , all eligible patients continued their usual dose of metformin and were then randomized to treatment with either linagliptin 5 mg once daily or placebo for 24 weeks . the primary endpoint was the change from baseline hba1c , adjusted for baseline hba1c and the use of monotherapy versus combination therapy at enrolment , after 24 weeks of treatment . at the end of the study , linagliptin reduced the mean hba1c level by 0.49% , whereas hba1c in the placebo group rose by 0.15% ( p < 0.0001 ) . linagliptin also led to significant reductions versus placebo in both fasting plasma glucose and postprandial plasma glucose ( p < 0.0001 , see table 2 ) . haak et al conducted a 24-week , randomized , double - blind , placebo - controlled phase iii trial in 791 patients who were either treatment - nave or had been treated with one other antidiabetic therapy.15 eligible patients were 1880 years of age , had a diagnosis of type 2 diabetes , and had a body mass index of 40 kg / m . in treatment - nave participants , hba1c had to be 7.5% and < 11% , and for patients pre - treated with one antidiabetic therapy had to be 7.0% to 10.5% . patients pretreated with one antidiabetic therapy entered a 4-week washout period followed by a 2-week placebo run - in period that all patients participated in . subjects were then treated for 24 weeks with one of two free combinations of linagliptin ( linagliptin 2.5 mg twice daily + metformin 500 mg twice daily or 1000 mg twice daily ) or placebo , linagliptin 5 mg once daily , metformin 500 mg twice daily , or metformin 1000 mg twice daily monotherapy . the primary endpoint was change in hba1c from baseline to 24 weeks of treatment , adjusted for baseline hba1c and previous oral antidiabetic therapy . mean baseline hba1c values were similar for all treatment groups , with an overall mean of 8.7% . the adjusted placebo - corrected mean ( 95% confidence interval ) changes in hba1c were 1.7% ( 2.0% , 1.4% ) for linagliptin + metformin 1000 mg ; 1.3% ( 1.6 , 1.1 ) for linagliptin + metformin 500 mg ; 1.2% ( 1.5% , 0.9% ) for metformin 1000 mg ; 0.8% ( 1.0 , 0.5 ) for metformin 500 mg ; and 0.6% ( 0.9% , 0.3% ) for linagliptin monotherapy ( all p < 0.0001 ) . significant reductions in fasting plasma glucose from baseline to the end of the study period were seen with combination therapies relative to metformin monotherapy . the placebo - corrected changes in fasting plasma glucose from baseline were also statistically significant for each group . this study did not assess changes in postprandial plasma glucose ( see table 2 ) . this randomized , placebo - controlled , double - blind , parallel - group study enrolled subjects with type 2 diabetes receiving metformin 1500 mg / day ( or the maximum tolerated dose ) and the maximum tolerated dose of sulfonylurea.16 patients were 1880 ( mean 58.1 ) years of age , with a body mass index 40 kg / m and hba1c 7.0% and 10.0% ( mean 8.14% ) . following a 2-week placebo run - in , a total of 1055 participants were randomized to treatment with linagliptin 5 mg once daily or placebo , in addition to the established background therapy of metformin in combination with a sulfonylurea . the primary endpoint was the change in hba1c levels between baseline and 24 weeks , stratified by baseline hba1c value . after 24 weeks , linagliptin was superior to placebo for the adjusted mean change in hba1c from baseline . the linagliptin placebo - corrected adjusted mean change from baseline was 0.62% ( p < 0.0001 ) . linagliptin also produced greater reductions in fasting plasma glucose than placebo at week 24 ( p < 0.0001 , see table 2 ) . this randomized , double - blind , parallel - group , active - controlled , noninferiority trial was conducted by gallwitz et al in 1519 patients with type 2 diabetes , aged 1880 years , and a body mass index of 40 kg / m.17 eligible subjects were receiving metformin 1500 mg / day ( or the maximum tolerated dose ) alone with an hba1c of 6.5%10.0% or 6.0%9.0% on metformin and one other oral antidiabetic therapy . mean baseline hba1c and age were 7.7% and 59.8 years in each group , respectively . participants receiving metformin and one additional antidiabetic therapy entered a 6-week wash - out period followed by a 2-week open - label placebo run - in . those receiving metformin monotherapy entered directly into a 2-week , open - label , placebo run - in period . subjects who met the inclusion criteria were then randomly assigned to treatment with linagliptin 5 mg once daily or glimepiride at an initial dose of 1 mg daily added to the current dose of metformin . the primary endpoint was the change in hba1c from baseline to week 104 , and was stratified by baseline hba1c and previous antidiabetic therapy use . after 2 years of treatment , linagliptin was noninferior to glimepiride in reducing hba1c . the difference between the treatment groups met the noninferiority criteria and was 0.20% ( p < 0.125 ) . as add - on to metformin , both linagliptin and glimepiride caused significant reductions in fasting plasma glucose and postprandial plasma glucose . the treatment differences for reductions in fasting and postprandial plasma glucose , respectively , were 6.31 mg / dl ( p = 0.012 ) and 9.73 mg / dl ( p = 0.0918 , see table 2 ) . the 12-week , multicenter , randomized , double - blind , placebo - controlled , five parallel - group study conducted by forst et al included patients with type 2 diabetes aged 2175 ( mean 60 ) years with a body mass index of 2540 kg / m.14 patients were eligible if they were pretreated with metformin alone ( baseline hba1c levels had to be 7.5%10% ) or treated with metformin and one other oral antidiabetic therapy other than a thiazolidinedione ( baseline hba1c levels had to be 7.0%9.0% ) . eligible patients who had already received metformin monotherapy entered a 2-week open - label run - in phase . patients who received metformin plus one other antidiabetic therapy entered a 6-week washout period , with the last 2 weeks being an open - label run - in phase . three doses of linagliptin ( 1 , 5 , and 10 mg once daily ) were explored when added to metformin . there was also an open - label treatment arm where patients were randomized to receive glimepiride ( 1 , 2 , or 3 mg once daily ) as add - on therapy to metformin . the mean placebo - corrected lowering of hba1c levels was 0.39% for linagliptin 1 mg ( p = 0.005 ) , 0.75% for 5 mg ( p < 0.001 ) , and 0.73% for 10 mg ( p < 0.001 ) . the change in mean placebo - corrected hba1c from baseline was 0.90% for glimepiride . the reduction in hba1c with open - label glimepiride was numerically greater versus linagliptin , but not statistically significant . fasting plasma glucose reductions were also found to be significantly greater with all doses of linagliptin than with placebo at week 12 . postprandial plasma glucose changes were not addressed in this study ( see table 2 ) . this randomized , double - blind , placebo - controlled , multicenter , parallel - group study was conducted by gomis et al in 389 patients with type 2 diabetes and aged 1880 ( mean 57.5 ) years.18 at baseline , the patients had hba1c concentrations of 7.5%11.0% ( mean 8.6% ) and a body mass index 40 kg / m . patients pretreated with oral antidiabetic therapies underwent a 6-week washout period that included an open - label placebo run - in phase in the last 2 weeks . for treatment - nave patients , only the 2-week run - in phase eligible subjects were then randomized to receive pioglitazone 30 mg once daily and linagliptin 5 mg once daily or pioglitazone 30 mg once daily and placebo for 24 weeks . the primary endpoint was change from baseline hba1c , adjusted for baseline hba1c and baseline antidiabetic therapy , after 24 weeks of treatment . at the end of the study , the adjusted mean change in hba1c from baseline for linagliptin plus pioglitazone was 1.06% compared with 0.56% for placebo plus pioglitazone . changes in fasting plasma glucose were assessed as a secondary endpoint , showing a significantly greater reduction for linagliptin plus pioglitazone than for placebo plus pioglitazone . changes in postprandial plasma glucose were not addressed in this study ( see table 2 ) . a 78-week open - label extension conducted by gomis et al evaluated participants who had previously completed one of the four 24-week , randomized , double - blind , placebo - controlled parent trials.19 these subjects received either linagliptin monotherapy , linagliptin plus metformin , linagliptin plus metformin and sulfonylurea , or linagliptin plus pioglitazone . all patients receiving one of these treatments during a previous trial continued the same treatment for an additional 78 weeks ( n = 1532 ) . those patients previously treated with placebo were switched to linagliptin monotherapy ( n = 589 ) . overall , the cohort of patients had a mean age of 57.7 years and mean baseline hba1c of 7.5% . this extension study was conducted primarily to assess the long - term safety and tolerability of linagliptin . secondary efficacy outcomes evaluated the changes in hba1c and fasting plasma glucose from baseline to 102 weeks . in participants randomized to treatment with linagliptin in the four previous trials , the mean change from baseline hba1c during the initial 24 weeks of treatment was 0.8% . this was maintained over the 78 weeks of the extension study , with a change from baseline hba1c of 0.8% . the largest observed reduction in hba1c from baseline to week 102 was in the group receiving linagliptin plus pioglitazone at 1.5% . this was followed by those patients receiving metformin and metformin plus a sulfonylurea in combination with linagliptin ( 0.7% ) . lastly , patients receiving linagliptin monotherapy showed a reduction of 0.5% at week 102 . similarly , fasting plasma glucose values already reduced during the previous trials further decreased during the extension period . in subjects randomized to placebo in the previous trials and switched to linagliptin monotherapy in the extension phase , the change in mean hba1c was 0.90% . fasting plasma glucose values also decreased from baseline over the study period ( see table 2 ) . taskinen et al performed a randomized , double - blind , placebo - controlled , multicenter , parallel - group study in 701 patients with type 2 diabetes aged 1880 years.13 subjects included had a mean age of 56.5 years , a body mass index 40 kg / m , and a mean baseline hba1c of 8.1% . subjects eligible for inclusion needed to have received metformin at a dose 1500 mg / day ( or the maximum tolerated dose ) and not more than one other oral antidiabetic therapy . in patients who had previously been treated with metformin monotherapy , hba1c had to be 7.0%10.0% at screening ; for patients treated with an additional medication , a1c had to be 6.5%9.0% . patients taking antidiabetic therapy in addition to metformin were instructed to stop the medication and then underwent a 6-week washout period that included an open - label placebo run - in phase in the last 2 weeks . for patients taking metformin monotherapy at enrolment , all eligible patients continued their usual dose of metformin and were then randomized to treatment with either linagliptin 5 mg once daily or placebo for 24 weeks . the primary endpoint was the change from baseline hba1c , adjusted for baseline hba1c and the use of monotherapy versus combination therapy at enrolment , after 24 weeks of treatment . at the end of the study , linagliptin reduced the mean hba1c level by 0.49% , whereas hba1c in the placebo group rose by 0.15% ( p < 0.0001 ) . linagliptin also led to significant reductions versus placebo in both fasting plasma glucose and postprandial plasma glucose ( p < 0.0001 , see table 2 ) . haak et al conducted a 24-week , randomized , double - blind , placebo - controlled phase iii trial in 791 patients who were either treatment - nave or had been treated with one other antidiabetic therapy.15 eligible patients were 1880 years of age , had a diagnosis of type 2 diabetes , and had a body mass index of 40 kg / m . in treatment - nave participants , hba1c had to be 7.5% and < 11% , and for patients pre - treated with one antidiabetic therapy had to be 7.0% to 10.5% . patients pretreated with one antidiabetic therapy entered a 4-week washout period followed by a 2-week placebo run - in period that all patients participated in . subjects were then treated for 24 weeks with one of two free combinations of linagliptin ( linagliptin 2.5 mg twice daily + metformin 500 mg twice daily or 1000 mg twice daily ) or placebo , linagliptin 5 mg once daily , metformin 500 mg twice daily , or metformin 1000 mg twice daily monotherapy . the primary endpoint was change in hba1c from baseline to 24 weeks of treatment , adjusted for baseline hba1c and previous oral antidiabetic therapy . mean baseline hba1c values were similar for all treatment groups , with an overall mean of 8.7% . the adjusted placebo - corrected mean ( 95% confidence interval ) changes in hba1c were 1.7% ( 2.0% , 1.4% ) for linagliptin + metformin 1000 mg ; 1.3% ( 1.6 , 1.1 ) for linagliptin + metformin 500 mg ; 1.2% ( 1.5% , 0.9% ) for metformin 1000 mg ; 0.8% ( 1.0 , 0.5 ) for metformin 500 mg ; and 0.6% ( 0.9% , 0.3% ) for linagliptin monotherapy ( all p < 0.0001 ) . significant reductions in fasting plasma glucose from baseline to the end of the study period were seen with combination therapies relative to metformin monotherapy . the placebo - corrected changes in fasting plasma glucose from baseline were also statistically significant for each group . this study did not assess changes in postprandial plasma glucose ( see table 2 ) . this randomized , placebo - controlled , double - blind , parallel - group study enrolled subjects with type 2 diabetes receiving metformin 1500 mg / day ( or the maximum tolerated dose ) and the maximum tolerated dose of sulfonylurea.16 patients were 1880 ( mean 58.1 ) years of age , with a body mass index 40 kg / m and hba1c 7.0% and 10.0% ( mean 8.14% ) . following a 2-week placebo run - in , a total of 1055 participants were randomized to treatment with linagliptin 5 mg once daily or placebo , in addition to the established background therapy of metformin in combination with a sulfonylurea . the primary endpoint was the change in hba1c levels between baseline and 24 weeks , stratified by baseline hba1c value . after 24 weeks , linagliptin was superior to placebo for the adjusted mean change in hba1c from baseline . the linagliptin placebo - corrected adjusted mean change from baseline was 0.62% ( p < 0.0001 ) . linagliptin also produced greater reductions in fasting plasma glucose than placebo at week 24 ( p < 0.0001 , see table 2 ) . this randomized , double - blind , parallel - group , active - controlled , noninferiority trial was conducted by gallwitz et al in 1519 patients with type 2 diabetes , aged 1880 years , and a body mass index of 40 kg / m.17 eligible subjects were receiving metformin 1500 mg / day ( or the maximum tolerated dose ) alone with an hba1c of 6.5%10.0% or 6.0%9.0% on metformin and one other oral antidiabetic therapy . mean baseline hba1c and age were 7.7% and 59.8 years in each group , respectively . participants receiving metformin and one additional antidiabetic therapy entered a 6-week wash - out period followed by a 2-week open - label placebo run - in . those receiving metformin monotherapy entered directly into a 2-week , open - label , placebo run - in period . subjects who met the inclusion criteria were then randomly assigned to treatment with linagliptin 5 mg once daily or glimepiride at an initial dose of 1 mg daily added to the current dose of metformin . the primary endpoint was the change in hba1c from baseline to week 104 , and was stratified by baseline hba1c and previous antidiabetic therapy use . after 2 years of treatment , linagliptin was noninferior to glimepiride in reducing hba1c . the difference between the treatment groups met the noninferiority criteria and was 0.20% ( p < 0.125 ) . as add - on to metformin , both linagliptin and glimepiride caused significant reductions in fasting plasma glucose and postprandial plasma glucose . the treatment differences for reductions in fasting and postprandial plasma glucose , respectively , were 6.31 mg / dl ( p = 0.012 ) and 9.73 mg / dl ( p = 0.0918 , see table 2 ) . the 12-week , multicenter , randomized , double - blind , placebo - controlled , five parallel - group study conducted by forst et al included patients with type 2 diabetes aged 2175 ( mean 60 ) years with a body mass index of 2540 kg / m.14 patients were eligible if they were pretreated with metformin alone ( baseline hba1c levels had to be 7.5%10% ) or treated with metformin and one other oral antidiabetic therapy other than a thiazolidinedione ( baseline hba1c levels had to be 7.0%9.0% ) . eligible patients who had already received metformin monotherapy entered a 2-week open - label run - in phase . patients who received metformin plus one other antidiabetic therapy entered a 6-week washout period , with the last 2 weeks being an open - label run - in phase . three doses of linagliptin ( 1 , 5 , and 10 mg once daily ) were explored when added to metformin . there was also an open - label treatment arm where patients were randomized to receive glimepiride ( 1 , 2 , or 3 mg once daily ) as add - on therapy to metformin . the mean placebo - corrected lowering of hba1c levels was 0.39% for linagliptin 1 mg ( p = 0.005 ) , 0.75% for 5 mg ( p < 0.001 ) , and 0.73% for 10 mg ( p < 0.001 ) . the change in mean placebo - corrected hba1c from baseline was 0.90% for glimepiride . the reduction in hba1c with open - label glimepiride was numerically greater versus linagliptin , but not statistically significant . fasting plasma glucose reductions were also found to be significantly greater with all doses of linagliptin than with placebo at week 12 . postprandial plasma glucose changes were not addressed in this study ( see table 2 ) . this randomized , double - blind , placebo - controlled , multicenter , parallel - group study was conducted by gomis et al in 389 patients with type 2 diabetes and aged 1880 ( mean 57.5 ) years.18 at baseline , the patients had hba1c concentrations of 7.5%11.0% ( mean 8.6% ) and a body mass index 40 kg / m . patients pretreated with oral antidiabetic therapies underwent a 6-week washout period that included an open - label placebo run - in phase in the last 2 weeks . for treatment - nave patients , only the 2-week run - in phase was required . eligible subjects were then randomized to receive pioglitazone 30 mg once daily and linagliptin 5 mg once daily or pioglitazone 30 mg once daily and placebo for 24 weeks . the primary endpoint was change from baseline hba1c , adjusted for baseline hba1c and baseline antidiabetic therapy , after 24 weeks of treatment . at the end of the study , the adjusted mean change in hba1c from baseline for linagliptin plus pioglitazone was 1.06% compared with 0.56% for placebo plus pioglitazone . changes in fasting plasma glucose were assessed as a secondary endpoint , showing a significantly greater reduction for linagliptin plus pioglitazone than for placebo plus pioglitazone . changes in postprandial plasma glucose were not addressed in this study ( see table 2 ) . a 78-week open - label extension conducted by gomis et al evaluated participants who had previously completed one of the four 24-week , randomized , double - blind , placebo - controlled parent trials.19 these subjects received either linagliptin monotherapy , linagliptin plus metformin , linagliptin plus metformin and sulfonylurea , or linagliptin plus pioglitazone . all patients receiving one of these treatments during a previous trial continued the same treatment for an additional 78 weeks ( n = 1532 ) . those patients previously treated with placebo were switched to linagliptin monotherapy ( n = 589 ) . overall , the cohort of patients had a mean age of 57.7 years and mean baseline hba1c of 7.5% . this extension study was conducted primarily to assess the long - term safety and tolerability of linagliptin . secondary efficacy outcomes evaluated the changes in hba1c and fasting plasma glucose from baseline to 102 weeks . in participants randomized to treatment with linagliptin in the four previous trials , the mean change from baseline hba1c during the initial 24 weeks of treatment was 0.8% . this was maintained over the 78 weeks of the extension study , with a change from baseline hba1c of 0.8% . the largest observed reduction in hba1c from baseline to week 102 was in the group receiving linagliptin plus pioglitazone at 1.5% . this was followed by those patients receiving metformin and metformin plus a sulfonylurea in combination with linagliptin ( 0.7% ) . . similarly , fasting plasma glucose values already reduced during the previous trials further decreased during the extension period . in subjects randomized to placebo in the previous trials and switched to linagliptin monotherapy in the extension phase , the change in mean hba1c was 0.90% . fasting plasma glucose values also decreased from baseline over the study period ( see table 2 ) . most adverse events with linagliptin were considered to be mild to moderate in nature . adverse reactions that occurred in 2% of patients treated with linagliptin included nasopharyngitis , diarrhea , cough , urinary tract infection , and hypertriglyceridemia ( in combination with sulfonylurea therapy ) , hyperlipidemia , and weight increase ( in combination with pioglitazone).1 weight changes were reported or addressed in each of the studies above . no significant changes with regard to body weight were found when linagliptin was given as monotherapy . with regard to sulfonylurea therapy , two of the studies revealed an increase in body weight in patients treated with glimepiride versus those receiving linagliptin.14,17 however , in a study in which all patients received metformin and sulfonylurea therapy and were then randomized to placebo or linagliptin , no significant changes in body weight were seen.16 when patients received pioglitazone and either placebo or linagliptin , both groups showed an increase in body weight from baseline . the amount of weight gain was larger in patients receiving linagliptin , but the mean weight for patients receiving linagliptin was lower than that in patients receiving placebo at baseline.18 in general , linagliptin showed a low propensity to cause hypoglycemia . when used as monotherapy , no patients experienced hypoglycemia in the two studies reviewed.11,15 one study reviewing linagliptin as monotherapy versus placebo reported hypoglycemia occurring in one patient in each group.12 when combined with metformin and sulfonylurea , a higher percentage of patients receiving linagliptin experienced hypoglycemia versus placebo . however , a smaller percentage of patients experienced severe hypoglycemia when compared with placebo.16 three studies discussed or reported the occurrence of pancreatitis . one study reported zero cases15 while another study reported one case of pancreatitis in a patient receiving linagliptin.17 a 78-week , open - label extension study , which included 2121subjects , reported four cases of pancreatitis in patients who had received linagliptin for a total of 102 weeks , with two cases being acute and two chronic . this was an incidence of 0.2% in the overall treated set.19 according to the prescribing information , pancreatitis was reported more often in patients treated with linagliptin ( 21.9 per 10,000 patient years ) versus placebo ( eight per 10,000 patient years).1 one study prospectively assessed cardiovascular safety for linagliptin versus sulfonylurea ( e.g. glimepiride ) . major cardiovascular events occurred in 2% of patients treated with linagliptin and 3% treated with glimepiride ( p = 0.0213 ) . this finding was mainly attributable to a significantly lower number of nonfatal strokes with linagliptin compared with glimepiride , without any relation to hypoglycemia.17 data from the clinical trials suggest that linagliptin administered as monotherapy or in combination with other antidiabetic therapies improves hba1c and reduces fasting plasma glucose.1119 when used as monotherapy , linagliptin resulted in a placebo - corrected change in hba1c ranging from 0.28% to 0.69%.11,12 when linagliptin was added to metformin or metformin and a sulfonylurea , similar hba1c reductions ranging from 0.39% to 0.75% were observed.13,14,16 when comparing linagliptin with glimepiride as add - on therapy to metformin , a numerically greater response was seen with glimepiride , but this was not statistically significant . however , when linagliptin was used in combination with pioglitazone , larger reductions in placebo - corrected hba1c of 1.06% were seen.18 those studies that evaluated the impact of linagliptin therapy on postprandial plasma glucose also reported an improvement.1113 when used as monotherapy , linagliptin decreased postprandial plasma glucose in the range of 27.257.7 mg / dl , and when used in combination with metformin , postprandial plasma glucose decreased by 66.7 mg / dl.1113 with this , the data suggest linagliptin used as monotherapy or in combination with other antidiabetic therapies offers improvement in glycemic control . specific populations that may particularly benefit from linagliptin therapy should also be considered . in patients experiencing renal impairment precluding the use of metformin , linagliptin may have a niche in managing glycemia because it does not require dose adjustment in renal compromise . several of the studies discussed in this review stratified the change in hba1c according to the baseline value . reduction in hba1c was greater in patients with a baseline hba1c > 9% , offering another possible niche for linagliptin therapy . dpp-4 inhibitors as a class are generally well tolerated . a minimal risk of hypoglycemia when used as monotherapy and lack of weight gain are some of the desirable characteristics of this class of medications . overall , linagliptin has been shown to be well tolerated , with adverse events similar to others within its class . it is important to note that although linagliptin offers a low risk of hypoglycemia , this risk increases when this agent is combined with secretagogue therapy . pancreatitis is also of concern and is a class effect of dpp-4 inhibitors , although the risk of the condition seems very low with this medication . a long - term safety and efficacy study evaluated linagliptin therapy in over 2000 patients for a total of 102 weeks and found an overall incidence of 0.2%.19 however , recent discussions have noted that the prevalence of pancreatitis among patients with type 2 diabetes is similar to that seen with incretin hormones . a study published in 2009 by noel et al found that patients with type 2 diabetes had an almost three - fold greater risk of pancreatitis than those patients without diabetes.20 this information suggests that there may not be an increased risk of pancreatitis with incretin therapy . it has a long half - life and undergoes less renal excretion , avoiding the need for dose adjustments in patients with renal impairment.6,9 however , to date , there are no head - to - head studies comparing the efficacy of this agent with other dpp-4 inhibitors in its class . linagliptin is a newly approved dpp-4 inhibitor for use as a once - daily oral medication in the treatment of type 2 diabetes . the use of linagliptin as monotherapy or in combination with metformin or pioglitazone led to reductions in hba1c and fasting plasma glucose after 1224 weeks of therapy . this improvement in glycemic control was shown to be maintained for up to 102 weeks . it is generally considered to be weight neutral , unless used in combination with a thiazolidinedione , and has a low risk of hypoglycemia .

background : the purpose of this paper is to review the efficacy , safety , and tolerability of linagliptin in the management of hyperglycemia in adults with type 2 diabetes mellitus.methods:a medline search was performed using the keywords linagliptin and type 2 diabetes for articles published september 2010 through july 2012 . the literature search was limited by the following criteria : articles publication in the english language , clinical trials , randomized controlled trials , and research conducted in humans.results:a review of the data for linagliptin in the treatment of type 2 diabetes as monotherapy or in combination with other antidiabetic therapies suggests clinical efficacy in terms of reductions in glycosylated hemoglobin , fasting plasma glucose , and postprandial glucose . most adverse events with linagliptin are considered to be mild to moderate in nature . although linagliptin therapy may offer a low risk of hypoglycemia , the risk increases when it is used in combination with insulin secretagogues . linagliptin can generally be considered weight neutral , but a weight increase was observed when linagliptin was used in combination with a thiazolidinedione.conclusion:linagliptin is a once - daily oral medication used for the treatment of type 2 diabetes . the use of linagliptin as monotherapy or in combination with metformin , sulfonylureas , or pioglitazone led to improvement in glycemic control and was well tolerated by most patients .

Introduction Materials and methods Results Linagliptin monotherapy Combination therapy Linagliptin versus placebo as add-on therapy to metformin Linagliptin + metformin versus linagliptin alone, metformin alone, and placebo Linagliptin versus placebo in combination with metformin and sulfonylurea Linagliptin versus glimepiride in combination with metformin Linagliptin versus placebo as add-on to pioglitazone therapy Open-label extension: linagliptin monotherapy or in combination with other oral antidiabetic therapies Safety and tolerability Discussion Conclusion

since the creation of the very first genome databases in 1992 ( 1 ) , data structures as well as the information content of genome databases underwent little change . essentially the concept of genome databases is gene centered and the sequence associated information does not reach beyond its individual functional properties such as ec numbers or the annotation of certain classification types such as functional categories [ e.g. funcat ( 2 ) or geneontology ( 3 ) ] . an important contribution of novel experimental techniques during the last few years has been the computational analysis of modules and networks based on the combination of independent types of information ( 4,5 ) . to understand complex cellular processes , it is necessary to uncover the functional context of any individual gene . as a consequence , there is an urgent need to build information resources that enable the integration of different types of data as well as the quantitative evaluation of their reliability at inferring function as part of the annotation process . an essential but so far unsolved challenge for the annotation of gene properties within the functional context is the very dynamic change of the underlying data . in contrast to genome sequence data which are complete for hundreds of species and for which robust and mathematically rigorous algorithms are available , interaction information for most organisms is highly incomplete and the transfer of information between species is not straightforward [ e.g. ( 6 ) ] . from the user 's point of view , a number of basic requirements have to be met for genome databases to provide complex functional information . the gene centered view has to be extended from the single - gene to encompass a network perspective and metabolic , regulatory and interactive dimensions have to be included . in addition , to enable an interaction - based comprehensible view , the so called giant networks need to be subclustered to reflect their underlying modular structure and the edges of the functional interaction graphs must be quantitatively labeled . both views need to be accessible through browsers as well as through suitable computational interfaces . obviously , the current state of genome databases does not fulfill these requirements . in this paper , we will describe the current state of our developments to achieve these long - term goals for a limited number of model organisms ( fungi including yeast , arabidopsis thaliana and other plant models , and the mouse genome ) . genome information is traditionally stored in databases containing entries as instances of predefined rigid data structures ( i.e. formats ) . however , the development of concepts to cope with complex data structures within a database becomes practically unmanageable as soon as several independent data sources have to be covered . therefore information pointing to the same biological objects is distributed over a large number of independent and often syntactically incompatible databases ( e.g. nucleic acids , proteins , protein interactions , metabolic and regulatory networks and the like ) . while passive integration of these databases is feasible through database indexing and integration of flat files or web resources [ e.g. pubmed ( 7 ) ] , it does not allow for any semantic integration required for comprehensive annotation purposes ( table 1 ) . the munich information center for protein sequences ( mips ) genome research environment system ( genre ) provides a flexible technology to cope with the needs of biological data representation . it is a j2ee based multi - tier architecture , implemented with established software design patterns . seamless integration of distributed information resources ( databases and applications ) is realized with enterprise java beans ( ejbs ) capable of retrieving information in xml format for straightforward web publishing including expression based queries similar to pubmed . . components of the first type are responsible for the access of applications and databases . these ejbs provide a uniform interface while hiding the data resource dependent access mechanisms in the data integration tier . databases for example are typically accessed via hibernate , an object - relational mapping tool , whereas applications are often directly accessed . data objects , which represent the second type within genre abstract biological entities such as genes , proteins or even complexes at a semantic level . in this layered approach this allows the association of any biochemical entities ( e.g. rna , drugs , etc . ) with either an entity describing binary relationships protein interactions from yeast two - hybrid experiments with many to many relationships , e.g. functional assignments using the mips funcat ( 2 ) . hence genre does not only allow for the flexible creation of different object types needed to include various types of omics data , but is also capable of incorporating relations between instances from different data sources . even complex data models suitable for handling biological networks together with functional annotation of the distinct nodes are realized . in combination with integrated applications like simap components for comparative proteomics protein interaction resource ( mpact ) ( 8) is illustrative of the advantage of our approach to extend the single - protein view into a network perspective . the data model allows extensions for interactions of proteins with other biochemical entities ( e.g. rna , drugs , etc . ) . interacting objects can not only be associated with each other to represent for example complexes , but also with external information describing the corresponding experiments ( e.g. yeast two - hybrid , co - immunoprecipitation or mass spectrometry data ) . in the same way information about the evidence of interactions and various protein annotations such as functions , motifs and cellular localization are associated with the interacting object . owing to the object - oriented approach any instances of the interacting object ( notably a protein ) our implementation allows two different approaches to query the repository . on the one hand a gene - centric or protein - centric query is possible where distinct interacting objects can be retrieved within a specific context . since the proteins and interactions are decorated with annotation information , it is possible to query for specific attributes of proteins ( e.g. functions ) or the interactions ( e.g. evidence ) . on the other hand , network - centric queries can be performed . it is possible to query both for the nodes ( the proteins ) and the edges ( the interactions ) of the graph . this traversal can be used to quickly scan the network for false - positive interactions between proteins whose functions and/or localizations differ completely or to assign new functions to proteins without functions which interact specifically within a certain functional context . furthermore extraction of sub - networks based on any associated context ( function , localization , experiment ) is possible . it is relevant to point out that our approach enables seamless context dependent views starting from single genes and ending with complete networks . pairwise similarity comparison of every protein against the set of all known proteins is an indispensable step in any annotation process . many biological and evolutionary questions are related to the structure of the sequence space and its partitioning into substructures represented by the all - against - all similarity relations . however , individual searches for homologs do not allow structuring the sequence universe . the mips similarity matrix of proteins ( 9 ) , currently contains a matrix of all - against - all comparisons of more than 4 million proteins from > 400 organisms including all uniprot sequences . simap is continuously updated to keep up with the rapidly increasing amount of data . the linked sequence feature database containing information on protein domains as well as predicted transmembrane regions , signal peptides and protein localization supports efficient post - processing of homology lists into sub - clusters of homogeneous sequence properties . simap serves as an example of a system offering highly dynamic information in the form of a persistent database to be explored systematically at high performance . simap is also used as an annotation tool and generates similarity input information for the pedant databases ( 11 ) . in contrast to the straightforward similarity matrix , the compilation of biological interaction information requires methods dealing with mostly incomplete but also inherently heterogeneous sets of data . to provide a system for comprehensive network analysis , we have developed cabinet ( comprehensive analysis of biomolecular networks ) within the framework of genre . cabinet offers a set of methods for network statistics , integration , analysis and clustering applied to interaction data administered by genre as well as to user - submitted network data . cabinet allows the user to browse and query across any subset of the generated networks and clusters . as with all methods in genre , the software design of cabinet allows an easy adoption of new functions into the system . to address the issue of inconsistent use of protein identifiers in different networks , a genre component to resolve protein identifiers and aliases in all major sequence databases high quality data collections are needed as a reference set for testing computational methods in network analysis . in the case of protein protein interaction data , any collection from various sources including high - throughput experiments contains a considerable number of false - positive and false - negative results ( 12 ) . thus , for the analysis of protein networks there is a need for gold standards ( 12 ) in order to validate the quality of data resources or as a reference for testing the reliability of computational methods . the cooperation and interaction of proteins is most unambiguously found in protein complexes where several proteins simultaneously act together to perform a single reaction . for the analysis of protein networks in lower eukaryotes the protein complexes from yeast have become a gold standard in the field ( 8) . analysis of the even more elaborate protein networks in mammals requires manually curated resources in its own right . information in mammalian protein complex database ( mpcdb ) is extracted from scientific literature describing individual experiments ; data stemming from high - throughput experiments has not been incorporated . information about protein complexes includes gene names of the members as well as protein names , cross - references and literature references . if a protein complex has been analysed from other mammals the orthologous mouse proteins are presented . in addition , the type of experiment that was used to analyse the protein complex is given . evidence is structured according to the mips evidence catalogue originally developed for yeast protein complex and protein this is in line with the requirements for psi - mi compliant annotation ( 8) . manual annotation of the respective proteins is performed in the mouse functional genome database ( mfungd ) . here , protein function annotation is performed with the funcat ( 2 ) annotation scheme , which in a comparison of several individual features showing the highest predictive power for the analysis of protein networks ( 13 ) . whereas within the protein complex data in bind ( 14 ) the vast majority of protein complexes contain less than three different proteins , the protein complexes within mpcdb contain 4.6 different proteins on average . high molecular weight protein complexes like proteasomes and the eukaryotic chaperonin tric perform central functions in cells like protein degradation and protein folding , respectively . these two protein complexes are examples that so far , are not present in any manually curated publicly available database of protein complexes . hence , the mpcdb dataset provide scientists with a reliable data resource for the analysis of protein networks and functional modules in mammals . the mips data resource aims to extend the scope of its curated genome databases towards functional context information . these databases include model systems for mammals ( mus musculus , in progress ) , fungi ( yeast , cygd ; neurospora crassa , mndb ; ustillago maydis , mumdb ; fusarium graminearum , fgdb ) , plants ( a.thaliana , matdb ; oryza sativa , mosdb ; maize genome sequencing project , mgsp ; european medicago and legume database ; urmeldb , lotus japonica ) , microorganisms ( chlamydiae , listeriae ) , the comprehensive automatic annotation of genomes in the pedant database ( 11 ) . protein interaction datasets for mammalia ( mppi ) and yeast ( mpact ) as well as the database for mammalian protein complexes ( mpcdb ) . proteins in these databases are functionally classified using the well established functional catalogue funcat ( 2 ) .

the munich information center for protein sequences ( mips at the gsf ) , neuherberg , germany , provides resources related to genome information . manually curated databases for several reference organisms are maintained . several of these databases are described elsewhere in this and other recent nar database issues . in a complementary effort , a comprehensive set of > 400 genomes automatically annotated with the pedant system are maintained . the main goal of our current work on creating and maintaining genome databases is to extend gene centered information to information on interactions within a generic comprehensive framework . we have concentrated our efforts along three lines ( i ) the development of suitable comprehensive data structures and database technology , communication and query tools to include a wide range of different types of information enabling the representation of complex information such as functional modules or networks genome research environment system , ( ii ) the development of databases covering computable information such as the basic evolutionary relations among all genes , namely simap , the sequence similarity matrix and the cabinet network analysis framework and ( iii ) the compilation and manual annotation of information related to interactions such as protein protein interactions or other types of relations ( e.g. mpcdb , mppi , cygd ) . all databases described and the detailed descriptions of our projects can be accessed through the mips www server ( ) .

FROM GENE-CENTRIC TO NETWORK-BASED REPRESENTATION OF GENOME INFORMATION GENRE, THE GENERIC MODEL FOR COMPLEX GENOME INFORMATION SIMAP AND CABINET: COMPUTATIONAL METHODS TO GENERATE INFORMATION FOR GENOME DATABASES THE MAMMALIAN PROTEIN COMPLEX DATABASE SUMMARY Figures and Tables

< 45 years old , mechanical lbp is the most common cause of disability , and it is generally attributed to an acute traumatic event . however , cumulative trauma must also be considered in the etiology , such as occupational overuse injury.2,3 the best approach to treat lbp appears to be a combination of pharmacological and nonpharmacological strategies.4 there is a great variability , possibly genetically related , in the individual response to painkillers.5 nonsteroidal anti - inflammatory drugs ( nsaids ) are the most common type of medication used in the treatment of acute pain , exerting their effect by interfering in the inflammatory response.6 they inhibit the cyclooxygenase ( cox ) enzyme , reducing the synthesis of prostaglandins . the traditional nsaids inhibit both cox-1 and cox-2 , and inhibiting cox-1 decreases platelet aggregation , irritates the gastric mucosa , and alters renal flow.7 ketorolac trometamol ( kt ; toragesic , ems sigma pharma ltd . , campinas , brazil ) is an nsaid , which is a racemic mixture of the s- and r - enantiomeric forms . kt inhibits cox that results in reduced synthesis of prostaglandins , thromboxanes , and prostacyclin as well as diminished platelet aggregation.8 compared with aspirin , which produces prolonged and irreversible antiplatelet effects that persist beyond drug administration , the anti - platelet activity of kt is not apparent after elimination from the plasma and is reversible . in addition , the platelet effects of kt are not related to dose.8 the s - enantiomer of kt is a rapid - acting and potent analgesic that possesses no anesthetic , sedative , or antianxiety effects and has no effect on gut motility.8 the effectiveness , safety , and analgesic efficacy and potency of kt are considered higher than those of ketoprofen in postoperative ear nose throat9 and dental surgeries.10 the aim of the current clinical trial ( protocol number nct01471886 ) was to test the hypothesis that kt is not inferior to naproxen ( na ) in its analgesic efficacy and incidence of adverse effects for the treatment of moderate - to - severe acute lbp . this 10-day , double - dummy , randomized , prospective , noninferiority clinical trial was conducted at two research centers in so paulo , brazil , in accordance with the principles of the declaration of helsinki and under protocol number 0752/11 , which was approved by the ethics committee of the university hospital at so paulo university . because the package insert indicates that the upper limit of use for kt is 5 days , the treatment duration was not longer than 5 days , and the study finished with safety reassessment 10 days after treatment initiation . outpatients diagnosed with moderate or severe acute lbp as determined by a visual analog scale ( vas ) score > 40 mm were screened . the exclusion criteria included the following : weight < 50 kg ; severe congestive heart failure ; current alcoholism or illegal drug use ; presence of fever or signs of infection ; kidney disease ; fracture ; fibromyalgia ; cancer ; neuropsychiatric disease ; rheumatologic disease ; history of peptic ulcer disease , gastrointestinal bleeding , or hemorrhagic diathesis ; cerebrovascular disease ; hemostatic disorders or use of anticoagulants ; pregnancy ; lactation ; postoperative patients at high risk of bleeding ; history of hypersensitivity to any of the ingredients in the formula or other nsaids ; nasal polyps ; and asthma . participants could not have participated in another experimental study in the 6 months prior to study entry . none of the 83 prospective participants were excluded ; thus , these 83 volunteers were randomized . this noninferiority study compared the analgesic efficacy and incidence of adverse effects in the treatment of moderate - to - severe acute lbp for kt at a dosage of 10 mg given sublingually three times daily ( tid ) and na at a dosage of 250 mg administered orally tid . eligible participants were randomly assigned to one of these two treatment groups by a computer - generated lottery . this scale was used to evaluate the investigators global assessment of efficacy on reducing the participant s pain through the following ratings : excellent , vas score reduction 50 mm or greater ; very good , vas score reduction between 40 mm and 50 mm ; good , vas reduction between 30 mm and 40 mm ; regular , vas between 20 mm and 30 mm ; bad , vas score 10 mm or less . during the initial visit ( v0 ) on the first treatment day , the participant received two pills of either the tested or reference medication , followed by one tablet every 8 hours , for a total of 40 mg and 1,000 mg , respectively . thereafter , a daily dosage of 10 mg tid was administered sublingually for the test medication and 250 mg tid for the reference medication . from the second to the fifth day of treatment , if the patient had vas > 40 mm , increased dosage to four times per day was allowed . participants were reassessed after the initiation of treatment at 2 days ( v1 ) and 4 days ( v2 ) , when the treatment was discontinued . ten days ( v3 ) after the initiation of the study , participants returned for a safety assessment and adverse events were recorded . the analgesic effect was evaluated on v0 before and 60 minutes after taking the drug ( v060 ) as well as on v1 and v2 through a vas score categorized as follows : 0 mm , no pain ; 0.140 mm , mild pain ; 4170 mm , moderate pain ; and 71100 mm , severe pain . the primary end point was the rate of pain relief ( rpr ) calculated by the following formula : rpr = vas(vi)vas(vf)vas(vf)(1)where vas(vi ) is the vas on v0 ( before taking the drug ) and vas(vf ) is the vas on v060 or v1 or v2 . the secondary end point was rpr1 and was calculated for each of the three drug administrations on each day as follows : rpr1=vas(vi)vas(vf)vas(vf)(2)where vas(vi ) is the vas 1 hour before the administration of medication and vas(vf ) is the vas 1 hour after the administration of medication . adverse effects occurring up to 10 days after v0 ( v3 ) were also included in the study . a sample size of at least 78 participants was deemed sufficient to detect differences in the rpr at a significance level of 5% , power of 80% , noninferiority margin of 10% ( as per the recommendation of the us food and drug administration [ fda ] ) , and an average difference between 5% and 10% , considering a 20% dropout.11,12 a total of 63 ( per protocol ) of the 83 ( intention - to - treat , itt ) participants completed the study ( there was no screening failure ) . the homogeneity of the demographic and clinical features between the groups was compared by tests , fisher s exact tests ( for sex , and clinical changes ) , levene s test for variance equality , and t - test for two independent samples to compare means between two groups for the averages equality ( age , weight , rolland - morris , and vas ) . the evaluation of the effectiveness ( vas ) was performed by levene s test for variance equality and t - tests for mean equality in the protocol population . the primary end point was the rpr between v060 and v0 , between v1 and v0 , and between v2 and v0 . the secondary end point was the pain relief following each of the three drug administrations on each day ( rpr1 ) . the primary end point for this analysis was the investigators global assessments of efficacy as measured using a likert scale . we used a logistic model with a stepwise backward approach to select the dependent variables among treatment , sex , age , current smoking status , alcohol use , and clinical changes ( inclusion in the model p<0.05 , and exclusion p>0.1 ) . the secondary end point in this analysis was the percentage of participants with improvement in pain relief as assessed by the vas . for this analysis , we considered pain improvement as vas scores from 0 to 3 after the administration of medication . we also used a logistic model with a stepwise backward approach to select the dependent variables among treatment , sex , age , current smoking status , alcohol use , and clinical changes ( inclusion in the model p<0.05 , and exclusion p>0.1).13 eighty - three outpatients diagnosed with moderate or severe acute lbp as determined by a visual analog scale ( vas ) score > 40 mm were screened . the exclusion criteria included the following : weight < 50 kg ; severe congestive heart failure ; current alcoholism or illegal drug use ; presence of fever or signs of infection ; kidney disease ; fracture ; fibromyalgia ; cancer ; neuropsychiatric disease ; rheumatologic disease ; history of peptic ulcer disease , gastrointestinal bleeding , or hemorrhagic diathesis ; cerebrovascular disease ; hemostatic disorders or use of anticoagulants ; pregnancy ; lactation ; postoperative patients at high risk of bleeding ; history of hypersensitivity to any of the ingredients in the formula or other nsaids ; nasal polyps ; and asthma . participants could not have participated in another experimental study in the 6 months prior to study entry . none of the 83 prospective participants were excluded ; thus , these 83 volunteers were randomized . this noninferiority study compared the analgesic efficacy and incidence of adverse effects in the treatment of moderate - to - severe acute lbp for kt at a dosage of 10 mg given sublingually three times daily ( tid ) and na at a dosage of 250 mg administered orally tid . eligible participants were randomly assigned to one of these two treatment groups by a computer - generated lottery . this scale was used to evaluate the investigators global assessment of efficacy on reducing the participant s pain through the following ratings : excellent , vas score reduction 50 mm or greater ; very good , vas score reduction between 40 mm and 50 mm ; good , vas reduction between 30 mm and 40 mm ; regular , vas between 20 mm and 30 mm ; bad , vas score 10 mm or less . during the initial visit ( v0 ) on the first treatment day , the participant received two pills of either the tested or reference medication , followed by one tablet every 8 hours , for a total of 40 mg and 1,000 mg , respectively . thereafter , a daily dosage of 10 mg tid was administered sublingually for the test medication and 250 mg tid for the reference medication . from the second to the fifth day of treatment , if the patient had vas > 40 mm , increased dosage to four times per day was allowed . participants were reassessed after the initiation of treatment at 2 days ( v1 ) and 4 days ( v2 ) , when the treatment was discontinued . ten days ( v3 ) after the initiation of the study , participants returned for a safety assessment and adverse events were recorded . the analgesic effect was evaluated on v0 before and 60 minutes after taking the drug ( v060 ) as well as on v1 and v2 through a vas score categorized as follows : 0 mm , no pain ; 0.140 mm , mild pain ; 4170 mm , moderate pain ; and 71100 mm , severe pain . the primary end point was the rate of pain relief ( rpr ) calculated by the following formula : rpr = vas(vi)vas(vf)vas(vf)(1)where vas(vi ) is the vas on v0 ( before taking the drug ) and vas(vf ) is the vas on v060 or v1 or v2 . the secondary end point was rpr1 and was calculated for each of the three drug administrations on each day as follows : rpr1=vas(vi)vas(vf)vas(vf)(2)where vas(vi ) is the vas 1 hour before the administration of medication and vas(vf ) is the vas 1 hour after the administration of medication . adverse effects occurring up to 10 days after v0 ( v3 ) were also included in the study . a sample size of at least 78 participants was deemed sufficient to detect differences in the rpr at a significance level of 5% , power of 80% , noninferiority margin of 10% ( as per the recommendation of the us food and drug administration [ fda ] ) , and an average difference between 5% and 10% , considering a 20% dropout.11,12 a total of 63 ( per protocol ) of the 83 ( intention - to - treat , itt ) participants completed the study ( there was no screening failure ) . the homogeneity of the demographic and clinical features between the groups was compared by tests , fisher s exact tests ( for sex , and clinical changes ) , levene s test for variance equality , and t - test for two independent samples to compare means between two groups for the averages equality ( age , weight , rolland - morris , and vas ) . the evaluation of the effectiveness ( vas ) was performed by levene s test for variance equality and t - tests for mean equality in the protocol population . the primary end point was the rpr between v060 and v0 , between v1 and v0 , and between v2 and v0 . the secondary end point was the pain relief following each of the three drug administrations on each day ( rpr1 ) . the primary end point for this analysis was the investigators global assessments of efficacy as measured using a likert scale . we used a logistic model with a stepwise backward approach to select the dependent variables among treatment , sex , age , current smoking status , alcohol use , and clinical changes ( inclusion in the model p<0.05 , and exclusion p>0.1 ) . the secondary end point in this analysis was the percentage of participants with improvement in pain relief as assessed by the vas . for this analysis , we considered pain improvement as vas scores from 0 to 3 after the administration of medication . we also used a logistic model with a stepwise backward approach to select the dependent variables among treatment , sex , age , current smoking status , alcohol use , and clinical changes ( inclusion in the model p<0.05 , and exclusion p>0.1).13 one participant was withdrawn due to adverse effects ( acute cholecystitis , improbably associated with the test drug ) , four due to the use of banned medicine , and five due to a breach of protocol , while four chose to withdraw from the study , and six were withdrawn because of lack of follow - up ( figure 1 ) . both sample groups were clinically homogeneous , and there was no significant difference between them ( table 1 ) . comparison of the rpr between v0 and v060 showed a 5.6% gain in the rpr for kt compared with na , which was below the 10% limit ( difference = 0.056 ; 95% confidence interval [ ci ] , 0.166 , 0.055 ) and within the noninferiority margin . comparing the rpr for v1 and v0 , and for v2 and v0 , the secondary end point showed that kt was not inferior to na on day 1 for the first and third administrations of the drug , on day 2 for the second and third administrations , on days 3 and 4 for the first three administrations , and on day 5 for the first and third administrations ( table 3 ) . because we observed a pattern of superiority in the rpr for kt compared with that for na ( figure 2 ) , we performed a post hoc analysis using likert scale scores of the investigators global assessment of efficacy on reducing the participants pain as the end point . the final logistic model included age as the only important independent variable after a stepwise approach . on v1 , participants in the kt group had 193.1% higher odds of pain reduction compared with those in the na group , controlling for age ( 95% ci , 1.107.80 ) . however , this was not observed on v2 , at which no statistically significant difference in pain improvement was detected between the two treatment groups ( table 4 ) . however , the percentage of participants who reported an improvement in pain relief at v060 was higher in the kt group ( 24.2% ) than in the na group ( 6.5% ; p=0.049 ) . the percentage of participants rated as excellent , very good , or good by the investigator for the kt treatment group ( 66.7% ) was much higher than that for the na group ( 40.0% ) , with 95% cis for the differences of 0.493 and 0.041 . these results indicated that , compared with the na treatment , the kt treatment had a margin of superiority equal to 4.1% . there were 35 adverse events in the study population treated with na and 42 in the population treated with kt . the main adverse effects were diarrhea , stomach pain , drowsiness , nausea , and vomiting . the frequency of occurrence of each event between the two treatments was not statistically significant ( table 5 ) . the safety evaluation for changes in the laboratory results performed in the protocol population on v2 and v3 and compared with that on v0 did not show any difference between the two treatment groups ( table 6 ) . this study showed that the efficacy of kt was not inferior to that of na in the treatment of acute lbp of moderate - to - severe intensity , with no significant differences in the occurrence of adverse effects between the two treatment groups . however , participants who received kt exhibited a higher percentage of response after the initial administration and had higher odds of responding according to the investigator s assessment at the first visit , suggesting a faster pain relief in the kt group . the rate of pain relief should always be considered when choosing an analgesic in order to improve the quality of life for patients . there is evidence that kt is more effective than other nsaids in pain reduction from both inflammatory and non - inflammatory etiologies.9,10 its mechanism of action is to reduce prostaglandin production by blocking cox 1 and 2 . it has no sedative or anxiolytic properties.14 the fda approved ketorolac in november 1989 . in studies of postoperative pain , kt showed an opioid dose - sparing effect and consequently a decrease in the adverse events related to opioids.15,16 in addition , for intravenous administration , kt is more cost - effective than morphine in blunt limb injury.17 only two studies have evaluated kt for the treatment of acute lbp , and both studies used opioids as comparators.18,19 in both studies , kt had comparable efficacy and fewer side effects . the current study is the first to compare kt to another nsaid in the management of acute lbp . the treatment of acute lbp is an unmet need in which the variability of medical options , mostly uncontrolled , includes the use of nsaids , opioids , corticosteroids , and invasive procedures , such as epidural blockade . the results of our study comparing kt with the gold standard nsaid na indicated that kt is a valid option for the treatment of lbp . kt is not inferior to na in efficacy , provides faster pain relief , and is a safe acute treatment option for acute pain relief .

backgroundnonsteroidal anti - inflammatory drugs ( nsaids ) are the most common type of medication used in the treatment of acute pain . ketorolac trometamol ( kt ) is a nonnarcotic , peripherally acting nonsteroidal anti - inflammatory drug with analgesic effects comparable to certain opioids.objectivethe aim of this study was to compare the efficacy of kt and naproxen ( na ) in the treatment of acute low back pain ( lbp ) of moderate - to - severe intensity.patients and methodsin this 10-day , phase iii , randomized , double - blind , double - dummy , noninferiority trial , participants with acute lbp of moderate - to - severe intensity as determined through a visual analog scale ( vas ) were randomly assigned in a 1:1 ratio to receive sublingual kt 10 mg three times daily or oral na 250 mg three times daily . from the second to the fifth day of treatment , if patient had vas > 40 mm , increased dosage to four times per day was allowed . the primary end point was the reduction in lbp as measured by vas . we also performed a post hoc superiority analysis.resultskt was not inferior to na for the reduction in lbp over 5 days of use as measured by vas scores ( p=0.608 for equality of variance ; p=0.321 for equality of means ) and by the roland morris disability questionnaire ( p=0.180 for equality of variance test ; p=0.446 for equality of means ) using 95% confidence intervals . the percentage of participants with improved pain relief 60 minutes after receiving the first dose was higher in the kt group ( 24.2% ) than in the na group ( 6.5% ; p=0.049 ) . the most common adverse effects were heartburn , nausea , and vomiting.conclusionkt is not inferior in efficacy and delivers faster pain relief than na .

Introduction Patients and methods Participants Treatments, groups, and outcome measures Statistical analysis Results Security assessment Discussion Conclusion

the dedifferentiation and proliferation / apoptosis of smooth muscle cells ( smcs ) in the arterial intima represent one of the changes found in early atherosclerotic lesions , when the disease is still reversible [ 13 ] . cultured smcs from an atherosclerotic plaque showed a greater susceptibility to apoptosis that did not vary with subculture . this finding suggests that stable and cell - intrinsic changes in the expression of proapoptotic or antiapoptotic genes exert a greater control over apoptosis in smcs than do cell - cell interactions or the microenvironment in the plaque , indicating that this susceptibility develops in initial stages of the disease . if the sum of signals gives apoptosis as a result , the whole protein machinery for destruction is unleashed . the bcl-2 protein family also regulates the apoptosis pathways to influence cell survival ; this family forms heterodimers between apoptosis - inhibiting proteins such as bcl-2 , bcl - xl , and a1 , and inducing proteins such as bax , bad , bid , regulating cell survival . the ratio of anti- to proapoptotic proteins determines susceptibility to apoptosis , especially the bcl-2/bax ratio . smcs express low levels of bcl-2 in vitro and in vivo [ 4 , 7 ] . although smcs in an atherosclerotic process show no major changes in bcl-2 expression , the balance between antiapoptotic and proapoptotic proteins can change in favor of the latter and trigger apoptosis , mainly mediated by bax [ 8 , 9 ] . the most numerous cholesterol oxides found in human atheromatous plaque are 7-hydroxycholesterol and 7-ketocholesterol , while 7-ketocholesterol , and 25-hydroxycholesterol are the most abundant in the aortic wall of experimental animals after a cholesterol - rich diet and are the most effective to induce cell death , especially 25-hydroxycholesterol . thus , chickens have been reported to readily develop hypercholesterolemia with a cholesterol - rich diet , producing atherosclerotic lesions in some cases [ 1416 ] . preliminary studies demonstrated that a 20-day diet enriched with 5% cholesterol is sufficient to cause hypercholesterolemia and gives rise to lipid deposits in the main arteries that are similar to the fatty streaks observed in the first stages of atherosclerosis . because the presence of apoptosis in atherosclerotic lesions can have a major impact on the progression of the disease , characterization of oxysteroid - induced cell death is important to understand the development of atherosclerosis , since it is not clear how cholesterol and its oxides induce apoptosis in smcs . therefore , the objective of this study was to investigate the apoptotic pathways induced by oxysterols , using a cell model in which smcs were exposed to atherogenic factors ( cholesterol - rich diet ) or antiatherogenic factors ( fish oil - rich diet ) . these cells were then exposed in vitro to 25-hydroxycholesterol , studying levels of apoptosis and apoptotic proteins bcl-2 , bcl - xl , and bax and the expression of genes that encode the proteins involved in apoptosis , bcl-2 , bcl - xl . the protocol of this study was approved by the animal laboratory service of the university of granada ( spain ) and chickens received humane treatment according to the regulations for animal research of the european union . newborn white leghorn male chicks ( gallus domesticus ) , supplied by the animal laboratory service of the university of granada , were kept in a chamber with a light cycle from 09.00 to 21.00 hours and controlled temperature of 2931c and allowed free access to food and water . the diet was started at hatching and kept on until the chicks were killed ( 20 days after ) . none of the chicks died a natural death during the treatment nor developed any illness . three groups of chicks twenty days old were used , the control diet group ( c - group ) was kept on a standard diet ( sanders a-00 ) while treated group ( ch - group ) was fed on the same diet supplemented with 5% w / w powdered cholesterol mixed homogeneously ( panreac reagent barcelona , pure grade ) . the third group ( ch - fo - group ) was fed for 10 days with a diet of 5% cholesterol and then cholesterol diet was withdrawn and the standard diet was supplemented with 10% of fish ( menhaden ) oil for 10 days more . standard diet free of cholesterol contained ( w / w ) 42% carbohydrate ( mainly starch ) , 3.5% fat , and 20.5% protein . experimental diets were obtained by supplementation to de standard diet with 5% of cholesterol ( ch diet ) and 10% fish ( menhaden ) oil ( fo diet ) . no significant differences were observed in fatty acid composition of each diet during the experiments . animals did not suffer at all at any stage of the experiment because our laboratory usually uses the anesthetic ketamine ( 60 mg / kg of body weight ) and sodium pentobarbital ( 50 mg / kg of body weight ) according to the regulations of the animal research of the european union . the research staff had the preparation and the certification to do experimental work with animals . smcs were isolated from the aortic arch of the chicks as described elsewhere with slight modifications and cultured in dulbecco 's modification of eagle 's medium ( dmem ) supplemented with d - glucose ( 4.5 g / l ) , l - glutamate ( 0.584 g / ml ) , antibiotic cocktail composed of penicillin ( 100 g / ml ) and amphotericin ( 0.25 g / ml ) ( sigma - aldrich , inc . ) , as well as 10% ( v / v ) fetal bovine serum ( fbs ) . medium was buffered with bicarbonate and cultures were kept at 37c in humidified atmosphere of 95% air and 5% co2 . secondary cultures were initiated after either low or high passages using 0.05%/0.02% trypsin - edta solution . cells were determined to be vascular smcs by their hill - and - valley configuration at confluence and positive fluorescence staining for smooth muscle actin and myosin . smcs were plated in 96-well plates at a density of 25000 cells / well . after adhering during overnight culture , cells were treated for 24 and 48 hours with 25-hydroxycholesterol ( 540 g / ml ) dissolved in absolute ethanol . the final concentration of ethanol in the culture medium never exceeded 0.8% and no effect on culture was observed at or below this concentration . an amount of this solution equal to 10% of the culture medium volume was added to cell cultures . the formazan crystals were solubilized by adding 200 l l of solubilization solution ( 0.05 n hcl in isopropanol ) . metabolic activity was quantified by subtracting light absorbance at 630 nm from absorbance at 570 nm . total rna was isolated with tri - reagent / trizol ( invitrogen , ltd , uk ) . single - stranded cdna was synthesized from 4 g total rna using an oligo(dt)1218 as primer and powerscript reverse transcriptase ( clontech laboratories , inc . , real - time pcr was performed with the fast start dna master sybr green i kit ( roche ) and light cycler system ( roche ) . for the light cycler reaction , a master mix of the following reaction components was prepared to the indicated final concentration : 12.6 l l h2o , 2.4 l l mgcl2 ( 4 mm ) , 1 l l forward primer ( 0.5 m ) , 1 l l reverse primer ( 0.5 m ) , and 2.0 l l of the fast start dna master sybr green i mix ( roche ) . the primer sequences used in this study are given in table 2 and optimized at an annealing temperature of 55c . the cdna of the genes studied in the different samples ( treated in vivo and in vitro ) were diluted 1 : 100 and amplified to obtain the cp value for each sample . light cycler products of the different gene expressions were analyzed by agarose gel electrophoresis and a light cycler melting curve was constructed to test for a single product at the end of each pcr reaction . a mathematical model developed by pfaffl was used for the relative quantification of bcl-2 , bcl - xl , c - myc , and p53 mrna expression in real - time pcr with respect to the reference -actin gene transcript . the efficiency of the assay for each studied gene was -actin : 1.86 ; bcl-2 : 1.89 ; bcl - x : 1.9 ; c - myc : 1.91 ; p53 : 1.81 . cell monolayer ( 1 10 cells ) was disrupted by incubation with ripa buffer ( 1 pbs , 1% nonidet p-40 , 0.5% sodium deoxycholate , 0.1% sds , 0.1 mg / ml pmsf , 2 g / ml aprotinin , 0.18 mg / ml sodium orthovanadate ) . protein concentration was determined by using the micro - bca procedure ( bio - rad laboratories , inc . , calif proteins were denatured in 1 sample buffer with 5% 2-mercaptoethanol at 95 for 10 minutes . total cell lysate was separated under reducing conditions by 12% sds - polyacrylamide gel electrophoresis ( mini protean ii , bio - rad ) . gel - resolved proteins were then transferred onto a polyvinylidene difluoride membrane ( pvdf ) using a mini trans - blot cell apparatus ( bio - rad ) . membranes were blocked for 1 hour at room temperature in blocking reagent ( 5% milk power , 0,05% tween-20 in tbs or pbs , ph 7.4 ) and probed at 4c overnight with the primary antibody : anti - bcl - xl ( cell signaling technology , inc . , mass , usa ) 1 : 1000 , anti - bax 1 : 100 ( santa cruz biotechnology , inc . , santa cruz , calif , usa ) , and anti - bcl-2 1 : 500 ( bd biosciences , calis , usa ) . the immunocomplex was detected with the ecl - plus kit ( amersham , buckinghamshire , uk ) , and the band density was analyzed using quantiscan software ( biosoft , cambridge , uk ) . data were analyzed by student 's t - test when the variability was the same in each group , because the t - test assumes that standard deviations of two datasets are equal . a difference between groups was considered significant when the p - value was .05 . to evaluate the cytotoxicity of 25-hidroxycholesterol on smc - c , smc - ch , and smc - ch - fo cultures , cells in third passage were incubated for 24 hours in 25-hidroxycholesterol at concentrations of 0 , 5 , 10 , 20 , 40 , and 80 g / ml , were used . the 25-hidroxycholesterol was previously dissolved in the ethanol and was diluted in cultures in order to obtain the concentrations of previous experiments . the concentration of ethanol in cultures never exceeded 0.8% , wich previously verified that it was not toxic for the cells . as figure 1 shows , the citotoxicity of 25-hidroxycholesterol during 24 hours is the same in the three types of cultures . even then , a slightly greater viability was observed in the smc - ch - fo cultures with respect to the control . with a concentration of 20 g / ml expression of proteins of the bcl-2 family of oncogenes ( bax , bcl - xl , and bcl-2 ) was studied ( figure 2 ) . because of the homodimerization and heterodimerization capacity of bax , bcl - xl , and bcl-2 , the relationship between expression levels of bcl-2/bax and bcl - xl / bax determines whether the cells will undergo apoptosis or not after an apoptotic stimulus . table 3 shows the antiapoptotic / proapoptotic ratios at baseline ( after in vivo treatments ) and after 25-hydroxycholesterol in vitro treatment . at baseline , expression of bcl-2 and bax ( figure 2 ) was similar among the three culture types , but expression of bcl - xl was higher in smc - ch and smc - ch - fo than in smc - c . hence , the bcl-2/bax ratios were very similar among cultures , whereas the bcl - xl / bax ( table 3 ) was significantly higher in smc - ch - fo . the smc - ch - fo ( table 3 ) showed a highly significant increase in the bcl - xl / bax ratio but a similar bcl-2/bax ratio to that of the control cells , indicating some resistance to apoptosis . therefore , the replacement of a cholesterol - rich diet with a dish oil - rich diet not only reverses the effects of cholesterol but also protects the smcs from apoptotic stimuli . the addition of 25-hydroxycholesterol produced a highly significant increase in bax levels in all three culture types ( figure 2 ) but no change in bcl - xl , except for a nonsignificant increase in the smc - c . moreover , a large reduction in the bcl - xl / bax ratio was observed for the smc - c and an intermediate reduction for the smc - ch - fo ( table 3 ) . we also studied the expression of genes that encode proteins implicated in apoptosis ( bcl-2 , bcl - xl ) . at baseline ( after in vivo experiments ) , the amount of mrna of bcl-2 gene remained unchanged in the smc - c and smc - ch ( figure 3 ) . however , the smc - ch - fo showed a slight increase in bcl-2 ( p < .05 ) . no major differences were observed in baseline expression of the bcl - xl gene ( figure 4 ) in the smc - c , smc - ch , and smc - ch - fo cells , as also found for bcl-2 and protein levels . incubation of the cultures with 25-hydroxycholesterol increased the mrna of bcl-2 ( p < .001 ) to a greater degree in smc - ch than in smc - c ( p < .05 ) , see figure 3 . moreover , the expression of bcl - xl markedly increased in the three culture types after the addition of 25-hydroxycholesterol ( p < .001 ) , see figure 4 . hyperlipemia and similar conditions , in particular , high cholesterol , change the expression of genes in endothelial cells and smcs , inducing atherosclerotic lesions in which proliferation and apoptosis are both present [ 1 , 8 , 21 ] . the dedifferentiation and proliferation / apoptosis of smcs in the arterial intima represent one of the changes found in early atherosclerotic lesions , when the disease is still reversible [ 2 , 3 ] . in light of this , it is predictable that smc culture models from animals fed with fish oil diet could produce some reversal of the changes induced by cholesterol in apoptotic proteins bcl-2 , bcl - xl , and bax and the expression of bcl-2 and bcl - xl genes [ 22 , 23 ] . the smc culture model generated in our laboratory by isolating the cells from control and cholesterol - fed chicks produces changes in smcs that make them more susceptible to 25-hydroxycholesterol - mediated apoptosis . replacement of a cholesterol - rich diet with a fish oil - rich diet produces some reversal of the cholesterol - induced changes , increasing the resistance of smcs to apoptosis . the very low level of apoptosis showed in smcs is similar to the 4% death rate usually observed in cultured cells . these data are in agreement with previous reports that cultured smc from the arterial media , even those from an atherosclerotic plaque , showing no apoptosis in culture , unlike observations in smc from the intima . in early atherosclerosis , the cells in the arterial media that will proliferate and migrate , modulating their phenotype , are in some way protected against apoptosis . in our experimental cell model , bcl-2 expression was very low in smcs from chicks after a 20-day calorie - rich diet , whereas bax expression showed virtually no change . these results are consistent with previous reports that bcl-2 is undetectable in most smcs from atherosclerotic plaque or healthy arteries [ 25 , 26 ] , explaining its poorly defined role , and that the expression of bax does not differ between smcs with synthetic and contractile phenotypes . however , other studies suggested that bcl-2 is expressed in smcs with contractile phenotype but not in those with synthetic phenotype . it has , therefore , been postulated that bcl-2 may be repressed throughout the modulation from contractile to synthetic phenotype . this modulation in smcs of the arterial intima is observed in early atherosclerotic lesions , when the disease is still reversible . cells in fatty streaks have lipid deposits in small vacuoles in the cytoplasm [ 2729 ] . they subsequently become so - called foam cells [ 30 , 31 ] , and both cell types show a high expression of bax . therefore , although the increase in bax expression in our cells did not reach significance , it suggests that the lesion may still be in an early and reversible state , as are initial adaptive streaks in which bax is not detectable . in contrast , the bcl - xl / bax ratio increased in the smc - ch . the expression of bcl - xl has been reported in smcs from atherosclerotic plaques , and is believed to play the main role in preventing apoptosis in atherosclerosis . hence , it is thought to act largely in initial stages of atherosclerosis , in which proliferation must predominate . in fact , an increase in bcl - xl was observed in smc from the intima in early atherosclerotic lesions . other members of the bcl-2 family , for example , bak , are abundantly expressed in smcs from atherosclerotic plaques and tend to heterodimerize with bcl - xl . oxysterols , especially 25-hydroxycholesterol , can reduce the expression of bcl-2 y bcl - xl [ 3436 ] , activate bad , and increase the expression of genes that encode bh3-only proapoptotics , for example , bim , which in turn activates bax / bak . these actions appear to be mediated by the inhibition of akt survival kinases . beside the protein levels , we also studied the expression of genes of bcl-2 family that encode proteins implicated in apoptosis ( bcl-2 , bcl - xl ) , the amount of mrna of bcl-2 gene ( prototype of antiapoptotic genes ) remained unchanged in the smc - c and smc - ch , consistent with previous findings of no modifications in the expression of bcl-2 during atherosclerotic alterations [ 9 , 25 , 26 ] . however , the smc - ch - fo showed a slight increase in bcl-2 , which may imply some resistance to apoptotic stimuli . in fact , many genes involved in the response to oxidative stress , for example , nf-b survival factor genes , are activated by a fish oil - rich diet and are also involved in the regulation of bcl-2 [ 3840 ] . no major differences observed in baseline expression of the bcl - xl gene in the smc - c , smc - ch and smc - ch - fo cells , as also found for bcl-2 and protein levels . the bcl - xl gene is thought to play a critical role in the prevention of cell death in atherosclerotic plaques , and a reduction in bcl - xl expression levels may be a prerequisite for apoptotic induction . it has also been reported that the inhibition of nf-b ( activator of cell survival genes reduces the expression of bcl - xl , which makes the cells more susceptible to apoptosis ) . the increase in the mrna of bcl-2 to a greater degree in smc - ch than in smc - c may appear contradictory , since bcl-2 protein levels are known to be reduced by oxysterol treatment of the cells . however , this reduction is largely produced by dimerization of this protein with bax , which increases in the presence of oxysterols , as demonstrated by the results of our protein studies . the marked increase of the expression of bcl - xl in the three culture types after the addition of 25-hydroxycholesterol again appears contradictory because bcl - xl protein levels are reduced , which may be explained by the dimerization of bcl - xl with bax and especially with bak . the aortic arches of male chick were chosen for this study for two reasons : first , for the ability of chicks to absorb high amount of dietary cholesterol [ 14 , 42 ] ; and second , because intimal thickening in the aortas from these hypercholesterolemic chicks can be detected after only 20 days [ 43 , 44 ] . this short diet period is very convenient and contrasts with those reported for other experimental animal models , mainly non - human primates and rabbits , which must be a cholesterol - containing diet for between 1 and 18 months to obtain an atherosclerotic lesion . the short time of the chicken model is comparable with that necessary to induce mitotic activity in aortas of white carneau pigeons or swine . serum cholesterol levels observed in 10-day - old control chicks are normal because newly hatchet chicken reabsorb the yolk during the first week of live , thus developing hypercholesterolemia , which becomes almost three times higher in cholesterol - fed chicks . the significantly elevated cholesterol and triglyceride plasma levels are in accordance with previously reported plasma lipids levels . avian models were used in trials of atherosclerosis , and , in fact , cholesterol feeding has been described elsewhere as producing atherosclerotic lesions in fowl species . we have also used chicks previously to study lipids metabolism after cholesterol administration and to develop a cell - culture avian model to look into , in vitro , the effect of a cholesterol diet , in vivo , on the transformation of smc . thus , in our laboratory , we isolated smcs from cholesterol - fed chicks ( smc - ch cultures ) which are very proliferative in culture compared with smc isolated from control - fed chicks ( smc - c cultures ) , and with identical maintenance in culture of the two lines of smc . in this way , dna synthesis in the s phase was 4-fold higher and after 20 days of culture , smc - ch increased their cholesterol content to double that of smc - c , giving smc - ch cultures under conditions mimicking such a cholesterol diet and a very early atherosclerosis in vivo / in vitro model at the smc level . we have studied the cholesterol synthesis and hmg - coa reductase gene expression in these cultures , showing great differences between smc - c and smc - ch [ 50 , 51 ] . also we demonstrated the existence of cyclic fluctuations of hmg - coa reductase activity in nonsynchronized smc cultures not correlated to the cultured feeding and not with the increase of mrna , suggesting the posttranscriptional modulation of the hmg - coa reductase and the relationships between hmg - coa reductase activity and cell division . finally , we have examined the morphological , molecular , and proliferation change in arterial smc mimicking such a cholesterol diet . consequentially , this transformed smc is a good model to study the alterations of the differentiated state of smc , caused not only by cholesterol - rich diet but also by fish oil - rich diet as well as the apoptotic pathway induced by oxysteroid in smcs . in conclusion , we investigated the apoptotic pathway induced by oxysteroid in smcs isolated from male chicks exposed to a control diet ( smc - c ) and an atherogenic cholesterol - rich diet ( smc - ch ) or an antiatherogenic fish oil - rich diet ( smc - ch - fo ) . we found that 25-hydroxycholesterol - induced apoptosis in smcs , mediated by a high increase in bax protein and bax gene expression . these changes were more evident in smc isolated from chicks exposed to an atherogenic than to an antiatherogenic one . thus , we deducted that the replacement of a cholesterol - rich diet with a fish - oil rich diet might produce some reversal of cholesterol - induced changes in oxysterol - activated apoptotic pathway , making smc more resistant to apoptosis . moreover , high cholesterol diet and fish - oil rich diet in the animals , before obtaining the smcs cultures , induced changes in the apoptotic gene expression studied . thus , the mrna concentration was downregulated in smc - ch - fo versus smc - ch . since we reported previously that , the nutritional culture conditions , the intracellular cholesterol concentration , and the ultrastructural morphology were the same during the first days of cultures ; the change in gene expression must have been induced by the cholesterol or fish oil diet in the aortic smc in vivo . in this way , this in vivo / in vitro model is relevant to study the nutritional control and gene regulation of the differentiation and apoptosis in smc . new studies would be necessary to demonstrate the implication of the cell signalling pathways , as well as to show if new protein synthesis is required for the bax increase or if some peaks of gene expression correlate with other regulatory events .

smooth muscle cells ( smcs ) undergo changes related to proliferation and apoptosis in the physiological remodeling of vessels and in diseases such as atherosclerosis and restenosis . recent studies also have demonstrated the vascular cell proliferation and programmed cell death contribute to changes in vascular architecture in normal development and in disease . the present study was designed to investigate the apoptotic pathways induced by 25-hydroxycholesterol in smcs cultures , using an in vivo / in vitro cell model in which smcs were isolated and culture from chicken exposed to an atherogenic cholesterol - rich diet ( smc - ch ) and/or an antiatherogenic fish oil - rich diet ( smc - ch - fo ) . cells were exposed in vitro to 25-hydroxycholesterol to study levels of apoptosis and apoptotic proteins bcl-2 , bcl - xl and bax and the expression of bcl-2 and bcl - xl , genes . the quantitative real - time reverse transcriptase - polymerase chain reaction and the immunoblotting western blot analysis showed that 25-hydroxycholesterol produces apoptosis in smcs , mediated by a high increase in bax protein and bax gene expression . these changes were more marked in smc - ch than in smc - ch - fo , indicating that dietary cholesterol produces changes in smcs that make them more susceptible to 25-hydroxycholesterol - mediated apoptosis . our results suggest that the replacement of a cholesterol - rich diet with a fish oil - rich diet produces some reversal of cholesterol - induced changes in the apoptotic pathways induced by 25-hydroxycholesterol in smcs cultures , making smcs more resistant to apoptosis .

1. Introduction 2. Methods and Materials 3. Results 4. Discussion 5. Conclusion

functional mitral regurgitation ( mr ) is associated with exacerbation in clinical symptoms and poor prognosis and probably induces additional adverse ventricular remodeling through volume overload in heart failure patients . several competing geometric and hemodynamic factors such as abnormalities in the left ventricular ( lv ) volumes , function , and shape as well as the lv dyssynchrony and the qrs duration are among the suggested contributing mechanisms for determining the severity of functional mr in heart failure patients . there is some evidence that this relationship may vary in patients with idiopathic ( dcm ) and ischemic ( icm ) dilated cardiomyopathy . on these grounds , the aim of the present study was to examine the relationships between the severity of functional mr and the qrs duration and intra- and interventricular dyssynchrony in a group of patients with cardiomyopathy and investigate the effect of the etiology of cardiomyopathy in this regard . between january 2007 and march 2010 , we prospectively evaluated 251 heart failure patients ( 74.5% male , mean age = 53.38 16.68 years ) with indications for cardiac resynchronization therapy who were referred to one of the echocardiography clinics in tehran heart center , tehran , iran , for a pre - procedural echocardiographic evaluation . the inclusion criteria were comprised of the new york heart association ( nyha ) classes ii iii , refractory heart failure , and lv ejection fraction ( lvef ) 35% . all the patients underwent complete resting conventional echocardiography and tissue doppler imaging ( tdi ) for the evaluation of the extent of the lv dyssynchrony . the etiology was diagnosed as ischemia if the patients had either evidence of previous myocardial infarction or angiographic evidence of significant coronary artery disease ( at least narrowing 50% in one epicardial coronary artery ) with corresponding wall motion abnormality . standard twelve - lead electrograms were acquired at a paper speed of 25 mm / s and a scale of 10 mm / mv . the measurement of the qrs duration ( recorded from the surface leads , demonstrating the greatest values ) was performed by an experienced observer . conventional echocardiographic studies , comprising complete two - dimensional ( 2d ) transthoracic echocardiography , m - mode , pulsed , and continuous - wave doppler with color - flow imaging , were performed using a commercially available ultrasonographic system ( vivid 7 , vingmed ge , horten , norway with a 3.5-mhz transducer ) . the severity of mr was graded on a four - point scale : i ( mild ) , jet area / la area < 15% ; ii ( moderate ) , jet area / la area = 1530% ; iii ( moderately severe ) , jet area / la area = 3550% ; and iv ( severe ) , jet area / la area > 50 . the lv end - diastolic and end - systolic volumes ( bi - plane simpson disc method ) and diameters were measured . efforts were made to record the apical four - chamber view in inspiration to optimize long - axis measurement . the lv wall motion score index ( wmsi ) was calculated as the mean score in a sixteen - segment model of the lv using 2d images , in which each segment was given a score in the range 14 , using 1 = normal wall motion , 2 = hypokinetic wall motion , 3 = akinetic , and 4 = paradoxical wall motion ( dyskinesia ) . tdi systolic synchronicity was performed according to the american society of echocardiography ( ase ) expert consensus statement for echocardiography for cardiac resynchronization therapy and was assessed via tdi using the apical views ( four - chamber , two - chamber , and long - axis ) of the lv as was previously described with adjustments of the filter frequency , gain settings , pulse repetition frequency , and color saturation . at least three consecutive beats were stored , and the images were digitally stored for off - line analysis . the following twelve segments were interrogated : septal ; lateral ; anterior ; inferior ; anteroseptal ; and posterior walls at both basal and middle levels . the timing of the systolic events was evaluated by measuring tdi in each lv segment with reference to the onset of the qrs complex . myocardial velocity curves were constructed with the tdi images simultaneously , when necessary , to confirm the pattern of myocardial motion . the time - to - peak systolic velocity ( ts ) and the time from the onset of the qrs complex to the maximum positive velocity during the ejection period were measured . if a positive velocity was not observed , the segment was excluded from the study . if there were multiple peaks in the ejection period with the same velocity , the earliest peak was chosen . the definitions of the dyssynchrony indices measured in this study were reported in detail in our previous study . in summary , the interventricular dyssynchrony was assessed by measuring the opening and closing times of the aortic and pulmonic valves using the systolic blood flow by pulsed doppler , with the sample volume placed at the level of the aortic and pulmonic annulus . the aortic pre - ejection time was measured from the beginning of the qrs complex to the beginning of the aortic flow velocity curve recorded by pulsed - wave doppler in the apical view . similarly , the pulmonary pre - ejection time was measured from the beginning of the qrs complex to the beginning of the pulmonary flow velocity curve recorded in the left parasternal short - axis view . cardiac synchronicity was assessed through the measurements of time intervals , obtained in twelve lv segments . the following intraventricular indices were calculated : all segments delay ( ts - all - delay ) : delay between the shortest and longest ts in twelve lv segmentsbasal segments delay ( ts - basal - delay ) : delay between the shortest and longest ts in lv basal segmentsall segments standard deviation ( ts - all - sd ) : sd of the time - to - peak myocardial systolic velocity of twelve lv basal and mid segmentsbasal segments sd : ( ts - basal - sd ) sd of the time - to - peak myocardial systolic velocity of six lv basal segmentsmid- and basal - septal - lateral delay : the maximum delay between the peak systolic velocities between the septum and the lateral wall in the mid and basal levelsmid- and basal - anteroseptal - posterior delay : the maximum delay between the peak systolic velocities between the anteroseptal and the posterior walls in the mid and basal levelsmid- and basal - anterior - inferior delay : the maximum delay between the peak systolic velocities between the anterior and the inferior walls in the mid and basal levelsmid- and basal - septal - posterior delay : the maximum delay between the peak systolic velocities between the septum and the posterior wall in the mid and basal levels . all segments delay ( ts - all - delay ) : delay between the shortest and longest ts in twelve lv segments basal segments delay ( ts - basal - delay ) : delay between the shortest and longest ts in lv basal segments all segments standard deviation ( ts - all - sd ) : sd of the time - to - peak myocardial systolic velocity of twelve lv basal and mid segments basal segments sd : ( ts - basal - sd ) sd of the time - to - peak myocardial systolic velocity of six lv basal segments mid- and basal - septal - lateral delay : the maximum delay between the peak systolic velocities between the septum and the lateral wall in the mid and basal levels mid- and basal - anteroseptal - posterior delay : the maximum delay between the peak systolic velocities between the anteroseptal and the posterior walls in the mid and basal levels mid- and basal - anterior - inferior delay : the maximum delay between the peak systolic velocities between the anterior and the inferior walls in the mid and basal levels mid- and basal - septal - posterior delay : the maximum delay between the peak systolic velocities between the septum and the posterior wall in the mid and basal levels . because of the importance of the four anterior , lateral , inferior , and posterior lv walls in supporting the papillary muscle attachment , we included the delay between the shortest and longest ts in these eight lv segments ( ts - eight segments delay ) and the sd of the ts in eight segments ( ts - eight segments sd ) in the anterior , lateral , inferior , and posterior walls at both basal and mid - levels . for these analyses , the normality of the residue hypothesis was tested using the kolmogorov the chi - squared or the fisher exact test was employed to compare the proportions . the continuous variables were compared using the two - tailed student t - test for the parametric and the mann - whitney test for the nonparametric variables as appropriate quantitative variables . then , in a multiple logistic regression analysis , the effect of the dyssynchrony indices on the mr severity was explored by adjusting for potential confounders ( using enter method ) . a p value < 0.2 was used first to identify the confounder variables and subsequently enter the variables into the analysis . data analysis was conducted utilizing the spss ( version 18.0 ) statistical software ( spss inc . , the mean width of the qrs was 146.54 34.62 ms for all the patients , and 76.9% of the patients had surface electrocardiography evidence of a prolonged qrs complex ( 120 ms ) . the degree of mr ranged widely : 130 ( 51.8% ) patients had mild mr and 121 ( 48.2% ) had moderate mr . the etiology of the lv dysfunction was ischemic in 108 ( 43% ) patients and idiopathic in 143 ( 57% ) patients . comparison of the clinical and echocardiographic characteristics between the study groups data are presented as meansd or n ( % ) mr , mitral regurgitation according to table 1 , the patients with significant mr were younger than the other group , although the difference was non - significant . the lvef was significantly lower in the patients with significant mr than in those with no mr or mild mr . the lv systolic and diastolic dimensions and volume and the lv wmsi were higher in the patients with significant mr . for the calculation of the dyssynchrony indices , a total of 3012 segments ( 12 segments per patient ) time - to - peak systolic velocity was not measurable in eight segments ( one in each anterior , inferior , and posterior basal segment ; one in each anterior , inferior , and posterior segment ; and two in the anteroseptal basal segments ) . in table 2 , the dyssynchrony indices are compared between the patients with and without significant mr . according to table 2 , no differences were observed in the mean value of the various dyssynchrony parameters between the two groups . the difference of the mean qrs duration , ivmd , and ts - basal - sd were in the significant level and needed further adjustment to determine any independent effect of these parameters on the severity of mr . comparison of dyssynchrony markers between the study groups all variables are presented as meansd in milliseconds ts , time - to - peak systolic velocity ; sd , standard deviation using multivariate analysis the relationships between the mr severity and the qrs duration and the dyssynchrony indices , including ivmd and ts - basal - sd , were adjusted for potential confounders ( age , wmsi , and lv end - systolic volume ) . after adjustment , there was no significant impact of the qrs , ivmd , and ts - basal - sd on the severity of mr ( table 3 ) . effect of unadjusted and adjusted association between qrs and dyssynchrony indices and severity of mitral regurgitation in cardiomyopathy patients ( n=251 ) adjustments were performed for age , wall motion score index , and left ventricular end - systolic volume . this study demonstrates that the severity of mr was not correlated with the qrs duration , the intra- and interventricular dyssynchrony indices by echocardiography in the patients with ischemic or dilated cardiomyopathy . it has been described that intraventricular mechanical dyssynchrony is an important contributor to functional mr . studied 32 patients with dilated cardiomyopathy and showed that the presence of functional mr correlated with a significant delay in mechanical activity between the lv segments supporting the lateral and medial papillary muscles , as assessed by the difference in the time - to - peak systolic myocardial strain . showed that the degree of mr was associated mainly with the mitral deformation indices and reported that the regional dyssynchrony also had an independent association with the degree of mr , with a minor influence in patients with dcm but not in those with icm , which is in line with the present study . they also found that the qrs duration had no effect on the severity of functional mr . in the most recent study , liang et al . demonstrated that in patients with lv systolic dysfunction , significant functional mr was determined not only by the mitral valve tenting area , but also by the degree of the global lv systolic dyssynchrony . the difference between the studies is possibly due to the difference in the definition of lv dyssynchrony . lv dyssynchrony was defined as the difference in the time - to - peak systolic myocardial strain by soyama et al . and as the sd of time - to - peak systolic velocity of 8 ( not 12 ) lv segments by agricola et al . elsewhere , liang et al . defined dyssynchrony as delay of time - to - peak systolic velocity of twelve lv segments ( one of the dyssynchrony indices in our study ) . finally , our study demonstrated that none of the previously defined dyssynchrony indices were associated with the degree of mr . study , using regional strain analysis in 87 patients with dcm , demonstrated that the degree of functional mr was determined not only by the mitral orifice characteristics but also by the lv characteristics , especially longitudinal contractility ( strain of lv mid - lateral wall ) and dyssynchrony defined as the time delay between the septal and lateral mid - portion strain divided by rr squared root . in line with our study , the authors found that mr was not correlated with interventricular mechanical delay and pre - ejection period of the aortic valve . in the present study , the patients with a higher degree of functional mr had a greater lv diameter and volumes , which chimes in with a previous description that in patients with the lv dilatation , the papillary muscles are displaced toward the apex , thereby restricting the ability of the mitral leaflets to close through tethering forces and leading to incomplete leaflet coaptation and mr . evaluated 74 patients with chronic lv dysfunction ( 53% ischemic etiology ) with varying degrees of mr and suggested that systolic mitral valvular tenting was the major determinant of functional mr , which is directly determined by local ( regional wmsi ) and global lv remodeling . we also observed that in our population , including 43% with icm , the regional wmsi was significantly higher in the patients with significant mr . in daily practice , the physician s knowledge about factors with a significant contribution to the mr severity in heart failure patients may help to apply a more accurate treatment protocol for such patients . although previous studies have shown the favorable effects of cardiac resynchronization therapy ( crt ) on the reduction of the mr severity , future studies in this regard may make clear conclusions as to whether the echocardiographic dyssynchrony indices can explain the severity of mr in heart failure patients and also whether the normalization of these indices after crt can reduce the severity of mr . one possible limitation of our study is that the evaluation of strain and time - to - peak systolic strain parameters was not performed , which might have conferred a more precise evaluation of the lv myocardial dyssynchrony . another limitation is that the design of this study did not allow us to examine whether the mi site influences the relationship between the severity of mr and the presence of dyssynchrony among patients with icm . however , we explored the influence of the territory of the involved coronary artery on the mr severity in our recent study and found no difference in the mr severity in the patients with different degrees of coronary involvement and different infarction sites . in the light of the results of the present study , the degree of functional mr , adjusted for the lv regional and global remodeling indices , is not associated with the qrs duration and inter- and intraventricular dyssynchrony indices in patients with icm or dcm . the impact of the etiology of cardiomyopathy on the severity of mr was not significant .

abstractbackground : several competing geometric and hemodynamic factors are suggested as contributing mechanisms for functional mitral regurgitation ( mr ) in heart failure patients . we aimed to study the relationships between the severity of mr and the qrs duration and dyssynchrony markers in patients with ischemic or dilated cardiomyopathy.methods:we prospectively evaluated 251 heart failure patients with indications for echocardiographic evaluation of possible cardiac resynchronization therapy . all the patients were subjected to transthoracic echocardiography and tissue doppler imaging to evaluate the left ventricular ( lv ) synchronicity . the patients were divided into two groups according to the severity of mr : mild mr and moderate mr . the effects of different dyssynchrony indices were adjusted for global and regional left ventricular remodeling parameters.results:from the 251 patients ( 74.5% male , mean age = 53.38 16.68 years ) , 130 had mild mr and 121 had moderate mr . there were no differences between the groups regarding the mean age , frequency of sex , and etiology of cardiomyopathy . the lv systolic and diastolic dimensions were greater in the patients with moderate mr ( all p values < 0.001 ) . among the different echocardiographic factors , the qrs duration ( 150.75 34.66 vs. 126.77 29.044 ms ; p value = 0.050 ) and interventricular mechanical delay ( 41.60 29.50 vs. 35.00 ms 22.01 ; p value = 0.045 ) were significantly longer in the patients with mild mr in the univariate analysis . after adjusting the effect of these parameters on the severity of mr for the regional and global lv remodeling parameters , no significant impact of the qrs duration and dyssynchrony indices was observed.conclusion:our results showed that the degree of functional mr was not associated with the qrs duration and inter- and intraventricular dyssynchrony in our patients with cardiomyopathy . no association was found between the severity of mr and the ischemic or dilated etiology for cardiomyopathy .

Introduction Methods Results Discussion Conclusions

breslau and associates estimated the lifetime prevalence of physical assault in the united states to be 8.3% for both genders . other studies have reported lifetime rates of physical assault from 7% to 12% for women and from 10% to 19% in males.[25 ] although the risk for assault exists in all ethnic , racial , and socioeconomic classes , certain demographic groups experience disproportionate rates of physical violence . several studies show racial disparities exist among victims of assault.[246 ] amstadter and associates showed african americans were two - fold as likely to have experienced a new physical assault compared to their caucasian counterparts . other studies have confirmed the finding that african americans are at the greatest risk of violence . in his assessment of lifetime rates of violence among men and women , kilpatrick et al . found 28% of african americans reported that they had been assault victims , compared with 19% of caucasians . low income is also reported as a predictive factor for assault . a study of income and risk of assault by kessler et al . , found persons of both sexes with annual household incomes below $ 15,000 are one and a half times more likely to be physically assaulted as persons with annual household incomes above $ 15,000 . the inverse relationship between socioeconomic status and susceptibility to assault was confirmed again in a study in milwaukee , wisconsin study adolescent assault victims which found subjects with lower median household incomes experienced higher rates of interpersonal violence . the costs of nonfatal physical assault are significant and entail more than simply the physical injury sustained by the victim . victims of violent assault also experience psychological injury , lost productivity from missed work and school days , and loss of quality of life due to pain and suffering . lifetime costs for intentional injury for patients twelve and older were estimated at $ 187 billion during the period from 1987 - 1990 , with $ 96 billion dollars attributed to injury from assault . the estimate $ 96 billion dollar cost associated with injury from assault included approximately $ 8 billion dollars for medical costs , $ 53 billion for mental health care costs and $ 35 billion for lost quality of life . this breaks down to a per physical injury cost for assault victims of $ 22,000 . although racial and socioeconomic disparities and the costs of these disparities to assault victims is well documented , the predictive factors that lead to these disparities in female assault victims remains an open area of research . the interplay between the identified predictors of assault and their combined contribution to violent victimization in women is better elucidated . existing literature fails to show the influence that one predictor of assault has on the co - existence of other predictors of assault . this interplay suggests that even though individual risk factors may increase the likelihood of assault , the combination of multiple risk factors , creates a susceptible patient population that is significantly more likely to experience assault . the identification of this interaction between two different risk factors could be useful to select a population more susceptible to the risk for assault and trauma than any other individual risk factor alone would be able to predict . selecting for a susceptible population would allow public health efforts to be focused appropriately on the highest risk population . additionally , existing literature largely draws conclusions from all emergency room visits and fails to specifically analyze " severe assaults , " or assaults serious enough in nature to necessitate trauma activation . the purpose of this study is to determine predictors of assault and predictors of high - risk behaviors in women who sustain injuries significant enough to require state of illinois trauma activation . identifying the predictive factors that make women a susceptible population to assault requiring trauma activation will help inform injury prevention efforts and ideally lead to a reduction in violent victimization among women . to identify both predictors of severe assault and the high - risk behaviors of severely assaulted women , a retrospective analysis of all female trauma patients was performed using the illinois department of public health trauma registry . the registry is a state - wide , mandatory reporting system that contains de - identified information for all trauma patients from all trauma centers in illinois . permission to use the database was obtained from the illinois department of public health and this study was approved by the university institutional review board . for the period 1999 - 2003 , all female trauma patients aged 15 - 50 were identified . the following e - codes for assault were used to identify the female victims : 960 ( 0.0 - 0.1 ) , 961 , 962 ( 0.0 - 0.9 ) , 963 - 964 , 965 ( 0.0 - 0.9 ) , 966 , 967 ( 0.0 - 0.9 ) , 968 ( 0.0 - 0.9 ) and victims of gunshot and stabbing wounds were included in this group . the remaining women ( n = 23,841 ) who had other , non - assault mechanisms of injury served as the control group . demographic data was collected on both the study and control groups to include age , race , pregnancy status , alcohol and drug use , insurance status , residence in a rural area [ table 1 ] . drug use was based on the presence of one or more of the following seven substances : amphetamine , barbiturates , benzodiazepines , cocaine , marijuana , opiates , and phencyclidine . patients were considered uninsured if they had medicaid or were listed as having no insurance . medicaid patients were considered uninsured because many of these patients entered the hospital without insurance and were enrolled in medicaid only during their hospital stay . chicago , springfield , and east saint louis are considered urban ; all other areas fall under the rural category . demographic characteristics and predictors of assault in female trauma victims by mechanism of injury data a logistic regression model was used to compare the two groups of female victims ( those who were assaulted against those who had other mechanisms of injury ) on variables including age , race , pregnancy status , alcohol and drug use , rural residence and lack of insurance , in order to identify factors predictive of assault and high - risk behaviors . once factors predictive of assault were identified , a separate analysis was conducted to study interaction affects among these identified risk factors . this additional analysis examined the combined effect of the identified predictors of assault on end outcome- all possible variations of combined risk factors were studied . in a retrospective review of all trauma patients from all trauma centers in the state of illinois for the time period 1999 - 2003 , 26,602 female victims were identified . of these 26,602 female victims , 2,761 ( 10.4% ) reported assault as their mechanism of injury , and the remaining 23,841 women had other listed mechanisms of injury . in comparing the two groups , the age distribution in the assaulted women group was younger than in the other mechanism of injury group . about 53.4% of the assaulted women group was in the ages 15 - 30 , while in the other mechanism of injury group , only 48.1% fell in this age range . in regards to race , 75.6% of assaults were against non - white women , in contrast to the female victims of non - assaultive traumas , of whom only 35.6% were non - white . this disparity was largely due to the significant percentage ( 64.3% ) of assaulted women who were of african american descent . other races did not factor significantly in the racial disparity between the assaulted and other mechanism of injury groups , largely due to small total numbers in the study population . in addition to being non - white , women who were assaulted were also more likely to use alcohol ( 54.7% versus 39.6% ) and drugs ( 25.0% versus 16.2% , p < 0.001 ) than women in the other mechanisms of injury group [ table 1 ] . after comparing demographic differences between female trauma victims who were assaulted and female trauma victims who reported other mechanisms of injury , attention turned to identifying specific predictors of assault among the female assault victims . on multivariate regression analysis , three variables were noted to be independent predictors of assault in the female victims including african american race ( or 3.88 , p < 0.001 ) , lack of insurance ( or 1.79 , p < 0.001 ) , and drug use ( or 1.32 , p < 0.001 ) [ table 2 ] . age under 30 also predicted assault ( or = 1.17 , p < 0.001 ) . neither pregnancy nor rural residence appeared to play a role in female victims likelihood of being assaulted . predictors of assault in women in this data set , female victims with one identified predictor of assault often exhibited other predictive factors for assault . multivariate analysis to predict the likelihood of certain risk factors among female assault victims was undertaken . in table 3 the data shows assaulted women who use alcohol are also significantly more likely to be uninsured ( or 3.5 , p < 0.001 ) and also more likely to use drugs ( or = 1.7 , p < 0.001 ) . predictors of alcohol use in female assault victims these findings were confirmed again when predictors of drug use and uninsured status were analyzed individually . female assault victims who used drugs were also more likely to be uninsured ( or = 1.8 , p < 0.001 ) and to use alcohol ( or = 1.7 , p < 0.001 ) . african - american race also appeared to be more prevalent among female assault victims who used drugs ( or = 1.5 , p = 0.009 ) . in contrast , neither latina race nor age appeared statistically significant predictors of drug use in female assault victims [ table 4 ] . predictors of drug use in female assault victims predictors of uninsured status in female assault victims included african american race ( or 4.6 , p < 0.001 ) , alcohol use ( or 3.3 , p < 0.001 ) and drug use ( or 1.7 , p < 0.001 ) . additionally , latina race was also a statistically significant predictor of being uninsured for female trauma patients who reported assault as their mechanism of injury [ table 5 ] . predictors of uninsured status in female assault victims clearly , female assault victims often exhibit more than one high - risk behavior or risk factor for assault . these risk factors may not just exist in tandem but may also interact to exert a shared and therefore increased influence on the overall susceptibility of female victims to assault . the combined influence , or interaction affects , of these risk factors on violent victimization was tested in a regression analysis [ table 6 ] . the regression model showed that drug use and being uninsured had a combined effect of predicting assault ( or 1.67 , p < 0.02 ) . characteristics of female assault victims and predictors of physical assault in female trauma patients were examined in this study . the study showed women of african - american race , women without insurance , and women who used alcohol and/or drugs are disproportionately represented among assault victims . a significant finding of this study was that female assault victims with one predictor of assault were more likely to have multiple predictors of assault and when drug use is combined with lack of insurance the likelihood of being assaulted increases . while there are known disparities in trauma , this paper highlights the interaction between these risk factors , which has not previously been studied in this patient population . lack of insurance and drug abuse are more frequent among people with low socioeconomic status , however , having both of these factors increase the risk more that each individual factor would predict . therefore , this susceptible population bears more of the risk for assault and trauma than any individual risk factor would predict . this underscores the observation that there are racial and socioeconomic disparities with respect to violent victimization , and makes an argument for specific interventions to this high risk population . this study demonstrates that predictors of assault in women frequently coexist and both independently and in combination may increase risk . one possibility is that one of the predictors of assault identified in this study , for example , lack of insurance , is the unifying link that increases the likelihood of a victim exhibiting all other predictors of assault . another possibility is that an unnamed risk factor such as poverty or education level is the link that explains the co - existence of all of these high - risk taking behaviors in one setting . there is also the possibility that the temporal order between victimization and the identified predictors of assault is inverse to what is interpreted in this paper . that is , instead of drug use and lack of insurance being factors predicting the likelihood of women to experience assault , females may be more likely to use drugs and alcohol and not have insurance precisely because they have been assaulted . the significance of the co - existence of multiple predictors of assaults in female victims is relevant both to the understanding of what leads to gender - based violent victimization and how healthcare providers and society can most effectively intervene . however , this study is not without limitations , including defining a rural / urban dichotomy on the basis of population , without considering boundaries or suburbs , and possible lack of generalizability as this study is restricted to urban patients from a single state in the u.s . it also would have been beneficial to have data on a wider range of predictors of assault including socioeconomic status , education level , u.s . despite its limitations , this is a powerful study that demonstrates the interdependence of risk factors for assault in a population - based sample of women in a large midwestern state . this study helps us gain an understanding of how predictors of assault in female victims interact and lead to an increase susceptibility to violent victimization . although there is no acceptable justification for violence against women , understanding the factors that predict assault in women can serve as a way to increase awareness of the victimization of women and to help better direct intervention and prevention efforts , especially in areas such as multimodality drug or treatment programs or comprehensive domestic violence shelters offering drug and alcohol services . future research should also be directed at identifying protective factors against female violent victimization , which remains a yet unexplored area of study .

background : assault is a common mechanism of injury among female trauma victims . this paper identifies risk factors for assault in female victims and explores the interplay between identified predictors of assault and their combined contribution to female violent victimization.materials and methods : a retrospective analysis of all female trauma patients was performed using the illinois department of public health trauma registry from 1999 - 2003 . patients with assault listed as their mechanism of injury were compared to patients with other mechanisms of injury . bivariate and multivariate analyses were performed using stata statistical software to identify independent risk factors for assault . finally , interaction affects were studied among these identified risk factors.results:female victims of assault were more likely to be african american ( or 1.32 , p < 0.001 ) , lack insurance ( or 1.79 , p < 0.001 ) , and to have tested positive for drugs ( or 1.32 , p < 0.001 ) than women with other mechanisms of injury . in addition to the independent effects of these variables , patient drug use and lack of insurance demonstrated interaction effects ( or 1.67 , p = 0.02).conclusion : in this study , women of color , the uninsured , and those using drugs were disproportionately represented among assault victims , highlighting further evidence of trauma disparities . most significantly , this study demonstrates that predictors of assault in women frequently coexist and both independently and in combination may increase the risk for female violent victimization .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION

takotsubo cardiomyopathy ( tc ) , also called stress cardiomyopathy or apical ballooning syndrome , is a syndrome of reversible stress - induced cardiomyopathy associated with profound emotional or physical stress . tc is characterized by transient left ventricular ( lv ) dysfunction with ischemia - like chest pain and ischemia - like electrocardiographic ( ecg ) changes and lack of any obstructive epicardial coronary artery disease observed at the time of emergent coronary angiography . lv wall motion abnormalities usually involve apical and/or midventricular myocardial segments with wall motion abnormalities extending beyond a single epicardial coronary distribution . although several pathological mechanisms have been proposed , the precise pathophysiology of tc is still not entirely understood . we present a case with lung adenocarcinoma whose initial hospital admission was due to tc . a 59 year - old man without any history of cardiovascular disease was admitted to emergency service with the complaint of chest and back pain . ecg revealed sinus rhythm with a rate of 70/min , 2 - 3 mm st elevations in v2 and v6 [ figure 1 ] . he was on antihypertensive medication and smokes 20 cigarettes per day for more than 20 years . he was immediately taken into the cardiac catheterization laboratory with the diagnosis of acute anterior myocardial infarction . transthoracic echocardiography demonstrated apical akinesia with a dynamic lv outflow tract obstruction ( peak resting gradient : 45 mmhg , peak gradient reaches to 177 mmhg and mean gradient to 81 mmhg with valsalva maneuver ) [ figure 3 ] . st elevations returned towards baseline and his complaints were improved progressively with medical treatment , which included antiplatelet agents and anticoagulation , beta adrenergic receptor blocker and renin - angiotensin system blocker agents . twelve - lead electrocardiography samples of patient obtained at admission ( a ) and 2 days later ( b ) coronary angiography and left ventriculography of the patient transthoracic echocardiography images of the patient demonstrating left ventricular systolic apical ballooning ( arrows ) and left ventricular outflow tract obstruction patient had a cachectic appearance and had complaints of backache and dysphagia with weight loss of 25 kg during the last 12 months . endoscopic examination revealed esophageal obstruction due to external compression . computed tomography scan of the chest revealed a mass with 5 x 2.5 cm diameter at the level of right pulmonary upper lobe on the posterior segment , extending from retrotracheal to paravertebral space with bone invasion . fine needle aspiration biopsy obtained from mass showed neoplastic cells and immunohistochemical analysis demonstrated that these cells were reactive with ck7 , ck20 , and ttf-1 antibodies . he was diagnosed with lung adenocarcinoma and whole body positron emission tomography ( pet ) demonstrated hypermetabolic subcarinal and paraosephageal lymphadenopathies and lytic / sclerotic lesions on thoracic vertebral bodies ( t 3 - 4 - 5 ) and right sided ribs ( from 4 to 9 ) , which were accepted as metastases . repeat transthoracic echocardiogram performed 10 days after admission revealed complete resolution of lv systolic dysfunction and disappearance of lv outflow gradient [ figure 4 ] . tc usually mimics acute coronary syndrome and the most common abnormalities on the ecg are st elevations on the precordial on the precordial leads . usually there is only a moderate rise in cardiac enzymes which is disproportionate with the size of the affected myocardium . dynamic lv outflow tract ( lvot ) obstruction may occur in up to a fourth of tc subjects . basal hypercontractility related venturi effect has been suggested as a cause of dynamic lvot obstruction . tc is a transient syndrome and resolution of symptoms with complete echocardiographic and clinical recovery is expected within 2 to 3 weeks of presentation . our patient had complete recovery of cardiac symptoms and echocardiography performed 10 days after presentation revealed complete resolution of both wall motion abnormalities and dynamic lvot obstruction . several pathophysiological mechanisms have been suggested for tc among them coronary artery vasospasm , coronary microcirculation dysfunction , and catecholamine overload . exposure to emotional or physical stress and increased sympathetic activity has been reported in most cases of tc . excessive catecholamine production in patients with pheochromocytoma has also been shown to induce reversible lv dysfunction . prognosis of tc seems favorable in the absence of significant underlying co - morbid conditions . however , a high rate of concomitant malignancies were reported in a prospective tc registry and burgdorf- et al . they evaluated 50 patients with tc and 50 age- and gender- matched control patients with acute anterior myocardial infarction ( mi ) . they reported that 9 patients with tc ( 18% ) and 3 patients with mi ( 6% ) had a previous history of malignancy at the time of the index event . on follow - up , 7 malignancies were newly diagnosed in the tc group , whereas no new case of malignancy was found in the control group . these observations have suggested a possible association between malignancies and tc , which may be a result of paraneoplastic phenomena . a variety of malignancies were observed in patients with tc in their study , such as bronchial carcinoma , colorectal carcinoma , breast carcinoma , endometrial carcinoma , melanoma , bladder urothelial carcinoma , gastric carcinoma , and chronic lymphocytic leukemia . on the basis of these observations , burgdorf et al . suggested to perform cancer screening in patients with tc . to the best of our knowledge , our patient had bone metastases causing backache and had complaints of dysphagia with weight loss of 25 kg during the past 12 months , which might also have constituted sufficient physical stress for the development of tc . we contribute this case report to the growing set of literature data regarding the presence of various concomitant malignancies in patients with tc .

takotsubo cardiomyopathy ( tc ) is a rare and usually physical or emotional stress - induced clinical disorder characterized by transient left ventricular dysfunction and apical segment ballooning . much is still unknown regarding risk factors and clinical relationships . recently , an association between tc and malignancies has been proposed . we present a case of lung adenocarcinoma whose initial hospital admission was due to tc . we contribute this case report to the growing set of literature on the association between tc and malignancies .

INTRODUCTION CASE REPORT DISCUSSION CONCLUSION

subarachnoid hemorrhage ( sah ) is one of the most common radiological features of traumatic brain injury ( tbi ) occurring in 30%40% of moderate severe head injuries . vasospasm and resulting cerebral ischemia as well as cerebral hyperemia can cause delayed neurological recovery and poor outcome . a 56-year - old male suffered a moderate head injury following an alleged road traffic accident and presented to the neuro intensive care unit with a glasgow coma scale ( gcs ) score of 11/15 . the computerized tomography ( ct ) scan of brain showed bilateral frontal and right temporal contusion with left sylvian and temporal sah . he was treated with antiedema measures , namely , mannitol 1 g / kg and hypertonic saline ( 3% ) at 30 ml / h infusion . ct scan was repeated when gcs did not improve after 48 h. it showed a relative decrease in cerebral edema compared to the earlier scan . in view of this , antiedema measures were continued for further 2 days . however , there was no improvement in gcs . a transcranial doppler ( tcd ) done at this time was suggestive of cerebral hyperemia [ figure 1 ] with a lindegaard ratio ( lr ) of 4 . the possibility of vasospasm in view of traumatic sah was ruled out with a normal digital subtraction angiography ( dsa ) [ figure 2 ] done on the 5 posttrauma day . conservative management was continued and the patient started improving clinically to gcs score of 13/15 on day 7 . transcranial doppler flow with hyperemia of brain angiographic image of bilateral internal carotid arteries ruling out vasospasm transcranial doppler flow when hyperemia reduced tcd can be an important bedside tool in the management of head injury . in patients with unanticipated delay in improvement of gcs , tcd can play a vital role . the lr calculated as the ratio of mean flow of middle cerebral artery ( mca ) and mean flow of extracranial internal carotid artery helps diagnose or rule out vasospasm as a cause . the mean flow velocities of mca coupled with lr differentiates vasospasm from hyperemia [ table 1 ] . transcranial doppler grading criteria for middle cerebral artery vasospasm as in our case with lr of 4 , a definitive dsa was needed to rule out vasospasm . the significance of hyperemia on the management and clinical outcome of tbi is still unknown . the effect of hyperemia on intracranial pressure ( icp ) is a key to predicting clinical outcome . found hyperemia associated with raised icp to be a predictor of poor outcome and needing aggressive treatment while mild hyperemia without raised icp was linked to favorable outcome . in our case , also , mild moderate hyperemia suggested by lr of 4 and pulsatility index of 0.8 relating to low icp had a good outcome . the doppler waveform suggestive of hyperemia was described by chan et al . as an absent diastolic notch similar to our recording . the clinical implications of the above - mentioned findings are of uncertain significance . however , as observed in our patient , the resolution of hyperemia coincided with clinical improvement and may just be the temporal profile of the injury . the popularity of tcd as a bedside tool is hampered by the limitation that it is extremely operator dependent . the angle of insonation and detailed knowledge of cerebral vascular anatomy and its variant limits the interpretation . this case report highlights the importance of evaluating with tcd for an unexplained persistent low gcs . cerebral hyperemia may be one of the causes of nonimproving gcs in the early phases of tbi . once diagnosed , this entity may not need any further treatment other than close neurological observation .

subarachnoid hemorrhage is a common manifestation of traumatic brain injury . a clinical deterioration in glasgow coma scale score without an accompanying radiological worsening is suggestive of vasospasm . however , hyperemia could be another possibility which can easily be considered with corroborating transcranial doppler ( tcd ) features . this case report reiterates the value of tcd in such instances .

I C D C Financial support and sponsorship Conflicts of interest

intestinal inflammatory diseases are a serious problem in human as well as veterinary medicine . the etiology of these diseases is often multifactorial and the underlying molecular mechanisms are poorly understood . the current medicinal therapies for inflammatory gut diseases involve treatment with nonsteroidal anti - inflammatory drugs , antibiotics , corticosteroids , and immunosuppressant , but the application of these drugs is limited due to their toxicity and side effects . therefore , there is an increased interest in finding an alternative treatment with fewer side effects . there is evidence supporting the therapeutic usefulness of oral administration of various plant extracts in inflammatory diseases of the gut . experimental data obtained in mouse and rat models of colitis suggest that the beneficial effects of the plant extracts could be mediated by their effects on mucosal cytokines production or / and action [ 39 ] . increased levels of proinflammatory cytokines [ il-1 , il-6 , il-8 , tnf , il-12 , and ifn ] were found in inflamed intestinal mucosa in various animal models and humans [ 1013 ] , as well as in farm animals [ 14 , 15 ] . thyme ( thymus vulgaris l. ) and oregano ( origanum vulgare l. ) are aromatic plants of the mediterranean flora commonly used as spices and for medicinal purposes . like other various thymus species , furthermore , thyme possesses antimicrobial , antifungal , antioxidative , and antiviral properties [ 1619 ] . the essential oil derived from thyme ( t. vulgaris l. ) is a mixture of monoterpenes and one of the main compounds of this oil is a natural terpenoid thymol . thymol exhibits multiple biological activities including anti - inflammatory , immunomodulating , antioxidant , antibacterial [ 24 , 25 ] , antifungal , and free radical scavenging properties . oregano is recognized for its potential therapeutic role because of its diaphoretic , carminative , antispasmodic , antiseptic , and tonic properties . oregano , ( origanum syriacum l. ) similar to thyme , evinces antioxidant and antimicrobial activities and some reports deal with its antimutagenic and anticarcinogenic effects . origanum essential oil is obtained by steam distillation of o. vulgare and its major compounds are carvacrol and thymol . origanum essential oil is known to possess antimicrobial , antifungal , and antioxidant activities [ 31 , 32 ] . the aim of our study was to examine possible beneficial effects of thyme and oregano essential oils on intestinal inflammation . the results of our preliminary experiment suggested that the administration of thyme oil in combination with oregano oil could be more effective in improvement of trinitrobenzene sulphonic acid ( tnbs)-induced colitis than the separate administration of these essential oils . in the present study , we evaluated further the effect of administration of three different doses of thyme and oregano oil combination on tnbs - induced colitis in mice . male 7-week - old balb / c mice weighing 1825 g were purchased from velaz ( prague , czech republic ) . the animals were maintained under standard conditions of temperature ( 211c ) , relative humidity ( 5510% ) , and 12 hours/12 hours light / dark cycle . all animal experimentations were reviewed and approved by the ethical committee of the institute of animal physiology . after a period of adaptation , weight - matched animals were randomized into five groups : group a ( 20.20.971 g ) , group b ( 20.60.75 g ) , and group c ( 20.710.844 g ) , mice with tnbs - induced colitis treated with three different doses ( see table 1 ) of thyme and oregano oil combination ; group d ( 21.031.025 g ) , mice with tnbs - induced colitis ; group e ( 18.741.189 g ) , sham - treated mice . 4 ) and oregano aromatic oil ( origani aetheroleum ) were purchased from calendula , ( nov l'ubova , slovakia ; thyme aromatic oil : lot 5 - 015 - 003 - 10 - 04 ; oregano aromatic oil : lot 5 - 027 - 007 - 10 - 04 ) . p - cymene and 24% of thymol , and the oregano aromatic oil contained about 55% of carvacrol . 2,4,6-trinitrobenzene sulphonic acid ( tnbs ) was purchased from fluka chemie ( buchs , switzerland ) . the thyme oil and oregano oil were mixed with the diet at concentrations as shown in table 1 . both aromatic oils were suspended in edible soya oil ( brlio , hamm , germany ) and added to powdery commercial rodent diet ( diet for laboratory mice and rats spf , m1 ; frantisek machal , ricmanice , czech republic ) . in the tnbs and sham groups , edible soya oil was mixed with the powdery rodent diet at a concentration of 1% ( wt / wt ) . diets were fed ad libitum throughout the experiment , starting 6 days before administration of tnbs . the mice were anesthetized with ketamine and xylazine , and colitis was induced by intrarectal administration of 120 mg / kg of the hapten reagent tnbs ( fluka chemie ) in 50% ethanol , and they were then kept in a vertical position for 30 seconds . the total injection volume was 30 l . development of colitis was assessed daily by measurement of body weight . the colons were removed , cut longitudinally , and cleared of fecal material with gentle spray of 0.9% saline solution . the extent of mucosal damage was assessed using the colon macroscopic scoring system adapted from wallace et al . . ulceration : ( 1 ) focal hyperemia , no ulcer ; ( 2 ) ulceration , no hyperemia / bowel wall thickening ; ( 3 ) ulceration , inflammation at one site ; ( 4 ) ulceration , inflammation at 2 or more sites ; ( 5 ) major injury > 1 cm ; 610 major damage > 2 cm . adhesion : ( 1 ) minor ( colon easily separated from other tissue ) ; ( 2 ) major . colon tissues were fixed in 4% formalin in 0.1 m phosphate buffer , dehydrated with increasing concentrations of ethanol , embedded in paraffin , and sectioned . sections ( 46 m thick ) were mounted on slides , cleared , hydrated , and stained with hematoxylin and eosin . the slides were examined and photographed with an olympus bx51 microscope ( olympus , japan ) . strips of colonic tissue ( 1530 mg from segments most intensively affected by the inflammation ) were cut out , immersed in liquid nitrogen , and kept at 70c until the cytokine measurement . total rna was isolated from the mouse colon ( about 15 mg of tissue for each sample ) with trizol reagent ( invitrogen life technologies , karlsruhe , germany ) according to the manufacturer 's instructions . total rna preparations were then cleaned and dnase i was treated with rneasy micro kit ( qiagen , hilden , germany ) according to the manufacturer 's protocol . in order to quantify total rna extracted from each sample , optical density at 260 nm was measured . the rna ( 0.75 g from each sample ) was reverse transcribed at 42c for 1 hour in 30 l containing 300 units of superscript ii rnase hreverse transcriptase ( invitrogen life technologies ) , 7 m anchored oligo dt13vn , 50 mm tris - hcl ph 8.3 , 3 mm mgcl2 , 75 mm kcl , 10 mm dtt , 500 m dntps ( datp , dttp , dctp , dgtp ) , 60 units rnase out ( recombinant ribonuclease inhibitor , invitrogen life technologies ) , and 0.75 g acetylated bsa . the reaction was terminated by heating at 95c for 5 minutes . to check for the presence of genomic dna contamination in the rna preparations , reverse transcriptase negative control ( no reverse transcriptase in the reaction ) was carried out in parallel , using rna pool prepared from aliquots of all rna samples . the pool of colon rna obtained from aliquots of all samples served as standard rna . the relative standard curve was generated using mx 3000p 2.0 software ( stratagene , la jolla , calif ) . pcr reactions were carried out in a 20 l final volume in duplicates using sybrgreen i as a fluorescent detection dye . the reactions contained 0.8 l of cdna ( corresponding to 20 ng of sample total rna ) , one unit of platinum taq dna polymerase ( invitrogen life technologies ) , sybrgreen i in final dilution of 1 : 25000 ( sigma - aldrich , munich , germany ) , 30 nm rox ( passive reference dye for correction of non - pcr - related fluctuations in fluorescence signal , stratagene ) , 0.2 mm dntps ( datp , dttp , dctp , dgtp ) , 50 mm kcl , 10 mm tris - hcl ph 8.3 , 2.5 mm mgcl2(except for the -actin reaction , where 1.5 mm mgcl2 was used ) , forward and reverse primers in final concentration of 0.25 m ( for il-1 , il-12b , tnf , ifn- , hprt , and sdha ) , or 0.5 m ( for il-6 , il-10 , gm - csf , and -actin ; see table 2 for full gene names ) . oligonucleotide primers used in the experiment were designed in our previous work , and their sequences are shown in table 2 . pcr amplification was performed in the real - time pcr system mx 3000p ( stratagene ) . after an initial step at 95c for 2 minutes ( dna denaturation and hot - start dna polymerase activation ) , 40 cycles with the following thermocycling conditions were carried out : 94c for 30 seconds , specific annealing temperature for 30 seconds , 72c for 30 seconds , and specific temperature at which the fluorescence was acquired ( acquiring temperature ) for 30 seconds . measurement of fluorescence at an elevated temperature ( acquiring temperature , a few degrees of celsius below the melting temperature of the specific pcr product ) enables elimination of the fluorescence signal produced by incidental short nonspecific pcr products . amplification specificity was then checked by generation of a melting curve using 41 cycles with temperature increments of 1c ( starting with 55c ) and a fluorescence measurement in each cycle . specific annealing and acquiring temperatures are shown in table 2 . to ensure the correctness of the quantification firstly , expression stability of several housekeeping genes was tested using genorm software . subsequently , the normalization factor for each sample was calculated ( by genorm software ) as the geometric means of the relative amounts of the three most stable housekeeping genes hprt , sdha , and -actin ( see table 2 for full gene names ) . finally , the relative amount of cytokine mrna in each sample was divided by the normalization factor of the sample . colon tissue samples were homogenized in ice - cold pbs containing protease inhibitor cocktail for use with mammalian cell and tissue extracts ( p8340 , sigma - aldrich ) , and the homogenates were then centrifuged at 12000 xg at 4c for 15 minutes . total protein amounts in the tissue supernatants were determined using bradford protein assay with bsa employed as the standard . il-1 and il-6 amounts were determined using an elisa kit , according to the manufacturer 's recommendation ( pierce - endogen , rockford , ill , usa ) . the kruskal - wallis test and the mann - whitney u the chi - square test was used to assess differences in mortality rate . the student t test the kruskal - wallis test was used for the comparison of differences in cytokine expression between groups and the mann - whitney u test was used to compare differences between the group of untreated colitic animals and other groups of animals . as shown in figure 1 , administration of tnbs caused a dramatic decrease in body weight ( almost 20% after 3 days ) ; body weight was recovered gradually from day 4 but not fully to the initial weight in day 7 . mice receiving 50% ethanol without tnbs ( control sham group ) showed only slight and transient loss of body weight . in mice of group b ( colitic animals treated with 0.2% thyme and 0.1% oregano oils ) , body weight was recovered gradually from day 3 when it became higher than the body weight of untreated colitic animals ( group d ) ; on day 7 , the body weight of animals in group b reached a level near to that of the control mice ( sham group ) . the body weight of mice in group a ( colitic animals treated with 0.4% thyme and 0.2% oregano oils ) and group c ( colitic animals treated with 0.1% thyme and 0.05% oregano oils ) did not differ significantly from that of untreated colitic animals ( group d ) . the mortality rate of mice with tnbs - induced colitis ( group d ) was 53.3% , while that of the control sham group was 0% ( see figure 2 ) . the mortality rate in group a ( colitic animals treated with 0.4% thyme and 0.2% oregano oils ) was 50% and in group c ( colitic animals treated with 0.1% thyme and 0.05% oregano oils ) was 62.5% , which are comparable to that found in group d. treatment with the combination of 0.2% thyme and 0.1% oregano oils ( group b ) decreased the mortality rate to 33.3% ( which was still not significantly different from that of mice with tnbs - induced colitis ) . macroscopic damage scores of mice in group d were significantly higher than those of mice in the control sham group . treatment with the combination of 0.2% thyme and 0.1% oregano oils ( group b ) significantly lowered the macroscopic damage scores in comparison to untreated colitic animals ( group d ) . animals in groups a and c showed no significant changes in macroscopic damage scores compared with mice in group d ( see figure 3 ) . representative samples of colon after hematoxylin and eosin stainings are shown in figure 4 . there is no evident histological modification in sham mice ( e ) . in mice with tnbs - induced colitis ( d ) , there is a wide range of histopathological changes including necrosis of epithelium , destruction of glands , and infiltration of inflammatory cells in the mucosa and submucosa ( up to 50% of colon section ) . the samples from mice treated with 0.2% thyme and 0.1% oregano oils ( b ) show intermediary histopathological changes ( up to 30% of colon section ) . relative amounts of il-1 , il-6 , gm - csf , and tnf mrnas ( for full gene names , see table 2 ) were significantly higher in animals with tnbs - induced colitis ( group d ) than in the control sham - treated animals ( see figure 5 ) . treatment of the colitic animals with the combination of thyme and oregano oils significantly lowered the amount of il-1 mrna , using all three tested doses of the aromatic oils ( see figure 5 ) . the amount of il-6 mrna in group b ( colitic animals treated with 0.2% thyme and 0.1% oregano oils ) was significantly lower than that in the group d , whereas the decrease of il-6 mrna level in groups a and c ( colitic animals treated with 0.4% thyme and 0.2% oregano oils or with 0.1% thyme and 0.05% oregano oils ) was not statistically significant ( see figure 5 ) . a similar effect was found for gm - csf and tnf but the difference between group b and group d did not reach statistical significance ( p=.064 and p=.053 , resp . ; see figure 5 ) . we found no significant changes in mrna levels of two other cytokines ( il-10 and ifn , data were not shown ) . as shown in figure 6 , the amounts of il-1 and il-6 proteins were significantly higher in the animals with tnbs - induced colitis ( group d ) than in the control sham group . the concentrations of these proteins were significantly reduced in group b ( colitic animals treated with 0.2% thyme and 0.1% oregano oils ) compared to group d. the levels of il-1 and il-6 proteins in groups a and c ( colitic animals treated with 0.4% thyme and 0.2% oregano oils or with 0.1% thyme and 0.05% oregano oils ) did not differ significantly from those found in group d ( see figure 6 ) . various aromatic plants and their products have been reported to have health benefit properties . in this study , we examined whether dietary supplementation with a combination of thyme essential oil and oregano essential oil could have a protective effect in intestinal inflammation . we applied three doses of thyme and oregano essential oil combination ( 0.4% thyme and 0.2% oregano oils , 0.2% thyme and 0.1% oregano oils , 0.1% thyme and 0.05% oregano oils ) to mice with tnbs - induced colitis , and found that administration of the medium dose decreased the mortality rate from 53% to 33% , significantly accelerated the body weight gain recovery , and significantly reduced the macroscopic damage of the colonic tissue . in animals fed with the two other doses of the essential oils , we did not find a significant improvement in the mortality rate , body weight gain recovery , or colonic tissue damage . examining the expression of cytokines , we found significantly elevated mrna levels of proinflammatory cytokines il-1 , il-6 , gm - csf , and tnf in mice with tnbs - induced colitis . this finding is in agreement with other studies showing increased expression of proinflammatory cytokines in mouse experimental models of colitis [ 47 ] . treatment of the colitic animals with the medium dose of aromatic oils ( 0.2% thyme and 0.1% oregano oils ) decreased the mrna amounts of il-1 , il-6 , gm - csf , and tnf ( in gm - csf and tnf , the difference did not reach statistical significance ) . other two doses ( 0.4% thyme and 0.2% oregano oils ; 0.1% thyme and 0.05% oregano oils ) were less effective and the difference in cytokine mrna level between animals treated with these doses of the aromatic oils and untreated colitic animals was significant only in the case of il-1. the most sensitive indicators of the effectiveness of the thyme and oregano oil treatment were mrna levels of proinflammatory cytokines il-1 and il-6 in our experiment . similarly , kwon et al . demonstrated that plant flavonoid rutin administered in diet to mice with dextran sulfate sodium ( dss)-induced colitis significantly suppressed mrna levels of il-1 and il-6 , whereas the effect on mrna level of gm - csf was less marked . increase of il-1 and il-6 mrna levels in inflamed intestinal tissue has been well documented [ 1214 ] , and there are data indicating that il-1 can stimulate production of il-6 in intestinal epithelial cells [ 37 , 38 ] . reported data about the expression of tnf are somewhat contradictory , showing either no change or an increase of tnf levels in intestinal inflammation . sugimoto et al . showed that elevated levels of tnf mrna in mice with tnbs - induced colitis can be suppressed by curcumin treatment , but kwon et al . found no significant changes in tnf mrna levels in mice with dss - induced colitis ( treated or untreated with plant flavonoid rutin ) . examination of il-1 and il-6 protein expression in our experiment confirmed the best efficacy of the medium dose of thyme and oregano oil combination in the suppression of colitis . the cytokine protein level in animals treated with the medium dose , but not in animals treated with the other two doses , was significantly lower than in the untreated colitic animals . the low effectiveness in attenuating the colitis found after administration of the highest dose of thyme and oregano oil combination could be connected with possible cytotoxic effects of higher concentrations of these oils . in our preliminary experiments with intact mice , we found negative effects of higher concentrations of thyme essential oil ( 1% ) and oregano essential oil ( 0.5% ) on body weight and food intake . moreover , the cytotoxic effect of higher concentrations of these oils has been demonstrated in intestinal cells and lymphocytes [ 39 , 40 ] . thus , the lack of the dose dependency found in this study could be due to a combination of positive and negative effects of the highest concentration of thyme and oregano essential oil combination . on the other hand , too low doses of essential oils can be insufficient to reduce the intensity of inflammation . a similar phenomenon was found in the study examining the protective effects of curcumin on tnbs - induced colitis in mice , where the medium tested dose was more effective at improving body weight gain than the lower or higher doses of curcumin . to explain the lack of the dose dependency , authors speculated about curcumin toxicity or about the influence on the food intake . thus , the use of optimal doses is essential for good efficacy of essential oils ( or their components ) in attenuating inflammation . further experiments are needed to establish the most efficient concentration of thyme and oregano essential oil combination . in our preliminary experiments ( using similar experimental conditions as in the present study ) , we administered thyme ( 0.5% , 0.25% , 0.12% ) or oregano ( 0.4 , 0.2% , 0.1% ) essential oil alone in diet to mice with tnbs - induced colitis and we found no significant positive effect . furthermore , we observed negative effects on body weight and food intake with oregano at 0.4% concentration . however , we observed a better recovery of body weight after treatment with a combination of these essential oils in preliminary tests . the results of the present study confirm the positive effects of the combined administration of appropriate concentrations of thyme and oregano oils on tnbs - induced colitis . it is known that oregano essential oil possesses strong antimicrobial activity , which is ascribed to carvacrol , the main component of this oil . thymol , one of the major compounds of thyme essential oil , has anti - inflammatory activity . thus , it seems that major components of these oils can complement one another , having synergic effects on inflammation so that their combination could exhibit positive preventive or therapeutic effects . a similar phenomenon was found in another study where the effect of peppermint oil and caraway oil on postinflammatory visceral hyperalgesia was examined ( using a rat model of tnbs - induced colitis ) . neither peppermint nor caraway oil administered individually had a significant effect on postinflammatory visceral hyperalgesia , but combined treatment with these essential oils significantly reduced the visceromotor response . mechanisms mediating the suppressive effects of thyme and oregano oils on colitis are unclear , and we can only speculate that there are several potential manners of action . one possibility could be the influence of the essential oils on nuclear factor b ( nf-b ) , a pleiotropic transcription factor which can activate expression of genes involved in immune and inflammation responses such as proinflammatory cytokines . several studies have demonstrated an inhibitory effect of various plant extracts or their components on nf-b activation . suppression of the nf-b inhibitory protein ( ib ) degradation in colonic epithelial cells and macrophages was demonstrated after the administration of curcumin and zerumbone [ 4 , 44 , 45 ] . reduced activation of nf-b was also shown after treatment with black tea polyphenol theaflavin in raw 264.7 cells . on the other hand , il-1 ( such as other proinflammatory cytokines ) is a potent inducer of nf-b and it has been shown that extract of thymus pulegioides can inhibit activation of nf-b by il-1 in human hepatoma cells . in conclusion , the present data indicate that dietary administration of a combination of thyme and oregano essential oils in appropriate concentrations can reduce the production of proinflammatory cytokines and attenuate the degree of colonic tissue injury , and thereby ameliorate tnbs - induced colitis in mice . we suggest that the combination of thyme and oregano essential oils has potential value as an additional or supporting treatment in gastrointestinal inflammations . our results indicate that some essential oils could have positive effects on tnbs - induced colitis but seemingly in rather narrow range of concentrations , thus limiting their therapeutic / preventive potential .

we examined the anti - inflammatory effects of the combination of thyme and oregano essential oil dietary administered at three concentrations ( 0.4% thyme and 0.2% oregano oils ; 0.2% thyme and 0.1% oregano oils ; 0.1% thyme and 0.05% oregano oils ) on mice with tnbs - induced colitis . treatment of colitic animals with the essential oils decreased the mrna levels of pro - inflammatory cytokines il-1 , il-6 , gm - csf , and tnf , especially after application of the medium dose . the medium dose of the essential oils significantly lowered the amount of il-1 and il-6 proteins too . moreover , administration of the medium dose decreased the mortality rate , accelerated the body weight gain recovery , and reduced the macroscopic damage of the colonic tissue . our results indicate that combined treatment with appropriate concentrations of thyme and oregano essential oils can reduce the production of proinflammatory cytokines , and thereby attenuate tnbs - induced colitis in mice .

1. INTRODUCTION 2. MATERIALS AND METHODS 3. RESULTS 4. DISCUSSION

the patient was a 46-year - old saudi woman who had chronic hepatitis c , end - stage renal disease of undetermined etiology , and a renal transplant in 1993 . seizures were usually preceded by epigastric pain and a sensation of nausea for few seconds , followed by left arm posturing and loss of consciousness . she lived in a rural area , was involved in animal husbandry , and consumed unpasteurized milk products . her medications included mycophenolate mofetil ( 500 mg 2/d since 1993 ) , prednisone ( 5 mg 1/d since 1993 ) , levetiracetam ( 500 mg 2/d for 5 mo ) , and phenytoin ( 200 mg every night for 1 mo ) . neurologic examination showed left homonymous hemianopia , increased deep tendon reflexes in the left hemibody , and the babinski sign on the left hallux . initial laboratory test results , including those for complete blood count , erythrocyte sedimentation rate , c - reactive protein , and liver and renal profiles , were within references ranges . results of serologic analysis for hiv and hepatitis b virus were negative . a standard agglutination tube ( sat ) test result for brucella spp . was positive ( titer 1:320 ) , and a 2-mercaptoethanol test result for brucella spp . cerebrospinal fluid ( csf ) had a leukocyte count of 21 ( 90% lymphocytes ) . levels of protein , glucose , and lactate dehydrogenase in csf were within references ranges . gram staining of a csf sample and cultures for bacteria , virus , fungi , and acid - fast bacilli ( afb ) showed negative results . serologic analysis of csf showed brucella igg ( titer < 1:20 ) and antibodies against brucella ( titer 1:320 ) . test results were negative for antibodies against aspergillus , aspergillus galactomannan , blastomyces , borrelia , coccidia , cryptococcus , histoplasma , and toxoplasma . an electroencephalogram showed sharp waves over the right temporal region and continuous slow activity over the right temporooccipital region . magnetic resonance imaging ( mri ) of the brain showed diffuse t2/fluid - attenuated inversion recovery hyperintense white matter lesions involving the right frontal , parietal and temporal lobes ( figure 1 ) . no appreciable mass effect or enhancement after administration of gadolinium was observed . positive emission tomography of the brain showed hypometabolic cerebral activity involving a large area of right cerebral hemisphere . magnetic resonance spectroscopy shows a low peak of n - acetyl aspartate ( 2.2 ppm ) . magnetic resonance imaging of the brain of a 46-year - old immunocompromised woman with central nervous system brucellosis granuloma and white matter disease , saudi arabia . a ) axial t2 images showing hyperintensity in the right frontoparietal lobe and right temporal lobe . b ) axial fluid - attenuated inversion recovery ( flair ) and c ) coronal flair images showing that hypersensitivity extends to u - fibers without involvement of the cortex . d ) gadolinium - enhanced image showing that no appreciable mass effect and no central or peripheral enhancement after administration of gadolinium were observed . each image within each panel shows involvement in different levels of frontal , parietal , and temporal lobes . a brain biopsy specimen of cerebral cortex and superficial white matter showed a moderate lymphoplasmacytic and focally histiocytic infiltrate that involved deep cortex , white matter , and leptomeninges . the inflammatory reaction , including granulomas , was mainly perivascular with some angiocentric patterns and focal parenchymal involvement . there were no morphologic signs of a specific etiology : no viral inclusions , and staining results microorganisms ( afb , fungi , epstein - barr virus , and jc polyomavirus ) were negative ( figure 2 ) . histologic analysis of a brain biopsy specimen from a 46-year - old immunocompromised woman with central nervous system brucellosis granuloma and white matter disease , saudi arabia . a ) low magnification view of cerebral cortex showing infiltration by perivascular lymphocytes and histiocytes . b ) high magnification view showing an angiocentric epithelioid granuloma cuffed by mature lymphocytes ( original magnification 200 ) . was sensitive to gentamicin , streptomycin , tetracycline , trimethoprim / sulfamethoxazole , and rifampin . the patient received intravenous ceftriaxone ( 2 g every 12 h ) , oral doxycycline ( 100 mg every 12 h ) , oral rifampin ( 600 mg 1/d ) , and trimethoprim / sulfamethoxazole ( 1 tablet [ 160 mg/800 mg ] every 12 h ) for 2 wk . after discharge , she was receiving oral doxycycline ( 100 mg every 12 h ) , rifampin ( 600 mg , 1/d ) , trimethoprim / sulfamethoxazole ( 1 tablet every 12 h ) , and ciprofloxacin ( 500 mg every 12 h ) for 6 mo : she was also receiving levitiracetam ( 750 mg 2/d ) , carbamazepine ( 200 mg 2/d ) , mycophenolate mofetil ( 500 mg 2/d ) , and prednisone ( 5 mg 1/d ) . three months later , repeat mri of the brain showed decreased t2 hyperintensity associated with volume loss and ex vacuo dilatation of the subjacent right lateral ventricle . neurobrucellosis can affect the central or peripheral nervous systems and lead to diverse clinical syndromes ( 4 ) . diagnosis of neurobrucellosis depends on clinical manifestations , csf findings suggestive of pinocytosis , high protein levels , low or standard glucose levels , and a positive antibody titer for brucella spp . although the patient had mild pleocytosis with a predominance of lymphocytes and high antibody titers against brucella spp . in csf , however , low levels of antibodies might not be detected by sat . in suspicious cases in which the sat result is negative , sat and a coombs test , elisa , and pcr are helpful in making a diagnosis . 77the clinicalradiologic correlation for neurobrucellosis ranges from uneventful results for imaging studies , despite positive clinical findings , to imaging abnormalities ( 3 ) . neurobrucellosis with a focal brain mass has been rarely observed in imaging studies ( 7,8 ) . radiologic results in this case suggested an infectious disease , autoimmune disease , or malignancy in an immunocompromised patient . because we deemed it necessary to exclude other conditions , such as progressive multifocal leukoencephalopathy or lymphoma the diagnosis was established by detecting antibodies against a brucella sp . in serum and csf and confirmed by isolation of a brucella sp . from brain tissue . we found that the patient had epilepsy and extensive white matter changes secondary to brucellosis . mri of the brain showed abnormal results ( prominent white matter disease and focal encephalomalacia ) . inflammation can cause permanent cellular biochemical dysfunction , which can lead to electrically irritable tissue and parenchymal damage despite successful treatment . longitudinal studies of white matter hyperintensities caused by vascular , noninfectious , infectious , and inflammatory conditions showed white matter hyperintensities over time despite effective treatment . reported that white matter changes in neurobrucellosis were sequelae of demyelination , as confirmed by the pathologic analysis ( 9 ) . we believe that unresolved white matter hyperintensities in this patient were a sequela of the inflammatory process . a case report documented similar clinical features in a patient with seizures caused by chronic neurobrucellosis for 2.5 years ( 10 ) . solitary cysticercus granuloma and calcified lesion are 2 common neuroimaging abnormalities in patients with epilepsy . treatment for underlying cysticercosis does not cure epilepsy ( 12 ) . seizures associated with central nervous system tuberculomas the underlying pathogenesis for relapsing epilepsy in neurocysticercosis is probably related to abnormal neurons and their arrangement within calcified nodules ( 13 ) . the epilepsy prognosis for neurobrucellosis is probably similar to that for central nervous system neurocysticercosis ( 13 ) . our findings indicate the need for suspecting neurobrucellosis as a cause of epilepsy and white matter disease in immunocompromised patients in disease - endemic areas .

brucellosis is a multisystem zoonotic disease . we report an unusual case of neurobrucellosis with seizures in an immunocompromised patient in saudi arabia who underwent renal transplantation . magnetic resonance imaging of the brain showed diffuse white matter lesions . serum and cerebrospinal fluid were positive for brucella sp . granuloma was detected in a brain biopsy specimen .

The Study Conclusions

secondary ( aa ) amyloidosis is a systemic disease caused by the deposition of amyloid in various tissues and organs leading to impaired function.1 it occurs most frequently in patients with poorly controlled chronic inflammatory disease , mainly rheumatoid arthritis , and ankylosing spondylitis.2 in systemic amyloidosis , the usual presentation is renal involvement , and the gastrointestinal tract is commonly involved.3 patients with gastric involvement present with various symptoms such as nausea , vomiting , hematemesis , and epigastric pain.4 most studies emphasize the presence of stomach motility disturbances in amyloidosis.5 however , there have been few case reports of systemic amyloidosis with gastric outlet obstruction . here , we report a case of systemic aa amyloidosis with gastric outlet obstruction mimicking linitis plastica secondary to ankylosing spondylitis . a 65-year - old woman was referred to us because of abdominal distention , nausea , and vomiting that had been occurring for a month . her medical history includes a diagnosis of ankylosing spondylitis 1 year ago , and she had been taking celecoxib daily . complete blood cell count showed a leukocyte number of 7,470/l , hemoglobin of 8.8 g / dl , and platelet count of 301,000/mm . her blood chemistry values were as follows : total protein , 6.1 g / dl ; albumin , 3.1 g / dl ; total bilirubin , 0.4 mg / dl ; aspartate aminotransferase , 26 u / l ; alanine aminotransferase , 16 u / l ; alkaline phosphatase , 368 u / l ; blood urea nitrogen , 16.6 mg / dl ; creatinine , 1.4 mg / dl ; erythrocyte sedimentation rate , 79 mm / hr ; and c - reactive protein , 2.8 mg / dl . blood coagulation test revealed a prothrombin time / activated partial thromboplastin time of 11.8/29.5 seconds . abdominal radiography showed a huge gastric shadow with a large amount of food materials in the gastric lumen . abdominal computed tomography showed a large amount of retained food materials in the stomach and diffuse wall thickening of the gastric antrum ( fig . endoscopy revealed marked edema of the mucosa , multiple ulcerations , and luminal narrowing and limited distensibility of the gastric antrum ( fig . 1c ) , but endoscopic mucosal change was not observed in the duodenum ( fig . we performed endoscopic biopsies of the gastric antrum and the duodenum , which revealed the deposition of eosinophilic amorphous materials in the lamina propria and the submucosa in the stomach but not in the duodenum on hematoxylin and eosin staining ( fig . 2 ) , and the accumulation of apple - green materials in the lamina propria and the submucosa in the stomach on congo red staining ( fig . 3a , b ) . the histological findings were compatible with amyloidosis , and the amyloid was identified as the aa type on immunohistochemical testing with monoclonal antibodies specific to serum amyloid a protein . colonoscopy with random biopsies showed no colonic involvement by the amyloidosis . bence - jones proteins were present in urine , but an m - peak was not found in serum . moreover , there were no abnormalities on bone marrow biopsy . subtotal gastrectomy was recommended because of the worsening obstruction symptoms ; however , she refused surgery and wanted to be transferred to another hospital . amyloidosis is a group of disorders characterized by the accumulation of amyloid in various organs and tissues of the body . it is categorized according to the tissue distribution of the amyloid as systemic or localized amyloidosis , and according to the presence or absence of the predisposing factors as aa or primary ( al ) amyloidosis.6 serum amyloid a protein is an acute phase reactant that is produced because of chronic infection or inflammation . the prevalence of aa amyloidosis in patients with ankylosing spondylitis was estimated to be from 4.4% to 8.6%.7 the frequency of clinically apparent gastrointestinal involvement varies with the type of amyloidosis . gastrointestinal disease is present in as many as 60% of patients with aa amyloidosis.8 in cases of gastrointestinal tract involvement , gastrointestinal symptoms include gastrointestinal bleeding , chronic intestinal dysmotility , malabsorption , and protein - losing enteropathy . aa amyloidosis presents with diarrhea and malabsorption , whereas al amyloidosis usually presents with constipation , mechanical obstruction , or chronic intestinal pseudo - obstruction.9 especially , amyloidosis with gastric involvement presents with gastroparesis , epigastric pain , gastric outlet obstruction , gastric amyloid tumors , peptic ulceration , hematemesis , and melena.10 gastric amyloidosis with obstructive symptoms is usually due to submucosal tumors , polyps , or antral narrowing but rarely due to lesions similar to linitis plastic.11,12 endoscopically , al amyloidosis typically forms a polypoid mass lesion and aa amyloidosis shows a fine granular appearance.13 in our case , the patient presented with gastric outlet obstruction , which is unusual in aa amyloidosis . moreover , endoscopically , she showed multiple ulcerations on the edematous mucosa of the antrum in the stomach , which showed a poorly demarcated margin suggestive of gastric lymphoma or linitis plastica . gastric amyloidosis could be misdiagnosed as gastric cancer because of the likeness in endoscopic and radiologic findings . although they performed various examinations , including gastroscopy with biopsy , barium meal , and endoscopic ultrasonography , they did not find any evidence of amyloidosis . although most of the gastric amyloidosis cases are not related to gastric cancer , some might be associated with gastric malignancies.15 in such cases , the confirmative diagnostic method is biopsy.16 the amyloid displays amorphous , homogenous , translucent , and acidophilic materials under a light microscope on hematoxylin and eosin staining . with congo red staining , the amyloid could be observed as an apple - green birefringence under polarized light . under an electron microscope , the amyloid is seen as thin linear fibrils . in our case , we found apple - green birefringence under the light microscope and thread - like fibrils under the electron microscope on congo red staining . analysis of monoclonal immunoglobulin in serum and urine has little role in the diagnosis of aa amyloidosis but could help exclude al amyloidosis . the treatment of aa amyloidosis is focused on the treatment of the underlying inflammatory disease , whereas the mainstay treatment for al amyloidosis has been chemotherapy . recently , several reports have described the benefits of tumor necrosis factor- ( tnf- ) inhibitors in patients with amyloidosis secondary to chronic inflammatory disease.17 these agents have a remarkable ability to suppress inflammatory reactions.17 two reports about aa amyloidosis and tnf- inhibitor therapies showed improvement of protein - uria and renal function in patients with renal amyloidosis secondary to ankylosing spondylitis.18,19 however , studies on the treatment of gastrointestinal amyloidosis especially for patients with ankylosing spondylitis are limited . mcmahan et al.17 emphasized the importance of early treatment with a tnf- inhibitor for gastrointestinal amyloidosis secondary to ankylosing spondylitis because delayed treatment might prevent patients from obtaining the full benefits of the drug . al amyloidosis has a poor prognosis with a median survival of < 2 years despite treatment with mephalan and steroids.13 the prognosis of aa amyloidosis differs according to the underlying disease and is correlated with serum amyloid a concentration.20 a cohort study of patients with systemic aa amyloidosis showed a median survival of 133 months.20 in that cohort study , mortality , amyloid burden , and renal prognosis were all significantly correlated with the serum amyloid a concentration during follow - up.20 the risk of death was 17.7 times higher in patients with serum amyloid a concentrations of 155 mg / l compared to that in those with concentrations of 4 mg / l.20 whole - body i - labeled serum amyloid p component scintigraphy for measuring the concentration of serum amyloid a is not commercially used in korea yet , so we were not able to measure the amyloid burden in our patient . in this case , the patient presented with nonspecific symptoms such as nausea , vomiting , and abdominal distention , and endoscopy showed segmental luminal narrowing similar to linitis plastica , which is rare in patients with aa amyloidosis . however , with suspicion , we performed congo red staining and finally concluded a diagnosis of amyloidosis secondary to ankylosing spondylitis . therefore , in a patient with long - standing ankylosing spondylitis , gastric amyloidosis should be differentiated when the patient presents with gastric outlet obstruction .

amyloidosis is a group of disorders characterized by the extracellular accumulation of insoluble , fibrillar proteins in various organs and tissues . it is classified , on the basis of the identity of the precursor protein , as primary , secondary , or familial amyloidosis . gastrointestinal amyloidosis usually presents as bleeding , ulceration , malabsorption , protein loss , and diarrhea . however , gastric amyloidosis with gastric outlet obstruction mimicking linitis plastica is rare . we report a case of gastrointestinal amyloidosis with gastric outlet obstruction in a patient with ankylosing spondylitis . the patient was indicated for subtotal gastrectomy because of the aggravation of obstructive symptoms , but refused the operation and was transferred to another hospital . three months later , the patient died of aspiration pneumonia during medical treatment .

INTRODUCTION CASE REPORT DISCUSSION

anterior cervical fusion ( acf ) is a commonly performed surgical procedure to treat degenerative disorders of the cervical spine9 ) . although the use of tricortical iliac crest bone graft in acfs is associated with the excellent outcomes , the risk of donor site related complications have always incited the spine surgeon to use various contemporary graft substitutes . in 1965 , urist14 ) discovered a subset of protein extract , which had a significant potential of inducing new bone formation even at the non - osseous tissues . recombinant human bone morphogenetic protein-2 ( rhbmp-2 ) is a member of this family , which has gained a widespread popularity for its application in spinal fusions . although , their role in lumbar fusions is well established , the safety profile of rhbmp-2 in acfs is yet to be defined101113 ) . baskin et al.1 ) were the first authors who conducted a prospective randomized controlled trial and reported that the use rhbmp-2 in acfs is a safe and effective technique . conversely several other authors reported a high incidence of neck swelling and dysphagia associated with the use of rhbmp-2 warranting either prolonged stay in the hospital or readmissions of the patients6101115 ) . despite the high fusions rates , some authors have even abandoned the use of rhbmp-2 for acfs due to its cost , side effects and availability of safer alternatives15 ) . on the basis of results of earlier trials , food and drug administration ( fda ) issued a warning in 2008 against the use of rhbmp-2 in acfs until the sufficient evidence is available about its safety . shields et al.10 ) reported a high rate of complications and attributed it to the use of greater amount of bmp dose ( 2.1 mg / level ) placed both inside and outside the cage . further emphasis on the influence of the dose and delivery method of rhbmp-2 in acfs was given by dickerman et al.4 ) and in their letter they proposed that the containment of low dose ( 1.05 mg ) rhbmp-2 within the cage and placing demineralized bone matrix ( dbm ) putty surrounding the infuse ensures a controlled delivery of rhbmp-2 in the vicinity of desired fusion site , which therefore is associated with excellent fusion rates with no adverse effects related to rhbmp-2 . the purpose of our study is to share our clinical experience with low - dose of rhbmp-2 in acf . we also aim to elucidate the impact of dose and delivery techniques of rhbmp-2 on the safety profile of its use in acfs based on our clinical experience and review of the literature . we performed a retrospective analysis of 197 patients who underwent acf with the use of rhbmp-2 during 2007 - 2012 . acfs included mainly anterior cervical discectomy and fusion ( acdf , n=191 ) , although few patients underwent anterior cervical corpectomy and fusion ( accf , n=4 ) . there were 80 males ( 40.6% ) and 117 ( 59.4% ) females included in our study . surgeries were performed for herniated disc prolapsed in 91 patients , for spondylosis with or without instability in 104 , and for pseudoarthrosis in 2 patients ( revision acf was performed in both these patients ) . most common presenting symptom was neck pain ( n=175 ) , followed by arm pain ( n=163 ) , sensory deficit ( n=102 ) and motor weakness ( n=87 ) . history of cigarette smoking was present in 53 patients ( 26.9% ) and diabetes mellitus in 21 ( 10.65% ) . thirty nine patients had a history of previous neck surgery , most of which had undergone discectomy or nerve decompression by foraminotomy ( n=37 ) and 2 patients had anterior fusions performed at different levels . in the majority of cases ( n=191 ) polyetheretherketone ( peek ) cages were used as a spacer device and the construct was supplemented with anterior cervical plate . in 6 patients , peek prevail ( medtronics sofamor danek ) device was used , which has inbuilt slots for self drilling screws . cages were filled with infuse bone graft substitute , which has 2 components : a reconstituted solution containing recombinant human bone morphogenetic protein-2 ( rhbmp-2 ) and an absorbable collagen sponge ( acs ) . we placed only 1/3 of sponge within the cage ( measuring 1.72.540.5 cm ) , which would deliver 0.7 mg of rhbmp-2 per level considering a homogenous distribution of this protein within the sponge ( fig . no additional acs was filled around the cage . in a large number of the patients ( n=102 ) , we also used demineralized bone matrix ( dbm ) , which was placed from the top and the bottom over the centrally located infuse within the peek cage ( fig . 1b ) . unless contraindicated , intravenous dexamethasone ( 8 mg ) was administered at the start of the procedure in all cases interbody spaces were prepared for cage placement , which were filled with infuse substitute in a proportion already discussed . anterior plate fixation was supplemented in all patients except in those in which prevail peek device was used ( n=6 ) . in the patients with major anatomical deformities , the amount of infuse was the same even if a larger spacer was placed after accf . closure was performed in layers without placing any drain . unless it was contraindicated , all patients were given methylprednisolone orally ( 4 mg ) in taper doses during the first week of postoperative period . plain x - ray of the cervical spine was taken within few hours of surgery to document the appropriate placement of hardware . during hospitalization , any events such as dysphagia , neck hematoma , incisional swelling , and vocal cord palsy were recorded . the majority of the patients were discharged within 24 hours of surgery and the patients hospitalized beyond 48 hours were considered to have a prolonged stay . after discharge , the patients were evaluated at 2 weeks , 6 weeks , 3 months , 6 months , 12 months and 24 months after surgery . incidence and severity of dysphagia was retrospectively determined by the 5 point swal - qol scale7 ) . score 1 indicates the patient almost always had difficulty ; score 2 indicates the patient often had difficulty ; score 3 indicates the patient sometimes had difficulty ; score 4 indicates the patient hardly had any difficulty ; score 5 indicates the patient never had difficulty . for the statistical analysis , patients with dysphagia were grouped into minimal ( score 3 - 5 ) and substantial ( score 1 - 2 ) dysphagia . all statistical analyses were performed using the spss software , version 21.0 ( ibm corp . the comparison of incidence and severity of complications between dbm and non - dbm was performed by using fisher 's exact test . in the majority of cases ( n=191 ) polyetheretherketone ( peek ) cages were used as a spacer device and the construct was supplemented with anterior cervical plate . in 6 patients , peek prevail ( medtronics sofamor danek ) device was used , which has inbuilt slots for self drilling screws . cages were filled with infuse bone graft substitute , which has 2 components : a reconstituted solution containing recombinant human bone morphogenetic protein-2 ( rhbmp-2 ) and an absorbable collagen sponge ( acs ) . we placed only 1/3 of sponge within the cage ( measuring 1.72.540.5 cm ) , which would deliver 0.7 mg of rhbmp-2 per level considering a homogenous distribution of this protein within the sponge ( fig . no additional acs was filled around the cage . in a large number of the patients ( n=102 ) , we also used demineralized bone matrix ( dbm ) , which was placed from the top and the bottom over the centrally located infuse within the peek cage ( fig . unless contraindicated , intravenous dexamethasone ( 8 mg ) was administered at the start of the procedure in all cases . interbody spaces were prepared for cage placement , which were filled with infuse substitute in a proportion already discussed . anterior plate fixation was supplemented in all patients except in those in which prevail peek device was used ( n=6 ) . in the patients with major anatomical deformities , the amount of infuse was the same even if a larger spacer was placed after accf . closure was performed in layers without placing any drain . unless it was contraindicated , all patients were given methylprednisolone orally ( 4 mg ) in taper doses during the first week of postoperative period . plain x - ray of the cervical spine was taken within few hours of surgery to document the appropriate placement of hardware . during hospitalization , any events such as dysphagia , neck hematoma , incisional swelling , and vocal cord palsy were recorded . the majority of the patients were discharged within 24 hours of surgery and the patients hospitalized beyond 48 hours were considered to have a prolonged stay . after discharge , the patients were evaluated at 2 weeks , 6 weeks , 3 months , 6 months , 12 months and 24 months after surgery . incidence and severity of dysphagia was retrospectively determined by the 5 point swal - qol scale7 ) . score 1 indicates the patient almost always had difficulty ; score 2 indicates the patient often had difficulty ; score 3 indicates the patient sometimes had difficulty ; score 4 indicates the patient hardly had any difficulty ; score 5 indicates the patient never had difficulty . for the statistical analysis , patients with dysphagia were grouped into minimal ( score 3 - 5 ) and substantial ( score 1 - 2 ) dysphagia . all statistical analyses were performed using the spss software , version 21.0 ( ibm corp . , armonk the comparison of incidence and severity of complications between dbm and non - dbm was performed by using fisher 's exact test . a total of 197 patients with the mean age of 51.3 years and male to female ratio of 1.01 were included in the study . the mean duration of follow - up was 27.5 months ( range 9 - 43 months ) . the majority of patients underwent single level acfs ( n=110 , 55.8% ) , while 2 , 3 , 4 levels acfs were performed in 72 ( n=36.5% ) , 13 ( 6.6% ) , 2 ( 1% ) patients respectively . hospital stay for the majority of patients was uneventful except in 2 patients who had prolonged hospitalization . an 83 year old patient , who underwent 2 levels acdf , developed severe postoperative dysphagia on 2 day of surgery . the clinico - radiological assessment did not reveal any neck swelling or hematoma , but the patient failed swallow tests . the patient was inserted a percutaneous endoscopic gastrostomy ( peg ) tube until he started tolerating oral feeds over the next few weeks . the other patient was a 70 year old male with an existing pulmonary dysfunction , who underwent 3 levels acdf , developed acute respiratory failure on the day of surgery . the patient was reintubated ; however , no hematoma or fluid collection in the neck was detected . a total of 26 ( 13.2% ) patients complained of dysphagia and the mean duration of onset was 9.2 ( range 2 - 21 ) days . of these patients , 15 patients had minimal discomfort ( score 3 - 5 ) and the remaining 11 patients complained of a substantial degree of discomfort ( score 1 - 2 ) . neck swelling occurred on average postoperative day 5.4 ( range 2 - 12 days ) . in 9 ( 34.6% ) patients with dysphagia , there was also an associated visible neck swelling . on the other hand , more than half ( n=9 , 52.9% ) of the patients with neck swelling had associated dysphagia . in a large number of the patients these adverse events resolved spontaneously ( table 1 ) . however , several other patients were given oral methylprednisolone as an outpatient ; only few required either prolonged hospitalization or readmissions . as already discussed , one patient with severe dysphagia who was found to have swallowing dysfunctions received a peg tube and therefore , had an extended hospital stay . two patients with neck swelling were readmitted for the management of associated dysphagia and respiratory difficulty ( fig . resolution of the symptoms could be achieved in both patients by administering intravenous dexamethasone , and the patients were also given oral methylprednisolone for 5 days following discharge . none of the patients necessitated surgical management for the aforementioned complications . in 102 patients dbm overall the incidence of dysphagia , substantial dysphagia and neck swelling was lower in the patients who were inserted dbm putty around infuse . on the contrary , the rate of spontaneous resolution was more in the non - dbm group ; although , none of these observations reached statistically significance ( table 2 ) . there was no difference in the incidence of prolonged hospitalization and readmissions in two groups . four patients ( 2% ) developed vocal cord palsies , which were transient and subsided over the period of few weeks in all of these patients . pseudoarthrosis was seen in 2 patients . in the first patient , who was 50 year female with a 3 level acdf patient deferred to any further intervention for the persistent symptoms arising from the involved segment . the second patient was a 66 year female , who underwent a single acdf for the traumatic subluxation of c5/6 region . this patient underwent posterior fusion and stabilization due the radiological presentation of implant loosening and impending loss of fusion at 1 month . one patient developed postoperative deltoid weakness , which subsided spontaneously over the next few months . the reports of high incidence of complication following its use in acfs invoked the debate on the safety profile of rhbmp-2 in these procedures . one of such reports was from schilds et al.10 ) , who documented a significant rate of complications resulting after the use of a high dose rhbmp-2 in acfs . interestingly , the incidence of the adverse events in the literature ranges from none to very high rates of complications ( table 3)123561011121315 ) . lower incidence of the complications in some of the studies has been correlated with the lower dose of rhbmp-2 and methods of delivery241013 ) . boakye et al.2 ) produced the first report of rh - bmp-2 filled in a peek spacer , which is what we use at our institution . the authors studied 24 patients that underwent acdfs with peek implants and rh - bmp-2 . three patients were found to have heterotopic bone formation , while the authors were using half of the amount of a small infuse kit ( 2.1 mg rhbmp-2/level ) . subsequently , the authors decided to use one - fourth of the sponge ( 1.05 mg rhbmp-2/level ) and found no heterotopic bone formation . the results of bmp in acfs were convincing until schilds et al.10 ) presented their study , which documented alarmingly high incidence of complications . however , one glaring difference was the amount of rh - bmp-2 used per level ( 2.1 mg ) . they also suspected that higher amount of infuse used in vertebrectomies led to a greater risk of the adverse events ( 7.9% vs 38.8% hematoma ) . the impact of bmp dose was also evident from the study by tumialan et al.13 ) , who were initially using 2.1mg / level . the authors noticed excess interbody bone formation in the first 24 patients and subsequently reduced the dose to 1.05 mg of rh - bmp-2 per level in the next 93 patients . the authors went on to reduce the dose even more ( 0.7 mg / level ) as more studies supported using a smaller dose . recent attention has also been directed to the methods of delivery . while reviewing their results , schilds et al.10 ) pointed out that the placement of bmp sponge outside the cage could be related to the high incidence of complication in their series . some surgeons have also used thrombin glue to control the diffusion of bmp into the surrounding tissues5 ) . the influence of delivery techniques gained more ground when dickermann et al.4 ) shared their experience with using dbm around bmp sponge to minimize its leakage . in the present study , we used a low - dose rhbmp-2 ( 0.7mg / level ) and placed it exclusively inside the cage . in approximately half of the patient the incidence of dysphagia and neck swelling in our series was 13.2% and 8.6% respectively . only 2 patients necessitated readmission and both of them responded well to the intravenous dexamethasone . the incidence and severity of complications were lower in the patients , in whom dbm was used , though these observations were not statistically significant . interestingly , in a large number of the patients , the aforementioned symptoms resolved spontaneously . a careful evaluation of previous studies also gives a clue to the effect of dose and delivery methods on the safety profile of rhbmp-2 in acfs ( table 3 ) . as already discussed , higher dose and placing bmp sponge outside the cage were probably responsible for the greater incidence of adverse events in the case series presented by schilds et al.10 ) . apparently , buttermann3 ) used a smaller dose of bmp as compared to boakye et al.2 ) ( 0.9 vs 1.05 mg ) ; however , the incidence of complications was lower in the later study . placement of infuse both within and outside the cage may be a possible explanation for higher incidence of adverse events observed by buttermann . usage of rhbmp-2 in acfs has been described as a safe technique by several authors11213 ) . it is also evident from the review of these studies that the authors either used low - dose bmp or placed it exclusively inside the cage or both ( table 3 ) . on the basis of our findings , it appears that low dose bmp placed only inside the cage has a lower complication rate than previously reported higher doses ( table 3 ) . unlike higher readmission and reexploration rate in these reports , we had only 2 readmissions with bmp related complication and none of them required any surgical intervention . however , the risk of complications associated with the use of low - dose bmp seems to be greater than risk without its use . in a recent report from our institution , we documented relatively a lower risk of morbidity in a large group of patients who underwent acdf without bmp ( overall 8.4% , dysphagia 3.3% , neck hematoma 0.1% , and recurrent laryngeal nerve palsy 0.1%)8 ) . there are other factors , which may also influence the risk of complications in acfs using bmp . tumilian et al.13 ) stated that irrigation should be avoided after the placement of bmp to minimize any displacement of the protein into surrounding structures that can lead to inflammatory reactions in the adjacent tissues or cause heterotopic bone formation . perioperative steroid administration is also found to reduce the complaints of dysphagia and neck swelling3 ) . unless contraindicated the impact of type of spacer on the safety profile of bmp in acfs is unknown . the amount of rhbmp-2 in infuse sponge can not be accurately measured and it is also difficult to determine that how precisely 1/3 portion was separated from the remaining sponge . the impact of selection bias related to the surgeon 's choice of using dbm in approximately half of the cases also can not be denied . we also believe that the cost - effectiveness of rhbmp-2 and dbm should also be evaluated , which is another limitation of the present study . the use of low - dose rhbmp-2 in anterior cervical fusion is not without risk . however , in comparison to previous reports with high dose bmp placed both inside and outside the cage , a low - dose of bmp placed exclusively within the spacer is associated with lower incidence and severity of complications . placing dbm putty around the bmp sponge does not seem to affect the safety profile of bmp in acfs .

objectivethere are several reports , which documented a high incidence of complications following the use of recombinant human bone morphogenetic protein-2 ( rhbmp-2 ) in anterior cervical fusions ( acfs ) . the objective of this study is to share our experience with low - dose rhbmp-2 in anterior cervical spine.methodswe performed a retrospective analysis of 197 patients who underwent anterior cervical fusion ( acf ) with the use of recombinant human bone morphogenetic protein-2 ( rhbmp-2 ) during 2007 - 2012 . a low - dose rhbmp-2 ( 0.7mg / level ) sponge was placed exclusively within the cage . in 102 patients demineralized bone matrix ( dbm ) was filled around the bmp sponge . incidence and severity of dysphagia was determined by 5 points swal - qol scale.resultstwo patients had prolonged hospitalization due to bmp unrelated causes . following the discharge , 13.2%(n=26 ) patients developed dysphagia and 8.6%(n=17 ) patients complained of neck swelling . more than half of the patients ( 52.9% , n=9 ) with neck swelling also had associated dysphagia ; however , only 2 of these patients necessitated readmission . both of these patients responded well to the intravenous dexamethasone . the use of dbm did not affect the incidence and severity of complications ( p>0.05 ) . clinico - radiological evidence of fusion was not observed in 2 patients.conclusiona low - dose rhbmp-2 in acfs is not without risk . however , the incidence and severity of complications seem to be lower with low - dose bmp placed exclusively inside the cage . packing dbm putty around the bmp sponge does not affect the safety profile of rhbmp-2 in acfs .

INTRODUCTION MATERIALS AND METHODS 1. Implants and BMP 2. Surgical technique 3. Post-operative evaluation and dysphagia calculation 4. Statistical analysis RESULTS DISCUSSION CONCLUSION

periodical nanostructures are of great research interest because of their potential applications in data storage [ 1 - 3 ] as well as in preparing photonic crystals . in order to realize such opportunities , the development of lithography techniques that are capable of fabricating large area periodical nanostructures with reasonable control over their size and periodicity is required . in general , two approaches , namely the top down and the bottom up , have been coined to label the techniques used to generate nanometer - sized structures . the conventional lithographical methods , including electron - beam lithography , photolithography and focused ion beam lithography , are the representative top down approaches widely implemented in manufacturing nano - scale semiconductor devices as well as nanostructures for various materials . however , these techniques often require very high capital investment and involve multiple - step processes , which not only limits the facility accessibility but also results in relatively high operation cost . on the other hand , self - organized growth [ 9 - 11 ] has been demonstrated to be a viable bottom up method for fabricating large area nanostructures with reasonable control of size and shape distributions . these structures can be , in turn , used as templates for building nanometer - scale structures . here , we report a simple fabrication technique capable of producing large area , well - ordered , periodic nanogrids with sufficient size control in the sub-500-nm region . first , the sige films deposited on si substrates by ultrahigh vacuum chemical vapor deposition ( uhvcvd ) were transformed into self - assembled sige nanoisland arrays by thermal annealing . second , the resultant sige nano - island arrays after subjected to subsequent reactive ion etching ( rie ) treatments were found to result in either the quasi - beehive nanostructures or the self - organized nano - grids ( songs ) on si substrates , depending on the conditions of rie processes . first , since the sige thin films were deposited in the uhvcvd system , hence the issue of contamination during the annealing process can be largely minimized . moreover , owing to the fact that no aqueous chemical solution and metallic material were used in the manufacturing procedures , protection of the rie system from major pollution sources is guaranteed . finally , the lithography - less anisotropic etching process can reduce the fabrication cost significantly . figure 1 displays schematically the experimental procedures carried out in this work for fabricating the quasi - beehive si nanostructures . briefly , prior to the growth of sige thin film , the surface of si substrate was cleaned by the standard radio corporation of america ( rca ) procedures . the si wafers were then dipped in dilute hydrofluoric acid to form a passive surface layer , which allowed the wafers to maintain their clean surfaces when transported through air before being introduced into the loadlock chamber of the ultrahigh vacuum chemical vapor deposition ( uhvcvd , anelva sre-612 japan ) system . when the temperature reached 550c and the deposition chamber was pumped to 1.2 10 torr using a turbo molecular pump , the wafers were transferred directly into the deposition chamber from the loadlock chamber . the inlet gas was a mixture of si2h4 ( flow rate : 1 sccm ) and geh4 ( flow rate : 7 sccm ) . the sige epitaxial thin films were grown on the p - type si ( 100 ) substrate at a growth rate of ~8 nm / min with a total thickness of about 100 nm ( fig . . fabrication procedures of quasi - beehive si nanostructures and self - organized nanogrids : a sige thin film is deposited on si substrate ; b sige islands arrays are formed via the annealing treatment ; c then plasma etching ( rie ) ; d finally the self - organized nanostructures are fabricated following the film growth , in situ thermal annealing was carried out at 900c for 30 min in the uhvcvd chamber to form the well - ordered sige nanoislands , as illustrated schematically in fig . the annealed sige / si assembles were then placed into the reactive ion etching ( rie , tel te5000 japan ) chamber and , subjected to rie using cf4 ( 40 sccm ) and argon ( 200 sccm ) at an rf power of 200 w for 3 , 5 , or 10 min , respectively , as depicted in fig . the effect of ion bombardment was primarily determined by the ion energy , which , in turn , was dependent on the rf power and the self - bias . during the rie process , when the reactive ions passed through the sheath region , the positive ions were accelerated under the inserted electric field to produce the ion bombardment effect that , in turn , etches the target materials to form the quasi - beehive si nanostructures and the songs , as shown in fig . the high - resolution cross - sectional transmission electron microscopy ( xtem ) image of thin film was analyzed with an operating voltage of 200 kv . the composition of the films was analyzed by auger electron spectroscopy ( aes , vg scientific microlab 310f ) . the auger analyses were performed in a physical electronics-650 scanning auger microprobe with a background pressure of 1.0 10 torr . high - resolution x - ray diffraction was used to determine the phase formation and crystallographic structure of all samples . high - resolution reciprocal space mapping ( hrrsm ) was applied to observe the structural features of sige thin films . the characteristics of the surface morphology of the si substrate as well as that of the sige films were observed by field - emission scanning electron microscopy ( fesem ) . atomic force microscopy ( afm ) was also used to image the surface morphologies of the fabricated samples . a xtem image of the as - grown sige thin film is displayed in fig . the interface of sige / si is atomically smooth and flat with no sign of existence of any misfit dislocations , indicating the completely coherent epitaxial relations between the film and substrate . 2 reveal that the ge concentration is distributed uniformly throughout the film on si substrates . the averaged ge composition of the as - grown sige thin film was estimated to be around 24.4% . it is surprising that , in the present study , the apparent pseudomorphic growth of the dislocation - free sige strained layer can maintain to a much larger critical thickness than those reported previously . it is believed that the relative low growth temperature might have played a significant role . as will be described in more detail below , the strain relaxation and accompanied surface roughening induced by subsequent thermal annealing exhibited in the current films also displayed marked differences comparing to those reported by timbrell et al . and ozkan et al . , where generation of dislocations and accompanied orientation change in surface roughening morphologies were evidently observed the cross - sectional hrtem image of sige / si sample prior to thermal annealing . inset compositions of si and ge elements are confirmed by auger analysis figure 3 shows the typical top - view image observed by fesem for sige films annealed at 900c for 30 min . it is clear that the high temperature annealing - induced surface roughening has resulted in the formation of sige island grids along the ( 100 ) and ( 010 ) directions . the cross - sectional image of sige islands observed by xtem displayed in the inset of fig . 3 further indicates that in the vicinity of the interface between the sige islands and si substrate remains essentially free of relaxation dislocations during the annealing process . we first note that , unlike those reported by xie et al . where the ge islands have been deliberately manipulated to nucleate on the intersections of misfit dislocation networks generated at the interface of an underneath sige strain layer and si substrate , the formation of the present sige island array must have arisen from very different mechanisms . on the other hand , floro et al . have demonstrated that heteroepitaxial stress between the sige layer and si substrate can not only result in coherent islanding of sige layer but also have played the primary role in island shape transitions . however , we note that the abovementioned reports were all derived based on observations performed during deposition , and the islanding of the sige layer may behave differently from that results from the post - deposition annealing . indeed , as pointed out by jesson et al . that , in the case of annealed sixge1x films , especially at high supersaturations , the strain - induced roughening can bypass faceting and result in a transition with characteristics of the asaro - tiller - grinfeld ( atg ) instability . within the context of the atg instability , the strain field - induced surface roughening of semiconductor films is manifested by the appearance of continuous ripple morphology as displayed in fig . the reason for this is that the sixge1x film is under compressive strain with ~ 0.04 ( 1x ) such that an undulation in the surface allows lattice planes to relax toward the ripple peaks . this lowers the elastic energy stored in the strained film but , at the same time , increases the surface energy relative to the planar layer . the competition between these two factors , in turn , gives rise to a condition for a minimum undulation length scale c for which the morphology is stable . here , c can be expressed as following : with , and being the shear modulus , the surface energy density , the poisson s ratio of the sige layer , and the misfit stress , respectively . taking ~ 40 gpa , ~ 1 j / m , ~ 0.25 , and ~ 1.4 gpa one obtains a c ~ 170 nm , which is much smaller than the averaged island spacing displayed in the inset of fig . 3 ( ~400500 nm ) and those reported in ref . therefore , the obtained morphology can be indeed explained by the strain - induced roughening governed by the mechanism of atg instability . sem observation the surface morphological image of sige thin film at an annealing temperature of 900c . inset the xtem image of sige nanoislands on si substrate as has been pointed out by jesson et al . , since there is no energy barrier to roughening except for mass transport along the surface , one of the consequences of the atg instability - induced islanding is the formation of cusp . in order to elucidate this effect , fig . 4 shows the relationship of the depth of self - organized nanoislands as a function of the annealing temperature for a fixed annealing time of 30 min . in this analysis , areas of 20 20 m of the annealed sige thin films are measured at various annealing temperatures . based on these shape analyses , there are only sparsely distributed convex structures on the surface of the as - grown sige film . even at the annealing temperature of 700c , there are only few convex structures observed , indicating that at temperatures lower than 700c the strain - induced roughening is hindered by either the lack of supersaturation or insufficient time for adequate mass transport . nevertheless , as the annealing temperature is above 800c the measured depth of the sige islands increases rapidly and reaches an average height of ~100 nm at 900c , as shown in the inset of fig . 3 with the average depth being about the original film thickness . at this stage , we believe that film must have relaxed most of its strain . the depth of the self - organized nanoislands as a function of the annealing temperature . inset the shape analysis of sige thin film with the annealing treatment at 900c in order to obtain a more quantitative measure on the evolution of the structural quality upon annealing , we chose the asymmetric ( 113)-reflection and the symmetric ( 004)-reflection hrrsm to compare the characteristics of the crystallographic structure of the as - grown sige sample with the one annealed at 900c for 30 min . figs . 5a , 5b reveal typical hrrsm around the asymmetric ( 113 ) reflections of the as - grown sige sample and the annealed sample , respectively . the hrrsm images are plotted on a logarithmic scale as a function of the reciprocal lattice vector parallel ( qx ) and perpendicular ( qy ) to the surface . from fig . 5a , it is clear that the scattering distributions of the si substrate and that of the sige thin film are in perfect alignment , indicating that the sige thin film is completely commensurate with the si substrate . moreover , the scattering distributions of the sige film and substrate are very narrow , indicative of the high crystalline quality and the low defect density in the as - grown sige film . on the other hand , fig . 5b indicates that , after annealing at 900c for 30 min , the scattering distributions of both sige film and si substrate broadened in two directions , suggesting that significant degradation in crystallinity may have occurred in both of the sige film and si substrate . this is consistent with the characteristics of atg instability where the cusp regions are under tremendous compressive strain and the transported mass is rapidly accumulated at the island tips . the former is expected to have effects on the substrate , while the latter is certainly detrimental to the crystallinity of the resultant islands . 6 , where the apparent degradation in the crystalline structure of the annealed sige islands ( fig . 6b ) is clearly demonstrated by comparing that with the as - deposited one ( fig . it is also noted that the center of the scattering distribution of the sige film moves toward that of the si substrate , indicating that the annealing processes has been accompanied by significant strain relaxation . based on the current hrrsm analyses , the as - grown sige sample is apparently fully strained , and about 36% of the strain has been relaxed by annealing the sample at 900c for 30 min . asymmetric ( 113 ) hrrsm of a the as - grown sige thin film and , b the annealed sige thin film at 900c for 30 min the hrtem images of the a as - grown sige film and b sige film annealed at 900c for 30 min . the results clearly indicate the degradation of crystalline structure resulted from the atg instability - induced surface roughening driven by strain relaxation being inspired by defective structure revealed in the hrrsm analyses presented in fig . 5 , we have further tried to use the annealed sample as the template for creating various self - organized nanostructures . 7a ) and that of samples being first annealed at 900c for 30 min followed by rie etching with cf4 gas for 3 , 5 , and 10 min ( fig . the surface morphology of as - grown sige sample is very smooth with a surface roughness of ~0.32 nm over a 20 20 m area ( fig . 7a ) . after annealing at 900c ( 30 min ) and rie for 3 min , small cavities are evidently generated ( fig . 3 . note here that , when compared with the afm image shown in fig . 7b , e the regions with the convex dome shape appearance are in fact cavities while the light curvy lines are the ridges of the cavities . in their studies , the etching rate of si0.8ge0.2 is more than two times faster than that of pure si when using cf4 as the primary rie gas . in fact , it is generally conceived that ge is normally more susceptible to fluorine and , as a result , higher amount of fluoride ( from cf4 gas ) often results in higher chemical etching probability and more severe depredation in the original structural arrangements . in any case , 7 evidently displays that with the increasing rie time the nano - cavities grow bigger and deeper and finally form a quasi - beehive surface structure on the si substrate . the results indicate that the amount and size of cavities and , hence , the details of the quasi - beehive structure can be closely monitored by controlling the rie time . sem top - view images of sige thin films with a as - grown sample , b 900c annealed and 1 min rie , c 900c annealed and 5 min rie , and d 900c annealed and 10 min rie . e the sem and f afm image of the quasi - beehive si nanostructures to fully realize the application potential , we have further tried to develop methods of creating the nanostructures with more regular spatial arrangements . to this respect , instead of using the etching gases commonly used in the rie system , we changed to use ar plasma treatment on the annealed island array . to our surprise , even with as short as 1 min of ar plasma treatment , the highly concentrated and regularly distributed nanogrids consisting of nano - cavities and nano - tapers are clearly visible on si substrate , as shown in fig . the average diameter , height , and density of the nanocavities were ~400600 nm , ~5080 nm , and ~34 m , respectively . with a slight increase of ar plasma treatment to 3 min , a significant larger scale of nano - grids it is noted that ar plasma treatment not only is very efficient in removing the defective self - organized sige islands formed after annealed at high temperatures but also is capable of maintaining the original self - organized patterns to later stages treatment . it is not clear at present why ar plasma treatment can make such a dramatic difference when compared to that treated by more traditional rie processes . presumably , since ar plasma etching is a more physical mean and no complicated chemical reactions are involved , the etching is more isotropic and is easier to maintain the original structural arrangements . sem top - view images of sige thin films with a 900c annealed and 1 min ar plasma , b 900c annealed and 3 min ar plasma . c 2-d and d 3-d afm images of the self - organized nanogrids ( a ) in any case , the present study has not only presented a detailed account for the formation of the self - organized nanoislands arrays by thermal annealing , but also has indicated a very efficient method of producing the much desired self - organized nano - grids ( songs ) on si substrate by using the self - organized nanoisland arrays as the sacrificing mask . we emphasize that the present process has completely avoided the usage of any lithographic process , which should be of significant practical importance in future applications . experiments using these songs nanostructure as the template substrate to fabricate nanostructures of various interesting materials are underway . in summary , we have shown that it is possible to fabricate self - organized nanogrids arrays on si substrate by simply combining the thermal annealing and rie ( or ar plasma ) processes on the sige layers grown on si substrate . the compositions and structures of sige thin film are characterized by using auger and xtem techniques to reveal island formation mechanism . the results indicate that the self - organized sige islands were formed via the asaro - tiller - grinfeld instability - induced surface roughening driven by the strain established between the heteroepitaxy sige film and the si substrate . a well - ordered self - organized nanogrids structure formed on the si substrate was successfully demonstrated by treating the annealed sige film in ar plasma for as short as only 1 min and without resorting to any lithographical means . various values ( ranging from 0.22 to 0.28 ) of the poisson s ratio for sixge1x films have been reported . here , this work was partially supported by the national science council of taiwan , under grant no . jyj is supported in part by the national science council of taiwan and the moe - atp program operated at nctu . ching - liang dai ( department of mechanical engineering , national chung hsing university , taiwan ) and dr . jiann shieh and hung - min chen ( national nano device laboratories , taiwan ) for their useful discussions . assistances from fu - kuo hsueh for uhvcvd , chiung - chih hsu for tem , jie - yi yao for xrd and chih - ming wu for rie technical supports in national nano device laboratories are also gratefully acknowledged . this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited . this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited .

a lithography - free method for fabricating the nanogrids and quasi - beehive nanostructures on si substrates is developed . it combines sequential treatments of thermal annealing with reactive ion etching ( rie ) on sige thin films grown on ( 100)-si substrates . the sige thin films deposited by ultrahigh vacuum chemical vapor deposition form self - assembled nanoislands via the strain - induced surface roughening ( asaro - tiller - grinfeld instability ) during thermal annealing , which , in turn , serve as patterned sacrifice regions for subsequent rie process carried out for fabricating nanogrids and beehive - like nanostructures on si substrates . the scanning electron microscopy and atomic force microscopy observations confirmed that the resultant pattern of the obtained structures can be manipulated by tuning the treatment conditions , suggesting an interesting alternative route of producing self - organized nanostructures .

Introduction Experimental Details Results and Discussion Conclusion Footnotes Acknowledgments Open Access

noise - induced hearing loss ( nihl ) is a major public health problem , and its treatment with traditional therapy strategies is often unsuccessful because of the blood labyrinth barrier ( blb ) . due to tight junctions between cells , substances in the systemic circulation with potentially therapeutic effects additionally , the cochlea is a closed space and minor changes in the endolymph and perilymph can affect its function . therefore , delicate approaches are required to avoid possible damage caused by the delivery method itself . currently , drugs are commonly administered systemically , but there are some disadvantages of systematic use , such as the inability to get an ideal concentration in the inner ear , the possible occurrence of some deleterious side effects , and lack of clearance of pharmacokinetics from the inner ear . in recent years , many researchers have focused on local delivery for inner ear diseases , and some applications and therapies have been shown to be clinically relevant , so it is necessary to encourage further development of safe and reliable mechanisms for the direct delivery of compounds into the inner ear . intratympanic delivery can be accomplished via perfusion of the middle ear with the goal of diffusion through the round window membrane ( rwm ) into the fluid spaces of the inner ear . this method , introduced more than 50 years ago , remains in common use in the treatment of inner ear diseases . in recent years , the advanced technologies have been used which include hydrogels , nanoparticles , and poloxamers . direct intracochlear drug delivery involves the placement of drugs within the cochlear perilymphatic spaces via a cochleostomy in the surrounding bone or the rwm . this mode of delivery allows drugs to reach their intended targets more directly than with systemic delivery . molecules perfused into a perilymphatic compartment have direct access to the cells of the inner ear . methods of delivery include direct perfusion using micropumps and osmotic pumps . however , with both intratympanic delivery and direct intracochlear drug delivery , there are disadvantages . because direct intracochlea drug delivery requires surgical implantation , there are patients who can not accept it and there are also doctors who are not comfortable performing it . since the beginning of the 1990s , attention from various research groups has focused on an alternative to polymeric nanoparticles ; the solid lipid nanoparticles ( slns ) . basically , lipids can be used that are well - tolerated by the body ( e.g. , glycerides composed of fatty acids , which are present in emulsions for parenteral nutrition ) . large scale production can be undertaken in a cost - effective and relatively simple manner , using high - pressure homogenization to create slns . an alternative approach is the production of slns via microemulsions . because slns can be targeted to specified cell populations , and because they are biodegradable , traceable in vivo , and equipped with controlled drug / gene release , slns could overcome the disadvantages of local drug delivery to the inner ear . regarding nihl , research has shown that oxidative stress plays an important role in noise - induced cochlear injury , and these studies have also found that a number of antioxidants and cell death - inhibiting compounds can ameliorate the hearing loss associated with acoustic trauma . edaravone ( 1-phenyl-3-methyl-5-pyrazolone ) is the first free radical scavenger used in clinical practice in japan , where it has been used to treat acute cerebral infarction . there have been some studies showing the effects of edaravone on the inner ear disease . takemoto et al . , reported that preexposure by perilymphatic application of edaravone reduced nihl in guinea pigs . thus , in the present study , we administered edaravone to guinea pigs before and after noise exposure , and we investigated the advantages of the slow - release effects of edaravone slns for hearing function and hair cell protection . in addition , at various time points after noise exposure we measured levels of ros in the cochlea to observe the capacity for the free radical scavenging of edaravone solution and edaravone slns , as measured by electron spin resonance ( esr ) technology . ninety - six adult female albino guinea pigs ( 250300 g ) were obtained from the central laboratory of the naval general hospital in beijing , china . this study was performed in accordance with the public health service policy on the humane care and use of laboratory animals . the institutional animal care and use committee of our institution approved the animal use protocol . all the animals were anesthetized with a mixture of 40 mg / kg ketamine and 1 ml / kg xylazine administered intramuscularly . the animals were placed on the operating table with a heated pad to maintain a rectal temperature of 37 1c . the guinea pigs were divided into five groups : group a , animals exposed to noise and not treated with drugs ; group b , animals exposed to noise and treated with edaravone solution by intravenous injection ; group c , animals exposed to noise and treated with edaravone solution by intratympanic injection ; group d , animals exposed to noise and treated with edaravone slns by intravenous injection ; and group e , animals exposed to noise and treated with edaravone slns by intratympanic injection . all the exposures were conducted in an inhalation chamber that consisted of a round glass cage ( 30 cm 70 cm ) . for noise exposure , we used the collected stationary noise of a naval vessel , and the main energy of the noise was distributed at 0.254 khz , with the main peak at 500 and 1,000 hz . the signal was amplified with a power amplifier ( panasonic sa - dv150 ) and was delivered via stereo speakers ( t and t , 8 naval w , technology of england ) . the animals were exposed to 110 1 db sound pressure level ( spl ) for 2 h / d for a total of 4 days . three animals were exposed at the same time , and each of the animals was placed in a separate cage and allowed free access to food and water throughout the exposure . the sound levels were calibrated and measured with a volume level meter at multiple locations within the sound chamber , to ensure uniformity of the stimulus . after noise exposure on day 1 , the animals were immediately anesthetized . then , their acoustic vesicles were exposed through a sterile retroauricular incision , and a 0.15 mm 0.15 mm hole was drilled into each acoustic vesicle , through which was injected 0.1 ml of edaravone solution or slns into the middle ear . after drug delivery , the holes were sealed with bone wax , and the animals lay face up for 2 hours . intravenous injection was performed through a unilateral femoral vein , at the same dosage as the intratympanic injections . click - induced auditory brainstem response ( abr ) was measured for both ears of all of the guinea pigs 1 day before and 1 , 4 , and 6 days after noise exposure and drug delivery . the animals were lightly anesthetized with a mixture of 40 mg / kg ketamine and 1 ml / kg xylazine , administered intramuscularly prior to abr measurement , and they were lightly restrained in a wooden tube during the recording procedure . differential needle electrodes were placed subcutaneously below the test ear ( reference ) and at the vertex ( active ) . one thousand and twenty - four tone presentations given at a rate of 12.5/s , were averaged using a microcomputer and custom software to obtain a waveform . the hearing threshold was defined as the lowest stimulus intensity that produced a reliable peak iii or iv in abr waveforms . after abr measurement , the guinea pigs were immediately decapitated , and the bilateral temporal bones , open acoustic capsules , and cochleas were extracted . then , the blood was quickly washed away with ice water and 10 mmol / l phosphate buffered saline ( pbs ) . the crust of the cochlea was opened under an anatomical microscope and placed in a test tube and deep frozen in liquid nitrogen ( ln ) . the test conditions were as follows : microwave frequency x - wave band ( 9.45 ghz ) , microwave power 20 mw , modulation frequency 100 khz , modulation argument 5 gauss , scanning time 60 seconds , and scanning duration 500 gauss . testing below 77 k , scanning one at a time , the acquired signal was amplified by 1.0 10 with a computer . the guinea pigs were decapitated after hearing function measurement , and the temporal bone was obtained from a hole drilled in the apex of the cochlea , opening the round window and oval window and exposing the crista ampullaris at the same time . a solution of 0.5% agno3 was perfused into the hole of the cochlea apex three times , and a 4% methanol solution was then infused using the same method . subsequently , the basal membrane was taken under a dissecting microscope , isolated from the whole cochlea , and sealed with glycerin , under an optical microscope to observe the morphology of ohcs and any injury . the light microscope field was 200 , the lossin ohcs were counted from the apex to the base each with a 0.24 mm reticule . the average ohc loss of each 0.24 mm segment was plotted and calculated along the entire length of the cochlea as a cytocochleogram for each group . statistical differences were evaluated for significance based on the mean and variance data for the ohcs from the apex to base in the cochlea . all data were analyzed statistically by two - way analysis of variance ( anova ) using the statistical package for social sciences ( spss 11.5 ) software . data are expressed as mean standard deviation ( sd ) and differences were considered statistically significant when p < 0.05 . ninety - six adult female albino guinea pigs ( 250300 g ) were obtained from the central laboratory of the naval general hospital in beijing , china . this study was performed in accordance with the public health service policy on the humane care and use of laboratory animals . the institutional animal care and use committee of our institution approved the animal use protocol . all the animals were anesthetized with a mixture of 40 mg / kg ketamine and 1 ml / kg xylazine administered intramuscularly . the animals were placed on the operating table with a heated pad to maintain a rectal temperature of 37 1c . the guinea pigs were divided into five groups : group a , animals exposed to noise and not treated with drugs ; group b , animals exposed to noise and treated with edaravone solution by intravenous injection ; group c , animals exposed to noise and treated with edaravone solution by intratympanic injection ; group d , animals exposed to noise and treated with edaravone slns by intravenous injection ; and group e , animals exposed to noise and treated with edaravone slns by intratympanic injection . all the exposures were conducted in an inhalation chamber that consisted of a round glass cage ( 30 cm 70 cm ) . for noise exposure , we used the collected stationary noise of a naval vessel , and the main energy of the noise was distributed at 0.254 khz , with the main peak at 500 and 1,000 hz . the signal was amplified with a power amplifier ( panasonic sa - dv150 ) and was delivered via stereo speakers ( t and t , 8 naval w , technology of england ) . the animals were exposed to 110 1 db sound pressure level ( spl ) for 2 h / d for a total of 4 days . three animals were exposed at the same time , and each of the animals was placed in a separate cage and allowed free access to food and water throughout the exposure . the sound levels were calibrated and measured with a volume level meter at multiple locations within the sound chamber , to ensure uniformity of the stimulus . then , their acoustic vesicles were exposed through a sterile retroauricular incision , and a 0.15 mm 0.15 mm hole was drilled into each acoustic vesicle , through which was injected 0.1 ml of edaravone solution or slns into the middle ear . the holes were sealed with bone wax , and the animals lay face up for 2 hours . intravenous injection was performed through a unilateral femoral vein , at the same dosage as the intratympanic injections . click - induced auditory brainstem response ( abr ) was measured for both ears of all of the guinea pigs 1 day before and 1 , 4 , and 6 days after noise exposure and drug delivery . the animals were lightly anesthetized with a mixture of 40 mg / kg ketamine and 1 ml / kg xylazine , administered intramuscularly prior to abr measurement , and they were lightly restrained in a wooden tube during the recording procedure . differential needle electrodes were placed subcutaneously below the test ear ( reference ) and at the vertex ( active ) . one thousand and twenty - four tone presentations given at a rate of 12.5/s , were averaged using a microcomputer and custom software to obtain a waveform . the hearing threshold was defined as the lowest stimulus intensity that produced a reliable peak iii or iv in abr waveforms . after abr measurement , the guinea pigs were immediately decapitated , and the bilateral temporal bones , open acoustic capsules , and cochleas were extracted . then , the blood was quickly washed away with ice water and 10 mmol / l phosphate buffered saline ( pbs ) . the crust of the cochlea was opened under an anatomical microscope and placed in a test tube and deep frozen in liquid nitrogen ( ln ) . the test conditions were as follows : microwave frequency x - wave band ( 9.45 ghz ) , microwave power 20 mw , modulation frequency 100 khz , modulation argument 5 gauss , scanning time 60 seconds , and scanning duration 500 gauss . testing below 77 k , scanning one at a time , the acquired signal was amplified by 1.0 10 with a computer . the guinea pigs were decapitated after hearing function measurement , and the temporal bone was obtained from a hole drilled in the apex of the cochlea , opening the round window and oval window and exposing the crista ampullaris at the same time . a solution of 0.5% agno3 was perfused into the hole of the cochlea apex three times , and a 4% methanol solution was then infused using the same method . subsequently , the basal membrane was taken under a dissecting microscope , isolated from the whole cochlea , and sealed with glycerin , under an optical microscope to observe the morphology of ohcs and any injury . the light microscope field was 200 , the lossin ohcs were counted from the apex to the base each with a 0.24 mm reticule . the average ohc loss of each 0.24 mm segment was plotted and calculated along the entire length of the cochlea as a cytocochleogram for each group . statistical differences were evaluated for significance based on the mean and variance data for the ohcs from the apex to base in the cochlea . all data were analyzed statistically by two - way analysis of variance ( anova ) using the statistical package for social sciences ( spss 11.5 ) software . data are expressed as mean standard deviation ( sd ) and differences were considered statistically significant when p < 0.05 . the auditory thresholds before noise exposure were essentially equivalent in all of the ears , and there were no significant differences among the groups . the greatest threshold shift was approximately 50 db spl on the 4 day ; and at our last observation time point on the 6 day , the abr threshold still had not recovered to normal and was approximately 50 db spl . noise - induced threshold shifts ( tts ) , measured 1 day post - noise exposure , were not significantly reduced by treatment with the drug , neither in the local drug delivery groups , in the systematic drug delivery groups , nor in the solution groups or the slns groups . nihl , measured 6 days post - noise , was substantially reduced by treatment with edaravone slns administered by intratympanic injection [ figure 1 ] . only the edaravone slns by local delivery group demonstrated a significant attenuation of the noise - induced threshold shift on the 4 day following exposure . changes in hearing threshold , measured using auditory brainstem responses in guinea pigs . the animals were divided into five groups : noise alone ( n , control group , n = 6 ) ; noise + iv eda solution ( n + iv sol , n = 18 ) ; noise + it eda solution ( n + it sol , n = 18 ) ; noise + iv eda slns ( n + iv slns , n = 18 ) ; and noise + it eda slns ( n + it slns , n = 18 ) . data are presented as the mean sd , and differences were analyzed with anova for repeated measures ( two - way ) , followed by the student spl was statistically different among the time groups after noise exposure to normal animals and statistically different from the drug administered groups compared to normal animals . the sound pressure level of the intravenous injection of edaravone solution , intratympanic injection of edaravone solution , and intravenous injection of edaravone slns group remained elevated , while the intratympanic injection of edaravone slns group showed some recovery on day 4 and 6 . * p < 0.05 , p < 0.01 . sln : solid lipid nanoparticle , eda : edaravone . compared to normal animals , the thresholds of all groups at all time points after noise exposure were significant ( p < 0.05 ) . between group a and c there was no statistically significant difference ( p = 0.146 ) ; while between group a and b and groupd and e , there were statistically significant differences ( p < 0.01 ) . between group e and the other four groups , there werestatistically significant differences ( p < 0.01 ) . compared to group b , the hearing threshold of group c was significantly lower ( p < 0.01 ) and that of group d was higher ( p = 0.039 ) . the esr spectrum of guinea pig cochleas had three main peaks , peak i ( e es ii((e e and iii ( d e [ figure 2 ] . peak i was a background peak of resonance , which appeared in all of the specimens for reasons that are unclear , not only in the cochleas , but also in all of the other tissues of animals without peaks found in this site . peak ii was called peak o , peak iii was called peak o. we could not define the ros value from peak iii precisely because peak coenzyme q was mixed with this peak , so we choose peak ii as the measurement peak to calculate the value of free radicals . we adopted h ( cm ) to represent the absolute value of ros , which was calculated by the distance from the crest of the peak to the basal line , and we adopted w ( g ) to represent the weight of the cochlea , so we represented the relative value of ros as ros . the changes in the ros of the cochleas of the five groups are shown in figure 3 . ros spectra of the five animal groups shown in ( a ) ros spectra of normal animals cochleas . ( b - d ) ros spectra of animals at 1 , 4 , and 6 days after noise exposure . ( e ) ros spectra of animals at 1 day after eda solution ( iv ) . ( f ) ros spectra of animals at 1 day after eda solution ( it ) . ( g ) ros spectra of animals at 6 days after eda slns ( iv ) . ( h , i ) ros spectra of animals at 1 and 6 days after eda slns ( it ) . animal grouping , noise exposure methods , and statistical treatment are consistent with figure 1 . ros = relative value of ros , ros = h / w ( cm / g ) . ros was statistically different by time after noise exposure compared to normal animals , and statistically different by drug administered group from the noise exposure group . the ros level of the intravenous injected edaravone solution and intravenous injected edaravone slns groups remained elevated on the 1 day , and the intratympanic injected edaravone solution and intravenous injected edaravone slns groups remained elevated on the 4 day , while the edaravone slns groups showed some recovery on the 6 day . * /p < 0.05 , p < 0.01 . before noise exposure , the ros in the cochlea was approximately 26.52 cm / g , and it immediately increased after noise exposure to 126.39 cm / g . on the 4 day after noise exposure it achieved a maximum of 152.59 cm / g , but on the 6 day , the relative value of ros was decreased to near the normal level . compared to group a , ros was significantly lower on the 1 day in groups c and e , on the 4 day in groups b and e , and on the 6 day in groups c and e. missing hair cells were observed and counted with agno3 staining [ figure 4 ] , and the percentages of ohc loss were evaluated as the mean loss for each treatment group [ figure 5 ] . from the pictures , we can see the inner hair cells ( ihc , ed group from the noise exposure group . the ros level of the intravenous injected edaravone solu ) . ( b - d ) hair cell loss of animals at 1 , 4 , and 6 days after noise exposure . ( e ) hair cell loss of animals on the 6 day after eda solution ( iv ) . ( f ) hair cell loss of animals on the 6 day after eda slns . changes in hair cell loss by agno3 staining in guinea pigs . by counting hair cells , we found that the percentages of outer hair cell ( ohc ) loss showed no difference among the groups . the auditory thresholds before noise exposure were essentially equivalent in all of the ears , and there were no significant differences among the groups . the greatest threshold shift was approximately 50 db spl on the 4 day ; and at our last observation time point on the 6 day , the abr threshold still had not recovered to normal and was approximately 50 db spl . noise - induced threshold shifts ( tts ) , measured 1 day post - noise exposure , were not significantly reduced by treatment with the drug , neither in the local drug delivery groups , in the systematic drug delivery groups , nor in the solution groups or the slns groups . nihl , measured 6 days post - noise , was substantially reduced by treatment with edaravone slns administered by intratympanic injection [ figure 1 ] . only the edaravone slns by local delivery group demonstrated a significant attenuation of the noise - induced threshold shift on the 4 day following exposure . changes in hearing threshold , measured using auditory brainstem responses in guinea pigs . the animals were divided into five groups : noise alone ( n , control group , n = 6 ) ; noise + iv eda solution ( n + iv sol , n = 18 ) ; noise + it eda solution ( n + it sol , n = 18 ) ; noise + iv eda slns ( n + iv slns , n = 18 ) ; and noise + it eda slns ( n + it slns , n = 18 ) . data are presented as the mean sd , and differences were analyzed with anova for repeated measures ( two - way ) , followed by the student spl was statistically different among the time groups after noise exposure to normal animals and statistically different from the drug administered groups compared to normal animals . the sound pressure level of the intravenous injection of edaravone solution , intratympanic injection of edaravone solution , and intravenous injection of edaravone slns group remained elevated , while the intratympanic injection of edaravone slns group showed some recovery on day 4 and 6 . * p < 0.05 , p < 0.01 . sln : solid lipid nanoparticle , eda : edaravone . compared to normal animals , the thresholds of all groups at all time points after noise exposure were significant ( p < 0.05 ) . between group a and c there was no statistically significant difference ( p = 0.146 ) ; while between group a and b and groupd and e , there were statistically significant differences ( p < 0.01 ) . between group e and the other four groups , there werestatistically significant differences ( p < 0.01 ) . compared to group b , the hearing threshold of group c was significantly lower ( p < 0.01 ) and that of group d was higher ( p = 0.039 ) . the esr spectrum of guinea pig cochleas had three main peaks , peak i ( e es ii((e e and iii ( d e [ figure 2 ] . peak i was a background peak of resonance , which appeared in all of the specimens for reasons that are unclear , not only in the cochleas , but also in all of the other tissues of animals without peaks found in this site . peak ii was called peak o , peak iii was called peak o. we could not define the ros value from peak iii precisely because peak coenzyme q was mixed with this peak , so we choose peak ii as the measurement peak to calculate the value of free radicals . we adopted h ( cm ) to represent the absolute value of ros , which was calculated by the distance from the crest of the peak to the basal line , and we adopted w ( g ) to represent the weight of the cochlea , so we represented the relative value of ros as ros . thus , ros = h / w ( cm / g ) . the changes in the ros of the cochleas of the five groups are shown in figure 3 . ros spectra of the five animal groups shown in ( a ) ros spectra of normal animals cochleas . ( b - d ) ros spectra of animals at 1 , 4 , and 6 days after noise exposure . ( e ) ros spectra of animals at 1 day after eda solution ( iv ) . ( f ) ros spectra of animals at 1 day after eda solution ( it ) . ( g ) ros spectra of animals at 6 days after eda slns ( iv ) . ( h , i ) ros spectra of animals at 1 and 6 days after eda slns ( it ) . animal grouping , noise exposure methods , and statistical treatment are consistent with figure 1 . ros = relative value of ros , ros = h / w ( cm / g ) . ros was statistically different by time after noise exposure compared to normal animals , and statistically different by drug administered group from the noise exposure group . the ros level of the intravenous injected edaravone solution and intravenous injected edaravone slns groups remained elevated on the 1 day , and the intratympanic injected edaravone solution and intravenous injected edaravone slns groups remained elevated on the 4 day , while the edaravone slns groups showed some recovery on the 6 day . * /p < 0.05 , p < 0.01 . before noise exposure , the ros in the cochlea was approximately 26.52 cm / g , and it immediately increased after noise exposure to 126.39 cm / g . on the 4 day after noise exposure it achieved a maximum of 152.59 cm / g , but on the 6 day , the relative value of ros was decreased to near the normal level . compared to group a , ros was significantly lower on the 1 day in groups c and e , on the 4 day in groups b and e , and on the 6 day in groups c and e. missing hair cells were observed and counted with agno3 staining [ figure 4 ] , and the percentages of ohc loss were evaluated as the mean loss for each treatment group [ figure 5 ] . from the pictures , we can see the inner hair cells ( ihc , ed group from the noise exposure group . the ros level of the intravenous injected edaravone solu ) . ( b - d ) hair cell loss of animals at 1 , 4 , and 6 days after noise exposure . ( e ) hair cell loss of animals on the 6 day after eda solution ( iv ) . ( f ) hair cell loss of animals on the 6 day after eda slns . changes in hair cell loss by agno3 staining in guinea pigs . by counting hair cells , we found that the percentages of outer hair cell ( ohc ) loss showed no difference among the groups . ros induced inner ear injury primarily occurs via three pathways : ( 1 ) oxidizing of lipid molecules and protein molecules by kinds of cellular membranes ( cms ) , thereby influencing the stability of cms ; ( 2 ) blocking of ion transmission of cms , leading to disequilibrium of calcium and other ions , further interfering with signal conduction inside and outside the cells ; ( 3 ) oxidization of organelles , especially mitochondria , resulting in energy metabolism disturbance , generating more free radicals and resulting in a vicious cycle . all molecular injuries appear morphologically as hair cell changes and finally decrease hearing function . in comparison to a previous study of edaravone by japanese researchers , the auditory functional results from this study with edaravone solution did not demonstrate similar protective effects of the drug against exposure to noise . however , edaravone slns by local administration showed protective effects on the cochlea from noise exposure . these results demonstrate that edaravone has protective effects on the cochlea against noise exposure , but because intravenous injection can not achieve a sufficiently high concentration , and edaravone solution can not be sustained long enough in the inner ear , and these groups could not achieve ideal protective effects . this study directly detected the changes in ros in the cochlea after noise exposure , generating evidence of relationships among noise exposure , ros generation , hearing loss , and hair cell injury . in this study , we did not use free radical capture agents , such as 5,5-dimethyl-1-pyrroline n - oxide ( dmpo ) or 5-(diethoxyphosphoryl)-5-methyl-1-pyrroline n - oxide ( depmpo ) . we considered that one agent could capture only one corresponding free radical , while noise can induce many kinds of free radicals , so we chose esr technology without capture agents to assess all of the changes in ros in the cochlea after noise exposure . in this study , we detected little ros formation in the cochleas of normal guinea pigs , and the signals of ros were very weak . after noise exposure , the signal of ros increased quickly , reached a peak on the 4 day , and decreased to near normal levels by the 6 day . via drug administration intratympanic administration is better than systematic use and results in slower release of the dosage than from a solution . compared to auditory function , the ros generation in animals on the 1 day following an intratympanic edaravone solution injection was significantly inhibited , similar to the results for the intratympanic edaravone sln injection . this finding demonstrates that the drug is useful for inhibiting noise - induced reactive oxygen species ( ros ) generation in the cochlea ; also , the abr threshold changes were affected not only by ros injury , but also by some other mechanisms . in this study , the ros generation in the animals on the 4 and 6 days by intratympanic edaravone solution injection was not inhibited effectively , similar to the results for the animals without drug treatment . this finding demonstrates that slns have a detectable slow release effect in intratympanic topical use , and the effects have advantages for inhibiting ros generation in the cochlea . in the morphology study , we did not find differences among the noise exposure groups and the drug delivery groups , and we also did not find differences among the two dosages and two delivery methods . we believe that we did not observe protective effects of edaravone on morphology by agno3 staining , perhaps because agno3 staining was not suitable for calculating the hair cell loss ratio or , because this method could not draw a clear distinction between hair cell loss and cilium disorders . however , it might also be possible that edaravone did not have protective effects against noise - induced hair cell loss . therefore , our next study will use a well received and efficient morphology method to investigate this surprising result . there are relationships among the drug delivery methods , the drug dosage forms , and the protective effects on the cochlea against noise exposure . our edaravone slns demonstrate sustained release of edaravone to the inner ear over a 6-day period by acoustic vesicle injection to the rwm . the edaravone slns can inhibit ros generation in cochleas after noise exposure and decrease hearing thresholds as measured by abr . these encouraging results support further investigation of slns as a novel delivery method for local drug administration to the inner ear .

background : antioxidants and the duration of treatment after noise exposure on hearing recovery are important . we investigated the protective effects of an antioxidant substance , edaravone , and its slow - release dosage form , edaravone solid lipid nanoparticles ( slns ) , in steady noise - exposed guinea pigs.methods:slns loaded with edaravone were produced by an ultrasound technique . edaravone solution or edaravone slns were administered by intratympanic or intravenous injection after the 1st day of noise exposure . guinea pigs were exposed to 110 db sound pressure level ( spl ) noise , centered at 0.254.0 khz , for 4 days at 2 h / d . after noise exposure , the guinea pigs underwent auditory brainstem response ( abr ) threshold measurements , reactive oxygen species ( ros ) were detected in their cochleas with electron spin resonance ( esr ) , and outer hair cells ( ohcs ) were counted with silvernitrate ( agno3 ) staining at 1 , 4 , and 6 days.results:the ultrasound technique was able to prepare adequate edaravone slns with a mean particle size of 93.6 nm and entrapment efficiency of 76.7% . acoustic stress - induced ros formation and edaravone exerted a protective effect on the cochlea . comparisons of hearing thresholds and ros changes in different animal groups showed that the threshold shift and ros generation were significantly lower in treated animals than in those without treatment , especially in the edaravone sln intratympanic injection group.conclusions:edaravone slns show noticeable slow - release effects and have certain protective effects against noise - induced hearing loss ( nihl ) .

I M Animals Noise stimulation Pharmacological protocol Auditory assessment ESR measurement Outer hair cell counting Statistical analysis R Hearing function ROS in cochleas Hair cell loss D C

the obesity epidemic is affecting all age groups and could decrease prospects for an active life expectancy . the prevalence of overweight among children and adolescents in the india has doubled from 11.7% to 22.1% from 2006 to 2011 . although the body mass index ( bmi ) is widely used as a surrogate measure of adiposity , it is a measure of excess weight relative to height , rather than excess body fat . the interpretation of bmi among children and adolescents is further complicated by the changes that occur in weight , height , and body composition during growth . bmi levels among adults are highly correlated with the percentage of body fat among various race , sex , and age . these weaker associations among children and adolescents may be attributable to the asynchronous changes that occur in the levels of fat mass ( fm ) and lean mass ( lm ) during growth . it is suggested that the obesity paradox is merely based on the inadequacy of bmi to differentiate between lm and fm . against the background of obesity , it is perceived that adipose tissue is a plain risk factor and lm is the protective element . it is argued that the favorable impact of elevated bmi results from the beneficial effects of lean tissue , overriding the adverse effects of excess body fat . however , the association of obesity and lm has not been studied well in literature . hence , we designed this cross - sectional population - based study to ( i ) evaluate the relationship between bmi categories and lm and ( ii ) to analyze the effect of regional obesity ( subcutaneous and visceral ) on total lm ( tlm ) in children and adolescents . adolescents were recruited from different schools in the city of new delhi as a part of the project to generate normative data for bmd . there were 1829 apparently healthy children and adolescents who underwent health examination ( clinical , biochemical , and densitometric ) on a voluntary basis . the data on lm and fm and its distribution were available from 1403 children and adolescents for the present study . children and adolescents with clinically overt hepatic , renal , neoplastic , gastrointestinal , dermatological , endocrine , and systemic infective disorders , steroid intake , or alcoholism were excluded . demographic , anthropometric , and clinical data were ascertained , and a detailed physical examination was conducted . this study was conducted according to the guidelines laid down in the declaration of helsinki , and all procedures involving the children and adolescents were approved by the institutional ethics committee of the institute of nuclear medicine and allied sciences . administrative approval was taken from the school authorities , written informed consent from parents / guardians , while verbal assent was taken from the children who participated in the study . height was measured to the nearest 0.1 cm using a portable wall - mounted stadiometer ( 200 cm/78 inches ) model ws045 ( narang medical limited , new delhi , india ) with the participant standing straight with head held in the frankfurt horizontal plane . weight , without shoes and while wearing light clothes , was measured to the nearest 0.1 kg , using an electronic scale ( equinox digital weighing machine , model eb6171 , equinox overseas private limited , new delhi , india ) . the study population was divided according to bmi - based criteria proposed by cole et al . as normal , overweight , and obese . pubertal staging was carried out by trained professionals of the same sex based on tanner criteria . testicular volume was determined by comparative palpation with prader orchidometer ( pharmacia and upjohn , uppsala , sweden ) . stage 1 ( prepubertal ) included participants with testicular volume < 4 ml , stage 2 ( early puberty ) volume 4 but 8 ml , stage 3 volume 10 but 15 , and stage 4 ( fully mature ) testicular volume > 15 ml . a testicular volume of 4 ml or greater was considered as the onset of puberty . if there was a discrepancy in the testicular volumes of two sides , the larger one was taken as the final volume . lm was measured using the prodigy oracle ( ge lunar corp . , madison , wi ) according to a standard protocol . instrument variation was determined regularly using a phantom supplied by the manufacturer , and the mean coefficient of variation was < 0.5% . for in vivo measurements , instrument variation was determined by measuring total fm and regional fm in twenty healthy adults twice , and the mean coefficient of variation was < 0.5% . leg and arm fat - to - total fat ratio ( latr ) was considered as indicative of subcutaneous fat and trunk fat - to - total fat ratio ( ttr ) was indicative of visceral fat . interquartile range for latr and ttr was 0.05 and 0.06 and 0.06 and 0.08 for girls and boys , respectively . appendicular skeletal muscle mass index ( asmi ) was calculated by lm at arms and leg in kilogram divided by square of height in meters . statistical analysis was carried out using spss software version 20.0 ( chicago , il , usa ) . data were presented as mean standard deviation or number ( % ) unless specified . one - way analysis of variance was used to test the differences between bmi groups . post hoc analysis was used to compare the significance level between two groups within each parameter . mean age of the study participants was 13.2 2.7 years ( boys - 13.0 2.7 ; girls - 13.4 2.8 years ) . nearly , 79.5% of the children and adolescents were normal weight , 16.0% were overweight , and 4.5% were obese . age and pubertal status were comparable in all groups in both genders [ table 1 ] . basic characteristics of the population asmi , tlm , and its regional distribution were higher in overweight and obese compared to normal weight children and adolescents , but were comparable between overweight and obese boys ( lm : p = 0.828 ; asmi : p = 0.982 ) and girls ( lm : p = 0.268 ; asmi : p = 0.096 ) [ table 2 ] . tlm per unit of fat ( tlm / tf ratio ) showed a significant decrease from normal weight group to obese group , but was comparable between overweight and obese groups , even after adjustment with age , height , and sms in both genders [ table 3 ] . lean mass according to weight categories among boys and girls total lean mass versus total fat ratio in weight categories according to interaction with age , height , and sexual maturity score unadjusted tlm decreased with the quartiles of latr ( subcutaneous fat ) and increased with the quartiles of ttr ( visceral fat ) in both gender . however , when adjusted for age and sms , the same pattern persisted among boys , but the pattern of tlm became nonsignificant with latr in girls [ table 4 ] . effect of subcutaneous fat ( leg arm fat - to - total fat ratio ) and visceral fat ( trunk - to - total fat ratio ) on total lean mass * in the present study , we observed that tlm and regional lm were more in overweight and obese categories when compared to the normal weight category , but were comparable between overweight and obese category . consistent with this , we expect that lm should show a similar pattern of increase . surprisingly , tlm / tf decreased after adjustment with age , height , and sms in both genders . this suggests that overweight and obese children and adolescents have lower tlm / tf when compared to normal bmi category . studies have shown that lm is increased when weight gain is observed in early childhood , but fm increases when weight gain is seen in late childhood . hence , weight gain in later childhood will have relatively lower lm when compared to early childhood . physical activity increases lm and decreases fm with decreasing weight and obesity in children and adolescents . pharmacological therapy ( sibutramine ) hence , an increase in the physical activity is the best mode of therapy to achieve weight loss . increase in lm may help in improving the health status by decreasing obesity while a decrease in lm is associated with an adverse outcome . the relationship between regional lean and fm was influenced by age and gender . with an increasing adiposity , skeletal muscle to adipose tissue ratio declined faster at the trunk in men and at the extremities in women . we observed a negative effect of subcutaneous fat and a positive effect of visceral fat on lm which was influenced by age and pubertal status in girls , indicating the importance of pubertal status for the effect . a study has shown that the change in the pattern of subcutaneous fat distribution could be due to a varied response of different sites toward the loss of subcutaneous fat due to increased levels of activity . furthermore , increase in physical activity will result in a decrease in subcutaneous fat and increase in lm , and this can explain the inverse relationship . visceral fat due to its gravitational effect will put physical strain on appendicular system and will increase tlm . the main limitation of the study was the absence of longitudinal data , which could have assessed the change in bmi categories and its effect on lm . another limitation was the absence of measurement of adipokines and myokines , which could have highlighted the mechanism of association between body fat and lm . however , the strength of the study attributes to the large sample size from healthy indian population . obese children and adolescents have higher lm than normal weight children , but when calculated as per the unit of fm , they have lower lm . subcutaneous fat had a negative impact and visceral fat had a positive impact on tlm which is influenced by age and pubertal status .

background : the association of obesity and lean mass ( lm ) has not been examined well in children and adolescents , and it remains controversial.objective:the objective of this study was to evaluate the relationship of body mass index ( bmi ) categories and regional obesity with total and regional lm in children and adolescents.methods:a total of 1408 children and adolescents ( boys 58.9% ; girls 41.1% ) divided according to bmi ( normal weight 79.5% , overweight 16.0% , and obese 4.5% ) were included in this cross - sectional study . total and regional lm and fat mass were measured by dxa . leg and arm fat - to - total fat ratio ( latr ) indicative of subcutaneous fat and trunk fat - to - total fat ratio ( ttr ) , an indicator of visceral fat , were calculated.results:mean age of the study population was 13.2 2.7 years ( boys - 13.0 2.7 ; girls - 13.4 2.8 years ) . total lm ( tlm ) and its regional distribution were higher in overweight and obese groups when compared with those with normal bmi in both genders . tlm was comparable between overweight and obese in both genders . tlm per unit of fat progressively decreased from normal to obese categories . the difference in lm per unit fat between bmi categories persisted after adjustment for age , height , and sexual maturity score . tlm increased across the quartiles of ttr , but decreased with an increment in subcutaneous fat ( quartiles of latr).conclusions : obese children and adolescents apparently have higher lm than normal bmi children , but have lower lm per unit of fat . subcutaneous fat had a negative impact and visceral fat had a positive impact on tlm .

I M R D C Financial support and sponsorship Conflicts of interest

varicocele is characterized by retrograde flow in testicular veins pathophysiologically and is manifested clinically by abnormal tortuosity and dilatation of the spermatic veins and pampiniform plexus . it affects 15% of the general population and is especially common among teenagers and young adults . the clinical relevance of varicocele is based on its symptoms being related to scrotal venous stasis and the potential association with male infertility . physical examination is still the standard diagnostic method for varicocele , but it is usually difficult to estimate the existence of varicocele by use of physical examination alone . some varicoceles are impalpable and asymptomatic and are diagnosed only with ultrasound evaluation owing to thick scrotal skin and a strong cremasteric reflex . several authors have examined groups of patients with a diagnosis of varicocele to establish qualitative and quantitative color doppler ultrasonography ( cdu ) criteria , but the criteria were heterogeneous and poorly defined from a quantitative point of view . furthermore , physical examination for diagnosis of varicocele is generally performed with the patient in the standing position , but some studies examined cdu for patients in the supine position and some studies did so for patients in the standing position . in this study , we proposed to assess the effectiveness of the valsalva maneuver and the standing position on cdu for varicocele diagnosis and to devise a new index that can improve existing diagnostic criteria of cdu for varicocele . we reviewed the findings of a physical examination and cdu for 87 patients who visited national police hospital for varicocelectomy with complaints of scrotal pain , painful swelling , or infertility and were clinically diagnosed with varicocele from january 2011 to april 2014 . after obtaining approval from the institutional review board ( irb ) of national police hospital , we retrospectively reviewed the imaging findings and clinical records ( irb approval no . 116222 - 201409-hr-006 ) . none of the patients had a previous history of genitourinary trauma or surgery . the age of the patients ranged from 19 to 65 years ( mean age , 22.343.86 years ) . patients were examined in a warm room after standing for 5 minutes and varicocele was graded by physical examination in a standing position according to the system of dubin and amelar as follows : grade i , palpable only with valsalva maneuver ; grade ii , palpable without the valsalva maneuver ; and grade iii , visible from a distance . all cdu studies were performed by three experienced physicians using the same equipment ( 7.5-mhz electronic linear probe , prosound alpha5 sv , aloca co. , tokyo , japan ) . we placed the transducer transversely on the bilateral scrotal surface with the patients in a supine position with the abdomen and chest elevated to about 15 , followed by the same measurement with the patient in a standing position . diameters of the largest vein in the pampiniform plexus were measured bilaterally during resting and during a valsalva maneuver in the supine position followed by same examination with the subjects standing ( fig . 1 ) . we calculated the ratio of mean maximal vein diameter ( mmvd ) during resting to that during the valsalva maneuver ( resting - valsalva ratio ) , and the ratios were compared between the two positions ( fig . the data were analyzed by using the t - test with a personal computer and the spss ver . we compared the mmvd of normal testis units versus that of grades i , ii , and iii varicocele testis units and the mmvd of each varicocele unit in the supine position during rest and during the valsalva maneuver , followed by the same comparisons in the standing position . resting - valsalva ratios were compared in both positions in the same way . a two - tailed p - value less than 0.05 was considered to be statistically significant . of a total 87 patients , 76 patients had left varicoceles and 11 patients had bilateral varicoceles upon physical examination . among the 76 patients with left unilateral varicocele , 7 patients had grade i ( 9% ) , 40 patients had grade ii ( 53% ) , and 29 patients had grade iii ( 38% ) on physical examination , respectively . the 11 patients with bilateral varicoceles were identified as follows : 2 patients with grade ii ( 18% ) and 9 patients with grade iii ( 82% ; right grade i , 7 ; grade ii , 3 ; grade iii , 1 ) . among the physical parameters of the 174 testis units in 87 patients , 77 testis units were normal testis units with no varicocele ( 44% ) , 13 units were grade i ( 7% ) , 45 units were grade ii ( 26% ) , and 39 units were grade iii ( 22% ) , respectively . by use of scrotal cdu in the supine position at rest , the mmvd of varicocele testis units was 1.8 mm ( grade i ) , 2.0 mm ( grade ii ) , and 2.5 mm ( grade iii ) , respectively , and that of normal testis units was 1.2 mm . compared with normal testis units , only grade iii varicoceles showed a significant difference ( p=0.004 ) . in the supine position during the valsalva maneuver , mmvd was 3.0 mm ( grade i ) , 3.4 mm ( grade ii ) , and 4.2 mm ( grade iii ) and that of normal testis units was 1.8 mm ( p=0.007 , p<0.001 , p<0.001 , respectively ) . the average resting - valsalva ratio in the supine position was 0.69 , 0.74 , and 0.74 for grades i , ii , and iii , respectively , and 0.67 for normal testis units . 2 ) . in the standing position at rest , mmvd was 2.8 mm , 3.3 mm , and 3.8 mm for grades i , ii , and iii , respectively , and 1.8 mm for normal testis units ( p=0.002 , p<0.001 , p<0.001 , respectively ) . in the standing position during a valsalva maneuver , mmvd was 5.0 mm , 5.8 mm , and 6.6 mm for grades i , ii , and iii , respectively , and 2.5 mm for normal testis units ( p=0.002 , p<0.001 , p<0.001 , respectively ) . average resting - valsalva ratios were 0.76 , 0.90 , and 0.71 for grades i , ii , and iii , respectively , and 0.26 for normal testis units , which showed a significant difference for all grades ( p<0.001 , p<0.001 , p<0.001 , respectively ) ( fig . varicocele is an abnormal degree of venous dilatation in the pampiniform plexus due to reflux of blood resulting from the absence or incompetency of the valves within the spermatic vein . however , clinical examination is subjective , may be associated with significant interphysician variability , and has a limited capacity to detect blood flow changes . furthermore , physical examination alone may be inadequate to diagnose small or subclinical varicoceles , which are also considered to have significant pathophysiological potential . testicular venography is the most reliable method for the detection of small varicoceles , but it has several disadvantages including a morbidity rate of 0.5% to 1.0% owing to contrast medium injection , high cost , and inappropriateness for routine use because it is limited to embolization procedures . ultrasound technology has improved considerably in recent years . at present it allows the identification of minimal ectasia of the scrotal veins and minimal retrograde venous flow . ultrasonography and particularly cdu appear to be the most reliable and practical methods for diagnosing subclinical varicocele . a widely accepted ultrasound criterion for diagnosis of varicocele is the existence of veins larger than 2 mm in diameter . gonda et al . reported 95% sensitivity with a 2-mm cutoff for vein diameters . in a recent study , lee et al . reviewed previous studies and insisted that multiple veins > 3.0 to 3.5 mm with concomitant reversal of flow after valsalva maneuver is the most widely used criteria for diagnosing a varicocele on cdu . nonetheless , they described that there is no clear - cut standardized size criterion , which may be not only a result of the lack of proper prospective trials , but also a manifestation of a spectrum phenomenon in which there is no clear discrete normal value . used cdu to analyze the diameter of the veins in the pampiniform plexus in patients with clinical or subclinical varicocele and in controls . those authors suggested that venous diameter should not be used as a diagnostic criterion in patients without clinical signs of varicocele , but rather should be used to document and quantify pathology in patients with clinical varicocele . cdu can be used to measure the size of the pampiniform plexus and blood flow parameters of the spermatic vein . however , the reliability of cdu to diagnose varicoceles remains controversial and the diagnostic criteria remain poorly def ined , with considerable variation between investigators . the change in color is subjective and unreliable for the diagnosis of reflux in cdu examination and should be quantified with spectral doppler analysis . varicocele may be diagnosed more reliably by quantifying the duration of reflux in spectral analysis . a study by kocakoc et al . reported a 62.3% incidence of reflux in testicular veins with a diameter <3 mm . however , their measures were obtained only in the supine position . a new scoring system to improve cdu criteria to diagnose scrotal varicocele was proposed by chiou et al . by incorporating the maximal venous diameter , the presence of a venous plexus , the sum of diameters of veins in the plexus , and the change in flow on valsalva maneuver . an attempt to identify new criteria for the cdu diagnosis of subclinical varicocele was performed by mihmanli et al . , although these criteria have not provided new information on the diagnosis of subclinical varicocele in infertile patients . reported that a scrotal diameter of up to 3.7 mm and a reflux lasting up to 3 seconds with a velocity of 0.1 m / s can be observed in healthy subjects and should not be interpreted as a certain sign of scrotal varicocele . also , physical examination alone is not a highly reliable tool in the diagnosis of varicocele , and the use of venography is inappropriate for routine screening . moreover , cina et al . insisted that a gold standard for detecting subclinical varicocele does not exist . as enumerated above , cdu is a useful modality for scrotal varicocele diagnosis and has many merits , such as being a real - time , noninvasive , and relatively inexpensive technique . we considered supplementing the varicocele diagnosis index by using cdu , with a focus on dilation of the pampiniform plexus in the standing position during a valsalva maneuver . in our study , in the supine position at rest , only mmvd of grade iii varicocele testis units showed a significant difference with normal testis units . in the supine position during the valsalva maneuver , all grades of varicocele testis units showed significant differences with normal testis units . this suggests that the valsalva maneuver results in dilation of the pampiniform plexus in all grades of varicocele . however , the average resting - valsalva ratio in the supine position had no significant meaning . in the standing position , whether during rest or during the valsalva maneuver , all grades of varicocele testis units showed significant differences with normal testis units . also , the average resting - valsalva ratio showed significant differences for all grades . this suggests that the detection of varicocele is more precise in the standing position , and the valsalva maneuver has a greater role in dilation of the pampiniform plexus in the standing position than in the supine position . the resting - valsalva ratio of normal testis units showed significant differences with the ratio of testis units of each grade of varicocele in the standing position . it seems that in the standing position , the valsalva maneuver contributes to the dilatory effectiveness of the pampiniform plexus , thus increasing the resting - valsalva ratio . in this study , mmvd values of varicocele testis units were greater than and differed significantly from the values for normal testis units when the patients performed the valsalva maneuver or were in the standing position . this finding suggests that only the standing position or valsalva maneuver can distinguish between normal testis units and varicocele testis units . however , the mmvds of normal testis units during the valsalva maneuver in the supine position and during resting and the valsalva maneuver in the standing position were 1.80.9 mm , 1.81.2 mm , and 2.50.3 mm , respectively . compared with the conventional cutoff value of varicocele diagnosis by mmvd , 2 mm , the mmvd of normal testis units was too close to the cutoff value . thus , it is hard to differentiate between normal and varicocele testis units by use of mmvd . using the cutoff value of mmvd > 3 mm , when the mmvd of normal testis units by physical examination is over 3 mm , the resting - valsalva ratio can help in the discrimination of varicocele . the resting - valsalva ratio in the supine position does not discriminate significantly but in the standing position can be a useful diagnostic index for detecting varicocele and grading . first , normal testis units were classified from varicocele patients by physical examination instead of in a normal population with no varicocele . second , cdu and the resting - valsalva ratio were not compared with the use of another varicocele diagnostic modality . in addition , this study did not give a concrete cutoff value of the resting - valsalva ratio for varicocele diagnosis . thus , further studies correlating cdu to assess the cutoff values of the resting - valsalva ratio are needed and reproducibility should be verified by other studies . the detection of varicocele is more precise with the patient in the standing position , and the valsalva maneuver has a greater role in dilation of the pampiniform plexus in the standing position than in the supine position . the resting - valsalva ratio in the standing position could be a new and ancillary diagnostic index for varicocele diagnosis by use of scrotal cdu .

purposeto determine effectiveness of valsalva maneuver and standing position on scrotal color doppler ultrasound ( cdu ) for the varicocele diagnosis.materials and methodswe reviewed the physical examination and cdu finding in 87 patients who visited national police hospital from january 2011 to april 2014 . diameters of pampiniform plexus were measured bilaterally during resting and valsalva maneuver in the supine position and standing position . we calculated the ratio of mean of maximal vein diameter ( mmvd ) during resting and valsalva maneuver ( resting - valsalva ratio ) and compared in the both position.resultsin the resting and supine position , mmvd of varicocele testis units were 1.8 mm , 2.1 mm , 2.6 mm ( grades i , ii , iii , respectively ) , and that of normal testis units ( ntu ) 1.2 mm . during valsalva maneuver in the supine position , mmvd were 3.0 mm , 3.4 mm , 4.2 mm ( grades i , ii , iii ) vs 1.8 mm ( ntu ) ( p=0.007 , p<0.001 , p<0.001 , respectively ) . average of resting - valsalva ratio in the supine position were 0.69 , 0.74 , 0.74 ( grades i , ii , iii ) and 0.67 ( ntu ) . whereas in the resting and standing position , mmvd were 2.8 mm , 3.3 mm , 3.8 mm ( grades i , ii , iii ) and 1.8 mm ( ntu ) ( p=0.002 , p<0.001 , p<0.001 ) . during valsalva maneuver in the standing position , mmvd were 5.0 mm , 5.8 mm , 6.6 mm ( grades i , ii , iii ) and 2.5 mm ( ntu ) ( p=0.002 , p<0.001 , p<0.001 ) . and average resting - valsalva ratio were 0.76 , 0.90 , 0.71 ( grades i , ii , iii ) and 0.26 ( ntu ) , which showed significant differences from all grades ( p<0.001 , p<0.001 , p<0.001).conclusionsit is suggested that the standing position and valsalva maneuver during cdu could improve diagnostic ability for varicocele . resting - valsalva ratio in the standing position could be a new diagnostic index for varicocele diagnosis using cdu .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSIONS

in the treatment of spinal tumors , radiotherapy is considered as the essential treatment modality5 ) . recently , stereotactic radiosurgery ( srs ) has been developed and widely used in the field of spine tumor treatment . one of the major complications associated with srs is vertebral compression fracture ( vcf)3,7,11 ) . in cases of osteolytic spinal tumors , vertebral body and pedicle are eroded by tumor mass and the remaining bony structures must withstand spinal loading . when radiation is delivered to spinal tumor and the remaining vertebral body , soft mass shrinkage and bony necrosis can develop , which leads to vcf and the resultant kyphotic deformity10 ) . the risk of vcf following srs has been investigated in several studies . a prospective trial by rose et al . revealed that 39% of treated vertebral bodies showed new or progressing fractures , in which larger , lytic lesions located in the lower spine presented a high risk11 ) . larger radiation dose , previous spinal deformity , histology , age of more than 55 years and vertebral body involvement by at least 40 - 60% were suggested as significant risk factors3,7,12,13 ) . in cases of significant vcf , vertebroplasty or stabilization surgery the spine oncology study group ( sosg ) defines spine instability as the " loss of spinal integrity as a result of a neoplastic process that is associated with movement - related pain , symptomatic or progressive deformity and/or neural compromise under physiological loads"8 ) . the sosg developed the spinal instability neoplastic score ( sins ) in 20118,9 ) . under this classification system , tumor - related instability is assessed by adding together six individual component scores : spine location , mechanical pain , lesion bone type ( lytic or blastic ) , radiographic alignment , vertebral body collapse , and posterolateral involvement of the spinal elements ( table 1 ) . a score of 0 - 6 means stable condition , 7 - 12 denotes indeterminate ( possibly impending ) instability , and 13 - 18 instability . the study cohort was 72 patients with malignant spinal column tumors , who underwent srs ( table 2 ) . the mean age of the participants was 51 years ( range , 19 - 78 years ) . 17 tumors were located in the cervical region , 26 in the thoracic region , and 29 in the lumbar spine . pre - srs deformities such as compression fracture or kyphosis were present in 8 patients . spinal canal encroachment by tumor mass was observed in 22 patients . sins ranged from 2 to 15 ( mean score=8 ) . a modified weinstein - boriani - biagini ( wbb ) classification system was adopted to assess the extent of tumor infiltration in the whole vertebral body4 ) ( fig . this measure was developed specifically to stage in patients with primary spine tumors . in this system , the whole vertebral body including posterior element is divided into 12 sectors . the rate of whole vertebral body involvement was defined as the ratio of the number of tumor - infiltrated sectors to whole sectors ( sector 1 - 12 ) . vertebral body osteolysis rate is defined as the ratio of the number of tumor - infiltrated sectors to sectors 4 - 9 . to evaluate the extent of tumor infiltration , t1 weighted axial mri was used . 1b shows a tumor infiltrating both laminae , the right pedicle and right vertebral body , which correspond to sectors 8 - 12 , 1 , and 2 . the sectors of vertebral body excluding posterior element are 4 - 9 . in fig . when these values were calculated as single equivalent srs doses , they ranged from 18gy to 26gy ( mean=21gy ) . after srs , patients were assessed with regular follow - up for pain status , neurological status and radiological response . x - rays were checked every month for 3 months and mri was used to evaluate radiological response . vcf was defined as development of a new fracture or progression of pre - existent fractures with relevant symptoms . analyzed risk factors of vcf were age , sex , whole vertebral body involvement rate , vertebral body osteolysis rate , pre - srs spinal deformity , spinal instability neoplastic score ( sins ) , spinal canal encroachment , lesion level , and radiation dose . continuous variables such as age , whole spine involvement rate , vertebral body osteolysis rate , sins and radiation dose were categorized as two groups ( below mean and above mean ) . pre - srs spinal deformity and spinal encroachment were also analyzed as categorical factors , which mean the presence or absence of the factors . the mean follow - up for the study population was 11 months ( range , 3 - 24 months ) . the mean time to fracture for those patients who developed vcf was 1.5 months ( range , 0.3 - 3.5 months ) . according to uni - variate analyses , whole vertebral body involvement rate ( p=0.007 ) , pre - srs deformity ( p=0.013 ) , vertebral body osteolysis rate ( p=0.001 ) , and sins ( p=0.002 ) were significant factors ( table 4 ) . however , multi - variate analyses confirmed that only vertebral body osteolysis rate was predictive of vcf development ( p=0.016 ) . patients whose vertebral body was destroyed by more than 60% showed an 8.4 times higher risk of vcf than those who had vertebral body destruction of less than 60% . pre - srs deformity ( p=0.31 ) , sins ( p=0.07 ) , and whole vertebral body involvement rate ( p=0.8 ) were not significant predictive factors . ten patients underwent percutaneous vertebroplasty and 5 underwent fusion surgery to treat pain associated with post - srs vcf . mri showed a metastatic spine tumor infiltrating c2 vertebral body , left pedicle and left lamina ( fig . after srs , his pain improved and vcf was not detected at 24 months follow - up . in case 2 , the metastatic spine tumor involved the vertebral body only ( fig . following srs , the neck pain aggravated and follow - up x - ray showed progression of kyphosis at the c2 - 3 level . srs is an emerging treatment for spinal tumors and is widely applied in clinical setting . although the risk of vcf is approximately 5% after conventional radiotherapy , crude risk estimates for vcf after spinal srs range from 11% to 39%13 ) . the incidence of vcf reported after spinal srs is variable depending on the reporting authors . , who reported vcf in 27 ( 39% ) of 71 sited treated with srs11 ) . they treated patients with high - dose single fraction srs ( median dose-24gy in one fraction ) . authors from md anderson cancer center investigated 127 vertebral bodies of 93 patients , and reported a 20% risk of vcf with a threemonth median time to vcf3 ) . cunha et al . analyzed 167 spinal segments in 90 patients treated with srs and reported an actuarial vcf rate of 12.7% at 1 year post - srs with a mean time to vcf of 3 months7 ) . in this study , patients with srs of 20gy or greater were at a higher risk of vcf . in a recent study by sahgal et al . , the approximate risk was 14% , and the 1-year cumulative incidence was 12.35%12 ) . in that report , it was clear that as the radiation dose increases , the risk of vcf significantly increased . the incidence of vcf was 39% in the group with radiation doses of > 24gy . the risk of late normal tissue adverse effects increases as the radiation dose increases . similar findings that doses > 20 gy are associated with a greater risk of radiation necrosis have been obtained from brain radiosurgery14 ) . in the present study , the incidence of vcf was 36% , which was higher than the risk reported by other authors . several reports on post - srs vcf suggest that if the radiation dose is reduced , the adverse events associated with vcf can be avoided . the present findings suggested whole vertebral body involvement rate , pre - srs deformity , vertebral body osteolysis rate , and sins as risk factors for vcf , using uni - variate analyses . of these factors , vertebral body osteolysis rate was the only significant factor using multi - variate analyses . in their study , risk factors of vcf included age > 55 years , a preexisting fracture , and baseline mechanical pain3 ) . states that the presence of kyphotic / scoliotic deformity , presence of a lytic tumor , specific histology ( lung and hepatocelluar carcinoma metastasis ) , and radiation dose of 20 gy were predictive factors of vcf . investigated the risk factors of vcf using six criteria of sins ; location , presence of mechanical pain , bone lesion type , alignment , baseline vcf , and posterior element involvement . among six criteria , baseline vcf , bone lesion type ( lytic tumor ) , and malalignment were significant factors however , the overall score was not predictive , which is compatible with our present results . another study by cunha et al . , which also evaluated sins criteria as predictive risk factor of vcf , revealed that the presence of a lytic tumor , and the presence of malalignment were significant and baseline vcf was excluded7 ) . 's study investigated the risk of fracture depending on the degree of the vertebral body involvement rate . classification according to the amount of the vertebral body occupied by the lesion resulted in a significantly different fracture incidence . the risk of vcf was 22% in the group with 1 - 20% vertebral body involvement , 58% in the group with 21 - 40% involvement , 86% in the patients with 41 - 60% involvement , and 83% in the patients with 61 - 80% involvement . there were a significant difference in the risk of vcf between the group with vertebral body involvement < 40% and the group with vertebral body involvement > 40% , which is compatible with the results of the present study . our data indicate that patients with vertebral body osteolysis rates more than 60% showed higher risk of vcf than those with rates less than 60% . osteoradionecrosis , which lead to both healthy vertebral bone and tumor tissue being replaced with friable necrotic tissue , is the proposed mechanism of srs induced vcf . osteoradionecrosis has been defined as a slow - healing radiation - induced ischemic necrosis of the bone tissue . the mechanism of osteoradionecrosis is thought to relate to radiation therapy by the production of a hypoxic , hypocellular , and hypovascular environment in which the basic metabolic demands for cellular survival can not be met15 ) . the onset of osteoradionecrosis has been described to range from 6 months to 3 years following treatment , and may even occur as late as 25 years after radiation therapy . in srs planning , the entire vertebral body is included in the target volume , even if focal involvement was diagnosed6 ) . recent data have confirmed a great risk of failure if the target is restricted to a visible tumor within the vertebral body . therefore , both the healthy trabecular bone and tumor tissue are exposed to the high radiation dose . histopathological analysis showed markedly thinned bone trabeculae , and the bone marrow was completely replaced by either dense fibrous tissue with focal lymphocytic inflammation or loose paucicellular fibrous tissue . bone is a complex two - phase composite substance containing mineral ( hydroxyapatite ) and organic ( collagen ) components13 ) . the mineral component gives strength and stiffness to bone tissue whereas the collagen part gives bone ductility , increasing the tissue toughness . decreases in the strength , modulus , and toughness of the collagen network are associated with decline in bone strength . a high radiation dose damages collagen , which reduces bone toughness . the mechanism of radiation - associated collagen damage might be an increase in the cross - link ratios2 ) . ultimately , exposure to radiation progressively degrades the strength , ductility , and toughness of the bone tissue2 ) . the management of vcf consisted of conservative treatment , bone cement augmentation , or surgical stabilization . the proportion of patients who underwent vertebroplasty or surgery was 3/2711 ) , 10/253 ) , and 9/197 ) . of these patients , percutaneous cement augmentation procedures were used more commonly ( 77% ) than spinal stabilization surgery ( 23% ) . the choice of surgical intervention is determined by radiological finding of the spine . for example , vcf without kyphosis and without substantial posterior element involvement can be treated with a percutaneous cement augmentation procedure alone . by contrast , patients with kyphotic deformity or translation instability generally need a combination of vertebral augmentation and pedicle screw reconstruction . additionally , the systemic status of the patient , tumor pathology , and extent of metastatic burden need to be carefully considered when deciding on surgical options . of the patients in this study , 15 out of 26 patients with vcf were treated with vertebroplasty ( 10 patients ) and stabilization operation ( 5 patients ) . vertebral body osteolysis rate more than 60% was the only significant risk factor for post - srs vcf demonstrated by our findings .

objectivestereotactic radiosurgery ( srs ) is an emerging treatment modality for malignant spinal tumors . after srs , some patients suffered from pain aggravation due to development of vertebral compression fracture ( vcf ) . in these cases , surgery should be considered.methodsthis study consisted of 72 patients who underwent srs due to spinal tumors . in them , whether post - srs vcf developed or not was investigated . we retrospectively analyzed their medical records and radiological imaging data . vcf was diagnosed with x - ray and magnetic resonance imaging ( mri ) . the incidence , time to development and risk factors for vcf were investigated . age , sex , whole vertebral body involvement rate , vertebral body osteolysis rate , pre - srs spinal deformity , spinal instability neoplastic score ( sins ) , spinal canal encroachment , lesion level , and radiation dose were analyzed as potential risk factors . a multi - variate logistic regression model was used for statistical analysis.resultsin our study population , vcf was observed in 26 patients ( 36% ) . the mean time to vcf development was 1.5 months . using uni - variate analyses , the significant risk factors were pre - srs spinal deformity , sins , vertebral body osteolysis rate , and whole vertebral body involvement rate . however , using multi - variate analyses , the only significant risk factor was vertebral body osteolysis rate . the patients whose vertebral body was destroyed by more than 60% showed an 8.4 times higher risk of vcf than those who had vertebral body destruction of less than 60%(p=0.016).conclusionthe most significant prognostic factor for post - srs vcf was vertebral body osteolysis rate , rather than whole vertebral body involvement rate . when more than 60% of the vertebral body was destroyed , the risk of vcf or spinal deformity was high .

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSION

vaccination using antigens expressed by endothelial cells lining the tumor vasculature represents the most attractive vaccination strategy because immunization using this approach may prevent the growth of any solid tumor . therefore , endothelial cells can be used as a source of antigens used in the development of a universal cancer vaccine ( ucv ) . however , utoimmune - mediated damage to microvessels , the primary targets of anticancer endothelial cell - based vaccination strategies , may lead to side effects , namely , autoimmune - mediated damage of microvessels in healthy tissues [ 2 , 3 ] . therefore , antigen compositions constituting a ucv that are distinct from antigens expressed by endothelial cells in normal tissues need to be designed to prevent the elicitation of undesired autoimmunity . recently we described the interactions between tumor - induced endothelial cell surface heterogeneity and endothelial cell escape from cell - mediated immune responses [ 4 , 5 ] . these data sets suggested that an efficient autologous vaccine could be designed utilizing surface antigens expressed by cultured human microvascular endothelial cells ( hmec ) if their tumor - induced cell surface profile and the profile of target hmec were similar . in this scenario , the efficacy of the autologous vaccine would exceed 18 ( i.e. , 18 tumor endothelial cells will be destroyed before 1 endothelial cell in normal tissue is destroyed ) . antigen compositions intended for vaccination were based on a specifically derived set of hmec natural cell surface antigens distinguished by the abbreviation santavac ( set of all natural target antigens for vaccination against cancer ) . although the design of these studies was mainly intended to describe an autologic type of santavac , it was found that alloantigen compositions also may be efficiently used for anticancer vaccination . in one case , the killing rate of target hmec using allogeneic surface antigens related directly to the in vitro design of the allogeneic universal vaccine with efficacy of targeting equal to 4 . this efficacy provides a therapeutic window where tumor hmec could be killed before hmec of normal tissues are adversely affected . unfortunately , the efficacy of the allogeneic santavac in these studies was characterized by a limited number of experiments . to fill this gap , additional cytotoxicity assays ( cta ) were performed in the present study to complement the ucv design based on the santavac . the possibility of excluding a patient 's own biomaterial from the vaccine preparation simplifies the development activities and increases the value of the allogeneic santavac vaccines . two abdominal subcutaneous adipose tissue biopsies were obtained from female patients ( 4050 years old ) undergoing open abdominal surgical procedures at the national medico - surgical center ( moscow , russia ) . the protocol was approved by the research ethics committee and the patients provided written informed consent . the biopsy specimens were transported to the laboratory , and endothelial primary cultures were established using magnetic beads coated with anti - cd31 monoclonal antibody ( dynabeads cd31 endothelial cells , invitrogen , life technologies , carlsbad , ca , usa ) as described previously . culture media ( medium mcdb 131 and microvascular growth supplement , gibco , thermo fisher scientific , waltham , ma , usa ) supplemented with 10% fbs ( fetal bovine serum ) ( paa laboratories , dartmouth , ma , usa ) , 50 g / ml streptomycin , 50 u / ml penicillin , 2 mm glutamine ( gibco ) , and 12 u / ml heparin ( sigma - aldrich , st . louis , mo , usa ) were changed every 2 - 3 days and after the first passage . cells were grown to 65% confluence and used in future experiments . to obtain hmec with tumor - induced phenotypes , cell cultures were incubated for 4 days in culture medium ( mcdb 131 , fbs , streptomycin - penicillin , glutamine , and heparin ) supplemented with 5% , 15% , and 25% of tumor - conditioned medium . cells were visualized using a lei dm5000b microscope ( leica microsystems , buffalo grove , il , usa ) . primary fibroblast cultures were established from an adult skin biopsy ( 45-year - old woman ; donor provided written informed consent ) as described by ritti and fisher . primary cultures were cultured in dmem ( gibco ) supplemented with 10% fbs , 5 g / ml streptomycin , 5 u / ml penicillin , and 2 mm glutamine at 5% co2 at 37c and third passage cells were used to obtain fibroblast - associated antigens ( faa ) . tumor - conditioned medium was collected from hepg2 ( human hepatocellular carcinoma cells , atcc , manassas , va , usa ; cell lines have been authenticated by cell proteomic footprinting ) as described by folkman et al . . media were conditioned for 48 h , collected , centrifuged for 10 min at 600 g , and filter - sterilized ( 0.2 m ) . tumor - conditioned medium was then concentrated 10x using centriplus centrifugal filter devices ym-3 ( millipore , merck kgaa , darmstadt , germany ) and used in experiments . in order to determine the optimal concentration of tumor - conditioned medium required to provide different tumor - induced stimuli to hmec , the 10x tumor - conditioned medium was added to hmec seeded in the wells of a 96-well plate at different concentrations ( 0 , 10 , 20 , 30 , 40 , and 50% in mcdb 131 medium supplemented with streptomycin - penicillin , glutamine , and heparin ) . after 3 days in culture , cells were counted in wells using trypan blue staining to determine the concentration of tumor - conditioned medium that induced weak ( stimuli just a little higher than in the control ) , moderate ( half of the maximum ) , and strong ( a little more than related to maximum ) stimulation . endothelial cells were stained with phycoerythrin- ( pe- ) conjugated mouse anti - hvegfr-2 igg1 ( clone 89106 , r&d systems , minneapolis , mn , usa ) or pe - conjugated mouse anti - human cd62e igg1 ( clone 68 - 5h11 , bd pharmingen , becton dickinson , san jose , ca , usa ) . for isotype control , cells were stained with pe - conjugated mouse igg1 ( r&d systems , clone 11711 , or bd pharmingen , clone mopc-21 , resp . ) . flow cytometry was performed on a bd facscalibur flow cytometry system ( becton dickinson ) and the data analyzed using cell quest software ( becton dickinson ) . hmec or fibroblasts grown to 65% confluence were washed 5x with hbss before being treated with 0.2 g / ml trypsin ( 15,000 u / mg , promega , madison , wi , usa ) in hbss . a 0.5 ml trypsin solution was added to each well of a 6-well plate , incubated for 20 min at 37c in saturated humidity , then collected again , and centrifuged ( 600 g for 5 min ) . the resulting supernatant contained cell surface targets and was considered a solution of santavac or fibroblast - associated antigens ( faa ) , respectively . briefly , fresh peripheral blood mononuclear cells ( pbmcs ) from healthy donors were isolated using ficoll - hypaque ( paneco , moscow , russia ) gradient centrifugation and were then allowed to adhere to 12-well culture plates for 1 h. nonadherent cells were collected and centrifuged , and cell pellets were mixed with autologous serum containing 10% dmso and stored in liquid nitrogen . cryopreserved , nonadherent pbmcs , which also are considered as peripheral blood lymphocytes , were later used as a source of effector cells ( cytotoxic t lymphocytes , ctl ) for cytotoxicity assays . the adherent cell fraction was cultured in rpmi-1640 ( gibco ) supplemented with 10% fbs , streptomycin - penicillin , and glutamine in the presence of 0.075 g / ml granulocyte macrophage colony - stimulating factor ( neostim , 1.67 10 me , fds farma , uk ) and 1000 u / ml interleukin-4 ( sigma - aldrich ) . after 6 d in culture , santavac ( 0.5 ml ) or faa ( 0.5 ml ) were added to each well of a 12-well culture plate with immature dc ( 3 10 cells / well in 1 ml of culture medium ) and dc were matured with 1000 u / ml tumor necrosis factor- ( sigma - aldrich ) for 48 h. matured , santavac - loaded or faa - loaded dc were then used to stimulate ctl . santavac - loaded dc ( 3 10 cells / well ) in 12-well culture plates were combined with 6 10 autologous nonadherent pbmcs ( 1 : 20 ) in 1 ml of rpmi-1640 medium ( containing 10% fbs , streptomycin - penicillin , and glutamine ) supplemented with 30 u / ml of clinical grade human interleukin-2 ( ronkoleukin , biotech , st . after incubation for nine days , nonadherent pbmcs containing stimulated ctl were washed by centrifugation and used as effector ctl in cytotoxicity assays . hmec ( 5 10 cells / well ) were seeded into 48-well plates , which yielded 3 10 cells / well after 72 h. effector ctl were then added to hmec at an effector : target ratio of 20 : 1 . on the third day , target hmec were washed to remove ctl and attached hmec were trypsinized and viability detected using trypan blue exclusion . the number of nonstimulated and tumor - stimulated hmec in the presence or absence of effector ctl stimulated with faa - loaded dc was used as controls . cta data were used to calculate the in vitro efficacy of the allogeneic santavac formulation , namely , efficacy type i , denoted as efficacy i and calculated as a ratio of the number of nonstimulated cells in control wells ( i.e. , hmec ) to the number of tumor - stimulated cells in experimental wells , and efficacy type ii , denoted as efficacy ii and calculated as a ratio of the number of tumor - stimulated cells in control wells ( i.e. , hmec , hmec , or hmec ) to tumor - stimulated cells in experimental wells . figures 1(a ) and 1(b ) show primary hmec cultures isolated from fat biopsies obtained from donors 1 and 2 , respectively . facs analysis ( figure 1(c ) for hmec donor 1 ; data for donor 2 are not shown ) revealed that the vegfr-2 endothelial cell marker is associated with almost 90% of the cells during the first passage following isolation . no growth of contaminating fibroblasts or mesothelial cells was detected , demonstrating that primary hmec cultures were successfully established . additionally , facs analysis of cd62 confirmed the endothelial nature of the primary cultures after activation using tumor - conditioned medium ( figures 1(d ) and 1(e ) ) . the optimal concentration of tumor - conditioned medium required to provide hmec stimulation was determined next . hmec were cultured for 3 days in the presence of different concentrations of tumor - conditioned medium . culture medium containing tumor - conditioned volumes of 5% , 15% , or 25% elicited weak ( stimuli just a little higher than in the control ) , moderate ( half of the maximum ) , or strong ( a little more than related to maximum ) levels of hmec stimulation , respectively ( figure 2 ) . the immunologic properties of respective santavac compositions were evaluated by loading dc with corresponding santavac as a means of activating and stimulating human cytotoxic t lymphocytes ( ctl ) against target hmec . ctl stimulated with fibroblast - associated antigen- ( faa- ) loaded dc incubated in the presence of target hmec were used as controls . on day 3 , surviving target hmec were identified using trypan blue exclusion . a subtle improvement in cytotoxicity was observed when ctl were stimulated with faa - loaded dc . dc loaded with hmec and stimulated with 15% or 25% tumor - conditioned medium elicited effective immune responses measured by high death rates of target hmec ( figure 3 ) . notably , ctl stimulated with dc loaded with antigens from hmec ( superscript represents the percentage of tumor - conditioned medium used to stimulate hmec ) was also most effective against hmec target cells ( in this case almost all target cells were dead ) . the target hmec were most efficiently killed by ctl stimulated with dc loaded with antigens from hmec . santavac efficacy i indicates that in vitro modeled vaccine safety was 17.3 , achieved using antigens derived from hmec and hmec used as targets . santavac efficacy ii indicates that the in vitro modeled capacity to arrest tumor growth was ~60 , also achieved by santavachmec ( hereinafter [ santavac is santavac generated from hmec for cta][hmec used as target cells in same cta ] ) . development of cell - based vaccines focuses on the elicitation of immune responses against target cells expressing native antigens [ 12 , 13 ] . cell surface targets are prioritized for vaccine design [ 14 , 15 ] and are accessible to proteases whose byproducts could be isolated following in vitro proteolytic cleavage . previously , it was shown that the antigenic essence of cells , which may be used in cell - based vaccines in contrast to whole cells , could be prepared by proteolytic cleavage of cell surface targets [ 16 , 17 ] . the composition of this antigenic essence , which was established by the proteomic footprinting [ 8 , 18 ] , directly defined target cell killing rates in cta that represent an in vitro anticancer vaccination model . santavac formulations can be mixed with different adjuvants and their immunogenicity and safety tested in vivo as ucv . the present study expanded on the selection of alloantigens used in the preparation of santavac vaccines . the primary benefit of utilizing alloantigens as vaccine components is the possibility of excluding the patient 's biomaterial from the vaccine preparation , thereby simplifying vaccine development , lowering the cost , and facilitating translation into clinical practice . although autogenic santavac induced much higher target cell killing rates in cta than alloantigens , alloantigens may also be highly efficient . alloantigen compositions that induced low tumor killing rates also exhibited low killing rates of healthy tissues providing the required therapeutic window for their application . from the perspective of estimating vaccine efficacy ( defined by target cell destruction in the absence of damage to healthy tissues ) , the immune response elicited by alloantigens was safer and the following previously discovered observations relating to endothelial cell heterogeneity were considered : ( i ) the tumor influence on hmec was not specific to the tumor type and hmec heterogeneity was a result of differences in strength of this influence ; ( ii ) there was a linear dependence between target cell killing rates and the similarity of cell surface profiles of target cells and cells used to generate surface antigens for targeting the immune response ; and ( iii ) the increase in tumor - induced changes at the hmec surface led to decreased immunogenicity of hmec surface antigens . in addition , one particular observation from previous experiments suggested that the strongest changes to the hmec surface were induced by hepg2 cells . this research was therefore designed to measure target cell killing rates in cta where alloantigens were derived from hmec stimulated to grow following stimulation by hepg2 that possessed a different signal strength ( from weak to strong stimuli ) . it was therefore expected that the cta experiments would reveal the maximum efficacy of allogeneic santavac in vitro . figure 2 showed how tumor stimuli strength was selected to provide hmec with the diversity of tumor - induced surface profiles . weak stimuli corresponded to the tumor - conditioned medium that induced an hmec proliferation rate slightly higher compared to proliferation of control hmec . moderate stimuli corresponded to the percentage of tumor - conditioned medium which provided hmec proliferation at half the maximum rate . strong stimuli corresponded to the percentage of tumor - conditioned medium used which provided hmec the stimuli to proliferate at a high rate . cta revealed that hmec with tumor - induced surface changes may be efficiently targeted by allogeneic santavac . this phenomenon was consistent with previously published data describing hmec heterogeneity that established the foundation for the development of the santavac . tumor cells induced unidirectional changes to the hmec surface profiles resulting in a more similar antigen profile between target cell surface antigens and the surface antigen profile of cells used to generate antigens needed to target the immune response . as a consequence , the observed efficacy of santavac generated from hmec and hmec ( i.e. , santavac and santavac , resp . ) was sufficiently higher than the efficacy observed for control cells ( i.e. , hmec ) and santavac . the high similarity between antigens present in santavac and the cell surface antigens expressed by target cells explains this observation . the fact that target cell killing of santavachmec was sufficiently higher than that of santavachmec can be explained by one above - mentioned statement : that immunogenicity decreases with increasing tumor - induced changes to the hmec antigen surface profile . therefore , moderate tumor - induced changes to hmec surface antigens would be preferable in the context of vaccine design resulting in efficacy i equal to 17.3 ( safety ) and efficacy ii equal to 60 ( capacity to arrest tumor growth ) . in this report efficacy i allowed for an in vitro estimation of the number of tumor vasculature endothelial cells that would be destroyed before one normal tissue endothelial cell would be destroyed . efficacy ii allowed for an in vitro estimation of the vaccine efficacy in the context of suppression of hmec proliferation of the tumor vasculature and primarily is a reflection of the potential for the vaccine to arrest tumor growth ; that is , it describes the vaccine 's therapeutic effect . it should be noted that stimuli of different strengths would be expected in vivo due to gradual diminishing growth stimuli in relation to increasing distance from the tumor cells . therefore , it can be expected that hmec with different target surface profiles , including profiles related to hmec , will also be present in the tumor - associated vasculature . future studies in the field of vaccine development using allogeneic santavac are required ; however , in vitro data presented in this report demonstrated that the allogeneic santavac was a perfect candidate for the development of a ucv with outstanding efficacy and safety . the santavac formulation described achieved efficacy equal to 17 and 60 in relation to in vitro prediction of vaccine safety and capacity to arrest tumor growth , respectively . criteria critical to the development of such efficient allogeneic santavac are defined in this paper and may be used for preparing ucv for clinical trials .

recently it was demonstrated that tumors induce specific changes to the surface of human endothelial cells thereby providing the basis for designing endothelial cell - based vaccines that directly target antigens expressed by the tumor endothelium . the present report extends these studies in vitro by investigating the efficacy of allogeneic antigens with regard to their ability to target immune responses against the tumor vasculature since alloantigens simplify vaccine development and implementation in clinical practice . we demonstrated that allogeneic santavac ( set of all natural target antigens for vaccination against cancer ) , which presents a specifically prepared composition of cell surface antigens from tumor - stimulated endothelial cells , allows targeting of the tumor vasculature with efficacy of 17 , where efficacy represents the killing rate of target cells before normal cells are adversely affected , and efficacy of 60 , where efficacy represents the fold decrease in the number of target cells and directly relates to tumor growth arrest . these data suggest that allogeneic santavac may be considered an antigenic composition that following administration in the presence of respective adjuvants may be clinically tested as a therapeutic or prophylactic universal cancer vaccine without adverse side effects to the normal vasculature .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

having a partner with a serious illness has an enormous impact on family life , and relatives are affected both physically and mentally . relatives living with a critically ill patient will often experience that their life is turned upside down , which can be very stressful . a study on relatives to patients with alzheimer 's disease showed that relatives were more distressed , showed poorer immune function , and had an increase in respiratory tract infections , compared to a control group . the study found that even when the patient died , the relatives continued to show immunological downregulation for several years . family members are , in many cases , the main source of support for a critically ill patient and often hold valuable knowledge about the patient . allowing relatives to be present and play a role in caring for the patient is often comforting for the patient and can improve care planning for the benefit of both patients and the hospital . research has shown that relatives do not always receive the attention they need from health professionals ; the reason for this is often unclear . a study on frail and vulnerable patients indicated that quality of care improved in decision - making and exchange of knowledge was a collaboration between relatives and health professionals . if care is not properly coordinated by the health professionals , the quality of care can be experienced as being inadequate and lead to frustration for patients and their relatives . a canadian study showed that poor satisfaction from patients and relatives was due to health professionals ' inability to coordinate care . the main source of dissatisfaction was rotation between health professionals , difficulties in making decisions , and lack of coordination between health professionals . it has been shown that relatives receiving information , advice , and emotional support are more likely to be satisfied . when caring for critically ill patients , health professionals must be aware of their role and the asymmetry this relationship contains . being in a situation where a patient 's life situation is changing will often lead to changes in the relatives ' situation . relatives will often experience an increase in pressure due to the hospitalization of their loved one , which can leave them with a feeling of hopelessness and despair . hope is essential , because it enables people to cope with difficult situations and life changes . health professionals must be aware of the responsibility they have to influence the feeling of hope . it has been shown that health professionals did not have the knowledge of what relatives go through during the hospitalization of their partners [ 8 , 9 ] . there are often no standardized protocols for including relatives in the care provided by health professionals in a general ward , and there is a great variation in the care offered for relatives within the hospitals . the sooner the health professionals prepare interventions that include relatives in the care and treatment of the patient , the sooner they can prevent a later negative reaction from the relatives . a recent study reported that relatives should be considered important in the treatment and care with patients . this study measured the impact of different levels of social support on patients ' self - care . patients with a high level of social support found that having a supporting partner had a significant influence on several parameters , such as taking medications , managing fluid intake , and consulting health professionals . therefore , it is necessary to be aware of what relatives go through and ideally have a way of monitoring relatives ' experience of quality of care . a recent study reported that relatives should be considered important in the treatment and care with patients . this study measured the impact of different levels of social support on patients ' self - care . patients with a high level of social support found that having a supporting partner had a significant influence on several parameters , such as taking medications , managing fluid intake , and consulting health professionals . the aim of this study was to investigate the relatives ' satisfaction and involvement on a general surgery ward , regarding the critically ill patient . this study was a mixed methods study designed to identify the relatives ' involvement , satisfaction , and needs during hospitalization of a patient that became acutely ill . data were collected in two steps , first a survey and then a study using in - depth interviews . the reason for choosing a mixed method was because of its capacity to strengthen and explore the results found in one research approach compared to the other . in this case , it allowed the quantitative results from the survey to be explained with a qualitative study through in - depth interviews . inclusion criteria were relatives to patients with a deterioration in their illness within the last 48 hours defined as fulfilling one of the following criteria : an early warnings score 7 , having the mobile emergency team called for a consultation or transfer to the intensive care unit or another room for closer observation . exclusion criteria were relatives with psychiatric disorder , language difficulties , or withdrawal of consent . all participants were recruited from the surgical ward between march 1 , 2014 , and july 1 , 2014 . the questionnaire used for the survey was a translated version of the nursing care survey 2002 nosa . the questionnaire is structured so a score can be obtained from each item . for this study , two items were excluded from the questionnaire , because they were regarding discharge , a theme not relevant for this study , since patients were not discharged at the time of data collection . the process of translation was aligned to the recommendations for translation and cultural adaption of surveys . approval to translate the nursing care survey 2002 nosa was obtained from the inventors . a panel of three expert researchers translated each the nursing care survey 2002 nosa from english to danish . when agreement was reached , the survey was translated back to english by a native speaking dane . when the questionnaire was backward translated to english it was sent to the inventor in australia for validation . when the translated questionnaire was sent back from australia with comments , the danish version was corrected and deemed ready for testing . for further validation each participant was interviewed about the meaning of each question in the questionnaire in order to clarify misconceptions . a written conclusion was signed by each participant , after each interview , and used in the further validation process . each item could be responded on a 5-point likert scale with 0 indicating total agreement and 4 indicating total disagreement with the statement ( table 1 ) . a total score for each participant was calculated and converted to a score ranging from 0 to 100 by total score / max score 100 . furthermore , responses were analyzed with the use of cut - off values with the percentages of respondents in the categories always and mostly . the categories were > 80% very good standard , 7080% acceptable standard , and < 70% requiring attention . comparison of total score for interview participants versus noninterview participants was performed with the mann - whitney u test . , the researchers were focusing on a circular motion , where the researcher was concerned with the relatives ' experiences as they were lived . here , the process becomes a dialogical method , where the researcher and the phenomenon being studied are combined together . the in - depth interviews were preferred , as they made participants feel more comfortable to talk about their personal experiences , when they were done face to face as opposed to focus group discussions . this approach makes it more likely for the researcher to get in depth with the themes of a more sensitive character . a semistructured flexible interview guide was developed from the themes in the questionnaire and then combined with findings from conversations with two relatives to patients that had become critically ill . this was done to secure that the responses contributed to a deeper understanding of the items in the questionnaire . the first author performed the interviews , which took between 30 and 45 min . each interview was recorded and then transcribed verbatim by an external contributor and carefully reviewed by jannie laursen and kristoffer andresen . the interviews were transcribed into full text and qualitative content analysis was used for analyzing the data . the two researchers ( jannie laursen , kristoffer andresen ) performed the analysis in parallel processes ; they subsequently discussed subthemes and themes which were then compared and reflected upon in an in - depth process . the study was approved by the danish data protection agency ( journal number 528 - 02971 ) and was exempt from ethical approval from the ethical committee of the capital region in denmark , but a statement of exemption was obtained ( journal number h-2 - 2013-fsp56 ) . relatives who met eligibility criteria were identified by nurses at the surgical ward and asked by the first author whether they would participate in the study . the relatives were informed that they at any time could withdraw from the study , and it would not influence the patient 's treatment or care . before answering the questionnaire and/or participation in the interview , a consent form was signed and the relatives were reassured of the confidentiality both orally and in writing . we approached 50 potential relatives of whom 27 participated in the questionnaire , and six of them participated in in - depth interviews . all participants were family members , including parents , siblings , children , and spouses . reason for declined participation for the 23 was due to stress , fatigue , or the loss of their loved ones . in the questionnaire , median ( range ) score for all participants were 30 ( 070 ) . for seven items out of 10 , less than 70% of the participants indicated that they were always or this is an indication that a third of the relatives were unsatisfied with these items and that they require attention ( see table 1 ) . the highest degree of dissatisfaction was found for items four were you involved in decisions about the care of your relative as much as you felt you needed to be and eight did the health professionals anticipate and meet the needs of your relative , both with only 48% of patients responding always / mostly . in order to further explore these items , the in - depth interviews were conducted . the findings were based on the narratives from six relatives , four women and two men which participated in the in - depths interviews . during the analyses of the data , three themes emerged ; the first one was lack of continuity and structure , the second one was responsibility of coordination , and the third one was relatives left alone with no guiding and support . all relatives were physically involved in the care of the critically ill patient and they were all very emotional and sensitive about the critical situation . all relatives were experiencing feelings such as frustration , anxiety , and a profound struggle to understand the unfortunate situation , which lead to the themes described in the following . this theme was focused on the relatives ' perceptions of lack of continuity and structure . the relatives experienced that when the condition of the patient deteriorated and the situation became severed , the thing they needed the most from the health professionals was structure and some form of continuity in the further plan , one relative explained it as follows:there was a new doctor every day , there were 47 different names to remember , and who should i call ( ? ! ) . all they did was to state her ( the patient ) diagnosis , and send a request for a supervising doctor . i believe we all know what her diagnosis was and that the doctors needed a consultation from another doctor,everything inside the relatives was an emotional chaos and they were clinging to every little thing in the hope of gaining some sense of the situation . when the relatives were not offered reconciliation from the health professionals , it often resulted in confusion and frustration , as a relative noted : my nerves were frayed , the health professionals promised to take care of my husband , to check on him , but that just did n't happen . there was a new doctor every day , there were 47 different names to remember , and who should i call ( ? ! ) . all they did was to state her ( the patient ) diagnosis , and send a request for a supervising doctor . i believe we all know what her diagnosis was and that the doctors needed a consultation from another doctor , my nerves were frayed , the health professionals promised to take care of my husband , to check on him , but that just did n't happen . in line with quantitative findings often relatives felt that the health professionals were not able to create continuity in the care of , or during the admission of , the critically ill patients . the relatives felt that availability of information was poor and always at the request of them . even though they were present and tried to be involved , the health professionals made no effort to include them in any way . this was commented on as follows : the health professionals saw me every day , so they knew who i was , but there was no attempt to include me and they knew that information was very important for us , that i knew what was going on , because my mom did n't always understand what was happening . often the health professionals were vague in their attempts to meet the relatives and often the waiting time felt very long and uncertain , which only made it more urgent for the relatives to gain some kind of information and not have to bear all the responsibility on their own . the relatives felt that they had to take charge on all follow - ups regarding care and treatment ; they felt that there were a lack of leadership and consistency presented by the health professionals . the lack of consistency and follow - up from health professionals often resulted in negative emotional reactions , which lead to some relatives having difficulties pursuing with their daily lives . it was by one relative commented on asit is terrible for you as a spouse , to see your wife lying there , horrible when you ca n't see any progress and you feel the health professionals just talk and talk , but nothing happens . you can only interpret this as carelessness , as they do n't take any responsibility , which leaves you feeling powerless . they experienced that the health professionals were apathetic and indifferent , which often lead to difficulties in managing and coping with the given situation for the relatives:i never received any explanation why they went in a new direction with my husband , which meant a lot of stress for me.consistent with the findings from the quantitative analysis , only 55% of relatives were answered by the health professionals in a way they could understand . this led to uncertainties in the situations , which often led to stress and anxiety for the relatives . often the feeling of not being able to deal with the responsibility and not being offered any support or guiding from the health professionals led to relatives not having time to cope with their own emotions:there was too much focus on coordinating things , making sure that all was running smoothly . if i should n't have done that , i could have been there for her , been more present and less stressed . i was very scared of what was going to happen and what i feared the most did happen . often when relatives did try and manage the increased responsibility and the lack of commitment from the health professionals , they felt that they were not given any authority to do so . the increase in responsibility and the severity of the situation only made them more desperate and resigned . in some cases , that meant that some of the relatives had a strong need to stay in control and take all the responsibility for care and treatment . a relative expressed it as i sit all day in my taxi , thinking , should i call the hospital ' , hoping they had remembered to check on my mother . but then again it would be stupid , that will only signal that i did n't feel comfortable or relied on the system . it is terrible for you as a spouse , to see your wife lying there , horrible when you ca n't see any progress and you feel the health professionals just talk and talk , but nothing happens . you can only interpret this as carelessness , as they do n't take any responsibility , which leaves you feeling powerless . i never received any explanation why they went in a new direction with my husband , which meant a lot of stress for me . there was too much focus on coordinating things , making sure that all was running smoothly . if i should n't have done that , i could have been there for her , been more present and less stressed . i was very scared of what was going to happen and what i feared the most did happen . the division of roles and responsibilities between health professionals and relatives was not clear for them , as described by one relative:it 's not me who has to walk around and organize their work . it seems wrong.relatives felt that they had to be responsible and stay in control over the situation . if they did not , the critically ill patient would not get the correct or proper care . at the same time , the relatives felt anxious and confused and the weight from the responsibility was almost unbearable for them , as one relative indicated : there is no consistency in anything , always swopping around , new doctors , and new nurses . no one takes any responsibility.many relatives felt that they had to be present most of the day , to make sure that the health professionals were offering the critically ill patient the needed care , according to one relative : there were many situations where my mother did not understand what was happening if i was n't thererelatives felt that they had the responsibility to coordinate and secure that things were running smoothly . if they did not take part in caring for the critically ill patient and were physically and mentally present with a constant awareness of the situation , everything would collapse and everything would fall apart ; it was described as follows : i was told that she was hospitalized , but my dad said that i should n't hurry to the hospital , so i came here at one o'clock . i found her in her own dirt , she had urinated in her pants and i was indignant . i am checking that this is not happening again , i have to stay in control . it made me angry and sad.the relatives had to manage care and treatment for the critically ill patient , to make sure that all was done professionally , even though they were not health professionals:if they felt that the situation called for more professionalism than the health professionals delivered , which meant they had to be responsible for it . it was often described asi did n't understand why i should attain work that was not mine . it was hard , that i had to play such a big part in coordinating things.it was clear during the interviews that the responsibility to harmonize , the lack of structure , and the unclear division of roles left the relatives with a feeling of lack of coherence , which often lead them to a feeling of losing control , frustration , and mistrust of the system . there is no consistency in anything , always swopping around , new doctors , and new nurses . there were many situations where my mother did not understand what was happening if i was n't there i was told that she was hospitalized , but my dad said that i should n't hurry to the hospital , so i came here at one o'clock . i found her in her own dirt , she had urinated in her pants and i was indignant . i am checking that this is not happening again , i have to stay in control . it was hard , that i had to play such a big part in coordinating things . many relatives were overwhelmed by the situation , when their loved one became critically ill . they felt that they were being left on their own and at the same time expected to maintain control ; one relative indicated thatthe role of just being relatives was hard to keep - not being able to come for a visit and just give her a hug was hard.in line with quantitative findings , only 48% felt that the health professionals anticipated and met the needs of their relatives . they felt that they had to oversee the work of the health professionals in order to make sure that the patient received sufficient care . they had a direct responsibility for the patient , but at the same time they were torn between trusting the system and experiencing it as collapsing . they simply said , that we have to let certain things go , which for me meant , that i had to take responsibility for my mother 's care . many relatives felt that they had to use their full mental and emotional capacity to maintain some control over the situation . the communication with the health professionals was challenged by the feeling that they did not listen to them and were not taking charge over the situation . the amount of energy the relatives had to mobilize to be in control often exceeded what was possible . the relatives experienced a lack of care or concern from the health professionals , which was perceived as hard and unsatisfying for them . relatives felt isolated in the situation , which left them with a feeling that no one understood what was going on . they felt detached from the situation and they did not feel that the health professionals were interested in them or their resources . relatives were not an integrated part of the care for the critically ill patient and more perceived as someone who toke resources from the health professionals . one relative expressed it as i did n't receive any care as a spouse . i would have liked if they had talked to me , included me in their plans , spent a little time on me , and showed they empathized . another relative stated , the culture is very much them and us ' . the role of just being relatives was hard to keep - not being able to come for a visit and just give her a hug was hard . they simply said , that we have to let certain things go , which for me meant , that i had to take responsibility for my mother 's care . i had to stay in control , because what if they missed something . when health professionals were not able to include and inform the relatives , it left the relatives feeling powerless . often relatives felt they had to be the coordinator and secure that everything was running smoothly . in this study , the aim was to investigate the relatives ' satisfaction and involvement on a general surgery ward regarding the critically ill patient . the study investigated the level of information , the involvement of the relatives in the patient care , and the relatives ' perspectives of quality of care , regarding the patients ' needs , and health professionals ' communication . the questionnaire results showed that a third of the participants did not seem satisfied with the quality of care . the qualitative results showed that in critical situations health professionals need to be present , caring , and empathic . this was not the general experience by the relatives as revealed by the responses to the questionnaire . often they felt they were on their own , not skilled to cope with the situation , and in need of the health professional that could lead care and treatment and at the same time include them in the process . the use of satisfaction as a tool to measure quality of care has previously been discussed although it is a common and often used measurement [ 1921 ] . earlier studies using satisfaction as a measurement found that being a woman , having a high educational level , or having a health professional 's background often was associated with a decrease in satisfaction [ 4 , 21 ] . however , these uncertainties were taken into account in the in - depth interviews , so that participants were of both sexes , there was a mixture of educational levels , and there were no health professionals among the relatives . a study on collaboration between relatives of elderly patients and nurses stated that relatives that were new in the role as relatives could also be more critical towards the healthcare system than others . this is of course a factor to consider , as in this study there were relatives that were both new in the role and more experienced . a third of the relatives stated that they were dissatisfied with the health professionals on the surgical ward . they were especially dissatisfied with the organization of the care and the involvement about the care . these results were consistent with other studies , showing that dissatisfaction often was associated with how the relatives were informed and was often associated with severity of the patient 's illness [ 4 , 22 ] . if patients were managed on a special unit and not a general ward , it was often seen that it had a positive influence on the level of satisfaction [ 4 , 11 , 22 ] . this study showed that relatives felt there were no structures during the admission and often they felt that they were left in the dark , with no ability to obtain information and with no consistency . these findings align with previous research , where relatives experienced both system and patient frustration [ 5 , 6 ] . the frustration was often due to poor communication and long waiting time especially for feedback but also decisions about care . the study found that relatives often felt that the health professionals did not care and that they were met with negligence [ 5 , 9 ] . these findings add to the evidence that relatives want to participate in decision - making and be treated as collaborators when the patient becomes critically ill . many of the challenges identified by the relatives were interrelated and often exacerbated each other . for example , a poor understanding on who was responsible for what led to a feeling of lack in feedback which increased the uncertainty further . frustration with managing the proper care was aggravated by the health professionals ' inability to coordinate and take charge and thereby not providing the appropriate comfort and security for the relatives . better communication and improving the management of decision - taking were a key item to be able to guide the relatives in a more satisfactory way . a study on frustration expressed by relatives stated that they wanted face to face consultation , but because this is not always possible an alternative could be to use an electronic consulting system as a supplement to the face to face communication . , the relatives would be considered as important collaborators to the critically ill patient , providing relevant and significant information and at the same time maintaining energy to be supporting and caring for the critically ill patient . a study on spouses ' needs for professional support showed that many spouses felt that the health professionals were annoyed by their presence and that the spouses often were met by indifference . when people experienced lack of coherence due to a life changing event , it was often shown in difficulties in managing and coping with even the smallest things . a hospital culture that provides support and consistence will often lead to a more manageable situation . if the culture values the role of people , it will be perceived as more sustaining and leave a feeling of meaningfulness , which can help support relatives in a more manageable way . relatives can be perceived as both resources and potential clients and the stress they experience can affect their health on a long term . being a relative to a critically ill patient will often lead to the loss of control . the feeling of loss of control will often collide with the need to see the world in a clear , ordered , and structured way : there is a need to also study the perception of care for relatives from the health professionals ' point of view . there is probably a range of reasons why the health professionals do not provide the care for relatives that they so desperately need , and it is important to characterize the health professionals ' experience in order to make meaningful interventions for the improvement of the care for relatives . however , it was not within the scope of this study to also cover the experience of the health professionals . there is a need to also study the perception of care for relatives from the health professionals ' point of view . there is probably a range of reasons why the health professionals do not provide the care for relatives that they so desperately need , and it is important to characterize the health professionals ' experience in order to make meaningful interventions for the improvement of the care for relatives . however , it was not within the scope of this study to also cover the experience of the health professionals . combining results from two different research approaches may be a challenge . however , by interviewing six participants in the in - depth interviews , we exemplified what the relatives dissatisfaction covered , which can lead to new interventions towards including relatives in general wards . the reason for this was that very little research has been done in the field of a general surgical ward with patients that suddenly became acutely ill . these patients ' relatives take a lot of focus due to the fact that their situation unexpectedly changes . a third of the participants in this study were unsatisfied with the organization and the involvement in care . the findings implied that they were left with no guiding or support from the health professionals , which often led to the feeling of loss of control . thereby , relatives can gain a sense of coherence during the hospitalization of a critically ill patient , which can lead to a greater satisfaction and thereby better support for the patient .

aims and objective . to investigate the relatives ' satisfaction and involvement on a general surgery ward regarding the critically ill patient . introduction . relatives to critically ill patients are affected both physically and mentally during the hospitalization of a family member . research has shown that relatives do not always receive the attention they need from health professionals . there is a lack of studies that focus on relatives ' satisfaction and involvement during their family members ' hospitalization . design . a mixed methods design was chosen . methods . a quantitative study was conducted with 27 relatives to critically ill patients . all participated in a questionnaire and out of the 27 relatives , six participated in qualitative in - depth interviews . results . the questionnaire revealed that relatives were dissatisfied with care and involvement . for further exploration of the dissatisfaction , a qualitative approach was used and the in - depth interviews revealed three themes : lack of continuity and structure , responsibility of coordination , and relatives feeling left on their own with no guiding and support . conclusion . health professionals ' key role in relation to relatives must be guidance and support . thereby , relatives can gain a sense of coherence during the hospitalization of a critically ill patient , which can lead to a greater satisfaction and thereby better support for the patient .

1. Introduction 2. Methods 3. Results 4. Discussion 5. Strengths and Limitations of the Study 6. Conclusion

transient ischemic attack ( tia ) is defined as a transient episode of neurological dysfunction caused by focal brain , spinal cord , or retinal ischemia , without acute infarction . tia has long been regarded as the most important independent risk factor and the most useful warning signal of acute infarction [ 24 ] . it was reported that more than 10% of tia patients had acute infarction within 90 days and half of them had acute infarction within 48 h after tia . thus , it is important to refine the clinical risk factor stratification and develop an optimal intervention plan to prevent ischemic stroke . abcd score is a simple and efficient scale that covers the main clinical features and risk factors of tia and has been validated for prediction of short - term risk of ischemic stroke after tia , but some authors find it has many limitations [ 612 ] . the abcd score can predict the short - term risk of stroke after ac - tia ( anterior circulation tia ) , but may have limited value in pc - tia ( posterior circulation tia ) . in this prospective , hospital - based study , we compared the correlations between various risk factors and recurrent events after tia . using multiple statistical methods , we also explored the predictive value of abcd score in early recurrent events after tia . all data were obtained from patients attending our hospital from january 2010 to december 2011 diagnosed with tia according to the definition recommended by aha / asa in 2009 , with a hospital stay longer than 7 days according to guideline recommended by eso ( european stroke organization ) . mri examination ( including dwi ) and other examinations patients with clinical symptoms lasting for more than 1 h and with a corresponding lesion on the t2-weighted mri were excluded . after being admitted into hospital , antiplatelet therapy and statins were prescribed according to guidelines recommended by the nsa ( national stroke association ) . the abcd score was calculated based on the characteristics of tia by another investigator blind to the prognosis , as follows : age > 60 years=1 , blood pressure > 140 systolic and/or > 90 diastolic mm hg=1 , clinical features ( unilateral weakness=2 , speech disturbance=1 ) , duration of symptoms ( minutes=2 , 10 to 59 minutes=1 , < 10minutes=0 ) , and diabetes=1 . early prognosis within 7 days after tia was assessed by another experienced physician , and classified as no recurrent events , recurrent tia , minor stroke , or major stroke . a recurrent tia was defined as a new neurologic deficit in patients who had completely recovered from the initial symptoms before ; with a duration < 24 h and without corresponding lesions on mri images obtained 6 h after the recurrent events . a recurrent stroke was defined as a new neurologic deficit with a corresponding new lesion on mri obtained 6 h after the recurrent events . a minor stroke was defined as a stroke with baseline nihss score <3 , a score 0 or 1 on every nihss score item , except level of consciousness items ( items 1a to 1c ) , which must be 0 . this study was approved by the ethics committee of shanghai tenth people s hospital of tongji university . all subjects were imaged with a 3.0 t mr scanner ( siemens 3.0 t magnetom verio , medical solutions , erlangen , germany ) with a standard 8-channel phased - array head coil . the mr protocol consists of t1-weighted image ( repetition time / echo time=2000/9 ) , t2-weighted image ( repetition time / echo time=6000/94 ) , flair ( repetition time / echo time=8500/94 ) , and dwi ( motion - probing gradients in 3 directions with b factors of 1000 s / mm ) were obtained with a slice thickness of 5.5 mm in the axial plane . a focal hyperintensity in the specific area corresponding to the clinical symptoms on dwi was regarded as the sign of recurrent stroke . a multinomial logistic regression model was constructed to analyze the predictive value of risk factors for the severity of recurrent events , with z test to compare the values . all data were obtained from patients attending our hospital from january 2010 to december 2011 diagnosed with tia according to the definition recommended by aha / asa in 2009 , with a hospital stay longer than 7 days according to guideline recommended by eso ( european stroke organization ) . mri examination ( including dwi ) and other examinations patients with clinical symptoms lasting for more than 1 h and with a corresponding lesion on the t2-weighted mri were excluded . after being admitted into hospital , antiplatelet therapy and statins were prescribed according to guidelines recommended by the nsa ( national stroke association ) . the abcd score was calculated based on the characteristics of tia by another investigator blind to the prognosis , as follows : age > 60 years=1 , blood pressure > 140 systolic and/or > 90 diastolic mm hg=1 , clinical features ( unilateral weakness=2 , speech disturbance=1 ) , duration of symptoms ( minutes=2 , 10 to 59 minutes=1 , < 10minutes=0 ) , and diabetes=1 . early prognosis within 7 days after tia was assessed by another experienced physician , and classified as no recurrent events , recurrent tia , minor stroke , or major stroke . a recurrent tia was defined as a new neurologic deficit in patients who had completely recovered from the initial symptoms before ; with a duration < 24 h and without corresponding lesions on mri images obtained 6 h after the recurrent events . a recurrent stroke was defined as a new neurologic deficit with a corresponding new lesion on mri obtained 6 h after the recurrent events . a minor stroke was defined as a stroke with baseline nihss score <3 , a score 0 or 1 on every nihss score item , except level of consciousness items ( items 1a to 1c ) , which must be 0 . this study was approved by the ethics committee of shanghai tenth people s hospital of tongji university . all subjects were imaged with a 3.0 t mr scanner ( siemens 3.0 t magnetom verio , medical solutions , erlangen , germany ) with a standard 8-channel phased - array head coil . the mr protocol consists of t1-weighted image ( repetition time / echo time=2000/9 ) , t2-weighted image ( repetition time / echo time=6000/94 ) , flair ( repetition time / echo time=8500/94 ) , and dwi ( motion - probing gradients in 3 directions with b factors of 1000 s / mm ) were obtained with a slice thickness of 5.5 mm in the axial plane . a focal hyperintensity in the specific area corresponding to the clinical symptoms on dwi was regarded as the sign of recurrent stroke . a multinomial logistic regression model was constructed to analyze the predictive value of risk factors for the severity of recurrent events , with z test to compare the values . we enrolled 108 patients into this study and 2 of the 108 patients were excluded because of a history of cancer . baseline characteristics of all subjects , including the vascular risk factors , are listed in table 1 . none of the hypertension or diabetes patients had organ damage . at 7 days after tia , 24 ( 22.6% ) patients had recurrent tia . twenty ( 18.9% ) patients had recurrent stroke , of which 14 had minor stroke and 6 had major stroke . risk factors of tia and abcd score were investigated within different categories of prognosis of tia . the overall comparison and multiple comparisons among different prognoses showed that the proportions of hypertension , dyslipidemia , and history of cerebral infarction of tia increased with the severity of recurrent events . compared with patients with no recurrent events , the results also show that abcd score increased with the severity of recurrent events ( table 2 ) . based on the results in table 2 showing that abcd score increased with the severity of recurrent events , we further analyzed the relationship between different items of abcd score and the severity of recurrent events . the results show that only duration of symptom increased with the severity of recurrent events ( p<0.001 ) ( table 3 ) . in this part , we constructed a multivariate , stepwise , logistic regression model to analyze the predictive value of duration of symptom as an item of abcd score for the severity of recurrent events . major stroke were defined as 0 , 1 , 2 , and 3 , respectively . first , 3 variants ( hypertension , dyslipidemia , and history of cerebral infarction or tia ) related to the severity of recurrent events ( table 1 ) , together with age and sex , were included in the equation to show the severity of recurrent events ( white histogram ) . second , the abcd score was added to the predictive equation ( grey histogram ) . third , duration of symptom was added to the first predictive equation ( black histogram ) . the results showed that compared to the first predictive equation , the second equation , which included abcd , score did not show a significant improvement of the predictive value for the severity of recurrent events , whereas the third equation , which included duration of symptom , significantly improved the predictive value for the severity of recurrent events ( 47.9 vs. 34.8 , p=0.01 ) ( figure 1 ) . in this part , hypertension , dyslipidemia , and history of cerebral infarction or tia which were proven to be related to the severity of recurrent events , together with age , sex , abcd score , and duration of symptom , were added to the predictive equation for the severity of recurrent events . the results showed that only hypertension ( rr=9.21 , 95% ci=3.0727.61 , p<0.001 ) and duration of symptom ( rr=1.10 , 95% ci=1.021.17 , p=0.01 ) could independently and significantly predict the severity of recurrent events , whereas no significant predictive value of abcd score ( p= 0.18 ) was found for the severity of recurrent events ( table 4 ) . we enrolled 108 patients into this study and 2 of the 108 patients were excluded because of a history of cancer . baseline characteristics of all subjects , including the vascular risk factors , are listed in table 1 . twenty ( 18.9% ) patients had recurrent stroke , of which 14 had minor stroke and 6 had major stroke . risk factors of tia and abcd score were investigated within different categories of prognosis of tia . the overall comparison and multiple comparisons among different prognoses showed that the proportions of hypertension , dyslipidemia , and history of cerebral infarction of tia increased with the severity of recurrent events . compared with patients with no recurrent events , the results also show that abcd score increased with the severity of recurrent events ( table 2 ) . based on the results in table 2 showing that abcd score increased with the severity of recurrent events , we further analyzed the relationship between different items of abcd score and the severity of recurrent events . the results show that only duration of symptom increased with the severity of recurrent events ( p<0.001 ) ( table 3 ) . in this part , we constructed a multivariate , stepwise , logistic regression model to analyze the predictive value of duration of symptom as an item of abcd score for the severity of recurrent events . no recurrent events , recurrent tia , minor stroke , and major stroke were defined as 0 , 1 , 2 , and 3 , respectively . first , 3 variants ( hypertension , dyslipidemia , and history of cerebral infarction or tia ) related to the severity of recurrent events ( table 1 ) , together with age and sex , were included in the equation to show the severity of recurrent events ( white histogram ) . second , the abcd score was added to the predictive equation ( grey histogram ) . third , duration of symptom was added to the first predictive equation ( black histogram ) . the results showed that compared to the first predictive equation , the second equation , which included abcd , score did not show a significant improvement of the predictive value for the severity of recurrent events , whereas the third equation , which included duration of symptom , significantly improved the predictive value for the severity of recurrent events ( 47.9 vs. 34.8 , p=0.01 ) ( figure 1 ) . in this part , hypertension , dyslipidemia , and history of cerebral infarction or tia which were proven to be related to the severity of recurrent events , together with age , sex , abcd score , and duration of symptom , were added to the predictive equation for the severity of recurrent events . the results showed that only hypertension ( rr=9.21 , 95% ci=3.0727.61 , p<0.001 ) and duration of symptom ( rr=1.10 , 95% ci=1.021.17 , p=0.01 ) could independently and significantly predict the severity of recurrent events , whereas no significant predictive value of abcd score ( p= 0.18 ) was found for the severity of recurrent events ( table 4 ) . abcd score is a widely used tool for the prediction of prognosis of tia and screening for high - risk tia ( tia with abcd score>3 ) , which was proven to be strongly predictive of recurrent tia or stroke . in a follow - up study of 500 tia patients , arvin et al . found that a high abcd score was predictive of major stroke and a low abcd score was predictive of recurrent tia . our study also proved that abcd score increased with the severity of recurrent events . among the items of the abcd score , the multivariate , stepwise , logistic regression proved that duration of symptom had the greatest contribution to the predictive value of abcd score for the early recurrent events . the duration of symptom could independently and significantly predict the severity of recurrent events , whereas abcd score as a whole was less strongly predictive for the severity of recurrent events . this difference might be caused by the transformation of duration of symptom from a continuous variable to a classified variable , which might reduce the predictive value of duration of symptom , and the weakening effect of other items of the abcd score . our study showed that adding duration of symptom to the predictive equation , which included hypertension , dyslipidemia , history of cerebral infarction , and tia , could enhance the predictive value ( p=0.01 ) , while abcd score could not function as duration of symptom in this model . specifically , the risk of recurrent events increased by 5% with a 10-min increase in duration of symptom . the sensitivity analysis , which excluded some extreme values , showed that the risk of recurrent events increased by 10% with a 10-min increase of duration of symptom . short duration of symptom was predictive of a low risk and severity of recurrent events , which could be explained by the rapid improvement of collateral circulation and adaption of brain cells to ischemia caused by tia . it is reported that the release of glutamic acid was less in the condition of frequent transient vascular occlusion than in the condition of a relatively long occlusion . it has been reported that history of hypertension is an independent risk factor of short - term cerebral infarction and that that hypertension is correlated to the recurrent events of tia . as reported , the blood pressure - based genetic risk score was associated with both baseline hematoma volume and poor clinical outcome , specifically in deep ich . moreover , hypertension could significantly and independently influence the severity of recurrent events , which was proven by the multivariate logistic regression analysis of this study . found that many organs can help the brain maintain normal blood pressure in acute blood loss in rats . therefore , we think the high blood pressure after tia might be a compensatory reaction to the low blood flow volume of brain tissue , which directly suggests a condition of persistent ischemia of brain cells and a high risk of short - term cerebral infarction . the results of the present study suggest that tia with long duration of symptom and hypertension might need more attention and relatively more urgent treatment ; otherwise , this kind of tia might progress to severe cerebral infarction . we compared the predictive value of the abcd score as a whole and duration of symptom as an item for the severity of recurrent events , finding that duration of symptom was the main independent risk factor of the severity of recurrent events and proving its advantage for this prediction . however , due to a small sample size , we can not make further conclusions about the predictive values of different risk factors and items of the abcd score , such as the predictive values for time - point of recurrent events . a more strictly designed study with larger sample size is required . a history of hypertension and long duration of symptom both independently and significantly predict severe recurrent events after tia in 7 days , while a high abcd score was less strongly predictive of severe recurrent events . our findings provide evidence that the abcd score may predict recurrent tia and likelihood of becoming a stroke after tia , and also may help in clinical treatment of tia .

backgroundthe aim of this study was to refine clinical risk factor stratification and make an optimal intervention plan to prevent ischemic stroke.material/methodsclinical data , including diffusion - weighted imaging ( dwi ) findings , were collected in a cohort of hospitalized transient ischemic attack ( tia ) patients from january 2010 to december 2011 . recurrent cerebrovascular events after tia , including recurrent tia , minor stroke , and major stroke , were identified by face - to - face follow - up . a multivariate , ordinal , logistic regression model was used to determine significant predictors of recurrent events.resultsof 106 tia patients , 24 ( 22.6% ) had recurrent tia and 20 ( 18.9% ) had a stroke within 7 days . hypertension , dyslipidemia , a history of ischemic stroke or tia , and abcd2 score were significantly associated with the recurrent events after tia ( p<0.001 , p=0.02 , p<0.001 , p=0.02 ) . hypertension ( rr=9.21 ; 95% ci , 3.0727.61 , p<0.001 ) and duration of symptom ( rr=1.10 ; 95% ci , 1.021.17 , p=0.01 ) as an item of abcd2 score were highly predictive of the severity of recurrent events , whereas abcd2 score as a whole ( p=0.18 ) proved to be less strongly predictive.conclusionsa history of hypertension and long duration of symptom independently and significantly predict severe recurrent events after tia within 7 days , but a high abcd2 score was less strongly predictive of severe recurrent events .

Background Material and Methods General information of patients MR protocol and criteria Data analysis Results Baseline characteristics Relationship between the risk factors of TIA and recurrent events Relationship between different items of ABCD The predictive value of duration of symptom for the severity of recurrent events Different predictive values of risk factors for the severity of recurrent events Discussion Conclusions

ruthenium compounds belong to the most promising candidates of non - platinum containing metal complexes for cancer therapy . compared to pt drugs ru complexes cause less side effects and resistances against the drug are less likely . the overall chemical and pharmacokinetic behavior of ru is quite different from that of pt compounds , as reflected in extensive protein binding . imidazolium trans-[tetrachloro(dimethylsulfoxide)(imidazole)ruthenate(iii ) ] ( 13 , nami - a ) , indazolium trans-[tetrachlorobis(1h - indazole)ruthenate(iii ) ] ( 1 , kp1019 ) , its sodium analogue sodium trans-[tetrachlorobis(1h - indazole)ruthenate(iii ) ] ( 2 , kp1339 ) , and ru(ii)-arene complexes like [ ru(-p - cymene)cl2(pta ) ] ( 14 , rapta - c , pta = 1,3,5-triaza-7-phosphatricyclo[3.3.1.1]decanephosphine ) are the most promising investigational drug candidates up to now . phase i clinical trials in patients with refractory solid malignancies have successfully been completed for both 13(19 ) and 1 , the latter yielding disease stabilizations in more than half of the patients , and further clinical studies have commenced recently . in general , it is assumed that the ru(iii ) complexes serve as prodrugs that are reduced under pathophysiological conditions to ru(ii).13 is a ru(iii ) complex mainly active against metastases , and it is assumed that its main site of action is located in the extracellular matrix . the ru(ii)-arenes are organometallic complexes that are quite stable in the bloodstream , hydrolyzed in the nucleus , and bind to dna . the ru complexes 1 ( figure 1 ) and its na salt analogue 2 ( figure 1 ) are the subject of investigation in this work . 1 and 2 differ only in their countercations , indazolium for 1 and na for 2 , exhibiting the same ru(iii ) coordination sphere [ tetrachlorobis(1h - indazole)ruthenate(iii ) ] . therefore , their main binding partners in vivo and their mode of action are thought to be very similar . both are showing antitumor activity exceeding that of pt compounds or other cytostatic agents , e.g. , in colorectal carcinomas in vivo and a variety of primary explanted human tumors in vitro . fast uptake of 2 by the cell and initiation of apoptosis ( indicated by caspase activation ) were observed . the uptake mechanism of the two drugs may involve human serum albumin ( hsa ) , the iron transport protein transferrin ( tf ) , and the tf receptor , which is overexpressed in tumor cells to meet their increased demand for fe . a prodrug function is supposed involving reduction of ru(iii ) to ru(ii ) , which is supported by solution studies in the presence of different reductants . the low oxygen level favors the reduction of ru(iii ) and other redox - active substances . the electrochemical potential of ru(iii)/ru(ii ) is physiologically accessible , and glutathione ( gsh ) and single - electron transfer proteins are able to reduce ru(iii ) in the presence of nadh . however , the direct determination of the oxidation state , the coordination of the ru active site , and the mechanism of action in vivo for these and other ru drugs remains elusive . x - ray absorption spectroscopy ( xas ) is an element specific method that allows the investigation of the questioned element in disordered environments missing any long - range order . xas has proven to be a valuable tool for the speciation of metal centers . by application of x - ray absorption near edge structure ( xanes ) analysis , it is possible to determine the oxidation state and coordination of the ru metal center , whereas extended x - ray absorption fine structure ( exafs ) analysis opens the opportunity to specify the identity , number , and distances of the adjacent atoms . xas is one method of choice to determine the oxidation state of the metal site in model compounds and especially of metal coordination sites in vivo . for instance hambley et al . could monitor activation by reduction of anticancer pt(iv ) compounds inside cells . new reduction pathways of pt(iv ) to pt(ii ) species were monitored with xanes by nemirovski et al . , and the distribution and relative inertness of a ga(iii ) compound in biological tissue were investigated in a previous publication . the main obstacle for bio - xas is the low concentration of the metal in the targeted tissue . to generate spectra with a sufficiently good signal - to - noise ratio , x - ray sources like synchrotrons , with a sufficiently high photon flux in the range of 1 10 to 4 10 photons per second , are necessary . this high brilliance may cause the reduction of the probed metal through secondary electrons and the degradation of the biological tissue . these effects can be minimized using low temperature sample environments like helium cooled cryostats at around 20 k. ascone et al . studied the reaction of bovine serum albumin ( bsa ) with 13 and the formation of the respective 13/bsa adducts by means of the sulfur and chlorine k - edges and the ru k- and l3-edges . ru k- and l3-edge spectra proved unambiguously that the ru center remains in oxidation state + 3 after protein binding . comparative analysis of the cl k - edge xas spectra of 13 and 13/bsa revealed that the cl environment is greatly perturbed upon protein binding . in a subsequent study of liu et al . the binding behavior of 13 to bsa was analyzed by fitting a series of model compounds with known coordination to the unknown ru(iii)-bsa spectrum . the coordination environment of the adduct turned out to be completely different from that of the parent complex 13 with about 60% n and 40% o ligands coordinated to the ru(iii ) center . with a combination of s k - edge and ru k - edge xas and density functional theory ( dft ) techniques studied the activation of ru(ii)-arene complexes through oxygenation and subsequent protonation of the thiolate ( sr ) ligand . the sr ligand is oxygenated to sulfinate ( so2r ) via sulfenate ( sor ) and activated through protonation under acidic conditions . the protonation turned out to be a crucial step , which facilitates the dissociation of the so2r ligand and the dna binding . the ru metal center stayed in its ru(ii ) state throughout this process and was not affected by the ligand oxygenation . sadler and co - workers studied the photodissocation of ru bipyridine complexes and their nucleobase binding with a combination of exafs and dft calculations . used combined cl k - edge and ru l3-edge xas measurements together with dft calculations to describe the electronic structure properties of a set of four ru(iii ) and six ru(ii ) complexes with mixed cl / s / n coordination spheres , among them 1 and 13 . the effect of differing amounts of s ( from dimethyl sulfoxide , dmso ) and n ( from indazole / imidazole ) ligands onto the electronic configuration within each ru series ( iii and ii ) was quite low , and the ligand - to - metal donations reach a limit at around two s , two cl , and two n ligands . this was ascribed to a so - called trans effect where the -donor and -accepting effects of dmso s ligands counteract each other . for 1 it was found that the indazole ligands are weaker donors toward ru than imidazole ones , which is congruent with the proposed activation by reduction mechanism stated for 1 and its easier reduction to ru(ii ) compared to the imidazole analogue trans-[tetrachlorobis(1h - imidazole)ruthenate(iii ) ] ( kp418 ) . getty et al . assigned ru k - edge pre - edge peaks to the centrosymmetric structure of ru carbene complexes for olefin metathesis . with increasing symmetry of the complexes the pre - edge peaks got weakened , which was ascribed to a lowered ru 4d5p orbital mixing . even though 1 and 2 are known to undergo hydrolysis ( facilitating further ligand exchange reactions ) and to be redox - active , both of which are features proposed to be significant for the mechanism of action , neither coordination nor redox condition of 1/2 after biotransformation in biological systems has been examined because of the lack of appropriate analytical methods . xas is the method of choice that possesses a high value as a method for elucidation of the structure of metal coordination centers in biological environments . the aim of this work is to apply xas to investigate the tumor - inhibiting ru compound 1 in citrate saline buffer ( cs buffer ) at ph 3.5 within different time intervals , in the presence of the reducing agent gsh , in carbonate buffer in the presence of the possible transport protein apo - transferrin ( apotf ) , and as a powder . xanes spectra were recorded on tissue samples from mice treated with 1 and 2 . micro x - ray fluorescence ( micro - xrf ) maps were taken from tumor tissue samples taken from mice treated with 2 . additionally model compounds representing possible coordinations and oxidation states in vivo were measured as references . this study is designed to make a contribution toward the fundamental understanding of the biotransformation of ru compounds in vivo and the underlying principle of activation by reduction which has to be evaluated . the following model compounds were investigated with xas : 1 ( with first coordination shell ru(iii)cl4n2 ) , ruthenium(iii ) acetylacetonate ( 3 , ru(iii)o6 , sigma aldrich , cas 14284 - 93 - 6 , 97% ) , hexammineruthenium(iii ) trichloride ( 4 , ru(iii)n6 , sigma aldrich , cas 14282 - 91 - 8 , 99%),mer , trans - aquatrichloridobis(indazole)ruthenium(iii ) ( 5 , kasc003 , ru(iii)cl3n2o),trans , trans - dichloridotetrakis(indazole)ruthenium(iii ) chloride ( 6 , gabu129 , ru(iii)cl2n4),mer - trichloridotris(indazole)ruthenium(iii ) ( 7 , gupl328 , ru(iii)cl3n3 ) , hexammineruthenium(ii ) dichloride ( 8 , ru(ii)n6 , sigma aldrich , cas 15305 - 72 - 3 , 99.9%),mer , trans - trichlorido(dimethylsulfide)bis(indazole)ruthenium(iii ) ( 9 , flan005 , ru(iii)cl3n2s),trans , trans - dichloridotetrakis(indazole)ruthenium(ii ) ( 10 , gabu128 , ru(ii)cl2n4),mer - trichloridotris(ethylphenylsulfide)ruthenium(iii ) ( 11 , flan006 , ru(iii)cl3s3),trans , trans , trans - dichloridobis(dimethylsulfide)bis(indazole)ruthenium(ii ) ( 12 , flan004 , ru(ii)cl2n2s2 ) . all spectra were collected at 20 k. the structural formulas are shown in figure 1 . the xanes spectra of the model compounds and their corresponding first derivatives are presented in figure 2 . in figure 2a the ru(ii ) figure 2b exhibits ru(iii ) compounds with mixed cl / n first shell ligand atoms ( including 1 ) . figure 2c displays compounds with o or s containing first shells . within the same ru oxidation state the edge energies increase with increasing electronegativity of the first shell atoms ( see table 1 ) . model compounds with the same first shells show an edge shift of about + 2 ev from ru(ii ) to ru(iii ) ( see 8/4 and 10/6 ) . the absence of any distinct pre - edge feature implies a centrosymmetric coordination of the here investigated ru compounds . the edge energies observed in this study span a range of about 6 ev , with 1 occupying an energy position right in the middle . the bottom limit is marked by the s containing 12 in its oxidation state + 2 , and the upper boundary is represented by 3 with six o ligands and an oxidation state of + 3 . comprising the highest amount of four cl atoms , 1 occupies the lowest energy position within the ru(iii ) models , exhibiting only cl / n atoms in the first shells . the models 1 , 3 , and the ru hexammine compounds 8 and 4 , in both oxidation states , exhibit a characteristic edge shoulder . normalized spectra of the model compounds and their corresponding first derivatives with a ru(ii ) center ( a ) , mixed cl / n first shells ( b ) , and o or s containing first shells ( c ) . the k weighted exafs spectra and the fourier transforms ( ft ) of the ru model compounds are shown in figure 3 . in figure 3a the fine structures and the non - phase - shifted ft of the models containing a ru(ii ) center figure 3b shows the fine structures and ft of the ru(iii ) compounds with mixed cl / n first shells , and figure 3c shows the one for the models containing o or s in their first shell around the ru(iii ) center . the amplitudes of the fine structure oscillations and the ft magnitudes increase with a growing amount of heavy cl and s scatterers . 11 shows the strongest k - space oscillations and ft magnitudes . for compounds with mixed n / o / cl / s first shells and increasing number of n and/or o ligands a splitting of the first peak in the ft is observable . the ru(ii ) compounds 10 and 12 have the largest cl / n bond length differences and show the strongest peak splitting . the backscattering amplitudes of the heavy scatterers like s and cl and the light scatterers like n and o are out of phase . for 10 this cancellation leads to a node between 7 and 9 seen in figure 3a ( red dashed curve ) . the ru(iii ) analogue 6 has the same features between 8 and 10 seen in figure 3b ( red dashed curve ) . the shift of this feature is mainly attributed to the shortened cl bond lengths of the higher oxidized 6 . the fitting analysis using feff was restricted to the first coordination shell extracted from the first peak in the ft . the identity and number of backscatterers were fixed to the crystallographic values not to exceed the number of fitting parameters , and the known distances were taken as a starting point for the fitting analysis . the results of the first shell fits of the model compounds using theoretical amplitudes and phases provided by the feff code are presented in the supporting information ( table s2 ) , as well as the results for the dl - excurv fits ( table s3 ) . the distances are given as the average fitted distances for each atom type / shell ( cl / s , o / n , and n / c ) . for 6 and 10 the second shell scatterers 4 n and 4 c at about 3 were included in the feff fit , as they had a significant influence on the first shell spectral features . the curve fitting results obtained by feff and dl - excurv are both in good agreement with the crystallographic data . thus , the reliability of the amplitude and phase shift extracted from the model compounds is confirmed . extracted fine structures and fourier transforms of the model compounds with a ru(ii ) center ( a ) , a mixed cl / n first shell ( b ) , and a o or s containing first coordination shell ( c ) . in previous articles a correlation between the coordination charge and a distinct spectral edge feature could be shown . in this study the edge position determined over the first maximum in the first derivative was chosen as the point of reference . the electronegativity values according to the allred / rochow tables were used in the calculations . the calculated ionicities and corresponding degrees of covalence of the elements occurring in the first shells of the models are presented in table 2 . in table 1 the ruthenium model compounds are listed in order of their observed edge positions . in figure 4 the calculated coordination charges versus the experimentally determined ru k - edge positions are shown . the edge energy of 1 in boron nitride ( bn ) was set as an arbitrary origin and lies right in the middle of the observed edge energy range . a straight line was regressed with a coefficient of determination r = 0.95 , demonstrating a linear correlation between the coordination charge and the edge positions . the compounds containing ru(ii ) and/or s are on the left ( lower energy ) side , and the compounds containing ru(iii ) , n , and o are on the right ( higher energy ) side . this correlation is the basis for the further interpretation of the coordination mode of ru compounds in biological samples and in the presence of potential transport proteins . z , atomic number ; ar , electronegativity according to allred rochow ; iar , calculated ionicity ; car calculated covalency . calculated coordination charge ar according to the allred rochow scale in comparison to the observed edge energies of the xanes spectra . in figure 5a the xanes spectra of 1 in bn , suspended in cs buffer and in the presence of gsh ( 5-fold excess , cs buffer , ph 3.5 ) , are shown . 1 was incubated at 37 c for 30 min , 4 h , 8 h , and 5 h in the presence of gsh . the spectra of 1 after 30 min and 4 h of incubation are shifted by + 1.1 ev to higher energies than 1 in bn . after 8 h of incubation of 1 in cs buffer and 5 h in the presence of gsh , both spectra are shifted significantly to lower energies by 1.4 and 1.3 ev , respectively . the cs buffer spectra , after 30 min and 4 h , lost the edge shoulder at 22 130 ev present in the solid sample of 1 . the nearest model compound edge positions to these solution spectra ( e = + 1.1 ev ) are those with ru(iii)cl2n4 and ru(iii)cl3on2 first coordination shells . the shift in energy suggests that an average exchange of one cl ligand with an o atom arising from the buffer solution or a n atom from indazole ( deprotonated indazolium ) took place . the indazolium cation has a pka of 1.25 which enables deprotonation and opens the possibility to act as a n donor at ph 3.5 . this coordination environment proved to be stable up to 4 h , and the reduction to ru(ii ) is not assumed . in the ru(ii ) state an edge shift of + 1.1 ev would only be possible through the exchange of all ligands by o arising from the buffer solution . the spectrum of 1 , after 8 h , is shifted to lower energies by 1.4 ev . in comparison to the solution spectrum of 1 after 4 h a shift of 2.5 ev this demonstrates fundamental changes in the first coordination environments around the ru center . in the presence of gsh the spectrum is shifted to the low energy positions in the region of the ru(ii ) and ru(iii ) s containing model compounds . least square fits ( lsf ) were performed to suggest the most likely first coordination modes . ( a ) normalized xanes spectra and first derivative of 1 in bn , 1 in cs buffer ( after 30 min , 4 h , and 8 h ) and in cs buffer in the presence of the reducing agent gsh ( after 5 h ) . ( b ) 1 in cs buffer ( 30 min ) and carbonate buffer ( 30 min ) and in carbonate buffer in the presence of apotf ( 30 min ) . ( c ) normalized xanes spectra and first derivatives of the tumor and liver samples . lsf to 1 in cs buffer ( 30 min , 4 h ) and in the presence of gsh ( 5 h ) was performed using the solid state spectra of 1 , 4 , 5 , 6 , 9 , 10 , and 12 . the fit results are shown in table 3 and were analyzed according to the goodness of fit parameters and red , the shift in energy e , and the scaling factor c . the best fits for each sample are highlighted in bold - face . the best fits to 1 ( 30 min , 4 h ) could be achieved with 5 . an exchange of an average of one cl atom for an o from the buffer solution or n from indazole ( deprotonated countercation ) are two possible scenarios . in the presence of gsh the spectra of 9 and 12 gave similar results in the goodness of fit parameters but with opposite edge shift variances . this points toward a ru(ii)(cl / s)4n2 coordinated species , which would best match the experimental data , but a ru(iii)cls3n2 can not be ruled out . c is the sum of the fitted components and is the scaling factor applied to the fitted spectrum . the best fit is highlighted in boldface . in figure 5b the normalized xanes spectra and first derivatives of 1 suspended in carbonate buffer ( 30 min , 37 c ) and in carbonate buffer in the presence of apotf ( 30 min , 37 c ) are shown . for comparison the spectrum of 1 in cs buffer ( ph 3.5 ) is shown as well . the spectrum of 1 in carbonate buffer is shifted by + 1.7 ev to higher energies , which is slightly more than 1 in cs buffer ( + 1.1 ev ) . the spectrum of 1 in the presence of apotf is shifted even further to a higher energy position ( + 3.3 ev ) . this immense shift to positive energies is mostly due to the change in edge shape . when introducing a horizontal line at the ordinate value corresponding to the edge energy of the carbonate buffer spectra , a change to the apotf spectrum results in an energy displacement of about + 0.5 ev . this suggests the exchange of additional cl ligands by o or n , thus resulting in a first shell with a high content in o / n in the presence of apotf ( see figure 7 ) . lsf on 1 in carbonate buffer ( 30 min ) and in the presence of apotf ( 30 min ) was done in the same way as described for 1 dissolved in cs buffer . the best fits to 1 in the carbonate buffer solution were achieved with 5 and 6 . in the presence of apotf proposed structural motifs are presented in figure 7 . in a subsequent step linear combination analysis ( lca ) lsf of 3 , 4 , and 11 and combinations of them has been performed on 1 in bn , 1 in cs buffer at ph 3.5 ( 4 and 5 h with gsh ) , and 1 in carbonate buffer at ph 7.5 ( 30 min with and without apotf ) . the lca with ruo6 , run6 , and rucl3s3 environments resembles the known first coordination shell of solid 1 very well . after 4 h in cs buffer at 37 c a decrease to an overall coordination of ru to about 3 n and 3 cl in solution is seen by lca . after an incubation of 5 h in cs buffer in the presence of gsh a ratio of 2 n to 4 cl / s gave the best fitting results . in the presence of apotf the best lca fits were obtained with a first shell environment dominated by o / n and a small proportion of cl . the proposed first shell coordinations are presented in figure 7 , and the fitting results are shown in the supporting information ( table s4 ) . xanes spectra of tumor and liver samples from mice treated with 1 or 2 were collected in fluorescence mode at 20 k with an unfocused beam . because of the low concentration of ru in the biological tissue , data collection was restricted to the xanes region . the normalized xanes spectra and the corresponding first derivatives of the tumor and liver samples from mice are shown in figure 5c . the samples were taken from mice treated with different concentrations and application schemes of 1 and 2 ( details for drug administration see supporting information ) . the edge positions of the xanes spectra taken from all tumor and liver material are around 22 124.4 ev within 0.1 ev deviation ( see table 1 ) . because of the low signal strength , the changes in the edge positions are within the statistical error and there is no evidence for a change in comparison of all measured tissue spectra . the ru k - edge xanes spectra taken from liver and tumor samples are highly similar , which indicates the same local coordination around the ru center . the apparent coordination charge of the ru center of 1 and 2 in the tissue is similar to 1 in cs buffer after 30 min and 4 h of incubation at 37 c . principal component analysis ( pca ) was performed to confirm the high similarities seen within the probed tissue samples . lsf was used to propose a possible coordination and oxidation state pairing for the chemical constitution in tissue . in the following tissue xanes spectra were studied applying pca to give a statistical foundation for possible coordinations in vivo . the variance within all tissue samples could be described to an extent of 98% with the first principal component . the target transforms of the model compounds 1 , 4 , 5 , 6 , and 7 to the vector subspace of the first principal component are presented in the supporting information ( figure s1 , not for 4 ) . obviously 1 and 4 gave the worst results with spoil factors of 10.22 and 9.00 , which are well above an acceptable value . , a spoil factor below 6 is acceptable and below 3 would be a good result . the model compounds 7 , 5 , and 6 reach values of 4.95 , 5.31 , and 5.49 , respectively ( see table 4 ) . all other reference compounds measured in this study are far away from an acceptable result . on basis of the target transformation results , lsf to each tissue sample the outcomes of the lsf of 4 , 5 , 6 , and 7 to the tissue sample spectra are summarized in table 5 . fits based on solid 1 to each tissue sample are included in this study as well . the best values based on the statistical misfit , red , and energy shift e were achieved with 5 and 7 . these two fits are nearly identical , whereas 5 shows the smallest edge shift and 7 a lower statistical misfit . the fits with 6 are slightly worse in all fitting parameters . during the fits , the shift in energy e of the fitted samples was between 0.39 and + 0.39 ev . the fits of 5 to b2-liver and b2-tumor are coplotted in the supporting information ( figure s2 ) . the edge position of the tissue samples is indicated by the vertical blue line in figure 4 . this shift is slightly above the one for 5 and 6 . for the tissue samples ru(iii)cl3n2(o / n ) is proposed as a possible first shell environment for the majority of the 1 and 2 molecules , which are dominating the xas signals . nevertheless a ru(ii ) species with a high o and/or n content in the first coordination sphere as in ru(ii)cln2(o / n)3 can not be ruled out . spoil factor is an arbitrary defined value for the goodness of fit and should be below 6 . is the goodness of fit parameter scaled to the estimated uncertainty , red . e accounts for the energy shift of the sample data , and c is the sum of the fitted components and is the scaling factor applied to the fitted spectrum . the best fit is highlighted in boldface . tumor ( sw480 ) samples of mice treated with 2 were scanned with a x - ray beam focused to 10 m . the resulting maps give an overview of the elemental distribution patterns of ruthenium , iron , copper , and zinc in a defined region of the tumor . in figure 6 the 924 660 m micro - xrf maps of ru , fe , cu , and zn of one sw480 tumor ( mouse 148 - 1 ) sample are presented . the scanned region is indicated by a rectangle in the pictures in the top row . picture a is the scanned 10 m thin section on ultralene film , and picture b is the consecutively cut hematoxylin and eosin ( h & e ) stained 5 m thin section mounted on a glass slide . the concentrations of all four elements are highest in the region of the blood vessels and in the edge regions of the tissue . in contrast to the fe , cu , and zn distribution , ru shows a more disperse pattern with hotspots apart from the predominantly higher concentrated areas . the correlation between the ru distribution pattern and the fe one is of the same order of magnitude as between ru / cu or ru / zn . this opens the question of whether physiological pathways other than the fe - dependent ones are involved in the ru transport as well . the scanned regions are indicated by the rectangle in the pictures in the top row . the scatter peak and the transmitted signal ( the data show a total variation of 3% ) are shown as well . in the top left is shown a picture of the scanned 10 m thin section . in the top right is shown a picture of the consecutively cut h & e stained 5 m thin section . xanes analysis has been applied to propose a first coordination environment of an investigational anticancer drug in cs buffer ( ph 3.5 ) and carbonate buffer ( ph 7.4 ) , in carbonate buffer in the presence of apotf , in cs buffer in the presence of gsh , and in the target tissue . the concept of the coordination charge was applied to the model compounds , and a linear correlation between the coordination / oxidation state and the observed edge energies was established . this was the basis for the further interpretation of the spectra of 1 in solution and in biological samples . proposed oxidation state and first shell coordination of 1 in cs buffer ( 4 h ) , in liver and tumor tissue , in cs buffer in the presence of gsh and in carbonate buffer in the presence of apotf ( top ) . the spectra collected on 1 suspended in cs buffer ( 30 min , 4 h at 37 c , ph 3.5 ) suggest the dissociation of an average of one cl ligand and a change of the first shell environment from ru(iii)cl4n2 to ru(iii)cl3on2 . this coordination turned out to be prevalent up to 4 h of incubation , and 1 is suggested to remain in its oxidation state ru(iii ) . this can be interpreted by an average exchange of one cl ligand for an o atom from the buffer solution or a n atom from indazole formed by deprotonation of the indazolium cation at ph 3.5 . a possible n coordination is unique for 1 because of its chemical composition including an indazolium countercation . after 8 h in cs buffer at 37 c a significant change in the xanes spectra was seen , which is proof of a further transformation of the compound in solution . at ph 7.4 and 37 c in carbonate buffer , the results of this xas study are pointing toward an average exchange of at least one cl ligand after 30 min of incubation as well . the cl ligand can be exchanged for an o atom arising from water , an o atom from carbonate , or a n ligand from indazole . compared to the 1 mm concentrated indazolium countercation , the possible o donors are much higher concentrated in the buffer solution . the hydrolyzing reactions of 1 were studied previously by high performance capillary electrophoresis ( hpce ) , high performance liquid chromatography mass spectrometry ( hplc ms ) , and capillary zone electrophoresis inductively coupled plasma mass spectrometry ( cze - icp - ms).1 turned out to be the most labile complex in comparison to 13 and 14 . the half - life of 1 in buffer solution ( 10 mm phosphate buffer , 100 mm nacl , ph 7.4 ) was determined to be 17.1 min . in water 1 was hydrolyzed to about 2% within 2 h. the half - life in buffered solutions at 37 c turned out to be much smaller with values of 5.5 h ( ph 6.0 ) and < 0.5 h ( ph 7.4 ) . altogether the stability of 1 is strongly dependent on the ph of the buffer used , with the highest stability in solutions of low ph . ru(iii ) , like pt(iv ) , can be reduced by gsh under physiological conditions , and the resulting ru(ii ) complexes maintain their octahedral ligand set . an energy shift of 1.4 ev in comparison to solid 1 was found after 5 h of incubation in cs buffer in the presence of gsh ( 5-fold excess , 37 c , ph 3.5 ) . because of the 5-fold excess of gsh and the shift to lower energies , an adduct formation between 1 and gsh accompanied by a reduction to ru(ii ) is very likely , with a first coordination environment of ru(ii)cl3sn2 . an unchanged ru(iii ) center with a ru(iii)cls3n2 coordination would also match the seen shift in energy ( see figure 7 ) . reduction by gsh has previously been reported for [ cr(vi)o4 ] to a gsh bis - ligated chromium(v)-gsh complex . 1 binds to tf and is released from the protein supposedly after reduction to ru(ii ) by biological reductants , and the interference with the fe metabolism is assumed . in the presence of apotf , 1 incubated for 30 min in carbonate buffer ( ph 7.4 ) shows a slightly higher edge position than 1 in carbonate buffer without apotf . this is explainable by the exchange of additional cl through o and/or n ligands , whereas the ru center stays in its ru(iii ) state ( see figure 7 ) . it can not be stated without any doubt if the exchanged ligands are arising from the buffer solution or are due to the binding of apotf . in view of the more positive shift in energy in the presence of apotf at the same incubation conditions the ligand exchange is possibly due to an interaction with apotf . a consecutive binding of carbonate and apotf to the ru(iii ) center is a possible pathway , resulting in a complete dissociation of the four cl ligands . because of the changes in the xanes edge shape , both postulated binding modes are feasible and should be taken into consideration . in 2009 an electron paramagnetic resonance ( epr ) study on the interaction of 1 with human serum apotf showed a slow binding of 1 via ligand exchange reactions to the protein . in plasma samples of patients the fraction of 1/apotf adducts was smaller than 1% , but in vitro in the absence of other serum proteins the 1/apotf adduct formation took place within minutes . the strong binding of 1 to the histidine residues of apotf was reported from circular dichroism ( cd ) spectroscopy , electrospray mass spectrometry ( esi - ms ) , and gel filtration studies . in a x - ray diffraction study the interaction with lactoferrin , a protein closely related to apotf , could be shown . the xanes spectra collected on tissue samples from mice treated with 1 and 2 are the same ( see figure 5c ) . 2 is more soluble in water because of its sodium ( na ) countercation , and although the pharmacologically active complex anion is identical and biological targets are therefore likely to be the same , it is somewhat less cytotoxic than 1 and differences in their intracellular distribution have been recognized in the past years . the spectral features of the xanes spectra from all tissue samples are clearly different from that of solid 1 . their edge shifts fall into the same energy region as seen for 1 in cs buffer ( ph 3.5 ) up to 4 h of incubation at 37 c . the xanes spectra bear resemblance to the reference spectra of ru complexes with ru(iii)cl2on3 or ru(iii)cl2n4 active sites . a s ligation in the tissue samples can be ruled out , since all s containing and ru(ii ) model compounds are at lower energies . the two possible first shells ru(iii)cl3n2(o / n ) , based on model compound data , and ru(ii)cln2(o / n)3 , derived from theoretical considerations , are the best matching structural motifs . the stepwise release of the cl ligands throughout the course of application from the original ru(iii)cl4n2 over a ru(iii)cl3n2(o / n ) to a ru(ii)cln2(o / n)3 first shell environment is reasonable . a ru(ii ) state would be in agreement with the physiological accessibility of the ru(iii)/ru(ii ) redox pair in the presence of a reducing agent and with the activation by reduction mechanism suggested for ru and other transition metals in cancer therapy like pt(iv)/pt(ii ) . the favored major average coordination of ru in tissue is ru(iii)cl3n2(o / n ) , which is also in agreement with the possible interaction with apotf in the ru(iii ) oxidation state . the micro - xrf distribution maps of ru in tumor revealed the very good penetration of the drug into all regions of the tissue . notably , a recent micro - xrf study on 1 and 13 in single sh - sy5y cells showed a colocalization of the ru and fe concentrations inside the cells treated with 1 but not for 13 treated cells . furthermore , a change in iron distribution after treatment with 1 was seen , which provides further evidence for the interaction of 1 with the fe homeostasis . xas spectroscopy and micro - xrf were applied to study 1 in vitro and 1/2 in vivo . a xas database of ru model compounds representing possible coordinations and oxidation states of the ru metal center was established . the results obtained by fitting theoretical exafs amplitudes and phases to the model compounds were in good agreement with the known crystallographic data . the concept of the coordination charge was adopted to correlate the coordination / oxidation environment with the measured energy shifts . this linear correlation was the basis for the assignment of coordination / oxidation states in solution and tissue spectra . xanes analysis on 1 in cs buffer ( ph 3.5 , 37 c ) suggests the replacement of an average of one cl ligand through an o atom arising from the buffer solution or a n atom from the deprotonated indazolium countercation . the complex stayed predominantly in this coordination mode up to 4 h. after 8 h of incubation in cs buffer ( ph 3.5 ) a change in the xanes spectra and a strong shift in the edge position by 2.5 ev were observed , pointing toward subsequent changes in the coordination / oxidation state of the ru center . there is evidence for the release of one or more cl ligands in carbonate buffer ( ph 7.4 ) to a first coordination shell rich in o and/or n ligands . under the same incubation conditions , in the presence of apotf , a further dissociation of cl ligands is indicated , and this is a hint for a possible interaction with apotf . in the presence of gsh xanes spectra measured on liver and tumor samples , taken from mice treated with 1 and 2 , revealed identical first coordination environments in vivo . the two most probable coordinations are ru(iii)cl3n2(o / n ) and ru(ii)cln2(o / n)3 . the results were independent of the dosages and schedules tested . pca resulted in a first principal component describing 98% of the variance in all tissue samples . micro - xrf studies confirmed the high penetration depth of 2 into the closer packed tissue regions . this is the first time coordination / oxidation pairs could be assigned to the drug directly in target tissue . the model compounds were diluted in bn ( sigma aldrich , cas 10043 - 11 - 5 , 99.5% ) , placed into aluminum sample holders , and sealed with kapton foil . the bn preparations were prepared for a calculated absorption of about 1 absorbance unit according to standard methods . the solution samples were prepared by suspending 1 ( 1 mm ) , 1 and gsh ( 0.5:2.5 mm ) in 5 mm cs buffer ( ph 3.5 ) . 1 in the presence of apotf ( 0.5:0.5 mm ) and 1 ( 1 mm ) as a reference were suspended in carbonate buffer ( ph 7.4 ) , as carbonate is necessary in the binding process to tf . the resulting suspensions were placed into aluminum sample holders and sealed with kapton foil . 1 in cs buffer samples were incubated at 37 c for 30 min , 4 h , and 8 h , respectively . 1 in cs buffer in the presence of gsh was incubated for 5 h at 37 c . 1 in carbonate buffer ( ph 7.4 ) without and with the xas spectra were collected on the flash frozen samples at 20 k. the tissue samples were taken from experiments performed in accordance with the european community guidelines for the use of experimental animals in the animal facility at the cancer research institute , slovak academy of sciences , bratislava , slovak republic , and at the cancer research institute at the medical university of vienna , austria . the tissue material was placed into aluminum sample holders , sealed with kapton foil , flash frozen in liquid nitrogen , and stored at 80 c . the following tissue samples were measured : c1-tumor / liver ( treated with 15 mg / kg 1 ) , b2-tumor / liver ( 7.5 mg / kg 1 ) , 148 - 1-tumor / liver ( 40 mg / kg 2 ) , b1/f1-liver ( 40 mg / kg 2 ) . details for the buffer preparations and animal tests are given in the supporting information . part of the tumor ( sw480 , mouse 148 - 1 ) samples from mice treated with 2 were fixed in ethanol and embedded in paraffin according to standard procedures . the 5 m thick sections were mounted on glass slides and stained with h & e. the 10 m thick sections were mounted on 4 m thick ultralene foil fixed on aluminum frames and used for the micro - xrf measurements . the xas experiments were carried out at beamline bm26a at the european synchrotron radiation facility ( esrf ) in grenoble , france . the model compounds were measured in transmission mode , and the tissue samples and the drug solutions were collected in fluorescence mode . all experiments were conducted at cryogenic temperatures at 20 k. the energy dispersive micro - xrf experiments were conducted at the fluo beamline at the angstrmquelle karlsruhe synchrotron ( anka , germany ) with a spot size of 10 m . the program packages athena , artemis , ifeffit , feff , pyspline , dl - excurv , sixpack , and pymca were applied for the xas and micro - xrf data analysis . the normalization was accomplished by fitting a quadratic polynomial ( models ) or a straight line ( tissue and solution samples ) to the postedge region . the exafs analysis followed standard procedures described in refs ( 82 ) , ( 85 ) , and ( 93 ) . the ab initio amplitude and phases were provided by the program packages feff7 and dl - excurv , respectively . the dl - excurv fits were performed on the k - weighted exafs signals , and the feff7 fits were performed on the back - transform of the first peak in the ft . the program sixpack was used to perform the pca , lsf , and lca in the energy range of 2210022200 ev . the detailed descriptions of the experimental setups and data extraction and analysis procedures are given in the supporting information . the edge positions of xanes spectra are a combination of several features like valence , electronegativity of the first shell atoms , their coordination number , and the formal oxidation state of the central atom . batsanov introduced the concept of the coordination charge to account for these factors . with increasing electronegativity of the neighboring atoms the edge positions are shifted to higher energies when the number of ligands stays the same . the coordination charge is defined as depicted in eq 1.1where m is the formal oxidation state of the central metal , ck is the degree of covalence of a bond k , and nk is the number of such bonds . the degree of covalence ck is defined as 1 ik , where ik is the ionicity of that bond . the ionicity is calculated using pauling s formula ( eq 2)2and depends on the electronegativity of the central ru atom m and the electronegativity of the ligand atom l . the coordination charge is calculated as in eq 1 applying ik calculated as in eq 2 . the change in electronegativity due to changes in hybridization state was not considered in these calculations .

indazolium trans-[tetrachlorobis(1h - indazole)ruthenate(iii ) ] ( 1 , kp1019 ) and its analogue sodium trans-[tetrachlorobis(1h - indazole)ruthenate(iii ) ] ( 2 , kp1339 ) are promising redox - active anticancer drug candidates that were investigated with x - ray absorption near edge structure spectroscopy . the analysis was based on the concept of the coordination charge and ruthenium model compounds representing possible coordinations and oxidation states in vivo . 1 was investigated in citrate saline buffer ( ph 3.5 ) and in carbonate buffer ( ph 7.4 ) at 37 c for different time intervals . interaction studies on 1 with glutathione in saline buffer and apo - transferrin in carbonate buffer were undertaken , and the coordination of 1 and 2 in tumor tissues was studied too . the most likely coordinations and oxidation states of the compound under the above mentioned conditions were assigned . microprobe x - ray fluorescence of tumor thin sections showed the strong penetration of ruthenium into the tumor tissue , with the highest concentrations near blood vessels and in the edge regions of the tissue samples .

Introduction Results Discussion Conclusions Experimental Section

royal free ethics committee for retrospective publication of patient data . written informed consent for publication was obtained from the patients . ma beckles and t wagner not commissioned ; peer - reviewed by vaishali sanchorawala and kaushik sanyal royal free ethics committee for retrospective publication of patient data . written informed consent for publication was obtained from the patients .

lessonamyloidosis is a rare differential diagnosis of a mass detected in the chest . amyloidoma is caused by a local proliferation of clonal b - cells secreting an unstable immunoglobulin light chain which accumulates . fdg - pet scan are useful but not specific . treatment is generally by local resection for treatment of symptoms.we report two cases of amyloidomas , which are rare entities characterised by large local amyloid deposits . these can occur in the upper respiratory tract , soft tissues and central nervous system.1

Contributorship Declarations Competing interests Funding Guarantor Ethical approval Acknowledgements Provenance

the dichloromethane - soluble extract from roots and rhizomes of n. incisum exerted significant ppar activation in a ppar-driven luciferase reporter gene assay ( 2.5 0.28-fold activation , p < 0.001 ) . fractionation of the extract by several chromatographic separation steps on normal- and reversed- phase silica gel yielded 11 new polyyne derivatives ( 111 ) . notoethers a h ( 18 ) are four pairs of isomeric ethers , each consisting of a falcarindiol unit and a sesquiterpene unit . this is the first report of polyynes fused with sesquiterpenoids , and also the second type of polyacetylene adducts connected through an ether bond , besides reported polyacetylene coumarin adducts . notoincisols a c ( 911 ) are adducts of a polyacetylene and a phenylpropanoid unit , with 10 and 11 representing two new carbon skeletons . the hresims , c nmr , and hsqc data indicated a molecular formula of c32h50o3 . four acetylene carbon signals , at 80.0 , 79.9 , 69.6 , and 69.3 ppm , and four alkene carbons , at 116.1 , 136.3 , 128.1 , and 134.4 , together with a characteristic alkene proton at 5.79 ( ddd , j = 16.9 , 10.2 , 4.7 hz ) and a pair of terminal alkene protons at 5.58 and 5.50 suggested the presence of a falcarindiol unit . the remaining 15 carbon resonances including four tertiary methyl groups indicated an additional sesquiterpene unit . complete assignments of the 1d and 2d nmr signals and comparison with literature data revealed the second part of the molecule to be a 4,11-eudesmane diol . the hmbc correlation between c-4 ( 80.0 ) of the eudesmane and h-3 ( 4.84 ) of the falcarindiol unit indicated an ether linkage between these two parts , which was also supported by a noesy correlation between me-15 ( 1.11 ) of the eudesmane and h-3 ( 4.84 ) of the falcarindiol unit . the relative configuration of the eudesmane diol was determined by analyzing noesy correlations , together with coupling constants from the 1d proton spectrum and cross - peak intensities in the dqf - cosy spectrum . the observed noes , typical for a trans - fused decalin system in a chair conformation , indicated the -orientations of me-14 and me-15. the quadruplet signal of the axial h-6 ( 1.01 ) in combination with the large j coupling ( 12.3 hz ) required axial orientations of both the h-7 and h-5 methine protons . therefore , the relative configuration at the stereogenic centers was determined as depicted . the unsubstituted sesquiterpene , cryptomeridol , has been previously obtained by chemical modification of -eudesmane . the hresims , c nmr , and hsqc data indicated a molecular formula of c32h50o3 . four acetylene and four alkene carbons with chemical shifts like those of compound 1 , as well as the corresponding alkene protons , revealed the presence of a falcarindiol unit . correlations from the 2d nmr spectra confirmed a cryptomeridiol structure . a comparison with reference spectroscopic data obtained for falcarindiol showed different chemical shifts of the carbons centered on c-8 , including upfield shifts of c-8 ( 1.3 ppm ) , c-6 ( 0.9 ppm ) , and c-10 ( 3.1 ppm ) , as well as downfield shifts of c-7 ( 1.8 ppm ) and c-9 ( 0.9 ppm ) . further evidence came from the hmbc correlation between c-4 ( 79.5 ) and h-8 ( 5.01 ) and the noesy correlation between me-15 and h-8 . on the basis of these results , the structure of 2 was elucidated as a falcarindiol unit connected at c-8 via an ether bond to c-4 of cryptomeridiol . the hresims , c nmr , and hsqc data indicated a molecular formula of c32h50o4 . a falcarindiol subunit was identified from four acetylene signals and four alkene carbon signals , as well as from three alkene protons and two oxygenated methine proton ( h-3 , h-8 ) signals . complete nmr resonance assignments revealed that compound 3 consists of a falcarindiol unit attached to a trihydroxyeudesmane moiety . an hmbc correlation between h-3 ( 4.86 ) and c-4 ( 79.3 ) as well as a noesy correlation between h-3 and me-14 indicated that these two parts are connected via an ether bond between c-3 and c-4. the relative configuration of the sesquiterpene unit was determined by analyzing noe and coupling constant data . in contrast , the h-1 , h-5 , and h-7 protons were assigned with an -orientation , which corresponded to these protons with an axial orientation in a trans - decalin structure . the h-5 singlet and the missing cross - peak in the dqf - cosy spectrum for h-6 indicated an equatorial orientation of h-6. therefore , an axial orientation of the hydroxy group at c-6 could be suggested . an acetylated derivative of this sesquiterpene has been isolated but not fully characterized by onorato and co - workers . the hresims , c nmr , and hsqc data indicated a molecular formula of c32h50o4 . a falcarindiol unit was identified by its specific carbon and proton shifts , for which the chemical shift values correlated closely with those of compound 2 and therefore indicated c-8 substitution . assignment of the 2d nmr spectra confirmed the presence of a 1,4,6-trihydroxyeudesmane residue substituted at position c-4. an hmbc correlation between h-8 and c-4 , as well as a noesy correlation between h-8 and me-14 , indicated these two parts to be connected through an ether bond between c-8 and c-4. notoether e ( 5 ) was obtained as colorless needles . the hresims , c nmr , and hsqc data indicated a molecular formula of c32h50o4 . the falcarindiol unit was recognized again by its characteristic set of carbon and proton signals , for which the chemical shift values correlated closely with those of compounds 1 and 3 , and hence indicated a c-3 substitution of the falcarindiol moiety . assignments of the 1d and 2d nmr spectra were used to further identify a 1,4,6-trioxygenated eudesmane unit substituted at c-4. the absence of a noesy correlation between h-5 and the angular me-14 supported the occurrence of a trans - fused a / b ring system . coupling of h-1 ( dd , j = 10.9 , 4.1 hz ) and the noesy correlation between h-5 and h-1 suggested the -orientation of the c-1 hydroxy group . coupling of the bridgehead h-5 ( d , j = 10.9 hz ) with the h-6 of hydroxy methine ( dt , j = 10.4 , 3.3 hz ) revealed their vicinal diaxial relationship and , hence , an equatorial arrangement for the c-6 hydroxy group , which was also confirmed by the noesy correlation observed between me-14 and h-6. a noesy correlation between h-6 and the angular me-15 , as well as between me-14 and me-15 , suggested the c-4 oxy group to be also -oriented . it is noteworthy that the two free hydroxy group proton signals of the sesquiterpenoid moiety showed different patterns . the more low - field signal showed a doublet ( 4.76 , j = 2.6 hz , oh-6 ) , while a singlet could be found at high field ( 2.36 , oh-1 ) . the low - field pattern of 6-oh supported a syn - equatorial configuration for -o-4 and oh-6 , which allows an intramolecular hydrogen bonding that may resist hydrogen exchange with the residual solvent water indicated by a flat oh-1. thus , with one of the two small couplings of h-6 ( 2.6 hz ) assigned to the oh-6 hydroxy group proton , the remaining small coupling of h-6 ( 3.7 hz ) requires a cis relationship to the adjacent h-7 , suggesting the axial orientation of the isopropyl group . the axial -orientation of the isopropyl group was supported also by strong noes between h-11 , h-5 , and h-9 , respectively . when comparing its c-7 chemical shift ( 46.2 ) with the counterpart carbon of zingibertriol ( 51.5 ) , the difference ( = 5.3 ppm ) was close to that between equatorial and axial isopropylcyclohexane ( = 3.4 ppm , 150 c ) . the sesquiterpenoid moiety of compound 5 was therefore identified as the c-7 epimer of zingibertriol . accordingly , compound 5 was elucidated as a falcarindiol unit substituted at c-3 through an ether bond by 7-epizingibertriol ( c-4 ) . the hresims , c nmr , and hsqc data indicated a molecular formula of c32h50o4 . through assignments of the 1d and 2d nmr spectra , a c-8-substituted falcarindiol moiety was identified in the same way as in the case of compounds 2 and 4 . the other unit of this molecule was also found to be a c-4-substituted 7s isomer of zingibertriol . therefore , compound 6 was established as a falcarindiol unit substituted at c-8 through an ether bond by the 7s isomer of zingibertriol ( c-4).figure 1noesy correlations and intramolecular hydrogen bond ( dashed ) of the sesquiterpenoid moiety of 5 and 6 . noesy correlations and intramolecular hydrogen bond ( dashed ) of the sesquiterpenoid moiety of 5 and 6 . the hresims , c nmr , and hsqc data indicated a molecular formula of c32h50o4 . the falcarindiol moiety and its substitution at c-3 were apparent as described for earlier compounds . unlike for compounds 16 , nmr experiments revealed the presence of a different type of sesquiterpenoid . the most obvious difference was that both tertiary methyl groups of compound 7 showed hmbc correlations with three carbons , including one methylene , one methane , and one oxygenated tertiary carbon . assignment of the 1d and 2d nmr data observed and comparison with literature data revealed that the c nmr data were consistent with those previously reported for teuclatriol ( guaiane-4,6,10-triol ) , except for chemical shift changes of c-10 ( = 7.4 ppm ) and its vicinal c-1 ( = 2.1 ppm ) , c-9 ( = 5.3 ppm ) , and c-14 ( = 2.9 ppm ) , which suggested substitution at c-10. two broad singlets ( 2.38 , 2.24 ) , each integrating for one proton , assigned to oh-4 and oh-6 , were observed , with their shapes due to proton exchange . these data , together with hmbc correlation between c-4 and h-3 , as well as the noesy correlation between h-3 and me-14 , were used to establish compound 7 as a falcarindiol unit substituted at c-3 by teuclatriol ( c-10 ) via an ether bond . notoether h ( 8) was obtained as a colorless gum . the hresims , c nmr , and hsqc data indicated a molecular formula of c32h50o4 . 1d and 2d nmr spectroscopic data analysis revealed the presence of a falcarindiol moiety substituted at the c-8 position . the two hydroxy group singlets ( 2.37 , oh-4 ; 2.23 , oh-6 ) exhibited similar chemical shifts to those of 7 . furthermore , their sharp signal shape indicated the absence of any proton exchange . for the same reason , the oh-3 ( 1.91 ) proton of falcarindiol , which was absent in the other compounds isolated , was also observed . in contrast to oh-6 of compounds 5 and 6 , no downfield shift of the hydroxy group proton caused by intramolecular hydrogen bonding was observed , although oh-4 and oh-6 are both syn - equatorial in 7 and 8 . this is due to the distance between the two hydroxy group protons , which is larger in the guaiane skeleton when compared to the eudesmane skeleton . these arguments together with an hmbc correlation between c-4 and h-8 , as well as a noesy correlation between me-14 and h-8 , confirmed 8 as a falcarindiol unit substituted by teuclatriol via a ( c-8)o(c-10 ) ether bond . the hresims , c nmr , and hsqc data indicated a molecular formula of c27h32o5 . the falcarindiol moiety and its substitution at c-8 were identified through assignments of 1d and 2d nmr signals . the proton signals observed included three abx coupled benzene protons at 7.03 ( s ) , 6.92 ( d , j = 8.2 hz ) , and 7.07 ( br d , j = 8.3 hz ) , two trans vinyl protons at 7.65 ( d , j = 15.8 hz ) and 6.28 ( d , j = 15.4 hz ) , and a methoxy singlet at 3.93 . these h nmr data and 10 remaining carbon signals suggested the presence of a ferulic acid ester unit . therefore , compound 9 was elucidated as a falcarindiol moiety esterified at c-8 with ferulic acid . a biogenic pathway to form compound 9 from falcarindiol and ferulic acid is proposed ( figure 2 ) . compound 9 was found to be unstable , as it visibly changed color when exposed to elevated temperatures ( 45 c ) or was kept under direct sunlight at ambient temperature for an extended time period . possible biogenetic pathway for notoincisols a ( 9 ) and c ( 11 ) . notoincisol b ( 10 ) was obtained as a colorless gum . the hresims , c nmr , and hsqc data indicated a molecular formula of c27h32o4 . the h nmr spectrum showed three alkene signals at 6.11 ( m ) , 5.70 ( t , j = 9.4 hz ) , and 5.65 ( m ) , with similar chemical shifts and identical splitting patterns to that of h-2 , h-9 , and h-10 of a falcarindiol unit . the 2d nmr data further revealed two terminal alkene protons at 5.49 ( d , j = 18.0 hz ) and 5.24 ( d , j = 10.7 hz ) , as well as protons of two oxygenated methines at 5.80 ( d , j = 6.1 hz ) and 5.49 ( d , j = 8.7 hz ) , which corresponded to h-1cis , h-1trans , h-3 , and h-8 , respectively . furthermore , a seven - membered aliphatic chain connected to the alkene c-10 was identified . two alkylene carbons at c-6 ( 80.5 ) and c-7 ( 99.0 ) , both showing an hmbc correlation with h-8 , showed significant downfield shifts when compared to model compounds . instead of two alkyne carbons at the c-4 and c-5 positions , two quaternary aromatic carbons were observed , with hmbc correlations to h-3 and weak hmbc correlations to h-8 . the h-3 proton showed hmbc correlations with six carbons , including a pair of olefinic carbons ( c-1 , c-2 ) and a pair of aromatic carbons ( c-4 , c-5 ) , originating from falcarindiol . the other two hmbc correlations were between h-3 and the oxygenated methylene group c-9 and a quaternary aromatic carbon ( c-8 ) . the h-9 proton showed hmbc correlations with the c-7 , c-4 , and c-3 , indicating a five - membered ring . in turn , h-7 showed hmbc correlations with the aromatic carbons c-4 and c-6. the remaining two aromatic proton resonances of h-2 and h-5 were observed as singlets and were both correlated in the hmbc spectrum with the two quaternary aryl carbons c-4 ( 146.5 ) and c-3 ( 147.7 ) , for which the c nmr chemical shift values indicated an ortho - relationship of the phenolic carbons . in addition , h-5 correlated with c-1 and c-3 , while h-2 correlated with c-6 and c-7. the position of a methoxy group was determined by the hmbc correlation of its protons with c-3. analysis of all the aforementioned correlations led to the assignment of compound 10 as depicted , which is a cyclization and oxidation product of a falcarindiol and a hydroxy - methoxy phenyl propane unit . in this molecule , a second aromatic ring is formed , comprising carbons c-4 and c-5 of the falcarindiol and carbons c-7 and c-8 of the phenyl propane unit . this is the first time that this type of carbon skeleton has been described . the hresims , c nmr , and hsqc data indicated a molecular formula of c27h32o4 . the h nmr spectrum showed three alkene signals at 6.10 ( m ) , 5.53 ( t , j = 10.2 hz ) , and 5.74 ( m ) , with similar chemical shifts and identical splitting patterns to that of h-2 , h-9 , and h-10 of a falcarindiol unit . a 2d nmr experiment further revealed two terminal alkene protons at 5.57 ( d , j = 17.5 hz ) and 5.30 ( d , j = 10.1 hz ) , as well as protons of two oxygenated methines at 5.18 ( br s ) and 6.13 ( d , j = 9.2 hz ) , which correspond to h-1cis , h-1trans , h-3 , and h-8 , respectively . also identified was a seven - membered aliphatic chain connected to alkene c-10 . a major downfield shift occurred for c-8 , and two alkylene carbons at c-4 ( 97.2 ) and c-5 ( 81.9 ) , which both showed hmbc correlations with h-3 , experienced considerable downfield shift when compared to model compounds . instead of two alkyne carbons , which are supposed to be c-6 and c-7 , two quaternary aromatic carbons were apparent , which both showed hmbc correlations with h-8 and weak hmbc correlations with h-3 . as in the case of compound 10 , these data suggested a conversion of the alkyne carbons c-6 and c-7 into aromatic ones . c-7 showed hmbc correlations with three protons , including one aryl proton ( h-7 ) , one oxygenated methylene ( h-9 ) , and one oxygenated methane ( h-8 ) . the h-9 signal gave hmbc correlations with four carbons , including one now aromatic carbon ( c-7 ) of falcarindiol origin , an oxygenated methine ( c-8 ) , a quaternary aromatic carbon ( c-8 ) , and an unsubstituted aromatic carbon ( c-7 ) , indicating a five - membered ring , which resembled that of compound 10 . in turn , h-7 showed hmbc correlations with the aromatic carbons c-2 , c-6 , c-7 , and oxygenated methylene c-9. the remaining two aromatic proton resonances , h-2 and h-5 , gave clear singlet structures , and both showed hmbc correlations with the two quaternary carbons c-4 ( 146.5 ) and c-3 ( 147.7 ) , for which the c nmr chemical shift values indicated an ortho - position of the phenolic carbons . in addition , h-5 correlated with c-1 and c-3 , while h-2 correlated with c-6 and c-7. the position of a methoxy group was determined by the hmbc correlation of its protons with c-3. the aforementioned correlations led to the structure of compound 11 as depicted . like compound 10 , this is also a cyclization and oxidation product of a falcarindiol and a hydroxy - methoxy phenyl propane unit . a biogenic pathway to form compound 11 from falcarindiol and ferulic acid via compound 9 is proposed ( figure 2 ) . notoethers a c ( 13 ) , notoincisol a ( 9 ) , and notoincisol b ( 10 ) were the most potent partial ppar agonists among the tested compounds , with ec50 values ranging from 1.7 to 2.3 m and a maximal fold activation ranging from 1.6 to 2.8 ( see table 5 for comparison of the ec50 values and maximal fold activation induced by 13 , 9 , and 10 , as well as figure 3 for comparison of the effectiveness of all tested compounds at 10 m ) . for comparison , the full ppar agonist pioglitazone used as positive control activated 6.6-fold at 5 m ( figure 3 ) with an ec50 value of 0.21 m ( not shown ) . ( * * * p 0.001 , n.s . : not significant ; n = 3 , anova ) . in a previous study , molecular details for the ppar binding mode of falcarindiol falcarindiol was observed to occupy parts of the entrance region of the ppar ligand binding domain and established interactions with the mainly hydrophobic binding site arms i and ii . since the active compounds from this study have some structural features in common with falcarindiol but are significantly larger , it was investigated how the proposed binding mode would shift within the binding site and if the docking could distinguish between active and inactive polyyne hybrid compounds . in general , the ppar ligand binding domain is y - shaped and is divided into three parts : the entrance domain , arm i , and arm ii ( figure 4 ) . while the ppar ligand binding site entrance is lined by several polar residues ( e.g. , arg288 , glu291 , glu295 , glu343 ) , the two branches of the binding pocket arm i and arm ii are formed by mainly hydrophobic amino acids . arm i , however , accommodates some moderately hydrophobic residues ( e.g. , cys285 , ser289 , his323 , his449 , and tyr473 ) . falcarindiol - type polyacetylenes were supposed to form hydrophobic contacts with residues of arm i ( e.g. , ile326 , tyr327 , phe363 ) , arm ii ( e.g. , ile281 ) , and the entrance region ( e.g. , ala292 , met329 , leu330 , and leu333 ) . the hydroxy groups formed hydrogen bonds with the backbone amide of cys285 in arm i and the carboxy group of glu295 at the entrance . amino acids from the entrance region are marked in green , from arm i in blue , and from arm ii in pink . analyzing the protein ligand interactions of all active compounds and comparing them to the ones of the inactive molecules revealed that hydrogen bonding with ser289 was associated with the activity ( figure 5 ) . while all active compounds formed this hydrogen bond in their best - ranked docking pose , none of the inactive structures did so . ser289 is one amino acid in the core of the ligand binding site , where it is involved in the molecular recognition of many ppar agonists , as observed in x - ray crystal structures . the docking results rationalized the observed in vitro ppar activation by compounds 1 , 2 , 3 , 9 , and 10 and could serve as an inspiration for synthetic optimization to develop more potent partial agonists . representative docking poses of compounds 2 ( a ) and 10 ( b ) fitted into the ppar ligand binding site . both compounds occupied parts of the entrance region ( green ) and extend into one of the hydrophobic arms ( blue and pink ) with their long alkyl chains . the hydrogen bond with ser289 , which was only observed with the active compounds 1 , 2 , 3 , 9 , and 10 , is depicted as a green arrow . hydrophobic contacts with the binding site are shown as yellow spheres ; those with the hydrogen bonds , as arrows . the new polyacetylene derivatives were tested for inhibition of no production in stimulated raw 264.7 macrophages . while most of the compounds were inactive at the concentrations tested ( data not shown ) , notoincisol a ( 9 ) inhibited no production with an ic50 value ( 14.6 0.7 m ) comparable to those of polyacetylenes previously isolated from n. incisum ( around 10 to 30 m ) . the search for constituents with ppar agonistic activity of n. incisum led to the identification of active novel polyacetylene adducts ( 1 , 2 , 3 , 9 , and 10 ) . their preliminary structure notoincisol a ( 9 ) was also able to inhibit no production in lps - induced raw 264.7 macrophages . these compounds can serve as starting points for chemical modifications in order to optimize potency , selectivity , safety , and pharmacokinetic parameters , thereby offering new scaffolds for the development of compounds to treat inflammatory processes and possibly the related metabolic syndrome . melting points were determined with a reichert melting point apparatus and are uncorrected . h , c , and 2d nmr spectra were recorded in cdcl3 on unity 600 ( varian , palo alto , ca , usa ) and avance 700 ( bruker , billerica , ma , usa ) spectrometers . lc - esims were carried out using a thermo finnigan lcq deca xp plus mass spectrometer connected to a surveyor hplc system ( thermo fisher , waltham , ma , usa ) , with a zorbax sb - c18 narrow bore ( 3.5 m ) 2.1 150 mm column ( agilent , santa clara , ca , usa ) . open column chromatography was carried out using mci ch - p 20p resin ( mitsubishi chemical , tokyo , japan ) , octadecyl silica gel ( 2540 m , fuji silysia , kasugai , japan ) , sephadex lh-20 ( ge healthcare , little chalfont , uk ) , and silica gel ( 1540 m , merck kgaa , darmstadt , germany ) as stationary phase . tlc was conducted on silica gel 60 f254 and silica gel 60 rp-18 f254s plates ( merck kgaa ) . all chemical reagents ( ar grade ) were purchased from carl roth gmbh + co. kg ( karlsruhe , germany ) . accurate mass determinations were performed using an lc / ftms system consisting of an exactive orbitrap mass spectrometer , equipped with a heated esi ii source ( thermo fisher ) and operated in ultra - high - resolution mode ( 100.000 ) coupled to a u - hplc system ( thermo fisher ) . operating conditions for the esi source used in the positive ionization mode were as follows : 3.5 kv spray voltage , 325 c capillary temperature , 300 c heater temperature , sheath gas flow rate 45 units , and auxiliary gas flow 10 units ( units refer to arbitrary values set by the exactive software ) . u - hplc separations were performed on a hypersil gold c18 ( thermo fisher ) , 1.9 m , 2.1 50 mm i.d . each 10 min chromatographic run was carried out at a flow rate of 0.3 ml / min with a binary mobile phase consisting of acetonitrile ( a ) and 0.1% formic acid ( b ) using a step gradient profile of 50% a for 0.5 min and increased up to 100% a in 5 min , kept isocratic at 100% for 0.5 min , then decreased down to 50% a in 0.1 min . after re - equilibration at 50% a for 3.9 min , the next sample was injected . rhizoma et radix notopterygii ( 2 kg ) were purchased in 2008 from plantasia , oberndorf , austria , and authenticated as notopterygium incisum via dna - based identification . a voucher specimen ( no . 650107 ) has been deposited at the department of pharmacognosy , institute of pharmaceutical sciences , karl - franzens - university graz . the plant material ( 2 kg ) was ground and percolated with ch2cl2 ( 17.5 l ) , to produce 250 g of an extract . then , 145 g of the extract was partitioned twice between n - hexane and meoh ( 1.5:1 ) , to obtain n - hexane- ( 39 g ) and meoh - soluble ( 104 g ) portions . water solution ( 1:1 ) to obtain a ch2cl2 layer ( 94 g ) and an aqueous meoh layer ( 1.5 g ) . the dried ch2cl2 layer ( 94 g ) was fractionated using mci chp-20p resin , with a meoh h2o gradient ( 40% to 100% meoh ) as mobile phase , to afford 313 fractions . to facilitate subsequent biological testing , 0.3% of each of these fractions was sampled and recombined according to their tlc profile to afford 10 pooled fractions ( fraction pools first to 10th ) , which were assayed together with the ch2cl2 layer for ppar activation . the most active fraction pools , 8 and 9 ( eluting with 6590% meoh ) , were subjected to successive column chromatography , including rp-18 ( meoh h2o , 85:15 ) , sephadex lh-20 ( meoh h2o , 60:40 ) , silica gel ( n - hexane ethyl acetate , 3:1 or 2.2:1 ) , and preparative hplc ( acetonitrile h2o , 68:32 , 80:20 , or 95:5 ) , to afford 11 compounds : 1 ( 6.3 mg ) , 2 ( 11.2 mg ) , 3 ( 1.5 mg ) , 4 ( 1.1 mg ) , 5 ( 10.9 mg ) , 6 ( 9.6 mg ) , 7 ( 3.6 mg ) , 8 ( 2.3 mg ) , 9 ( 4.7 mg ) , 10 ( 3.1 mg ) , and 11 ( 0.68 mg ) . c32h50o3 , colorless oil ; [ ]d20 + 155.1 ( c 0.2 , meoh ) ; uv ( mecn h2o ) max 246 , 260 nm ; h nmr ( 600 mhz , cdcl3 ) and c nmr ( 150 mhz , cdcl3 ) data , see tables 1 and 2 ; positive esims m / z 505 [ m + na ] , 987 [ 2 m + na ] ; hresims m / z 505.3652 [ m + na ] ( calcd for c32h50o3na , 505.3658 ) . signals are interchangeable . c32h50o3 , colorless oil ; [ ]d20 + 68.4 ( c 0.4 , meoh ) ; uv ( mecn h2o ) max 246 , 260 nm ; h nmr ( 600 mhz , cdcl3 ) and c nmr ( 150 mhz , cdcl3 ) data , see tables 1 and 2 ; positive esims m / z 505 [ m + na ] ; hresims m / z 505.3652 [ m + na ] ( calcd for c32h50o3na , 505.3658 ) . c32h50o4 , colorless gum ; [ ]d20 + 155.3 ( c 0.05 , meoh ) ; uv ( mecn h2o ) max 246 , 260 nm ; h nmr ( 600 mhz , cdcl3 ) and c nmr ( 150 mhz , cdcl3 ) data , see tables 1 and 2 ; positive esims m / z 499 [ m + h ] , 997 [ 2 m + h ] ; hresims m / z 521.3607 [ m + na ] ( calcd for c32h50o4na , 521.3607 ) . c32h50o4 , colorless gum ; [ ]d20 + 8.6 ( c 0.04 , meoh ) ; uv ( mecn h2o ) max 246 , 260 nm ; h nmr ( 600 mhz , cdcl3 ) and c nmr ( 150 mhz , cdcl3 ) data , see tables 1 and 2 ; positive esims m / z 521 [ m + na ] ; hresims m / z 521.3602 [ m + na ] ( calcd for c32h50o4na , 521.3607 ) . c32h50o4 , colorless needles , mp : 9598 c ; [ ]d20 + 144.9 ( c 0.4 , meoh ) ; uv ( mecn h2o ) max 246 , 260 nm ; h nmr ( 600 mhz , cdcl3 ) and c nmr ( 150 mhz , cdcl3 ) data , see tables 1 and 3 ; positive esims m / z 521 [ m + na ] , 1019 [ 2 m + na ] ; hresims m / z 521.3600 [ m + na ] ( calcd for c32h50o4na , 521.3607 ) . signals are interchangeable . c32h50o4 , colorless gum ; [ ]d20 + 108.9 ( c 0.3 , meoh ) ; uv ( mecn h2o ) max 246 , 260 nm ; h nmr ( 600 mhz , cdcl3 ) and c nmr ( 150 mhz , cdcl3 ) data , see tables 1 and 3 ; positive esims m / z 499 [ m + h ] , 997 [ 2 m + h ] , 1019 [ 2 m + na ] ; hresims m / z 521.3600 [ m + na ] ( calcd for c32h50o4na , 521.3607 ) . c32h50o4 , colorless gum ; [ ]d20 + 148.5 ( c 0.07 , meoh ) ; uv ( mecn / h2o ) max 246 , 260 nm ; h nmr ( 600 mhz , cdcl3 ) and c nmr ( 150 mhz , cdcl3 ) data , see tables 1 and 3 ; positive esims m / z 521 [ m + na ] ; hresims m / z 521.3600 [ m + na ] ( calcd for c32h50o4na , 521.3607 ) . c32h50o4 , colorless gum ; [ ]d20 + 34.8 ( c 0.08 , meoh ) ; uv ( mecn h2o ) max 246 , 260 nm ; h nmr ( 600 mhz , cdcl3 ) and c nmr ( 150 mhz , cdcl3 ) data , see tables 1 and 3 ; positive esims m / z 521 [ m + na ] ; hresims m / z 521.3600 [ m + na ] ( calcd for c32h50o4na , 521.3607 ) . c27h32o5 , light green oil ; [ ]d20 + 85.5 ( c 0.09 , meoh ) ; uv ( mecn h2o ) max 237 , 328 nm ; h nmr ( 600 mhz , cdcl3 ) and c nmr ( 150 mhz , cdcl3 ) data , see tables 1 and 4 ; positive esims m / z 437 [ m + h ] ; hresims m / z 437.2353 [ m + h ] ( calcd for c27h33o5 , 436.2328 ) . signals are interchangeable . c27h32o4 , colorless gum ; [ ]d20 + 268.9 ( c 0.1 , meoh ) ; uv ( mecn h2o ) max 244 , 315 , 346 ; h nmr ( 600 mhz , cdcl3 ) and c nmr ( 150 mhz , cdcl3 ) data , see tables 1 and 4 ; positive esims m / z 421 [ m + h ] ; hresims m / z 421.2370 [ m + h ] ( calcd for c27h33o4 , 421.2379 ) . c27h32o4 , colorless gum ; [ ]d20 + 25.8 ( c 0.03 , meoh ) ; uv ( mecn h2o ) max 244 , 316 , 346 ; h nmr ( 600 mhz , cdcl3 ) and c nmr ( 150 mhz , cdcl3 ) data , see tables 1 and 4 ; positive esims m / z 421 [ m + h ] ; hresims m / z 421.2370 [ m + h ] ( calcd for c27h33o4 , 421.2379 ) . dulbecco s modified eagle s medium ( dmem ) and fetal calf serum ( fcs ) were supplied by lonza ( basel , switzerland ) . pioglitazone , a full ppar agonist , was used as positive control and was purchased from molekula ltd . for evaluation of ppar activation the test compounds were first dissolved in dmso , divided into aliquots , and frozen at 20 c until used . in all experiments , dmso was applied as solvent control , and the final concentration of dmso was always kept at 0.1% . the ppar luciferase reporter plasmid ( tk - pprex3-luc ) was a kind gift from prof . ronald m. evans ( howard hughes medical institute , la jolla , ca , usa ) , the plasmid encoding enhanced green fluorescent protein ( pegfp - n1 ) was supplied by clontech ( mountain view , ca , usa ) , and the plasmid encoding human ppar ( psg5-pl - hppar-1 ) was kindly supplied by prof . beatrice desvergne ( center for integrative genomics , university of lausanne , switzerland ) . briefly , hek-293 cells ( atcc , manassas , va , usa ) were grown in dmem with 2 mm glutamine , 10% fbs , 100 u / ml benzylpenicillin , and 100 g / ml streptomycin . cells were grown in 10 cm dishes ( 6 10 cells / dish ) for 18 h and then transfected by the calcium phosphate precipitation method with 4 g of plasmid encoding human ppar ( psg5-pl - hppar-1 ) , 4 g of reporter plasmid ( tk - pprex3-luc ) , and 2 g of pegfp - n1 as control for internal normalization . after 6 h , the cells were transferred to 96-well plates ( 5 10 cells / well ) in dmem without phenol red supplemented with charcoal - stripped fbs , glutamine , and antibiotics . the cells were treated with different concentrations of the indicated compounds and incubated for 18 h. cells were then lysed , and the luminescence of the firefly luciferase and the fluorescence of egfp were quantified with a geniospro microplate reader ( tecan , grdig , austria ) . the luminescence was finally normalized to the egfp - derived fluorescence from each well to account for differences in transfection efficiency or cell number . raw 264.7 macrophages were stimulated with lipopolysaccharides ( lps ) and interferon- ( ifn ) for induction of inos gene expression . the effects on no production were determined by photometric quantification of nitrite accumulation in cell culture supernatants using the griess assay compared with a sodium nitrite standard curve after 16 h of incubation with the respective sample as described by baer et al . with slight modifications . activity is referred to nitrite accumulation of cells treated with lps / ifn-/dmso ( final concentration of 0.1% dmso serves as solvent control ) . test compounds were first dissolved in dmso and then diluted with pbs to obtain respective concentrations . l - nmma ( n - monomethyl - l - arginine ) , a known nonselective inhibitor of all nos isoforms , was used as a positive control . ic50 determination was performed in eight concentrations , each in at least three independent experiments , every time in duplicate . statistical analyses for effects on ppar were performed with the graphpad prism software version 4.03 . ( with sigmoidal dose response ) was used to calculate the ec50 values and maximal fold activation . ic50 values for effects on no production were calculated with the sigmaplot program package employing the four - parameter logistic regression model . the prediction of binding modes for the investigated compounds was accomplished in a docking study . a quantum mechanics - polarized ligand docking ( qpld ) workflow available within maestro version 9.2.112 ( schrdinger , llc , new york , ny , 2011,www.schrodinger.com ) was applied as described previously . for each molecule , up to 10 docking poses were calculated . for further investigations , the highest ranked docking solution as determined by the emodel scoring function was used . visual inspection and analysis of the retrieved binding poses were performed with ligandscout 3.1 ( inte : ligand gmbh , maria enzersdorf , austria , 2012 , www.inteligand.com ) .

in the search for peroxisome proliferator - activated receptor gamma ( ppar ) active constituents from the roots and rhizomes of notopterygium incisum , 11 new polyacetylene derivatives ( 111 ) were isolated . their structures were elucidated by nmr and hresims as new polyyne hybrid molecules of falcarindiol with sesquiterpenoid or phenylpropanoid moieties , named notoethers a h ( 18 ) and notoincisols a c ( 911 ) , respectively . notoincisol b ( 10 ) and notoincisol c ( 11 ) represent two new carbon skeletons . when tested for ppar activation in a luciferase reporter assay with hek-293 cells , notoethers a c ( 13 ) , notoincisol a ( 9 ) , and notoincisol b ( 10 ) showed promising agonistic activity ( ec50 values of 1.7 to 2.3 m ) . in addition , notoincisol a ( 9 ) exhibited inhibitory activity on no production of stimulated raw 264.7 macrophages .

Results and Discussion Experimental Section

it inhibits transcription - replication by covalently binding to dna , rna and proteins in the cell . this agent is one the major chemotherapeutics , selectively preferred in treating testis , ovary , prostate , head - neck tumors and osteosarcomas ( 1 , 2 ) . being also ototoxic and neurotoxic , cisplatin is known to be primarily nephrotoxic , limiting its high dose applications ( 3 , 4 ) . its tissue destructive feature operates via apoptosis and necrosis following dna and protein damage ( 5 ) . cisplatin induces additive oxidative stress mostly owing to over - expression of the reactive oxygen species ( ros ) , such as superoxide anion ( 6 - 8 ) . it also disturbs and degrades renal capillaries leading to glomerular and tubular damage ( 9 ) . this agent is the major cause of inflammation triggering nuclear factor - kappa b ( nf-b ) activity in the kidney , thus leading to over - expression of tumor necrosis factor - alpha ( tnf- ) , transforming growth factor- beta ( tgf- ) , monocyte chemo - attractant protein-1 ( mcp-1 ) , intercellular adhesion molecule ( icam ) , hemoxygenase-1 , tnf receptor 1 ( tnfr1 ) and tnf receptor 2 ( tnfr2 ) ( 10 ) . cisplatin causes lymphocyte , tgf- and tnf- releasing macrophage infiltration , and resultant fibrosis in the renal medullary peritubular interstitial zone . consisting of nine amino acids and secreted by the hypothalamic supraoptic and paraventricular nuclei , oxytocin ( ot ) is a peptide hormone exerting its physiological and biological actions via its g - protein coupled receptor . ot receptors are widespread in the nervous system , vascular smooth muscle , myocard , thymus , pancreas , and adipocytes ( 14 - 16 ) . it has anti - oxidative , anti - inflammatory , and anti - apoptotic effects ( 17 - 20 ) . recently , we have shown its beneficial effects against rotenone- induced parkinson s disease and sepsis - induced polyneuropathy in rats ( 19 , 20 ) . hoping to contribute to the attempts for ameliorating the highly adverse and dose- limiting features of the most widely prescribed chemotherapeutic , cisplatin and optimizing the relevant cancer treatment protocols , we hypothesized that ot maybe of benefit in protection of the rat renal tissue during chronic exposures to this agent . we designed this preliminary experimental study to " translate " its outcomes for clinical implications in the future . twenty - one adult sprague dawley rats , weighing 200 - 220 g were used in this study . animals were housed in groups of four in cages and maintained under standard conditions with 12/12 hr light / dark cycle at room temperature ( 22 2c ) . they were fed by standard pellet diet and tap water ad libitum along the study . the protocol employed in this study was approved by the institutional animal care and ethical committee of the university of ege . seven rats were grouped as naive control ( nc ) , and randomly chosen 14 rats were injected ip . by 2 mg / kg / day cisplatin ( sisplatin flakon , kocak farma ) , twice a week for 5 weeks . seven randomly chosen cisplatin ( cp ) animals were also injected ip every day by 200 g / kg / day ot ( oxytocin , pituisan , ege vet , alfasan international b.v . , holland ) for five weeks ( cp+ot ) while the other seven cisplatin ( cp ) animals received 1 ml / kg / day , ip saline ( % 0.9 nacl ) in the same regime ( cp+s ) . during the treatment period , all animals monitored daily for health conditions . then , they were sacrificed and their kidneys were resected for histological and immunohistochemical evaluations . for histological and immunohistochemical studies , all animals were anesthetized by ketamin ( 40 mg / kg , alfamine , alfasan international bv , holland ) and xylazine ( 4 mg / kg , alfazyne , alfasan international b.v . , holland ) ip and perfused with 200 ml of 4% formaldehyde in 0.1 m phosphate - buffered saline ( pbs ) . formalin - fixed kidney sections ( 4 m ) were stained with hematoxylene and eosine . morphological evaluation was performed by computerized image analysis system ( image- pro express 1.4.5 , media cybernetics , inc . usa ) on 10 microscopic fields per section examined at a magnification of 20 , by the observer blind to the study group . kidney sections from every rat in all groups were evaluated semi - quantitatively in terms of the extent of tubular necrosis / atrophy , glomerular damage , and interstitial inflammation by being rated as follows : 0 - 5% = score 0 ; 6 - 20% = score 1 ; 21 - 40% = score 2 ; 41 - 60% = score 3 ; 61 - 80% = score 4 ; and 81 - 100% = score 5 ( 21 , 22 ) . for immunohistochemistry , sections were incubated with h2o2 ( 10% ) for 30 min to eliminate endogenous peroxidase activity and blocked with 10% normal goat serum ( invitrogen ) for 1 hr at room temperature . subsequently , sections were incubated in primary antibodies against akt , crp and tgf- ( bioss , inc . ; 1/100 ) for 24 hr at 4c . antibody detection was performed with the histostain - plus bulk kit ( invitrogen , inc . ) against rabbit igg , and 3,3 ' diaminobenzidine ( dab ) was used to visualise the final product . all sections were washed in pbs and photographed with an olympus c-5050 digital camera mounted on olympus bx51 microscope . the number of immune - expression positive cells was assessed systematically , scoring at least 50 glomeruli and tubuler cells per field in 10 fields of tissue sections at a magnification of 100x . all data were analyzed by non - parametric ( mann - whitney u ) test . data are presented as mean values standard error of the mean ( sem ) . twenty - one adult sprague dawley rats , weighing 200 - 220 g were used in this study . animals were housed in groups of four in cages and maintained under standard conditions with 12/12 hr light / dark cycle at room temperature ( 22 2c ) . they were fed by standard pellet diet and tap water ad libitum along the study . the protocol employed in this study was approved by the institutional animal care and ethical committee of the university of ege . seven rats were grouped as naive control ( nc ) , and randomly chosen 14 rats were injected ip . by 2 mg / kg / day cisplatin ( sisplatin flakon , kocak farma ) , twice a week for 5 weeks . seven randomly chosen cisplatin ( cp ) animals were also injected ip every day by 200 g / kg / day ot ( oxytocin , pituisan , ege vet , alfasan international b.v . , holland ) for five weeks ( cp+ot ) while the other seven cisplatin ( cp ) animals received 1 ml / kg / day , ip saline ( % 0.9 nacl ) in the same regime ( cp+s ) . during the treatment period , all animals monitored daily for health conditions . then , they were sacrificed and their kidneys were resected for histological and immunohistochemical evaluations . for histological and immunohistochemical studies , all animals were anesthetized by ketamin ( 40 mg / kg , alfamine , alfasan international bv , holland ) and xylazine ( 4 mg / kg , alfazyne , alfasan international b.v . , holland ) ip and perfused with 200 ml of 4% formaldehyde in 0.1 m phosphate - buffered saline ( pbs ) . formalin - fixed kidney sections ( 4 m ) were stained with hematoxylene and eosine . morphological evaluation was performed by computerized image analysis system ( image- pro express 1.4.5 , media cybernetics , inc . usa ) on 10 microscopic fields per section examined at a magnification of 20 , by the observer blind to the study group . kidney sections from every rat in all groups were evaluated semi - quantitatively in terms of the extent of tubular necrosis / atrophy , glomerular damage , and interstitial inflammation by being rated as follows : 0 - 5% = score 0 ; 6 - 20% = score 1 ; 21 - 40% = score 2 ; 41 - 60% = score 3 ; 61 - 80% = score 4 ; and 81 - 100% = score 5 for immunohistochemistry , sections were incubated with h2o2 ( 10% ) for 30 min to eliminate endogenous peroxidase activity and blocked with 10% normal goat serum ( invitrogen ) for 1 hr at room temperature . subsequently , sections were incubated in primary antibodies against akt , crp and tgf- ( bioss , inc . ; 1/100 ) for 24 hr at 4c . antibody detection was performed with the histostain - plus bulk kit ( invitrogen , inc . ) against rabbit igg , and 3,3 ' diaminobenzidine ( dab ) was used to visualise the final product . all sections were washed in pbs and photographed with an olympus c-5050 digital camera mounted on olympus bx51 microscope . the number of immune - expression positive cells was assessed systematically , scoring at least 50 glomeruli and tubuler cells per field in 10 fields of tissue sections at a magnification of 100x . all data were analyzed by non - parametric ( mann - whitney u ) test . data are presented as mean values standard error of the mean ( sem ) . glomerular structure shrinkage was prominent in all cp rats , with the cp+s group showing the highest damage possibly owing to apoptosis and necrosis . moreover , the cp+s group 's slides displayed intensive and extensive tubular and peritubular mononuclear cell infiltration . peritubular fibrotic areas and tubular atrophy could also be traced in the same animals ( figure 1 ) . cp+ot group rats ' sections displayed significantly much less glomerular and tubular damage compared to the saline group ( p<0.005 and p<0.05 , respectively ; table 1 ) . the most striking difference was observed in the tubulo - interstitial areas that expressed significantly much less inflammation than those of the saline treated animals ( p<0.005 , table 1 ) . figure 2 shows the akt immunostaining in renal sections . also , the ratios of akt ( + ) cells in renal sections for all groups are given in table 2 . cp+ot rats had significantly higher akt ( + ) cells than cp+s group ( p<0.01 , table 2 ) . figure 3 and 4 illustrate the immunoexpression of crp and tgf- in renal sections of all groups . as summarized in table 2 , cp+s rats had significantly higher tgf- ( + ) and crp ( + ) cells than in the nave control group ( p<0.01 , table 2 ) . treatment of cp with ot ( cp+ot group ) significantly diminished tgf- and crp immunexpression when compared with saline treated ( cp+s ) group . glomerular structure shrinkage was prominent in all cp rats , with the cp+s group showing the highest damage possibly owing to apoptosis and necrosis . moreover , the cp+s group 's slides displayed intensive and extensive tubular and peritubular mononuclear cell infiltration . peritubular fibrotic areas and tubular atrophy could also be traced in the same animals ( figure 1 ) . cp+ot group rats ' sections displayed significantly much less glomerular and tubular damage compared to the saline group ( p<0.005 and p<0.05 , respectively ; table 1 ) . the most striking difference was observed in the tubulo - interstitial areas that expressed significantly much less inflammation than those of the saline treated animals ( p<0.005 , table 1 ) . figure 2 shows the akt immunostaining in renal sections . also , the ratios of akt ( + ) cells in renal sections for all groups are given in table 2 . cp+ot rats had significantly higher akt ( + ) cells than cp+s group ( p<0.01 , table 2 ) . figure 3 and 4 illustrate the immunoexpression of crp and tgf- in renal sections of all groups . as summarized in table 2 , cp+s rats had significantly higher tgf- ( + ) and crp ( + ) cells than in the nave control group ( p<0.01 , table 2 ) . treatment of cp with ot ( cp+ot group ) significantly diminished tgf- and crp immunexpression when compared with saline treated ( cp+s ) group . the present study demonstrated that ot attenuated the renal tubulo - interstitial fibrosis - induced by chronic cisplatin treatment in the rat . additionally , ot also ameliorated tubular injury by decreasing the cisplatin associated renal over - expression of tgf-1 and crp , meantime , activating akt signaling . ot treatment significantly reduced interstitial macrophage infiltration thus leading to suppression of inflammation and cytotoxicity induced by cisplatin . these findings suggest that the nephro - protective effects of ot are likely to be achieved , at least partly , via suppression of tgf-1/smad2 signaling pathways and the resultant relative anti - apoptotic activity in these rats . cisplatin , a major anti - neoplastic drug of solid tumors , has multiple intracellular effects , such as direct toxicity with reactive oxygen species , enhancement of mitogen activated protein kinases ( mapk ) , triggering apoptosis , and stimulating inflammation and fibrogenesis ( 23 , 18 ) . cisplatin- induced renal injury is characterized by a series of ultra - structural changes , including tubular necrosis , loss of microvilli , alterations in number and size of lysosomes , and mitochondrial vacuolization ( 23 ) . many potential therapeutic approaches targeting these steps for the prevention of cisplatin - induced renal injury has been extensively studied ( 23 , 18 ) . in particular , recent evidence indicates that inflammation has an important role in the pathogenesis of cisplatin induced renal injury . in the present study , we observed that oxytocin significantly decreased intra - renal crp and tgf-1 expression in accordance with the dosage administered , which was paralleled by a significant attenuation of tubulo - interstitial fibrosis at 4 wk . our results suggest that oxytocin suppresses the progression of tubulo - interstitial inflammation and tubulo - interstitial fibrosis through a mechanism involving decreased crp and tgf-1 expression in cisplatin - induced nephropathy . excessive deposition of extracellular matrix ( ecm ) in the tubulo - interstitium causes decline in renal function in progressive renal disease ( 24 ) . epithelial - mesenchymal transition ( emt ) of tubular epithelial cells , characterized by loss of epithelial cell characteristics and gain of ecm - producing myofibroblast characteristics , is associated with tubulointerstitial fibrosis . tubular emt can be stimulated by tgf-1 ( 25 - 27 ) advanced glycation end products ( 28 , 29 ) , and angiotensin ii ( 30 ) . however , tgf-1 is probably the key inducer of emt because tgf-1 signaling is sufficient to induce emt in cultured epithelial cells ( 26 , 27 ) . in a normal rat tubular epithelial cell line , nrk-52e ; li et al ( 31 ) found that tgf-1-induced smad 2 phosphorylation resulted in stimulation of emt with the loss of e - cadherin , and de novo expression of -sma and collagens i , iii , and iv . moreover , they observed that over - expression of smad 7 resulted in inhibi - tion of tgf-1-induced smad 2 activation with the prevention of emt and collagen synthesis . tgf-1 induced emt in renal tubular epithelial cells , directly through activation of mapk and indirectly through extra - cellular signal regulated kinases ( erks ) , directed smad 2 phosphorylation ( 31 , 32 ) . stuveling et al demonstrated that crp is an inflammatory biomarker and a strong predictor of renal function abnormalities in humans ( 33 ) . the production of crp is presumably restricted to the liver , but a recent study has suggested that the kidney may be a second site of crp formation ( 34 ) . padilla et al showed that rat crp , similarly to human crp , can activate autologous complement ( 35 ) . this finding suggests that biological functions of crp are conserved among species . in this study , we evaluated intrarenal crp expression to test anti - inflammatory effects of ot on cisplatin - induced renal injury . the results of this study revealed that ot treatment decreased cisplatin - induced over - expression of crp expression . on the basis of present and previous studies , we propose that the attenuation of tubulo - interstitial inflammation by ot treatment in cisplatin treated rat kidneys may be related , in part , to the decrease in intrarenal crp expression . in this study , we showed that ot has cytoprotective effects against cisplatin - induced tubular toxicity and these effects are mediated by the anti - apoptotic effects of ot and involve akt activation . cell fate also depends on the activation of anti - apoptotic pathways these results from loss of equilibrium between apoptotic and anti - apoptotic mediators . of note , among the signaling pathways that participate in the inhibition of apoptosis , the phosphatidylinositol 3 phosphate kinase ( pi3k)/akt axis is considered a master regulator of cell survival and activating mutations of this pathway are widely implicated in numerous cancer types ( 36 ) . pi3k activation causes akt phosphorylation , and then anti - apoptotic mediators such as bcl - xl and x - linked inhibitor of apoptosis protein ( xiap ) are activated ( 37 , 38 ) . our study neatly showed that ot has been protective during chronic cisplatin - induced nephro - toxicity and interstitial fibrosis . for the first time in literature , we thereby identified this peptide 's anti - apoptotic activity specifically attributing its operating mechanism via akt signaling . we believe that this is of importance because of being strongly suggestive that ot could directly activate anti - apoptotic signaling at the cellular level . we reckon that these present findings referring to a receptor mediated activity could be an important additive actor involved in the other previously proposed/ defined potent tissue protection mechanisms of ot . in summary , ot treatment decreased renal tgf-1 expression and reduced tubulo - interstitial fibrosis in the rats . crp and macrophage infiltration was strongly attenuated by ot in this animal model of cisplatin induced renal damage . moreover , the anti - inflammatory and anti - fibrotic effects of ot were accompanied by suppression of tgf-1/smad2 in the cisplatin - injured kidneys . our data suggest that ot protects rat kidneys against cisplatin nephro - toxicity through anti - apoptotic mechanisms . therefore , we conclude that our results further imply that administration of ot may slow the progression of tubulo - interstitial nephritis by inhibiting the inflammatory and fibrotic processes .

objective(s ) : the purpose of the present study was to investigate the protective effect of oxytocin on cisplatin ( cp)-induced renal damage in rats.materials and methods : fourteen adult sprague dawley rats , weighing 200 to 210 , were administered by cisplatin ( cp , 2 mg / kg / day ) twice a week for five weeks . then , they were randomly divided into two groups and treated with either saline ( 1 ml / kg / day ) or ot ( 200 g / kg / day ) for five weeks . seven rats served as control group . at the end of the treatment period , animals were sacrificed and their kidneys were assessed histologically . in addition , c - reactive protein ( crp ) , tgf- and akt expression were evaluated immunohistochemically.results : both tubules and glomeruli were found to be severely damaged with marked medullary tubulo - interstitial inflammation due to chronic cisplatin exposure , particularly in the salinetreated group ( group 1 ) compared to control group . oxytocin treatment spared renal - tissue significantly by suppressing crp and tgf- , and enhancing akt expression . conclusion : conclusion : we conclude that renal damage due to cisplatin toxicity was prevented to a great extent by the anti - inflammatory effect of oxytocin .

Introduction Materials and Methods Animals Experimental protocol Histopathological examination of kidney Akt, CRP and TGF- immunohistochemistry Statistical analysis Results Histopathological evaluation Immunoexpression of Akt, TGF- and CRP Discussion Conclusion Declaration of interest

once characteristics damage to the optic nerve occurs , the loss of vision and visual field is irreversible . an essential step in identification of glaucomatous optic neuropathy is assessment of the optic nerve head ( onh ) for structural changes . increases in cup - to - disc ratio ( cdr ) may represent development or progression of glaucoma thereby warranting further investigation . for example , the three - dimensional aspect of cdr is poorly appreciated from two - dimensional images obtained with nonmydriatic cameras . three - dimensional evaluation of the onh has been shown significantly more accurate in comparison to traditional two - dimensional pictures . in addition , discrepancies in observer training and experience evaluating the onh can lead to significant variability in patient referral patterns . software guided optic nerve assessment can assist in automating the process and reduce interobserver disagreement , regardless of the level of ophthalmic training . with the ever increasing number of people diagnosed with glaucoma and insufficient number of glaucoma specialists worldwide , the use of software - assisted cdr assessment by ancillary medical professionals with varying levels of experience during remote telemedicine screenings may help to triage patients appropriately and thereby decrease the overall burden of disease . in the following , we characterize the ability of depth analysis software to assess cdr from simultaneous stereoscopic images of normal optic nerves . we then conduct comparisons with physician - determined stereoscopic and nonstereoscopic cdr to establish data correlation . this represents the first step in validating the use of this software in screening and telemedicine applications . a normal exam was defined as healthy anterior and posterior segments , refractive errors between 6 and + 4 diopters , noncontact intraocular pressure ( iop ) < 21 mm hg , normal optic nerve head appearance with a cdr < 0.6 ( upper limit of population 95% confidence interval ) , and no signs of glaucomatous neuropathy . the rutgers university new jersey medical school telemedicine outreach program services collected demographic / clinical patient data , performed ocular examination , and obtained simultaneous stereoscopic optic nerve images during community screenings in essex county , nj , from 2011 to 2012 . we certify that all applicable institutional and governmental regulations concerning ethical use of human volunteers were followed during this research . nondilated images were acquired by a single user ( bcs ) using a kowa 3wx nonmydriatic simultaneous stereoscopic retinal camera ( tokyo , japan ) with a resolution of 12.3 megapixels and a field of view of 22.5 degrees . no image enhancement or compression was performed . all images were viewed on a single high - resolution monitor ( 1080 pixels ) in a darkened room . stereoscopic image quality was determined based on the ability to acquire satisfactory right and left image pairs and to view the nerve stereoscopically . vertical cup - to - disc ratio ( vcd ) was determined from a stereoscopic pair . stereoscopic viewing was performed using a berezin stereo viewer of a stereoscopic image pair at a distance of 18 inches . on a different day , in a randomized order and unaware of the software grading , vcd was determined from a single image ( nonstereoscopic using the right channel image ) , then again using the depth analysis software . a novel proprietary pixel depth analysis software ( tokyo , japan ) was employed for the software analysis . the software registers the stereo image pair and makes quantitative depth calculations based on right and left image channel disparity measurement . this software was used to determine vcd after disc and cup contour line manual placement by one physician operator ( snp ; figure 1(a ) ) . a total of 16 control points were used by the software to generate a disc ( 8 points ) and a cup margin ( 8 points ) contour line . in order to improve the quality of line positioning , we relied on stereoscopic viewing with the berezin viewer during control point placement . in addition , we used the green channel ( 550 nm ; figure 1(b ) ) to best appreciate the neural rim during cup determination . image was used to determine disc margins and aided in disc contour line placement ( figure 1(c ) ) . the software generated a depth analysis map for each stereo pair and calculated vcd ( figure 1(d ) ) . composite nonstereoscopic , stereoscopic , and software generated vcd values were expressed as means standard deviation ( sd ) . the measurement of agreement between observations was quantified using the intraclass correlation coefficient ( icc ) . statistical analysis completed using ibm spss ( version 17 , ny , usa ) , with p < 0.05 signifying statistical significance . a total of 32 stereoscopic onh images from 32 subjects were included in the analysis . mean sd age was 40 14 years ( range , 2160 years ) . fourteen ( 44% ) participants were caucasian , 13 ( 41% ) hispanic , three ( 9.4% ) asian , and two ( 6.3% ) african american . iris color was brown in 23 ( 72% ) participants , hazel in five ( 16% ) , and blue in four ( 12% ) subjects . image stereoscopic quality was adequate in all subjects for high fidelity analysis by clinician and software . the mean vcd with stereoscopic images was 0.36 0.09 ( 95% ci 0.330.40 ) , nonstereoscopic images was 0.29 0.12 ( 95% ci 0.250.32 ) , and depth analysis software was 0.38 0.08 ( 95% ci 0.350.41 ) . the difference between stereoscopic and depth analysis software - assisted recordings was not significant ( p = 0.45 ) . the difference in mean vcd was significant between nonstereoscopic and stereoscopic ( p < 0.05 ) and nonstereoscopic and depth analysis software ( p < 0.005 ) recordings . the icc between stereoscopic and software - assisted recordings was 0.88 ( strong ) , between nonstereoscopic and stereoscopic recordings was 0.70 ( moderate - strong ) , and between nonstereoscopic and software - assisted recordings was 0.56 ( moderate ) . in this pilot study , we set out to assess the ability of a novel depth analysis software to reliably measure cdr by comparing it to physician - determined cdr assessed from high quality simultaneous stereoscopic images . we demonstrated that this depth analysis software accurately assessed stereoscopic optic nerve images and showed no statistically significant difference from physician stereoscopic assessment of vcd . there was also a high degree of agreement between software and physician stereoscopic assessment in normal optic nerves as demonstrated by the intraclass correlation coefficient . the importance of teleocular health screening in at - risk , low access populations is widely accepted and software - assisted screening permits thorough , efficient evaluation of ocular health [ 7 , 8 ] . however , at present there is no standardized method for evaluating the onh during telescreenings . software - assisted stereoscopic imaging not only may be helpful in evaluation of ocular health but also may allow for efficient long term monitoring . there is a large amount of literature demonstrating limited interobserver and intraobserver reproducibility in regard to optic disc assessment [ 911 ] . nonetheless , stereoscopic onh imaging has been shown superior to monoscopic imaging and , with low - cost internet transmission , was better perceived and interpreted than monoscopic images . demonstrated that stereoscopic images of several cameras have better diagnostic performance than subjective assessment of onh by general ophthalmologists . other studies have also demonstrated the improved detection of at - risk eyes between stereoscopic imaging and nonstereoscopic imaging with higher cdr in all regions of the onh and even increased interobserver agreement using stereoscopic imaging compared with monoscopic assessments [ 3 , 14 , 15 ] . these studies suggest that stereoscopic imaging and depth software analysis could supplement the clinical exam in glaucoma detection during remote screenings and telemedicine efforts . previous studies have shown software ability to analyze stereo image pairs of a retinal fundus and generate onh parameters with some degree of consistency . these have shown reliability between depth analysis software assessment of cdr and heidelberg retina tomograph ( hrt ) [ 16 , 17 ] . in addition , hrt has been shown to have superior sensitivity to the average ophthalmologist in detecting glaucomatous optic nerve changes . more interestingly , wollstein et al . showed that depth analysis using hrt image analysis is more sensitive than clinical assessment of stereoscopic images in differentiating healthy and early glaucomatous onh . similar studies tested other methods of automated cdr assessment including edge detection , active contour modeling , and pixel segmentation in comparison to expert ophthalmologist assessment with similar results [ 2022 ] . automated determination using optical coherence tomography has also shown promise in comparison to manual assessment . levels of agreement in cdr estimations in above - mentioned studies are comparable to those reported in our study . while our study shows promise towards clinical , screening , and telemedicine applications , there are a few inherent limitations , primary of which is the need for contour line placement in order for the software to perform onh measurements . this step may require some experience and may contribute to variability in characterizing onh parameters . however , this requirement is similar to the hrt , and a recent study showed good agreement in stereometric parameters between our software and the hrt platform . in order to minimize this potential source of error , we relied on stereoscopic viewing during contour line placement . in addition , we used the green channel to best appreciate the neural rim during cup determination and a negative image to best depict the disc margin during disc contour line placement . another limitation is the relatively young age of the population compared to patients with glaucoma ; however , our data validated the use of this software for cdr assessment in normal eyes over a wide range of ages . additional studies validating the use of this promising technology in the elderly and myopes may be helpful prior to applying it to patients with glaucomatous optic neuropathy . in summary , the new depth analysis software was able to reliably calculate vcd from a digital stereoscopic image pair in normal patients and strongly correlated with the clinician determined stereoscopic onh analysis . the preliminary results of this study were presented at the arvo conference in fort lauderdale , florida , in may 2012 . the ability to accurately perform depth analysis from a single stereoscopic image pair could have several clinical applications especially in remote screening efforts and telemedicine applications . despite the limitations and additional studies required to determine the full clinical application of this software , we believe that the most immediate use of this software would be to train nonphysician staff to place the optic nerve contour lines and allow the software to reliably estimate cdr in locations where physicians may not be available to provide real time feedback . this analysis would be used to triage patients appropriately . an additional clinical utility of this software may stem from its ability to characterize the neural rim , which may be helpful in following glaucoma patients over time .

background . software guided optic nerve assessment can assist in process automation and reduce interobserver disagreement . we tested depth analysis software ( das ) in assessing optic nerve cup - to - disc ratio ( vcd ) from stereoscopic optic nerve images ( soni ) of normal eyes . methods . in a prospective study , simultaneous soni from normal subjects were collected during telemedicine screenings using a kowa 3wx nonmydriatic simultaneous stereoscopic retinal camera ( tokyo , japan ) . vcd was determined from soni pairs and proprietary pixel das ( kowa inc . , tokyo , japan ) after disc and cup contour line placement . a nonstereoscopic vcd was determined using the right channel of a stereo pair . mean , standard deviation , t - test , and the intraclass correlation coefficient ( iccc ) were calculated . results . 32 patients had mean age of 40 14 years . mean vcd on soni was 0.36 0.09 , with das 0.38 0.08 , and with nonstereoscopic 0.29 0.12 . the difference between stereoscopic and das assisted was not significant ( p = 0.45 ) . iccc showed agreement between stereoscopic and software vcd assessment . mean vcd difference was significant between nonstereoscopic and stereoscopic ( p < 0.05 ) and nonstereoscopic and das ( p < 0.005 ) recordings . conclusions . das successfully assessed soni and showed a high degree of correlation to physician - determined stereoscopic vcd .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

optical coherence tomography ( oct ) provides high - resolution , cross - sectional tomographic images of the human retina and permits direct evaluation of retinal thickness . in recent years the development of spectral - domain oct ( sd - oct ) technology has greatly increased imaging speed and resolution relative to earlier time - domain technology . sd - oct has become invaluable in the management of a variety of retinal diseases including neovascular age - related macular degeneration ( amd ) [ 25 ] and diabetic macular edema [ 6 , 7 ] . this utility is due primarily to the ability to extract estimates of retinal thickness across the macula ( to aid in clinical diagnosis and treatment decisions ) . previous studies on the application of sd - oct to retinal pathology have uncovered multiple sources of error that dramatically decrease the accuracy of these macular thickness measurements [ 8 , 9 ] . perhaps the most obvious source of error is imprecise retinal layer segmentation , which can result from poor signal quality of the sd - oct image or the outright failure in the segmentation algorithm itself in otherwise high - quality images [ 8 , 10 , 11 ] . additional errors inherent to the system can be elucidated by evaluating the reproducibility of sd - oct systems [ 9 , 1217 ] . these reproducibility studies capture all errors inherent to the basic operation of the sd - oct system and represent a baseline level of error that could reasonably be expected even under the best circumstances . however , there are additional sources of inaccuracy that have received considerably less attention and are independent of segmentation and operator errors . rather they pertain to instrument sampling and processing protocols . for example , sadda et al . compared central subfield thickness values from volumes containing 128 b - scans to less densely sampled volumes . as b - scan density is reduced , less retinal area is sampled , leading to less data being included in the retinal thickness calculation . the reduction in data led to differences , or errors , in retinal thickness measurements , the magnitude of which increased as sampling density was decreased . here , we further examined b - scan density as well as factors that are related to assumptions about the patient being imaged , such as errant fixation and variation in axial length among patients . taken together , these variables compromise the accuracy of macular thickness maps . while the degree of inaccuracy depends on the patient , the significance of the inaccuracy depends on the application of the retinal thickness data . one hundred thirteen normal subjects ( 55 male , 58 female ) age 18 years and older were recruited for sd - oct imaging ( mean standard deviation = 27.3 8.3 years ) . normal subjects had normal color vision assessed with the neitz test of color vision and no history of refractive surgery or any vision - limiting ocular pathology . forty - three patients ( 18 male , 25 female ) with various retinal pathologies were also recruited ( mean standard deviation = 40.7 20.1 years ) . pathology included macular dystrophy ( n = 9 ) , blue cone monochromacy ( n = 3 ) , x - linked high myopia ( n = 4 ) , basal laminar drusen ( n = 5 ) , retinitis pigmentosa ( n = 2 ) , amd ( n = 3 ) , plaquenil toxicity ( n = 3 ) , diabetic macular edema ( n = 3 ) , macular telangectasia ( n = 2 ) , central artery occlusion ( n = 2 ) , and one each of oligocone trichromacy , posterior epithelial detachment , oculocutaneous albinism , punctate inner choroidopathy , achromatopsia , cystoid macular edema , and acute zonal occult outer retinopathy . informed consent was obtained from all subjects after explanation of the nature and possible consequences of the study . all research on human subjects followed the tenets of the declaration of helsinki and was approved by the institutional review board at children 's hospital of wisconsin . volumetric sd - oct images of the macula were obtained using the cirrus hd - oct ( carl zeiss meditec , dublin , calif , usa ) . volumes were nominally 6 mm 6 mm and consisted of 128 b - scans ( 512 a - scans / b - scan ) . the internal fixation target of the system was used , which consists of a large green asterisk on a red background , and focus of the lso fundus image was optimized using built - in focus correction . in addition , the polarization setting was optimized using the built - in function for each eye . retinal thickness was calculated using the built - in macular analysis software on the cirrus ( software version 5.0 ) , which is automatically determined by taking the difference between the ilm and rpe boundaries . the positions of the foveal center and retinal thickness data from each volume scan were exported for offline analysis using the zeiss cirrus research browser ( version 5.0 ) . all volumes were manually examined for accuracy of the ilm and rpe segmentation and relative accuracy of the autofovea function . in order to evaluate the acquisition and analysis parameters of interest , we needed to be able to manipulate these macular thickness maps off line . custom matlab ( mathworks , natick , mass , usa ) software was used to generate early treatment diabetic retinopathy study ( etdrs ) thickness maps from the .dat files exported from the zeiss cirrus research browser . as shown in figure 1 , there is good agreement between etdrs segment thicknesses derived from the on - board cirrus software and our offline matlab program , thus demonstrating the fidelity of the data export and validating our use of these matlab - derived etdrs maps for subsequent analysis . to assess the interpolation error in volumetric retinal thickness maps due to decreased b - scan sampling , we created undersampled versions of the retinal thickness volumes exported from the cirrus system . these maps used thickness values from 8 ( every 16th b - scan ) , 16 ( every 8th b - scan ) , 32 ( every 4th b - scan ) , or 64 ( every other b - scan ) of the 128 b - scans initially collected . complete thickness maps were then created by interpolating between these evenly spaced b - scans ( using a matlab spline interpolation function ) . this enabled point - by - point comparison between the native macular thickness map and the undersampled ones , as well as comparison between the corresponding etdrs plots . in all etdrs comparisons , most sd - oct systems assume foveal fixation ; however there is frequently significant discrepancy between the location of the fovea and the preferred retinal locus of fixation . even among individuals with no retinal pathology , there is modest variation in fixation and there is evidence that suggests that the foveal center is not always used for fixation [ 2124 ] . we used the autofovea function of the cirrus hd - oct to identify the location of the foveal pit and generated an etdrs plot centered at this location and a second plot centered at the middle of the volume ( the default setting on most other sd - oct systems ) . manual inspection of each volume confirmed that the fovea was identified by the autofovea function ( though in more severe macular pathology we have seen the algorithm fail ) . comparing these two etdrs plots provides an estimate of the potential error due to improper anchoring of the plot to the scan center . moreover , as we had access to the ( x , y ) coordinate of the fovea within each nominal 6 mm 6 mm volume , we examined error as a function of the displacement of each subject 's fixation from the center of his or her foveal pit . the scan length reported by sd - oct systems ( when reported in mm ) is relative , not absolute . this is because the scanning mirrors are calibrated to a model eye , which assumes a fixed axial length ( typically around 24 mm ) . however there exist significant individual differences in retinal magnification ( primarily caused by differences in axial length ) ; thus the actual scan length will vary from person to person . in fact , using normative axial length data to correct for ocular magnification , we estimate that approximately one - third of individuals would have a scan length that deviates by more than 0.3 mm from the expected length ( with a maximum deviation of nearly 1 mm ) . we obtained axial length measurements using the zeiss iol master ( carl zeiss meditec , dublin , calif , usa ) and subsequently calibrated the lateral scale of each subject 's sd - oct scans in order to generate revised etdrs plots . these plots were then compared to those derived assuming a 24.46 mm axial length ( that of the cirrus model eye ) . despite the macular volume scan nominally subtending a 6 mm 6 mm area , the entire retinal area within that volume is not actually scanned . as shown in figure 2 , even a scan using 512 a - scans / b - scan and 128 b - scans only samples 29% of the retinal area within the volume . using 37 high - resolution b - scans results in less than 10% of the retinal area within the volume actually being scanned . as only retina that gets scanned can actually contribute to plots of retinal thickness measurements , this undersampling can significantly affect the integrity of the resultant macular thickness maps . at first glance , assessment of the effect of b - scan density on macular thickness maps suggests that despite reducing the number of b - scans , the general contour of the map remains qualitatively similar ( figure 3(a ) ) . however in reality , interpolation between b - scans causes overrepresentation and underrepresentation of different features within a given retinal volume ( figure 3(b ) ) . as shown in the normal example , since sampling is being reduced in the vertical direction , the superior and inferior aspects of the fovea show equal magnitude of underrepresentation and overrepresentation of retinal thickness , respectively . this effect is greatly enhanced in a subject with dominant drusen , wherein error is generated not only in the central fovea but also broadly across the retinal volume . we found that in the normal individuals for the central 1 mm subfield , the mean ( standard deviation ) absolute error was 0.19 0.15 m with 64 b - scans , 1.17 0.69 m with 32 b - scans , 7.15 2.35 m with 16 b - scans , and 22.98 7.54 m with 8 b - scans . when expressed as a percentage of subfield thickness we find that the mean percentage error was 0.07 0.06% with 64 b - scans , 0.47 0.29% with 32 b - scans , 2.85 1.08% with 16 b - scans , and 9.19 3.52% with 8 b - scans . for the central 1 mm subfield , the mean ( standard deviation ) absolute error was 0.31 0.36 m with 64 b - scans , 1.36 1.17 m with 32 b - scans , 6.35 3.64 m with 16 b - scans , and 19.56 11.08 m with 8 b - scans . when expressed as a percentage of subfield thickness we find that the mean percentage error was 0.13 0.15% with 64 b - scans , 0.63 0.56% with 32 b - scans , 3.03 2.14% with 16 b - scans , and 9.56 6.92% with 8 b - scans . previous data reveal that the coefficient of repeatability for central subfield measurements on the cirrus is about 4.96 m , indicating that 32 b - scans is sufficient sampling to generate accurate etdrs thickness plots . however , as shown in the difference plots in figure 3 , at neighboring retinal locations where the retinal contour is changing , retinal thickness measurements are in error in opposing directions . thus , reporting retinal thickness for a subregion that averages spatially ( i.e. , etdrs plots ) will not reveal the true extent of the error imparted by undersampling . in order to quantify the effect of b - scan density on the accuracy of retinal thickness at any given point within the 6 mm 6 mm volume , we examined the error per pixel ( a scan ) within the volume . in this case , the retinal thickness measurements utilizing all 128 b - scans were considered to be absolutely accurate for comparison to the undersampled volumes . at 32 b - scans , our analysis revealed that these interpolation errors could be as high as 5.5 m per pixel and 7.5 m per pixel in the normal and pathology groups , respectively . there are 65,536 pixels in each of our thickness maps , native or undersampled . in both groups , on average , the error per pixel increases as the number of b - scans used to construct the retinal thickness map decreases ( figure 4 ) . we compared etdrs thickness plots derived by placing the center of the etdrs grid on the foveal center to those plots centered on the subject 's actual fixation point . we found these plots to differ by over 100 m in some normal individuals ( sum of the error in all nine etdrs segments ) , with the mean error being 14.4 19.3 m ( figure 5(a ) ) . in the 43 pathology cases , the mean error was 30.4 40.9 m , with some individuals exceeding 200 m of total error in their etdrs plots ( figure 5(b ) ) . of course if eccentric fixation is identified by the oct operator , the scan location can be repositioned prior to image acquisition to help reduce this error . for two pathology cases , we acquired one scan at their normal eccentric fixation location and a second after moving the scan to be visually centered on the fovea . at their normal fixation position , these subjects had etdrs plots that deviated by 74.5 m and 101.9 m from an etdrs plot precisely positioned at the foveal center ( using our offline matlab program ) . even after the operator acquired a second scan intentionally centered on the fovea to the best of their ability , etdrs errors persisted of 16.3 m and 17.8 m . regardless , for both normal subjects and subjects with retinal pathology , the greater the distance between the fovea and the center of the sd - oct volume , the less accurate the etdrs thickness map . in just the central subfield thickness , not correcting for scan position results in a mean error of 3.18 6.09 m in the normal subjects ( with a maximum error of 32 m ) and 10.50 19.43 m in the patients with retinal pathology ( with a maximum error of 104 m ) . on average , the central subfield error accounts for 14% and 22% of the total etdrs error in the normal and pathology patients , respectively . axial length varied in our normal subjects from 21.56 to 28.36 mm and in pathology patients from 21.87 to 30.13 mm . using each subject axial length to correct the lateral scale of the nominal 6 mm sd - oct scan , we determined that actual scan sizes range from about 5.29 to 6.96 mm for our normal population and 5.36 to 7.4 mm for our pathological population . we used these corrected scan dimensions to derive corrected etdrs plots , where the rings were actually 1 mm , 3 mm , and 6 mm in diameter . in comparing these plots to the uncorrected ones , we found that the summed error for the nine etdrs segments was as much as 44.9 m , with 37 out of 113 ( 32% ) subjects having more than 20 m of total error . for subjects with retinal pathology the summed error for the nine etdrs segments was as much as 77.3 m , and 13 out of 43 ( 30% ) showed more than 20 m of total error ( figure 6 ) . in just the central subfield alone , the error was as much as 7.86 m ( with an average of 2.56 1.85 m ) for the normals and as much as 12.33 m ( with an average of 2.84 2.46 m ) in the individuals with retinal pathology . in both groups , the error increased with increasing difference in axial length from that of the model eye ( 24.46 mm ) . as illustrated above , not correcting for axial length and not positioning the scan at the center of the fovea introduces significant error in the corresponding etdrs thickness plots . taken together , these artifacts tend to have a cumulative negative effect on the accuracy of the etdrs plots . for example , in considering just the central subfield thickness , not correcting for axial length or scan position results in a mean error of 4.53 5.77 m in the normal subjects ( with a maximum combined error of 33 m ) and 11.29 19.18 m in the patients with retinal pathology ( with a maximum combined error of 105 m ) . this study examined the effects of preventable operational and analytic aspects of the sd - oct on the overall accuracy of etdrs retinal thickness plots . scan density , position of the scan with respect to the foveal center , and magnitude of subject axial length differential all contribute to significant error in computing retinal thickness from sd - oct volumes . an important point to consider is the cumulative nature of the errors reported here ; these parameters should all be accounted for when developing normative databases or analyzing specific retinal features within individual patient data . while the errors were estimated using a single sd - oct device ( cirrus hd - oct ) , they are generic to sd - oct imaging in general . the issue of scan positioning is typically something that can be addressed by the operator by repositioning the etdrs grid ( either manually or using an automatic function like autofovea ) . currently , correcting the lateral scale of oct data / images requires offline correction by the user . in comparing our results to previously published data , we find similarities and differences . in an examination of b - scan density , sadda et al . concluded that 32 b - scans result in only a minimal change in retinal thickness . our data also show that when examining maps of retinal thickness that are based on spatially integrating individual thickness values ( i.e. , etdrs ) , reduced b - scan sampling has minimal impact . however , if interested in deriving absolute measures of retinal thickness at any given point , reduction to 32 b - scans ( a value suggested to provide accurate retinal thickness maps ) , results in an average error of around 3 m per pixel . while this average error is within the system resolution on commercial sd - oct systems , it is worth keeping in mind that the error at any one pixel can be much larger , since not all pixels will contribute equally to the total error ( which is implicit in computing an average error ) . real cost of undersampling , and this would significantly limit the ability to make precise measurements of retinal features ( e.g. , drusen ) . this highlights the importance of considering how the sd - oct data is going to be used when deciding how densely to sample the retina . it is well documented that differences in axial length result in different ocular magnification of retinal images and thus can affect the accuracy of measurements of retinal features . with respect to oct , axial length has been shown to influence measurements of retinal nerve fiber layer ( rnfl ) thickness [ 2831 ] . this of course is based on the fact that rnfl measures are presumed to be taken at a fixed distance from the optic nerve ; thus individual differences in ocular magnificent would result in the rnfl being measured at the wrong location . here we demonstrate that individual differences in ocular magnification also affect the accuracy of macular thickness maps . if the distribution of axial lengths in a normative database does not match that of the subject population being studied , misinterpretation can occur . perhaps more important than retinal thickness maps is the fact that not correcting the nominal scan length for differences in axial length will obviate making reliable measurements in the lateral dimension within a given oct dataset . this could include measuring the area of geographic atrophy , the size of a macular hole , or the size of a druse . despite this , some sd - oct systems still output lateral scale bars on their images that are given in m or provide calipers with which to make lateral measurements in m , despite no correction for axial length having been made . one should avoid using such scale bars to report absolute length measurements , as they are simply not accurate without first taking into account ocular magnification . there have also been previous examinations of the effect of fixation on the accuracy of oct thickness measurements . in glaucoma , it has been shown that if the circular scan is not centered on the onh , the rnfl thickness measurements are inaccurate . examined how intentionally shifting the center of macular volume oct scans ( stratus time - domain ) affected central subfield thickness measurements for 10 normal subjects . they found that scan decentration of 0.50 mm resulted in foveal thickness measurements that were in error by about 45% . for our normal subjects , the average decentration of the sd - oct volume with respect to the foveal center was 0.09 mm and the average error of foveal thickness measurements was about 35% . while this is roughly consistent with the finding of campbell et al . , some discrepancy would be expected given our use of sd - oct ( instead of time domain ) and our ability to precisely determine the exact misalignment between the two scans being compared ( whereas the previous study would have be confounded by errors due to normal fixational instability ) . currently , the cirrus hd - oct will automatically position the etdrs grid over the center of the fovea ( after the scan is taken ) . while this results in a more accurate etdrs map , it may not be valid to compare these maps to a database in which the etdrs maps were not centered on the fovea , though in the case of the cirrus database , good centration of the volume on the fovea was an inclusion criterion . it is generally important to ensure that the scan parameters used to develop the normative database match that of the on - board scan protocol . moreover , the subject composition ( race and gender ) may also need to be considered when comparing a specific patient to a particular normative database . first , in our examination of b - scan sampling , we used 128 b - scans as the truth . this was simply due to a limitation of the specific sd - oct device being used . however , as we showed in figure 2 , 128 b - scans ( at 512 a scans / b - scan ) only sample 29% of the nominal 6 m 6 mm volume . thus these volumes are likely already in error compared to an isotropic volume of 512 b - scans . with the expected availability of even faster oct systems , it will be important to quantify the level of inaccuracy systematically across more densely sampled volumes . in addition , we likely underestimate the real effect of undersampling , as we used simulated thickness maps . if one were to really only acquire 32 b - scans , this could affect the accuracy of segmentation as many oct devices use 3d approaches to make correct assignment of layers . a second limitation is that we corrected for ocular magnification using a linear scaling based on axial length . there are other methods to correct for ocular magnification , and the exact method used for the correction would influence the measured differences in retinal image magnification . finally it seems likely that different retinal pathology would suffer more ( or less ) than others . intuitively , one can conclude that the more uniform the retinal thickness contoured ( as might occur in retinitis pigmentosa , where the retina is uniformly thin ) , the less impact the b - scan sampling , axial length , and scan position would have . likewise , retinal pathology that results in significant peaks and troughs in retinal thickness ( macular holes , amd , diabetic macular edema ) might be more significantly influenced by these parameters . it is important to keep in mind that the relevance of these errors of course ultimately depends on the clinical application . for monitoring patients over time , relative differences in retinal thickness would be generally unaffected by axial length , though comparing populations of patients ( such as in a clinical trial ) where there may be differences in axial length between the groups could result in significant error . if one uses the same sampling density , then the accuracy of these longitudinal measurements of retinal thickness will be on the order of that reported for previous repeatability and reproducibility studies . however , in instances where one is interested in correlating a measure of retinal thickness over a specific retinal area ( e.g. , central subfield thickness ) with some other measure of vision ( such as treatment response ) these errors could reveal correlations that do not exist or hide ones that do exist . moreover , where one is interested in making absolute measurements in the lateral dimension , such as foveal pit morphology [ 12 , 34 ] or drusen volume , it is critical that these sources of error be removed .

sd - oct has become an essential tool for evaluating macular pathology ; however several aspects of data collection and analysis affect the accuracy of retinal thickness measurements . here we evaluated sampling density , scan centering , and axial length compensation as factors affecting the accuracy of macular thickness maps . forty - three patients with various retinal pathologies and 113 normal subjects were imaged using cirrus hd - oct . reduced b - scan density was associated with increased interpolation error in etdrs macular thickness plots . correcting for individual differences in axial length revealed modest errors in retinal thickness maps , while more pronounced errors were observed when the etdrs plot was not positioned at the center of the fovea ( which can occur as a result of errant fixation ) . cumulative error can exceed hundreds of microns , even under ideal observer conditions . this preventable error is particularly relevant when attempting to compare macular thickness maps to normative databases or measuring the area or volume of retinal features .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

colorectal cancer is the third most common cancer worldwide and also the fourth most common cause of cancer - related death . at presentation , staging of the disease is crucial , giving prognostic information and guidance for treatment decision making . half of all patients have disseminated disease at the time of diagnosis or develop evidence of metastatic disease later . approximately 30% will develop liver metastases and around 20% will develop lung metastases [ 3 , 4 ] , the 2 most common sites for distant metastases . lung presentation has a better prognosis than other metastatic sites , with a slower disease progression . the first choice is resection with the possibility of further treatment with stereotactic body radiation therapy ( sbrt ) or thermal ablative techniques as salvage procedures . guidelines often suggest chemotherapy with response or stable disease before attempting potentially curative treatment of metastatic disease . a completely new area of interest has opened up with the arrival of immunomodulating drugs , but these need targetable antigenic properties on the tumours . this is seen with colorectal cancers that have microsatellite instability in their genome , causing a changing expression of surface antigens allowing cytotoxic t - cell activity that can be unlocked with drugs like programmed cell death 1 receptor ( pd-1 ) action [ 6 , 7 ] . an alternative method to open new antigens on tumours is local destruction with ablative techniques such as cryotherapy , radiofrequency ( rf ) ablation , or microwave ablation . microwaves have the benefit of being able to deliver energy quickly keeping ablation times short and overcoming cooling from adjacent vessels [ 8 , 9 ] . also , for lung treatment , there is no need for tissue conductivity as is the case for rf , as microwaves can propagate through the alveolar air . if a good immunological response can be elicited , a general effect on all tumoural tissue can sometimes be noticed , the abscopal effect , which has been shown in animals receiving immunomodulation with local ablative techniques . we present the case of a 51-year - old woman with a history of guillain - barr syndrome as a teenager , probable neuroborreliosis in the 1980s , and a malignant melanoma in situ in the 1990s . the patient had repeat rectal surgeries for sphincter damage after childbirth , and in 2011 , she was diagnosed with a t4 rectal cancer causing haemorrhage . no distant metastases were found and treatment with curative intent was decided at a multidisciplinary team conference . she had neoadjuvant chemotherapy with fluorouracil and leucovorin followed by radiation with 50.4 gy to the rectum . the postoperative course was uneventful except for a superficial wound infection and she was discharged after 3 weeks of hospitalization . after 2 weeks , she was readmitted because of a takotsubo cardiomyopathy and intestinal obstruction requiring more surgery with resection of a short segment of small bowel . after 1 year , the first lung metastases were diagnosed with a 2-cm metastasis in the right lower lobe and a 5-mm . after 3 pulmonary resective procedures , further lung metastases were seen during follow - up . a second line of chemotherapy was started with oxaliplatin , resulting in shrinkage of the noted lesions . then , local treatment was done with sbrt , 17 gy 3 for 2 right - sided metastases and a resection of the left lung , 3 years after the resection of the primary tumour . three months later a new lung metastasis was diagnosed and treated with sbrt , 7 gy 8 . six months later , 2 more lung lesions were found and a third line of chemotherapy based on irinotecan was started , but as tumour progression was observed , treatment was discontinued after 3 months . without having the final test result on microsatellite instability in the tumour , it was decided to start pd-1 treatment ( this was not within a clinical trial , since the only available trial in sweden had not opened yet ) . there were a total of 6 confirmed metastases on both sides after the first 3 doses of pembrolizumab ( standard dose with 2 mg / kg every third week ) . the ct evaluation showed size increase of all lung metastases , but no new lesions . this early evaluation did not contradict further therapy , but before continuing with the immunological treatment , local ablative treatment with microwaves was proposed , as this has become a standard treatment for liver tumours , and also evidenced with a growing pile of international publications on treatment of lung lesions [ 9 , 11 , 12 , 13 ] . the tumours were deemed treatable and were , after 2 more doses of pembrolizumab , done so in 2 sessions 3 weeks apart using a computer - assisted targeting system ( cas - one ; cascination ag , bern , switzerland ) and microwaves ( angiodynamics ) under immobilization of the lungs with high - flow jet ventilation as described in a previous publication . the patient stayed in hospital overnight after the ablations . during the first ablative session , a pneumothorax was caused and a 16f chest tube with suction was placed and removed after clamping the next day . after the sixth course of pembrolizumab , the patient felt pain over the liver area , and experienced low appetite and some weight loss . further investigations showed no signs of liver metastases or damage , but a drop in serum albumin and elevated esr and crp . this rise in inflammatory parameters was judged as potential reaction on pd-1 inhibition and treated with betamethasone . for better pain control , amitriptyline was added to the standard analgesic regimen as there could be a neurogenic pain component . two weeks thereafter , the patient experienced weakness of her left lower leg , finger tremors , and numbness on the ulnar side of the right hand . the symptoms were regarded as side effects of pembrolizumab , although mechanistically not fully understood . the dose of corticosteroids was increased and the eighth course of pembrolizumab was given with no worsening of symptoms . images from a follow - up computed tomography are shown in figure 2 where an inflammatory reaction is initially seen with focal lesions , pseudo - tumours , that later disappeared . after 8 months of follow - up , there have been no signs of new or recurrent lung metastases . presently , the patient is still suffering from neurological symptoms that in spite of efforts giving higher doses of steroids are not declining . the other complication is upcoming diffuse non - malignant lesions in both lungs , interpreted as either inflammatory or infectious . steroid treatment has only partially alleviated the symptoms , as has antibiotic treatment , covering both gram - positive bacteria and pneumocystis carinii . further investigations are ongoing . as mentioned , the lung metastasis has not recurred , giving her time off anti - tumoural treatment . the presented case demonstrates the possibilities of using stereotactically navigated ablation antennas for microwave ablation of multiple lung metastases . further , it points to possible immunological benefits when combining ablative treatment with immune activation therapy using pd-1 targeting drugs like pembrolizumab , and promising early clinical results have recently been published in a study from china . the combination could open a completely new set of possibilities in the field of oncology where efforts should be made to ensure in a prospective controlled fashion .

we present a patient with colorectal metastases confined to the lungs and treated with multiple resections until this was not an option anymore , followed by stereotactic body radiation therapy until this option was drained . then , the patient was successfully treated with multiple microwave ablations combined with immunological activation targeting the programmed cell death 1 receptor ( pd-1 ) , possibly instigating a powerful abscopal effect . techniques , doses , and radiological findings are presented .

Introduction Case Presentation Conclusion Statement of Ethics Disclosure Statement

dimer and tetramer geometries were optimized in a development version of q - chem at the pbe0-ddsc / def2-svp level , which has been shown to be reliable for noncovalently bound complexes . the representative grid used to map the contour surface for transfer integrals and binding energies as a function of molecular x- and y - axis translations ( figure 2 ) was constructed from a dimer of bare quaterthiophene optimized at the same level . the relative monomer barycenters were then displaced ( in x , y ) on intervals of 0.25 at a fix interplane distance ( z ) of 3.55 . the pbe0-ddsc / def2-svp binding energies were computed from the energy difference between the dimer and the monomers in the dimer geometries , with no correction for basis - set superposition error . note that the use of other functionals ( e.g. , m06 - 2x ; see supporting information ) leads to the same qualitative features as shown in figure 2b , c . the charge transfer integrals for hole transport were computed at the pbe0/dzp level for each grid conformation as well as for the pairs of optimized substituted quaterthiophene derivatives . we used the direct quantum - mechanical approach implemented in adf 2013 that is based on localized monomer orbitals in combination with a basis set orthogonalization procedure .

we show that substituting quaterthiophene cores with strong h - bond aggregators , such as urea groups , provides an efficient way to adjust the mutual in - plane displacements of the semiconducting units and promote charge transfer . our 2-d structure property mapping reveals that the insertion of substituents induces up to 2.0 longitudinal and transversal displacements between the -conjugated moieties . some of these relative displacements lead to improved cofacial orbital overlaps that are otherwise inaccessible due to pauli repulsion . our results also emphasize that the fine - tuning of in - plane displacements is more effective than achieving tighter packing to promote charge - transfer properties .

Computational Details

biofilms are associated with a variety of persistent infections as a result of their propensity to form and grow on foreign bodies . compared with planktonic forms , organisms in biofilms exhibit increased resistance to the host immune system and antimicrobial therapy ; for this reason , the management of biofilm - associated infections is challenging . today , many of these infections are definitively managed using medical device removal , an intervention that is both costly and inconvenient . given that biofilm - associated infections are difficult to manage , prevention strategies are ideal . most preventive approaches utilize antimicrobials or antiseptics [ 48 ] ; however , considering that biofilms can survive in the presence of high concentrations of antimicrobial agents , new prophylactic strategies are needed . chemical and mechanical strategies such as silver or gallium ions , cationic molecules , and other disinfectants have been studied as coatings of indwelling devices [ 912 ] . substances with antibiofilm activity , such as lactoferrin or synthesized chalcones [ 1315 ] , as well as low acoustic energy [ 16 , 17 ] have shown some ability to prevent biofilm formation . none of these strategies has , however , solved the clinical challenge of biofilm - associated infections . the initial step of biofilm formation on medical devices involves adhesion of organisms to medical implant surfaces by electrostatic forces which are largely repulsive , as both are negatively charged . direct current ( dc ) may augment repulsive electrostatic forces between organisms and medical implants [ 1922 ] . in addition , dc may impact biofilm formation by changing physical conditions ( e.g. , temperature , ph ) at the implant surface and through the accumulation of products of oxidative stress [ 20 , 2327 ] . previous studies have demonstrated that dc exhibits bactericidal activity against established biofilms [ 20 , 22 , 23 , 25 , 28 ] . the bactericidal effect of dc against sessile cells suggests that this strategy may be useful to reduce biofilm formation . in a previous study , we showed that 24 hours of 2,000 a dc reduced s. epidermidis biofilm formation . whether lower amperage of dc would also reduce biofilm formation and whether our findings with s. epidermidis generalize to other microorganisms are unknown . the use of dc to reduce biofilm formation may provide a new strategy to prevent biofilm formation in clinical practice . it has the potential benefit of eliminating the use of traditional antimicrobials and therefore decreasing the risk of selecting resistance to these agents . herein , we examined the effect of different amperages and delivery durations of dc in reducing formation of biofilms of five bacterial and one fungal species . s. epidermidis xen 43 , staphylococcus aureus xen 30 , escherichia coli ( idrl-7029 , prosthetic hip infection clinical isolate ) , pseudomonas aeruginosa xen 5 , candida albicans ( gdh2346 , mouth infection clinical isolate ) , and propionibacterium acnes ( idrl-7676 , prosthetic shoulder infection clinical isolate ) were studied . the xen strains were generous gifts of perkinelmer caliper life sciences ( formerly xenogen corp . , jyotsna chandra and mahmoud ghannoum ( university hospitals of cleveland and case western reserve university , cleveland , oh ) . experiments were performed using polycarbonate channeled chambers designed and fabricated by the mayo division of engineering ( figure 1 ) . each chamber contained a groove into which a 12.5 1 mm teflon or titanium disc was inserted , positioned vertically . cylindrical platinum electrodes , 1.5 55 mm , were placed in each chamber , 3 mm from the disc , with 1 cm of electrode extended above the chamber for the purpose of connecting the electrode to a current generator . a power source ( keithley 2400 sourcemeter ) or an 8-channel computer controlled current generator ( designed by mayo division of engineering ) was used to deliver direct current ( 200 or 500 a ) . microorganisms were subcultured from frozen aliquots onto bbl trypticase soy agar with 5% sheep blood plates ( tsa ii , becton dickinson franklin lakes , nj ) and incubated overnight at 37c in 5% co2 . one colony was added to 3 ml of trypticase soy broth ( tsb ) and grown for 1 - 2 hours at 37c on an orbital shaker . the broth was adjusted to a 0.5 mcfarland standard and added to a previously described semisynthetic medium supplemented with 64 ml of 1% glucose and tsb ( 10% ) to a final bacterial concentration of 10 colony forming units ( cfu)/ml . a continuous flow ( 3 ml / hour ) of the semisynthetic medium containing 10 cfu / ml test organism was delivered to the polycarbonate treatment chambers containing teflon or titanium discs . after 2 hours ( for gram - negative bacilli ) or 4 hours ( for gram - positive cocci ) , the semisynthetic medium containing the test organism was changed to a phosphate buffer ( 12.78 mg na2hpo4 , 6.15 mg kh2po4 , and 19.2 mg glucose in 1000 ml sterile water ) without bacteria , also flowing at 3 ml / hour . dc ( 0 , 200 , or 500 a ) was delivered ( starting at the same time that semisynthetic medium with bacteria flow started ) for either 4 , 8 , 12 , 16 , 20 , or 24 hours of a 24-hour period when testing 500 a dc , or 12 , 24 , 36 , or 48 hours of a 48-hour period when testing 200 a dc , with 0 a controls tested at each time point . testing was performed at 37c for gram - positive cocci and at room temperature for gram - negative bacilli . after 24 hours when using 500 a or 48 hours when using 200 a , discs were aseptically removed from the test chambers , planktonic organisms rinsed off by gently dipping the discs into sterile saline , and the discs placed into sterile tubes containing 1 ml of sterile saline . biofilm organisms were removed by vortexing and sonication in an ultrasound bath ( 40 khz , 320 mw / cm ) for 5 minutes . the medium that remained in the chamber ( planktonic organisms ) after 24 or 48 hours was also quantitatively cultured . biofilm results were expressed as log10 cfu / cm ; planktonic results were expressed as log10 cfu / ml . c. albicans was subcultured from frozen aliquots and incubated for 48 hours at 30c in room air , only 0 and 500 a dc for 24 and 48 hours were tested , semisynthetic medium was changed to phosphate buffer after 4 hours , and experiments were conducted at room temperature . for p. acnes , the organism was subcultured from frozen aliquots and incubated for 72 hours at 37c under anaerobic conditions , only 0 and 500 a dc for 24 and 48 hours were tested , semisynthetic medium was changed to phosphate buffer after 4 hours , and experiments were conducted at 37c in an anaerobic chamber ( coy laboratory products , grass lake , mi ) . in addition to performing experiments under aerobic conditions , s. epidermidis experiments were run under anaerobic conditions using 0 and 500 a dc for 24 hours . we compared the difference between s. epidermidis and e. coli biofilm formation on titanium discs using 0 , 200 , and 500 a of dc for 12 and 24 hours and the treatment device and methods described above . reductions in biofilm or planktonic cells were calculated comparing quantitative cultures of discs or surrounding fluid in chambers exposed and not exposed to electrical current . was performed with each current delivery strategy and no current delivery using the wilcoxon rank sum test to determine if electricity reduced biofilm formation . all tests were two - sided ; p values < 0.05 were considered statistically significant . time- and dose - dependent reductions in biofilm formation on teflon discs were observed for s. epidermidis , s. aureus , e. coli , and p. aeruginosa , using 500 and 200 a ( figure 2 ) . for s. epidermidis , a 1 log10 cfu / cm reduction in biofilm formation was observed starting at 8 hours of exposure to 500 a , with a 4 log10 cfu / cm reduction observed after 16 hours of exposure to 500 a or 24 hours of exposure to 200 a . for s. aureus , there were 2 log10 cfu / cm reductions in biofilm formation with 12 or more hours of exposure to 200 and 500 a . for e. coli , there were 1 and 4 log10 cfu / cm reductions in biofilm formation with 12 and 24 hours of exposure to 500 a , respectively ; a similar but smaller effect was observed with 200 a , with a 4 log10 cfu / cm reduction observed with 48 hours of exposure . for p. aeruginosa , a 1 log10 cfu / cm reduction in biofilm formation was observed with 4 hours of exposure to 500 a or 36 hours of exposure to 200 a , with a 4 log10 cfu / cm reduction being observed after 24 hours of exposure to 500 a . overall , significant reductions in biofilm formation were observed using 500 a for at least 12 hours ( p = 0.0495 ) and 200 a for at least 36 hours ( p < 0.05 ) for all four bacteria studied . significant differences in amounts of planktonic cells were observed using 500 a for at least 12 hours ( p = 0.0495 ) and 200 a for at least 36 hours ( p = 0.0495 ) for all four bacteria studied . since dc reduced s. epidermidis , s. aureus , e. coli , and p. aeruginosa biofilm formation on teflon discs , we next tested whether this effect would be observed with yeast and an anaerobic bacterium on teflon discs , as well as with s. epidermidis and e. coli on titanium discs . a 3 log10 cfu / cm reduction in c. albicans biofilm formation on teflon discs was detected after 24 hours of exposure to 500 a dc ( figure 3 ) . there was no reduction in p. acnes biofilm formation with 48 hours of exposure to 500 a dc ( figure 4 ) , although there was a 1 log10 cfu / ml reduction in planktonic p. acnes with exposure to 500 a dc for 24 hours . a 3 log10 cfu / cm reduction in s. epidermidis biofilm was observed with 24 hours of exposure to 500 a ( figure 4 ) . 1 and 2 log10 cfu / cm reductions in e. coli and s. epidermidis biofilm formation on titanium discs , respectively , were observed with 12 hours of exposure to 500 a ( p = 0.0495 ) . a 1 log10 cfu / cm reduction in biofilm formation was observed for both e. coli and s. epidermidis on titanium discs with 24 hours of exposure to 200 a ( p = 0.0495 ) . the overall magnitude of the effect observed with titanium and teflon discs was similar for both bacteria , although e. coli ( means of 5 versus 6 log10 cfu / cm , p = 0.0009 ) but not s. epidermidis ( p = 0.0765 ) formed slightly less biofilm on untreated titanium than teflon discs . results of these studies demonstrate that dc reduces staphylococcus species , e. coli , p. aeruginosa , and c. albicans biofilm formation . since these microorganisms are frequently involved in biofilm - associated infections , these findings are of potential clinical interest . although our results are consistent with previous data showing a bactericidal effect of dc against sessile and planktonic cells [ 22 , 25 , 26 , 34 ] , previous studies have focused on treatment of established biofilms . our results provide evidence that dc can reduce biofilm formation by staphylococci , gram - negative bacilli , and candida species . overall , a reduction in biofilm formation was measureable within 12 hours of application of 500 a dc ; when applying 200 a of dc , an effect was observed after 36 hours of current application . dc may reduce the formation of biofilms by preventing adherence of bacterial cells to surfaces , through augmentation of the noncovalent forces between organisms , and in our study teflon and titanium discs . however , the decrease in the observed planktonic cell population suggests that there may be additional active mechanisms . direct damage from dc to bacteria or yeast by electroporation and/or production of reactive oxygen species , as well as generation of other toxic substances , has been proposed . chlorine has been identified as a toxic substance that plays a role in the bactericidal effect of electrical current against established biofilms . the absence of an effect against p. acnes biofilm formation may be explained by the involvement of reactive oxygen species in the mechanism underlying the antibiofilm activity of electrical current . the contribution of reactive oxygen species to this process is also supported by the decreased effect observed under anaerobic conditions with s. epidermidis . differences in bactericidal effect have been described when using different electrode materials ; we observed less antibiofilm effect when using stainless steel compared with platinum electrodes ( data not shown ) . although most of our experiments were performed using teflon discs , we demonstrated a similar effect using titanium discs , which is of clinical relevance since titanium is used in the construction of orthopedic implants . further investigation is needed to determine the appropriate dose and time of administration of dc for reduction of biofilm formation . future work could explore the capacity of cells to adhere to a surface that has been previously exposed to electrical current and intermittent dc administration . overall , our results demonstrate that biofilm formation can be reduced using low dose dc . potentially , this strategy could be used during surgery to prevent early infection and contamination of newly implanted foreign bodies .

new strategies are needed for prevention of biofilm formation . we have previously shown that 24 hr of 2,000 a of direct current ( dc ) reduces staphylococcus epidermidis biofilm formation in vitro . herein , we examined the effect of a lower amount of dc exposure on s. epidermidis , staphylococcus aureus , escherichia coli , pseudomonas aeruginosa , propionibacterium acnes , and candida albicans biofilm formation . 12 hr of 500 a dc decreased s. epidermidis , s. aureus , e. coli , and p. aeruginosa biofilm formation on teflon discs by 2 , 1 , 1 , and 2 log10 cfu / cm2 , respectively ( p < 0.05 ) . reductions in s. epidermidis , s. aureus , and e. coli biofilm formation were observed with as few as 12 hr of 200 a dc ( 2 , 2 and 0.4 log10 cfu / cm2 , resp . ) ; a 1 log10 cfu / cm2 reduction in p. aeruginosa biofilm formation was observed at 36 hr . 24 hr of 500 a dc decreased c. albicans biofilm formation on teflon discs by 2 log10 cfu / cm2 . no reduction in p. acnes biofilm formation was observed . 1 and 2 log10 cfu / cm2 reductions in e. coli and s. epidermidis biofilm formation on titanium discs , respectively , were observed with 12 hr of exposure to 500 a . electrical current is a potential strategy to reduce biofilm formation on medical biomaterials .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

the rising tide of obesity continues to be a major concern of public health in the usa and worldwide . the prevalence of obesity , defined usually by a body mass index ( bmi ) of 30 kg / m , has increased substantially from 13.3% during 19601962 to 33.8% during 2007 - 2008 among us adults [ 13 ] with noticeable differences between men and women ( 32% versus 36% in 2007 - 2008 ) . in addition to its substantial impact on physical health ( i.e. , obesity - related chronic conditions ) , obesity is also associated with increased risks of psychiatric or mental disorders such as depression , anxiety , mania , panic attacks , and social phobia in both men and women [ 48 ] . with regard to suicidal behaviors and suicide mortality , a vast majority of previous studies including large , prospective cohort studies have shown that among men , bmi is inversely associated with suicidal ideation , suicide attempt , or suicide death and thus provides protection from suicide mortality [ 4 , 913 ] . although the mechanism underlying the inverse relationship remains unknown , evidence suggests that low levels of blood cholesterol and markers of insulin sensitivity in lean men may interfere with circulating tryptophan metabolism and brain serotonin production , thereby increasing the risk for suicide attempts and suicide death [ 1417 ] . among women , a longitudinal follow - up study using the national health interview survey linked mortality data reported that for a 5 kg / m increase in bmi , the relative risk of suicide death decreased by 24% after controlling for sociodemographics , region of residence , number of chronic conditions , number of psychiatric conditions , activity limitation , and self - rated health . however , the national longitudinal alcohol epidemiologic survey study showed that a 10 kg / m increase in bmi was associated with 22% increased likelihood for past - year suicidal ideation among adult us women after controlling for sociodemographics , lifetime disease history , and substance use . another study conducted on canadian women also reported that obesity was associated with increased likelihoods of lifetime and past - year suicidal ideation and suicide attempts when controlling for age , education , psychiatric disorders and comorbidity , and physical illness burden assessed as charlson comorbidity index . thus , the associations between bmi and suicidal behaviours or suicide death among women remain uncertain . moreover , in the previous studies , only bmi as an indicator of overall obesity was evaluated ; the association between abdominal obesity and suicidal behaviors is largely unknown . to further shed light on these issues , the present study , by using a large nationally representative sample , aimed to ( 1 ) examine the prevalence of suicidal ideation among us adult women across quartiles of bmi , a measure of overall obesity , and across quartiles of waist circumference and waist - height ratio ( whr ) , measures of abdominal obesity , and ( 2 ) examine the associations of bmi , waist circumference , and whr with suicidal ideation while controlling for multiple potential confounders including sociodemographic characteristics , lifestyle - related behavioral risk factors , obesity - related chronic physical conditions , and current depression status , most of which have been included as covariates in the previous studies [ 6 , 10 , 18 ] . we hypothesized that a positive association may exist between abdominal obesity and suicidal ideation as well as between overall obesity and suicidal ideation independent of behavioral risk factors , obesity - related chronic physical conditions , and current depression status among us women . we analyzed data from the national health and nutrition examination survey ( nhanes ) 20052008 , a nationally representative sample obtained using a multistage stratified sampling design from the noninstitutionalized civilian us population . survey participants were initially interviewed at home and were then invited to a mobile examination center , where they received various examinations and provided blood samples for laboratory tests . all procedures involving human subjects were reviewed and approved by the research ethics review board of the national center for health statistics at the centers for disease control and prevention . written informed consent was obtained from all participants . we examined interview data from women aged 20 years who attended the mobile examination center . weight was measured in pounds on a toledo digital scale with participants only wearing underwear , disposable paper gowns , and foam slippers . waist circumference was measured at a point immediately above the iliac crest on the midaxillary line at minimal respiration to the nearest 0.1 cm . waist - height ratio ( whr ) was calculated from measured waist circumference ( cm ) and height ( cm ) . the quartiles of bmi , waist circumference , and whr were created based on their distributions among women aged 20 years after taking into account the sampling weights . suicidal ideation was assessed using the 9th item of the patient health questionnaire-9 ( phq-9 ) [ 20 , 21 ] , which has been used widely to assess suicidal ideation in psychiatric research [ 2226 ] . specifically , participants were asked about how often over the previous two weeks they had been bothered by thoughts of being better off dead or of hurting themself in some way . their response options were categorized as ( 1 ) not at all , ( 2 ) several days , ( 3 ) more than half the days , and ( 4 ) nearly every day . participants with an affirmative response to the options ( 2 ) to ( 4 ) were defined as having suicidal ideation . sociodemographic variables in the analyses included age , sex , race / ethnicity ( non - hispanic white , non - hispanic black , mexican american , and other race ) , educational status ( < high school diploma , high school graduate , and > high school diploma ) , marital status ( married or living with a partner , divorced / widowed / separated , and never married ) , and family poverty - income ratio ( calculated as a ratio of family income to poverty threshold and categorized as < 1.0 , 1.0<3.0 , 3.0 ) . health - related behavioral risk factors included smoking , physical activity , and alcohol use , which were assessed based on participants ' self - reports . for smoking , participants were asked if they had smoked at least 100 cigarettes in their entire life and if they were smoking cigarettes now . participants were then categorized as current smokers ( those who had smoked at least 100 cigarettes during their lifetime and were still smoking ) , former smokers ( those who had smoked at least 100 cigarettes during their lifetime but stopped ) , and never smoked ( those who had smoked less than 100 cigarettes during their lifetime ) . physical activity was assessed by asking participants whether , over the past 30 days , ( 1 ) they had engaged in specific moderate or vigorous leisure - time activities , ( 2 ) they had walked or bicycled as part of getting to and from work , or school , or to do errands ( transportation activities ) , and ( 3 ) they had done any tasks in or around their home or yard for at least 10 minutes that required moderate or greater physical effort ( household activities ) . if a confirmative answer of yes was recorded , participants were then asked about how many times and the average duration each time they engaged in the activities over the past 30 days . based on the metabolic equivalent task ( met ) score for specific activities , we calculated the average daily metabolic equivalent - hour index ( met - hr / day ) that summed transportation , household , and leisure - time physical activity and participants were then dichotomized as physically active ( met - hr / day > 0 ) and inactive ( met - hr / day = 0 ) . alcohol consumption was assessed by asking respondents how many days per week or per month they had had at least 1 drink ( equivalent to a 12-ounce beer , a 5-ounce glass of wine , or a drink with 1 shot of liquor ) of any alcoholic beverages during the past 30 days and how many drinks they had on average on the days when they drank . we calculated the average number of daily drinks , and participants were then dichotomized as having excessive drinking ( > 1 drink / day ) and not ( 1 drink / day ) . chronic conditions included hypertension , diabetes , coronary artery disease ( i.e. , coronary heart disease , angina pectoris , or heart attack ) , congestive heart failure , stroke , arthritis , asthma , chronic bronchitis , emphysema , thyroid problem , liver disease , renal disease or renal failure , sleep disorders , disability , and cancer . most of the conditions were assessed by asking participants whether they had ever been told by a healthcare professional that they had these conditions or whether they still had asthma , chronic bronchitis , thyroid problem , or liver disease at the time when the survey was conducted . mean systolic and diastolic blood pressures were calculated as the average of the last two readings of systolic or diastolic blood pressure for participants who had three measurements , as the last reading for participants who had two measurements , and as the only reading for participants who had one measurement . participants who were on antihypertension medications or had systolic blood pressure of 140 mmhg or diastolic blood pressure of 90 mmhg were defined as having hypertension . disability status was assessed by asking participants whether ( 1 ) they were limited in any way in any activities including limitations from working and walking or experiencing confusion / memory problems because of physical , mental , or emotional problems and ( 2 ) they were required to use special equipments such as a cane , a wheelchair , a special bed , or a special telephone because of any health problem . participants with an affirmative response to either question were defined as having a disability . the number of the above chronic conditions was summed and participants were defined as having none of the conditions , 1 - 2 conditions , or 3 conditions . current depressive symptoms were assessed using the items 1 to 8 of the phq-9 , which has been shown to provide a valid measure of depressive symptoms and severity in the general population . briefly , participants were asked about symptoms of depression they experienced in the past 2 weeks , which included little interest or pleasure in doing things ; feeling down , depressed , or hopeless ; trouble falling asleep , staying asleep , or sleeping too much ; feeling tired or having little energy ; a poor appetite or eaten too much ; feeling bad as a failure or letting self or family down ; trouble concentrating on things such as reading the newspaper or watching tv ; and moving or speaking too slowly , or moving around a lot more than usual because of being so fidgety or restless . a total depression score was calculated as described elsewhere [ 7 , 28 , 29 ] ; participants with a score of 10 were defined as having current depression . the prevalence of suicidal ideation was estimated and age - standardized to the 2000 female population in the usa the regression coefficient ( ) , odds ratio ( or ) , and 95% confidence interval ( ci ) for having suicidal ideation were estimated by conducting logistic regressions using each obesity indicator ( bmi , waist circumference , and whr ) as a predictor while controlling for covariates including sociodemographic characteristics , lifestyle - related behaviors , chronic conditions , and current depression . a body of evidence has shown that obesity is associated with a variety of risky lifestyle behaviors ( such as physical inactivity and alcohol use ) and health outcomes ( such as obesity - related chronic physical conditions and mental disorders ) [ 7 , 8 , 3037 ] . on the other hand , the sociodemographic factors , risky lifestyle behaviors , stressful life events including severe chronic or terminal illness , and psychiatric and psychological factors are important risk factors related to suicidal ideation or suicidal behaviors [ 3841 ] . therefore , we included these variables as study covariates in our analyses ; similar covariates have also been used in the previous studies . trends in the prevalence of suicidal ideation were tested using orthogonal contrasts , and the trends in the ors were tested using the median values for the quartiles of bmi , waist circumference and whr in logistic regression models . sudaan ( software for the statistical analysis of correlated data , release 9.0 , research triangle institute , research triangle park , nc ) was used to account for the complex sampling design . among 5,399 female participants aged 20 years , exclusions included pregnant women ( n = 382 ) and women with missing values for suicidal ideation ( n = 537 ) , bmi ( n = 94 ) , waist circumference ( n = 307 ) , or whr ( n = 310 ) . after further excluding those who had missing values for study covariates , 3,732 nonpregnant women ( median age : 46 years ) remained in our analyses . approximately 73.7% were non - hispanic white , 10.8% non - hispanic black , 6.7% hispanic , and 8.8% other racial / ethnic participants . about 59.3% attained an educational level of greater than a high school diploma , 61.8% were married or living with partners , and 52.2% had a poverty - income ratio of 3.0 . the percentages of women with unhealthy lifestyle behaviors were 20.6% for current smoking , 19.5% for physical inactivity , and 6.8% for excessive alcohol drinking . in addition , 39.8% reported having 1 - 2 chronic conditions , 23.1% reported having 3 of chronic conditions , and 8.2% reported having current depression . overall , the unadjusted and age - adjusted prevalence of suicidal ideation was 3.1% ( 95% ci : 2.53.8% ) and 3.0% ( 95% ci : 2.43.8% ) , respectively ( table 1 ) . the prevalence of suicidal ideation was the lowest in non - hispanic white women or in women who had an educational level of > high school diploma , who were married or living with partners , or who had a poverty - income ratio of 3.0 among their respective categories ( bonferroni corrected p < 0.05 for all ) . however , the prevalence was significantly higher in women with poor health behaviors ( p < 0.05 for all ) , chronic conditions ( p < 0.01 ) , or current depression ( p < 0.01 ) compared to their counterparts ( table 1 ) . the means of the obesity indicators were 28.5 kg / m for bmi , 94.4 cm for waist circumference , and 0.58 for whr among study participants . the age - adjusted prevalence of suicidal ideation increased linearly with increasing quartiles of bmi , waist circumference , and whr ( p for linear trend < 0.01 for all ) ( figure 1 ) . similarly , the unadjusted ors for suicidal ideation also increased linearly across quartiles of bmi , waist circumference , and whr ( p < 0.01 for all , model 1 , table 2 ) . adjustment for sociodemographic variables and lifestyle - related behavioral factors had little effects on these ors ( model 2 ) . after further adjustment for either chronic conditions ( model 3 ) or current depression ( model 4 ) , the positive associations of waist circumference and whr with suicidal ideation were attenuated but remained statistically significant ( p < 0.05 ) . however , when adjusting simultaneously for both chronic conditions and current depression ( model 5 ) , the strength of the associations was reduced substantially . the association of bmi with suicidal ideation was attenuated after further adjustment for either chronic conditions or current depression or both ( models 35 ) . these similar patterns persisted when continuous bmi , waist circumference , and whr were entered in the models ( table 3 ) . to our knowledge , our study is the first to examine the associations between anthropometric indicators for obesity and suicidal ideation among women in a large , population - based , nationally representative sample . although our study demonstrated a significantly increasing trend in the prevalence of suicidal ideation with increasing levels of the three indicators for obesity , the associations between obesity and suicidal ideation seem to be confounded by having chronic conditions or current depression , either individually ( for the association between bmi and suicidal ideation ) or jointly ( for the associations between waist circumference and whr and suicidal ideation ) . suicide is one of the leading mental health problems in the world with enormous consequence [ 42 , 43 ] . from 19901992 to 20012003 , the prevalence of suicidal ideation , plans , or attempts did not vary much in the us population despite a dramatic increase in treatment . in 2007 , suicide accounted for more than 34,000 deaths and was the 11th leading cause of death in the united states . regarding suicidal ideation , results of previous studies showed that the lifetime prevalence of suicidal ideation was 15.6% in the adult us population . a recent study showed that about 3.7% of us adults ( 3.5% of men and 3.9% of women ) reported having suicidal thoughts in the past year . our study further revealed that about 3.0% of us women reported having suicidal ideation in the past 2 weeks . multiple risk factors for suicidal ideation or suicidal behaviors have been reported including sociodemographic factors ( such as younger age , being female , less educated , and not being married ) , dsm - iv disorders ( such as anxiety disorders , mood disorders , impulse - control disorders , depression , and substance abuse ) , chronic physical conditions ( such as disability , chronic physical pain , terminal illness , and life - threatening diseases ) , some medications , and firearm ownership [ 24 , 26 , 3941 , 4648 ] . previous studies exploring the relationships between bmi and risk of suicide mortality or suicidal behaviors among women have yielded mixed results [ 6 , 10 , 18 ] . this may have resulted from different study settings with different outcomes assessed ( the risk of suicide death versus lifetime or past - year suicidal ideation or suicidal attempts ) and different covariates adjusted for . the present study provides further evidence that a high bmi level was associated with an increased likelihood for suicidal ideation among us adult women independent of sociodemographic variables and lifestyle risk factors ; however , this positive association no longer existed after taking into consideration the chronic conditions or current depression status as demonstrated in the present study . importantly , our results also showed that both chronic conditions and current depression were significantly associated with suicidal ideation . thus , the previously reported association between bmi and suicidal ideation may have been confounded by existence of obesity - related chronic conditions or depression , which deserves further investigation . the strength of the present study is that we were able to simultaneously assess the relationships between abdominal obesity as measured by waist circumference and whr and suicidal ideation . abdominal obesity has been shown to be associated with impaired health , impaired quality of life , and psychiatric disorders [ 5 , 8 , 49 , 50 ] . however , results of a previous study showed that waist - hip ratio was not a predictor of suicide mortality among 46,755 male participants in the health professionals follow - up study . results of the present study demonstrated that both waist circumference and waist - height ratio were positively associated with suicidal ideation among us adult women irrespective of having either chronic conditions or current depression ; however , as shown for bmi , these associations appeared to be confounded jointly by chronic conditions and current deperssion . studies have shown that both physical conditions and mental disorders are associated with higher risks for suicidal ideation or suicidal behaviors [ 40 , 5156 ] . our findings that the associations between obesity indicators ( i.e. , bmi , waist circumference , and waist - height ratio ) and suicidal ideation diminished in the present study after controlling for either chronic conditions or current depression or both suggest that impaired physical health or mental disorders may have individually ( for overall obese women ) or jointly ( for abdominally obese women ) contributed to an increased risk for suicidal ideation among obese population . first , suicidal ideation was assessed based on self - report of a single item on the phq-9 and thus subject to recall bias . second , although we have included a number of physical chronic conditions in our analyses , the severity of each individual chronic condition was unknown , so we were unable to weigh differently the impact of a specific chronic condition on the association between obesity indictors and suicidal ideation . third , we assessed the potential role of current depression in confounding the relationship of obesity with suicidal ideation in the present study ; however , we were unable to evaluate the possible effects of other psychiatric disorders , antipsychotic medication use , emotional functioning , social support , and family history of suicidal behaviors on the association due to lack of data . finally , potentially protective factors including life satisfaction , social support , and coping were not assessed either . in conclusion , our results from this large , population - based study suggest that depression and chronic physical conditions may explain much of the association between obesity and suicidal ideation among us adult women . although the exact mechanisms mediating the association between obesity and suicidal ideation remain to be elucidated , results from the present study may have important implications for preventing suicidal ideation . our findings suggest that combined intervention programs targeting obesity management and the prevention / treatment of obesity - related physical chronic conditions and depression may help to reduce the prevalence of suicidal ideation and ultimately reduce risk of suicide mortality . currently , obesity among us adults is a major public health concern after decade of increase in its prevalence [ 2 , 57 , 58 ] . thus , efforts on screening and assessing obesity - related physical and mental disorders may provide useful information for preventing suicidal behaviors in this population .

obesity is associated with increased risks for mental disorders . this study examined associations of obesity indicators including body mass index ( bmi ) , waist circumference , and waist - height ratio with suicidal ideation among u.s . women . we analyzed data from 3,732 nonpregnant women aged 20 years who participated in the 20052008 national health and nutrition examination survey . we used anthropometric measures of weight , height , and waist circumference to calculate bmi and waist - height ratio . suicidal ideation was assessed using the item 9 of the patient health questionnaire-9 . odds ratios with 95% conference intervals were estimated using logistic regression analyses after controlling for potential confounders . the age - adjusted prevalence of suicidal ideation was 3.0% ; the prevalence increased linearly across quartiles of bmi , waist circumference , and waist - height ratio ( p for linear trend < 0.01 for all ) . the positive associations of waist circumference and waist - height ratio with suicidal ideation remained significant ( p < 0.05 ) after adjustment for sociodemographics , lifestyle - related behavioral factors , and having either chronic conditions or current depression . however , these associations were attenuated after both chronic conditions and depression were entered into the models . thus , the previously reported association between obesity and suicidal ideation appears to be confounded by coexistence of chronic conditions and current depression among women of the united states .

1. Introduction 2. Subjects and Methods 3. Statistical Analysis 4. Results 5. Discussion

although the widespread use of recombinant human insulin and human insulin analog in patients with diabetes has greatly reduced the incidence of insulin allergy13 , cases with insulin allergy continue to occasionally present in the clinic . insulin allergies are varied and can be local or systemic , as well as immediate or delayed1,4 . we report herein the case of a patient with type 2 diabetes who showed skin rash , marked eosinophilia and progression of renal dysfunction after insulin therapy . she was intermittently treated with oral hypoglycemic agents and had not been monitoring her blood glucose . the treatment with insulin aspart 30 ( novo nordisk , bagsvaerd , denmark ) started when she was admitted to the neurology department at nanjing medical university affiliated wuxi people 's hospital , jiangsu wuxi , china , because of cerebral infarction . three weeks later , she noticed a red itchy rash occurring several hours after insulin injection at the injection sites , but neither treatment for the skin lesions nor insulin cessation was practiced . two months later , for management of her condition , she was admitted to the endocrinology department . she had a 50-year history of hypertension leading to renal complication ( urinalysis white blood cells [ wbc ] 0/l , red blood cells 3.2/l , protein ( + ) ; serum urea 12.7 mmol / l ; serum creatinine 203.3 mol / l before insulin injection ) . there was no history of drug - induced or alimentary allergy . at the time of admission , the patient had an intradermal induration ranging from 1 cm to 3 cm in diameter at the insulin injection sites . her laboratory data showed : peripheral blood wbc 8,900/mm , eosinophils 9.0% ; fasting blood glucose 132.5 mg / dl ; glycated hemoglobin 10.9% ( 96 mmol / mol ) ; urinalysis wbc 283.2/l , red blood cells 25.9/l , protein ( + ) , glucose ( ) , ketone ( ) ; negative urine culture ; 24 h urine protein 0.36 g ; serum urea 14.8 mmol / l ; serum creatinine 250.5 mol / l . after admission , blood sugar was controlled by subcutaneous injection of insulin aspart 30 . on day 3 , insulin aspart 30 was replaced by human insulin 30r ( novo nordisk , bagsvaerd , denmark ) because of the continuous emergence of a new rash at the insulin injection site . then , the rash began to subside with oral ketotifen and topical corticosteroid ointment . however , biochemistry suggested a gradual deterioration of renal function . on day 9 , there erupted similar skin lesions at the insulin injection sites , and laboratory data at that time showed progression of renal function ( serum urea , 25.0 mmol / l ; serum creatinine , 362.5 mol / l ) and marked eosinophilia ( wbc 10,600/mm , eosinophils 15.4% ) , so human insulin 30r was discontinued , and repaglinide ( 6 mg / day ) treatment were initiated , as well as intravenous injection of dexamethasone ( 5 mg / day ) . on day 11 , skin lesions began to disappear , and eosinophils decreased to 0.10% , but renal function ( serum urea , 29.5 mmol / l ; serum creatinine , 379.9 the skin lesions disappeared completely , the eosinophils were maintained in the normal range and serum creatinine began to decline , so dexamethasone was stopped . on day 23 , renal function ( serum urea 14.4 mmol / l ; serum creatinine 238.9 mol / l ) returned to a similar level to that before insulin therapy ( table 1 ) . during hospitalization , immunological tests showed that antinuclear antibody , anti - extractable nuclear antigen antibody spectrum , anti - proteinase 3 antibody , anti - myeloperoxidase antibody and anti - glomerular base membrane antibody were negative , and immunoglobulin ( ig ; iga , igm , igg ) , complement ( c3 , c4 ) , c - reactive protein and rheumatoid factor were within the normal range . ige specific for human insulin was < 0.35 ua / ml . with the patient 's consent , skin prick tests were carried out after her renal function recovered . the results showed that protamine caused a skin reaction , whereas short - acting human insulin ( insulin r ) or insulin analog ( aspart ) did not . laboratory data after admission of the patient two months later , the patient consulted our hospital as an outpatient . laboratory data showed : peripheral blood wbc 7,900/mm , eosinophils 1.0% ; urinalysis wbc 17.1/l , red blood cells 4.3/l , protein ( ) , glucose ( ) , ketone ( ) ; serum urea 6.6 mmol / l ; serum creatinine 235.3 mol / l ; fasting blood glucose 128.7 mg / dl ; glycated hemoglobin 10.1% ( 87 mmol / mol ) ; and serum c - peptide 7.71 ng / ml ( fasting ) , 9.25 ng / ml ( 2-h postprandial ) . according to the result of serum c - peptide , the patient 's endogenous insulin secretion was preserved with insulin resistance , and repaglinide was continued to control the blood sugar . recently , we acquired information that the patient had passed away , and before her death she was treated with a short - acting insulin without insulin allergy for half a year , which was provided by her family . because of that patient 's clinical features ( rash , urine wbc , eosinophilia , deterioration of renal function ) acute interstitial nephritis ( ain ) was suspected5 . after withdrawal of insulin and corticosteroid therapy , her renal function returned to basal . therefore , we concluded that renal dysfunction was induced by her insulin allergy . there is no relevant literature description , except a similar case reported by naqai et al.6 in 2001 . common characteristics of two cases were elderly patients , pre - existing kidney disease , parallel changes of renal dysfunction progression with eosinophilia and the key treatment of stopping insulin . we speculate that eosinophilia can be the signal of kidney damage induced by insulin allergy , and that old age and pre - existing kidney disease seem to be predisposing factors for this condition7 . in their case , naqai et al.6 confirmed the type of insulin allergy as immediate - type ige - mediated reactions by skin prick test and increased insulin - specific ige antibody . in the present case , because of patient 's insulin - specific ige and the skin prick test results , we speculated that protamine was the cause of her insulin allergy . this was further confirmed by the recent information that she was treated with a short - acting insulin without insulin allergy for half a year . renal pathology showed that cell - mediated immune mechanisms seemed to be more important than humorally - mediated mechanisms in the pathogenesis of ain5 . however , renal biopsy was not made in the present case , because of the patient 's refusal . because of a delayed onset after insulin injection and induration at the injection site , we tend to consider the type of insulin allergy in our case as delayed type hypersensitivity reactions8 .

an 87-year - old woman with type 2 diabetes noticed a red itchy rash at the insulin injection sites 3 weeks after initiation of premixed insulin therapy . laboratory data at that time showed marked eosinophilia and progression of renal dysfunction . insulin treatment was discontinued , and antidiabetic oral drugs were used , as well as intravenous injection of dexamethasone . her skin lesions disappeared , and both eosinophilia and renal dysfunction gradually improved . the results of skin prick tests and measurement of specific immunoglobulin e antibodies suggested that the insulin allergy was caused by protamine . although cases of insulin allergy associated with renal dysfunction are rare , we must be aware , especially for elderly patients with poor renal function in the first application of insulin .

Introduction Case Report Discussion Disclosure

a 56-year - old gentleman presented under the surgical team with left upper quadrant pain and mild anemia ( hb 11.2 gm / dl ) . he reported feeling well aside from intermitted left upper quadrant pain and denied any weight loss . he underwent a ct scan which showed a 10 10 9 cm rounded lesion within the spleen with small areas of central calcification ( fig.1 ) . there was no evidence of lymphadenopathy or any other neoplastic process from the ct scan . bone marrow biopsy showed active trilineage hemopoiesis without any evidence of lymphoma or other infiltrative neoplastic process . computed tomography ( ct ) . this showed paucicellular fibrosis with medium - caliber vessels embedded in fibrous tissue showing signs of obliteration and/or recanalization . he subsequently underwent splenectomy to characterize these splenic lesions as splenic biopsy itself was not completely diagnostic . resected spleen ( 175 110 95 mm ) weighed 578 g. it contained a central bulky stellate mass of white compact tissue ( 50 40 45 mm ) , surrounded by multiple poorly defined hard dark - brown nodules ( fig.2 ) . microscopically , the center of the lesion consisted of almost acellular hyaline , whereas the peripheries comprized macro - nodular aggregates of round angiomatoid structures , each composed of a chaotic meshwork of capillary - like vessels in the middle ( cd34 + , cd31 + , cd8 ) , rimmed by a band of collagen - rich connective tissue , and scant smooth muscle cells . the appearances were diagnostic for sclerosing angiomatoid nodular transformation of the spleen ( sant ) , a very rare entity first recognized in 2004 , distinct from much more frequent hamartomas and angiomas . in retrospect , features of this lesion were also seen in the core needle biopsy , which , however , was hardly diagnostic on its own . sclerosing angiomatoid nodular transformation was originally described in 2004 by martel et al 1 . radiologically , they present as solitary , round , lobulated mass which is centrally hypodense with peripheral - enhancing portions . contrast ct / mri scan shows heterogeneously hypo - enhancing lesion during arterial and venous phase with an early peripheral - enhancing radiating lines and delayed enhancement of the central area due to fibrous tissue . mri appearances on t1-weighted images have been described as spokes wheel pattern 3,4 . it is noted that these lesions are fdg - avid . in few reported cases where pet ct is employed , fdg - avid multiple splenic nodules with a prunes on bread appearance in the maximum - intensity - projection image ( mip image ) are seen . in sectional pet / ct images , a central cold area with peripheral increased fdg uptake in the splenic nodule immunostaining of the vessels simulate the composition of normal splenic red pulp and features are different from angioma , hemangioma of the spleen . myofibroblasts are highlighted within the nodules and endothelial lining cells are d2 - 40 negative supporting vascular over lymphatic origin . vessels in the angiomatoid nodular are the combination of three different types : capillaries ( cd34+/cd8/cd31 + ) , small veins ( cd34/cd8/cd31 + ) , and sinusoids ( cd34/cd8+/cd31 + ) . some cells in sant are cd68 + and sma+ 1,6 . differential diagnoses of splenic lesions include both benign and malignant disease . it is difficult to rule out other benign pathological conditions of the spleen such as inflammatory pseudotumor or hamartoma using imaging modalities . however , it may be possible to differentiate benign and malignant splenic lesions with a combination of clinical history and radiological modalities . asymptomatic patient with hyper echoic lesions point toward benign , whereas patients with systemic symptoms and hypo echoic lesions on the scan should point toward possible malignant etiology . however , nodular carcinomatous metastasis to spleen can not be sufficiently be diagnosed by imaging modalities alone . although histological examination of the spleen is always employed to give the diagnostic yield , there is a debate if one should be subjecting an asymptomatic patient through a surgical procedure to obtain diagnosis . there were diagnostic clues from splenic biopsy in our case , but the diagnosis of most of the published cases has been based on a splenectomy specimen . suggests that good core biopsy can be used to distinguish sant from other lesions . however , there is a worry about risk of intra peritoneal seeding if the lesion biopsied proves to be angiosarcoma and other complications such as splenic rupture and bleeding are noted with splenic biopsy . postulated that sant was a response to stromal proliferation and that the internodular zones were similar to inflammatory pseudotumor 1,7 . sant may represent a hamartomatous transformation of splenic red pulp in response to an exaggerated nonneoplastic stromal proliferation . in majority of cases , sant - like changes may be occasionally seen in vicinity of splenic metastases , but there was no evidence of any malignant / metastatic process in this case .

key clinical messagesclerosing angiomatoid nodular transformation ( sant ) of spleen is a very rare benign entity with unknown etiology . here , we report this unusual case in a fit middle - aged gentleman and discuss various diagnostic modalities along with the management of this condition .

Case Discussion Conflict of Interest

the british medical journal recently published a report by christensen and hoyer on prehospital tracheal intubation in severely injured patients . this retrospective observational study identified 220 severely injured patients ( injury severity score > 15 ) , who were treated by the anaesthesiologist staffed mobile emergency care unit in aarhus ( denmark ) over a period of 3 years ( 19982000 ) . a total of 172 patients were taken to the hospital , and 41% ( 74/172 ) of these were intubated before arrival . the majority ( 84% [ 62/74 ] ) of intubations were facilitated by anaesthesia ( hypnotics , analgesics and muscle relaxants ) , and 58% ( 36/62 ) of patients intubated in this manner survived for at least 6 months . this contrasted with only 8% ( 1/12 ) survivors among those patients who were intubated without administration of anaesthetics . the authors concluded the following from their data : endotracheal intubation in traumatized patients who do not require the use of anaesthetics should not be considered hopeless ; and ambulance personnel may be unable to master administration of anaesthesia and intubation in the prehospital setting ( a corresponding paper was published previously elsewhere by the same group ) . the work reported by christensen and hoyer lacks substantial supplemental information , making it difficult to appreciate how the authors drew their conclusions from the actual data presented in the article . the group of patients who received anaesthetics for intubation appears very heterogeneous , exhibiting large variations in glasgow coma scale and injury severity scores . therefore , differences in injury characteristics between the groups might have contributed , at least in part , to the differences in survival rates ( see the report by eckstein and coworkers for comments on the limitations of the injury severity score for characterizing a group of severely injured patients ) . additionally , it is difficult to appreciate why christensen and hoyer concluded that ambulance personnel may not be able to master anaesthesia and intubation in trauma patients , because their data were collected in a physician - based emergency care system . they relate their data to a previous study from the uk conducted by lockey and coworkers , which analyzed the survival of severely traumatized patients after out - of - hospital endotracheal intubation without the use of anaesthetics . this group , however , analyzed data from patients who were intubated by paramedics or by physicians at the scene . all but one of their patients eventually died before hospital discharge ( n = 486 ) but , in contrast to the suggestion by christensen and hoyer , lockey and coworkers attribute this adverse outcome to the severity of the sustained injuries rather than to the quality of care provided ( e.g. by the participating paramedics ) . giving credit to the limited empirical evidence , lockey and coworkers even question the current practice in the uk that allows paramedics to perform non - drug - assisted intubations only . however , the work by christensen and hoyer raises an interesting set of questions on the overall role of endotracheal intubation in out - of - hospital advanced trauma life support . is intubation actually beneficial , and what are the risks and benefits associated with this intervention ? should a physician perform the intubation ? finally , should severely injured patients , given their bad prognosis , be intubated at all ? there is broad consent that providing adequate oxygenation at all times is of paramount importance to the critically injured patient because hypoxaemia or , worse , asphyxia may result in secondary damage ( e.g. to the cardiovascular system or the brain ) . accordingly , control of the airway is given the highest priority in the current algorithms for trauma management . moreover , trauma victims are at risk for pulmonary aspiration of , for example , stomach contents or blood . as a consequence , early control of the airway by endotracheal intubation appears to be the best therapeutic approach , and indeed has been shown to improve outcome in critically injured patients [ 5 - 7 ] . invasive airway management at the scene is successfully performed in systems that supply physician staffed ambulances , and is considered a vital part of their advanced trauma life support [ 7 - 12 ] . some experts , however , argue that out - of - hospital intubation may be deleterious to traumatized patients who are not in respiratory distress , because of the risks involved ( e.g. airway trauma , oesophageal intubation , hazard to the cervical spine ) . moreover , they believe that intubation unnecessarily prolongs the time spent on - scene and that it does not improve long - term outcome [ 3,13 - 17 ] . however , there is little scientific evidence to support either opinion . most of the studies favouring prehospital endotracheal intubation of severely traumatized patients were conducted in out - of - hospital systems that rely on highly skilled personnel such as anaesthesiologists , emergency physicians , or specially trained nurses , mostly in continental europe or australia . in contrast , studies that do not support this approach rely on data from paramedic or emergency technician staffed services , mostly in the usa or the uk . there is no doubt that endotracheal intubation in the prehospital setting is more difficult and involves a higher risk for failure compared with in - hospital intubation . intubation may be particularly difficult in the severely but not fatally injured patient , who will fight laryngoscopy and gag or cough on passage of the endotracheal tube . these situations not only require additional skills and experience but also the use of anaesthetics and/or muscle relaxants . because both drugs may only be applied by physicians , it appears obvious that outcome may be influenced by the skills and training of the emergency personnel . specially trained physicians or appropriately skilled nonphysician care providers may actually be required at the trauma scene for patients to benefit from prehospital intubation . recent studies indeed support the idea that , for example , rapid sequence induction before endotracheal intubation can safely be administered by paramedics in the field [ 19 - 22 ] . invasive airway management requires sufficient training of personnel and immediate availability of appropriate salvage airway devices and monitoring . however , if adequate skills are not available , then critically traumatized patients may rather benefit from adequate ventilation using less invasive means ( e.g. bag valve mask ventilation if transport times are short ) . unfortunately , no study has yet related outcome to the availability of qualified personnel in the different prehospital emergency care systems . this might actually be very difficult because multiple issues must be considered , including manual skills , case load and continuing training opportunities for the providers , applicable guidelines for airway management , drug treatment options available and subsequent ventilation patterns , as well as access to prehospital emergency medical services and many other social and economic issues that could all affect outcomes after severe trauma . christensen and hoyer do not contribute to this discussion because their study was performed in a purely physician staffed medical system . a survival rate of only 0.2% in severely injured patients who could be intubated without anaesthetics is indeed very discouraging and appears to suggest that endotracheal intubation should be abandoned in this setting . christensen and hoyer reported a slightly better survival ( 8% [ 1/12 ] of patients ) and concluded that invasive airway management is not a hopeless intervention . however , given the small size of the nondrug intubation group ( n = 12 ) , it is difficult to conclude that the outcome is actually better than that reported by lockey and coworkers . regardless of this , the above - mentioned question relates to an extremely complex ethical problem , which must be addressed on broader grounds . from our perspective , the decision to provide or withhold a potentially life - saving treatment must be based on a thorough consideration of individual circumstances in every single case , although empirical data may help to reach this decision . even if survival seems unlikely , all appropriate means should be applied in the out - of - hospital setting to allow further diagnosis and treatment in a qualified trauma centre . at present we can only conclude that appropriate oxygenation is essential in any critically traumatized patient . the applied means of airway management should be based on the skills of the respective provider . it seems unlikely that prehospital endotracheal intubation by itself may influence outcome after severe trauma , because it mainly reflects the overall standard of prehospital medical care . a more important question might be whether intensive care ( e.g. optimal airway management and appropriate ventilation ) should already be started in the field and maintained during transport , which may indeed require the presence of a physician or another adequately skilled person at the scene . if such a system is considered desirable , then the benefits of early intensive care must be balanced against the increased costs of this service .

adequate oxygenation at all times is of paramount importance to the critically injured patient to avoid secondary damage . the role of endotracheal intubation in out - of - hospital advanced trauma life support , however , remains controversial . initiated by a recent observational study , this commentary discusses risks and benefits associated with prehospital intubation , the required personnel and training , and ethical implications . recent evidence suggests that comprehensive ventilatory care already initiated in the field and maintained during transport may require the presence of a physician or another adequately skilled person at the scene . benefits of such as service need to be balanced against increased costs .

Introduction Should endotracheal intubation be part of out-of-hospital advanced trauma life support? Must out-of-hospital intubation be performed by a physician to be beneficial? Should severely injured patients be intubated at all, given their poor prognosis? Conclusions Competing interests

dna single strands can hybridize to form higher - order functional structures , which include hairpins , triplexes , and quadruplexes [ 14 ] . the existence and physiological relevance of these secondary structures in vivo have been the subject of much controversy . however , several in vivo techniques have confirmed the presence of dna secondary structures in telomeres and regulatory regions of specific genes ( e.g. , bcl-2 , c - myc ) [ 58 ] . secondary structures may also serve as specific targets recognized by drugs , such as actinomycin d and piper , as well as transcription factors , such as sp1 , because of their topological variance from duplex watson - crick dna [ 9 , 10 ] . on account of their occurrence in regulatory regions and their structural peculiarity , functional dna structures may serve as biological microswitches for altering transcription by silencing or enhancing gene expression [ 11 , 12 ] . exercising control over gene expression by controlling the activation of these switches and/or introducing new switches in biological circuits could revolutionize medical research and offer new avenues of treating genetic disorders . for exercising such control , it is imperative to understand the factors affecting the mechanism of formation and maintenance of functional structures at a fundamental level . numerous fluorescent analogs of dna bases have been evaluated for examining the subtleties of dna transitions [ 1315 ] . locating an appropriate probe that could map the mechanistic aspects of transition of double stranded ( ds ) dna to single stranded ( ss ) secondary structure is a first step toward monitoring the formation of complex , higher - order structures since ssdna is an intermediate in the pathway to functional structures . in the following report , we present a comparative study of two deoxycytidine analogs , pdc and tc ( figure 1 ) , to evaluate their suitability as fluorescent reporter probes for dna transitions . the properties of pyrrolocytosine and the effects of base stacking and hydrogen bonding on its quantum yield in nucleic acids have been previously evaluated . based on this prior work , we reported the use of pdc to determine hairpin formation in short oligos ( 16 nucleotides ) . this result implied that pdc might be a useful probe for investigating more complex dna functional structures in detail . however , to overcome certain limitations of pdc , we also explored another recently characterized fluorescent base analog , tc. the tc has a quantum yield five - times greater than pdc ( qf = 0.30 for tc ) and a molar absorptivity maximum of 9000 m cm at 360 nm . the absorbance wavelength of tc is similar to pdc , which allows both to be easily distinguishable from dna . both of these fluorophores have been reported to be quenched , relative to the single strand , when base - paired with guanine , making it easy to determine when the dna is in the duplex form [ 17 , 19 ] . in addition , unlike pdc , tc has only minor variations in fluorescent properties caused by surrounding bases . however , like pdc , tc induces little or no changes in stability upon incorporation into dsdna . high quantum yield , retention of the original configuration of dna , and quenching when base - paired suggested that tc would be a useful fluorescent probe for mapping the transition of duplex dna to a functional dna structure spectroscopically . in this paper , we compare spectral properties of tc and pdc for use as reporters of dna conformation . the dna sequence used ( table 1 ) is known to form a cruciform structure in the cloning vector pbr322 under superhelical duress [ 21 , 22 ] . this sequence was chosen since the results from the work described here will provide a context for interpreting data in future studies of the pdc and tc incorporated into this supercoiled plasmid . hence the effect of supercoiling on functional structure formation and conformation can be potentially probed with these fluorescent bases . all dna oligonucleotides ( sequences shown in table 1 ) , including those incorporating pdc and tc , were obtained from midland certified reagent co. ( midland , tx , usa ) . all oligos were dissolved in te buffer ( 10 mm tris , 1 mm edta , ph 8) made from spectroscopic - grade reagents obtained from fisher scientific . purity of each oligo was assessed using agarose gels , which showed no other higher or lower molecular weight contaminations . cd and fdcd experiments were performed using a circular dichroism instrument ( model 202sf , aviv biomedical inc . lakewood , nj , usa ) and fluorescence lifetime measurements were conducted on a multifrequency cross - correlation phase and modulation fluorometer ( model k2 , iss inc . , champaign , il , usa ) . after ensuring the purity of the single - strand pdc , tc , and wildtype ( sspdc , sstc , and sswt ; the wt contains no fluorophore ) oligos , each was mixed with a slight molar excess of their complementary strand . this was heated to 80c for 20 minutes , and then cooled to room temperature to anneal strands . the double - strand oligo formation was confirmed by observing the difference in migration of ds- and ss - oligos on agarose gels and compared to a dna ladder of the known length . in addition , duplex was the only strand observed after staining with the sybr gold , which stains both ss- and dsdna . cd spectra were recorded using a quartz cuvette having an optical path length of 1 cm . all oligos analyzed were in 700 l volume at concentration of 0.35 m . wild - type oligos were analyzed to ensure that the signals were not modified by the fluorophores . each data point was averaged over an integration time of 1 s per nm . cd signals were collected from 25c to 90c over the range of 220 nm to 420 nm to check for any change in the global conformation of the single - stranded and double - stranded wt , pdc , and tc oligos . while performing cd scans , the total uv absorbance of each oligo was also collected . oligos analyzed were in a total volume of 70 l and at the concentration of 8.5 m . each fdcd scan was averaged over 15 seconds per nm in order to increase signal - to - noise ratio . the excitation wavelengths were from 300 nm to 420 nm at temperatures ranging from 25c to 90c . steady - state fluorescence spectra were analyzed for ss- and ds- ( wt , pdc , and tc ) oligos . all the oligos had concentration of 0.35 m in te buffer ( 10 mm tris , 1 mm edta , ph 8) . excitation scans were collected over the wavelength range of 220400 nm , with the emission wavelength fixed at 450 nm . emission spectra were taken over the wavelength ranging from 400 nm to 580 nm with the excitation wavelength fixed at 350 nm . the ss- and dswt oligos were used as a baseline signal and subtracted from the steady - state fluorescence data . fluorescence lifetime was measured for both ss- and ds - oligos using a frequency domain lifetime instrument . excitation wavelengths were 350 nm and 368 nm for pdc and tc , respectively . data were collected from 10240 mhz frequencies with 100 iterations at each frequency and 40 total frequencies from which the lifetimes were calculated . both the individual decays ( fitted to 2 components ) and average lifetimes are reported . in order to assure that no structural perturbations were introduced by insertion of the fluorophores in the oligos , changes in absorbance at 260 nm were monitored at varying temperatures to determine duplex melting temperatures as well as any transitions occurring in ssdna ( data not shown ) . the data indicated that the sswt , sspdc , and sstc undergo similar spectral changes with temperature , indicating no perturbations to the ss - structures after replacement of cytidine with pdc or tc. the absorbance for all ssdna increases by ~10% from 25c to 40c , signifying reorientation of the strands during melting . thus , introduction of either pdc or tc did not lead to the formation of any additional secondary conformation in ss - oligos as predicted based on the previous literature [ 17 , 19 ] . hence , pdc and/or tc could be used to investigate single- and double - stranded regions of dna functional structures . circular dichroism ( cd ) spectroscopy was also used to investigate whether the overall helical structural conformation of the dna might have been affected by the fluorophores ( figure 2 ) . our results , in agreement with melting data from absorbance and the literature , indicated that the fluorophores did not affect the structure of the duplexes or the manner in which they melted [ 17 , 23 , 24 ] . there were only negligibly small changes in the cd spectrum with temperature for ss - oligos , which indicated little structure at any temperature as compared to dsdna . the dsdna oligos showed considerable cd , consistent with the common global spectral features typical of b - dna . major changes in the cd signal of dsdna with respect to the temperature were observed at 245 nm , with relatively smaller changes that occurred at 280 nm . these cd spectra and their temperature dependence illustrated that the dna is not affected by replacing cytidine with pdc or tc. circular dichroism has been used for detecting the local environmental changes around pdc integrated into dna . however , the direct detection of cd by pdc or other base analogs is restricted to analogs that either have an absorbance far enough removed from the dna max of 260 nm to prevent spectral overlap or are incorporated into short dna sequences . in both cases , an alternative approach to direct cd observation is to use fdcd to study the local environment of the fluorescent base analog . since our previous data has sufficiently demonstrated that the replacement of deoxycytidine with either pdc or tc does not affect the original dna structure , we analyzed the fluorophores by fdcd to explore the local structural changes occurring around the base . in our studies , pdc - containing dna at concentrations up to 8.5 m did not show any fdcd signal over the temperature range of 25c to 90c , suggesting that pdc 's low quantum yield is insufficient for fdcd measurements at reasonable dna concentrations with our instrument . however , tc showed a strong fdcd signal for both ss- and dsdna between 300 nm and 420 nm even at submicromolar concentrations ( 0.5 m ; figure 3 ) . the fdcd signal for duplex dna was significantly larger than that for the ss oligo . in addition it had a positive value throughout , indicating the base was stacked parallel to the bases in the vicinity . the lower intensity of the peak in ss - oligos is attributed to the residual structure at room temperature . thus , tc is a very effective probe for monitoring the localized changes occurring in dna structure in response to variations in structural parameters . fdcd data obtained can be used for predicting the molecular details of higher - order secondary structures . for example , in case of loop regions of i - motif and cruciform structures , tc will exhibit lower fdcd signal since these regions are less structured . however , tc substituting for dc in the regions where base - pairing occurs should show higher fdcd signals . these structural details could then be used to assess the stabilities of functional dna structures after binding of transcription factors or drugs . fluorescence intensities of pdc and tc depend on their hydrogen bonding state , and decrease if the fluorophores are base - paired [ 17 , 19 ] . figure 4 clearly demonstrate this quenching of fluorescence for both pdc and tc in duplex dsdna versus unpaired ssdna . fluorescence intensities from ssdna to dsdna are lowered by approximately 60% and 40% for pdc and tc , respectively . figure 4 also shows the difference in the quantum yield of pdc and tc , with pdc exhibiting significantly lower fluorescence . both the fluorophores had an excitation maximum at 350 nm and an emission maximum of 450 nm that did not change in ssdna versus dsdna . these decreases in the fluorescence and the location of the maxima are consistent with the known literature [ 8 , 19 ] . like steady - state intensities , fluorescence lifetimes of pdc and tc decrease when they are paired to their complementary base [ 17 , 19 ] . since fluorescence lifetimes are independent of concentration , their decrease has the potential to be used for differentiating paired bases from unpaired , thus they can be used for deductively mapping functional dna structures . two lifetimes ( 1 , 2 ) were fit to the phase - modulation data . the weighted average of the two lifetimes , 1 and 2 , were calculated and reported as in table 2 . these weighted averages indicate that the lifetimes for tc decreased slightly ( 0.3 ns ) with respect to the strandedness . in contrast , pdc showed appreciable difference ( 1.9 ns ) between single and duplex oligos . these lifetime values are similar to those previously reported [ 17 , 19 ] . to unambiguously differentiate between the ss- and ds regions of the secondary structures , thus , the lifetime data indicates that pdc is a better choice than tc for assessing the strand base - pairing in dna via this methodology . similar to fdcd , lifetime measurements can facilitate the studies to observe differences between ss loop regions and ds regions in functional dna structures like i - motif and cruciforms , and hence aid the studies to investigate formation and stability of secondary structures . in this report , spectroscopic techniques were used to determine the appropriate fluorescent deoxycytidine analog for probing the transition of duplex dna into topologically distinct functional nucleic acid structures . rather , we suggest the two should be used in conjunction to obtain an overall description of changes to nucleic acid structure . while tc has a very good quantum yield that allows for fdcd analysis , it exhibits only minor changes in fluorescence lifetime between ss- or dsdna . pdc , on the other hand , undergoes a substantial decrease in the fluorescence lifetime when base - paired , but shows no fdcd signal at concentrations appropriate for most biochemical studies . hence , we conclude that to map the transition of duplex dna to other functional forms , both pdc and tc at concentrations up to 8.5 m can be used , depending on the structural information desired . we are now investigating spectral changes incurred by these probes , when they are contained within well - known functional dna structures , such as quadruplex and i - motif dna .

topological variants of single - strand dna ( ssdna ) structures , referred to as functional dna , have been detected in regulatory regions of many genes and are thought to affect gene expression . two fluorescent analogs of deoxycytidine , pyrrolo - dc ( pdc ) and 1,3-diaza-2-oxophenoxazine ( tc ) , can be incorporated into dna . here , we describe spectroscopic studies of both analogs to determine fluorescent properties that report on structural transitions from double - strand dna ( dsdna ) to ssdna , a common pathway in the transition to functional dna structures . we obtained fluorescence - detected circular dichroism ( fdcd ) spectra , steady - state fluorescence spectra , and fluorescence lifetimes of the fluorophores in dna . our results show that pdc is advantageous in fluorescence lifetime studies because of a distinct ~2 ns change between paired and unpaired bases . however , tc is a better probe for fdcd experiments that report on the helical structure of dna surrounding the fluorophore . both fluorophores provide complementary data to measure dna structural transitions .

1. Introduction 2. Materials and Methods 3. Results and Discussion 4. Conclusions

ileosigmoid knotting ( isk ) is a rare cause of closed - loop intestinal obstruction , which rapidly progresses to gangrene of involved gut segments . isk is a very unusual entity in western world , but is relatively common in asian , middle eastern and african nations . although the reported mortality rate in isk varies from 0 to 48% ( mean 35.5% ) , but isk with gangrene has a mortality rate [ 1 , 3 ] of 20100% . more than 330 cases in world and only 22 cases from india have been described so far in the literature as summarized in table i. it is still a diagnostic dilemma for surgeons all over the world and only 028% cases could be diagnosed preoperatively . x - ray abdomen can reveal large gas - filled loops of small and large bowels in the right mid and lower abdomen . computed tomography ( ct ) is the best diagnostic modality in clinching the diagnosis . a 51-year - old male was brought in our casuality in shock with history of abdomen pain and non - passage of flatus and stools for 24 h. his blood pressure was 78/56 mmhg and pulse rate was 112 min . abdomen was distended and tender . he was resuscitated , and x - ray of abdomen revealed multiple dilated gut loops as depicted in fig . 1 . ileum was wrapped around sigmoid colon making two complete turns with gangrene of sigmoid colon and ileum as depicted in fig . clamps applied on large gut and sigmoid colon removed followed by ileum , and end jejunostomy was done in view of haemodynamic unstability of the patient along with descending sigmoid colon anastomosis . the patient expired after 2 weeks despite exhaustive efforts due to complications of short bowl syndrome . figure 2:intraoperative picture showing ileal knotting around sigmoid colon resulting in gangrene of both . the isk is rare but life - threatening type of closed - loop intestinal obstruction . the exact mechanism of isk is still speculative . a long small bowel mesentery , long sigmoid mesocolon on a narrow pedicle and ingestion of high bulk diet after fasting are predisposing factors [ 1 , 6 ] . the ileal loops can twist around sigmoid colon in clockwise ( 60.963.2% ) or anticlockwise direction ( 36.839.1% ) . the knot is 360 in 52.9% , two 360 turns in 19.1% and three 360 turns in 5.9% cases . isk is seen predominantly in males ( 80.2% ) , with a mean age of 40 years ( 490 years ) . isk has been classified into four types as described in table 2 . in the present case , we have type ia knot ( most common variety ) with two 360 turns of ileum over sigmoid colon . atamanalp et al . in 2008 described a new classification of isk based on age , shock , associated chronic illness and shock as summarized in table 3 . pain abdomen ( 100% ) , abdomen distension ( 94100% ) , nausea and vomiting ( 87100% ) and shock ( 060% ) are usually present at admission [ 1 , 2 , 9 ] . x - ray abdomen reveals a large gas - filled loop of sigmoid colon in the right mid and lower abdomen . ct of abdomen can help to clinch the diagnosis in preoperative stage [ 1 , 2 ] . it can markedly reveal a dilated loop of sigmoid colon with loss of haustration and non - enhancing thinned out wall . the characteristic whirl sign ( twisted mesentery and bowel ) convergence of superior mesenteric vein towards knot and medial pointing of caecum are other suggestive findings . despite availability of various modern diagnostic tools in the present era 2b18.920.65sigmoid colonileumclockwiseanticlockwise3type 31.5ileocaecal segmentsigmoid colon4type 4undetermined table 3:new classification for isk c1c2ac2bc3ac3bc4ac4bc5c6a0d0one of a , d1two of a , d1at most 1 of a , d1two of a , d1at most 1 of a , d1two of a , d1s0s0s0s1s1s0s0s1g0g0g0g0g0g1g1g1g2c : class ; a ( age ) : a0 : under 60 years ; a1 : 60 years and older ; d ( associated disease ) : d0 : absent ; d1 : present ; s ( shock ) : s0 : absent ; s1 : present ; g ( bowel gangrene ) : g0 : absent ; g1 : present in the ileum or sigmoid colon ; g2 : in both segments . classification of isk [ 1 , 2 , 7 ] new classification for isk c : class ; a ( age ) : a0 : under 60 years ; a1 : 60 years and older ; d ( associated disease ) : d0 : absent ; d1 : present ; s ( shock ) : s0 : absent ; s1 : present ; g ( bowel gangrene ) : g0 : absent ; g1 : present in the ileum or sigmoid colon ; g2 : in both segments . exploratory laparotomy is the definite key to diagnose majority of these cases of diagnostic dilemma . the incidence rate of gangrene was paradoxically high ( 90.9% ) in cases who presented within 24 h of onset of their symptoms than those presenting after 24 h of their symptoms ( 57% ) as happened in the present case also . excision of gangrenous segment with end - to - end anastomosis of healthy bowel is the most acceptable surgical procedure in the literature [ 1 , 2 ] . a high index of suspicion is required for all these cases . in view of diagnostic dilemma and rapidly fatal course of disease , urgent exploratory laparotomy is the best answer for better outcome . while selecting the type of surgery , general condition of patient m.s . as the main and corresponding author certifies all authors that this paper is original and had not been sent to any other journal for publication . wish to state that as in this case report , no research work is conducted so institutional ethical committee involvement was not done . informed consent of the patient was taken , and he was acknowledged orally regarding the process and ensured that his identity will not be revealed anywhere .

ileosigmoid knotting ( isk ) is a rare cause of intestinal obstruction in which loops of ileum and sigmoid colon wrap around each other . it is very uncommon in western world when compared with the african and asian region . it is rapidly a progressive , fatal disease . early diagnosis and intervention is the key of better outcome . we are reporting a case of 51-year - old male who presented with shock within 24 h of onset of symptoms . exploratory laparotomy revealed isk causing gangrene of ileum and sigmoid colon . in view of haemodynamic unstability , end ileostomy was done after excising gangrenous segments . the patient expired after 2 weeks due to complications of short bowl syndrome . we are also tabulating all cases of isk reported in the literature till date .

INTRODUCTION CASE REPORT DISCUSSION CONFLICT OF INTEREST STATEMENT

cardiac resynchronization therapy ( crt ) is a well accepted therapy for patients with heart failure ( hf ) , left ventricular ( lv ) systolic dysfunction and qrs prolongation . previously , prospective , randomized trials demonstrated that crt improves quality of life ( qol ) , exercise capacity , lv systolic function , and decreases hospitalizations for hf . with longer follow - up , large randomized studies have now shown a reduction in mortality with crt in both mild and advanced hf . subgroup analyses of these trials have frequently identified qrs duration and morphology as independent predictors of outcomes . specifically , patients with left bundle branch block ( lbbb ) and more prolonged qrs duration ( 150 ms ) tend to have better response rates , whether measured by acute haemodynamics , reverse remodelling , or clinical outcomes . this has reinforced the concept that lv electrical delay or electrical dyssynchrony is an important factor for predicting benefit from crt . to investigate this further , we evaluated the relationship between such electrical delay defined by time interval from the first deflection on a surface ecg to local intrinsic activation at the lv stimulation site ( qlv ) and reverse remodelling in a prospectively designed substudy of the smart - av trial . details of the design and primary results of the smart - av study have been published previously . briefly , this was a multicentre , randomized trial of atrioventricular ( av ) optimization techniques among patients with advanced hf undergoing crt defibrillator implantation . a subset of 426 ( 50.4% ) of the 846 patients in smart - av was included in the qlv substudy . at the final lead positions , surface lead ii , right ventricular ( rv ) and lv egm were recorded simultaneously on paper strips at a sweep speed of 100 mm / s . qlv was measured by a blinded core lab with no knowledge of lead position or clinical outcomes . the qlv interval was measured in sinus rhythm and in the absence of pacing as the interval from the onset of qrs from the surface ecg to the first large positive or negative peak of the lv egm during a cardiac cycle with the resolution of 5 ms ( figure 1 ) . the amplitude of the first large peak needed to be > 50% of the amplitude of the largest peak in the same cardiac cycle . the qlv interval measured for every patient was reduced by 30 ms to account for the average variable latency ( or noise ) between the alignment of surface ecg and the egm channels in device programmers . core lab measurements were performed independently by two reviewers , and a sample of 15 egms were reviewed by both to assess reproducibility of the results . the calipers are aligned with the onset of qrs and peak of the left venticular electrogram . the qlv was calculated as 90 ms for the patient in ( a ) and 165 ms for the patient in ( b ) . the calipers are aligned with the onset of qrs and peak of the left venticular electrogram . the qlv was calculated as 90 ms for the patient in ( a ) and 165 ms for the patient in ( b ) . the primary endpoint of the smart - av trial was left ventricular end - systolic volume ( lvesv ) . secondary endpoints included left ventricular end - diastolic volume ( lvedv ) , lv ejection fraction ( ef ) , qol score , as assessed by the minnesota living with heart failure questionnaire , new york heart association ( nyha ) functional class and 6-min hall walk distance . all deaths , hf - related hospitalizations and emergency room visits were collected as defined previously . the echocardiographic endpoints were analysed blindly by a single echocardiography core laboratory unaware of group assignment . off - line software ( pro - solv version 3.0 or ge echo pac version 6.0 ) was used for measurements . two - dimensional - derived lv volumes were determined in the apical four and two chamber views by the biplane method of discs . in 84% of images , the apical two chamber view image quality was deemed excellent or good with respect to visualization of the anterior wall . intra- and inter - observer core lab reliability for lv volumes was evaluated in a sample of 20 images using lin 's concordance correlation coefficient ( lin 's ccc ) . for both lvedv and lvesv , excellent reliability was observed [ edv intraobserver : ccc = 0.981 95% ci : ( 0.9540.992 ) , edv interobserver : ccc = 0.981 95% ci : ( 0.9560.992 ) , esv intraobserver : ccc = 0.986 95% ci : ( 0.9660.994 ) , esv interobserver : ccc = 0.986 95% ci : ( 0.9640.994 ) ] . in addition to lv volumetric measurements , mechanical dyssynchrony was measured as the delay between the time of peak systolic velocity was achieved at basal septal and basal lateral segments . lifetime % biventricular ( biv ) pacing was determined from the device interrogation disc data collected from the 6-month visit , and was available for 375 ( 88% ) of the 426 patients in the substudy . since no difference was shown in primary or secondary outcomes between randomized treatment groups in the main study , data were pooled for the present analyses . the effect of qlv on crt response was evaluated using univariate and multivariate logistic regression models . stratified models and inclusion of qlv by subgroup interactions in multivariate analysis were utilized to assess for heterogeneity of effect . prespecified response metrics to crt included a > 15% reduction in lvesv , b and a > 10 points reduction in qol response from implant to 6 months . since no difference was shown in primary or secondary outcomes between randomized treatment groups in the main study , data were pooled for the present analyses . the effect of qlv on crt response was evaluated using univariate and multivariate logistic regression models . stratified models and inclusion of qlv by subgroup interactions in multivariate analysis were utilized to assess for heterogeneity of effect . prespecified response metrics to crt included a > 15% reduction in lvesv , b and a > 10 points reduction in qol response from implant to 6 months . the 426 patients included in the qlv substudy were typical of those undergoing crt for advanced hf , including predominately late middle aged males with a reduced ef and advanced hf . a summary of baseline clinical data is presented in table 1 . of note , none of these values differs from the larger full cohort included in the smart - av trial , other than a slightly shorter mean qrs duration in the substudy population ( 151 19 vs. 154 21 ms , p < 0.05 ) . table 1patient characteristics ( n = 426)age , years66 11gender ( male , % ) 66ischaemic heart disease ( % ) 59nyha functional class ( % ) i0 ii3 iii94 iv3lv ejection fraction ( % ) 26 7cardiac medications ( % ) ace / arb84 beta - blocker92 diuretic82 digoxin22ecg characteristics qrs duration ( ms)151 19 lbbb ( % ) 75 rbbb ( % ) 13 ivcd ( % ) 12baseline lvesv ( ml)128 62qol46 26values expressed as mean sd.ace/arb , angiotensin - converting enzyme inhibitor / receptor blocker . patient characteristics ( n = 426 ) values expressed as mean sd.ace/arb , angiotensin - converting enzyme inhibitor / receptor blocker . the qlv measurement was reproducible , as evidenced by a strong concordance among qlv reviewers in the sample of duplicate reviews evaluated . the median value for qlv in this population was 95 ms with inter - quartile range of 70120 ms . the programmed av delay varied depending on whether nominal ( 120 ms ) , smartdelay electrogram optimization or echocardiographic optimization was used . overall , the median sensed av delay was 120 ms with inter - quartile range of 120140 ms . these programmed parameters resulted in a very high rate of lifetime biv pacing during this study with a median of 98.4% ( 95.199.6% ) , which is higher than the 92% threshold often used to insure a maximal crt response . when separated at the median qlv , patients with longer qlv intervals had shorter programmed av delays [ median ( q1q3 ) : 120 ( 110130 ) vs. 120 ( 120140 ) , p = 0.016 ] and slightly higher percentages of biv pacing [ median ( q1q3 ) : 98.8% ( 94.899.7% ) vs. 97.9% ( 95.299.3% ) , p = 0.014 ] . when separated by the qlv median value ( 95 ms ) , lvesv , lvedv , ef , and qol responses all were significantly larger for patients with long vs. short qlv ( figure 2 ) . the responses for lvesv , lvedv , ef , and qol from baseline to 6 months all significantly increased with the increase in the qlv from the shortest quartile ( < 70 ms ) to the longest quartile ( > 120 ms ) ( figure 3 ) . specifically , changes in nyha class , 6-min hall walk distance and hf events are shown for each qlv quartile . although these relationships were only statistically significant for nyha , the largest response figure 2comparisons of the changes in left ventricular end - systolic volume , left ventricular end - diastolic volume , ejection fraction , and quality of life from implant baseline to 6 months for the two qlv groups separated by the median value . figure 3comparisons of the changes in left ventricular end - systolic volume , left ventricular end - diastolic volume , ejection fraction , and quality of life from implant baseline to 6 months for the qlv quartiles . the data were presented as median inter - quartile range ( box ) . table 2relationship of qlv with clinical outcomesqlv quartilesq1 : 070 ms ( % ) q2 : 7095 ms ( % ) q3 : 95120 ms ( % ) q4 : 120195 ms ( % ) total ( % ) overall p - valueq4 vs. q1 p - valuepatients with hf events15 ( 12.1)7 ( 7.1)7 ( 6.4)6 ( 6.3)35 ( 8.2)0.370.17nyha improved89 ( 73.0)79 ( 80.6)76 ( 71.0)77 ( 83.7)321 ( 76.6)0.040.04 no change33 ( 27.1)16 ( 16.3)30 ( 28.0)14 ( 15.2)93 ( 22.2 ) worsened0 ( 0.0)3 ( 3.1)1 ( 0.9)1 ( 1.1)5 ( 1.2)six minute walk delta52 11868 9150 10470 9359 1030.360.13 comparisons of the changes in left ventricular end - systolic volume , left ventricular end - diastolic volume , ejection fraction , and quality of life from implant baseline to 6 months for the two qlv groups separated by the median value . comparisons of the changes in left ventricular end - systolic volume , left ventricular end - diastolic volume , ejection fraction , and quality of life from implant baseline to 6 months for the qlv quartiles . relationship of qlv with clinical outcomes the overall response rates were 50% for lvesv and 60% for qol in this population , which is typical for response rate for these parameters to crt . the response rates increased progressively from the shortest quartile to the longest quartile of qlv for both lvesv ( 38.768.4% ) and qol ( 5072% ) criteria . it is noteworthy that the median value ( 95 ms ) was also the optimal cut - point for qlv based on roc analysis using the point on the curve closest to the upper left corner for both lvesv and qol . for lvesv endpoint , auc = 0.634 95% ci : ( 0.6070.660 ) p < 0.001 for test of ho : auc = 0.5 by equivalent wilcoxon test . the sensitivity and specificity at 95 ms cut - off were 0.63 and 0.61 , respectively . for qol endpoint , auc = 0.600 95% ci : ( 0.5730.627 ) p < 0.001 for test of ho : auc = 0.5 by equivalent wilcoxon test . the sensitivity and specificity at 95 ms cut - off were 0.58 and 0.60 , respectively . table 3the left ventricular end - systolic volume and qol response rates for the qlv quartilesqlvnlvesv response rate ( % ) qol response rate ( % ) 070 ms12438.750.07095 ms9839.854.695120 ms10957.865.1120195 ms9568.472.0pearson <0.0010.004 the left ventricular end - systolic volume and qol response rates for the qlv quartiles qlv is expected to be longer with increased qrs duration as well as lbbb . for qrs duration > 150 ms , qlv was 113 33 ms , compared with 78 30 ms for qrs < 150 ms ( p < 0.001 ) . however , qrs duration was not strongly correlated with qlv , as it accounted for only 35% of the variability observed ( r = 0.35 , p < 0.001 ) . similarly , among lbbb patients qlv was 100 35 ms compared with 73 30 ms for non - lbbb patients ( p < 0.001 ) . median mechanical dyssynchrony was 35 ms with inter - quartile range from 13 to 68 ms . in contrast to the relationships between qlv and qrs duration and morphology , mechanical dyssynchrony did not vary by qlv quartile ( p = 0.55 , kruskal wallis test ) . in the multivariate regression models , qlv added significant predictive value for crt responses , assessed by either reductions of lvesv or qol , after accounting for baseline covariates ( table 4 ) . patients in the highest quartile of qlv had a greater than three - fold increase in their odds of lvesv response vs. the shortest quartile . for the endpoint of a > 15% reduction in lvesv , qlv , gender and aetiology of hf were the only independent variables that were significantly associated with the response . for the qol endpoint , only qlv and gender were independently associated with the response . it is noteworthy that , as expected , both qrs and lbbb were univariately associated with both lvesv response ( qrs : p = 0.04 ; lbbb : p < 0.001 ) and qol response ( qrs : p = 0.004 ; lbbb : p = 0.024 ) . table 4multivariate logistic regression model resultscovariateodds ratio ( 95% ci ) , p - valuelvesv responseqol responseqlv 2nd quartile vs. 1st quartile1.10 ( 0.621.95 ) , 0.7431.30 ( 0.752.26 ) , 0.355qlv 3rd quartile vs. 1st quartile1.86 ( 1.043.31 ) , 0.0361.86 ( 1.053.31 ) , 0.033qlv 4th quartile vs. 1st quartile3.21 ( 1.586.50 ) , 0.0012.73 ( 1.355.54 ) , 0.005age ( per 1 year increase)1.00 ( 0.981.02 ) , 0.8010.99 ( 0.971.01 ) , 0.209lvef ( per 1% increase)0.98 ( 0.941.01 ) , 0.1861.00 ( 0.961.03 ) , 0.83ischaemic vs. non - ischaemic0.58 ( 0.370.91 ) , 0.0191.05 ( 0.671.64 ) , 0.846qrs ( > 150 ms vs. 150 ms)0.86 ( 0.531.40 ) , 0.5430.88 ( 0.551.43 ) , 0.611lbbb vs. non - lbbb1.20 ( 0.722.01 ) , 0.481.17 ( 0.711.93 ) , 0.526male vs. female0.53 ( 0.330.85 ) , 0.0080.56 ( 0.340.91 ) , 0.018nyha class iv vs. i iii1.67 ( 0.446.29 ) , 0.453.41 ( 0.6916.92 ) , 0.133lvesv1.00 ( 0.991.01 ) , 0.981.00 ( 0.991.00 ) , 0.682adjusted for baseline ef , lvesv , aetiology of hf , lbbb , gender , nyha , qrs and age . multivariate logistic regression model results adjusted for baseline ef , lvesv , aetiology of hf , lbbb , gender , nyha , qrs and age . the association between longer qlv and crt response was assessed in several pre - specified subgroups . the univariate relationship between qlv and crt response was consistent in all groups . this was the case for both lvesv ( figure 4a ) and qol ( figure 4b ) response criteria . no significant interactions with qlv were observed in the logistic regression models for both endpoints . figure 4univariate logistic regression results for left ventricular end - systolic volume ( a ) and quality of life ( b ) by subgroups . univariate logistic regression results for left ventricular end - systolic volume ( a ) and quality of life ( b ) by subgroups . the location of the lv lead was not controlled in this study . however , as expected , most leads were placed in the anterolateral or posterolateral veins , as reported by the implanting physicians . in fact , only 46 of 426 patients had leads placed apically and only 13 had them placed in an anterior or septal location . these small numbers preclude any meaningful analysis of the impact of lead location on qlv or response rate . however , even in similar locations , there was marked variation in qlv . for instance , the qlv interval ranged from 10 to 195 ms in the mid - anterolateral location ( n = 89 ) , and from 15 to 195 ms in the mid - posterolateral location ( n = 230 ) . the majority of patients ( 76% ) had bipolar leads , 19% patients had unipolar leads , and for 5% patients the lead type was not available . the sensing configuration was true bipolar in 68% of patients , extended bipolar in 28% of patients , while the remaining 4% used unipolar sensing . the 426 patients included in the qlv substudy were typical of those undergoing crt for advanced hf , including predominately late middle aged males with a reduced ef and advanced hf . a summary of baseline clinical data is presented in table 1 . of note , none of these values differs from the larger full cohort included in the smart - av trial , other than a slightly shorter mean qrs duration in the substudy population ( 151 19 vs. 154 21 ms , p < 0.05 ) . table 1patient characteristics ( n = 426)age , years66 11gender ( male , % ) 66ischaemic heart disease ( % ) 59nyha functional class ( % ) i0 ii3 iii94 iv3lv ejection fraction ( % ) 26 7cardiac medications ( % ) ace / arb84 beta - blocker92 diuretic82 digoxin22ecg characteristics qrs duration ( ms)151 19 lbbb ( % ) 75 rbbb ( % ) 13 ivcd ( % ) 12baseline lvesv ( ml)128 62qol46 26values expressed as mean sd.ace/arb , angiotensin - converting enzyme inhibitor / receptor blocker . patient characteristics ( n = 426 ) values expressed as mean sd.ace/arb , angiotensin - converting enzyme inhibitor / receptor blocker . the qlv measurement was reproducible , as evidenced by a strong concordance among qlv reviewers in the sample of duplicate reviews evaluated . ( lin 's ccc , 95% ci : 0.93 , 0.820.98 ) . the median value for qlv in this population was 95 ms with inter - quartile range of 70120 ms . the programmed av delay varied depending on whether nominal ( 120 ms ) , smartdelay electrogram optimization or echocardiographic optimization was used . overall , the median sensed av delay was 120 ms with inter - quartile range of 120140 ms . these programmed parameters resulted in a very high rate of lifetime biv pacing during this study with a median of 98.4% ( 95.199.6% ) , which is higher than the 92% threshold often used to insure a maximal crt response . when separated at the median qlv , patients with longer qlv intervals had shorter programmed av delays [ median ( q1q3 ) : 120 ( 110130 ) vs. 120 ( 120140 ) , p = 0.016 ] and slightly higher percentages of biv pacing [ median ( q1q3 ) : 98.8% ( 94.899.7% ) vs. 97.9% ( 95.299.3% ) , p = 0.014 ] . when separated by the qlv median value ( 95 ms ) , lvesv , lvedv , ef , and qol responses all were significantly larger for patients with long vs. short qlv ( figure 2 ) . the responses for lvesv , lvedv , ef , and qol from baseline to 6 months all significantly increased with the increase in the qlv from the shortest quartile ( < 70 ms ) to the longest quartile ( > 120 ms ) ( figure 3 ) . specifically , changes in nyha class , 6-min hall walk distance and hf events are shown for each qlv quartile . although these relationships were only statistically significant for nyha , the largest response was consistently observed in the fourth quartile . figure 2comparisons of the changes in left ventricular end - systolic volume , left ventricular end - diastolic volume , ejection fraction , and quality of life from implant baseline to 6 months for the two qlv groups separated by the median value . figure 3comparisons of the changes in left ventricular end - systolic volume , left ventricular end - diastolic volume , ejection fraction , and quality of life from implant baseline to 6 months for the qlv quartiles . the data were presented as median inter - quartile range ( box ) . table 2relationship of qlv with clinical outcomesqlv quartilesq1 : 070 ms ( % ) q2 : 7095 ms ( % ) q3 : 95120 ms ( % ) q4 : 120195 ms ( % ) total ( % ) overall p - valueq4 vs. q1 p - valuepatients with hf events15 ( 12.1)7 ( 7.1)7 ( 6.4)6 ( 6.3)35 ( 8.2)0.370.17nyha improved89 ( 73.0)79 ( 80.6)76 ( 71.0)77 ( 83.7)321 ( 76.6)0.040.04 no change33 ( 27.1)16 ( 16.3)30 ( 28.0)14 ( 15.2)93 ( 22.2 ) worsened0 ( 0.0)3 ( 3.1)1 ( 0.9)1 ( 1.1)5 ( 1.2)six minute walk delta52 11868 9150 10470 9359 1030.360.13 comparisons of the changes in left ventricular end - systolic volume , left ventricular end - diastolic volume , ejection fraction , and quality of life from implant baseline to 6 months for the two qlv groups separated by the median value . the data were presented as median inter - quartile range . comparisons of the changes in left ventricular end - systolic volume , left ventricular end - diastolic volume , ejection fraction , and quality of life from implant baseline to 6 months for the qlv quartiles . the overall response rates were 50% for lvesv and 60% for qol in this population , which is typical for response rate for these parameters to crt . the response rates increased progressively from the shortest quartile to the longest quartile of qlv for both lvesv ( 38.768.4% ) and qol ( 5072% ) criteria . it is noteworthy that the median value ( 95 ms ) was also the optimal cut - point for qlv based on roc analysis using the point on the curve closest to the upper left corner for both lvesv and qol . for lvesv endpoint , auc = 0.634 95% ci : ( 0.6070.660 ) p < 0.001 for test of ho : auc = 0.5 by equivalent wilcoxon test . the sensitivity and specificity at 95 ms cut - off were 0.63 and 0.61 , respectively . for qol endpoint , auc = 0.600 95% ci : ( 0.5730.627 ) p < 0.001 for test of ho : auc = 0.5 by equivalent wilcoxon test . the sensitivity and specificity at 95 ms cut - off were 0.58 and 0.60 , respectively . table 3the left ventricular end - systolic volume and qol response rates for the qlv quartilesqlvnlvesv response rate ( % ) qol response rate ( % ) 070 ms12438.750.07095 ms9839.854.695120 ms10957.865.1120195 ms9568.472.0pearson <0.0010.004 the left ventricular end - systolic volume and qol response rates for the qlv quartiles qlv is expected to be longer with increased qrs duration as well as lbbb . for qrs duration > 150 ms , qlv was 113 33 ms , compared with 78 30 ms for qrs < 150 ms ( p < 0.001 ) . however , qrs duration was not strongly correlated with qlv , as it accounted for only 35% of the variability observed ( r = 0.35 , p < 0.001 ) . similarly , among lbbb patients qlv was 100 35 ms compared with 73 30 ms for non - lbbb patients ( p < 0.001 ) . median mechanical dyssynchrony was 35 ms with inter - quartile range from 13 to 68 ms . in contrast to the relationships between qlv and qrs duration and morphology , mechanical dyssynchrony did not vary by qlv quartile ( p = 0.55 , kruskal wallis test ) . in the multivariate regression models , qlv added significant predictive value for crt responses , assessed by either reductions of lvesv or qol , after accounting for baseline covariates ( table 4 ) . patients in the highest quartile of qlv had a greater than three - fold increase in their odds of lvesv response vs. the shortest quartile . for the endpoint of a > 15% reduction in lvesv , qlv , gender and aetiology of hf were the only independent variables that were significantly associated with the response . for the qol endpoint , only qlv and gender were independently associated with the response . it is noteworthy that , as expected , both qrs and lbbb were univariately associated with both lvesv response ( qrs : p = 0.04 ; lbbb : p < 0.001 ) and qol response ( qrs : p = 0.004 ; lbbb : p = 0.024 ) . table 4multivariate logistic regression model resultscovariateodds ratio ( 95% ci ) , p - valuelvesv responseqol responseqlv 2nd quartile vs. 1st quartile1.10 ( 0.621.95 ) , 0.7431.30 ( 0.752.26 ) , 0.355qlv 3rd quartile vs. 1st quartile1.86 ( 1.043.31 ) , 0.0361.86 ( 1.053.31 ) , 0.033qlv 4th quartile vs. 1st quartile3.21 ( 1.586.50 ) , 0.0012.73 ( 1.355.54 ) , 0.005age ( per 1 year increase)1.00 ( 0.981.02 ) , 0.8010.99 ( 0.971.01 ) , 0.209lvef ( per 1% increase)0.98 ( 0.941.01 ) , 0.1861.00 ( 0.961.03 ) , 0.83ischaemic vs. non - ischaemic0.58 ( 0.370.91 ) , 0.0191.05 ( 0.671.64 ) , 0.846qrs ( > 150 ms vs. 150 ms)0.86 ( 0.531.40 ) , 0.5430.88 ( 0.551.43 ) , 0.611lbbb vs. non - lbbb1.20 ( 0.722.01 ) , 0.481.17 ( 0.711.93 ) , 0.526male vs. female0.53 ( 0.330.85 ) , 0.0080.56 ( 0.340.91 ) , 0.018nyha class iv vs. i iii1.67 ( 0.446.29 ) , 0.453.41 ( 0.6916.92 ) , 0.133lvesv1.00 ( 0.991.01 ) , 0.981.00 ( 0.991.00 ) , 0.682adjusted for baseline ef , lvesv , aetiology of hf , lbbb , gender , nyha , qrs and age . multivariate logistic regression model results adjusted for baseline ef , lvesv , aetiology of hf , lbbb , gender , nyha , qrs and age . the association between longer qlv and crt response was assessed in several pre - specified subgroups . this was the case for both lvesv ( figure 4a ) and qol ( figure 4b ) response criteria . no significant interactions with qlv were observed in the logistic regression models for both endpoints . figure 4univariate logistic regression results for left ventricular end - systolic volume ( a ) and quality of life ( b ) by subgroups . univariate logistic regression results for left ventricular end - systolic volume ( a ) and quality of life ( b ) by subgroups . the location of the lv lead was not controlled in this study . however , as expected , most leads were placed in the anterolateral or posterolateral veins , as reported by the implanting physicians . in fact , only 46 of 426 patients had leads placed apically and only 13 had them placed in an anterior or septal location . these small numbers preclude any meaningful analysis of the impact of lead location on qlv or response rate . however , even in similar locations , there was marked variation in qlv . for instance , the qlv interval ranged from 10 to 195 ms in the mid - anterolateral location ( n = 89 ) , and from 15 to 195 ms in the mid - posterolateral location ( n = 230 ) . the majority of patients ( 76% ) had bipolar leads , 19% patients had unipolar leads , and for 5% patients the lead type was not available . the sensing configuration was true bipolar in 68% of patients , extended bipolar in 28% of patients , while the remaining 4% used unipolar sensing . the present study is the first comprehensive evaluation of the relationship between electrical delay or dyssynchrony as measured by qlv and crt outcomes in a large clinical trial . the results demonstrate that the qlv was strongly associated with reverse remodelling and qol improvement . longer qlv at the lv stimulation site was associated with better crt responses even after adjusting for baseline covariates , including qrs duration , bundle branch block , and aetiology of hf . previously , in small preliminary studies of qlv , this measure was shown to correlate directly with acute haemodynamic response as assessed by invasive measurement of lv dp / dtmax . subsequently , in a study of 71 patients , singh et al . reported that the percentage of lv delay as a function of qrs duration predicted not only acute haemodynamic response but also chronic clinical outcomes after 12 months of follow - up . the present trial extends these findings by showing the qlv was strongly associated with chronic reverse remodelling and qol in a much larger prospective , multicentre trial . the role of pacing site to influence crt outcomes is an area of active research . however , analyses of multicentre trials have failed to support this strategy . in the companion study , lead position had little effect on outcomes , whereas in madit crt apical positions were associated with worse outcomes , rather than non - lateral positions . however , other studies have showed that 30% of patients had optimal pacing site in the apical regions . these discrepant findings suggest that anatomic lead position alone is unlikely to be a sufficient guide for optimization of crt . in support of this notion , studies of mechanical dyssynchrony to guide lead position showed that optimal pacing site varies from patient to patient . however , current measurement of mechanical dyssynchrony requires echocardiography or other imaging modalities that may be hard to correlate with fluoroscopic imaging at the time of device implantation and have shown to have a high degree of variability . further study will be needed to test the hypothesis that positioning lv leads at the site of maximal qlv rather than simply by anatomical location improves the response rate to crt and clinical outcomes . one mechanism of the benefit of crt is to restore electrical synchrony by pre - exciting the delayed lv area to achieve more synchronous electrical activation and thus contraction within the left ventricle . to identify patients with such conduction delays , thus , patients with right bundle branch block ( rbbb ) can also have a prolonged qrs duration , yet typically will have delayed right but not lv activation . patients with rbbb show little or no response to crt . to reduce the contribution of activation time from the rv , sweeny et al . used left ventricular activation time ( lvat ) , which is the qrs width after substracting the early part that corresponds to the rvat . moreover , lvat also reflects the overall left ventricular activation time , and does not identify regions with latest delay . therefore , it identifies the potential for a good clinical response to crt by measuring electrical dyssyncrhony . to insure good crt responses , it is desirable to have an indicator that reflects the degree of delayed lv activation at the pacing site . thus qlv reflects the time that it takes for the ventricular depolarization wavefront to reach the lv electrode site , and thus the resynchronization that will occur with pacing . it is intriguing to speculate that this can be utilized during the implant procedure to determine an area of late activation by repositioning the lv electrode and examining the qlv value at different locations . in contrast to the strong relationship between qlv and qrs and lbbb , no correlation was observed with mechanical dyssynchrony . this may be due to the fact that qlv reflects electrical dyssynchrony at the stimulation site which is not well correlated with global measures of mechanical dyssynchrony , which are weak predictors of crt response at best . in this regard , qrs duration , morphology ( i.e. lbbb ) , aetiology of hf and gender are consistently associated with outcomes . these variables were also strongly associated with outcomes in the present study . however , lbbb and qrs duration were no longer predictive of crt response after adjusting for qlv . this suggests that qlv or ventricular electrical delay at the stimulation site is a fundamental mechanism for the enhanced crt response in the presence of lbbb or more prolonged qrs duration . non - responders continue to be a challenge for crt therapy despite optimized device programming . recent studies suggest that a purely anatomic approach to lead position will be of limited value . however , the qlv interval is strongly associated with response and helps identify good lv pacing sites . thus , it seems reasonable to consider repositioning the pacing lead either within a vein or in a different vein towards a larger qlv value , particularly if an initial qlv value is 95 ms or less , which could be associated with poor outcome . the intra - patient data may not be the same as cross - patient data for guiding lead placement . in addition , the choice of lead position was not controlled with a marked preponderance on the lateral wall . this limits the ability to evaluate fully the relationship between qlv and lead position , as only 11% of subjects had apical and only 3% had true anterior positions . furthermore , since the qlv is currently measured from electrodes that are placed epicardially through a coronary vein branch , it may not be able to identify intramural or endocardial latest activated regions . advancement in lv lead placement technology may improve this shortcoming when the lead is able to be placed via endocardial approach . finally , an echocardiographic measure of reverse remodelling ( lvesv ) at 6 months was the primary endpoint of this study . whereas reverse remodelling is a good predictor of survival and clinical outcomes with crt , harder endpoints such as hospitalization and survival were not powered endpoints in the smart - av trial and the short follow - up precluded more complete assessment of hf events . in summary , electrical dyssynchrony , as measured by qlv , was strongly and independently associated with chronic outcomes with crt . the best outcomes were observed with a qlv > 95 ms , so this target should be considered when selecting lv lead position at the time of crt implantation . further study is warranted to assess the value of using qlv rather than anatomic location to guide lead positioning to improve response rates with crt . one mechanism of the benefit of crt is to restore electrical synchrony by pre - exciting the delayed lv area to achieve more synchronous electrical activation and thus contraction within the left ventricle . to identify patients with such conduction delays , thus , patients with right bundle branch block ( rbbb ) can also have a prolonged qrs duration , yet typically will have delayed right but not lv activation . patients with rbbb show little or no response to crt . to reduce the contribution of activation time from the rv , sweeny et al . used left ventricular activation time ( lvat ) , which is the qrs width after substracting the early part that corresponds to the rvat . moreover , lvat also reflects the overall left ventricular activation time , and does not identify regions with latest delay . therefore , it identifies the potential for a good clinical response to crt by measuring electrical dyssyncrhony . to insure good crt responses , it is desirable to have an indicator that reflects the degree of delayed lv activation at the pacing site . thus qlv reflects the time that it takes for the ventricular depolarization wavefront to reach the lv electrode site , and thus the resynchronization that will occur with pacing . it is intriguing to speculate that this can be utilized during the implant procedure to determine an area of late activation by repositioning the lv electrode and examining the qlv value at different locations . in contrast to the strong relationship between qlv and qrs and lbbb , no correlation was observed with mechanical dyssynchrony . this may be due to the fact that qlv reflects electrical dyssynchrony at the stimulation site which is not well correlated with global measures of mechanical dyssynchrony , which are weak predictors of crt response at best . regard , qrs duration , morphology ( i.e. lbbb ) , aetiology of hf and gender are consistently associated with outcomes . these variables were also strongly associated with outcomes in the present study . however , lbbb and qrs duration were no longer predictive of crt response after adjusting for qlv . this suggests that qlv or ventricular electrical delay at the stimulation site is a fundamental mechanism for the enhanced crt response in the presence of lbbb or more prolonged qrs duration . non - responders continue to be a challenge for crt therapy despite optimized device programming . recent studies suggest that a purely anatomic approach to lead position will be of limited value . however , the qlv interval is strongly associated with response and helps identify good lv pacing sites . thus , it seems reasonable to consider repositioning the pacing lead either within a vein or in a different vein towards a larger qlv value , particularly if an initial qlv value is 95 ms or less , which could be associated with poor outcome . the intra - patient data may not be the same as cross - patient data for guiding lead placement . in addition , the choice of lead position was not controlled with a marked preponderance on the lateral wall . this limits the ability to evaluate fully the relationship between qlv and lead position , as only 11% of subjects had apical and only 3% had true anterior positions . furthermore , since the qlv is currently measured from electrodes that are placed epicardially through a coronary vein branch , it may not be able to identify intramural or endocardial latest activated regions . advancement in lv lead placement technology may improve this shortcoming when the lead is able to be placed via endocardial approach . finally , an echocardiographic measure of reverse remodelling ( lvesv ) at 6 months was the primary endpoint of this study . whereas reverse remodelling is a good predictor of survival and clinical outcomes with crt , harder endpoints such as hospitalization and survival were not powered endpoints in the smart - av trial and the short follow - up precluded more complete assessment of hf events . in summary , electrical dyssynchrony , as measured by qlv , was strongly and independently associated with chronic outcomes with crt . the best outcomes were observed with a qlv > 95 ms , so this target should be considered when selecting lv lead position at the time of crt implantation . further study is warranted to assess the value of using qlv rather than anatomic location to guide lead positioning to improve response rates with crt . this study was funded by boston scientific corporation . funding to pay the open access publication charges for this article was provided by boston scientific corporation . conflict of interest : m.g . reported receiving research grants from medtronic , boston scientific and st jude , fees for fellowship support from medtronic and biotronik , honoraria and consulting fees from medtronic , boston scientific , st jude and biotronik . u.b . reported receiving research grants from medtronic , boston scientific and st jude , honoraria / speakers bureau from medtronic , boston scientific and st jude . j.s . reported receiving research grants from st jude , medtronic , boston scientific and biotronik , fees for advisory board / steering committee / consultant from boston scientific , biotronik , st jude , medtronic , cardioinsight , thoratec and biosense webster . reported receiving research grants from medtronic , boston scientific , st jude , fees for fellowship support from medtronic , boston scientific , and biotronik , honoraria and consulting fees from medtronic , boston scientific , st jude and biotronik .

aimsthe aim of the present study was to evaluate the relationship between left ventricular ( lv ) electrical delay , as measured by the qlv interval , and outcomes in a prospectively designed substudy of the smart - av trial.methods and resultsthis was a multicentre study of patients with advanced heart failure undergoing cardiac resynchronization therapy ( crt ) defibrillator implantation . in 426 subjects , qlv was measured as the interval from the onset of the qrs from the surface ecg to the first large peak of the lv electrogram . left ventricular volumes were measured by echocardiography at baseline and after 6 months of crt by a blinded core laboratory . quality of life ( qol ) was assessed by a standardized questionnaire . when separated by quartiles based on qlv duration , reverse remodelling response rates ( > 15% reduction in lv end systolic volume ) increased progressively from 38.7 to 68.4% and qol response rate ( > 10 points reduction ) increased from 50 to 72% . patients in the highest quartile of qlv had a 3.21-fold increase ( 1.586.50 , p = 0.001 ) in their odds of a reverse remodelling response after correcting for qrs duration , bundle branch block type , and clinical characteristics by multivariate logistic regression analysis.conclusionelectrical dyssynchrony , as measured by qlv , was strongly and independently associated with reverse remodelling and qol with crt . acute measurements of qlv may be useful to guide lv lead placement .

Introduction Methods Statistical analysis Results Patient population QLV response Biventricular pacing CRT responses CRT response rate Relationship between baseline parameters and QLV Relationship between electrical intervals and anatomical locations Discussion Electrical dyssynchrony measures and CRT responses Clinical implications Limitations Funding

an 80-year - old female patient who has a history of taking agents for hypertension and diabetes mellitus ( the patient personally discontinued the medications two weeks ago ) for more than 20 years was transferred to our emergency room from another medical center with sudden developed dyspnea and drowsy consciousness . the patient had visited two other hospitals and magnetic resonance imaging ( mri ) for lower back pain and left sciatica which were developed three months ago had been performed respectively . the leg symptom was dominant on l4 and 5 dermatomes , but specific and definite dermatome was not noted . the straight leg raise test and the sign of myelopathy showed negative results . in each hospital , she received several times of epidural block under the impression of left neural foraminal and subarticular stenosis on l4 - 5 ( fig . the symptom was sustained by a shortening of interval and an increasing of intensity , although there were some alleviations of the symptom immediately after the procedures . she developed sudden and severe abdominal pain while staying in a rest room after a left l4 and 5 selective transforaminal epidural block using triamcinolone and bupivacaine at the second - visit hospital . there were no abnormal signs related with procedure and chemical laboratory studies except mild elevation of serum creatinine ( 1.46 mg / dl ) . the abdominal pain was aggravated without any alleviation under painkillers and she was transferred to our emergency room . whole abdominal computed tomography ( ct ) was performed for evaluating abdominal symptom and it revealed a huge hematoma presenting as a leakage of dye on the retroperitoneal space with calcified large sized fusiform aneurysm containing thrombus and arising from the left common iliac artery ( fig . it was noted that there was a large aneurysm originating from the left common iliac artery with irritating the surrounding lumbosacral plexus , and thrombus was slowly growing inside of the aneurysm . the patient was not able to undergo an operation for the ruptured aneurysm of the common iliac artery due to severe hypovolemic condition and expired in the end . the causes of acute lower extremity symptoms are variable and include musculoskeletal , dermatologic , infectious , neoplastic , and vascular disorders . although radiculopathy is usually caused by degenerative disc disease in the lumbar spine , it may be related with other less common causes . reported cases of lumbosacral radiculopathy due to extra - spinal causes have been sporadic and overall incidence has seldom been reported . kleiner et al . reported that the incidence of extra - spinal cause of lumbosacral radiculopathy was about 0.09% from the review of 12,125 patients . iliac artery aneurysm has a close anatomical relationship to the ureter , bladder , colon , pelvic vessels , and femoral or sciatic nerve . the neurological symptoms are usually due to the compression of the nerves of segments l5 and s1 , which are located directly posterior to the internal iliac artery . hypertension and arteriosclerosis are the most important etiological factors in the formation of aneurysm , but connective tissue disorders such as the marfan and ehler - danlos syndrome , luetic , traumatic , and post - partum aneurysms have also been reported . in addition , such as transvaginal needle biopsy , renal transplantation , lumbar disc surgery , and radiation therapy could be an iatrogenic cause of pseudoaneurysm or arteriovenous fistula in the pelvis . the importance of clinical history and examination in the diagnosis of these lesions can not be overemphasized . the aneurysm may remain clinically silent , but when it ruptures , the consequences can be disastrous . the patient may present with slowly progressive sciatic - type symptoms or pain in the lower back , buttock , and thigh in many cases . in one series , isolated iliac aneurysms caused gastrointestinal tract signs , genito - urinary tract symptoms , lumbosacral plexopathy symptoms , and a palpable mass in 22 , 15 , 13 , and 17% of patients , respectively . compression of pelvic organs , such as urinary tract , recto - sigmoid , and venous trunks can be the cause of urinary retention and hydronephrosis , lower abdominal and perineal pain , constipation , edema of the leg , and thrombosis . larger aneurysms and those that are symptomatic should be treated with either surgical excision or endovascular techniques . many successful endovascular treatments for internal iliac artery pseudo - aneurysms have recently been reported . an increase in size may enhance the risk of aneurysmal rupture , and the rupture of a large artery such as the common iliac artery can be fatal . aneurysms of the iliac artery are relatively difficult to identify , as up to 40% may present with rupture . the operative mortality for ruptured aneurysms is reported as high as 50% , so the early diagnosis of a symptomatic aneurysm is crucial . in this case , although the doctors had prescribed a spine mri in order to evaluate the likelihood of a herniated intervertebral disc or spinal stenosis , the important additional discovery of an aneurysm in the left common iliac artery was not appreciated even though there was a sustained symptom compare to the severity of the lesion on mri . the aneurysm consisted of a portion with low - signal intensity ( signal voids ) , which meant that the blood flow in the lumen , and periphery showed a high - signal intensity compare to the thrombus . these findings suggested that the lesion was an out - pouching aneurysm with a thrombus that was arising from the left common iliac artery , which was noticed in the parasagittal image section upon retrospective reviewing of the previous lumbar spine mris . as time went by , the aneurysmal size increased and there was pronounced irritation in the surrounding nerve plexus . we think that the increase of direct compression and chemical irritation associated with the increasing aneurysmal size caused by the growing thrombus inside the aneurysm caused the sciatica . sciatica emerged as a kind of warning sign for the aneurysmal rupture as the thrombus grew inside it , and abruptly developed into abdominal pain and distension , which were a result of the intra - abdominal hemorrhage from the aneurysmal rupture . we guess that self - discontinuation of the anti - hypertensive agents recently might have an influence with an aneurysmal rupture . . a peripheral crescent - shaped area of hyper - attenuation in the mural thrombus of an aneurysm may represent an impending rupture . moreover , we assumed it was possible that some blood leakage from the aneurysm ahead of the active extravasation of hemorrhage had caused the aggravation of leg symptoms . however , there was no definitive evidence of hemorrhage on the latest lumbar spine mri whether it was resolved before performing mri at the second - visit hospital . this case indicates the process of a growing thrombus inside an aneurysm that seems to rupture imminently , while most other previous similar cases have focused on the presence and treatment of the aneurysm . this case serves as a reminder for the assessment of neurological symptoms associated with the lower extremities , extra - spinal causes in the pelvis should be considered with high suspicion . it is sometimes not easy to distinguish the partially - sectioned aneurysm from the pelvic organ or bowel signal , because the routine axial and sagittal sections of an mri scan generally do not extend to either the bottom of the sacrum or the more lateral portion of the neural foramen . in conclusion , sciatica caused by extra - spinal causes is a very rare condition and it is easy to neglect the problems . when we evaluate the patient with lower extremity symptoms which does not meet the result of imaging studies or physical examination fully and past medical history such as hypertension , extra - spinal problems including vessel problem should be also considered as a cause of the symptom .

the causes of sciatica are variable and include musculoskeletal , dermatologic , infectious , neoplastic , and vascular disorders . in many cases , the symptom is usually caused by degenerative disease in the spine with the compression or irritation of spinal nerve . on the other hands , there are also several announced extra - spinal causes including aneurysm , diabetes , and radiation for sciatica in a low rate . among the extra - spinal cases , aneurysms arising from iliac vessels are sometimes developing a diagnostic confusion with the spinal causes , and delayed diagnosis can lead to poor prognosis . it is very important to pay attention weather the aneurysmal cause is involved in the symptom of sciatica .

CASE REPORT DISCUSSION

intracranial foreign bodies such as needle , wooden and bullets are generally due to penetrating injuries through the orbita , ear or cranial bones or rarely forgotten surgical objects in the brain during surgery . most of the cases were diagnosed incidentally and/or during evaluation for symptoms such as headache , epilepsy or altered behavior . patients , who presented with seizure due to intracranial needles , were rarely reported previously . we report a 14-year - old boy with epilepsy resulting from the presence of sewing needle located in the brain . a 14-year - old boy was admitted to the pediatric neurology outpatient department with a history of generalized tonic - clonic ( gtc ) seizures . there were no previous history of epileptic seizures , head trauma or injury and his family history was unremarkable . on admission his neurological examination was normal , there were no localizing neurological findings or lateralized weakness . after his second seizure sodium valproate treatment ( 20 mg / kg / day ) was started . to determine etiology of seizures cranial magnetic resonance imaging was obtained and magnetic susceptibility artifact in right frontal region was seen ( figure 1 ) . to reveal the nature of the object computed tomography ( ct ) was obtained , which showed a linear density compatible with a sewing needle surrounded with a local encephalomalacic area and calcification ( figure 2 ) . also , skull radiography demonstrated the presence of metallic opacity of a sewing needle , located in a cranio - caudal direction on the right frontal area ( figure 3 ) . based on the needle s location , we thought that it might have been inserted through the anterior fontanel during infancy . the needle was encrusted with an irregular gliotic area ( figure 4 ) . during the postoperative 8 months he was seizure - free with valproic acid treatment . two months after discontinuing valproic acid treatment his seizure reoccurred and a spike wave activity in the right frontal region was determined in his eeg . in the two there are reports of sewing needles and other foreign objects retained in the brain for long periods of time without any symptoms . since its first description in 1914 , approximately forty cases have been reported all over the world , which were reviewed by struiale et al . in this review , about one third of patients with intracranial needles were asymptomatic and had been discovered incidentally . the most seen complaint was long time history of slight headache and secondly was seizure . initial complaints such as fever , hemiparesis , extrapyramidal signs , cranial nerve palsy , hemi - chorea , brain abscess , nausea , vomiting , lethargy , hemorrhage , meningitis and rarely hypothalamic syndrome had also been reported in this review . the underlying pathophysiologic mechanism of seizures linked to intracranial foreign bodies is not clearly understood . reported that persistent epilepsy after penetrating brain injuries is as high as 50% at 15 years after the injury , 85% in cases with longer follow - up . hypothesized that the needle can function as an electric dipole and can be the main reason for epileptogenesis . although we could not identify any abnormality in his first awake / sleep eeg , his postoperative eeg showed spike wave activity in the same area with the needle in our case . therefore we thought that the area of gliosis around the needle might be a possible reason for seizures then the needle . the most widely accepted approach is to follow - up without surgical removal when the patients have no clinical signs or symptoms and the diagnosis is purely incidental . the excision of the cortical scar tissue at the sewing needle entrance is highly recommended , especially if there are preoperative eeg abnormalities . we preferred to remove the needle surgically because of the early presentation of the patient with seizure . most frequently , the patients and their relatives have no idea about how and when the needle was inserted . in most cases , as in ours , the needle presumably was introduced in infancy before the closure of the fontanels ; therefore the patient can not remember anything . although it is thought that the needle inserted accidently , the conditions such as introduction of the needle by another child without the awareness of parents or other family members and child abuse should be strongly considered in these cases . in conclusion , although there are no clear - cut guidelines regarding the management of these foreign bodies , follow - up with antiepileptic treatment before surgery might be a reasonable approach to the patients with seizure .

placing of sewing needles in the brain through the anterior fontanel is a rare entity . there are very few cases reported in literature . most of them were asymptomatic , but some of them presented with seizure . we report here a 14-year - old boy , who was admitted to the pediatric neurology department with a history of generalized tonic - clonic seizures due to sewing needle located in the frontal lobe .

Introduction Case Report Discussion and Conclusions

culture of penicillium citrinum mtcc1256 was obtained from imtech chandigarh , india , and was maintained on the slants of potato - dextrose agar ( pda ) medium at 4c and subcultured at 30-day intervals . the culture of p. citrinum was grown on potato glycerol agar ( pga ) slants , and the spore suspension ( 4 10 spores per ml ) was prepared in glycerol water solution ( 15 g / l ) . the inoculum media used in this study were glucose ( 20 g / l ) , glycerol ( 30 g / l ) , peptone ( 8 g / l ) , which were dissolved in a water - soluble extract of soybean meal . all fermentation experiments were carried out in 250 ml erlenmeyer flasks containing 50 ml of production media , as per the experimental design . each flask was inoculated at 5% v / v with spore suspension and incubated at 24c and 220 rpm in an orbital shaker for 14 days . glucose , glycerol , arrowroot , oats , urea , peptone , yeast extract , magnesium sulfate , and calcium chloride were the nine medium constituents selected for the study . the plackett - burman experimental design , for 11 variables : nine nutritional components ( independent variables ) and two dummy variables [ table 1 ] , were used , to evaluate the relative importance of various nutrients for mevastatin production in the submerged culture . in table 2 high ( + ) and low ( - ) were tested [ table 2 ] . concentrations of variables at different levels in plackett - burman design for mevastatin production in submerged culture plackett - burman experimental design of 12 trials for 11 variables ( 9 nutrients + 2 dummies ) along with the observed concentration of mevastatin in fermentation broth mevastatin from fermentation broth was extracted according to the procedure given by chakarvarti and sahai , 2002b . fermentation broth ( 5 ml ) was adjusted to ph 6.5 with either acid ( h3po4 ) or alkali ( aq . naoh ) . the broth was diluted five - fold with absolute ethanol , filtered through a 0.22 m filter , and analyzed by high performance thin layer chromatography ( hptlc ) ( camag , muttenz , switzerland ) the extracted mevastatin were applied to the plates as 3-mm - width bands with a camag 100 l syringe , using a linomat v ( camag , muttenz , switzerland ) sample applicator on pre - coated silica gel aluminum plates 60f-254 ( 20 cm 10 cm , with 0.2 mm thickness , e. merck , germany ) . the sample application rate kept at 150 nl / s was employed and the space between two bands was kept at 12.3 mm . thin layer chromatography was performed using a mixture of toluene , ethyl acetate , and formic acid as the mobile phase , in the ratio of 3:2:1 per volume , in 10 10 cm twin through - glass chambers . densitometric scanning was performed on a camag tlc scanner iii in absorbance mode , at 238 nm , for mevastatin , after drying in a hot air oven for 10 minutes at 100c . the effect of each variable was determined according to the procedure given by plackett - burman . the percentage of contribution of each nutrient parameter was calculated by using design expert 7.1 software of stat ease inc . culture of penicillium citrinum mtcc1256 was obtained from imtech chandigarh , india , and was maintained on the slants of potato - dextrose agar ( pda ) medium at 4c and subcultured at 30-day intervals . the culture of p. citrinum was grown on potato glycerol agar ( pga ) slants , and the spore suspension ( 4 10 spores per ml ) was prepared in glycerol water solution ( 15 g / l ) . the inoculum media used in this study were glucose ( 20 g / l ) , which were dissolved in a water - soluble extract of soybean meal . all fermentation experiments were carried out in 250 ml erlenmeyer flasks containing 50 ml of production media , as per the experimental design . each flask was inoculated at 5% v / v with spore suspension and incubated at 24c and 220 rpm in an orbital shaker for 14 days . glucose , glycerol , arrowroot , oats , urea , peptone , yeast extract , magnesium sulfate , and calcium chloride were the nine medium constituents selected for the study . the plackett - burman experimental design , for 11 variables : nine nutritional components ( independent variables ) and two dummy variables [ table 1 ] , were used , to evaluate the relative importance of various nutrients for mevastatin production in the submerged culture . in table 2 , each row represents a different variable . for each nutrient variable two different concentrations high ( + ) and low ( - ) were tested [ table 2 ] . concentrations of variables at different levels in plackett - burman design for mevastatin production in submerged culture plackett - burman experimental design of 12 trials for 11 variables ( 9 nutrients + 2 dummies ) along with the observed concentration of mevastatin in fermentation broth mevastatin from fermentation broth was extracted according to the procedure given by chakarvarti and sahai , 2002b . fermentation broth ( 5 ml ) was adjusted to ph 6.5 with either acid ( h3po4 ) or alkali ( aq . naoh ) . the broth was diluted five - fold with absolute ethanol , filtered through a 0.22 m filter , and analyzed by high performance thin layer chromatography ( hptlc ) ( camag , muttenz , switzerland ) the extracted mevastatin were applied to the plates as 3-mm - width bands with a camag 100 l syringe , using a linomat v ( camag , muttenz , switzerland ) sample applicator on pre - coated silica gel aluminum plates 60f-254 ( 20 cm 10 cm , with 0.2 mm thickness , e. merck , germany ) . the sample application rate kept at 150 nl / s was employed and the space between two bands was kept at 12.3 mm . thin layer chromatography was performed using a mixture of toluene , ethyl acetate , and formic acid as the mobile phase , in the ratio of 3:2:1 per volume , in 10 10 cm twin through - glass chambers . densitometric scanning was performed on a camag tlc scanner iii in absorbance mode , at 238 nm , for mevastatin , after drying in a hot air oven for 10 minutes at 100c . the effect of each variable was determined according to the procedure given by plackett - burman . the percentage of contribution of each nutrient parameter was calculated by using design expert 7.1 software of stat ease inc . screening of the nutrient by the placket - burman experimental design for mevastatin production , using p. citrinum mtcc 1256 , was carried out in this study . maximum mevastatin production was found in experiment trial 2 ( 589.3 mg / l ) , minimum in 5 ( 38.9 mg / l ) [ table 2 ] , under submerged fermentation . the effect of the dummy variables 1 and 2 were close to zero [ table 3 ] , which indicates a successful experimental study . experimental error was calculated and found to be 0.00005 . among the nine nutrient components used in the study , glycerol , peptone , yeast extract , mgso4.7h2o , and cacl2.2h2o had contributed to a large extent in mevastatin production by p. citrinum mtcc 1256 . urea and oats had little impact , while glucose and arrowroot contributed moderately [ figure 1 ] . effect of different medium components on mevastatin production percent contribution and effect of factors used in the plackett - burman design it has been found that glycerol is useful as a carbon source , it has a high contribution , and is effective in a lesser amount , as glycerol is a significant limiting factor influencing the biosynthesis of statin via growth . peptone has been found to be a better nitrogen source than yeast extract for mevastatin production by p. citrinum mtcc 11256 . this is one reason why the growth of p. citrinum ( biomass ) largely depends on the type of nitrogen source . moreover , a suitable concentration of peptone is important for a higher production of mevastatin ; a lower biomass at lower peptone concentration results in less production of mevastatin . in fungal nutrition , magnesium and calcium are noted as macronutrients and manganese , iron , copper , and zinc as micronutrients , but in the case of mevastatin production by p. citrinum , the contribution by magnesium and calcium is higher than that by iron and manganese . designing the medium is an open - ended , time - consuming , laborious process , involving a large number of experiments . the plackett - burman experimental design is a preliminary technique for the rapid illustration of effects of various medium constituents . it tests each variable at two levels only ; hence , it can not give an exact idea regarding the optimum level of the constituents required in a medium . therefore , further optimization of selected nutrients , such as , glycerol , peptone , mgso4.7h2o , cacl2.2h2o , and kh2po4 for mevastatin production by penicillium citrinum , is necessary .

objective : mevastain , an hmg - coa reductase inhibitor produced by penicillium citrinum . the placket - burman experimental design was used to identify the important nutrients influencing the production of mevastatin by penicillium citrinum mtcc 1256 under submerged fermentation.materials and methods : nine nutritional parameters , such as , glucose , glycerol , arrowroot , oats , urea , peptone , yeast extract , mgso4.7h2o , and cacl2.2h2o were screened by placket - burman experimental design in 12 experimental run.results:nine nutritional parameters , glucose , glycerol , arrowroot , oats , urea , peptone , yeast extract , mgso4.7h2o , and cacl2.2h2o contributed with 0.8114% , 24.0390% , 2.2786% , 0.1491% , 0.5608% , 47.5029% , 6.8092 % , 4.0980% , 10.5823% respectively towards mevastatin production by penicillium citrinum under submerged fermentation.conclusion:among the nine nutrient components glycerol , peptone , yeast extract , mgso4.7h20 , and cacl2.2h2o contributed to a large extent , urea had little impact , while glucose , oats , and arrowroot contributed moderately on production of mevastatin .

Materials and Methods Microorganisms Seed culture and fermentation Plackett-Burman experimental design Extraction of mevastatin Estimation of mevastatin Data analysis of the Plackett-Burman design Results Discussion

most fish bones stick in the oropharynx and are within the province of the ear nose throat surgeon . thoracic complications due to esophageal penetration by an ingested foreign body are rare , with the reported incidence being 1% to 4% . incidence of complications by ingested fish bones can be of a more significant rarity because only approximately 9% to 45% ingested foreign bodies are fish bones . fatal hemorrhage followed by aortoesophageal fistula , aortic pseudoaneurysm , and severe mediastinitis is the most common cause of death . lung abscess caused by ingested fish bones is very rare . to date , less than ten similar cases have been reported in the literature . to our knowledge , there have been no cases reported in which this condition was treated using video - assist thoracic surgery ( vats ) . in november 2014 , a 47-year - old male public official was admitted to the department of thoracic surgery with the complaint of continuous cough and fever . the patient recalled that he had swallowed a bowl of fish soup in a drunken state twenty days before . he felt that a fish bone was impacted in his throat , and he tried several ways to pick it out . he made no gain even after having suffered great pains of trying inducing vomiting with his fingers , drinking a cup of vinegar , chewing gum and swallowing repeatedly . before deciding to seek medical intervention his sensation of foreign body impaction was relieved at that time by this self - service approach , but several days later , he began to suffer from the throat itching , dry cough , and a feeling of being very ill . he went to see doctor a week later but no abnormalities could be found by endoscopic and barium meal x - ray examinations . the dry cough continued and so did the fever that began fourteen days after the accident . a computed tomography ( ct ) scan at a local hospital revealed that a lung abscess and a foreign body embedded in his right upper lobe . after double - lumen intubation and in the lateral position , exploration by vats was carried out and a dissection of the lung abscess located in the right upper lobe tip section was performed . the 4-cm - long , sharp - blade shaped fish bone was successfully removed . we spent a bit more time treating hemorrhage of adhesion resulting from the stimulation of inflammation on the posterior chest wall . the surgical exploration revealed that there was no observable mediastinitis and the enlargement of the mediastinum seen in the ct film was proved to be the peripheral lung abscess . the surgical time was 50 minutes , and there was about 50 ml blood loss . after antibiotic therapy followed by observation , the patient was discharged with an uneventful recovery on the seventh day after surgery . there were no pulmonary or esophageal abnormalities at a follow - up appointment 3 months later . the case study was approved by the ethics committee of the second xiangya hospital , central south university , changsha , hunan , china . complications such as aortoesophageal fistula , aortic pseudoaneurysm and mediastinitis are extremely difficult to treat surgically . strategies using a thoracotomy with or without cardiopulmonary bypass or intravascular stent have been reported in the literature but often the erosion of the walls of the great vessels is too extensive to be repaired . potential life - threatening sequela such as severe thorax / mediastinal infection , massive hemoptysis or latent hemorrhage caused by erosion can occur , although these complications are not as urgent as aortic perforation . fish bones are the common kind of foreign bodies , which are easy to ingest because of their shape and size . when a fish bone stuck in the throat , many people adopt a strategy of swallowing a compact mass of food to press the fish bone downward . however , this approach can backfire if the fish bone has already penetrated the esophageal mucosa . in this patient , we suspect that it was the swallowed rice that forced the sharp blade - shaped fish bone completely into the right upper lobe parenchyma . the process was so quick as the patient complained of no initial esophageal symptoms and it could not be found by the endoscopic or barium x - ray examinations . fortunately for the patient there was no great vessel involvement during injury . although the diagnosis was supported by routine ct scanning , ct angiography before surgery is recommended to clarify the situation of vessel injury so as to reduce the probability to take adventure . there was no evidence of a visible injury to the esophagus based on ct scanning , barium x - ray and endoscopy , although there was a long period of time between the injury and treatment . these factors enable us to choose vats , which has not been reported before , to treat this patient . the good clinical outcome showed it to be safe , minimally invasive , and feasible ( figure 1 ) . ( a and b ) a 4-cm - long fish bone is shown embedded in the abscess in right upper lobe . in conclusion , vats procedure can be useful to obtain a good clinical outcome in a case of lung abscess from an ingested fish bone . however , it is also important to educate the public of the risks of trying to force an ingested object down into the stomach .

abstractwe report a case of lung abscess caused by an ingested fish bone that was successfully treated by minimally invasive surgery . although cases of ingested foreign body abscess are well reported , lung abscess caused by ingested fish bone is extremely rare . to date , less than 10 similar cases have been reported in the literature . to the best of our knowledge , the case presented in this case report is the first report of this kind that was successfully treated by video - assist thoracic surgery ( vats).a 47-year - old man was admitted to department of thoracic surgery with the complaint of continues dry cough and fever . the patient accidentally swallowed a long sharp - blade shaped fish bone 20 days before , which perforated the upper thoracic esophagus on the right and embedded in the right upper lobe.the diagnosis was verified by computed tomography scan and a video - assist thoracic surgery procedure was successfully performed to treat the patient . the patient survived the esophageal perforation fortunately without involvement of great vessel injury and probable mediastinitis.this report may provide additional experience on lung abscess caused by ingested fish bones . however , it is also important to educate the public of the risks of trying to force an ingested object down into the stomach .

INTRODUCTION CASE PRESENTATION DISCUSSION CONCLUSIONS

primordial dwarfism is a specific type of severe proportionate dwarfism , in which individuals are small for their chronological age from the very beginning of life . reported here is also an extremely rare association of mopd i with cardiovascular and brain malformations . we report a case of 800 g male baby born out of a non - consanguineous marriage , at 38 weeks , who presented with severe intra uterine growth restriction ( iugr ) , length ( 35 cm ) and head circumference ( 25 cm ) both below 3 centile , peculiar facies [ figure 1 ] alopecia totalis , prominent eyes , megalocornea , low set dysplastic ears [ figure 2 ] , short neck , broad nasal tip , flat malar region , micrognathia , cryptorchidism , micropenis and a rocker bottom foot . the clinical diagnosis was consistent with classical mopd i. echocardiography revealed a 0.8 mm subpulmonic ventricular septal defect ( vsd ) . antenatal ultrasound had revealed severe oligohydramnios and hypoplastic cerebrum with porencephalic cyst . postnatal magnetic resonance imaging ( mri ) brain showed pachygyria with multiple areas of gyral widening , corpus callosum agenesis with a left paramedian dorsal inter - hemispheric cyst . infantogram revealed mild bowing of the femoral diaphysis and absent epiphysis of the distal end of the femur . baby had uneventful neonatal period and was discharged on breast feeds . however , he succumbed to septicemia at 3 months of age . alopecia totalis , prominent eyes , pointed nose , micrognathia alopecia totalis , dysplastic low set ears primordial dwarfism is a disorder of extreme growth failure of prenatal onset . it encompasses distinct entities including russell - silver syndrome , seckel syndrome , meier - gorlin syndrome and mopd types i / iii and ii . mopd i is synonymous with brachymelic primordial dwarfism , taybi linder syndrome , cephalo - skeletal dysplasia , low birth weight dwarfism with skeletal dysplasia . mopd i phenotype consists of severe iugr , microcephaly , neuronal migration abnormalities , absent / sparse hair including scalp hair , eyebrows and eyelashes , dry and aged - appearing skin , multiple joint contractures and skeletal anomalies such as reduced height of the vertebrae , long clavicles , bowed femora or hip dislocation . many children have abnormalities in the brain seen on mri , such as corpus callosum agenesis , abnormal gyration , pachygyria . our case had classical features of mopd i described above and in addition had unusual association with a dorsal inter - hemispheric cyst in the brain and vsd .

less than 100 cases of primordial dwarfism have been reported worldwide out of which microcephalic osteodysplastic primordial dwarfism type i comprise about < 30 cases . we report a rare case of extreme growth failure in a neonate with primordial dwarfism of antenatal onset due to microcephalic osteodysplastic primordial dwarfism type i. our case is also unique in being associated with hitertho unreported association of subpulmonic ventricular septal defect and a dorsal interhemispheric cyst in the brain .

INTRODUCTION

spasticity is defined as a velocity - dependent increase in the tonic stretch response with excessive tendon jerk reflexes and is caused by the reduction of inhibitory impulses on lower motor neurons . spasticity can cause pain , muscle shortening , and orthopedic malformations , and it can severely interfere with functional abilities and gait pattern . cerebral palsy is a group of disorders of movement and posture due to a nonprogressive lesion of the developing brain . as a consequence of this definition , its causes are diverse . selective dorsal rhizotomy ( sdr ) is a neurosurgical treatment that is mainly performed at lumbar level in patients with bilateral spastic paresis . by incomplete transection of the ( sensory ) posterior lumbosacral rootlets , sdr reduces the excitatory input from the lower limbs that enters the spinal cord . in children with spastic cp , sdr leads to a more normal gait pattern [ 36 ] , better performance of the activities of daily life [ 7 , 8 ] , and improvement in gross motor function [ 613 ] . data on functional outcome after sdr in patients with other conditions than spastic cp are limited , though promising . detailed information about the clinical characteristics of the selected children , other than spasticity alone , is often lacking . medical history and clinical examination does not always provide sufficient evidence to establish the diagnosis of the underlying disorder in patients with cp . the quality standards subcommittee of the american academy of neurology and the practice committee of the child neurology society both advise magnetic resonance imaging ( mri ) of the brain for all cp patients . in patients with bilateral spastic cp , the most common mri abnormality is periventricular leucomalacia ( pvl ) , which is characterized by a damage of the periventricular white matter [ 1619 ] . gray matter lesions , early developmental abnormalities of the central nervous system , and abnormalities of the cerebrospinal fluid space , such as hydrocephalus , are less commonly found [ 1719 ] , and in some children with bilateral spastic cp no abnormalities are found with mri [ 1619 ] . in patients with normal mri findings and bilateral spastic paresis , genetic causes or spinal cord involvement should be considered . the goal of this study was to identify possible relationships between the mri findings with the level of gross motor function of the patient before sdr and the change in functioning after sdr . for this purpose , we retrospectively analyzed the mris of the patients who underwent sdr in our clinic . this study was part of the project : investigation of long - term effects of sdr in children with spastic diplegia and was approved by the medical ethical committee of the vu university medical center , amsterdam , the netherlands ( project number 2006/105 ) . the study population consisted of all the patients who underwent sdr in our clinic between january 1998 and december 2007 . the patients were selected for sdr according to the criteria shown in table 1 . in our previous study , we only included patients with bilateral spastic cp and documented pvl . in the present study , , we included data on patients who underwent pre- and postoperative gross motor function measure ( gmfm-66 ) analysis with a follow - up period of at least 12 months and of whom mri was available for review . table 1selection criteria for selective dorsal rhizotomy in the vu university medical centercriteria for selective dorsal rhizotomy1.)bilateral spasticity of the lower extremities interfering with walking performance2.)presence of spasticity ( defined as velocity - dependent resistance to passive stretch ) in at least six muscle groups of the lower limbs3.)sufficient force in the quadriceps femoris muscle ( squatting at least seven times ) and the hip extensors ( kneel with extended hips , support for balance allowed)4.)absence of structural orthopedic deformities or contractures at hip , knee , or ankle5.)presence of moderate to good selective motor control in the lower limbs6.)gross motor function classification system ( gmfcs ) level i , ii , or iii7.)good support from parents and rehabilitation setting selection criteria for selective dorsal rhizotomy in the vu university medical center selective dorsal rhizotomy was performed by the same neurosurgeon ( wvo ) in all children . dorsal roots l2-s1 were exposed and separated into different rootlets after laminotomy l2-l5 and opening of the dura . transection of the rootlets was performed after electro - stimulation , according to palpable muscle contraction and emg response . at most , 50% of the rootlets to prevent sexual and bladder disturbances , rootlets / fascicles showing electrical response after stimulation of the penis / the clitoris were spared . the mris were assessed at two different points in time by two investigators one neuropediatrician ( 8 years of experience in the assessment of mr neuroimaging ; rjv ) and one pediatrician with specialization in pediatric neurorehabilitation ( 2 years of experience in the assessment of mr neuroimaging ; sg ) . imaging was classified into three diagnostic groups according to the following criteria : periventricular leucomalacia ( pvl ; increased signal intensity of the periventricular white matter in t2 weighted imaging and/or flair ; other abnormalities optional ) ; hydrocephalus ( signs of ventricular dilatation and increased intracranial pressure ) ; normal mri ( see fig . 1a i ) . in one patient , the mr abnormalities could not be classified into one of the three diagnostic groups and he was excluded from further data analysis ( patient number 19 , table 2 ; his mri showed delayed myelinisation and slightly enlarged ventricular size but no other white matter abnormalities and there were no signs of increased intracranial pressure ) . in the patients with pvl , we graded the severity of their mri abnormalities based on the work of cioni et al . . the following items were assessed : ventricular size , evidence and extension of white matter signal intensity , evidence and extension of white matter loss , thinning of the corpus callosum , dimension ( size ) of subarachnoidal space , evidence and size of cysts , and presence of gray matter abnormalities . the items were scored on a three - point scale , with a score of three indicating the most severe mri abnormalities . the scores were summed to obtain a total score for each child ( minimal score , 7 and maximal score , 21 ) . if the two investigators did not agree , the classification and/or scoring were determined by a consensus . 1a i mr imaging of three patients with bilateral spastic paresis undergoing sdr . a , d , g midsagittal t1 weighted images . b , e , h transversal t2 weighted images at the level of the centrum semiovale . g , h , i transversal t2 weighted imaging at the level of the basal ganglia . d f mr images classified as periventricular leucomalacia showing thinning of the corpus callosum involving the total body ( fig . 1e ) , a slight ventricular enlargement , and a loss of the occipital white matter ( fig . 1i ) are enlargedtable 2summary of the characteristics of the patients included in the studycasegenderga ( weeks)bw ( g)age sdr years ( mts)follow - up years ( mts)mri classificationdiagnosisgmfm-66 before sdrgmfm-66 ( mean ) after sdr1f302,0005 ( 7)8 ( 5)pvlpvl50.8553.292f402,5005(7)9 ( 0)pvlpvl47.6849.663f403,4505 ( 8)8 ( 11)pvlpvl54.3855.714m301,6506 ( 8)8 ( 11)pvlpvl46.9148.325f281,2854 ( 11)7 ( 10)pvlpvl50.3254.756m261,0005 ( 3)7 ( 10)pvlpvl64.9867.827m322,5105 ( 1)6 ( 7)pvlpvl54.1560.388m331,2658 ( 9)5 ( 1)pvlpvl47.0955.929m268706 ( 11)3 ( 11)pvlpvl50.0954.3210m267805 ( 4)3 ( 0)pvlpvl52.3262.9811f413,0608 ( 4)5 ( 2)hydrocephaluscongenital hydrocephalus55.6256.3512m271,02010 ( 1)4 ( 5)hydrocephaluscongenital hydrocephalus68.8668.6913m403,3005 ( 9)7 ( 2)normalunknown65.3367.3114m343,1556 ( 11)3 ( 0)normalspinal process76.7585.1515m384,2808 ( 0)2 ( 7)normalunknown82.9989.7016f403,8758 ( 10)1 ( 7)normalhiv - encephalo(myelo)pathy73.6380.4617m394,0406 ( 7)2 ( 0)normalunknown65.9878.3818m403,4606 ( 5)1 ( 1)normalunknown73.6381.9319m373,4003 ( 11)7 ( 1)not classifiedlaurence moon syndrome47.2683.01f female , m male , ga gestational age , bw birth weight , sdr selective dorsal rhizotomy , gmfcs gross motor function classification system , gmfm gross motor function measure , pvl periventricular leucomalacia , g gram , mts months a b , e , h transversal t2 weighted images at the level of the centrum semiovale . g , h , i transversal t2 weighted imaging at the level of the basal ganglia . d f mr images classified as periventricular leucomalacia showing thinning of the corpus callosum involving the total body ( fig . 1e ) , a slight ventricular enlargement , and a loss of the occipital white matter ( fig . 1i ) are enlarged summary of the characteristics of the patients included in the study f female , m male , ga gestational age , bw birth weight , sdr selective dorsal rhizotomy , gmfcs gross motor function classification system , gmfm gross motor function measure , pvl periventricular leucomalacia , g gram , mts months all patients had a detailed pre- and postoperative clinical evaluation , including spasticity assessment , range of motion of single joints , gait analysis , and the gmfm . in this study the gmfm is a criterion - referenced observational measure that was developed to assess children with cp . the validity , reliability , and responsiveness of the gmfm have been demonstrated in a population of patients similar to the participants in the present study . for our data analysis , we used the gmfm-66 version , which assesses 66 items covering five gross motor dimensions ( lying and rolling / crawling and kneeling / standing and walking / running / jumping ) and is elaborated to a numerical scale ranging from 0 to 100 . as outcome parameters we used the mean of all postoperative gmfm-66 scores from 1 year after surgery . the changes after sdr were expressed as the difference between gmfm-66 score and the preoperative gmfm-66 score ( delta - gmfm-66 ) . agreement strengths for the kappa values were classified according to landis and koch . for the comparison of the outcome in patients with different mri characteristics , we used nonparametric tests ( kruskal walis test for group comparison ; post hoc analysis was performed using the mann this study was part of the project : investigation of long - term effects of sdr in children with spastic diplegia and was approved by the medical ethical committee of the vu university medical center , amsterdam , the netherlands ( project number 2006/105 ) . the study population consisted of all the patients who underwent sdr in our clinic between january 1998 and december 2007 . the patients were selected for sdr according to the criteria shown in table 1 . in our previous study , we only included patients with bilateral spastic cp and documented pvl . in the present study , , we included data on patients who underwent pre- and postoperative gross motor function measure ( gmfm-66 ) analysis with a follow - up period of at least 12 months and of whom mri was available for review . table 1selection criteria for selective dorsal rhizotomy in the vu university medical centercriteria for selective dorsal rhizotomy1.)bilateral spasticity of the lower extremities interfering with walking performance2.)presence of spasticity ( defined as velocity - dependent resistance to passive stretch ) in at least six muscle groups of the lower limbs3.)sufficient force in the quadriceps femoris muscle ( squatting at least seven times ) and the hip extensors ( kneel with extended hips , support for balance allowed)4.)absence of structural orthopedic deformities or contractures at hip , knee , or ankle5.)presence of moderate to good selective motor control in the lower limbs6.)gross motor function classification system ( gmfcs ) level i , ii , or iii7.)good support from parents and rehabilitation setting selection criteria for selective dorsal rhizotomy in the vu university medical center selective dorsal rhizotomy was performed by the same neurosurgeon ( wvo ) in all children . dorsal roots l2-s1 were exposed and separated into different rootlets after laminotomy l2-l5 and opening of the dura . transection of the rootlets was performed after electro - stimulation , according to palpable muscle contraction and emg response . at most , 50% of the rootlets rootlets / fascicles showing electrical response after stimulation of the penis / the clitoris were spared . the mris were assessed at two different points in time by two investigators one neuropediatrician ( 8 years of experience in the assessment of mr neuroimaging ; rjv ) and one pediatrician with specialization in pediatric neurorehabilitation ( 2 years of experience in the assessment of mr neuroimaging ; sg ) . imaging was classified into three diagnostic groups according to the following criteria : periventricular leucomalacia ( pvl ; increased signal intensity of the periventricular white matter in t2 weighted imaging and/or flair ; other abnormalities optional ) ; hydrocephalus ( signs of ventricular dilatation and increased intracranial pressure ) ; normal mri ( see fig . 1a i ) . in one patient , the mr abnormalities could not be classified into one of the three diagnostic groups and he was excluded from further data analysis ( patient number 19 , table 2 ; his mri showed delayed myelinisation and slightly enlarged ventricular size but no other white matter abnormalities and there were no signs of increased intracranial pressure ) . in the patients with pvl , we graded the severity of their mri abnormalities based on the work of cioni et al . . the following items were assessed : ventricular size , evidence and extension of white matter signal intensity , evidence and extension of white matter loss , thinning of the corpus callosum , dimension ( size ) of subarachnoidal space , evidence and size of cysts , and presence of gray matter abnormalities . the items were scored on a three - point scale , with a score of three indicating the most severe mri abnormalities . the scores were summed to obtain a total score for each child ( minimal score , 7 and maximal score , 21 ) . if the two investigators did not agree , the classification and/or scoring were determined by a consensus . 1a i mr imaging of three patients with bilateral spastic paresis undergoing sdr . a , d , g midsagittal t1 weighted images . b , e , h transversal t2 weighted images at the level of the centrum semiovale . g , h , i transversal t2 weighted imaging at the level of the basal ganglia . d f mr images classified as periventricular leucomalacia showing thinning of the corpus callosum involving the total body ( fig . 1e ) , a slight ventricular enlargement , and a loss of the occipital white matter ( fig . 1i ) are enlargedtable 2summary of the characteristics of the patients included in the studycasegenderga ( weeks)bw ( g)age sdr years ( mts)follow - up years ( mts)mri classificationdiagnosisgmfm-66 before sdrgmfm-66 ( mean ) after sdr1f302,0005 ( 7)8 ( 5)pvlpvl50.8553.292f402,5005(7)9 ( 0)pvlpvl47.6849.663f403,4505 ( 8)8 ( 11)pvlpvl54.3855.714m301,6506 ( 8)8 ( 11)pvlpvl46.9148.325f281,2854 ( 11)7 ( 10)pvlpvl50.3254.756m261,0005 ( 3)7 ( 10)pvlpvl64.9867.827m322,5105 ( 1)6 ( 7)pvlpvl54.1560.388m331,2658 ( 9)5 ( 1)pvlpvl47.0955.929m268706 ( 11)3 ( 11)pvlpvl50.0954.3210m267805 ( 4)3 ( 0)pvlpvl52.3262.9811f413,0608 ( 4)5 ( 2)hydrocephaluscongenital hydrocephalus55.6256.3512m271,02010 ( 1)4 ( 5)hydrocephaluscongenital hydrocephalus68.8668.6913m403,3005 ( 9)7 ( 2)normalunknown65.3367.3114m343,1556 ( 11)3 ( 0)normalspinal process76.7585.1515m384,2808 ( 0)2 ( 7)normalunknown82.9989.7016f403,8758 ( 10)1 ( 7)normalhiv - encephalo(myelo)pathy73.6380.4617m394,0406 ( 7)2 ( 0)normalunknown65.9878.3818m403,4606 ( 5)1 ( 1)normalunknown73.6381.9319m373,4003 ( 11)7 ( 1)not classifiedlaurence moon syndrome47.2683.01f female , m male , ga gestational age , bw birth weight , sdr selective dorsal rhizotomy , gmfcs gross motor function classification system , gmfm gross motor function measure , pvl periventricular leucomalacia , g gram , mts months a i mr imaging of three patients with bilateral spastic paresis undergoing sdr . a , d , g midsagittal t1 weighted images . b , e , h transversal t2 weighted images at the level of the centrum semiovale . g , h , i transversal t2 weighted imaging at the level of the basal ganglia . d f mr images classified as periventricular leucomalacia showing thinning of the corpus callosum involving the total body ( fig . 1e ) , a slight ventricular enlargement , and a loss of the occipital white matter ( fig . 1i ) are enlarged summary of the characteristics of the patients included in the study f female , m male , ga gestational age , bw birth weight , sdr selective dorsal rhizotomy , gmfcs gross motor function classification system , gmfm gross motor function measure , pvl periventricular leucomalacia , g gram , mts months all patients had a detailed pre- and postoperative clinical evaluation , including spasticity assessment , range of motion of single joints , gait analysis , and the gmfm . in this study , we only report the results of the gmfm . the gmfm is a criterion - referenced observational measure that was developed to assess children with cp . the validity , reliability , and responsiveness of the gmfm have been demonstrated in a population of patients similar to the participants in the present study . for our data analysis , we used the gmfm-66 version , which assesses 66 items covering five gross motor dimensions ( lying and rolling / crawling and kneeling / standing and walking / running / jumping ) and is elaborated to a numerical scale ranging from 0 to 100 . as outcome parameters we used the mean of all postoperative gmfm-66 scores from 1 year after surgery . the changes after sdr were expressed as the difference between gmfm-66 score and the preoperative gmfm-66 score ( delta - gmfm-66 ) . agreement strengths for the kappa values were classified according to landis and koch . for the comparison of the outcome in patients with different mri characteristics , we used nonparametric tests ( kruskal walis test for group comparison ; post hoc analysis was performed using the mann thirty - six patients underwent sdr of whom 32 patients had a brain mri performed before sdr , and 26 mris were available for review . of the patients with available mri , four did not have any preoperative gmfm-66 assessments . three patients had a gmfm-66 assessment before sdr but with a follow - up period of less than 12 months . the detailed patient characteristics of the remaining 19 patients are summarized in table 2 . the mean number of gmfm assessments per patient was 4.9 ( standard deviation ( sd ) 3.5 , range 1 to 12 ) , and the mean follow - up period was 5 years and 4 months ( sd 2 years and 9 months , range 1 year and 1 month to 9 years ) . the mean age at the time of the operation was 6 years and 10 months ( sd 1 year and 6 months , range 5 years and 9 months to 10 years and1 month ) . the age at the time of sdr neither correlate with the preoperative gmfm-66 ( rho , 0.328 ; p = 0.184 ) nor with the postoperative gmfm-66 scores ( rho , 0.336 ; p = 0.173 ) and the improvement after sdr ( rho , 0.049 ; p = 0.847 ) . we diagnosed pvl in ten patients , hydrocephalus in two patients , and no mri abnormalities in six patients . with respect to the grading of the mr abnormalities , the intrarater agreement was perfect for the frontal and occipital white matter loss , cysts , thinning of the corpus callosum , subarachnoidal space , and gray matter abnormalities ( kappa , 1.0 ) and almost perfect for the ventricular size ( kappa , 0.90 ) and the white matter signal intensities ( kappa , 0.87 ) . it was perfect for the subarachnoidal space and the gray matter abnormalities ( kappa , 1.0 ) , almost perfect for the ventricular size ( kappa , 0.90 ) , substantial for the occipital white matter loss ( kappa , 0.74 ) , and moderate for the frontal white matter loss ( kappa , 0.45 ) . kappa statistics could not be calculated for the white matter signal intensities , cysts , and thinning of the corpus callosum as only one of the two observers graded severe abnormalities ( according grade three on the point scale ) . with respect to the white matter signal intensities and the thinning of the corpus callosum , the observers disagreed in 25% of the scorings , with respect to the cysts there was a disagreement in 36% . the outcome parameters in patients with different mri classification are summarized in table 3 and in fig . the preoperative gmfm-66 scores were significantly higher in patients with normal mri than in patients with pvl ( p = 0.001 ) . patients with hydrocephalus had intermediate scores and did not differ significantly from the other groups . in the follow - up measurements , the mean gmfm-66 was the highest in patients with a normal mri ( group difference , p = 0.003 ; difference between pvl and normal , p = 0.002 ) . almost no improvement was observed in the patients with hydrocephalus ( group difference p = 0.030 ; difference between pvl and hydrocephalus , p = 0.032 ; difference between hydrocephalus and normal mri , p = 0.046 ) . there was a significant group difference in age at the time of the operation ( p = 0.028 ) . patients with normal mri and patients with hydrocephalus were older at the time of the operation than patients with pvl for the patients with normal mri this difference was significant ( p = 0.044 ) . table 3differences of gross motor outcome in with patients with different mri classificationnormal mri ( n = 6)pvl ( n = 10)hydrocephalus ( n = 2)total ( n = 18)p valuemeansdrangemeansdrangemeansdrangemeansdrangegmfm-66 before sdr73.16.765.383.051.95.346.965.062.29.455.668.960.111.546.983.00.002mean gmfm-66 after sdr80.57.667.389.756.35.948.367.862.58.756.368.765.113.048.389.70.003delta - gmfm-667.43.42.012.44.43.21.310.70.30.60.20.75.03.70.212.40.030mri magnetic resonance imaging , pvl periventricular leucomalacia , sd standard deviation , gmfm gross motor function measuresignificant difference with p < 0.05 ( mann whitney test ) between normal mri and pvlsignificant difference with p < 0.05 ( mann whitney test ) between normal mri and hydrocephalussignificant difference with p < 0.05 ( mann whitney test ) between hydrocephalus and pvlfig . 2box plots of the preoperative gmfm-66 ( white boxes ) and the mean values of all postoperative gmfm-66 measurements ( dashed boxes ) in patients with different mri classification . note that the largest improvements after sdr were observed in patients with normal mri and that the patients with hydrocephalus did not improve after sdr differences of gross motor outcome in with patients with different mri classification mri magnetic resonance imaging , pvl periventricular leucomalacia , sd standard deviation , gmfm gross motor function measure significant difference with p < 0.05 ( mann whitney test ) between normal mri and pvl significant difference with p < 0.05 ( mann whitney test ) between normal mri and hydrocephalus significant difference with p < 0.05 ( mann whitney test ) between hydrocephalus and pvl box plots of the preoperative gmfm-66 ( white boxes ) and the mean values of all postoperative gmfm-66 measurements ( dashed boxes ) in patients with different mri classification . note that the largest improvements after sdr were observed in patients with normal mri and that the patients with hydrocephalus did not improve after sdr the scoring of the mri abnormalities in the patients with pvl is summarized in table 4 . two patients with pvl did not show ventricular enlargement , and eight patients had moderate ventricular enlargement . nine patients had moderate occipital white matter loss , and one patient had moderate frontal white matter loss . small cysts were found in one patient , and large cysts were found in two . four patients had no thinning of the corpus callosum , and six patients had moderate thinning of the corpus callosum . none of the patients had gray matter abnormalities or an enlargement of the subarachnoidal space . the mean total score was 10.8 ( sd , 1.1 ; range , 8 to 12 ) . the ventricular size showed a significant correlation with the preoperative gmfm-66 score ( rho , 0.696 ; p = 0.025 ) . however , none of the items in the scoring correlated with the postoperative changes of the gmfm-66 . table 4scoring of the mr abnormalities in patients with periventricular leucomalacia ( n = 10)normalmoderatesevereventricular size2 ( 20%)8 ( 80%)0 ( 0%)white matter signal intensity0 ( 0%)10 ( 100%)0 ( 0%)white matter loss1 ( 10%)9 ( 90%)0 ( 0%)thinning of the corpus callosum4 ( 40%)6 ( 60%)0 ( 0%)cysts7 ( 70%)1 ( 10%)2 ( 20%)gray matter abnormality10 ( 100%)0 ( 0%)0 ( 0%)enlargement of the subarachnoidal space10 ( 100%)0 ( 0%)0 ( 0%)meansdrangetotal score10.81.1812 scoring of the mr abnormalities in patients with periventricular leucomalacia thirty - six patients underwent sdr of whom 32 patients had a brain mri performed before sdr , and 26 mris were available for review . of the patients with available mri , four did not have any preoperative gmfm-66 assessments . three patients had a gmfm-66 assessment before sdr but with a follow - up period of less than 12 months . the detailed patient characteristics of the remaining 19 patients are summarized in table 2 . the mean number of gmfm assessments per patient was 4.9 ( standard deviation ( sd ) 3.5 , range 1 to 12 ) , and the mean follow - up period was 5 years and 4 months ( sd 2 years and 9 months , range 1 year and 1 month to 9 years ) . the mean age at the time of the operation was 6 years and 10 months ( sd 1 year and 6 months , range 5 years and 9 months to 10 years and1 month ) . the age at the time of sdr neither correlate with the preoperative gmfm-66 ( rho , 0.328 ; p = 0.184 ) nor with the postoperative gmfm-66 scores ( rho , 0.336 ; p = 0.173 ) and the improvement after sdr ( rho , 0.049 ; p = 0.847 ) . we diagnosed pvl in ten patients , hydrocephalus in two patients , and no mri abnormalities in six patients . with respect to the grading of the mr abnormalities , the intrarater agreement was perfect for the frontal and occipital white matter loss , cysts , thinning of the corpus callosum , subarachnoidal space , and gray matter abnormalities ( kappa , 1.0 ) and almost perfect for the ventricular size ( kappa , 0.90 ) and the white matter signal intensities ( kappa , 0.87 ) . it was perfect for the subarachnoidal space and the gray matter abnormalities ( kappa , 1.0 ) , almost perfect for the ventricular size ( kappa , 0.90 ) , substantial for the occipital white matter loss ( kappa , 0.74 ) , and moderate for the frontal white matter loss ( kappa , 0.45 ) . kappa statistics could not be calculated for the white matter signal intensities , cysts , and thinning of the corpus callosum as only one of the two observers graded severe abnormalities ( according grade three on the point scale ) . with respect to the white matter signal intensities and the thinning of the corpus callosum , the observers disagreed in 25% of the scorings , with respect to the cysts there was a disagreement in 36% . the outcome parameters in patients with different mri classification are summarized in table 3 and in fig . 2 . the preoperative gmfm-66 scores were significantly higher in patients with normal mri than in patients with pvl ( p = 0.001 ) . patients with hydrocephalus had intermediate scores and did not differ significantly from the other groups . in the follow - up measurements , the mean gmfm-66 was the highest in patients with a normal mri ( group difference , p = 0.003 ; difference between pvl and normal , p = 0.002 ) . almost no improvement was observed in the patients with hydrocephalus ( group difference p = 0.030 ; difference between pvl and hydrocephalus , p = 0.032 ; difference between hydrocephalus and normal mri , p = 0.046 ) . there was a significant group difference in age at the time of the operation ( p = 0.028 ) . patients with normal mri and patients with hydrocephalus were older at the time of the operation than patients with pvl for the patients with normal mri this difference was significant ( p = 0.044 ) . table 3differences of gross motor outcome in with patients with different mri classificationnormal mri ( n = 6)pvl ( n = 10)hydrocephalus ( n = 2)total ( n = 18)p valuemeansdrangemeansdrangemeansdrangemeansdrangegmfm-66 before sdr73.16.765.383.051.95.346.965.062.29.455.668.960.111.546.983.00.002mean gmfm-66 after sdr80.57.667.389.756.35.948.367.862.58.756.368.765.113.048.389.70.003delta - gmfm-667.43.42.012.44.43.21.310.70.30.60.20.75.03.70.212.40.030mri magnetic resonance imaging , pvl periventricular leucomalacia , sd standard deviation , gmfm gross motor function measuresignificant difference with p < 0.05 ( mann whitney test ) between normal mri and pvlsignificant difference with p < 0.05 ( mann whitney test ) between normal mri and hydrocephalussignificant difference with p < 0.05 ( mann whitney test ) between hydrocephalus and pvlfig . 2box plots of the preoperative gmfm-66 ( white boxes ) and the mean values of all postoperative gmfm-66 measurements ( dashed boxes ) in patients with different mri classification . note that the largest improvements after sdr were observed in patients with normal mri and that the patients with hydrocephalus did not improve after sdr differences of gross motor outcome in with patients with different mri classification mri magnetic resonance imaging , pvl periventricular leucomalacia , sd standard deviation , gmfm gross motor function measure significant difference with p < 0.05 ( mann whitney test ) between normal mri and pvl significant difference with p < 0.05 ( mann whitney test ) between normal mri and hydrocephalus significant difference with p < 0.05 ( mann whitney test ) between hydrocephalus and pvl box plots of the preoperative gmfm-66 ( white boxes ) and the mean values of all postoperative gmfm-66 measurements ( dashed boxes ) in patients with different mri classification . note that the largest improvements after sdr were observed in patients with normal mri and that the patients with hydrocephalus did not improve after sdr the scoring of the mri abnormalities in the patients with pvl is summarized in table 4 . two patients with pvl did not show ventricular enlargement , and eight patients had moderate ventricular enlargement . nine patients had moderate occipital white matter loss , and one patient had moderate frontal white matter loss . small cysts were found in one patient , and large cysts were found in two . four patients had no thinning of the corpus callosum , and six patients had moderate thinning of the corpus callosum . none of the patients had gray matter abnormalities or an enlargement of the subarachnoidal space . the mean total score was 10.8 ( sd , 1.1 ; range , 8 to 12 ) . the ventricular size showed a significant correlation with the preoperative gmfm-66 score ( rho , 0.696 ; p = 0.025 ) . however , none of the items in the scoring correlated with the postoperative changes of the gmfm-66 . table 4scoring of the mr abnormalities in patients with periventricular leucomalacia ( n = 10)normalmoderatesevereventricular size2 ( 20%)8 ( 80%)0 ( 0%)white matter signal intensity0 ( 0%)10 ( 100%)0 ( 0%)white matter loss1 ( 10%)9 ( 90%)0 ( 0%)thinning of the corpus callosum4 ( 40%)6 ( 60%)0 ( 0%)cysts7 ( 70%)1 ( 10%)2 ( 20%)gray matter abnormality10 ( 100%)0 ( 0%)0 ( 0%)enlargement of the subarachnoidal space10 ( 100%)0 ( 0%)0 ( 0%)meansdrangetotal score10.81.1812 scoring of the mr abnormalities in patients with periventricular leucomalacia ( n = 10 ) the aim of this study was to identify possible relationships between mr characteristics and the level of functioning before and after sdr in patients with bilateral spastic paresis . we classified the mris in three mri categories : pvl , hydrocephalus , and normal mri and compared the postoperative improvement in the gmfm in the three groups . the best results were found in the group with normal mri , and the poorest results were found in patients with hydrocephalus . the poor outcome of patients with hydrocephalus could be a consequence of persistently elevated intracranial pressure , which can be observed in the absence of characteristic symptoms in children with cp . in the present study , both patients with hydrocephalus ( patient 11 and patient 12 ) underwent surgical correction . patient 12 was diagnosed with hydrocephalus a few months before sdr , and he underwent third ventriculostomy . unfortunately , there was no follow - up imaging available for either of these patients , and although neither of them showed any clinical evidence of elevated intracranial pressure , it can not be ruled out definitively . previous studies found greater postoperative improvements after sdr in children with less motor impairment [ 7 , 13 ] . in contrast , in the three randomized controlled trials comparing functional outcome after sdr , the poorest results were found in the study which included children with the best preoperative gross motor skills [ 9 , 10 ] . in the present study , the patients with normal mri had much better preoperative gross motor skills than the patients with pvl and hydrocephalus . mclaughlin et al . found an inverse correlation between the age at the time of the operation and the postoperative changes in the gmfm . this could be explained as a consequence of faster spontaneous motor development in early childhood . however , in our study , not only the children with hydrocephalus ( who showed the poorest outcome ) , but also the children with normal mri ( who showed the best outcome ) were older than the patients with pvl when sdr was performed . there was no correlation between the age at the time of sdr and outcome . in the patients with pvl , we graded the severity of the mr abnormalities and correlated them with the gross motor abilities . for this purpose , we used a grading scale that has previously been used to describe mr abnormalities in patients with spastic cp [ 20 , 24 ] . several explanations should be considered : it was difficult to detect cysts in an area with extensive gliosis , there is a difference between the level of experience with brain mri in the two investigators ( 2 years vs 8 years ) . correlations between ventricular size and gross motor abilities have been described previously in patients with spastic cp . in contrast to the findings of previous studies [ 20 , 24 , 26 ] , we did not find a correlation between gross motor skills and the total mri score / the thinning of the corpus callosum . however , the present study was limited to ambulatory patients with gmfcs levels i to iii , and patients with more severe motor handicaps where more severe brain abnormalities could be expected on mri have not been studied . no correlations were found between the severity of the brain anomalies and the outcome after sdr . the outcome assessment in the present study consisted in the gmfm-66 which according to the international classification of functioning , disability , and healths ( icf ) assesses the domain of activity . however , the other two domains of the icf body structure and participation have not been evaluated . unfortunately , we did not have access to all mri scans and not all patients had a preoperative gmfm assessment . we could only include data on a small number of patients in our analysis . notably , the group with hydrocephalus was small and comprised only two patients . therefore , the association between the type of brain lesion and the outcome after sdr needs to be proved in future studies with larger study samples , including the other icf domains body structure and participation . we found significant differences in the post - operative changes in the gmfm-66 in patients with different brain mri abnormalities . the largest postoperative improvement was observed in patients with normal mri , and the poorest outcome was observed in patients with hydrocephalus . in patients with pvl , we could not detect any relation between mri abnormalities and the postoperative improvement in of gross motor function after sdr . we conclude that mri of the brain can provide additional information for the selection of patients for sdr . however , the degree of pvl does not provide information about the degree of improvement in gross motor function after sdr .

purposeto identify mri characteristics that may predict the functional effect of selective dorsal rhizotomy ( sdr ) in children with bilateral spastic paresis.methodswe performed sdr in a group of 36 patients . the gross motor functioning measure-66 ( gmfm-66 ) was applied before and after sdr . available cerebral mris were retrospectively classified into three diagnostic groups : periventricular leucomalacia ( pvl ; n = 10 ) , hydrocephalus ( n = 2 ) , and normal ( n = 6 ) . in patients with pvl , we scored the severity of the mr abnormalities . we compared the changes in the gmfm-66 after sdr in the diagnostic groups . in patients with pvl , we correlated the severity of the mr abnormalities with the changes in the gmfm-66.resultsthe mean follow - up period was 5 years and 4 months ( range , 1 year and 1 month to 9 years ) . the best improvement in gross motor function was observed in patients with normal mri , and the slightest improvement was observed in patients with hydrocephalus . the severity of the pvl did correlate with the gmfm-66 score before sdr but not with the functional effect of sdr.conclusionwe conclude that with respect to gross motor skills , the improvements after sdr are good in patients with no mri abnormalities . in the patients with hydrocephalus , the improvements after sdr were insignificant . in patients with pvl , the improvements were intermediate and did not correlate with the degree of pvl .

Introduction Methods and materials Subjects Procedure Neuroimaging Outcome measure Statistical analysis Results Clinical characteristics and level of functioning Neuroimaging Discussion Conclusion

we previously identified a medullary population of basophils with few granules , which produce histamine together with il-4 and il-6in response to il-3 ( 6 ) . knowing that these cells also can take up histamine from the environment ( 10 ) , we examined whether this process affected their typical biologic activities . hence , we stimulated total or basophil - enriched bm cells for 24 h with il-3 in the presence or absence of histamine ( 10 and 10 m ) , before measuring cytokine production in supernatants . 1 a , histamine inhibited the generation of il-4 and il-6 in total and mature cell depleted lin bm cells . this decrease was preceded by lower mrna transcription , as measured by real - time pcr in lin bm cells that were incubated for 4 h with histamine ( 10 m ) . remarkably , transcription of hdc , the gene that encodes the histamine - forming enzyme , also was diminished ( fig . 1 a ) . histamine and h3/h4r ligands exert a similar inhibition on histamine and cytokine production by bm basophils . ( a ) effect of histamine on il-3induced il-4 and il-6 production as well as il-4 , il-6 , and hdc mrna expression . results are means sem from three separate experiments for bm cells and represent a typical experiment for lin cells . ( b ) effect of h3/h4r ligands on histamine production and uptake by bm cells stimulated with il-3 . data , expressed as percentage inhibition relative to controls , are means sem from three to seven separate experiments . cpf , ciproxifan ; mr , carboperamide ; cb , clobenpropit ; tp , thioperamide ; cz , clozapine ; i m , imetit . ( c ) inhibition of histamine and cytokine production by bmc in the presence of optimal concentrations ( 10 m ) of h3/h4r ligands . data , expressed as percentage inhibition relative to controls , are means sem from three separate experiments . based on our previous evidence that h3r antagonists bind to histamine - producing bm cells and compete with histamine for uptake ( 11 ) , we evaluated the effect of these drugs on histamine and cytokine production measured in culture supernatants after a 24-h exposure to il-3 . they diminished these biologic activities similarly to histamine itself ; the degree of inhibition correlated with their potency as inhibitors of histamine uptake ( fig . clobenpropit ( cb ) , classified as an h3r antagonist and an h4r agonist ( 12 ) , inhibited histamine uptake and synthesis , as did thioperamide , although it antagonizes h3 and h4 receptor binding . mr 16155 and ciproxifan , two h3r antagonists were the most potent inhibitors , in contrast with the less effective imetit , an agonist of h3 and h4r . none of the drugs impaired cell viability , as assessed by trypan blue exclusion or colorimetric mtt assay ( unpublished data ) . depletion of mature cells markedly increased il-3induced histamine production ( 391.0 15.3 ng/10 lin versus 65.7 3.9 ng/10 total bm cells ) , whereas cb maintained a similar inhibition ( 159.0 9.5 ng/10 lin versus 30.0 2.4 ng/10 total bm cells ; means sem from three separate experiments ) . the reduced histamine levels in bm cell supernatants after exposure to cb were due to lower histidine decarboxylase ( hdc ) activity as measured by the transformation of radiolabeled histidine into histamine ( 49,102 6,598 dpm / h / mg protein in controls incubated for 24 h with il-3 alone versus 25,923 5,360 dpm / h / mg protein in the presence of cb ; means sem from five separate experiments ; p < 0.05 ) . this was preceded by decreased hdc transcription , quantified by real - time pcr after a 4-h exposure to cb ( 81.0 12.53% decrease relative to controls ; mean sem from three separate experiments ) . as shown in fig . 1 c , h3/h4r ligands reduced the production of il-4 and il-6 similarly to histamine ( fig . 1 a ) , and cb decreased their mrna expression after a 4-h incubation of il-3-induced lin bmc ( 34.7 13.3% for il-6 and 67.0 11.4% for il-4 transcripts ; means sem from three separate experiments ) . in further support of the basophilic identity of histamine - producing cells , il-3induced lin bm cells produced il-13 , a typical basophil - associated cytokine ( 1 ) , which was inhibited similarly by cb ( 212 40 and 58 3 pg/10 cells , respectively ; means sd from two separate experiments ) . the preferential expression of h4r in the bm ( 13 ) , together with its pharmacologic characteristics , suggested its implication in histamine uptake ( 14 ) . yet , although h4r mrna was expressed in basophil - enriched bm cells ( fig . s1 , available at http://www.jem.org/cgi/content/full/jem.20050195/dc1 ) , the inhibition exerted by h3/h4r ligands was not impaired in mice in which the gene encoding either receptor had been disrupted ( fig . s1 ; references 15 and 16 ) , nor was it diminished in the presence of the highly specific h4r antagonist jnj7777120 ( not depicted ; reference 17 ) . furthermore , blocking h1 , h2 , and h4 receptors on bm cells from h3r mice did not prevent histamine uptake or inhibition of histamine and cytokine synthesis by the drugs ( unpublished data ) ; this ruled out the participation of any classical histamine receptor alone or in combination . recent progress in the characterization of transmembrane transporters , which enable small electrically charged molecules to cross the cell membrane , prompted us to address their potential role in histamine uptake by basophils . one member of the organic cation transporter family ( 1820 ) , oct3 , was particularly interesting in our model because of its relatively broad tissue distribution and usage of histamine as substrate ( 18 ) . oct3 mrna was detected easily in basophil - enriched lin bm cells and fcric - kit basophils sorted after 8 d of culture in il-3 ( fig . transcripts for oct1 , which can not transport histamine ( 18 ) , also were detected , whereas oct2 mrna was not ( fig . we examined the effect of several substrates or inhibitors of oct3 in our experimental set up , namely decynium 22 ( d22 ) , -estradiol , and corticosterone . 2 b , they reduced uptake and synthesis of histamine by bm cells that were exposed to il-3 , in accordance with their reported potencies for oct3 ( 1820 ) . in contrast , tetraethylammonium , which recognizes human oct1 and oct2 , but not human oct3 , had no such effect ( fig . 2 b ) . using radiolabeled 1-methyl-4-phenylpyridinium ( mpp ) , the prototypical substrate of octs , we found that it was effectively taken up by bm cells and inhibited by oct3 substrates , cb , and unlabeled histamine ( fig . 2 c ) . the low efficiency of histamine in inhibiting mpp uptake probably is explained by its exclusive transport by oct3 because it fails to label oct3 bm cells ( see fig . 4 a ) , whereas mpp also can interact with oct1 ( 18 ) , as confirmed by its residual labeling of oct3 bm cells ( not depicted ) . as shown in fig . 2 d , [ h]histamine and [ h]mpp uptake was enhanced greatly among sorted fcric - kit basophils ( 50 times on average ) , and inhibited by cb , mpp , and d22 ; this proved that oct3 is associated effectively with the basophil lineage . the transporter was clearly functional in these purified basophils because the large amounts of histamine generated in response to il-3 were decreased markedly in the presence of the drugs . ( a ) oct3 and oct1 mrnas are detected in basophil - enriched lin bm cells and sorted fcric - kit cells , in contrast with oct2 transcripts . ( c ) the prototypical substrate of octs , mpp , is taken up by bm basophils and inhibited by d22 , cb , -estradiol , and histamine ( data are means sem from three separate experiments ) . ( d ) electronically sorted fcric - kit basophils derived from bm cells cultured for 8 d in il-3 take up radiolabeled histamine and mpp and respond to cb , mpp , and d22 by decreasing their il-3induced histamine synthesis ( data represent a typical experiment out of three ) . the bidirectional mode of action of oct3 ( 19 , 20 ) , which is shared by the histamine transporter we reported previously ( 21 ) , provides an explanation for the paradox that h3/h4r ligands and inhibitors of oct3 exert the same effect on basophils as histamine itself . as shown in fig . 3 a , a 24-h incubation with cb significantly increased intracellular histamine levels in bm cells , whereas overall production and extracellular concentrations diminished . it is most likely due to a partial blockade of the outward transport after neosynthesis . it is plausible that the latter mechanism , which takes place continuously in many cells and does not involve granules , can be controlled by oct3 . the localization of intracellular histamine is likely to be important for the efficiency of the negative feedback because exogenous histamine at inhibitory doses induced 10-fold greater intracellular levels than those generated endogenously in response to il-3 and trapped inside the cells by the blockade of oct3 ( 117 12% increase after a 24-h exposure to il-3 + cb , versus 1,623 234% after uptake of exogenous histamine ; means sem from five different experiments ) . it is possible that histamine distributes differently inside the cells , depending on its origin . in its newly synthesized form it may remain in the cytosol preferentially , ready to exert its negative feedback , whereas exogenous histamine could be taken up and stored immediately in vesicles or granules , and thus , prevent most of its inhibitory action . although the intracellular localization of histamine is important , it remains possible that oct3 ligands enter the cells and synergize with histamine to enhance the susceptibility of basophils to the negative feedback . whatever the mechanism , the inhibition of cytokine production by cb depends on newly synthesized histamine , because it was diminished strikingly in hdc - deficient mice ( 23 ) , whereas exogenous histamine conserved its effect ( fig . it also was decreased when histamine synthesis was blocked by -fluoro - methyl histidine ( -fmh ) , the suicide substrate of hdc ( unpublished data ) . the disruption of the hdc gene had no effect on histamine uptake and its inhibition by cb and ciproxyfan , as shown in fig . ( a ) cb increases the intracellular histamine content of bm cells stimulated for 24 h with il-3 , whereas extracellular and total histamine decrease ( means sem from three separate experiments ) . ( b ) all inhibitory drugs tested increased the proportion of intracellular histamine in bm cells , relative to its overall il-3induced production ( means sem from three separate experiments ) . ( c ) the inhibition of il-6 production by cb ( 10 m ) is diminished strikingly in bm cells from histamine - deficient hdc mice , whereas exogenous histamine ( ha , 10 m ) remains effective . ( d ) histamine deficiency does not affect histamine uptake , and its inhibition by ciproxifan ( cpf ) and cb ( data are means sem from three separate experiments ) . ultimate proof of the implication of oct3 in histamine uptake and the ensuing diminution of the biologic activities of basophils was provided by the use of bm cells from mice in which the corresponding gene had been disrupted ( 24 ) . 4 a ) , nor was their cytokine production affected by histamine , cb , or d22 ( fig . 4 b ) . in accordance with the notion that oct3 behaves like a release valve for newly synthesized histamine , its intracellular levels were higher in bm cells from oct3-deficient mice than in their wild - type counterparts , both spontaneously and in response to a 24-h exposure to il-3 ( fig . 4 c ) . in contrast , extracellular histamine levels were significantly lower in bm cells from mice that lacked oct3 than in controls ( fig . 4 d ) , as was total histamine production . exocytosis of the few granules present in bm basophils ( 6 ) or vesicular secretion ( piecemeal degranulation ) , reported for basophils cultured in il-3 ( 25 ) , could account for the residual release in oct3-deficient mice ( fig . 4 d ) . il-6 and il-4 , generated during a 24-h incubation with il-3 , were decreased in bm cell supernatants from oct3-deficient mice , relative to wild - type controls ( fig . 4 e ) . this result indicates that in the absence of the transporter , when release of newly synthesized histamine is hampered , its intracellular levels increase sufficiently to trigger the negative feedback signal . in support of this notion , we found that il-3induced il-4 and il-6 synthesis in oct3 bm cells was enhanced significantly when histamine synthesis was abrogated by -fmh , the specific inhibitor of hdc ( 74 21% and 51 12% increase in il-3induced il-4 and il-6 production , respectively ; means sem from three separate experiments ) . oct3 and the transport system of histamine are identical . ( a ) oct3 deficiency abolishes histamine uptake , as compared with wild - type fvb / n bm cells ( data are means sem from five separate experiments ) . ( b ) oct3 deficiency prevents the inhibitory effect of histamine , cb , and d22 on il-3induced il-6 production by bm cells ( data are means sem from four separate experiments ) . ( c ) intracellular histamine is increased in bm cells from oct3 mice , whether they were stimulated for 24 h with il-3 or not . ( d ) in contrast , histamine levels in supernatants as well as total histamine production are decreased . ( e ) il-3induced il-6 and il-4 production by bm cells from oct3 mice is significantly lower than in wild - type controls . ( data are means sem from four separate experiments ; * p < 0.01 ) . the mechanism by which intracellular histamine decreases the transcription of cytokine and hdc genes remains unknown . involvement of molecules of the cytochrome p450 ( cyp450 ) family is most likely because it was shown that they bind histamine ( 26 ) . furthermore , their heme moiety recognizes various histamine receptor antagonists , particularly h3 receptor antagonists , such as thioperamide , cb , and ciproxifan ( 27 ) , which were effective in our experimental set up . in conclusion , we postulate that oct3 participates in the control of histamine and pro - th2 cytokine synthesis by modulating intracellular histamine levels . once it has attained a critical concentration in the cytosol , histamine is ready to exert its negative feedback control ; this alleviates its deleterious effect during allergic reactions , and hampers the development of th2 immune response ( 28 ) . h3r - deficient mice were provided by johnson & johnson pharmaceutical research department and development , l.l.c . , whereas oct3 mice were produced by zwart et al . recombinant murine il-3 and duoset elisa il-4 and il-6 kits were purchased from r&d systems . mr16155 ( carboperamide ) and ciproxifan were from bioproject , and cb dihydrobromide was from tocris . the specific h4r antagonist , jnj7777120 , was developed and provided by johnson & johnson ( 17 ) . all other histamine receptor ligands and oct3 substrates , as well as the irreversible hdc inhibitor , -fmh , were from sigma - aldrich . bm cells were prepared as reported ( 5 ) and adjusted to a final concentration of 2.5 10 per ml in culture medium ( mem ) supplemented with 10% horse serum ( all from gibco brl ) . various doses ( 1010 m ) of the drugs were added shortly before the addition of il-3 ( 1 ng / ml ) , followed by a 24-h incubation at 37c , 5% co2 . in some experiments , bm cells were enriched for histamine - producing cells using the spinsep depletion kit ( stemcell technologies inc . ) , which eliminates cells bearing lineage - specific antigens ( lin ) , according to the manufacturer 's instructions . basophil - enriched populations also were derived from total bm cells according to yoshimoto et al . after 89 d of culture with il-3 , the proportion of basophils was identified by their fcrc - kit phenotype . in some experiments they were 98% pure upon reanalysis , and contained a majority of cells with basophil morphology as assessed by mgg . il-6 and histamine was quantified by an automated continuous flow spectrofluorometric technique ( 5 ) . for binding experiments , 10 total bm cells , 10 lin , and 50,000 fcric - kit cells unless stated otherwise , the cells were incubated ( 37c , 5% co2 ) for 3 h with 3 ci / ml of [ h]histamine dihydrochloride ( 2.5 10 m ; 12 ci / mmol ) or 2 ci / ml of mpp ( 2.5 10 m ; 80 ci / mol ) in a final volume of 100 l . each experiment was performed in triplicate , and histamine binding was calculated from total cpm after subtraction of nonspecific binding to filters . rnas were extracted from 2 10 cells by trizol ( invitrogen ) , according to the supplier 's recommendations . primers and probes for mouse il-4 , il-6 , hdc , and gapdh real - time pcr were designed using the computer primer express software ( applied biosystems ) , except for h4r primers that were provided by f. cog ( servier laboratory , servier , france ) . pcr reactions contained 1 l cdna samples at different dilutions , 10 mm tris - hcl , ph 8.3 , 50 mm kcl , 5 mm mgcl2 , 200 m deoxyribonucleoside triphosphate , 100 nm of each primer , 200 nm of the specific probe , 60 nm passive reference ( rox ) , and 0.5 u hot gold star taq dna polymerase ( eurogentech ) . each amplification was performed in triplicate using the following conditions : 2 min at 50c and 10 min at 94c , followed by 45 cycles of 15 s at 94c and 30 s at 60c . the gapdh expression in each sample and expressed as relative expression using the ct method as described in the user bulletin # 2 from applied biosystems . the probes carried a 5 fam reporter label and a 3 dark quencher group and were synthesized by eurogentech . s1 shows histamine uptake and negative feedback on histamine and cytokine production by basophils is not mediated through h3/h4r . h3r - deficient mice were provided by johnson & johnson pharmaceutical research department and development , l.l.c . , whereas oct3 mice were produced by zwart et al . recombinant murine il-3 and duoset elisa il-4 and il-6 kits were purchased from r&d systems . mr16155 ( carboperamide ) and ciproxifan were from bioproject , and cb dihydrobromide was from tocris . the specific h4r antagonist , jnj7777120 , was developed and provided by johnson & johnson ( 17 ) . all other histamine receptor ligands and oct3 substrates , as well as the irreversible hdc inhibitor , -fmh , were from sigma - aldrich . bm cells were prepared as reported ( 5 ) and adjusted to a final concentration of 2.5 10 per ml in culture medium ( mem ) supplemented with 10% horse serum ( all from gibco brl ) . various doses ( 1010 m ) of the drugs were added shortly before the addition of il-3 ( 1 ng / ml ) , followed by a 24-h incubation at 37c , 5% co2 . in some experiments , bm cells were enriched for histamine - producing cells using the spinsep depletion kit ( stemcell technologies inc . ) , which eliminates cells bearing lineage - specific antigens ( lin ) , according to the manufacturer 's instructions . basophil - enriched populations also were derived from total bm cells according to yoshimoto et al . after 89 d of culture with il-3 , the proportion of basophils was identified by their fcrc - kit phenotype . in some experiments they were 98% pure upon reanalysis , and contained a majority of cells with basophil morphology as assessed by mgg . histamine was quantified by an automated continuous flow spectrofluorometric technique ( 5 ) . for binding experiments , 10 total bm cells , 10 lin , and 50,000 fcric - kit cells unless stated otherwise , the cells were incubated ( 37c , 5% co2 ) for 3 h with 3 ci / ml of [ h]histamine dihydrochloride ( 2.5 10 m ; 12 ci / mmol ) or 2 ci / ml of mpp ( 2.5 10 m ; 80 ci / mol ) in a final volume of 100 l . each experiment was performed in triplicate , and histamine binding was calculated from total cpm after subtraction of nonspecific binding to filters . rnas were extracted from 2 10 cells by trizol ( invitrogen ) , according to the supplier 's recommendations . primers and probes for mouse il-4 , il-6 , hdc , and gapdh real - time pcr were designed using the computer primer express software ( applied biosystems ) , except for h4r primers that were provided by f. cog ( servier laboratory , servier , france ) . pcr reactions contained 1 l cdna samples at different dilutions , 10 mm tris - hcl , ph 8.3 , 50 mm kcl , 5 mm mgcl2 , 200 m deoxyribonucleoside triphosphate , 100 nm of each primer , 200 nm of the specific probe , 60 nm passive reference ( rox ) , and 0.5 u hot gold star taq dna polymerase ( eurogentech ) . each amplification was performed in triplicate using the following conditions : 2 min at 50c and 10 min at 94c , followed by 45 cycles of 15 s at 94c and 30 s at 60c . the gapdh expression in each sample and expressed as relative expression using the ct method as described in the user bulletin # 2 from applied biosystems . the probes carried a 5 fam reporter label and a 3 dark quencher group and were synthesized by eurogentech . s1 shows histamine uptake and negative feedback on histamine and cytokine production by basophils is not mediated through h3/h4r .

in this study , we identify the bidirectional organic cation transporter 3 ( oct3/slc22a3 ) as the molecule responsible for histamine uptake by murine basophils . we demonstrate that oct3 participates in the control of basophil functions because exogenous histamine can inhibit its own synthesis and that of interleukin ( il)-4 , il-6 , and il-13through this means of transport . furthermore , ligands of h3/h4 histamine receptors or oct3 inhibit histamine uptake , and outward transport of newly synthesized histamine . by doing so , they increase the histamine content of basophils , which explains why they mimic the effect of exogenous histamine . these drugs were no longer effective in histamine - free histidine decarboxylase ( hdc)-deficient mice , in contrast with histamine itself . histamine was not taken up and lost its inhibitory effect in mice deficient for oct3 , which proved its specific involvement . intracellular histamine levels were increased strongly in il-3induced oct3/ bone marrow basophils , and explained why they generated fewer cytokines than their wild - type counterpart . their production was enhanced when histamine synthesis was blocked by the specific hdc inhibitor -fluoro - methyl histidine , and underscored the determinant role of histamine in the inhibitory effect . we postulate that pharmacologic modulation of histamine transport might become instrumental in the control of basophil functions during allergic diseases .

RESULTS AND DISCUSSION MATERIALS AND METHODS Mice and reagents. Cell cultures and flow cytometry. Cytokine assays, measurement of histamine production, and uptake. mRNA expression. Statistics. Online supplemental material.

stroke is a complex multifactorial disorder and a leading cause of mortality and morbidity worldwide . growing evidence has shown that inflammation appears to play crucial roles in the pathogenesis of is through the promotion of atherosclerosis . clinically , the incidence and outcome of is are influenced by systemic inflammatory processes , and stroke patients with systemic inflammation portend poorer outcomes [ 24 ] . experimentally , focal ischemic injury with acute and chronic inflammation induces production of proinflammatory mediators and recruitment of inflammatory cells , including neutrophils , t cells , and monocyte / macrophages [ 57 ] . in addition to some known risk factors , such as inflammation , advanced age , hypertension , and diabetes , genetic variants have been reported to contribute to the development of is [ 810 ] . identification of susceptibility genes is of great value to clarify the aetiology and improve prognostication , therapy , and prevention . subsequently , it was identified as a proinflammatory cytokine that is a 67 kd precursor protein consisting of 631 amino acids . il-16 is produced by activated cd8-positive ( cd8 + ) t cells and activates cd4 + t cells , monocytes , macrophages , and dendritic cells by binding to the cd4 molecular [ 16 , 17 ] . in addition to the activation of cd4 + t cells , il-16 can promote the secretion of inflammatory cytokines such as tumour necrosis factor ( tnf ) , interleukin-1 , and interleukin-6 ( il-6 ) . all of these cytokines are key elements in the ischemic cascade after cerebral ischemia [ 1922 ] . in 2000 , nakayama and colleagues found a -295t - to - c polymorphism in the promoter region of il-16 , which is related to different levels of gene expression . the polymorphism was reported to be associated with a series of inflammatory or autoimmune diseases , including crohn 's disease , allergic contact dermatitis , endometriosis , asthma , graves ' disease , and systemic lupus erythematosus ( sle ) . recently , another two functional polymorphisms ( i.e. , rs11556218 and rs4072111 ) were identified to be associated with sle and coronary artery disease ( cad ) [ 30 , 31 ] . to date , no data exist regarding the contribution of the il-16 polymorphisms to is . in this study , we aimed to assess the prevalence of the il-16 polymorphisms in is . the study was approved by the zhejiang hospital institutional review board for human subjects research , and written informed consent was obtained from all individuals . the study population comprised 434 unrelated chinese subjects who visited the zhejiang hospital between march 2010 and september 2012 . among them , 198 were patients with is ( 122 men and 76 women ) and 236 were healthy controls ( 155 men and 81 women ) . is was determined by the presence of a focal or global neurological deficit with symptoms and signs lasting more than 24 h. computed tomography and/or magnetic resonance image scanning of the brain was used to ascertain the diagnosis of is . hypertension was defined as having a systolic blood pressure 140 mmhg and/or a diastolic blood pressure 90 mmhg . diabetes mellitus was diagnosed if the fasting plasma glucose level 7.0 mmol / l or the plasma glucose 11.1 mmol / l 2 hours after a 75 g oral glucose tolerance test . mmol / l , and hypertriglyceridemia was determined by a fasting serum triglyceride level > 2.3 we used hospital - based controls that were age , gender , and ethnicity matched , without a history of is . il-16 polymorphisms were genotyped by performing polymerase chain reaction - restriction fragment length polymorphism ( pcr - rflp ) assay . randomly selected pcr products were examined by dna sequencing , and the results were 100% concordant . all data were analyzed using the spss software ( version 19.0 , spss inc . , , hardy - weinberg equilibrium was tested with a goodness - of - fit test . demographic and clinical data between cases and controls were compared using the test for dichotomous covariates and unpaired student 's t - test for continuous covariates . a binary logistic regression analysis was used to compute adjusted odds ratio ( or ) and 95% confidence intervals ( ci ) for evaluating the association of the il-16 polymorphisms with is . the genotype and allele frequencies of the rs4778889 t / c , rs11556218 t / g , and rs4072111 c / t polymorphisms in il-16 gene are summarized in table 2 . the genotype distributions of the three polymorphisms in controls were consistent with the hardy - weinberg equilibrium . the genotype frequencies of the rs11556218 t / g polymorphism were significantly different between cases and controls . the tg genotype of the rs11556218 t / g polymorphism was associated with a significantly increased risk of is compared with the tt genotype ( adjusted or = 1.88 ; 95% ci , 1.153.07 ) . similarly , the g allele of the rs11556218 t / g polymorphism was associated with a significantly increased risk of is compared with the t allele ( adjusted or = 1.54 ; 95% ci , 1.052.27 ) . however , there were no significant differences in the genotype and allele frequencies of il-16 rs4778889 t / c and rs4072111 c / t polymorphisms between the two groups , even after stratification analyses by age , gender , and the presence or absence of hypertension , diabetes mellitus , hypercholesterolemia , and hypertriglyceridemia . clinical and experimental data have demonstrated that inflammation plays fundamental roles in the pathogenesis of is [ 27 ] . an increased level of il-16 mrna and protein was observed in patients with inflammatory or autoimmune diseases , and the high expression of il-16 mrna correlated with increased numbers of cd4 + cells in acute skin lesions [ 36 , 37 ] . ischemic stroke patients had a high risk for systemic infections , and anti - inflammatory agents may be a promising approach to treating is [ 6 , 38 , 39 ] . based on the key roles of il-16 in inflammatory disorders , the association between il-16 polymorphism and the risk of inflammatory diseases has attracted widespread attention over the past decades . some authors reported that the rs4778889 polymorphism was associated with increased risks of developing allergic contact dermatitis , graves ' disease , sle , and endometriosis . in contrast , some researchers reported that the rs4778889 polymorphism was not related to the risk of periodontitis and cad [ 30 , 31 ] . in this study , we failed to find any association between the rs4778889 polymorphism and the risk of is . these findings suggest that the rs4778889 polymorphism may have different roles in different diseases . recently , another two nonsynonymous polymorphisms were identified ( rs11556218 t / g and rs4072111 c / t ) . the two polymorphisms were reported to be associated with increased risks of developing sle and cad [ 30 , 31 ] . in conformity with the results , we found that the frequency of the rs11556218tg genotype in is group was significantly higher than that in the control group , indicating that the il-16 rs11556218 polymorphism may be used as a genetic marker for is . although the mechanism of il-16 as an inflammatory mediator is still not fully known , there is evidence that il-16 participates in the inflammatory disorder through the activation of t lymphocytes and the secretion of inflammatory cytokines [ 41 , 42 ] . in the early stages following an ischemic stroke , t lymphocytes were activated , released reactive oxygen species , and finally contributed to brain injury . in the later stages depletion of t lymphocytes can reduce stroke size during the acute phase of ischemia , and the protective effect against stroke lasted in the later stages of infarct development . this evidence may explain the possible role of il-16 gene polymorphism in is . in conclusion , this study provides the first evidence for associations of il-16 gene polymorphisms with risk of is in the chinese population . the tg genotype and g allele of the rs11556218 polymorphism may have a promoting effect on is . however , further studies are warranted in order to shed more light on the molecular mechanism .

clinical and experimental data have demonstrated that inflammation plays fundamental roles in the pathogenesis of ischemic stroke . interleukin-16 ( il-16 ) is identified as a proinflammatory cytokine that is a key element in the ischemic cascade after cerebral ischemia . we aimed to examine the relationship between the il-16 polymorphisms and the risk of ischemic stroke in a chinese population . a total of 198 patients with ischemic stroke and 236 controls were genotyped using polymerase chain reaction - restriction fragment length polymorphism ( pcr - rflp ) and dna sequencing method . we found that the rs11556218tg genotype and g allele of il-16 were associated with significantly increased risks of ischemic stroke ( tg versus tt , adjusted or = 1.88 ; 95% ci , 1.153.07 ; g versus t , adjusted or = 1.54 ; 95% ci , 1.052.27 , resp . ) . however , there were no significant differences in the genotype and allele frequencies of il-16 rs4778889 t / c and rs4072111 c / t polymorphisms between the two groups , even after stratification analyses by age , gender , and the presence or absence of hypertension , diabetes mellitus , hypercholesterolemia , and hypertriglyceridemia . these findings indicate that the il-16 polymorphism may be related to the etiology of ischemic stroke in the chinese population .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

female nod / ltj and nod.scid mice were obtained from the jackson laboratory ( bar harbor , me ) and maintained under pathogen - free conditions . nod mice were screened for hyperglycemia at 12 weeks of age and diagnosed with diabetes when two consecutive glucose levels were > 200 mg / dl ( 2 ) . glucose levels were measured in whole blood from the tail vein using a glucometer elite xl ( bayer , elkhart , in ) . prediabetic nod mice were treated with intradermal phloridzin ( phz ) injections at 0.4 mg / kg per day for 14 days ( 15 ) . glycosuria induced by phz was detected for as long as 9 h after the injection . diabetic nod mice were treated with 10 g / day intraperitoneally ( i.p . ) of the mab 145 - 2c11 ( anti - mouse cd3 ) for 5 days beginning at the onset of hyperglycemia , as previously described ( 2 ) . reversal of diabetes was defined when random glucose levels were < 200 mg / dl for 2 weeks after diagnosis and persisted for > 10 days . glucose was injected i.p . at a dose of 4 g / kg per day . anti - cd3treated mice with reversed hyperglycemia for at least 10 days received daily injections of glucose or vehicle for 14 days . on day 14 , mice were subjected to an intraperitoneal glucose tolerance test ( ipgtt ) , and sera and pancreata were collected for additional analysis . in a separate set of experiments , nondiabetic 12- to 14-week - old nod.scid mice and 8- to 10-week - old nod mice were subjected to 14 days of either glucose or vehicle treatment . whole - blood glucose levels were measured from the tail vein taken before and 15 , 30 , 60 , and , in some experiments , 120 min after the injection . after fixation , pancreatic tissue was placed in a sucrose gradient and snap frozen in liquid nitrogen . noncontiguous 14-m pancreatic sections were stained with antibodies to insulin ( invitrogen , carlsbad , ca ) , 4,6-diamidine-2-phenylindole dihydrochloride ( dapi ) , cd31 ( bd biosciences , san jose , ca ) , and either ki67 or vegf ( abcam , cambridge , ma ) . the bound antibodies were detected by immunofluorescent secondary antibodies ( jackson immunoresearch , west grove , pa ) . for whole - tissue sections , 5 images were captured using mosaix software ( carl zeiss , thornwood , ny ) . numbers of single - color and dual - color labeled cells were counted using functions in imagej ( colocalization , watershed , and analyze particles ) . the total pancreatic section area and insulin cells were measure using imagej ( 16 ) . insulin concentration was measured on a continuous scale using automated quantitative analysis ( aqua ) , as has been previously described ( 17 ) . in brief , a series of high - resolution monochromatic images were captured using an automated microscope platform ( pm-2000tm ; historx , new haven , ct ) . fluorescent chromagens ( dapi , cy3-insulin ) were used to demarcate insulin cells within each whole - section image . dapi staining of cell nuclei was used to generate the nuclear compartment . subtracting the generated nuclear compartment from the masked cell area created a nonnuclear compartment , which included both the cytoplasm and the membrane . to generate an aqua score , each pixel was recorded on a scale of 0 ( black ) to 255 ( white ) , and pixel intensity was defined using the following equation : ( target pixel intensity ) ( compartment pixel intensity/255 ) . using the target and compartment pixel intensities , the following equation was generated : ( sum of all target pixel intensities)/(sum of all compartment pixel intensities/255 ) = the aqua score . all scores are normalized for image - exposure time and bit depth , allowing direct comparison of different histospot / whole - section scores . islets were isolated from nod or nod.scid mice after digestion with collagenase ( liberase ; roche , indianapolis , in ) ( 18 ) . islets were handpicked twice with an inverted microscope . to examine the effects of increasing glucose concentrations on vegf expression , islets were cultured in 10% fetal calf serum glucose - free rpmi ( mediatech , manassas , va ) supplemented with indicated glucose concentrations for 24 h. in some experiments , preconditioned islet culture media was collected and added to cultures of freshly isolated nod.scid islets . after incubation , islets were harvested and total rna was extracted using an rnaeasy kit according to the manufacturer s protocol ( qiagen , valencia , ca ) . purified islets from either nod or nod.scid donors were incubated with 5 or 10 mmol / l glucose for 7 days and then dispersed using trypsin digestion . we used bs-1 rather than cd31 for identification of endothelial cells because of cd31 sensitivity to trypsin digestion . examination of vegf-120 , vegf-164 , and vegf-188 levels was quantitated by real - time pcr using sybr green ( qiagen , valencia , ca ) on the iq-5 multicolor real - time pcr system ( bio - rad , hercules , ca ) . pcr primer pairs were as follows : gapdh : forward ctgcaccaccaactgcttag , reverse gatggcatggactgtggtcat ; and vegf : exon 3 common forward primer atcttcaagccgtcctgtgtgc , 120 reverse ttggcttgtcacatttttctgg , 164 reverse caaggctcacagtgattttctgg , and 188 reverse atcttcaagccgtcctgtgtgc . prediabetic nod mice were treated with intradermal phloridzin ( phz ) injections at 0.4 mg / kg per day for 14 days ( 15 ) . glycosuria induced by phz was detected for as long as 9 h after the injection . diabetic nod mice were treated with 10 g / day intraperitoneally ( i.p . ) of the mab 145 - 2c11 ( anti - mouse cd3 ) for 5 days beginning at the onset of hyperglycemia , as previously described ( 2 ) . reversal of diabetes was defined when random glucose levels were < 200 mg / dl for 2 weeks after diagnosis and persisted for > 10 days . glucose was injected i.p . at a dose of 4 g / kg per day . anti - cd3treated mice with reversed hyperglycemia for at least 10 days received daily injections of glucose or vehicle for 14 days . on day 14 , mice were subjected to an intraperitoneal glucose tolerance test ( ipgtt ) , and sera and pancreata were collected for additional analysis . in a separate set of experiments , nondiabetic 12- to 14-week - old nod.scid mice and 8- to 10-week - old nod mice were subjected to 14 days of either glucose or vehicle treatment . mice undergoing an ipgtt were fasted overnight . they received a 2 g / kg i.p . whole - blood glucose levels were measured from the tail vein taken before and 15 , 30 , 60 , and , in some experiments , 120 min after the injection . noncontiguous 14-m pancreatic sections were stained with antibodies to insulin ( invitrogen , carlsbad , ca ) , 4,6-diamidine-2-phenylindole dihydrochloride ( dapi ) , cd31 ( bd biosciences , san jose , ca ) , and either ki67 or vegf ( abcam , cambridge , ma ) . the bound antibodies were detected by immunofluorescent secondary antibodies ( jackson immunoresearch , west grove , pa ) . for whole - tissue sections , 5 images were captured using mosaix software ( carl zeiss , thornwood , ny ) . numbers of single - color and dual - color labeled cells were counted using functions in imagej ( colocalization , watershed , and analyze particles ) . the total pancreatic section area and insulin cells were measure using imagej ( 16 ) . insulin concentration was measured on a continuous scale using automated quantitative analysis ( aqua ) , as has been previously described ( 17 ) . in brief , a series of high - resolution monochromatic images were captured using an automated microscope platform ( pm-2000tm ; historx , new haven , ct ) . fluorescent chromagens ( dapi , cy3-insulin ) were used to demarcate insulin cells within each whole - section image . dapi staining of cell nuclei was used to generate the nuclear compartment . subtracting the generated nuclear compartment from the masked cell area created a nonnuclear compartment , which included both the cytoplasm and the membrane . to generate an aqua score , each pixel was recorded on a scale of 0 ( black ) to 255 ( white ) , and pixel intensity was defined using the following equation : ( target pixel intensity ) ( compartment pixel intensity/255 ) . using the target and compartment pixel intensities , the following equation was generated : ( sum of all target pixel intensities)/(sum of all compartment pixel intensities/255 ) = the aqua score . all scores are normalized for image - exposure time and bit depth , allowing direct comparison of different histospot / whole - section scores . islets were isolated from nod or nod.scid mice after digestion with collagenase ( liberase ; roche , indianapolis , in ) ( 18 ) . islets were handpicked twice with an inverted microscope . to examine the effects of increasing glucose concentrations on vegf expression , islets were cultured in 10% fetal calf serum glucose - free rpmi ( mediatech , manassas , va ) supplemented with indicated glucose concentrations for 24 h. in some experiments , preconditioned islet culture media was collected and added to cultures of freshly isolated nod.scid islets . after incubation , islets were harvested and total rna was extracted using an rnaeasy kit according to the manufacturer s protocol ( qiagen , valencia , ca ) . purified islets from either nod or nod.scid donors were incubated with 5 or 10 mmol / l glucose for 7 days and then dispersed using trypsin digestion . we used bs-1 rather than cd31 for identification of endothelial cells because of cd31 sensitivity to trypsin digestion . examination of vegf-120 , vegf-164 , and vegf-188 levels was quantitated by real - time pcr using sybr green ( qiagen , valencia , ca ) on the iq-5 multicolor real - time pcr system ( bio - rad , hercules , ca ) . pcr primer pairs were as follows : gapdh : forward ctgcaccaccaactgcttag , reverse gatggcatggactgtggtcat ; and vegf : exon 3 common forward primer atcttcaagccgtcctgtgtgc , 120 reverse ttggcttgtcacatttttctgg , 164 reverse caaggctcacagtgattttctgg , and 188 reverse atcttcaagccgtcctgtgtgc . examination of prediabetic mice showed impaired glucose tolerance in 13-week - old nod mice when compared with 9-week - old nod mice ( fig . 1a ; area under the curve at 9 weeks = 8,702 vs. at 13 weeks = 11,195 ; p < 0.05 ) . previous studies have described a decline in islet vascular area in nod mice during the progression of diabetes ( 9 ) , but the relationship between these changes and the impairment of glucose tolerance in nod mice has not been directly evaluated . we therefore studied the islet vascular area in prediabetic mice and after recovery from hyperglycemia in diabetic nod mice that were treated with anti - cd3 mabs . reduced cd31 area was evident as early as 9 weeks of age when compared with nonautoimmune nod.scid animals ( fig . although there was not a direct relationship between changes in glucose tolerance and islet vasculature during prediabetes , there was a sharp decline in cd31 area in the islets at the time of diabetes onset ( fig . anti - cd3treated diabetic nod mice fail to normalize their ipgtts and endothelial cell area in the islet . a : ipgtts of prediabetic mice at the ages of 9 , 11 , and 13 weeks ( n = 5 each group ) and after anti - cd3 treatment ( n = 12 ) . b : quantitative histomorphic analysis of cd31 in pancreatic sections ( n = 3 and four mice of islets from prediabetic , diabetic , and anti - cd3treated nod mice and n = 3 and four mice at each time point ) ( mean se ) . the cd31 area in the islets was compared with the same in nonautoimmune nod.scid mice by anova ( top line , p < 0.0001 ) and by the dunnett multiple comparison test ( * p < 0.05 ; * * * p < 0.001 ) and with mice with new - onset diabetes ( bottom line , anova p < 0.0001 and * * p < 0.01 ; * * * p < 0.001 ) . c : immunofluoresence staining samples of representative islets from 13-week - old nonautoimmune nod.scid mice , prediabetic nod mice , and nod mice with new - onset diabetes . blue , dapi ; red , insulin ; green , cd31 . ( a high - quality digital representation of this figure is available in the online issue . ) next , we treated newly diabetic nod mice with anti - cd3 mabs and found that the nonfasting glucose levels returned to nondiabetic levels of < 200 mg / dl for a period > 2 consecutive weeks ( 154.9 8.2 mg / dl ) . however , when challenged with an ipgtt , these mice showed glucose intolerance when compared with 9-week - old nod mice ( fig . 1a ; area under the curve at 9 weeks = 8,702 vs. anti - cd3treated = 16,578 ; p < 0.0001 ) . in addition , the endothelial cell density was not normalized after anti - cd3 mab therapy and remained significantly reduced when compared with nod.scid or 9-week - old nod mice ( fig . these results show a loss of endothelial cells in the islet during prediabetes that is concomitant with deterioration of glucose tolerance , both of which are not fully corrected following anti - cd3 treatment . to determine the relationship between changes in glucose and the cd31 cell density , we treated prediabetic nod mice with normal ( 8 weeks old ) or impaired ( 12 weeks old ) results from the ipgtt with daily injections of phz for a period of 14 days . first , we tested phz effects on glucose load in normoglycemic balb / c during the ipgtt . phz injection increased clearance of blood glucose , as indicated by a more rapid return to baseline glucose levels ( supplementary fig . daily phz injections of 12-week - old nod mice reduced endothelial cell density when compared with vehicle - treated mice ( fig . interestingly , phz also decreased the rates of -cell proliferation ( table 1 and supplementary fig . 3 ) , which is consistent with the previously described effects of glucose on -cell proliferation in prediabetic mice ( 13 ) . in contrast , phz treatment of 8-week - old nod mice , with normal ipgtt results , did not reduce endothelial cell density ( fig . histomorphic analysis of pancreata ( n 3 per group ) cd31 area in 8-week - old ( a ) and 12-week - old ( b ) prediabetic nod mice after daily injections of phz for a period of 14 days ( * p < 0.04 ) . c : endothelial cell area in diabetic and anti - cd3treated nod mice receiving either vehicle or glucose injections for 14 days . d : as in c but with immunodeficient nod.scid mice . * p < 0.05 ; * * p < 0.001 . proliferation levels in islets of prediabetic and anti - cd3treated mice data are means se . we also tested whether an increase in glucose in mice with impaired glucose tolerance would have the opposite effect . recovered anti - cd3treated nod mice showing a minimum of 10 consecutive days of basal euglycemia received daily injections of glucose ( 4 mg / kg i.p . ) for 14 days . glucose injections significantly increased endothelial cell density to a density similar in prediabetic nod mice when compared with vehicle - treated controls ( fig . in contrast , similar treatment of nod.scid mice with daily glucose injections failed to increase endothelial cell density in islets ( fig . these data suggest that fluctuation in daily glucose may modulate endothelial cell density under the conditions of islet inflammation . next , we tested the physiological consequences of increased endothelial cell density in glucose - treated anti - cd3treated nod mice . interestingly , despite the presence of impaired glucose tolerance before treatment , glucose - treated anti - cd3 mice showed improved ipgtt results when compared with vehicle - treated mice ( fig . 3a and b ; p < 0.05 ) . fasting insulin levels in glucose - treated mice were higher than in placebo - treated mice ( vehicle = 0.61 ng / ml vs. glucose = 0.90 ng / ml ; p < 0.06 ) ; however , no increase in -cell mass was detected ( fig . 3c ) . therefore , to examine the effect of glucose on insulin content in individual -cells , we used the aqua score to measure the content of insulin . the aqua score has been validated for protein quantization in histological section of malignant tissues in which good reproducibility and linearity with protein content of tissues has been validated ( 1823 ) . aqua score analysis revealed increased levels of insulin staining per -cell in glucose - treated mice ( fig . glucose treatment of anti - cd3treated mice did not increase -cell proliferation , albeit proliferation was at relatively high levels in both vehicle- and glucose - treated mice ( table 1).these results suggest that increased islet endothelial cell density may promote -cell function by increasing insulin content rather than -cell proliferation after treatment with anti - cd3 antibodies . daily glucose injections improve glucose tolerance and increase insulin content in anti - cd3treated nod mice . a : representative ipgtts of anti - cd3treated mice with normal basal glucose levels receiving daily injections of either vehicle ( left panel ) or glucose ( right panel ) intraperitoneally ( , pretreatment ; , posttreatment ) . b : summary of changes in ipgtt results of anti - cd3treated diabetic mice with normal basal glucose levels after a 14-day challenge of daily injections of either glucose or vehicle . * p < 0.04 ( n = 12 per group ) . stained pancreatic section of vehicle- and glucose - treated mice for insulin cells . d : aqua scores of insulin levels per -cell as described in research design and methods . * p < 0.03 . ins , insulin . to understand the basis for increased endothelial cell density after glucose treatment , we measured vegf production in the islets of glucose - treated anti - cd3treated mice by histomorphic analysis . preliminary immunofluorescence staining revealed an increase in vegf levels in prediabetic nod islets compared with nod.scid islets ( supplementary fig . , daily glucose injections resulted in increased vegf expression in the islets when compared with vehicle - treated mice ( fig . 4a ; p < 0.02 ) , suggesting that vegf production by resident or infiltrating islet cells can promote islets in response to glucose . to directly examine the effects of glucose on endothelial cell numbers , we incubated purified islets from either nod or nod.scid donors at either 5 mmol / l or 10 mmol / l glucose for 7 days followed by fluorescence - activated cell sorter analysis of bs-1 endothelial cells . nod islets incubated at 10 mmol / l glucose showed better maintenance of endothelial cells when compared with islets incubated at 5 mmol , high glucose levels failed to maintain endothelial cell levels in islets derived from nod / scid mice when compared with islets incubated at 5 mmol 4b ) . quantitative pcr analysis of purified endothelial cells from nod islets cultured at 10 mmol / l glucose showed a 4.2-fold increase in the expression of the antiapoptotic bcl - xl gene ( cycle difference from gapdh : nod = 1.87 0.73 vs. nod.scid = 0.44 0.07 ; p = 0.10 ) , whereas ki67 gene expression remained unchanged ( data not shown ) . high glucose levels stimulate vegf expression under the conditions of islet inflammation . a : histomorphic analysis of islets from the pancreatic section of vehicle- or glucose - treated anti - cd3treated nod mice ( p < 0.02 ) . b : purified islets from 8- to 10-week - old nod or nod.scid mice were incubated in either 5 or 10 mmol / l glucose for 7 days . after incubation , islets were dispersed and endothelial cell frequency was analyzed using fluorescence - activated cell sorter of bs-1 cells as described in research design and methods . left panel : a representative histogram depicting a sample of two nod or nod.scid islet cultures stained for bs-1 . right panel : summary of the percentage of bs-1 cells after culture in 5 or 10 mmol / l glucose . c : purified islets from 8- to 10-week - old nod ( left ) or nod.scid ( right ) mice as in b were incubated with increasing concentrations of glucose . quantitative rt - pcr was done for vegf-120 and vegf-164 isoforms in the islets ( * p < 0.05 ) . n 3 per group . because vegf - a is the main regulator of endothelial cell maintenance , we tested whether increased glucose had a differential effect on vegf production by islets from nod and nod.scid mice ex vivo . purified islets from 8- to 10-week - old mice were incubated with increasing concentrations of glucose for 24 h followed by mrna extraction . rt - pcr analysis of vegf-120 , vegf-164 , and vegf-188 mrna isoforms revealed a fivefold increase in vegf-120 and vegf-164 production in the islets of nod mice , whereas vegf-188 was undetectable ( fig . this increase was evident at glucose concentrations of 5 , 10 , 20 , and 40 mmol / l ( fig . in contrast , hyperglycemia did not induce vegf production in cultured islets form nod.scid mice ( fig . these findings were consistent with the lack of an effect of glucose on vascular area in nod.scid mice treated with glucose but left open the possibility that during inflammation , islets could acquire the ability to produce vegf after direct immune injury or in response to soluble factors produced by the infiltrating cells . to test this , we cultured nod.scid islets with supernatants collected after a 72-h incubation of nod islets in 10 mmol / l glucose and measured vegf production by real - time pcr . there was a significant increase in vegf-120 and vegf-164 after incubation with islets from nod but not control nod.scid mice ( fig . this increase was more pronounced in the vegf-164 isoform , suggesting that the vegf-120 isoform may derive from a non - islet resident cell ( fig . these data suggest that inflammation can promote the production of vegf - a in the islet by a yet - unidentified soluble factor . examination of prediabetic mice showed impaired glucose tolerance in 13-week - old nod mice when compared with 9-week - old nod mice ( fig . 1a ; area under the curve at 9 weeks = 8,702 vs. at 13 weeks = 11,195 ; p < 0.05 ) . previous studies have described a decline in islet vascular area in nod mice during the progression of diabetes ( 9 ) , but the relationship between these changes and the impairment of glucose tolerance in nod mice has not been directly evaluated . we therefore studied the islet vascular area in prediabetic mice and after recovery from hyperglycemia in diabetic nod mice that were treated with anti - cd3 mabs . reduced cd31 area was evident as early as 9 weeks of age when compared with nonautoimmune nod.scid animals ( fig . although there was not a direct relationship between changes in glucose tolerance and islet vasculature during prediabetes , there was a sharp decline in cd31 area in the islets at the time of diabetes onset ( fig . anti - cd3treated diabetic nod mice fail to normalize their ipgtts and endothelial cell area in the islet . a : ipgtts of prediabetic mice at the ages of 9 , 11 , and 13 weeks ( n = 5 each group ) and after anti - cd3 treatment ( n = 12 ) . b : quantitative histomorphic analysis of cd31 in pancreatic sections ( n = 3 and four mice of islets from prediabetic , diabetic , and anti - cd3treated nod mice and n = 3 and four mice at each time point ) ( mean se ) . the cd31 area in the islets was compared with the same in nonautoimmune nod.scid mice by anova ( top line , p < 0.0001 ) and by the dunnett multiple comparison test ( * p < 0.05 ; * * * p < 0.001 ) and with mice with new - onset diabetes ( bottom line , anova p < 0.0001 and * * p < 0.01 ; * * * p < 0.001 ) . c : immunofluoresence staining samples of representative islets from 13-week - old nonautoimmune nod.scid mice , prediabetic nod mice , and nod mice with new - onset diabetes . blue , dapi ; red , insulin ; green , cd31 . ( a high - quality digital representation of this figure is available in the online issue . ) next , we treated newly diabetic nod mice with anti - cd3 mabs and found that the nonfasting glucose levels returned to nondiabetic levels of < 200 mg / dl for a period > 2 consecutive weeks ( 154.9 8.2 mg / dl ) . however , when challenged with an ipgtt , these mice showed glucose intolerance when compared with 9-week - old nod mice ( fig . 1a ; area under the curve at 9 weeks = 8,702 vs. anti - cd3treated = 16,578 ; p < 0.0001 ) . in addition , the endothelial cell density was not normalized after anti - cd3 mab therapy and remained significantly reduced when compared with nod.scid or 9-week - old nod mice ( fig . these results show a loss of endothelial cells in the islet during prediabetes that is concomitant with deterioration of glucose tolerance , both of which are not fully corrected following anti - cd3 treatment . to determine the relationship between changes in glucose and the cd31 cell density , we treated prediabetic nod mice with normal ( 8 weeks old ) or impaired ( 12 weeks old ) results from the ipgtt with daily injections of phz for a period of 14 days . first , we tested phz effects on glucose load in normoglycemic balb / c during the ipgtt . phz injection increased clearance of blood glucose , as indicated by a more rapid return to baseline glucose levels ( supplementary fig . daily phz injections of 12-week - old nod mice reduced endothelial cell density when compared with vehicle - treated mice ( fig . interestingly , phz also decreased the rates of -cell proliferation ( table 1 and supplementary fig . 3 ) , which is consistent with the previously described effects of glucose on -cell proliferation in prediabetic mice ( 13 ) . in contrast , phz treatment of 8-week - old nod mice , with normal ipgtt results , did not reduce endothelial cell density ( fig . histomorphic analysis of pancreata ( n 3 per group ) cd31 area in 8-week - old ( a ) and 12-week - old ( b ) prediabetic nod mice after daily injections of phz for a period of 14 days ( * p < 0.04 ) . c : endothelial cell area in diabetic and anti - cd3treated nod mice receiving either vehicle or glucose injections for 14 days . d : as in c but with immunodeficient nod.scid mice . * p < 0.05 ; * * p < 0.001 . proliferation levels in islets of prediabetic and anti - cd3treated mice data are means se . we also tested whether an increase in glucose in mice with impaired glucose tolerance would have the opposite effect . recovered anti - cd3treated nod mice showing a minimum of 10 consecutive days of basal euglycemia received daily injections of glucose ( 4 mg / kg i.p . ) for 14 days . glucose injections significantly increased endothelial cell density to a density similar in prediabetic nod mice when compared with vehicle - treated controls ( fig . in contrast , similar treatment of nod.scid mice with daily glucose injections failed to increase endothelial cell density in islets ( fig . these data suggest that fluctuation in daily glucose may modulate endothelial cell density under the conditions of islet inflammation . next , we tested the physiological consequences of increased endothelial cell density in glucose - treated anti - cd3treated nod mice . interestingly , despite the presence of impaired glucose tolerance before treatment , glucose - treated anti - cd3 mice showed improved ipgtt results when compared with vehicle - treated mice ( fig . 3a and b ; p < 0.05 ) . fasting insulin levels in glucose - treated mice were higher than in placebo - treated mice ( vehicle = 0.61 ng / ml vs. glucose = 0.90 ng / ml ; p < 0.06 ) ; however , no increase in -cell mass was detected ( fig . 3c ) . therefore , to examine the effect of glucose on insulin content in individual -cells , we used the aqua score to measure the content of insulin . the aqua score has been validated for protein quantization in histological section of malignant tissues in which good reproducibility and linearity with protein content of tissues has been validated ( 1823 ) . aqua score analysis revealed increased levels of insulin staining per -cell in glucose - treated mice ( fig . glucose treatment of anti - cd3treated mice did not increase -cell proliferation , albeit proliferation was at relatively high levels in both vehicle- and glucose - treated mice ( table 1).these results suggest that increased islet endothelial cell density may promote -cell function by increasing insulin content rather than -cell proliferation after treatment with anti - cd3 antibodies . daily glucose injections improve glucose tolerance and increase insulin content in anti - cd3treated nod mice . a : representative ipgtts of anti - cd3treated mice with normal basal glucose levels receiving daily injections of either vehicle ( left panel ) or glucose ( right panel ) intraperitoneally ( , pretreatment ; , posttreatment ) . b : summary of changes in ipgtt results of anti - cd3treated diabetic mice with normal basal glucose levels after a 14-day challenge of daily injections of either glucose or vehicle . * p < 0.04 ( n = 12 per group ) . stained pancreatic section of vehicle- and glucose - treated mice for insulin cells . d : aqua scores of insulin levels per -cell as described in research design and methods . * p < 0.03 . ins , insulin . to understand the basis for increased endothelial cell density after glucose treatment , we measured vegf production in the islets of glucose - treated anti - cd3treated mice by histomorphic analysis . preliminary immunofluorescence staining revealed an increase in vegf levels in prediabetic nod islets compared with nod.scid islets ( supplementary fig . , daily glucose injections resulted in increased vegf expression in the islets when compared with vehicle - treated mice ( fig . 4a ; p < 0.02 ) , suggesting that vegf production by resident or infiltrating islet cells can promote islets in response to glucose . to directly examine the effects of glucose on endothelial cell numbers , we incubated purified islets from either nod or nod.scid donors at either 5 mmol / l or 10 mmol / l glucose for 7 days followed by fluorescence - activated cell sorter analysis of bs-1 endothelial cells . nod islets incubated at 10 mmol / l glucose showed better maintenance of endothelial cells when compared with islets incubated at 5 mmol in contrast , high glucose levels failed to maintain endothelial cell levels in islets derived from nod / scid mice when compared with islets incubated at 5 mmol 4b ) . quantitative pcr analysis of purified endothelial cells from nod islets cultured at 10 mmol / l glucose showed a 4.2-fold increase in the expression of the antiapoptotic bcl - xl gene ( cycle difference from gapdh : nod = 1.87 0.73 vs. nod.scid = 0.44 0.07 ; p = 0.10 ) , whereas ki67 gene expression remained unchanged ( data not shown ) . high glucose levels stimulate vegf expression under the conditions of islet inflammation . a : histomorphic analysis of islets from the pancreatic section of vehicle- or glucose - treated anti - cd3treated nod mice ( p < 0.02 ) . b : purified islets from 8- to 10-week - old nod or nod.scid mice were incubated in either 5 or 10 mmol / l glucose for 7 days . after incubation , islets were dispersed and endothelial cell frequency was analyzed using fluorescence - activated cell sorter of bs-1 cells as described in research design and methods . left panel : a representative histogram depicting a sample of two nod or nod.scid islet cultures stained for bs-1 . right panel : summary of the percentage of bs-1 cells after culture in 5 or 10 mmol / l glucose . c : purified islets from 8- to 10-week - old nod ( left ) or nod.scid ( right ) mice as in b were incubated with increasing concentrations of glucose . d : supernatants from nod or nod.scid islets incubated at 10 mmol / l glucose for 72 h were added to freshly purified nod.scid islets . quantitative rt - pcr was done for vegf-120 and vegf-164 isoforms in the islets ( * p < 0.05 ) . n 3 per group . because vegf - a is the main regulator of endothelial cell maintenance , we tested whether increased glucose had a differential effect on vegf production by islets from nod and nod.scid mice ex vivo . purified islets from 8- to 10-week - old mice were incubated with increasing concentrations of glucose for 24 h followed by mrna extraction . rt - pcr analysis of vegf-120 , vegf-164 , and vegf-188 mrna isoforms revealed a fivefold increase in vegf-120 and vegf-164 production in the islets of nod mice , whereas vegf-188 was undetectable ( fig . this increase was evident at glucose concentrations of 5 , 10 , 20 , and 40 mmol / l ( fig . , hyperglycemia did not induce vegf production in cultured islets form nod.scid mice ( fig . these findings were consistent with the lack of an effect of glucose on vascular area in nod.scid mice treated with glucose but left open the possibility that during inflammation , islets could acquire the ability to produce vegf after direct immune injury or in response to soluble factors produced by the infiltrating cells . to test this , we cultured nod.scid islets with supernatants collected after a 72-h incubation of nod islets in 10 mmol / l glucose and measured vegf production by real - time pcr . there was a significant increase in vegf-120 and vegf-164 after incubation with islets from nod but not control nod.scid mice ( fig . this increase was more pronounced in the vegf-164 isoform , suggesting that the vegf-120 isoform may derive from a non - islet resident cell ( fig . these data suggest that inflammation can promote the production of vegf - a in the islet by a yet - unidentified soluble factor . the improvement in insulin secretion that is seen after immune therapy in nod mice and most likely during the honeymoon of type 1 diabetes reflects the functional recovery of existing -cells , possibly with growth of new cells , but the factor(s ) that controls these responses is not well understood ( 3 ) . in this study , we have confirmed previous findings that in addition to -cells , the islet vasculature density is reduced prior to the presentation of diabetes and that a significant decrease in -cell mass and islet endothelial cells after presentation of diabetes in nod mice further promote glucose intolerance . moreover , treatment with the anti - inflammatory anti - cd3 mabs , which reverse frank hyperglycemia , fails to correct the impaired ipgtt results , which are associated with reduced cd31 cells . in addition , we have found that glucose is a regulator of islet vascular density both in the prediabetic period and after treatment of diabetic mice with anti - cd3 mabs , where glucose treatment augments cd31 density within the islets . this increase in islet vasculature occurs in conjunction with an increase in vegf production , resulting in enhanced insulin content and islet vasculature , but not -cell proliferation , in islets that have recovered or been spared destruction by the immune attack . the increase in endothelial cell density may be a result of decreased rates of cell death because the levels of the antiapoptotic gene bcl - xl were increased in inflamed endothelial cells under the condition of hyperglycemia . susceptibility to the effects of glucose is induced by soluble factor(s ) secreted by the inflamed islets in response to hyperglycemia . this soluble factor produced by inflamed islets controls vegf production by resident islet cells . the ongoing immunological assault on insulin - producing -cells in the islet during the progression of diabetes not only leads to the amplification of the immune response to islet antigens but also results in a gradual deterioration of glucose tolerance in prediabetic nod mice . this increase in metabolic demand imposes a new challenge for remaining -cells to compensate for increased glucose levels , as seen in situations of type 2 diabetes and during pregnancy ( 12 ) . our finding showing the ability of treatment with the glycosuric agent phz to reduce islet vasculature suggests that glucose levels may control the islet vasculature in the prediabetic state by increasing it with hyperglycemia and conversely by contracting it with reduced glucose load . the control of islet capillaries by glucose would be predicted because their unique structure , which consists of a basement membrane and fenestrations and is important for the control of glucose flow to the endocrine cells ( 25 ) . islet endothelial cells are highly sensitive to changes in glucose levels because increased glucose levels in gk rats can increase islet capillary blood pressure ( 26 ) . ( 8) have recently shown that islet blood flow is regulated by glucose in normal mice without insulitis . in their studies ( 8) , blood flow to the islet was dramatically increased after the hyperglycemic clamp . however , the effects of inflammation on imparting sensitivity of the islet vasculature to glucose had not been previously identified . in anti - cd3 mab treated mice , which show improved basal glucose levels but exhibit impaired glucose tolerance , islet vasculature improves modestly following anti - cd3 treatment . this recovery of endothelial cell density is enhanced by daily glucose injections , leading to improved glucose tolerance and increased insulin content per -cell . based on our previous studies ( 27 ) , it is likely that the improved islet vasculature increases the insulin content of recovered degranulated -cells , which accounts for the majority of -cell mass recovery after treatment with anti - cd3 ( 2 ) . inflammation has been suggested as a stimulant of -cell replication because -cell proliferation is increased in prediabetic nod mice and is highest at the time of the greatest -cell destruction ( 2,28 ) . in addition , the microvasculture is also dependent on inflammation and can increase by a variety of cytokines . these permissive roles of inflammation on -cell proliferation and islet vasculature are supported by our findings showing no increase in -cell replication and islet vasculature after glucose treatment of immunodeficient nod.scid mice . our new findings suggest that inflammation also affects the islet vasculature and that soluble products from inflamed islets render islet cells themselves responsive to glucose because nod.scid islets cultured with supernatants from nod islets acquired responsiveness of vegf production to glucose . one candidate cytokine capable of stimulating vegf production and vessel remodeling is tumor necrosis factor ( tnf)- ( 29 ) . the addition of tnf or its closely related family member , lymphotoxin , can lead to increased vegf production and stimulation of angiogenesis ( 30 ) . the ability of the islet endothelium to respond to increasing vegf levels may relate to increased expression of vegf receptors on endothelial cells during inflammation . the addition of tnf to endothelial cells in culture can indeed result in increased vegfr2 expression , leading to altered endothelial cell morphology and angiogenesis ( 31 ) , which , when combined with increased glucose levels , can lead to increased vasculature . the effects of the inflammatory response on the extracellular matrix ( ecm ) also must be considered . normal endothelial cell interactions are largely mediated via integrins , suggesting that inflammation may alter these conditions . recently , the role of matrix metalloproteinase-9 was documented in mediating the release of vegf , thus increasing the effective concentration of vegf-165 at the site of inflammation ( 32 ) . the breakdown of the ecm may further potentiate angiogenesis and endothelial cell survival under the conditions of inflammation ( 33 ) . based on our finding of different proportions of vegf isoforms produced in response to glucose by nod islets and nod.scid islets cultured with nod culture supernatants , we speculate that both the islet and immune cells are the sources of vegf in inflamed islets stimulated with glucose , and the possibility of ecm disturbance and increased accessibility of vegf to activated endothelial cells require additional investigation . our findings with phz are consistent with a recent report by pechhold et al . ( 13 ) in which islet transplantation or insulin treatment reduced -cell proliferation in nod mice . however , we were unable to detect an increase in -cell replication when we treated previously diabetic mice with glucose or even in prediabetic mice that were treated with glucose ( data not shown ) . one factor that may account for these discrepancies may be the way in which glucose was administered . in addition , the rates of -cell replication were already high in our prediabetic and postdiabetic mice treated with glucose , and , thus , it may not have been possible to increase the rates of replication further . our data suggest a novel role for glucose in the maintenance of islet vasculature during the progression of and recovery from diabetes and the effects of inflammation on imparting sensitivity to these effects . the factor(s ) that render the islet vasculature susceptible to glucose may identify a means of increasing -cell function and/or mass in settings where -cell mass is compromised .

objective-cell and islet endothelial cell destruction occurs during the progression of type 1 diabetes , but , paradoxically , -cell proliferation is increased during this period . altered glucose tolerance may affect -cell mass and its association with endothelial cells . our objective was to study the effects of glucose and inflammation on islet vascularity and on function , mass , and insulin in immunologically tolerant anti - cd3 monoclonal antibody ( mab)-treated and prediabetic nod mice.research design and methodsthe effects of phloridzin or glucose injections on -cells and endothelial cells were tested in prediabetic and previously diabetic nod mice treated with anti - cd3 mabs . glucose tolerance , immunofluorescence staining , and examination of islet cultures ex vivo were evaluated.resultsislet endothelial cell density decreased in nod mice and failed to recover after anti - cd3 mab treatment despite baseline euglycemia . glucose treatment of anti - cd3 mab treated mice showed increased islet vascular density and increased insulin content , which was associated with improved glucose tolerance . the increase in the vascular area was dependent on islet inflammation . increased islet endothelial cell density was associated with increased production of vascular endothelial growth factor ( vegf ) by islets from nod mice . this response was recapitulated ex vivo by the transfer of supernatants from nod islets cultured in high - glucose levels.conclusionsour results demonstrate a novel role for glucose and inflammation in the control of islet vasculature and insulin content of -cells in prediabetic and anti - cd3treated nod mice . vegf production by the islets is affected by glucose levels and is imparted by soluble factors released by inflamed islets .

RESEARCH DESIGN AND METHODS Treatment with phloridzin. Treatment with anti-CD3 mAbs. Treatment with glucose. IPGTT. Immunofluorescence. Image capture and automated quantitative analysis. Islet isolation. Studies of glucose effect on endothelial cell number. Real-time PCR. RESULTS Islet vasculature density is reduced in prediabetic NOD mice and fails to recover after anti-CD3 treatment. Variations in glucose load affect endothelial cell density in prediabetic and anti-CD3treated NOD mice. Increased endothelial cell density after a glucose load is associated with improved glucose tolerance and insulin content in anti-CD3treated NOD mice. DISCUSSION

prevalence studies in the uk4 found that 2.6% of people aged 66 and over living in private households experienced abuse , and a similar study in ireland3 indicated a prevalence of 2.2% . these studies also show that elderly victims of abuse are in frequent contact with health care services , but few report the abuse.3,4 elderly people may tend to play down abuse problems or regard it as a private matter.3,5,6 possible barriers for not seeking help may be fear of isolation , not to be believed , that the victim is embarrassed , or fear that the abuse will escalate if they tell someone about it and they then interfere.7 older victims might lack the strength to report the abuse due to health status , low self - confidence and self - esteem , possibly caused by the abuse.7 these same factors will influence the strategies used to cope with the stress caused by abuse . social support is an important factor for health and well - being and influences the elderly victim s coping strategies.8 behavioral factors , including coping style , are important determinants of health status , and will impact on how older people manage stress and maintain control over their lives , thereby protecting themselves from abuse.9 as a consequence at all encounters health professionals should be aware of signs indicating abuse of older people , be acquainted with relevant supporting services in the community , and discuss the problems as far as possible with the patient.10,11 such approaches may be crucial for how the older person appraises and copes with the abuse . most research on stress and coping tracks back to the work by lazarus and folkman 30 years ago.12 the authors emphasize that stress comes into existence when there is an unbalance in the relationship between the person and environmental incidents or demands . the person might appraise the stress in several ways depending on the seriousness of the event , if values , beliefs and personal control are challenged , in addition to previous experience of stress and personal coping resources . hence , people will manage stress in various ways depending on what is at stake , and the controllability of the situation.12 the comprehensive review by skinner et al13 assessing coping categories highlights the complexity of the coping phenomenon and critiqued commonly used distinctions such as problem - focused versus emotion - focused coping , as did lazarus,14 because no topologies covered the multidimensional aspects of coping . skinner and zimmer - gembeck introduced a model of coping that included adaptive , episodic and interactional processes and the interplay between these levels.15 appraisal and reappraisal of demands at the interactional level in real time involves behavior reaction , in addition to emotion , attention , motivation , and cognition . the outcome is influenced by previous experience and strategies used to reduce stress together with present social context and support.15 studies about coping across age and sex differences in older and younger people are inconsistent.16 age related differences might be due to controllability of the situation more than developmental , contextual , or cohort factors.17 while others have found very slight age differences , but more sex differences in coping strategies.18 brennan et als19 study of coping trajectories in later life , indicates that people s coping strategies diminish from late middle age to older age , and that the decline was most evident in avoidance coping . this might be the result of the aging process , dwindling personal and social resources , and/or the way the older person perceives stressors in their life . this observation is in line with other research , for example , a study by kraaij et al20 which identified that the better the social support is , the less the older person will engage in avoidance coping and instead use more efficient strategies to manage stressors and emotional problems . studies about coping and depressive symptoms , indicate that the elderly with a high degree of coping self - efficacy used more problem - focused than emotion - focused coping,20 and that such strategies strengthened the person s ability to be more resilient.8 over the last 20 years , the concept of resilience has received increased attention.21 resilience in older people can be understood as a process of adaption when challenged by adversity where the outcomes are influenced by internal and external factors.22 coping as a multi - dimensional adaptive process is much in line with the processes of resilience which stresses that personal qualities , and lifelong experiences , together with external and contextual factors will either bring on resilience or lead to inappropriate processes to overcome stress.15,21 as already mentioned , research indicates that coping strategies decline in old age , but this is not supported in the resilience literature.19 testing of the resilience scale suggest that a long life strengthens the person s ability to adapt to adversity,23,24 in particular if there are supportive social factors that prevent isolation and facilitate relationships.22 our aim was to explore the coping strategies elderly people used to manage stress caused by abusive offspring , and their ability to be resilient . the study used the world health organization definition of elder abuse as a single or repeated act , or lack of appropriate action , occurring within any relationship where there is an expectation of trust which causes harm or distress to an older person.25 the definition includes abuse of a physical , sexual , psychological / emotional , or financial nature , in addition to neglect . this study formed part of a project assigned by the norwegian directorate of health to the norwegian centre for violence and traumatic stress studies . a qualitative approach was used to explore the coping strategies used by older abused parents.26 the strategy was purposeful in that we recruited elderly people with experience of abuse . the criteria were that the participant was above 62 years old , living at home , and had sought professional assistance from the protective services for the elderly ( pse ) or a domestic shelter . employees of these services contacted both present and past clients , and invited them to participate in the study . pse exist only in two norwegian counties and participants were recruited from this area and from shelters nearby . the reasons given for withdrawal were that they did not wish to talk about the abuse after all , that they were too busy , or that they did not feel well at the time . fifteen participants , including 12 women and three men from a range of socioeconomic backgrounds were recruited by the pse , including one from a domestic shelter . therefore , this research is based on information provided by the 14 subjects it was possible to interview within the time frame of the project . the study group consisted of one married couple , and 12 participants who were either single or living alone . generally , they were well educated and seven participants had upper - secondary school or higher education ; all but two had had a previous occupation , although all were now retired . several participants described that they suffered from chronic illness but did not consider their health to be poor as long they could manage on their own . all could manage activities of daily living , but six received some help with housework . three participants reported having two abusers , whereas the other cases reported having only one abuser . according to information supplied by the participants , eight of the abusers had problems with alcohol and/or drug addiction , and four abusers had chronic mental health problems . the abuse problems had started several years earlier , and at the time of interview , ten participants were still being abused , although the frequency and intensity of the abuse had become less since they contacted the pse or domestic shelter . all participants were contacted by telephone and asked where they preferred to meet the researcher . most invited the researcher to their home , but three preferred to meet at the pse office and two asked to meet in a caf . they had been together when abused by their son and complemented each other during the interview , however this might have influenced the information given . at the start of the interview , the participants were asked for background information , such as place of birth , where they lived , and educational level achieved , which they found easy to talk about , with some showing photographs of places they had lived or of their families . these conversations provided an opportunity to gain some knowledge about their lives , and to establish a trusting relationship before moving on to discuss their experiences and the problems related to abuse . the themes outlined in figure 1 were used to guide the interviewer during the interview . all but one interview was digitally recorded and transcribed verbatim in full or in part . immediately after the interview , the researcher wrote a summary and notes describing the experience of the interview and dialogue with the participant . one interview inadvertently missed being recorded , so was not included in this paper because the notes taken were insufficient for further analysis . qualitative content analysis was performed according to the method described by graneheim and lundman27 whereby text is structured according to themes derived from the interview guide , reading through and listening to entire interviews , and reading the literature.26,28 our preliminary analysis of the interviews indicated the type of abuse and the relationship between the victim and the abuser , the victim s understanding of the situation , and the way they interpreted the abuse being perpetrated by their offspring . this participant was an elderly widow in her 80s who had been abused by two of her four offspring who had drug addiction problems , and was struggling to find ways to cope with her circumstances . the criteria were that the participant was above 62 years old , living at home , and had sought professional assistance from the protective services for the elderly ( pse ) or a domestic shelter . employees of these services contacted both present and past clients , and invited them to participate in the study . pse exist only in two norwegian counties and participants were recruited from this area and from shelters nearby . the reasons given for withdrawal were that they did not wish to talk about the abuse after all , that they were too busy , or that they did not feel well at the time . fifteen participants , including 12 women and three men from a range of socioeconomic backgrounds were recruited by the pse , including one from a domestic shelter . therefore , this research is based on information provided by the 14 subjects it was possible to interview within the time frame of the project . the study group consisted of one married couple , and 12 participants who were either single or living alone . generally , they were well educated and seven participants had upper - secondary school or higher education ; all but two had had a previous occupation , although all were now retired . several participants described that they suffered from chronic illness but did not consider their health to be poor as long they could manage on their own . all could manage activities of daily living , but six received some help with housework . three participants reported having two abusers , whereas the other cases reported having only one abuser . according to information supplied by the participants , eight of the abusers had problems with alcohol and/or drug addiction , and four abusers had chronic mental health problems . the abuse problems had started several years earlier , and at the time of interview , ten participants were still being abused , although the frequency and intensity of the abuse had become less since they contacted the pse or domestic shelter . all participants were contacted by telephone and asked where they preferred to meet the researcher . most invited the researcher to their home , but three preferred to meet at the pse office and two asked to meet in a caf . they had been together when abused by their son and complemented each other during the interview , however this might have influenced the information given . at the start of the interview , the participants were asked for background information , such as place of birth , where they lived , and educational level achieved , which they found easy to talk about , with some showing photographs of places they had lived or of their families . these conversations provided an opportunity to gain some knowledge about their lives , and to establish a trusting relationship before moving on to discuss their experiences and the problems related to abuse . the themes outlined in figure 1 were used to guide the interviewer during the interview . all but one interview was digitally recorded and transcribed verbatim in full or in part . immediately after the interview , the researcher wrote a summary and notes describing the experience of the interview and dialogue with the participant . one interview inadvertently missed being recorded , so was not included in this paper because the notes taken were insufficient for further analysis . qualitative content analysis was performed according to the method described by graneheim and lundman27 whereby text is structured according to themes derived from the interview guide , reading through and listening to entire interviews , and reading the literature.26,28 our preliminary analysis of the interviews indicated the type of abuse and the relationship between the victim and the abuser , the victim s understanding of the situation , and the way they interpreted the abuse being perpetrated by their offspring . this participant was an elderly widow in her 80s who had been abused by two of her four offspring who had drug addiction problems , and was struggling to find ways to cope with her circumstances . all participants were contacted by telephone and provided with verbal and printed information about the study prior to being interviewed . written consent and permission to make digital recordings of the interviews all participants had support systems available through the pse or shelter in the event that the interview raised concerns or painful emotions that were difficult to handle afterwards . during the analysis , we identified several coping strategies , some of which seemed to be successful in terms of helping the elderly person move on with their life , while others seemed to fail . when analyzing the interviews , it was evident that each participant s main coping strategy was based on one of the approaches shown in figure 2 . a main finding of the study was that participants were searching to explain the abusive behavior of their offspring and why they could not behave like decent people . the data indicate that the participants needed to find an explanation beyond themselves and their role as a parent , ie , that there were circumstances beyond their control . this finding is noteworthy because none of those interviewed were asked to offer reasons for why their offspring abused them , and were only asked when the abuse started and the circumstances in which the abuse occurred . none of the participants denounced their offspring as bad people , or described them as lacking the skills to manage everyday life and family relationships ; having an urgent need for money , drugs , or alcohol ; or being unable to control negative emotions . in some way , there was an influence of factors beyond the control of the parent that put their offspring at risk of becoming an abuser . participants mentioned relatives such as uncles or aunts with mental health problems or undesirable social behavior for unknown reasons that were interpreted by participants as bad genes . another , when describing her daughter , said : i think she is like my aunt who wants to control other people all the time ; she behaves like a psychopath . you know a chip off the old block . those who had adopted children blamed the bad influence of their children s friends in youth or relationships they had entered into as adults . participants also reported that their child had shown behavior problems very early on , often evident in primary or secondary school , that affected their relationships with family and friends . participants were less willing to regard themselves as victims of abuse , even though they had contacted professional services . this attitude was noticeable in almost all participants . at the beginning of the study , participants were asked to describe how they would characterize what they had been exposed to by their offspring , ie , whether they saw it as offensive behavior , abuse , or mistreatment . this question seemed confusing for the participants , and they often fell silent or switched to talking about other issues . most participants felt sorry for their offspring , regarding them as victims or losers in a complex society that they could not cope with or as people who could not function within a family . one stated at the beginning of their interview : it is my son who has a problem , not me . statements made by the participants indicated that hope was a prominent coping strategy for several parents . they had not given up on their adult child , even though the problems had been present for years and involved serious instances of abuse . i do not really have any hope for my son , but at the same time , i can not live without some hope the same participant described being woken up in the middle of the night by her son shouting : i ll kill you , whereupon he started to hit and hit and hit , you know . another participant reported being terrorized by her daughter s unstable behavior , stating : participants who sincerely hoped that their situation would change were preoccupied with an everlasting search for better services and support for their offspring . this quest was very time - consuming and exhausting , and they reported often feeling that they were faced with a professional wall of silence . they could not accept that there was no longer any hope of a better life for their offspring . her son had been abandoned by health and social services because of his inability to cooperate , his unrealistic expectations of the services available , his attempts to manipulate medical staff into prescribing tranquillizers and other drugs , and very aggressive behavior . this mother was constantly asking for her son s antidepressant and antipsychotic medication to be changed because she was not seeing any improvement . her son had recently visited her for the first time since being admitted to an institution and was accompanied by two security guards . she described her son s physical and psychological condition as poor , describing his visit as follows : he sat in that chair and said to me : mother , i feel terrible . i have so much up top. i said to him , john , i understand. no , you do not understand the pain i have. certainly , i understand your pain my son , but there is one thing your mother expects , which is that you take walks and exercise regularly . you know , john , medication can help you a lot , but you have to help yourself too . taking a walk is the best medicine. he sat in that chair and said to me : mother , i feel terrible . i have so much up top. i said to him , john , i understand. no , you do not understand the pain i have. certainly , i understand your pain my son , but there is one thing your mother expects , which is that you take walks and exercise regularly . you know , john , medication can help you a lot , but you have to help yourself too . taking a walk is the best medicine. participants who mainly used the abovementioned coping strategy had limited social interaction with family and friends because they lacked the strength needed to maintain close relationships due to depression , chronic pain , chronic sleep disturbance , and/or reduced mobility . another common coping strategy used by participants was to accept that they had done their best as parents . this attitude helped them to understand that they had to live with their problems and that it was unrealistic to believe that the abuse would end . several participants conveyed an understanding that something had gone wrong along the way , even though they had tried hard to do the best for their children . all these participants had been exposed to psychological abuse and two to severe financial abuse , with adverse consequences . one situation that resulted in psychological harassment occurred when an elderly parent transferred property to adult children , who started to quarrel about it . the elderly parent tried to resolve matters , but eventually came to realize that they would never be able to restore peace and order in the family . the consequence was a split family and a deadlocked conflict , whereby several of the offspring refused to have any contact with their parent . lost contact with grandchildren and great - grandchildren is a source of much despair and emotional stress for elderly parents in this situation . conversations with old friends and/or professional support helped these elderly parents to move on by putting distance between them and their problems . they tried to concentrate on other activities , such as reading a good book or watching an interesting television program , and when together with friends and family members they still stayed in touch with , they talked about things other than their problems . small and good moments in everyday life were of value , described by the oldest participant as follows : every moment is important , you have to savor it and enjoy it if possible . you know , when i lay down in a good bed without any pain , i think about how lucky i am . i have done the best i could ; it was done with the best intentions . every moment is important , you have to savor it and enjoy it if possible . you know , when i lay down in a good bed without any pain , i think about how lucky i am . i have done the best i could ; it was done with the best intentions . several participants expressed an understanding of their situation , and that they could not take responsibility as parents for the miserable lives of their offspring , which often involved drug and/or alcohol abuse and/or mental health problems . one mother reported that her son invaded her home after the breakdown of his third relationship . the first thing he did when he came to visit her was to empty the refrigerator . he was often aggressive and asked for money . over a period of years , she had become well acquainted with his bad behavior and knew that she could not cope with it any more . she had always managed to put her problems aside for a time , but now felt that it was impossible to do so . she had become depressed , cried a lot , and was hospitalized because of severe stress headaches . she attempted to talk to her son , asking him not to visit her so often , without success . that was the turning point for her , and she was finally able to get the help she needed to reclaim her life . she no longer felt the need to sit in darkness in her dining room without the television on pretending that she was not at home . pse staff talked with the son , reached an agreement regarding how often he could visit his mother , and helped him find a better place to live . his mother did not believe that he would ever be able to sort out his life . the only thing she wanted was to be able to live in peace , and said : i do not think he will change , no , i am sure about that . he is almost fifty , and he has to sort out things himself . at that time , she was looking forward to going on holiday with her brother and collecting the puppy she had ordered . they had transferred their house to their son some years earlier , and at the time of interview were living in a small flat in part of the house . during the previous year , their son , who suffered from delusions , had a worsening of his symptoms , possibly as a result of taking less medication because of adverse effects . the son was often verbally aggressive , and a few months earlier had knocked his father to the ground without any warning , kicked him , and then hit his mother in the face . the couple contacted their general practitioner and other services where their son had received treatment , but the general practitioner was not willing to change the medication . this elderly couple understood that their son s situation was not their responsibility , but struggled to find partners in the health care system who were willing to take action and protect them from abuse . a main finding of the study was that participants were searching to explain the abusive behavior of their offspring and why they could not behave like decent people . the data indicate that the participants needed to find an explanation beyond themselves and their role as a parent , ie , that there were circumstances beyond their control . this finding is noteworthy because none of those interviewed were asked to offer reasons for why their offspring abused them , and were only asked when the abuse started and the circumstances in which the abuse occurred . none of the participants denounced their offspring as bad people , or described them as lacking the skills to manage everyday life and family relationships ; having an urgent need for money , drugs , or alcohol ; or being unable to control negative emotions . in some way , there was an influence of factors beyond the control of the parent that put their offspring at risk of becoming an abuser . participants mentioned relatives such as uncles or aunts with mental health problems or undesirable social behavior for unknown reasons that were interpreted by participants as bad genes . another , when describing her daughter , said : i think she is like my aunt who wants to control other people all the time ; she behaves like a psychopath . you know a chip off the old block . those who had adopted children blamed the bad influence of their children s friends in youth or relationships they had entered into as adults . participants also reported that their child had shown behavior problems very early on , often evident in primary or secondary school , that affected their relationships with family and friends . participants were less willing to regard themselves as victims of abuse , even though they had contacted professional services . this attitude was noticeable in almost all participants . at the beginning of the study , participants were asked to describe how they would characterize what they had been exposed to by their offspring , ie , whether they saw it as offensive behavior , abuse , or mistreatment . this question seemed confusing for the participants , and they often fell silent or switched to talking about other issues . most participants felt sorry for their offspring , regarding them as victims or losers in a complex society that they could not cope with or as people who could not function within a family . one stated at the beginning of their interview : it is my son who has a problem , not me . statements made by the participants indicated that hope was a prominent coping strategy for several parents . they had not given up on their adult child , even though the problems had been present for years and involved serious instances of abuse . i do not really have any hope for my son , but at the same time , i can not live without some hope the same participant described being woken up in the middle of the night by her son shouting : i ll kill you , whereupon he started to hit and hit and hit , you know . participants who sincerely hoped that their situation would change were preoccupied with an everlasting search for better services and support for their offspring . this quest was very time - consuming and exhausting , and they reported often feeling that they were faced with a professional wall of silence . they could not accept that there was no longer any hope of a better life for their offspring . her son had been abandoned by health and social services because of his inability to cooperate , his unrealistic expectations of the services available , his attempts to manipulate medical staff into prescribing tranquillizers and other drugs , and very aggressive behavior . this mother was constantly asking for her son s antidepressant and antipsychotic medication to be changed because she was not seeing any improvement . her son had recently visited her for the first time since being admitted to an institution and was accompanied by two security guards . she described her son s physical and psychological condition as poor , describing his visit as follows : he sat in that chair and said to me : mother , i feel terrible . i have so much up top. i said to him , john , i understand. no , you do not understand the pain i have. certainly , i understand your pain my son , but there is one thing your mother expects , which is that you take walks and exercise regularly . you know , john , medication can help you a lot , but you have to help yourself too . taking a walk is the best medicine. he sat in that chair and said to me : mother , i feel terrible . i said to him , john , i understand. no , you do not understand the pain i have. certainly , i understand your pain my son , but there is one thing your mother expects , which is that you take walks and exercise regularly . you know , john , medication can help you a lot , but you have to help yourself too . taking a walk is the best medicine. participants who mainly used the abovementioned coping strategy had limited social interaction with family and friends because they lacked the strength needed to maintain close relationships due to depression , chronic pain , chronic sleep disturbance , and/or reduced mobility . another common coping strategy used by participants was to accept that they had done their best as parents . this attitude helped them to understand that they had to live with their problems and that it was unrealistic to believe that the abuse would end . several participants conveyed an understanding that something had gone wrong along the way , even though they had tried hard to do the best for their children . all these participants had been exposed to psychological abuse and two to severe financial abuse , with adverse consequences . one situation that resulted in psychological harassment occurred when an elderly parent transferred property to adult children , who started to quarrel about it . the elderly parent tried to resolve matters , but eventually came to realize that they would never be able to restore peace and order in the family . the consequence was a split family and a deadlocked conflict , whereby several of the offspring refused to have any contact with their parent . lost contact with grandchildren and great - grandchildren is a source of much despair and emotional stress for elderly parents in this situation . conversations with old friends and/or professional support helped these elderly parents to move on by putting distance between them and their problems . this can be described as putting family problems in a drawer and closing it as far as possible . they tried to concentrate on other activities , such as reading a good book or watching an interesting television program , and when together with friends and family members they still stayed in touch with , they talked about things other than their problems . small and good moments in everyday life were of value , described by the oldest participant as follows : every moment is important , you have to savor it and enjoy it if possible . you know , when i lay down in a good bed without any pain , i think about how lucky i am . i have done the best i could ; it was done with the best intentions . every moment is important , you have to savor it and enjoy it if possible . you know , when i lay down in a good bed without any pain , i think about how lucky i am . i have done the best i could ; it was done with the best intentions . several participants expressed an understanding of their situation , and that they could not take responsibility as parents for the miserable lives of their offspring , which often involved drug and/or alcohol abuse and/or mental health problems . psychological harassment and nagging about money were apparent in their stories . one mother reported that her son invaded her home after the breakdown of his third relationship . the first thing he did when he came to visit her was to empty the refrigerator . , she had become well acquainted with his bad behavior and knew that she could not cope with it any more . she had always managed to put her problems aside for a time , but now felt that it was impossible to do so . she had become depressed , cried a lot , and was hospitalized because of severe stress headaches . she attempted to talk to her son , asking him not to visit her so often , without success . that was the turning point for her , and she was finally able to get the help she needed to reclaim her life . she no longer felt the need to sit in darkness in her dining room without the television on pretending that she was not at home . pse staff talked with the son , reached an agreement regarding how often he could visit his mother , and helped him find a better place to live . his mother did not believe that he would ever be able to sort out his life . the only thing she wanted was to be able to live in peace , and said : i do not think he will change , no , i am sure about that . as long as he does not bother me he is almost fifty , and he has to sort out things himself . at that time , she was looking forward to going on holiday with her brother and collecting the puppy she had ordered . they had transferred their house to their son some years earlier , and at the time of interview were living in a small flat in part of the house . during the previous year , their son , who suffered from delusions , had a worsening of his symptoms , possibly as a result of taking less medication because of adverse effects . the son was often verbally aggressive , and a few months earlier had knocked his father to the ground without any warning , kicked him , and then hit his mother in the face . the couple contacted their general practitioner and other services where their son had received treatment , but the general practitioner was not willing to change the medication . this elderly couple understood that their son s situation was not their responsibility , but struggled to find partners in the health care system who were willing to take action and protect them from abuse . our findings indicate that one of the described coping strategies tended to be more evident in some participants individual coping behavior than the others . however , use of one strategy did not necessarily rule out using any of the other strategies , with coping responses varying according to the circumstances in which these elderly parents found themselves . independent of the type and severity of abuse , all participants struggled to some degree with despondency . despite the difficulties involved in making sense of their offspring s behavior the passage of time and their social , psychological , and physical resources helped participants to regain control over their lives , but this required a good deal of strength not to give in . the aim of this study was to gain knowledge of the strategies older abused people used to cope with everyday life , with the intention of informing health care workers when dealing with cases of elder abuse rather than adding to the body of literature of coping mechanisms . still , knowledge of theoretical perspectives remains important when interpreting the results of this study . based on recent research addressing coping in late life,8,18,19 the discussion of the result will be centered along different coping strategies in addition to the process of resilience.22,23 however , despite the critique , terms like problem and emotion - focused , or approach and avoidance coping exist in the literature . though , it is necessary to keep in mind that such concepts complement rather than distinguish the coping strategies used by individuals.14 the findings of the present study indicate that there is a pattern of response to stressors linked with abuse that is visible in terms of coping style at the level of the individual . for example , the strategy used by participants in our study to make some sort of sense of the abusive behavior of their offspring was to find external factors or circumstances that were beyond their control as parents . being abused by their own child is a serious life experience and may challenge participants values of the nuclear family , self - esteem related to upbringing of their children , and a sense of loss of control as head of the family . the degree of controllability is an important factor influencing the strategies chosen to prevent or reduce stress.12 the strategy to create external explanations may have the benefit of reducing the stress associated with the sense of failure as a parent . to take an active approach to the parent this stance seemed to be effective in helping these elderly parents to create meaning in a situation they were a part of but unable to resolve or control . the same mechanism might explain why participants were less willing to regard themselves as victims and this is a considerable finding . this could be interpreted as an emotional coping strategy to prevent stress by not accepting the seriousness of the situation . the cost of such a strategy may be that it prevents an active approach to abuse being taken , which in the long term could worsen the situation . participants understanding of the situation and reluctance to be identified as victim might be a result of older people s understanding of abuse as a phenomenon that occurs in society but far from their own personal lives.5,6,29,30 naughton et al29 found that financial abuse and neglect were seldom associated with elder abuse , and that this lack of awareness had a negative impact on help - seeking behavior . another issue is that the abused elderly may not acknowledge victimization because it can lead to social stigma associated with being an unsuccessful parent.30 such attitudes in the community might have a negative impact on the older person s ability to recover from adverse events like abuse and keep healthy . the feeling of shame might be prominent and contribute to less social contact.7 participants in the present study did not directly talk about embarrassment but all were reluctant to communicate their situation to anyone other than close family members and friends , and the abuse had gone on for a while before they sought professional support . emotion - focused strategies might be effective if the stressor is rare or less serious , because it can promote cognitive reappraisal of the situation that leads to more problem - focused coping.12 however , if the demands and thereby the stress is high , too much emotion can bring about self - deception and distorting of the events that in the long term might increase the stress.12,20 our findings indicate that participants whose coping strategy was strongly hoping for a miracle underestimated the abuser s physical and/or mental condition and ability to change their behavior . in the long term , such a strategy is exhausting and counterproductive in that is likely to prevent the victim from getting on with their life because they get trapped in an abusive relationship . in addition , these participants tended to search for better services and support for their offspring , and in this way took an active approach to the problem , anticipating that solving the problems of their offspring would solve their problems as well . both emotion - and problem - focused coping strategies may apply to reduce the stress related to abuse , and these strategies are therefore complementary and less mutually exclusive.8,12 toms et al8 found that both strategies were positively associated with resilience coping , but the correlation with problem - focused coping was much stronger to predict well - being in the elderly than emotional strategies . lazarus emphasized the importance of situational factors and the person s emotions and described the two distinctions , problem - focused and emotion - focused , as intertwined coping functions.14 participants who understood the need to create distance between themselves and the offspring by withdrawing emotionally and physically eventually realized that it was their children s responsibility to sort out their own problems ; the responsibility was not in the hands of their parents anymore . they had come to an understanding that they had done the best they could for their children . most participants with this attitude had lived with abuse problems for a long time and reported that the abuse had become less serious . taking such a stand might reflect the support of family and friends , the severity and frequency of the abuse , and/or the passage of time . social and community belonging is essential for coping and for recovering from adverse events.7,22 discussing the issue with family and friends may contribute to a new appraisal of the situation , and thereby more efficient strategies to meet certain demands created by the abuse . whether the abuse is ended or in some way controllable are essential factors for achieving some sort of resilience that enables the older victims to go on with their lives.7 research indicates that the importance of stressor controllability increases with age and the feeling of controllability promote healthy coping.16 the uk study of abuse7 showed that older victims of abuse felt frustrated , powerless , and depressed if they were unable to change their situation . the efficiency of any coping style has to be linked to outcomes as well as individual and social resources.19 the outcome desired by victims of offspring abuse might be different from that of victims of partner abuse , because the ties of kinship between victim and abuser are likely to be much stronger.31,32 none of the participants in our study expressed a desire to have no further contact with their offspring , and those who had lost contact with part of their family reported emotional distress . therefore , it is imperative that professionals identify the ties in the abusive relationship at an early stage and what the victim wants to achieve by seeking professional assistance.33,34 the study by brennan et al19 of coping trajectory in later life indicate that coping styles were much the same even though there were slight declines in all strategies.19 however problem solving strategies increased with age and the use of support and guidance to handle stressors did not decrease which might reflect on problem solving strategies.16,19 the alleged decline in coping strategies is in some contrast to research about resilience which indicates that the ability to achieve resilience increases with age.22,23 it is suggested that challenging events over the lifespan will strengthen the ability to recover from adversity.23,24 however the resilience scale do not cover such challenging experiences as abuse and few studies ask older people to identify what they regard as adverse events.22 it is important to have in mind that previous life experiences might strengthen self - efficient coping processes , but fundamentally these experiences might increase the older person s vulnerability as well . the study by mowlam et al7 indicated that earlier traumatic events during the lifespan were activated by the abuse experiences and that it was difficult to find strength to bounce back in the situation they now were a part of . support by someone close , in addition to professional support might help these older people find appropriate coping strategies . based on the findings of the abovementioned studies , it is important to identify the social network and resources available to older victims of abuse , and if possible activate partnerships with the victim s significant others.11 it is also of value to identify the coping style to the older victim , ie , how they have responded to negative life events and the various stressors that occur in life . our study has some limitations , in that all participants were recruited via a support service for victims of abuse , ie , the pse or a domestic shelter . our study participants had the insight , resources , and problem - solving skills to understand that they needed professional help , so might have had more personal and social resources than most elderly victims of abuse . a further limitation is that all participants in our study were ethnic norwegian , and their coping strategies might differ from those in other cultures and societies . nevertheless , we believe that this study makes a contribution to our knowledge about some of the coping strategies commonly used by elderly parents who are being abused by their offspring . abuse of older people by their offspring represents a huge stress to individuals , and challenges the values and beliefs of both professionals and victims with regard to the caring nature of families . the findings of this study indicate that victims of abuse use a wide range of coping strategies to manage their everyday lives , and that some of the strategies used are strongly linked to a need to maintain their self - respect as parents . participants that were able to create distance from their offspring emotionally and physically by realizing that the miserable situation was not their responsibility were able to bounce back from the dejection and find some sort of resilience . the time , seriousness and controllability of the events , support by family , friends and professionals were all important factors in this process .

backgroundabuse of older people is a serious issue and is associated with an increased risk of morbidity and mortality , and professionals will encounter elderly victims of abuse in all areas of the health care system . an important health determinant is behavioral factors , including coping style , which will impact on how older people manage stress and maintain control in their lives , and thereby protect themselves from abuse . the aim of this study was to explore the coping strategies elderly people abused by their offspring used to manage everyday life.methodsa qualitative approach was used and 14 elderly victims of abuse were interviewed . the interviews were recorded , transcribed , and subjected to qualitative content analysis.resultsfive main coping strategies were identified . the main strategy was linked to the role of parent . another prominent strategy was attitude towards being victimized . further strategies were associated with hope for a better relationship with offspring in the future , while others felt that they had done the best they could , or that their offspring were no longer their responsibility . the results are discussed in light of theoretical perspectives related to coping and resilience.conclusionabuse of older people by their offspring imposes severe stress on victims and challenges the values and beliefs about the caring nature of families . the findings of this study indicate that victims of abuse use a wide range of coping techniques to manage everyday life , and that some strategies help them to maintain their self - respect in their role as parents and find some sort of resilience .

Introduction Conceptual models Materials and methods Recruitment Data collection Analysis and interpretation Ethical considerations Results My performance as a parent was quite straightforward I am not a victim I am hoping for a miracle I have done the best I could My offspring are no longer my responsibility Struggle against despondency Discussion Conclusion

peripheral nerve injuries produce acute pain and often induce neuropathic pain , a severe clinical problem and chronic debilitating condition that affects the nervous system . neuropathic pain is relatively common and impairs the quality of life of sufferers . in the past few decades , neuropathic pain animal models have been used to study pain mechanisms and analgesia effects . chronic constrictive injury ( cci ) has been the common neuropathic pain model since 1988 [ 1 , 2 ] . the hippocampus , a part of the limbic system , has the function of learning , memory , emotion , and affect and also has relationships with chronic and acute pain . it has been reported that hippocampal formation plays an important role in pain information processing , including anatomical features , behavioral experiments , electrophysiology , functional imaging , and other molecular research . hippocampal n - acetylaspartate / creatine decreased in elderly patients suffering from acute pain [ 4 , 5 ] . neuropathic pain induced hippocampal interleukin-1 beta ( il-1 ) mrna levels upregulation , and the changes of il-1 mrna expression correlated with the injured side of the hippocampus . xiao et al . , yang et al . , and li et al . reported in a series of studies that acetylcholine ( ach ) influences the pain - induced discharge frequency and the electric activities of pain - related neurons in the hippocampus of rats . acupuncture has been widely applied in china and other asian countries for thousands of years to ameliorate a number of diseases , including acute and chronic pain . acupuncture analgesia has been gradually accepted by people due to its advantages , but its mechanism has not yet been clarified in detail . mounting evidence from many laboratories over the past years suggests that acupuncture has effects on the hippocampus . traditional acupuncture treatments significantly decreased functional magnetic resonance imaging ( fmri ) signals and the metabolism in the hippocampus ; 2 hz electrical acupoint stimulation - induced analgesia has negative correlations with the averaged fmri activation levels of the bilateral hippocampus . electroacupuncture ( ea ) could modulate the function of interneurons in the hippocampus , significantly enhancing long - term potentiation ( ltp ) . in some of our previous studies , chronic pain had an effect on the hippocampal cholinergic system , and ea treatment relieved pain by regulating hippocampal cholinergic neurons . ea had an obvious analgesic effect and in cci rats significantly diminished the injury - induced increase in synaptic cleft width and thinning of the postsynaptic density [ 15 , 16 ] . it also activated the extracellular regulated protein kinases ( erk ) signaling pathway in the hippocampus . previous studies suggested that erk / mitogen - activated protein kinase ( mek ) play an essential role in neuropathic pain . in the spinal cord , cci - induced neuropathic pain activated the erk- and camp - response element binding protein ( creb ) signaling pathway . however , it remains largely unknown how the erk is involved in pain modulation in the hippocampus . on the basis of these studies , the objective of this research is to investigate the effects of ea and the erk signaling pathway on the acute pain - induced responses of pain - related neurons in the hippocampus of wistar rats under both control and neuropathic pain conditions . adult male wistar rats , weighing from 220 g to 280 g ( n = 43 ) , purchased from beijing union medical college , were acclimatized to standard laboratory conditions ( 12-hour light and dark cycle ) at the beijing acupuncture and moxibustion institute for a week and given free access to standard chow pellet diet and water . the rats were randomly divided into three groups : ( 1 ) sham / control group : n = 15 ( sham - operated rats ) ; ( 2 ) cci group , n = 13 ; ( 3 ) u0126 ( erk1/2 inhibitor ) group , n = 15 ; u0126 ( 2.26 l , 10 g ) was injected to the rats . with the automatic injector , all surgical interventions and postoperative animal care were performed in accordance with the guidelines for declaration of the national institutes of health guide for the care and use of laboratory animals ( publication number 80 - 23 , revised 1996 ) . the rats were anesthetized by a mixture of a solution of urethane ( 28 mg/100 g ) plus chloralose ( 3.3 mg/100 g ) . rectal body temperature was monitored throughout the experiment , and a heating pad was used to maintain the temperature of the animals at 37.0c 0.5c . the rats were fixed on the back and the hair on the neck was shaved . the trachea was exposed by blunt dissection through neck muscles after cutting off the neck skin above the manubrium . a t - shaped incision was sheared at the bottom of the thyroid isthmus , and then tracheal intubation was performed using special intubation designed by the laboratory of the institute of acupuncture and moxibustion . in the prone position , the left sciatic nerve was isolated ( the chronic constrictive injured nerve in the cci group ) and covered with liquid paraffin . as described by bennett and xie , cci was used as the neuropathic pain model . local application of antibiotics ( sodium penicillin , 900010000 u / rat ) was used to avoid postoperative infection . the rats were anesthetized by a mixture of urethane ( 28 mg/100 g ) and chloralose ( 3.3 mg/100 g ) . the head of the rat was fixed on the stereotaxic apparatus ( sr-6r , nihon kohden , tokyo , japan ) . with the aid of the stereotaxic atlas of the rat brain , two small skull windows were opened and covered with warm liquid paraffin at the positions for inserting recording electrodes and microsyringe ( kds-310-plus , kd scientific , holliston , ma , usa ) . a glass microelectrode ( 5 m , filled with 3 mol / l kcl ) was inserted into the right hippocampal ca1 area ( ap : 3.23.6 mm ; ml : 2.53.0 mm ; dv : 2.53.2 mm ) by a micromanipulator ( sm-21 , nihon kohden , tokyo , japan ) as recording electrode . another micromanipulator was used to insert the microsyringe into the lateral ventricle ( ap : 1.0 mm ; ml : 1.32.0 mm ; dv : 3.0 mm ) to inject the experimental drug ( mek1/2 inhibitor ) . the neuronal discharges were monitored by an oscilloscope ( vc-10 , nihon kohden , tokyo , japan ) at the same time . after recording spontaneous neural discharge for 5 min as control , the sciatic nerve was stimulated by a double stainless electrode ( delay 0 , interval 50 msec , duration 0.3 msec , and current intensity 5 ma ) for 10 s as noxious stimulation . if there was no change in the neural discharge after noxious stimulation , the neural discharges were not recorded anymore . when the discharge frequency returned to control level ( about 10 min after giving the noxious stimulation ) , the sciatic nerve was given another noxious stimulation for 10 s. at the end of noxious stimulation , bilateral acupoints were punctured with stainless - steel acupuncture needles ( gauge 28 , 0.20 mm in diameter ) to a depth of about 4 mm , respectively , and stimulated electrically using a hans ea stimulator for 1 min , and u0126 was administered intracerebroventricularly for 2 min at the same time . zusanli ( st36 ) and yanglingquan ( gb34 ) are the main points for treating sciatica and other types of leg pain according to the theory of traditional chinese medicine . ( st36 ) and yanglingquan ( gb34 ) has cumulative analgesic effects for neuropathic pain [ 1417 ] . the response of the neurons to noxious stimuli can have three forms : excitement , inhibition , and no response . neurons that respond to nociceptive stimulation are defined as pain - related neurons , neurons excited after noxious stimuli are called pain - excited neurons ( pens ) , and the inhibited neurons are defined as pain - inhibited neurons ( pins ) . the discharge frequencies before the noxious stimulus served as control ( corresponding to 100% ) to observe the changes of discharge frequencies of pain - related neurons . we analyzed the electrical activities of pain - related neurons whose discharge frequencies increased or decreased by more than 20% after noxious stimuli . the experimental data were scanned on a computer with spike ii ( ced instruments , cambridge , united kingdom ) after management and analyzed with spike ii software . all data were expressed as mean sem ( standard error of the mean ) . 29 pain - related neurons were recorded in the control group ( n = 15 ) . the electric activities of 17 pens ( 58.6% ) were increased while those of 12 pins ( 41.4% ) were decreased after noxious stimuli . in the cci group ( n = 13 ) , we recorded 18 pain - related neurons , 14 of which were pens ( 78% ) and 4 were pins ( 22% ) , so the number of recorded pins in the control group was larger than in the cci group . the u0126 group ( n = 15 ) showed 15 pain - related neurons , among which there were 9 pens ( 60% ) and 6 pins ( 40% ) . in sham rats , brief sciatic nerve stimulation significantly increased the electrical activities of 17 hippocampal pens in the control group ( 134.53 18.50% ) and ea group ( 126.1 8.97% ) , and there was no difference between the two groups ( p > 0.05 , figure 1(c ) ) . ea reduced the excitatory effects of brief sciatic nerve stimulation on the firing rates of 17 pens . at 2 min after the noxious stimuli , the discharge frequency changes of hippocampal pens in the ea group ( 121.18 7.45% ) were markedly lower than those in the control group ( 168.68 10.64% , p < 0.05 ) . at 4 min after the noxious stimuli , although the firing rates of hippocampal pens in the control group ( 145.08 7.22% ) were still increased , the firing rates of hippocampal pens in the ea group ( 108.65 4.48% ) had almost returned to normal level . no significant difference was found between the control group ( 116.86 8.21% , 103.22 2.13% ) and the ea group ( 102.14 6.03% , 97.65 4.12% ) at 8 and 10 min after the noxious stimuli . the electric activities of pens in the control group almost returned to normal level at 8 min after the noxious stimuli . it is suggested that ea played an inhibiting role in regulating excitatory effects of the acute noxious stimulus on the electrical activity of pens in sham rats . the electric activities of 12 hippocampal pins were decreased by the brief sciatic nerve stimulation in sham rats ( figure 1(d ) ) , and the frequency changes in the control group were larger than those in the ea group . at 0 minutes ( immediately ) after brief sciatic nerve stimulation , the firing rates in the control group ( 67.88% 6.00 ) were lower than those in the ea group ( 93.35% 6.46 , p < 0.05 ) . the frequencies of pins in the control group were still decreased at 2 min ( 54.35% 4.97 ) , 4 min ( 53.01% 6.12 ) , and 6 min ( 67.93% 7.64 ) and returned to normal level at 10 min ( 94.96% 6.11 ) after the stimulation . the frequencies of pins in the ea group were still at a low level at 2 min ( 74.36% 6.28 ) and 4 min ( 87.37% 3.78 ) and returned to normal level at 6 min ( 100.59% 8.80 ) , earlier than in the control group . in comparison with the control group , the frequency changes of pins in the ea group were higher ( p < 0.05 ) at 2 , 4 , and 6 min after giving the noxious stimuli . those findings suggested that ea played an exciting role in regulating inhibitory effects of the acute noxious stimulus on the electrical activity of pins in sham rats . the electric activities of 14 hippocampal pens reached 216.46 25.40% in the cci group and 219.57 44.15% in the cci + ea group after the noxious stimulus . there was no significant difference between the two groups ( p > 0.05 , figure 2(c ) ) of cci rats . similar to the sham rats , the discharge frequencies of 14 pens were decreased after ea treatment . the frequency changes of hippocampal pens in the cci group ( 193.54 21.50% ) were markedly higher than those in the cci + ea group ( 139.40% 12.78 , p < 0.05 ) at 2 min after the noxious stimuli . the firing rates of pens in the cci + ea group ( 116.99% 20.90 ) returned to normal level and were observably lower than those in the cci group ( 188.82% 16.16 , p < 0.05 ) at 6 min . the frequency changes of pens in the cci + ea group were 105.87% 13.26 and 99.58% 9.06 at 8 min and 10 min after the brief sciatic nerve stimulation , which are lower than those in the cci group ( 167.27% 14.86 , 148.82% 20.71 , p < 0.05 ) . it is suggested that ea treatment also reduced the excitatory effects of brief nerve stimulation on the firing rate of pens in cci rats . the discharge frequencies of 4 hippocampal pins were decreased significantly in both the cci ( 56.44% 8.68 ) and the cci + ea ( 68.27% 7.96 ) group after brief sciatic nerve stimulation ( figure 2(d ) ) . there was no significant difference between the two groups at 0 , 2 , and 4 min . at 6 min after giving the noxious stimuli , the frequencies of pins in the cci group ( 59.82% 9.57 ) were still inhibited , and the frequency of pins in the cci + ea group ( 81.40% 16.29 ) had almost returned to normal level . at 8 and 10 min after giving the noxious stimuli , the frequency changes of hippocampal pins reached 70.65 10.31% and 77.94 2.67% , respectively , in the cci group ; however , the frequencies in the cci + ea group were still at the normal level ( 100.30% 15.36 , 96.69% 5.66 ) . the discharge frequency changes of the cci and the cci + ea group showed no significant differences at 10 min . although the number of recorded pins was small , it is also suggested that ea treatment reduced the effect of brief sciatic nerve stimulation on the frequency of pins in cci rats . the discharges of 17 pens and 12 pins were recorded in the hippocampus of 15 sham rats , and those of 14 pens and 4 pins were recorded in the cci rats . at 2 min , there was no difference between sham and cci rats in the frequency changes ( p > 0.05 , figure 3(a ) ) ; however , brief sciatic nerve stimulation induced bigger frequency changes of pens in the cci rats than in the sham rats ( p < 0.05 ) from 4 min to 8 min . the discharge frequencies of pens in the cci rats were still increased at 10 min , while the discharge frequencies of pens in the sham rats had almost returned to normal level at 8 min after the acute noxious stimuli . the discharge frequency changes of pins in the cci group were slightly higher than in the control group at 2 and 10 min after the noxious stimuli ( p > 0.05 , figure 3(b ) ) . this might be associated with the small number of pins recorded in the cci group . compared with the ea group , the discharge frequency changes of pens in the cci + ea group were slightly increased ( p > 0.05 , figure 3(c ) ) , and those of pins in the cci + ea group were mildly decreased ( p > 0.05 , figure 3(d ) ) from 2 to 10 min after the noxious stimuli . ea suppressed the excitatory and inhibitory effects of the acute noxious stimulus on the electric activities of pens and pins in both sham and cci rats . compared with the ea group , the discharge frequency changes of 9 hippocampal pens in the u0126 group were not significant ( p > 0.05 , figure 4(b ) ) at 0 min . compared with the ea group , the discharge frequency changes of hippocampal pens in the u0126 group ( 195.20 22.98% ) increased significantly ( p < 0.05 ) at 2 min after the noxious stimuli ( after injection of u0126 ) . from 4 to 8 min after giving the noxious stimuli , the discharge frequency changes of pens in the u0126 group ( 165.80 39.32% , 188.32 25.35% , and 181.14 43.41% ) were still higher than those in the ea group ( p < 0.05 ) . at 10 min after giving the noxious stimuli , no significant differences were found between the u0126 group ( 118.34% 20.80 ) and the ea group . there was no significant difference between the u0126 group and the ea group in the discharge frequency changes of 6 hippocampal pins ( p > 0.05 ) at 0 min . the discharge frequency changes of hippocampal pins in the u0126 group ( 55.6% 13.27 ) were bigger compared to those in the ea group at 2 min after the noxious stimuli ( and after injection of u0126 ) . during a period of 6 to 10 min , the discharge frequency changes of pins in the u0126 group exhibited obvious differences when compared with the same period in the ea group ( p < 0.05 ) . the electrical activities of pins gradually returned to baseline levels at 6 min after the noxious stimuli in the ea group , while those in the u0126 group did not . combination of u0126 + ea in sham rats produced effects markedly greater than those observed when brief sciatic nerve stimulation was performed alone ( without drugs ) , so it may be assumed that u0126 increased the effect of noxious stimulation through a pathway other than that of the ea pathway , thus masking the effect of ea . it is suggested that the mek1/2 inhibitor u0126 blocked the ea effect on acute noxious stimulation . pain is an unpleasant sensory and emotional experience associated with actual or potential tissue damage , or described in terms of such damage . acute pain is very common in clinical practice , including pain in the perioperative setting , pain in patients with severe or concurrent medical illnesses ( such as arthritis ) , pain related to cancer or cancer treatment , and labor pain . tens of thousands of people are affected by acute pain , and the treatment costs amount to billions of dollars every year . to enhance the quality of life and maintain the patient 's function ability , clinical medicine is used to treat acute pain , but these medications have substantial side effects . acupuncture analgesia has its advantages , such as an obvious analgesic effect and little side effects , but its mechanism of action is not clarified at the moment . as a part of the limbic system , the hippocampus is associated with memory , but also with pain and acupuncture analgesia . the dorsal hippocampal dopamine receptors exert an analgesic effect during the orofacial pain test ; microinjections of nonsteroidal anti - inflammatory drugs or 2-ag into the hippocampus induce antinociception . a recent study indicates that persistent peripheral nociception induced by subcutaneous injection of bee venom upregulated mtor target p70 s6 kinase signaling and facilitated long - term potentiation which could be reversed by mtor inhibitor in the hippocampus . in our experiment , we observed that the discharge frequencies of hippocampal ca1 pain - related neurons ( pens or pins ) were changed after brief electrical impulses applied to the sciatic nerve . the electric activities of pens and pins returned to normal level at 8 and 10 min after the noxious stimuli , respectively . focused on electric activities of pain - related neurons in the hippocampus after noxious stimuli for many years . in the hippocampal ca1 and ca3 area and dentate gyrus , cholinergic neurons and muscarinic receptors have effects on the electric activities of pens and pins , so that they are involved in pain modulation [ 79 , 32 ] . glutamate and its receptors , noradrenaline ( ne ) , phentolamine , and alpha - adrenoceptors also have effects on pain modulation by regulating electric activities of pens and pins in the hippocampal ca3 region [ 33 , 34 ] . these studies reported the effects of pain - induced discharges of hippocampal neurons , but few research papers pay attention to electric activities of hippocampal neurons in a chronic pain state . hains et al . reported that after spinal cord contusion injury the changes of the spontaneous discharge and afterdischarge of extracellular neurons in the thalamus are related to an upregulated sodium channel expression . in cci rats , the acute noxious stimulation evoked greater changes of electric activities of pens and pins , and the recorded number of hippocampal pens was obviously bigger and that of pins smaller compared with sham rats . it took more time for the pain - related neurons to return to normal level in the cci rats than in sham rats . this might be because the effect of brief sciatic nerve stimulation on firing rates of pens and pins was enhanced under the advanced cci situation . the cci rats may have experienced more pain than the sham rats after the short noxious stimulation . the cci rats were in a state of hyperalgesia , an increased response to noxious stimuli , which means the same intensity of electrical stimulation causes more pain intensity and finally a prolonged time of recovery to normal . shi et al . reported that pain - related neurons were involved in the modulation of ea analgesia , and ea stimulation resulted in an inhibiting effect on the electrical activity of pens and an activating effect on the electrical activity of pins . after ea at the acupoint hegu , or dolantin given intravenously , gao et al . stimulated the head of the caudate nucleus , eliciting an inhibitory effect on pens and a reduction of inhibition or release on pins . ea has been shown to suppress pens and excite pins , which can be taken as an electrophysiological index for ea analgesia [ 38 , 39 ] . yang et al . also reported that ea treatment could play an inhibiting role in mediating the evoked discharge of pens and an activating role in that of pins , and cholecystokinin-8 's ( cck-8 ) b receptor antagonist could be antagonistic to the effect of cck on ea analgesia . figure 1 ) showed that , in the hippocampal ca1 area , ea inhibited the excitatory effect of brief sciatic nerve stimulation on the electric activities of pens and activated the inhibitory effect of brief sciatic nerve stimulation on electric activities of pins in sham rats , which caused the firing rates of pens and pins to return to normal level at 6 min after the noxious stimuli , earlier than in the control group . these findings suggest that the analgesic effect of ea is related to the electric activities of pain - related neurons in the ca1 area , which were affected by noxious stimulation . ea reduced the effect of acute noxious stimulation on the electric activities of pens and pins . the electric activities of pens and pins play an important role in mediating ea analgesia , as reported before . in cci rats , ea also had an effect on the firing rate of pens and pins similar to that evoked by acute noxious stimuli , but the electric activities returned to normal level at 6 or 8 min after administration of the noxious stimulus . it is suggested that the effect of ea treatment is closely related to the severity of pain . intrathecal administration of the inhibitor of the mapk family members mek1/2 , such as u0126 , pd198306 , and pd98059 , had analgesic effects and significantly potentiated the effectiveness of opioids in neuropathy in the spinal cord [ 4143 ] . u0126 downregulated the increased late responses and afterdischarge induced by melittin ( a pain - related peptidergic component ) in wide - dynamic - range neurons of the spinal cord . accumulating evidence showed that erk expression increased at the peripheral nerve and spinal cord horn [ 4547 ] . phospho - erk ( perk ) in the spinal cord is activated immediately in neurons ( < 6 h ) , then in microglia on days 1 and 3 and both in astrocytes and in microglia on day 10 , and finally in satellite cells on days 10 and 21 after spinal nerve ligation , and this activation contributes to mechanical allodynia . pd 98059 may modulate the nociceptive factors and antinociceptive factors that are released by glial cells , which have a close relationship with reduced symptoms of neuropathy [ 43 , 46 ] . these reports suggested that mek1/2 inhibitors have an analgesic effect on neuropathic models in the primary injury and that neuropathic pain is associated with the activity of the mapk / erk signal pathway within the spinal cord . few studies focused on the relationship between the expression of erk and the hippocampus in chronic neuropathic pain , and an agreement has not been reached [ 48 , 49 ] . the phosphorylation of the erk signal transduction pathway was enhanced by ea in depression rat tissue ; however , there was no report on the study of ea analgesia on the hippocampus erk signal pathway . our previous results showed that in the hippocampus the erk signal pathway was inhibited in chronic neuropathic rats , and after acupuncture treatment the erk signaling pathway was activated . our experimental results showed that , compared with the ea group , brief sciatic nerve stimulation produced a greater excitatory and inhibitory effect on the firing rate of pens and pins in u0126 + ea group , suggesting that u0126 suppressed the effect of ea on the analgesic pathway . it is suggested that involvement of the activation of erk signaling pathway in the hippocampal ca1 region in ea treatment induced pain relief . in cci rats , acute noxious stimulation required a longer time for the firing rate of pain - related neurons to return to normal level ; ea treatment could suppress the effect of the noxious stimulus on pens and pins in both sham and cci rats , which suggests a close relationship with the ea analgesic effect ; and the erk signal pathway is probably involved in pain and ea analgesia .

to study the effects of acupuncture analgesia on the hippocampus , we observed the effects of electroacupuncture ( ea ) and mitogen - activated protein kinase ( mek ) inhibitor on pain - excited neurons ( pens ) and pain - inhibited neurons ( pins ) in the hippocampal area ca1 of sham or chronic constrictive injury ( cci ) rats . the animals were randomly divided into a control , a cci , and a u0126 ( mek1/2 inhibitor ) group . in all experiments , we briefly ( 10-second duration ) stimulated the sciatic nerve electrically and recorded the firing rates of pens and pins . the results showed that in both sham and cci rats brief sciatic nerve stimulation significantly increased the electrical activity of pens and markedly decreased the electrical activity of pins . these effects were significantly greater in cci rats compared to sham rats . ea treatment reduced the effects of the noxious stimulus on pens and pins in both sham and cci rats . the effects of ea treatment could be inhibited by u0126 in sham - operated rats . the results suggest that ea reduces effects of acute sciatic nerve stimulation on pens and pins in the ca1 region of the hippocampus of both sham and cci rats and that the erk ( extracellular regulated kinase ) signaling pathway is involved in the modulation of ea analgesia .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusions

the regulation of pancreas development from the gut endoderm is a complex process that involves a carefully balanced interplay between several common signaling pathways . studies in several model organisms indicate conservation of the main mechanisms of pancreas development from lower to higher vertebrates ( table 1 ) . gastrulation in the developing embryo ( e7.5 in mice ) results in the formation of three germ layers , namely the ectoderm , the endoderm , and the mesoderm . it appears that these germ layers do not further develop in isolation from each other , but signals emanate from one to pattern the other and vice versa ( 1 ) . several structures temporally participate in these early tissue interactions including the notochord ( 2 ) , the cardiac mesoderm , the septum transversum mesenchyme and the lateral plate mesoderm ( 3 ) , the aortic endothelial cells and the vitelline veins ( 4 ) , and the developing pancreatic mesenchyme ( 5 ) . time scale of pancreas development in mouse and human the major sequences of developmental processes are similar in mouse and human embryonic pancreas . the striking difference resides in the duration of each stage , which can vary by a factor of 5 to 15 . as far as the pancreas is concerned , specific growth and differentiation factors released by adjacent tissues control a set of transcription factors expression , resulting in the patterning of the ventral and dorsal prepancreatic endoderm . the initial interactions usually confer competence to respond to additional inductive signals that establish organ determination and specification at particular time points referred to as competence windows . although our present knowledge of extrinsic factors that control patterning , proliferation , and differentiation cues throughout the developing pancreas is not yet complete , there is strong evidence emanating from all vertebrate developmental models that complex spatio - temporal combinations of common signaling pathways are crucial for appropriate specification of pancreatic cell fates from the endoderm ( 69 ) . these involve , for instance , the hedgehog , wnt , retinoid , and notch pathways , as well as activin / bone morphogenetic protein ( bmp ) , fibroblast growth factor ( fgf ) , vascular endothelial growth factor ( vegf ) , epidermal growth factor ( egf ) , and hepatocyte growth factor ( hgf ) signal transductions . an overview of the roles played in pancreas development by the most relevant growth and differentiation factors is summarized in table 2 . a detailed sequential presentation is difficult to address because many signaling events are not clearly dissociated from each other , while others function redundantly or intermittently at several developmental stages . it is also worth noting that the developmental effects elicited by these common signals can vary significantly according to the cell type being stimulated or according to the stage of development when the signal occurs . this level of complexity is further enhanced by the interplay between transcription factors that lie downstream of these extracellular stimuli and are responsible for observed developmental features . overview of growth and differentiation factors that participate in vertebrate pancreas development cmes , cardiac mesoderm ; dmes , dorsal mesenchyme ; gcg , glucagon ; gdf , growth differentiation factor ; hb - egf , heparin - binding epidermal growth factor ; ihh , indian hedgehog ; lpm , lateral plate mesoderm ; pepi , pancreatic epithelium ; pmes , pancreatic mesenchyme ; pnep , pancreatic ngn3 endocrine progenitor . , considerable progress has been achieved in understanding pancreas embryogenesis thanks to the numerous genetic studies involved in transcription factors . most of them belong to the homeobox domain , the paired - box , or the basic helix - loop - helix families . the sequential expression of different transcription factors that control pancreas development has been extensively reviewed elsewhere ( 68,10 ) . 1 with special focus on 1 ) the early pancreatic epithelial cells , 2 ) the pancreatic endocrine progenitors , and 3 ) the endocrine subtypes selection . expression of different combinations of tfs determines the sequential lineage segregation in the developing pancreas . not only are the combinations of tfs important , but the expression level of a particular tf is known to guide differentiation as well . the most relevant tfs that are landmarks for the selection of each stage / lineage are shown . it is presently well recognized that attempts to generate pancreatic cells from pluripotent cells should first establish a definitive endoderm ( de ) population as occurs in vivo . wnt and nodal signals were identified as sufficient to induce de from mouse and human embryonic stem ( he s ) cells , but also from induced pluripotent stem ( ips ) cells . in this model , high concentrations of activin a ( acta ) are used to mimic the function of the endogenous endoderm inducer nodal ( 11 ) . beside the activation of this pathway , initial treatment with wnt3a or bmp4 was found to improve the efficiency of de induction by setting up a transient mesendoderm progenitor population , especially when cultures are performed in feeder cell - free conditions ( 12,13 ) . because active pi3k signaling is inhibitory for de differentiation from embryonic stem ( es ) cells , antagonists of this pathway ( ly294002 , wortmanin ) were also included in some protocols , resulting in an increased efficiency ( 14,15 ) . in addition , supplementation of sodium butyrate was found to support endoderm differentiation when combined with acta ( 16 ) , though it remains unclear how this chemical participates in the signaling network required for the definitive endoderm . the standard and modified protocols for de induction from es cells allow for the derivation of at least 6080% cells that express the characteristic markers foxa2 , sox17 , gsc , and cxcr4 ( table 3 ) but not the visceral endoderm marker sox7 ( 13,14,1620 ) . whether the quest for a universal -cell differentiation protocol is a desired myth or an achievable reality , it appears clear from the literature that combined wnt3a and acta treatments efficiently activate de phenotype in a vast majority of he s cell lines . in other words , the molecular events that lead de differentiation in vivo have been largely if not completely unraveled and implemented in vitro . despite the recently described differences in the response of he s cell lines to differentiation cues ( 21 ) , the variability and the low success rate in the outcome of initial pancreas differentiation protocols might first of all reflect the lack of such a universal developmentally based strategy that thoroughly reproduces in vivo events in the culture dish after the de stage . derivation of pdx1 progenitors from he s cells recent models of pancreas differentiation from he s cells integrate bmp antagonism and retinoid signaling early after definitive endoderm induction . cyclo , cyclopamine ; dapt , n-[n-(3,5-difluorophenacetyl)-l - alanyl]-s - phenylglycine t - butyl ester ( gamma secretase inhibitor ) ; ebs , embryoid bodies ; ex4 , exendin-4 ; fbs , fetal bovine serum ; its , insulin selenium transferring supplement ; na , nicotinamide ; nabut , sodium butyrate ; ng , noggin ; stz , streptozotocin ; 3d , three dimensional . when maintained in culture without added growth factors or when transplanted under the kidney capsule of immunocompromised mice , hes - derived definitive endoderm cells could spontaneously generate hepatocyte - like cells characterized by the expression of afp , albumin ( alb ) ( fig . this tendency for hepatic lineage commitment was also reported in several studies wherein hes - derived de cells were exposed to bmp and/or fgf , two growth factors implicated in embryonic liver induction and specification ( 13,20,22,23 ) . the contribution of these pathways was further demonstrated by the treatment with bmp antagonist noggin and fgf receptor antagonist su5402 , leading to the complete abrogation of hepatic gene expression from de progenies that otherwise was mainly composed of hepatocytes . as suggested from animal studies , these experiments also indicated that fgf did not function in the induction but essentially contributed to the amplification of liver progenitors initially induced by bmp signaling ( 20 ) . therefore , the molecular signals elicited by bmp and fgf are the main factors driving hepatocyte differentiation from hes - derived de cells . expression of pancreas - related transcription factors in hes - derived de progenies treated with noggin , ra , and cyclopamine . foxa2 and albumin expression in control cultures ( a ) and following treatment with noggin , ra , and cyclopamine ( b ) . d : several nkx6.1 cells are also detectable , the majority of which express lower levels of pdx1 ( not shown ) . ( a high - quality digital representation of this figure is available in the online issue . ) in vivo , bmp activity generated by the adjacent mesoderm derived structures and operating in the ventral endoderm is associated with hepatic induction during early embryonic development . on the contrary , ventral pancreas progenitors are located away from the midline endoderm with active bmp signaling , whereas bmp inhibition in the dorsal endoderm plays a crucial function in the acquisition of a pancreatic fate ( 3,24 ) . the requirement for bmp antagonism is reverted after pancreas induction since this organ requires bmp signaling later on for the maintenance of pdx1 expression and further differentiation . this underscores the existence of a tight competence window and the versatile functions of growth factors during development , which complicates their in vitro implementation for directed differentiation of es cells ( 24 ) . retinoic acid ( ra ) plays a crucial role shortly after gastrulation in endoderm patterning and in the induction of pdx1 expression by pancreas progenitors in several organisms from xenopus to humans , which indicates the conservation of its activity during evolution ( 2527 ) . this role for ra has already been evaluated during mouse and human es cell differentiation in vitro and has proven to be relevant for the induction of pancreatic gene expression , notably detectable levels of pdx1 ( 17,23,2832 ) . in line with the in vivo recognized functions of these two signaling pathways on pancreas induction , recent studies have combined bmp inhibition ( noggin supplementation ) with retinoid signaling immediately after the de induction stage and succeeded in producing large amounts ( up to 80% ) of pdx1 pancreas progenitor cells ( table 3 ) , ( 13,14,20 ) . concomitantly , the proportion of hepatocytes that could be detected in these conditions was significantly reduced ( fig . 2a and b ) , indicating an efficient blockade of their induction upon bmp antagonism ( 20,33 ) . this combination was efficient not only in different he s cell lines , but also in ips cells ( 14 ) , suggesting that the basic molecular events that should be monitored in order to design a universal pancreatic differentiation protocol are being progressively clarified . these minimally include the signals for the blockade of hepatic induction on the one hand and those required for pancreatic induction ( namely pdx1 expression ) on the other ( fig . the necessity for such a combination was recently highlighted by treatment of hes - derived de cells with noggin in the absence of ra ; this blocked the expression of liver markers , but did not generate pdx1 cells ( 20,23 ) . this requirement for combining ra treatment with bmp antagonism could also be seen from another angle . indeed , retinoid signaling was shown to activate bmp expression in several in vivo and in vitro systems including embryonal carcinoma cells and differentiating mouse embryoid bodies ( 3436 ) . it is not yet clear whether this inductive effect on bmp also occurs during he s cell differentiation . nevertheless , considering the in vivo function of bmp signaling in the midgut endoderm , it appears reasonable that both retinoid signaling and bmp antagonism were required in these studies for strong induction of a pancreatic fate from the de cells while preventing hepatic differentiation . however , it is likely that the effect of ra is context - dependent because when applied on hes - derived de cells cultured at low density , it resulted in the inhibition of smad 1/5/8 phosphorylation ( 23 ) . it remains to be elucidated whether this later effect represents an artifact of in vitro culture or a specific retinoid effect at the single cell level . four main pathways regulate the early stages of pancreas differentiation from definitive endoderm and control the acquisition of hepatic vs. pancreatic fate . hedgehog signaling is well characterized as a potent inhibitor of pancreatic initiation ( a ) that is expressed in the hepatic domain ( b ) under the influence of fgf signaling . retinoic acid is expressed in the developing pancreas and participates in the induction of pdx1 expression ( c ) . it is also suggested to contribute to hepatic gene expression to a certain degree ( d ) . an inhibitory effect of retinoic acid on smad1 - 5 - 8 phosphorylation ( e ) was demonstrated on hes - derived definitive endoderm seeded at low density , which contrasts with the early studies indicating activation of bmp signaling by retinoic acid . bmp is well described as an inhibitor of early pancreas development ( f ) in contrast to its requirement for hepatic initiation ( g ) . this potent inhibitory effect at early stages gets reverted afterward and pancreatic progenitors require bmp signaling ( f ) . the inhibition of bmp signaling in the pancreatic domain is under the control of noggin ( h ) . as for bmp pathway , fgf signaling via erk / mapk also controls early pancreas induction with high concentration being inhibitory ( i ) whereas low concentrations are required ( j ) . in late stages , fgf plays in the proliferation of pancreas progenitors ( j ) . on the contrary the markers displayed in the progenitors recall the current status of protein detection from differentiated he s cells . other studies made use of ra combined with fgf ligands ( fgf4 , fgf7 , fgf10 ) or of noggin combined with fgf2 and egf to induce pancreatic cells albeit at a lower efficiency than for combined noggin and ra ( table 3 ) ( 13,14,16,17,19,23 ) . our unpublished observations suggest that fgf signals favor hepatic gene expression in the absence of bmp antagonism , but the addition of fgf ligands together with bmp antagonism ( noggin ) and ra enhances pancreatic gene expression . furthermore , the induction of pdx1 cells by combined noggin and ra requires at least a basal level of fgf activity ( via the extracellular signal regulated kinase / mitogen - activated protein kinase [ erk / mapk ] pathway [ fig . 3 ] ) given that the addition of the mapk - inhibitor u1026 prevented pancreatic cell differentiation ( 20 ) . because ra is known to act synergistically with fgf signaling during endoderm patterning , supplemented fgf can be seen as an enhancing factor in protocols that already integrate noggin and ra ( 13,14,19 ) . this view might resolve the nature of factors x suggested as involved in the indirect effects of ra in xenopus dorsal endoderm ( 37 ) . it was recently suggested that in the presence of fgf7 , ra can efficiently induce pdx1 + progenitors from hes - derived de cells seeded at low density ( 550,000 cells / cm ) and that this effect is paralleled by inhibition of smad1/5/8 phosphorylation , therefore recapitulating bmp antagonism described above ( 23 ) . recent analysis of the signaling network during early liver and pancreas development in 36 somites - stage mouse embryos further indicated that inhibition of the activin signaling significantly increases the proportion of cells fated toward pdx1 expression . these findings therefore suggest that the addition of activin inhibitors to the above - mentioned cocktails might still boost the occurrence of pdx1 cells in he s cell cultures ( 13,24 ) . despite the fact that combining bmp antagonism with retinoid signaling efficiently generates pdx1 pancreatic progenitors from hes - derived definitive endoderm , the requirement for hedgehog antagonism with cyclopamine during pancreas induction from these cells has not been clarified by these studies . the initial report by d'amour et al . ( 18 ) indicated the necessity to antagonize hedgehog signaling that is indeed activated during es cell differentiation , and it was shown to also play a negative role ex vivo by limiting endocrine and exocrine genes expression in embryonic ( e12.5 ) mouse pancreatic explants ( 38,39 ) . however , additional studies using noggin , fgf ligands , and/or ra after de induction succeeded in generating pdx1 cells without the use of hedgehog inhibitors ( 14,17,19,23 ) . owing to the previously described increase in the expression of hedgehog ligands and effectors upon de induction , we added cyclopamine to the combination of noggin and ra in our experimental setup , but it remains unclear whether this was mandatory for the efficient differentiation of pdx1 cells that we observed ( 20,38,39 ) . while waiting for conclusive data on this issue , we speculate that supplementation of hedgehog antagonists would become obsolete in settings where combined noggin and ra treatment of de cells essentially induces a true pancreatic endoderm cell type , which is normally devoid of hedgehog activity . gli1 transcripts profiling in cells treated with noggin and ra combination would help to clarify this issue . pancreatic progenitor cells are characterized by their expression of a subset of transcription factors . for instance , the combined expression of pdx1 , foxa2 , sox9 , hnf6 , nkx6.1 , and ptf1a ( fig . the last two transcription factors are more specific to the pancreas , whereas pdx1 , foxa2 , sox9 , and hnf6 are also detected in the adjacent duodenum , stomach , and liver . following the induction of pancreas progenitor cells from hes - derived de cells , pdx1 co - expression with foxa2 , sox9 , and hnf6 was demonstrated in a context where hepatic ( afp , alb ) and intestinal ( cdx1 , cdx2 ) markers were not induced or only minimally induced ( fig . however , none of the above - mentioned studies have assessed the expression of all the six transcription factors by the pancreatic progenitors obtained from he s cells . more specifically , demonstration of ptf1a expression has remained elusive until now , possibly owing to the lack of an optimal antibody against this protein . the same holds true for ngn3 , which has been detected at the protein level in only few studies . in our experimental setup , ptf1a transcripts were detected only at low levels , whereas a significant emergence of nkx6.1-positive cells was denoted . nevertheless , when combined with the demonstration of ins and pdx1 co - expression at later stages , these findings point toward the pancreatic nature of the differentiated pdx1 cells . additional efforts are required to obtain their efficient differentiation toward pancreatic endocrine cells in vitro ( table 3 ) ( 14,20 ) . during pancreas development , the pdx1 progenitor cells are amplified thanks to signals emanating from the pancreatic mesenchyme . fgf10 controls this mesenchymal - to - epithelial interaction , and its over - expression beyond the competence window ( e11.5e13.5 in the mouse ) significantly induces progenitor cell proliferation and arrests their terminal differentiation ( 40,41 ) . this signaling operates via activation of the notch pathway , which temporally prevents progenitor differentiation toward the endocrine or exocrine fates ( 42 ) . in agreement with these , fgf10 or egf supplementation induces the proliferation of hes - derived pdx1 cells , suggesting the contribution of erk / mapk and akt activation in this effect ( 14,16,20 ) furthermore , before the proliferation step , establishment of the pdx1 progenitors from hes - derived definitive endoderm was also shown to be highly dependent on erk / mapk signaling and possibly mediated by fgf2 ( 20,43 ) . the initiation of endocrine differentiation from the pdx1 progenitors relies on the activation of ngn3 expression , which should be paralleled or preceded by downregulation of notch activity and further sustained by additional induction of pax6 ( fig . although the transcription factors cascade regulating pancreatic endocrine differentiation has been largely explored , to date the instructive extracellular signals that trigger their coordinated expression remain elusive . to this end , there is a growing list of proposed growth factors and chemicals whose effects will need to be extensively assessed in the endocrine commitment and maturation of pdx1 progenitors obtained in vitro from hes - derived de cells . these include but are not limited to wortmannin and ly294002 that are pi3k inhibitors ( 46 ) , vegf ( 4,47 ) , ra ( 26 ) , conophylline ( 48 ) , wnt , and hedgehog ligands ( 49,50 ) , and antagonists of the notch pathway such as gamma secretase inhibitors , notch ligands , and soluble notch . not only is the nature of these factors important , but their timely combination will also be of consideration given the demonstration of a competence window for endocrine patterning beyond which the endocrine differentiation arrest becomes irreversible ( 41 ) . for instance in our experimental setup ( table 3 ) , fgf10 was supplemented for controlling pdx1 cell proliferation together with a gamma secretase inhibitor ( compound e ) for notch antagonism in view of endocrine induction ( 20 ) . considering the above - mentioned crosstalk between fgf10 and notch activity in the proliferation of the pdx1 progenitors , such a protocol therefore included two phenomenas that were actually antagonistic . this issue might explain the very limited progression toward endocrine cells that we obtained , a hypothesis that will need further evaluation by dissociating fgf10 treatment from notch inhibition in this protocol . the next step after endocrine commitment will be the further endocrine differentiation and maturation by use of old and new players such as betacellulin , activin , exendin-4 , insulin - like growth factor , hgf , nicotinamide , bone morphogenetic protein , fgf , and ra ( 14,16,18,20,26,28 ) . similarly , three - dimensional cultures will merit further investigation in order to mimic the actual environment of the -cells in islets as was recently described in differentiating he s cells ( 16 ) . some of these factors have been used singly or in combination on pdx1 progenitors generated from he s cells . because of the complex nature of pancreatic endocrine differentiation , which is presently not yet elucidated , the generation of mature and functional -cells has not been efficiently achieved in vitro . the demonstration of human - specific cell functions in animal models following transplantation of pancreatic progenitors derived from he s cells ( 19,32,51 ) underscores this gap in our current knowledge . based on these data , it has been proposed that diabetic patients could be grafted with pancreatic progenitors derived from he s cells , eliminating the need for finding the efficient strategy for terminal differentiation in vitro . however , this approach would be hampered by teratoma formation from cells that were not fully differentiated at the time of transplantation ( see below ) . although the differentiation of specific cell types such as pancreatic cells can be established through their characterization with several markers , it remains obvious that no protocol currently offers a factual conversion of all cultured stem cells to the desired phenotype . therefore , the possibility exists that other cell types or even multi- or pluripotent cells might be transplanted to the diabetic recipients , which raises safety issues . indeed , despite the fact that functional -cells developed in vivo after transplantation of hes - derived pancreatic cell preparations , teratoma formation was also observed in at least 15% of grafts ( 19,51,52 ) . several tools have been investigated in order to select out the undifferentiated cells that express surface markers ( ssea4 , ssea3 , tra-160 , tra-181 ) or to specifically isolate the desired cell type ( cell - trapping ) that have been modified to express an antibiotic resistance gene , a fluorescent or a bioluminescent reporter under ck19 , pdx1 , or ins promoter ( 5355 ) . whereas these techniques would allow for the selection of differentiated -cells up to purity , transplantation of such cells is presently not approved given the genotoxic , the mutagenic , and the oncogenic risks associated with transgenic approaches . the in vitro differentiation of functional -cells from human pluripotent cells ( he s and ips ) represents a major challenge for diabetes cell therapy in the future . progress toward this goal already encompasses the efficient generation of definitive endoderm and pdx1-expressing pancreas progenitors . the recent successful studies indicate that the differentiation of pdx1 progenitors concomitantly requires at least two events after de establishment in order to mimic the in vivo situation : blockade of hepatic induction by bmp antagonism and induction of pancreas progenitors by retinoid signaling ( fig . optimization of this step might still prove beneficial in order to unravel the role of fgf and hedgehog modulation and in order to definitely establish cells that undoubtedly show combined expression of the major transcription factors recognized for the multipotent pancreas progenitor , namely pdx1 , ptf1a , and nkx6.1 . in addition , the recently described temporal shift in the requirement for bmp antagonism to a need for bmp signaling during mouse pancreas development will merit implementation in he s cell differentiation . despite the latest data indicating differentiation of the pdx1 progenitors into insulin / c - peptide cells , we believe that additional work is needed for an optimal in vitro control of the progression toward ngn3-expressing endocrine progenitor cells and for the maturation of glucose - sensing and insulin - secretion functions in the -like cells . a step forward toward these goals will certainly shorten the time frame for achieving our objective of using he s cells as alternative sources of functioning -cells in diabetes cell therapy .

recent studies with human embryonic stem ( he s ) cells have established new protocols for substantial generation of pancreatic progenitors from definitive endoderm . these findings add to the efficient derivation of definitive endoderm , which is controlled by wnt and nodal pathways , and delineate a step forward in the quest for alternative -cell sources . it also indicates that critical refining of the available strategies might help define a universal protocol for pancreatic differentiation applicable to several cell lines , therefore offering the possibility for transplantation of immune - matched or patient - specific hes derived -cells . we appraise here the fundamental role that bone morphogenetic protein , fibroblast growth factor , and retinoid signaling play during pancreas development , and describe a fundamental emergence of their combination in recent studies that generated pancreatic cells from he s cells . we finally enumerate some prospects that might improve further differentiation of the progenitor cells into functional -cells needed in diabetes cell therapy .

Overview of embryonic pancreas development. Efficient definitive endoderm differentiation from many human embryonic stem cell lines and protocols. Noggin and retinoids: key players in blocking in vitro liver induction and favoring pancreas specification from definitive endoderm. Amplification of early pancreas progenitors by FGF signaling. Prospects for further endocrine differentiation of hES cellderived pancreatic progenitors. Molecular beacons for cell selection. Concluding remarks.

a 40-year - old male patient with maxillofacial trauma reported to the department of oral and maxillofacial surgery with a chief complaint of inability to close the mouth and difficulty in chewing the food . orthopantamogram and computed tomography scan showed a fracture of left parasymphysis , bilateral condyle and left coronoid fracture [ figure 3 ] . after obtaining a detailed case history , clinical , radiographic and hematological investigations , a diagnosis of maxillofacial trauma with oral myiasis the patient was planned for open reduction and internal fixation for fracture and manual removal of maggots under general anesthesia . intra oral photograph showing laceration in palate and upper lip intra oral photograph showing disturbed occlusion pre - operative computed tomography scan cotton bud impregnated with turpentine oil was applied to the lacerated mucosa for a minimum of 10 - 12 min . after these maggots were manually removed with the help of blunt tweezer and curved forceps and then sent for entomological examinations [ figures 4 and 5 ] . further management included surgical removal of necrotic tissue slough present and irrigating the area with saline , h2o2 and then with betadine followed by metronidazole . after debridement of the region , intermaxillary fixation with plating was done in parasymphysis and condylar region [ figure 6 ] . the patient was put on tablet ivermectin 6 mg od for 5 days along with antibiotic cover of doxycycline 100 mg bd and metronidazole 100 ml 8 h given for 5 days . the patient was advised to maintain proper oral hygiene and rinse the wound with 0.2% chlorhexidine mouthwash , 3 to 4 times daily . intra oral debridement of the lesion intraoral photograph showing maggots maxillomandibular fixation all maggots were removed including dead larvae in approximately 2 days . lab analysis report of maggots , described it as house fly ( musca nebulo ) common indian house fly . myiasis is a rare condition in human beings although frequently reported in vertebrate animals , main parasites being flies of order of diptera ( maggots ) , which feed on the host 's dead or living tissue . in this condition , the soft - tissue parts of the oral cavity are invaded by parasitic larvae of these flies . hope et al . , described the first incidence of this parasitosis in 1840 , common infestations being reported in open wounds and dead tissues ; but , cavities such as ears , nose and oral cavity may be involved . this parasitic infestation commonly seen in mouth breathers , alcoholism , senility , in oral and maxillofacial traumas or in old age groups especially mentally handicapped persons . low socio - economic status , immunocompromised state , debilitated and unhygienic living conditions may also act as predisposing factors . the traditional management of oral myaisis is mechanical removal using hemostats or ordinary clinical pincers . when there are multiple larvae , extensive tissue destruction or in an advanced stage of development of larva as in the present case , adjuvant measures like treating the area with ether or comparable solvents are advocated in literatures , which irritate the maggots causing larval asphyxia and forcing them out of their hiding place . local application of several substances such as oil of turpentine , mineral oil , ether , chloroform , ethyl chloride , mercuric chloride , creosote , saline , phenol , calomel , olive oil , iodoform , can be used to ensure complete removal of larvae . male predilection of occurrence has been noted in most literatures because of their more outdoor activities and neglecting the oral hygiene when compared to the female counterpart . ivermectin , a semi synthetic macrolide antibiotic , is found safe for human use as proposed by shinohara et al . and osorio et al . in some cases

myiasis is a rare disease primarily caused by the invasion of tissue by larvae of certain dipteran flies . oral myiasis is still more rare and unique owing to the fact that oral cavity rarely provides the necessary habitat conducive for a larval lifecycle . common predisposing factors are poor oral hygiene , halitosis , trauma , senility , learning disabilities , physically and mentally challenged conditions . oral myiasis can lead to rapid tissue destruction and disfigurement and requires immediate treatment . treatment consists of manual removal of maggots from the oral cavity after application of chemical agents . good sanitation , personal and environmental hygiene and cleanliness and special care for debilitated persons are the best methods to prevent oral myiasis . this case report describes the presentation of oral myiasis caused by musca nebulo ( common house fly ) in a 40-year - old male patient , with recent maxillofacial trauma . the patient was treated by manual removal larvae by topical application of turpentine oil , followed by surgical debridement of the wound and open reduction and internal fixation of the fracture .

Case Report Discussion

colorectal cancer is the fourth most common cause of cancer death in the world ( 0.69 million , 8.5% ) . early detection and treatment are essential for reducing high mortality from colorectal cancer , given that adenomas and early colorectal cancers are usually small and asymptomatic . however , participation in colorectal cancer screening shows a wide variation across different socioeconomic or regional conditions , e.g. , from 53% in oklahoma to 72% in delaware in the united states during 2006 - 2010 , from 33% in the most deprived area to 67% in the least deprived area in england for the year 2008 ( organized screening ) , and from 22% in gyeongnam ( a rural province ) to 28% in daejeon ( a metropolitan province ) in south korea ( korea hereafter ) for the year 2012 ( organized screening ) . this disparity in colorectal cancer screening might exacerbate disparity in health status , making more contribution to those with higher participation in this intervention . however , the current cost effectiveness analysis of colorectal cancer screening focuses on improving population health and ignores health disparity generated by this intervention . but recent studies show that the purposes of maximizing population health and minimizing health disparity often contradict with each other : the promotion of a targeted reminder designed to increase participation in organized colorectal cancer screening among deprived populations with ethnic diversity minimizes health disparity , whereas the promotion of a universal reminder designed to increase participation in organized colorectal cancer screening among the entire population maximizes population health in the united kingdom . for this reason , several researchers started to develop distributional cost effectiveness analysis ( dcea ) of healthcare interventions , a combination of cost effectiveness analysis and health disparity examination . socioeconomic disparity in organized colorectal cancer screening has slightly decreased in korea since 2005 , e.g. , 10.3% vs. 16.9% for medicaid vs. insured in 2006 , then 22.2% vs. 26.1% in 2012 . however , regional disparity in this intervention still persists in the nation , i.e. , from 22% in gyeongnam ( a rural province ) to 28% in daejeon ( a metropolitan province ) for 2012 . indeed , korea has much lower national participation in organized colorectal cancer screening than does the united kingdom , i.e. , 26% in 2012 vs. 52% in 2008 . in this context , this study evaluated the cost effectiveness of organized colorectal cancer screening interventions ( i.e. , screening with various types of reminders ) , with their impacts on regional health disparity being considered . markov cohort simulation was conducted for hypothetical cohorts aged 50 years as of the year 2013 in each of 16 korean provinces . the interventions until the age of 80 were ( 1 ) annual fecal occult blood test ( fobt ) ( standard screening ) , ( 2 ) annual fobt with basic reminder letters for eight provinces with higher mortalities from either all causes or colorectal cancer than the national average ( i.e. , busan [ metropolis ] , gangwon , chungbuk , chungnam , jeonbuk , jeonnam , gyeongbuk , and gyeongnam [ rural areas ] ) ( targeted reminder ) , ( 3 ) annual fobt with basic reminder letters for all provinces ( universal reminder 1 ) , and ( 4 ) annual fobt with enhanced reminder letters ( i.e. , personal reminder letters with tailored information packages ) for all provinces ( universal reminder 2 ) . the markov states were ( 1 ) healthy , ( 2 ) polyps not detected by screening ( p1 ) , ( 3 ) polyps detected by screening ( p2 ) , ( 4 ) symptom - free early colorectal cancer not detected by screening ( ecc1 ) , ( 5 ) symptom - free early colorectal cancer detected by screening ( ecc2 ) , ( 6 ) symptomatic early colorectal cancer ( ecc3 ) , ( 7 ) symptom - free advanced colorectal cancer not detected by screening ( acc1 ) , ( 8) symptom - free advanced colorectal cancer detected by screening ( acc2 ) , ( 9 ) symptomatic advanced colorectal cancer ( acc3 ) , ( 10 ) death from colorectal cancer , and ( 11 ) death from other causes ( the true positive goes through colorectal cancer treatment without further colorectal cancer screening ) . the length of the cycle was 1 year and the length of the duration was 40 years between the ages of 50 and 90 . atkinson incremental cost effectiveness ratio ( atkinson icer ) , the incremental cost effectiveness ratio adjusted by the atkinson inequality index ( to be elaborated below ) was used to evaluate the cost effectiveness of the four interventions with their impacts on health disparity being considered . 1 shows a simplified version of the markov model for cohort simulation . in each cycle , the healthy can stay healthy , develops polys ( p1/2 ) or dies from causes other than colorectal cancer . without treatment ( polypectomy ) , one with polyps ( 1 ) stays as he or she is , ( 2 ) develops early colorectal cancer with the annual polyp - ecc transition rate of 0.005 , i.e. , p1 to ecc1 , p2 to ecc2 , or ( 3 ) dies from causes other than colorectal cancer . without treatment , one with early colorectal cancer ( 1 ) stays as he or she is , ( 2 ) develops advanced colorectal cancer with the mean ecc dwelling time of 2 years , i.e. , ecc1 to acc1 , ecc2 to acc2 , ecc3 to acc3 , or ( 3 ) dies from causes other than colorectal cancer . also , without treatment , the mean sojourn time from symptom - free to symptomatic colorectal cancer ( i.e. , from ecc1/2 to ecc3 , from acc1/2 to acc3 ) is 5 years . a new incidence of polyps is detected by a screening , while a new incidence of colorectal cancer is detected by either a screening or a symptom . the incidence rate of polyps or colorectal cancer is the same between screened and unscreened groups . suspicious lesions detected by colonoscopy are biopsied and those detected by fobt receive colonoscopy ( and biopsy if applicable ) . patients who receive treatment either stay as cancer patients or die , and those who survived for 5 years after treatment have the same mortality rates with healthy people in the same age group . utilities for the 11 markov states came from a systematic review of colorectal cancer utilities and a cost effectiveness analysis of colorectal cancer screening with blood - based biomarkers . values on screening - related variables and the natural history of colorectal cancer were obtained from statistics korea , previous studies on cancer registry data ( for korea and for germany ) , existing literature on the cost effectiveness of colorectal cancer screening , and bayesian calibration for the natural history of colorectal cancer . data sources on survival after treatment were randomized trials through 13 and 30 years of follow - up for the cost effectiveness of colorectal cancer screening in the united states . the cost of a basic / enhanced reminder letter , fobt , colonoscopy and biopsy per participant in korea for 2013 were derived from randomized trials for the cost effectiveness of reminder letters for colorectal cancer screening in the united states and uk for 2005 and 2009 , respectively , the korea ministry of health and welfare notifications and the korea health insurance review and assessment service guidelines on health insurance medical cost including drug components and materials for medical treatment . based on the randomized trials , the basic ( or enhanced ) reminder letters are expected to increase the participation rate in colorectal cancer screening by 6% ( or 12% ) ( the cost of the reminder letter in the united states / united kingdom was adjusted by the ratio of korea s per - capita health expenditure to its united states / united kingdom counterpart for 2013 ) . for instance , screening participation was assumed to be higher by 6% in the targeted - reminder intervention than in the standard - screening intervention in busan , gangwon , chungbuk , chungnam , jeonbuk , jeonnam , gyeongbuk , and gyeongnam , e.g. , 27% , 35% , and 25% for those aged 51 - 60 , 61 - 70 , and 71 - 80 in busan from supplementary table 1 , respectively . the participation gap between the universal - reminder-1 and standard - screening interventions was presumed to be 6% in every area , e.g. , 31% , 41% , and 29% for those aged 51 - 60 , 61 - 70 , and 71 - 80 in seoul from supplementary table 1 , respectively . likewise , the participation difference between the universal - reminder-2 and standard - screening interventions was supposed to be 12% in every area , e.g. , 37% , 47% , and 35% for those aged 51 - 60 , 61 - 70 , and 71 - 80 in seoul from supplementary table 1 , respectively . for the calculation of treatment cost per patient for colorectal cancer by the phase of care in korea for the year 2013 , treatment cost per patient for colorectal cancer from the korea national health insurance corporation was adjusted by the share of direct cost for cancer care in the united states for the year 2010 by the phase of care . the cost in korean won was converted to us dollars with the exchange rate of $ 1=1,055.4 won as of the year 2013 . the annual inflation rate adjusted by the annual discount rate for cost was assumed to be 1 . the crux of dcea is to adjust total effectiveness outcome ( the un - weighted mean or sum of individuals effectiveness outcomes in the conventional cost effectiveness analysis ) by an inequality index so that interventions with greater health disparity lead to smaller total effectiveness outcomes . ( 1 ) , a function of inequality aversion , i.e. , public aversion to health disparity . usually , inequality aversion on income distribution is measured as public opinion on the ideal rate of exchange between the incomes of those with highest income and those with the lowest income ( leaky bucket questionnaire ) . likewise , inequality aversion on health distribution can be measured as public opinion on the ideal rate of exchange between the health of those with the best health and those with the worst health . once the atkinson inequality index is calculated for every intervention , the atkinson icer in eq . ( 2 ) , the incremental cost effectiveness ratio adjusted by the atkinson inequality index , can be used to compare both cost effectiveness and health disparity from the interventions . ( 2 ) , is different from the conventional icer in the following manner : as inequality aversion increases , individuals with smaller qalys / worse health have more weights in total effectiveness outcome than do those with greater qalys / better health . the atkinson inequality index becomes 0 and the atkinson icer becomes the conventional icer when inequality aversion becomes 0 . in this vein , the atkinson inequality index and the atkinson icer were calculated to compare both cost effectiveness and health disparity from the standard screening , the targeted reminder and , the universal reminder 1 and 2 in korea . per - capita qalys and percapita cost were computed for each intervention for each area based on the markov cohort simulation described above ( 2014 , treeage software inc . , then , the atkinson inequality index and the atkinson icer for the nation were calculated based on the equations below . a atkinson inequality index for qi qaly , individual i q qaly , per - capita ( mean ) inequality aversion c intervention 2/1 s per - capita cost a intervention 2/1 s atkinson index q intervention 2/1 s per - capita qaly inequality aversion markov cohort simulation was conducted for hypothetical cohorts aged 50 years as of the year 2013 in each of 16 korean provinces . the interventions until the age of 80 were ( 1 ) annual fecal occult blood test ( fobt ) ( standard screening ) , ( 2 ) annual fobt with basic reminder letters for eight provinces with higher mortalities from either all causes or colorectal cancer than the national average ( i.e. , busan [ metropolis ] , gangwon , chungbuk , chungnam , jeonbuk , jeonnam , gyeongbuk , and gyeongnam [ rural areas ] ) ( targeted reminder ) , ( 3 ) annual fobt with basic reminder letters for all provinces ( universal reminder 1 ) , and ( 4 ) annual fobt with enhanced reminder letters ( i.e. , personal reminder letters with tailored information packages ) for all provinces ( universal reminder 2 ) . the markov states were ( 1 ) healthy , ( 2 ) polyps not detected by screening ( p1 ) , ( 3 ) polyps detected by screening ( p2 ) , ( 4 ) symptom - free early colorectal cancer not detected by screening ( ecc1 ) , ( 5 ) symptom - free early colorectal cancer detected by screening ( ecc2 ) , ( 6 ) symptomatic early colorectal cancer ( ecc3 ) , ( 7 ) symptom - free advanced colorectal cancer not detected by screening ( acc1 ) , ( 8) symptom - free advanced colorectal cancer detected by screening ( acc2 ) , ( 9 ) symptomatic advanced colorectal cancer ( acc3 ) , ( 10 ) death from colorectal cancer , and ( 11 ) death from other causes ( the true positive goes through colorectal cancer treatment without further colorectal cancer screening ) . the length of the cycle was 1 year and the length of the duration was 40 years between the ages of 50 and 90 . atkinson incremental cost effectiveness ratio ( atkinson icer ) , the incremental cost effectiveness ratio adjusted by the atkinson inequality index ( to be elaborated below ) was used to evaluate the cost effectiveness of the four interventions with their impacts on health disparity being considered . 1 shows a simplified version of the markov model for cohort simulation . in each cycle , the healthy can stay healthy , develops polys ( p1/2 ) or dies from causes other than colorectal cancer . without treatment ( polypectomy ) , one with polyps ( 1 ) stays as he or she is , ( 2 ) develops early colorectal cancer with the annual polyp - ecc transition rate of 0.005 , i.e. , p1 to ecc1 , p2 to ecc2 , or ( 3 ) dies from causes other than colorectal cancer . without treatment , one with early colorectal cancer ( 1 ) stays as he or she is , ( 2 ) develops advanced colorectal cancer with the mean ecc dwelling time of 2 years , i.e. , ecc1 to acc1 , ecc2 to acc2 , ecc3 to acc3 , or ( 3 ) dies from causes other than colorectal cancer . also , without treatment , the mean sojourn time from symptom - free to symptomatic colorectal cancer ( i.e. , from ecc1/2 to ecc3 , from acc1/2 to acc3 ) is 5 years . a new incidence of polyps is detected by a screening , while a new incidence of colorectal cancer is detected by either a screening or a symptom . the incidence rate of polyps or colorectal cancer is the same between screened and unscreened groups . suspicious lesions detected by colonoscopy are biopsied and those detected by fobt receive colonoscopy ( and biopsy if applicable ) . patients who receive treatment either stay as cancer patients or die , and those who survived for 5 years after treatment have the same mortality rates with healthy people in the same age group . utilities for the 11 markov states came from a systematic review of colorectal cancer utilities and a cost effectiveness analysis of colorectal cancer screening with blood - based biomarkers . values on screening - related variables and the natural history of colorectal cancer were obtained from statistics korea , previous studies on cancer registry data ( for korea and for germany ) , existing literature on the cost effectiveness of colorectal cancer screening , and bayesian calibration for the natural history of colorectal cancer . data sources on survival after treatment were randomized trials through 13 and 30 years of follow - up for the cost effectiveness of colorectal cancer screening in the united states . the cost of a basic / enhanced reminder letter , fobt , colonoscopy and biopsy per participant in korea for 2013 were derived from randomized trials for the cost effectiveness of reminder letters for colorectal cancer screening in the united states and uk for 2005 and 2009 , respectively , the korea ministry of health and welfare notifications and the korea health insurance review and assessment service guidelines on health insurance medical cost including drug components and materials for medical treatment . based on the randomized trials , the basic ( or enhanced ) reminder letters are expected to increase the participation rate in colorectal cancer screening by 6% ( or 12% ) ( the cost of the reminder letter in the united states / united kingdom was adjusted by the ratio of korea s per - capita health expenditure to its united states / united kingdom counterpart for 2013 ) . for instance , screening participation was assumed to be higher by 6% in the targeted - reminder intervention than in the standard - screening intervention in busan , gangwon , chungbuk , chungnam , jeonbuk , jeonnam , gyeongbuk , and gyeongnam , e.g. , 27% , 35% , and 25% for those aged 51 - 60 , 61 - 70 , and 71 - 80 in busan from supplementary table 1 , respectively . the participation gap between the universal - reminder-1 and standard - screening interventions was presumed to be 6% in every area , e.g. , 31% , 41% , and 29% for those aged 51 - 60 , 61 - 70 , and 71 - 80 in seoul from supplementary table 1 , respectively . likewise , the participation difference between the universal - reminder-2 and standard - screening interventions was supposed to be 12% in every area , e.g. , 37% , 47% , and 35% for those aged 51 - 60 , 61 - 70 , and 71 - 80 in seoul from supplementary table 1 , respectively . for the calculation of treatment cost per patient for colorectal cancer by the phase of care in korea for the year 2013 , treatment cost per patient for colorectal cancer from the korea national health insurance corporation was adjusted by the share of direct cost for cancer care in the united states for the year 2010 by the phase of care . the cost in korean won was converted to us dollars with the exchange rate of $ 1=1,055.4 won as of the year 2013 . the annual inflation rate adjusted by the annual discount rate for cost was assumed to be 1 . the crux of dcea is to adjust total effectiveness outcome ( the un - weighted mean or sum of individuals effectiveness outcomes in the conventional cost effectiveness analysis ) by an inequality index so that interventions with greater health disparity lead to smaller total effectiveness outcomes . ( 1 ) , a function of inequality aversion , i.e. , public aversion to health disparity . usually , inequality aversion on income distribution is measured as public opinion on the ideal rate of exchange between the incomes of those with highest income and those with the lowest income ( leaky bucket questionnaire ) . likewise , inequality aversion on health distribution can be measured as public opinion on the ideal rate of exchange between the health of those with the best health and those with the worst health . once the atkinson inequality index is calculated for every intervention , the atkinson icer in eq . ( 2 ) , the incremental cost effectiveness ratio adjusted by the atkinson inequality index , can be used to compare both cost effectiveness and health disparity from the interventions . ( 2 ) , is different from the conventional icer in the following manner : as inequality aversion increases , individuals with smaller qalys / worse health have more weights in total effectiveness outcome than do those with greater qalys / better health . the atkinson inequality index becomes 0 and the atkinson icer becomes the conventional icer when inequality aversion becomes 0 . in this vein , the atkinson inequality index and the atkinson icer were calculated to compare both cost effectiveness and health disparity from the standard screening , the targeted reminder and , the universal reminder 1 and 2 in korea . per - capita qalys and percapita cost were computed for each intervention for each area based on the markov cohort simulation described above ( 2014 , treeage software inc . , then , the atkinson inequality index and the atkinson icer for the nation were calculated based on the equations below . a atkinson inequality index for qi qaly , individual i q qaly , per - capita ( mean ) inequality aversion c intervention 2/1 s per - capita cost a intervention 2/1 s atkinson index q intervention 2/1 s per - capita qaly inequality aversion table 2 shows per - capita qalys and cost of interventions and the comparison by province in korea . on a national level , non - screening was dominated by the standard screening , the targeted reminder and , the universal reminder 1 and 2 : on a national level , non - screening resulted in smaller percapita qalys and greater per - capita cost than did the standard screening , the targeted reminder , and the universal reminder 1 and 2 . only four provinces had higher per - capita qalys than the national mean across interventions and the comparison , i.e. , seoul ( the capital of the nation ) , gyeonggi ( the province surrounding seoul ) , daejeon ( the province specialized in research and development ) , and jeju ( a southern island ) . the pattern was similar for the per - capita cost of non - screening , the standard screening , and the universal reminder 1 and 2 . as expected , however , eight provinces with basic reminder letters , i.e. , busan ( metropolis ) , gangwon , chungbuk , chungnam , jeonbuk , jeonnam , gyeongbuk , and gyeongnam ( rural areas ) , had the higher per - capita cost of the targeted - reminder intervention than the national mean . figs . 2 or 3 presents per - capita qaly gains of the targeted reminder , and the universal reminder 1 and 2 compared to the standard screening by qaly group ( or by province ) . 2 , q1 is 25,000 participants with the smallest qalys and q2 is 25,000 with qalys greater than q1 s and smaller than the median qaly of the cohort . likewise , q4 is 25,000 participants with the greatest qalys and q3 is 25,000 with qalys smaller than q4 s and greater than the median qaly of the cohort . the per - capita qaly gain of the targeted - reminder intervention compared to the standard screening was greatest for q1 ( 0.0125 ) , followed by q2 ( 0.0056 ) , q3 ( 0.0006 ) , and q4 ( 0.0000 ) . a similar pattern was found for the universal reminder 1 and 2 albeit by a smaller gap between q1 and another qaly group in terms of percapita qaly gain . table 3 displays the atkinson inequality indexes and the atkinson icers of interventions and the comparison across different values of inequality aversion . health disparity , measured by the atkinson inequality index , was smallest ( or greatest ) in non - screening ( or the standard screening ) . across inequality aversion , indeed , the targeted reminder had smaller health disparity , and greater cost effectiveness with respect to the standard screening , than did the universal reminder 1 and 2 , e.g. , $ 6,140 vs. $ 6,868 and $ 8,726 ( or $ 5,744 vs. $ 6,831 and $ 8,835 ) for the atkinson icer with the inequality aversion of 0 ( or 7 ) . moreover , as inequality aversion increases , ( 1 ) the atkinson icer of the targeted reminder becomes smaller , ( 2 ) the atkinson icer of the universal reminder 2 becomes greater , and ( 3 ) a gap between the targeted reminder and the universal reminder 1 ( or 2 ) in terms of the atkinson icer expands ( fig . if public aversion to health disparity becomes greater , these results suggest , the gap between the cost effectiveness of the targeted reminder ( minimizing health disparity ) and the universal reminder 1 and 2 ( maximizing population health ) will become greater . this study might be the first dcea of cancer screening interventions in east asia , evaluating the cost effectiveness of organized colorectal cancer screening interventions with various types of reminders , with their impacts on regional health disparity being considered . based on the results of this study , health disparity was smallest ( or greatest ) in non - screening ( or the standard screening ) across inequality aversion . across inequality aversion , in addition , the targeted reminder had smaller health disparity , and greater cost effectiveness with respect to the standard screening , than did the universal reminder 1 and 2 . moreover , if public aversion to health disparity increases , a difference between the cost effectiveness of the targeted reminder ( minimizing health disparity ) and the universal reminder 1 and 2 ( maximizing population health ) will increase . these findings are largely consistent with those on the distributional cost effectiveness of organized colorectal cancer screening interventions in the united kingdom ( i.e. , the standard screening , the targeted reminder and the universal reminder 1 ) . as in korea , across all or most values of inequality aversion , health disparity was smallest in non - screening and the targeted reminder had smaller health disparity and greater cost effectiveness ( with respect to the standard screening ) than did the universal reminder 1 in the united kingdom . a atkinson inequality index for qi qaly , individual i q qaly , per - capita ( mean ) inequality aversion c intervention 2/1 s per - capita cost a intervention 2/1 s atkinson index q intervention 2/1 s per - capita qaly inequality aversion for model validation , simulated results for seoul and gyeonggi ( covering 45% of korea s population ) were compared with actual data from randomized trials through 30 years of follow - up for the cost effectiveness of colorectal cancer screening in the united states . simulation outcomes were comparable to actual data regarding the relative risk of 30-year mortality with annual screening for a cohort aged 60 at the baseline , i.e. , 0.62 for seoul and gyeonggi vs. 0.68 for the united states . a major policy implication of this study and dcea in general is that public aversion to health disparity can be an important factor for the cost effectiveness of a healthcare intervention especially in a region with significant health disparity : if inequality aversion increases , healthcare interventions designed to minimize health disparity ( e.g. , the targeted reminder ) will become relatively more cost effective than those designed to maximize population health ( e.g. , the universal reminder 1 and 2 ) . based on a global analysis of inequality aversion on income distribution for 1999 , the range of inequality aversion was 0.42 - 1.88 in the united states , 0.67 - 3.35 in the united kingdom , 0.68 - 3.67 in spain , and 0.72 - 3.83 in italy with population sizes and per - capita gdps of the latter three nations comparable to korea s for the year 2013 . first , sensitivity analysis for different values of utility for polyps and colorectal cancer might present additional insights on this line of research , even though these values in this study came from well - established existing literature including a systematic review of colorectal cancer utilities and a cost effectiveness analysis of colorectal cancer screening with blood - based biomarkers . second , this study did not consider whether various types of reminders are economically feasible . in some cases , new interventions , which were proven to be cost effective , examining the economic feasibility of these reminders is expected to expand the boundary of knowledge on this topic . third , this study focused on a dynamic interplay between cost effectiveness and regional health disparity from colorectal cancer screening interventions . using micro - simulation to highlight disparity in patient - level variables such as family history , socioeconomic status and social support might be another promising direction of research on this important issue . fourth , a significant part of data for this study came from existing literature for other nations with different healthcare systems . as promotional effort for colorectal cancer screening , the targeted reminder might be more cost effective than its universal - reminder counterpart with their effects on health disparity being considered . this study helps to develop promotional effort for colorectal cancer screening with the greatest cost effectiveness and the smallest health disparity at the same time .

purposethe purpose of this study was to evaluate the cost effectiveness of colorectal cancer screening interventions with their effects on health disparity being considered.materials and methodsmarkov cohort simulation was conducted with the cycle / duration of 1/40 year(s ) . data came from the results of randomized trials and others . participants were hypothetical cohorts aged 50 years as of year 2013 in 16 korean provinces . the interventions until the age of 80 were annual organized fecal occult blood test ( fobt ) ( standard screening ) , annual fobt with basic reminders for provinces with higher mortalities than the national average ( targeted reminder ) and annual fobt with basic / enhanced reminders for all provinces ( universal reminder 1 and 2 ) . the comparison was non - screening , the outcome was quality - adjusted life years , and only medical costs for screening and treatment were considered from a societal perspective . the atkinson incremental cost effectiveness ratio ( atkinson icer ) , the incremental cost effectiveness ratio adjusted by the atkinson inequality index , was used to evaluate the cost effectiveness of the four interventions with their impacts on regional health disparity being considered.resultshealth disparity was smallest ( or greatest ) in non - screening ( or the standard screening ) . the targeted reminder had smaller health disparity , and smaller atkinson icer with respect to standard screening , than did the universal reminder 1 and 2.conclusionthe targeted reminder might be more cost effective than the universal reminders with their effects on health disparity being considered . this study helps to develop promotional effort for colorectal cancer screening with both the greatest cost effectiveness and the smallest health disparity

Introduction Materials and Methods 1. Participant, intervention, comparison, and outcome 2. Model structure 3. Utility, screening, natural history, and survival after treatment and cost 4. Social welfare analysis Results Discussion Conclusion Electronic Supplementary Material

the goal of cervical cytology is to detect cervical pre - cancer / cancer ; it is not a screening method for endometrial abnormalities . however , when benign - appearing endometrial cells ( bec ) are seen , they must be noted . several studies have suggested that spontaneously exfoliated bec on a papanicolaou ( pap ) smear might indicate endometrial pathology in postmenopausal women , necessitating further investigation . the 1991 bethesda system ( tbs ) recommended that the presence of bec in postmenopausal women , which may be a harbinger of endometrial carcinoma or its precursors , should be reported in pap test reports . if clinical information is provided , it may be incorrect . a cut - off age of 40 years rather than menopausal status was included in the tbs 2001 based on studies of the clinical significance of endometrial cells in pap smears in western countries . reporting a cytological diagnosis of bec in all women aged 40 years and older may create the potential for unnecessary clinical intervention because there is no recommended approach for managing women with bec . setting an appropriate cut - off age of 40 years is an example of the question of sensitivity versus specificity of reporting bec . using a retrospective cohort of turkish women in istanbul , this study aimed to determine the significance of reporting bec between age subgroups for women , regardless of menopausal status , and to make a case for increasing the cut - off age to 50 years . between october 2006 and november 2011 , 41 patients with a cytological diagnosis of bec and 64 patients with a cytological diagnosis of normal smear ( ns ) were enrolled at the umraniye education and research hospital , istanbul ; regardless of menopausal status , the women were 40 years and older and for whom follow - up endometrial biopsies had been performed ( within 12 months ) . a diagnosis of bec was made based on the presence of three - dimensional clusters of endometrial cells with small , round nuclei , inconspicuous nucleoli and scant cytoplasm with indistinct cell borders . the specimens consisted of conventional smears obtained with a cytobrush , fixed in alcohol and pap - stained . all statistical analyses were carried out using number cruncher statistical system 2007 and power analysis and sample size 2008 statistical software ( utah , usa ) . on subsequent histopathologic evaluation ( he ) , no malignant lesion was detected in women aged 40 - 50 years compared to three endometrioid - type adenocarcinomas in women older than 50 years with cytological diagnosis of bec ( p = 0.232 ) . older than 50 years , 3 of 13 patients with cytologic diagnosis of bec had malignancy on he , whereas 0 of 30 patients with ns did ( p = 0.064 ) . histological correlation ( benign endometrial lesionsmalignant lesion ) of cytologic diagnosis of normal smear and benign - appearing endometrial cells according to age subgroup on he , eight of the 41 women with cytologic diagnosis of bec and one of the 64 patients with ns had premalignant lesions ( p = 0.001 ) . , premalignant lesions were detected on he in 3 of 20 patients with cytologic diagnosis of bec and in 1 of 34 patients with ns ( p = 0.138 ) . however , in patients who were older than 50 years , premalignant lesions were detected on he in 5 of 21 women with cytologic diagnosis of bec and in 0 of 30 women with ns ( p = 0.001 ) . there was a highly significant difference between women older than 50 years with cytologic diagnosis of bec and ns regarding premalignant lesions on he . premalignant lesions were endometrial simple / complex hyperplasia with or without atypia , and non - neoplastic lesions were endometrial polyp , inactive endometrium , dissociating endometrium , nonspecific chronic endometritis and secretory endometrium . histological correlation ( benign endometrial lesionspremalignant lesion ) of cytologic diagnosis of normal smear and benign - appearing endometrial cells according to age subgroup in turkey , the mean and median age at which menopause begins is 44.38 - 47.8 and 51 years , respectively . the cut - off age of 40 years for cytological diagnosis of bec for turkish women appears young , but the age of 50 years comes 2 - 6 years after the onset of menopause in turkey . the current study revealed that the reporting of bec for turkish women aged between 40 and 50 years has minor clinical significance , but is significant for women older than 50 years regardless of menopausal status . no malignant lesions were detected on he in women aged 40 - 50 years , compared to three endometrioid - type adenocarcinomas in women older than 50 years with cytological diagnosis of bec . similar results were detected with regard to premalignant lesions . for premalignant lesions , he revealed a significant difference between women older than 50 years with cytologic diagnosis of bec and ns ; however , this was not the case for women aged 40 - 50 years . therefore , it appears that the withdrawal of the cut - off age of 50 years in reporting cytological diagnosis of bec would reduce unnecessary anxiety and interventions without diminishing safety in turkish women . menopausal status was a significant independent parameter in determining the clinical significance of the cytological diagnosis of bec . fadare 's review of the medical literature of the last half century concluded that increasing age is an independent predictor of endometrial pathology . in the study of browne et al . two studies showed that cytological diagnosis of bec in premenopausal women aged over 40 years alone is clinically insignificant . the studies detected significant endometrial pathology in 14 of 121 ( 11.6% ) postmenopausal patients compared to 7 of 300 ( 2.3% ) in the control group ( postmenopausal women without bec on cytology ) , and in no premenopausal patients aged 40 years and older . the current study revealed that reporting of bec for turkish women aged between 40 and 50 years has minor clinical significance but is significant for women older than 50 years , regardless of menopausal status . the results of the current study led to the emergence of the idea that it may be more appropriate for each community to determine its own cut - off age for reporting bec , considering the particular menopause profile of that country .

background : spontaneously exfoliated benign - appearing endometrial cells ( bec ) on a papanicolaou smear might indicate endometrial pathology in postmenopausal women , necessitating further investigation . a cut - off age of 40 years was included in the bethesda system 2001 based on studies of clinical significance of endometrial cells in pap smears in western countries.aims:the purpose of this study was to determine the significance of age subgroup for women with a cytological diagnosis of bec , regardless of menopausal status , in a retrospective cohort of turkish women.materials and methods : between october 2006 and november 2011 , 41 patients with a bec diagnosis and 64 patients with a cytological diagnosis of normal smear ( ns ) were enrolled ; regardless of menopausal status , these women were 40 years and older and for whom follow - up endometrial biopsies had been performed.results:on subsequent histopathologic evaluation , no malignant lesion was detected in women aged 40 - 50 years compared to three endometrioid - type adenocarcinomas in women older than 50 years with cytological diagnosis of bec . there was a significant difference between women older than 50 years with cytologic diagnosis of bec and ns in relation to premalignant lesions on histopathologic evaluation ; however , this was not the case for women aged 40 - 50 years.conclusions:according to our study , reporting bec for women aged between 40 and 50 years has minor clinical significance but is significant for women older than 50 years , regardless of menopausal status . larger sample size would be appropriate to confirm the results of the current study .

Introduction Materials and Methods Results Discussion

congenital contracture is a muscle condition present from birth and refers to an abnormal and usually permanent contraction of muscle fibers , with a concomitant inability of passive extension and flexion and may be due to prolonged immobilization , serious injuries , and musculoskeletal or circulatory disorders containing isolated contractures and multiple contractures . approximately 1% of all live births show some type of contractures in one or more joints ranging in severity from unilateral clubfoot to fetal akinesia or the classic pena - shokeir phenotype ( perinatal lethal form of multiple contracture conditions ) . arthrogryposis multiplex congenita ( amc ) consists of several conditions of different etiology and mixed clinical features , including multiple congenital contractures in multiple body areas . the etiology still remains unclear but generally any cause that leads to reduced fetal movement may guide to congenital contractures and in severe cases to fetal akinesia deformation sequence ( fads ) because proper fetal growth is dependent on fetal movement , starting by 8 weeks ' gestation [ 2 , 3 ] . for practical reasons , it can be divided into subgroups , as a way of generating a differential diagnosis which includes neurological diseases ( brain , spine , or peripheral nerve ) , connective tissue defects ( diastrophic dysplasia ) , muscle abnormalities ( muscular dystrophies or mitochondrial abnormalities ) , space limitations within the uterus ( oligohydramnios , fibroids , uterine malformations , or multiple pregnancy ) , intrauterine or fetal vascular compromise ( impaired normal development of nerves , or anterior horn cell death ) , and maternal diseases ( diabetes mellitus , multiple sclerosis , myasthenia gravis , infection , drugs , or trauma ) [ 46 ] . it should be also noted that arthrogryposis could be a clinical manifestation of different syndromes such as dysgenesis of the nervous system observed in chromosome abnormalities ( trisomy 18 and 21 ) and dysplasias of brainstem nuclei and spinal cord as seen in the mbius , pierre - robin , prune belly , and zellweger syndrome . it affects approximately 1 in 2 - 3000 live births [ 2 , 8 ] or 1 in 510000 live births according to other authors [ 9 , 10 ] with an approximately equal gender ratio . what is more , connective tissue deposition is observed around joints due to intrauterine fetal movement restriction , resulting in fixation and contractures or skeletal abnormalities . the above - mentioned joint abnormalities may involve all limbs ( usually ) in the lower or the upper extremities . arthrogryposis is usually symmetrical , but , less frequently , various joints may be involved to a different extent . amc is a rare sporadic nonprogressive congenital disorder that is characterized by multiple joint contractures and can incorporate muscle weakness and fibrosis . research has shown that anything that inhibits normal joint movement before birth can result in joint contractures since tendons connecting to the joint are not stretched to their normal length . in animal models , viruses , neuromuscular diseases , hyperthermia , and limb immobilization are responsible for contractures . in spite of the fact that fetal akinesia in humans is the major cause of amc , there are multiple and varied intrinsic as well as extrinsic causes for reduced fetal movements . categorization in groups of causes that are responsible for impaired fetal movement are described by hall . neurologic abnormalities seem to be one of the most common causes of amc ( approximately 7080% of cases ) . the reason for this is brain disorders shown by magnetic resonance imaging ( mri ) , prenatal ultrasound ( in order to define intracranial pathology ) , and later at postpartum autopsies like epilepsy , defects in neural migration , cerebral hypoplasia , holoprosencephaly , pyramidal tract degeneration , and olivoponto - cerebellar degeneration [ 8 , 1218 ] which can be associated with chromosomal aneuploidy , an underlying genetic syndrome or the result of a teratogen . anterior horn cell disease ( including the werdnig - hoffmann disease ) is one of the most common causes of spinal cord degeneration ( autosomal inheritance ) with spinal muscular atrophy being a close second neurogenic cause of arthrogryposis [ 14 , 19 ] . last but not least , peripheral neuropathy has been closely associated with amc because of medium - to - large - axon demyelination as a result of deficiency of the myelin proteins p2 and p0 , myelin basic protein , and myelin - associated glycoprotein showing that arrest of peripheral myelination at the promyelin stage appears to be the origin of myelin deficiency . in addition , failure in spinal lengthening and longitudinal growth of schwann cells could also lead to amc . to begin with , an association has been strongly linked between amc and myasthenia mainly because of maternal antibodies entering fetal circulation through transplacental transfer and thus inhibiting fetal acetylcholine receptor function leading to damage to fetal muscle , impaired fetal movement in utero , and the development of multiple joint contractures [ 2325 ] . for example , a large number of neonatal cases in women with myasthenia gravis has been reported with hypotonia , extraocular weakness , bulbar symptoms , respiratory distress , and multiple joint contractures [ 2628 ] . furthermore , disorders arriving from the muscles like muscular dystrophy , myopathies , myositis , and mitochondrial disorders are common causes of amc . these include central core disease , nemaline myopathy , intranuclear rod myopathy , and many other types of congenital myopathies [ 1 , 29 , 30 ] caused by a mutation in the gene encoding for sarcomeric thin filament protein troponin i or a deficiency of -actinin-3 . congenital muscular dystrophies ( 110000 live births ) are the result of abnormal function of the dystrophin - glycoprotein - associated complex in the sarcolemma of skeletal muscles . in addition , mitochondrial cytopathy is also considered to play a major role in amc . the pathophysiologic mechanism of this is located in the area of muscle fibers ( ragged - red fibers ) , central nervous system , and chondrocytes [ 34 , 35 ] . amc may also result from connective tissue abnormalities because of a collagenic response ( law of connective tissue ) on account of the resultant loss of muscle mass with an imbalance of muscle power at the joints . the collagenic response consists of partial replacement of muscle volume and collagenous thickening of the joint capsules leading to joint fixation [ 36 , 37 ] , subsequent reduced fetal movement , and contractures observed in pterygium syndrome [ 4 , 13 , 38 ] , congenital contractural arachnodactyly , beals syndrome ( congenital heart disease , scoliosis , arachnodactyly , and crumpled ears ) , and larsen syndrome ( anterior dislocation of the knees ) [ 1 , 39 ] . amniotic cavity filled with amniotic fluid protects the fetus from extrinsic hazardous factors and provides the adequate space for proper fetal development and movement . pathologies arriving from the volume of amniotic fluid like oligohydramnios ( which commonly results from leakage of amniotic fluid due to cervical incompetence or due to potter 's syndrome ( bilateral renal agenesis ) ) are some of the major causes of space limitation hence leading to contractures which are more severe the earlier they happen [ 1 , 13 , 40 , 41 ] . furthermore , amniocentesis before 15 weeks of gestation has been reported to have a 10-fold higher risk for multiple contractures and clubfoot . moreover , this can also be observed in congenital uterine deformities , fibroids , uterine tumors , and multiple pregnancy ( as it is known that incidence of arthrogryposis is more common among twins than singletons ) . next , inadequate vascular supply to the fetus causes fetal hypoxia that leads to anoxic injury of tissue and/or blood clots or blockage of blood flow resulting in possible cell death , particularly anterior horn cell death or failure . inferior anterior horn cell function would likely cause fetal neuron , muscle , and bone damage and secondary multiple joint contractures [ 7 , 41 ] . in addition , maternal disease , such as diabetes mellitus , multiple sclerosis , myotonic dystrophy , and infections ( such as rubella , varicella , equine encephalitis , cytomegalovirus , and toxoplasmosis ) have been closely related with fetal akinesia and subsequent amc . however , in many cases this can not be proved if it was causal rather than coincidental [ 4 , 7 , 4245 ] . lastly , medical administration or drug abuse during pregnancy , for instance of curare ( a skeletal muscle relaxant ) , misoprostol , or substances such as cocaine and alcohol , can result in congenital contractures if given at a critical period of fetal development [ 46 , 47 ] . there are many known subgroups of amc differing in signs , symptoms , and causes . the principal cause of amc is both genetic and environmental factors , occurring individually or with a significant overlap among them . in order to establish a differential diagnosis in early child life , it is crucial to determine first if a child has normal neurological function or not . a normal one suggests that arthrogryposis is a result of amyoplasia ( the most common recognizable form of amc which is a sporadic symmetric syndrome that is characterized by the symmetrical improper development of limb muscles which are replaced by fatty and connective tissue and often a midline hemangioma ) , distal arthrogryposis ( an autosomal - dominant inherited syndrome with a characteristic involvement of distal joints with sparing of the large joints ; the upper limbs show ulnar deviation , camptodactyly , hypoplastic , or absent flexion and overriding fingers whereas the lower ones can show talipes equinovarus , calcaneovalgus , vertical talus , and metatarsus varus ) , a systemic connective tissue disorder , multiple pterygium syndromes ( a group of autosomal dominant , recessive , or x - linked inherited syndromes manifested with multiple contractures ( pterygia ) , micrognathia , low - set ears , cardiac and lung hypoplasia , cystic hygroma , and hydrops ) , or fetal crowding [ 1 , 11 , 39 ] . on the contrary , an abnormal neurological function highlights that diminished fetal movement in utero was the result of an abnormality of the central or peripheral nervous system , the motor end plate , or the muscles ( table 1 ) . although fetal movement is observed by ultrasound scan at 8 weeks ' gestation , most cases of amc are diagnosed prenatally at the second or third trimester of pregnancy with ultrasound scan and/or with the combination of maternal consideration for reduced fetal in utero movements . the combination of maternal consideration for fetal akinesia with ultrasound abnormalities ( usually before the perception of fetal movement ) will give the prospect of an arthrogrypotic syndrome [ 2 , 42 , 49 ] . the earlier the contractures occur ( or if there is a syndrome present with abnormalities other than skeletal malformations ) , the harder early prenatal diagnosis will be . the primary diagnosis is made when a lack of mobility and an abnormal position is noted in routine ultrasound scanning . these findings should guide the practitioner to a careful assessment of fetal anatomy and joints . the most common detailed ultrasound scan findings are fixed flexion deformities , micrognathia , altered amniotic fluid volume , limb deformities , cerebral ventriculomegaly , dysmorphic features , and growth retardation . amc may also be present with increased nuchal translucency at 1014 weeks or increased nuchal translucency and scoliosis at 15 weeks of pregnancy due to nuchal edema that has been found in first and early second trimester cases of arthrogryposis [ 51 , 52 ] , cystic hygroma and fetal seizures on first trimester ultrasound , small chest , thin ribs , and multiple diaphyseal fractures . visualization of details of the dynamics of small anatomical structures can now be done better and earlier ( body and limb movements can be visualized a week earlier than with 2d ) with the use of 4d ultrasound giving the possibility of a diagnosis of motoric failure by the end of the first trimester ( table 2 ) . some of the more common signs and symptoms are associated with the shoulder ( internal rotation ) , elbow ( extension and pronation ) , wrist ( volar and ulnar ) , hand ( fingers in fixed flexion and thumb in palm ) , hip ( flexed , abducted and externally rotated , often dislocated ) , knee ( flexion ) , and foot ( clubfoot ) . in some cases , a small number of joints may be affected and may have an almost full range of motion capabillity but in the most severe types , nearly every joint is involved , including the jaw and back [ 11 , 56 ] . furthermore , complications may include various congenital anomalies from the organs that can be related with arthrogryposis such as scoliosis , lung hypoplasia , respiratory problems , growth retardation , midfacial hemangioma , facial and jaw variations and abdominal hernias , congenital heart defects , tracheoesophageal fistulas , and ophthalmologic abnormalities ( table 3 ) . multiple contractures in general and amc more specifically are a common ultrasound finding although they are described as clinical findings rather than a precise diagnosis . neurogenic , or myopathy disorder , connective tissue process , intrauterine compression , vascular compromise , or teratogenic exposure could be the principal cause of the ultrasound finding . early diagnosis , prenatal evaluation , and further surveillance via image scanning ( ultrasound and mri ) give the opportunity for family counseling concerning elevated neonatal morbidity and mortality in these cases and labor or delivery planning . patients should be also informed that a specific prenatal diagnosis of arthrogryposis reaches only up to 50% . craniofacial abnormalities and micrognathia more often seems to be the consequence of neuromuscular dysfunction because of the adequate growth for the craniofacial bones , fetal muscle movement is required [ 45 , 51 ] . diagnosis of the condition by ultrasound will depend on the gestational age and possible presence of other anomalies , with additional mri surveillance providing additional information such as distal muscle atrophy , abnormal muscle formation , and lung volume measuring [ 58 , 59 ] . in several previous studies , the focus has been given to cystic hygroma and increased nuchal translucency with combination of reduced fetal movements in utero leading in this way to an early diagnosis of arthrogryposis in first and/or early second trimester of pregnancy [ 42 , 49 , 50 , 60 ] . other studies found that in some cases arthrogryposis occurring with hydramnion and rarely with hydrops may be a result of impaired swallowing [ 46 , 49 , 60 , 61 ] . the importance of autopsy and tissue procurement should be noted to parents as it can confirm prenatal diagnosis and provide families with valuable information other than that given by ultrasound and mri scanning . congenital contractures are a common birth defect and a subsequently prenatal ultrasound finding , observed more often randomly in early second trimester ultrasound prenatal assessment . any factor that predisposes the fetus to impaired fetal movement can cause congenital contractures , such as environmental , maternal , and genetic factors . amc is a term that describes contractures in multiple joints , in more than one area of the body , associated with fetal morbidity and future economic burden to put right . better understanding of ultrasound findings and the etiology of this clinical situation offers an opportunity for careful prenatal assessment through thorough image scanning focusing on flexion / extension , position of proximal and distal joints , jaw , and spine . when prenatal diagnosis is suspected families should be counseled for potential postnatal or postterm evaluation .

arthrogryposis multiplex congenita ( amc ) refers either to a syndromic or to a nonsyndromic group of conditions with varied etiology and complex clinical features , including multiple congenital contractures in different body areas . its etiology still remains unclear but generally any cause that leads to reduced fetal movement may lead to congenital contractures and in severe cases to fetal akinesia deformation sequence ( fads ) . it affects approximately 1 in 2 - 3000 live births with an approximately equal gender ratio . there are many known subgroups of amc differing in signs , symptoms , and causes . the primary diagnosis is made when a lack of mobility and an abnormal position is noted in routine ultrasound scanning . early diagnosis , prenatal evaluation , and further surveillance via image scanning ( ultrasound and mri ) give the opportunity for family counseling concerning neonatal morbidity and mortality and labor or delivery planning . better understanding of the ultrasound findings and the etiology of this clinical situation offers the opportunity for careful prenatal assessment .

1. Introduction 2. Arthrogryposis Multiplex Congenital (AMC) 3. Discussion 4. Conclusion

if viper bites are well known in france with recent epidemiological studies and official protocols for the treatement , pulmonary embolism is an exceptional complication of human envenomations induced by european vipers . we report the interesting case of a bilateral pulmonary embolism following a viper bite in french western coast . a 72-year - old female was admitted to the emergency department with a swollen leg , after a snake bite on her right foot while walking in the countryside , on the french western coast . the scar with 2 points confirmed it was the fang marks of a viper . the leg swill immediately and she came to the emergency department 48 hours after , because of an extensive hematoma on her calf and thigh . she had no prior significant medical and gynecological troubles , and no history of neoplasia or thrombosis . complete bilateral doppler powered ultrasound ( us ) at admission did not show any lower limbs thrombosis . blood tests showed no disseminated intravascular coagulation ( dic ) ( table 1 ) ; she had no clinical or biological signs of rhabdomyolysis or renal failure . she received daily preventive low - molecular - weight heparin injections ( enoxaparin 4000 iu / day ) and lower limb compression device was prescribed . initial biological findings of our patient seven days after admission , the hematoma started to heal although she presented acute thoracic pain and dyspnea ; computed tomography angiogram showed a bilateral pulmonary embolism . blood test ( troponin and coagulation factors ) and second complete bilateral lower limbs doppler us were still normal . a complete examination and she healed rapidly with low - molecular - weight heparin ( enoxaparin with a weight - related dosage of 12,000 iu / day ) and oxygen therapy ( 23 l / min ) . then she received warfarin and compression stockings for 6 months . during the 18-month follow - up , she did not present any other hemorrhagic or thrombotic episode . at the end of follow - up , lower limb doppler us , coagulation blood tests , and pulmonary function were strictly normal . ethical approval was not necessary because all data were collected anonymously , and the patient gave her consent for publication . usually , snake envenomations lead to pain , swelling , and moderate hemorrhagic symptoms . in many countries ( in africa , australia , and south america ) , snakes can cause death because of neurotoxicity , rhabdomyolysis , or severe coagulopathy causing necrosis or disseminated hemorrhage . several species ( viperidae , crotalidae , elapidae , and colubridae ) can also be responsible for haemostatic troubles . in french western coast only 2 species of viper can be seen : vipera aspis , which is more common and vipera berus . venom from viperidae has an effect on coagulation , that is why hemorrhagic complications are common and heparin treatment is not recommended during the acute phase of envenomation . in contrast , thromboembolic complications are very rare but can be seen during the later phase of envenomation . to our knowledge , only 4 others cases of pulmonary embolism following viper envenomation have been described so far . pulmonary embolism also occurred exactly 1 week after the bite , without associated phlebitis and after a previous subcutaneous hematoma . however , dic syndrome was described in all 3 cases , with decreased fibrinogen and elevated activated partial thromboplastin time ( aptt ) ratio . one more envenomation case was caused by greek viper on a child who suffered from diamond blackfan anemia . we found out 2 other cases in the literature : the first one occurred in martinique ( french west indies ) was because of bothrops lanceolatus , whose venom is responsible for acute thromboembolic complications in 30% cases . in this case , pulmonary embolism happened a few hours after the bite , suggesting a different way of hypercoagulation activation . the second one was because of crotalus scutulatus , an american snake . in this case , baghat et al described an interesting case of dic syndrome with decreased levels of fibrinogen . several hypotheses have been made to explain this late coagulopathy causing localized thromboembolism after snake bites . first , hypercoagulability could be caused by an increased systemic inflammation starting a few days after the bite , biologically showed by increased prothrombotic factors ( fibrinogen and thrombocytosis ) . all published cases of pulmonary embolism following envenomation had no associated lower limb thrombosis , which suppose a complex localized hypercoagulability . it is also important to note that thrombosis usually occurs at some distance from the site of bites . other hypotheses are more complex : venoms contain molecules directed against several targets of a coagulation pathway . for example , thrombin - like protease with initial fibrinolytic activity could cleave fibrinopeptide a or b from fibrinogen and activate coagulation factors , resulting in a cross - linked fibrin clot . dic - like syndrome , without real biologic dic : coagulation factors , d - dimer levels , and antithrombin 3 are usually normal . a localized coagulopathy appears because of increased levels of unstable fibrin produced by thrombin - like glycoproteins from the venom . in conclusion , we reported an extremely rare case of envenomation following viper bite in france , responsible for a late bilateral pulmonary embolism . our case is atypical because the patient had normal levels of fibrinogen , aptt , inr , and platelet counts , whereas in chani cases and baghat case patients had dic - like syndrome with low levels of fibrinogen . however , delay between the bite and happening of pulmonary embolism was similar between our case and all described cases . so far , heparin is not recommended in the acute phase of envenomation because of initial hypocoagulability , but could be useful once hemorrhagic symptoms improve . in french western coast only 2 species of viper can be seen : vipera aspis , which is more common and vipera berus . venom from viperidae has an effect on coagulation , that is why hemorrhagic complications are common and heparin treatment is not recommended during the acute phase of envenomation . in contrast , thromboembolic complications are very rare but can be seen during the later phase of envenomation . to our knowledge , only 4 others cases of pulmonary embolism following viper envenomation have been described so far . pulmonary embolism also occurred exactly 1 week after the bite , without associated phlebitis and after a previous subcutaneous hematoma . however , dic syndrome was described in all 3 cases , with decreased fibrinogen and elevated activated partial thromboplastin time ( aptt ) ratio . one more envenomation case was caused by greek viper on a child who suffered from diamond blackfan anemia . we found out 2 other cases in the literature : the first one occurred in martinique ( french west indies ) was because of bothrops lanceolatus , whose venom is responsible for acute thromboembolic complications in 30% cases . in this case , pulmonary embolism happened a few hours after the bite , suggesting a different way of hypercoagulation activation . the second one was because of crotalus scutulatus , an american snake . in this case , baghat et al described an interesting case of dic syndrome with decreased levels of fibrinogen . several hypotheses have been made to explain this late coagulopathy causing localized thromboembolism after snake bites . first , hypercoagulability could be caused by an increased systemic inflammation starting a few days after the bite , biologically showed by increased prothrombotic factors ( fibrinogen and thrombocytosis ) . all published cases of pulmonary embolism following envenomation had no associated lower limb thrombosis , which suppose a complex localized hypercoagulability . it is also important to note that thrombosis usually occurs at some distance from the site of bites . other hypotheses are more complex : venoms contain molecules directed against several targets of a coagulation pathway . for example , thrombin - like protease with initial fibrinolytic activity could cleave fibrinopeptide a or b from fibrinogen and activate coagulation factors , resulting in a cross - linked fibrin clot . dic - like syndrome , without real biologic dic : coagulation factors , d - dimer levels , and antithrombin 3 are usually normal . a localized coagulopathy appears because of increased levels of unstable fibrin produced by thrombin - like glycoproteins from the venom . in conclusion , we reported an extremely rare case of envenomation following viper bite in france , responsible for a late bilateral pulmonary embolism . our case is atypical because the patient had normal levels of fibrinogen , aptt , inr , and platelet counts , whereas in chani cases and baghat case patients had dic - like syndrome with low levels of fibrinogen . however , delay between the bite and happening of pulmonary embolism was similar between our case and all described cases . so far , heparin is not recommended in the acute phase of envenomation because of initial hypocoagulability , but could be useful once hemorrhagic symptoms improve .

abstractcomplications following snake bites are not common in france . we report the case of a bilateral pulmonary embolism following a viper envenomation in france.a healthy 72-year - old female presented with a lower limb hematoma following a viper bite . she was admitted at the hospital 2 days later and received low - molecular - weight heparin because of bed rest . seven days later , she complained of thoracic pain and respiratory failure , and a bilateral pulmonary was diagnosed , without biological sign of neither disseminated intravascular coagulation nor coagulation trouble . repeated lower limbs doppler ultrasound were normal.this case is particularly interesting because it is only the 7th reported case of pulmonary embolism following a snake envenomation ; moreover , it happened in france where poisonous snakes are very rare.several hypotheses have been made to explain this late localized coagulopathy : an increased level of unstable fibrin produced by thrombin - like glycoproteins from the venom is one of them .

INTRODUCTION CASE RESULTS AND DISCUSSION Toxicity Due to the Old World Vipers on Coagulation (Europe and North Africa) Toxicity Due to Other Snakes (America and Australia) Hypothesis

turner 's syndrome is the most common female sex chromosomal disorder with an estimated prevalence of 1 in 2500 . renal anomalies are seen in 3040% of these patients and screening for the same is currently recommended for all patients . although various renal anomalies ranging from horseshoe kidney to multicystic kidney disease have been described , the renal function is usually normal . the renal malformations increase the risk of recurrent urinary tract infections . decreased bone mineral density has been documented in turner 's syndrome and can occur independent of estrogen deficiency . a 16-year - old girl was admitted with progressive thinning and weakness of both upper and lower limbs with severe myalgia for 1 year duration . she was the second born girl of second - degree consanguineous marriage and her only sibling had died due to undiagnosed illness . on examination , her height was 131 cm ( < 3rd centile ) , weight was only 23 kg ( < 3rd centile ) , and had webbing of neck . there were features suggestive of rachitic rosary [ figure 1a ] , anterior bowing of tibia [ figure 1b ] , and proximal myopathy . her biochemical features showed hypocalcemia ( 6.5 mg/ dl ) , normal phosphorus ( 3.6 mg / dl ) , and raised alkaline phosphatase level ( 1813 iu / l ) . serum parathormone was greatly elevated ( 1652.5 pg / ml , normal 1474 pg / ml ) and 25-hydroxy vitamin d was decreased . ( 17.6 ng/ ml , normal > 30 ng/ ml ) . she also had uremia ( serum urea : 124 mg / dl and serum creatinine : 3.8 mg / dl ) and her ultrasound showed bilateral shrunken kidneys . ( c ) radiograph of right hand with wrist of a 16-year - old female patient with secondary hyperparathyroidism and renal osteodystrophy shows widening of the growth plate with indistinctness of metaphyseal margins and frayed appearance at the lower end of radius ulna and proximal metacarpals . also seen her arterial blood gases revealed an uncompensated metabolic acidosis with ph of 7.19 , hco3 of 11.4 x - ray of spine showed non - union of the ring apophyses [ figure 2 ] with the body of the vertebra and those of long bones and skull revealed features of osteosclerosis and metaphyseal widening [ figure 1c ] . tc99 m bone scan showed metabolic bone disease with no renal uptake , i.e. metabolic superscan [ figure 3 ] . ap view of pelvis of a 16-year - old female with renal osteodystrophy with lumbar spine shows deformed pelvis with bilateral protrusio acetabulae and triradiate configuration . there is increased density of bones with ground glass appearance , extensive cortical thickening of pelvic bones , and proximal femur more so involving the ileopectinate line with coarsened trabeculae . the physis plates of proximal femur are wide and irregular with deformed femoral epiphysis thus showing feature of both rickets and osteosclerosis in this patient . tc99 bone scan image of the patient showing avid tracer uptake by the entire skeleton with negligible renal uptake ( metabolic superscan ) . her chronic kidney disease was deemed to be due to chronic glomerulonephritis and was managed conservatively . she was given 3,00,000 iu bolus injection of cholecalciferol and followed with supplementation of calcium 1500 mg / day and calcitriol 0.75 mcg / day . with treatment , she also had significant reduction in bone pain and pth dropped to 627 pg / ml . turner 's syndrome is a chromosomal disorder which is usually recognized due to characteristic phenotypical features in preadolescence or due to delayed puberty / primary amenorrhea later on . the presence of renal anomalies in turner 's syndrome is well known but cases of frank renal failure and its complications have not been reported so far . di pinto et al studied the renal malformations in 24 patients with turner 's syndrome in which none had chronic kidney disease . in a larger series , lippe et al . studied 141 patients of which 33% had renal anomalies but none had bilateral contracted kidneys . the presence of hyperparathyroidism in turner 's syndrome has been reported in only five cases in the literature and all had primary hyperparathyroidism unlike secondary hyperparathyroidism in our case . her low calcium and high parathormone explain the significant contribution of coexistent vitamin d deficiency to her condition . rugger jersey spine , which is osteosclerosis of the superior and inferior ends of the body of vertebra . our patient paradoxically had an appearance that was the reverse of rugger jersey spine ( sclerotic center of the vertebra and lucent bands in the superior and inferior margins ) . the reason for preserved renal function in turner 's syndrome has not been investigated previously . it is probably due to earlier detection with remedial measures in majority of the cases . the poor socioeconomic status and limited access to healthcare resources could be the cause of late detection of the disease in some cases like the present one . the mortality rate in these patients is increased and is primarily due to cardiovascular cause . our patient did not have any congenital heart disease . since this was an atypical presentation of an uncommon syndrome , it was regrettably overlooked by local physicians . to our knowledge , this is the first reported case of renal osteodystrophy in turner 's syndrome in the literature .

turner 's syndrome is a genetic disorder with a complete or partial absence of one x chromosome with characteristic phenotypic features . the prevalence of renal anomalies in turner syndrome is 3040% . however , the renal function is usually normal . we report a case of turner 's syndrome presenting with chronic kidney disease and renal osteodystrophy .

I C D

conivaptan is a nonpeptide antagonist with a high affinity for the human vasopressin receptor subtypes v1a and v2 . the other vaptans mentioned earlier , lixivaptan , satavaptan , and tolvaptan , are selective v2 receptor antagonists , and do not have appreciable binding to the v1a receptors . the v1a receptor ( v1ar ) is ubiquitous and is located on the vascular smooth muscle cells , hepatocytes and platelets . stimulation of v1ar results in vasoconstriction , glycogenolysis , and platelet aggregation . the v1b receptor ( v1br ) is found in the pituitary , where it mediates the release of adrenocorticotropic hormone ( acth ) in conjunction with corticotrophin - releasing hormone ( crh ) . the v2 receptor ( v2r ) is located primarily in the kidney , where it mediates antidiuresis.4 the major pharmacological effect of conivaptan in hyponatremia is accomplished by potent antagonism of v2r . as mentioned earlier , the v2r are functionally coupled to aquaporin-2 channels in the apical membrane of the collecting ducts of the kidney . antagonism of v2r in the collecting duct of the kidney results in an increase in free water excretion or effective water clearance , net fluid loss , increased urine output , and decreased urine osmolality.10 but unlike diuretic agents , conivaptan enhances free water excretion without significantly increasing renal excretion of sodium or potassium . agents , ie , stimulating excretion of only water , to distinguish their renal effects from the increased solute and water excretion characteristically produced by diuretics . conivaptan is available as an iv formulation in 4 ml ampoules containing 20 mg of conivaptan hydrochloride . a loading dose of 20 mg is administered through a large vein over 30 minutes , followed by a maintenance dose of 2040 mg per day for up to four days by continuous infusion . peripheral intravenous infusion sites should be changed every 24 hours to reduce common infusion site complications such as irritation and phlebitis resulting from the use of propylene glycol as a solvent in the ampules . a new formulation pre - mixed in 100 ml infusion bags was approved by the fda in october 2008 , which should reduce complications from infusion site reactions since this formulation does not include propylene glycol . close monitoring of serum sodium and volume status ( every 46 hrs ) is recommended with dose adjustments as necessary to achieve desired correction rates of the serum sodium concentration.9 clinical trials of oral conivaptan have been reported at doses ranging from 20 to 80 mg . however , further development of an oral formulation was discontinued due to effects at the cytochrome p450 isoenzyme 3a4 ( cyp3a4 ) , leading to potential prolongation of action of other drugs also metabolized by cyp3a4 . the pharmacokinetics of conivaptan have been studied in healthy and special populations using both the oral and the intravenous formulations . the peak diuretic effect of oral and intravenous conivaptan occurred between two to four hours,1114 resulting in a seven - fold increase in urine flow rate and a decrease in urinary osmolality . the duration of aquaretic effect following single doses both orally and intravenously was 12 hours.11 urine output returned to baseline value 12 hours following oral or intravenous administration of conivaptan . the effect of conivaptan on pulmonary capillary wedge pressure ( pcwp ) in patients with advanced heart failure was sustained for approximately eight hours following the administration of intravenous conivaptan , and pcwp remained below baseline values even after 12 hours.13 the pharmacokinetics of 40 mg / day and 80 mg / day of intravenous and oral conivaptan were nonlinear , because conivaptan inhibits its own metabolism at cyp3a4 . conivaptan is metabolized by the liver by cyp3a4 , thus it can interact with other drugs that are also metabolized by cyp3a4 . because of this , conivaptan is contraindicated with the concurrent use of other potent cyp3a4 inhibitors such as ketoconazole , itraconazole , clarithromycin , ritonavir , and indinavir . the effects of hepatic or renal impairments on the pharmacokinetics of conivaptan have not been systematically evaluated . conivaptan s efficacy for the treatment of hyponatremia has been assessed in three randomized double - blinded , placebo - controlled clinical trials and one open - label nonrandomized study . the three randomized studies include one pivotal study with intravenous conivaptan and two trials using oral conivaptan ; the non - randomized study used intravenous conivaptan . phase iii studies showed that conivaptan reliably increases the serum sodium concentration , beginning as early as one to two hours after administration . mmol / l within 5 hours and by 6 to 9 mmol / l within 24 hours after initiation of therapy at the 20-mg and 40-mg doses , respectively . in most patients , approximately 70% , the serum sodium normalized over a four - day continuous infusion , with the greatest increase in serum sodium occurring during the first 24 to 48 hours of treatment . the primary efficacy endpoint in these studies was the mean change in serum sodium over the duration of treatment , as measured by the area under the serum sodium effect curve ( auc ) , corrected for baseline serum sodium.1517 in the pivotal phase iii trial conducted with iv conivaptan,17 84 patients with euvolemic or hypervolemic hyponatremia ( serum sodium 115130 meq / l ) were randomized to receive conivaptan 40 mg / day , 80 mg / day or placebo for four days . of 84 total patients included in the intention - to - treat analysis , 66 completed treatment . both doses of conivaptan were associated with significant improvements in serum sodium compared to placebo as measured by both the primary and secondary efficacy endpoints ( table 1 ) . all patients also received standard care treatments for hyponatremia , which primarily consisted of fluid restriction . this was not a strict fluid restriction , ie , < 2 liters / day , because the primary goal was to prevent the patients on placebo from worsening , rather than as an active treatment for hyponatremia . a planned subgroup analysis of this trial was performed to evaluate the efficacy of intravenous conivaptan in patients with euvolemic hyponatremia.18 fifty - six of the 84 patients analyzed in the trial were euvolemic . conivaptan 40 and 80 mg / day effectively raised mean serum sodium on the first day of treatment . the mean increase in serum sodium with conivaptan remained significantly greater than that with placebo at the end of the four - day treatment period . the placebo group did not demonstrate any significant changes in serum sodium concentration ( figure 1 ) . of the two oral conivaptan trials , one has been published.16 the efficacy of oral conivaptan was evaluated in 74 euvolemic and hypervolemic hyponatremic patients who were randomized to receive oral conivaptan 40 mg / day , 80 mg / day , or placebo , all given in two divided doses / day for five days . both doses of conivaptan were associated with significant dose - dependent improvements in serum sodium compared to placebo ( table 2 ) . results from the second oral conivaptan study are available in abstract form only.15 the study , similar to the other oral conivaptan study , included 83 patients with euvolemic and hypovolemic hyponatremia , and revealed the same dose - dependent increase in serum sodium concentrations ( table 2 ) . results from the open - label multicenter trial using intravenous conivaptan were presented at the annual meeting of the endocrine society in june 2008.19 the study was conducted from february 2004 to june 2005 , and included 251 hospitalized patients with euvolemic and hypervolemic hyponatremia to assess the efficacy and safety of intravenous conivaptan 20 and 40 mg / day for four days and for up to 30 days after cessation of therapy . the most common underlying illness associated with hyponatremia was siadh ( 43% of patients ) . conivaptan was associated with significant increases in serum sodium concentration that were sustained throughout the study . at the cessation of active therapy , the mean serum sodium increased by 9.4 and 8.8 meq / l in patients given conivaptan 20 and 40 mg / day , respectively . the response did not appear to differ significantly among patients given 20 or 40 mg / day . very interestingly , the increases in serum sodium over baseline achieved through the end of treatment persisted through days 11 and 34 after initiation of aquaretic therapy even though the duration of active treatment was only four days . the reason for the persistence of the correction is unknown , but it suggests that limited infusions of conivaptan may be sufficient to improve hyponatremia not only during active treatment , but also for longer periods of time in patients who have improvement in their underlying comorbidities responsible for the hyponatremia . although conivaptan has been evaluated extensively in patients with congestive heart failure ( chf ) , efficacy has not been established other than for correction of hyponatremia ; thus , conivaptan is not indicated for primary treatment of chf at this time . vasopressin levels are often elevated in patients with heart failure and left ventricular ( lv ) dysfunction,20 and they are clearly associated with adverse cardiovascular outcomes in the setting of lv dysfunction after myocardial infarction.21 these data suggest that vasopressin may contribute to the circulatory response in patients with heart failure , and may also play a role in the development and progression of heart failure . combined v1ar / v2r antagonism with conivaptan therefore does offer a theoretical benefit in chf . if systemic hemodynamic improvement occurs with v1ar antagonism , renal hemodynamics would improve as well with v2r antagonism , leading to a greater clinical benefit . the hemodynamic effects of conivaptan were evaluated in a prospective , randomized , double - blind study of 142 patients with new york heart association ( nyha ) class iii or iv heart failure of at least three months duration.13 subjects were randomized to receive a single dose of intravenous ( iv ) conivaptan ( 10 , 20 , or 40 mg ) or placebo , administered over 30 minutes . conivaptan produced favorable hemodynamic changes in patients with advanced heart failure , without affecting blood pressure or heart rate . pulmonary capillary wedge pressure and right atrial pressure were significantly reduced in the conivaptan 20 mg and 40 mg groups at three to six hours post - dose as compared with the placebo groups . urine output was significantly higher in the conivaptan - treated patients as compared with placebo , and dose - dependent increases in urine output were observed with increasing conivaptan doses ( p < 0.001 ) . despite conivaptan s properties as a v1ar antagonist , it had no significant effects on systolic blood pressure and pulse rate . no statistically significant changes in cardiac index , mean arterial pressure , pulmonary artery pressure , systemic or pulmonary vascular resistance were observed among the treatment groups . serum osmolality , serum sodium , and potassium levels were similar among conivaptan and placebo groups . of note , the patients were fluid - restricted to 250 ml every two hours during the 12-hour study periods and background diuretics and other medications were held during the study period . it should be noted that this study only examined the acute alterations in hemodynamics following a single intravenous dose of conivaptan . despite the encouraging results of this study , other pilot and phase ii studies have not shown benefits in clinical outcomes with longer term conivaptan use . in a double - blind , dose - ranging pilot study,22 162 hospitalized patients with nyha class iii or iv heart failure were randomized to receive conivaptan 20 mg by intravenous bolus followed by continuous infusion of 40 mg / day , 80 mg / day , 120 mg / day , or placebo for two days . ten patients in the conivaptan groups and one in the placebo group discontinued the drug due to adverse events . significant increases in urine output and changes in body weight were observed with all doses of conivaptan compared to placebo , but conivaptan did not improve the severity of respiratory symptoms . a dose evaluation of vasopressin antagonist in chf patients undergoing exercise ( advance ) was a multi - center , double - blind , placebo - controlled , randomized trial designed to investigate the effect of conivaptan on functional capacity in patients with heart failure.23 the study enrolled 345 patients with nyha class ii to iv symptoms who were being treated with standard pharmacotherapy for heart failure . currently , only the methodology of this trial has been published , but additional results are anticipated in the future . conivaptan s efficacy for the treatment of hyponatremia has been assessed in three randomized double - blinded , placebo - controlled clinical trials and one open - label nonrandomized study . the three randomized studies include one pivotal study with intravenous conivaptan and two trials using oral conivaptan ; the non - randomized study used intravenous conivaptan . phase iii studies showed that conivaptan reliably increases the serum sodium concentration , beginning as early as one to two hours after administration . mmol / l within 5 hours and by 6 to 9 mmol / l within 24 hours after initiation of therapy at the 20-mg and 40-mg doses , respectively . in most patients , approximately 70% , the serum sodium normalized over a four - day continuous infusion , with the greatest increase in serum sodium occurring during the first 24 to 48 hours of treatment . the primary efficacy endpoint in these studies was the mean change in serum sodium over the duration of treatment , as measured by the area under the serum sodium effect curve ( auc ) , corrected for baseline serum sodium.1517 in the pivotal phase iii trial conducted with iv conivaptan,17 84 patients with euvolemic or hypervolemic hyponatremia ( serum sodium 115130 meq / l ) were randomized to receive conivaptan 40 mg / day , 80 mg / day or placebo for four days . of 84 total patients included in the intention - to - treat analysis , 66 completed treatment . both doses of conivaptan were associated with significant improvements in serum sodium compared to placebo as measured by both the primary and secondary efficacy endpoints ( table 1 ) . all patients also received standard care treatments for hyponatremia , which primarily consisted of fluid restriction . this was not a strict fluid restriction , ie , < 2 liters / day , because the primary goal was to prevent the patients on placebo from worsening , rather than as an active treatment for hyponatremia . a planned subgroup analysis of this trial was performed to evaluate the efficacy of intravenous conivaptan in patients with euvolemic hyponatremia.18 fifty - six of the 84 patients analyzed in the trial were euvolemic . conivaptan 40 and 80 mg / day effectively raised mean serum sodium on the first day of treatment . the mean increase in serum sodium with conivaptan remained significantly greater than that with placebo at the end of the four - day treatment period . the placebo group did not demonstrate any significant changes in serum sodium concentration ( figure 1 ) . of the two oral conivaptan trials , one has been published.16 the efficacy of oral conivaptan was evaluated in 74 euvolemic and hypervolemic hyponatremic patients who were randomized to receive oral conivaptan 40 mg / day , 80 mg / day , or placebo , all given in two divided doses / day for five days . both doses of conivaptan were associated with significant dose - dependent improvements in serum sodium compared to placebo ( table 2 ) . results from the second oral conivaptan study are available in abstract form only.15 the study , similar to the other oral conivaptan study , included 83 patients with euvolemic and hypovolemic hyponatremia , and revealed the same dose - dependent increase in serum sodium concentrations ( table 2 ) . results from the open - label multicenter trial using intravenous conivaptan were presented at the annual meeting of the endocrine society in june 2008.19 the study was conducted from february 2004 to june 2005 , and included 251 hospitalized patients with euvolemic and hypervolemic hyponatremia to assess the efficacy and safety of intravenous conivaptan 20 and 40 mg / day for four days and for up to 30 days after cessation of therapy . the most common underlying illness associated with hyponatremia was siadh ( 43% of patients ) . conivaptan was associated with significant increases in serum sodium concentration that were sustained throughout the study . at the cessation of active therapy , the mean serum sodium increased by 9.4 and 8.8 meq / l in patients given conivaptan 20 and 40 mg / day , respectively . the response did not appear to differ significantly among patients given 20 or 40 mg / day . very interestingly , the increases in serum sodium over baseline achieved through the end of treatment persisted through days 11 and 34 after initiation of aquaretic therapy even though the duration of active treatment was only four days . the reason for the persistence of the correction is unknown , but it suggests that limited infusions of conivaptan may be sufficient to improve hyponatremia not only during active treatment , but also for longer periods of time in patients who have improvement in their underlying comorbidities responsible for the hyponatremia . although conivaptan has been evaluated extensively in patients with congestive heart failure ( chf ) , efficacy has not been established other than for correction of hyponatremia ; thus , conivaptan is not indicated for primary treatment of chf at this time . vasopressin levels are often elevated in patients with heart failure and left ventricular ( lv ) dysfunction,20 and they are clearly associated with adverse cardiovascular outcomes in the setting of lv dysfunction after myocardial infarction.21 these data suggest that vasopressin may contribute to the circulatory response in patients with heart failure , and may also play a role in the development and progression of heart failure . combined v1ar / v2r antagonism with conivaptan therefore does offer a theoretical benefit in chf . if systemic hemodynamic improvement occurs with v1ar antagonism , renal hemodynamics would improve as well with v2r antagonism , leading to a greater clinical benefit . the hemodynamic effects of conivaptan were evaluated in a prospective , randomized , double - blind study of 142 patients with new york heart association ( nyha ) class iii or iv heart failure of at least three months duration.13 subjects were randomized to receive a single dose of intravenous ( iv ) conivaptan ( 10 , 20 , or 40 mg ) or placebo , administered over 30 minutes . conivaptan produced favorable hemodynamic changes in patients with advanced heart failure , without affecting blood pressure or heart rate . pulmonary capillary wedge pressure and right atrial pressure were significantly reduced in the conivaptan 20 mg and 40 mg groups at three to six hours post - dose as compared with the placebo groups . urine output was significantly higher in the conivaptan - treated patients as compared with placebo , and dose - dependent increases in urine output were observed with increasing conivaptan doses ( p < 0.001 ) . despite conivaptan s properties as a v1ar antagonist , it had no significant effects on systolic blood pressure and pulse rate . no statistically significant changes in cardiac index , mean arterial pressure , pulmonary artery pressure , systemic or pulmonary vascular resistance were observed among the treatment groups . serum osmolality , serum sodium , and potassium levels were similar among conivaptan and placebo groups . of note , the patients were fluid - restricted to 250 ml every two hours during the 12-hour study periods and background diuretics and other medications were held during the study period . it should be noted that this study only examined the acute alterations in hemodynamics following a single intravenous dose of conivaptan . despite the encouraging results of this study , other pilot and phase ii studies have not shown benefits in clinical outcomes with longer term conivaptan use . in a double - blind , dose - ranging pilot study,22 162 hospitalized patients with nyha class iii or iv heart failure were randomized to receive conivaptan 20 mg by intravenous bolus followed by continuous infusion of 40 mg / day , 80 mg / day , 120 mg / day , or placebo for two days . ten patients in the conivaptan groups and one in the placebo group discontinued the drug due to adverse events . significant increases in urine output and changes in body weight were observed with all doses of conivaptan compared to placebo , but conivaptan did not improve the severity of respiratory symptoms . a dose evaluation of vasopressin antagonist in chf patients undergoing exercise ( advance ) was a multi - center , double - blind , placebo - controlled , randomized trial designed to investigate the effect of conivaptan on functional capacity in patients with heart failure.23 the study enrolled 345 patients with nyha class ii to iv symptoms who were being treated with standard pharmacotherapy for heart failure . currently , only the methodology of this trial has been published , but additional results are anticipated in the future . the majority of adverse events were infusion site reactions during intravenous administration , likely as a result of propylene glycol , which is irritating to veins . these reactions occurred in over 50% of conivaptan patients compared with 2% of placebo - treated patients during clinical trials ( table 3 ) . a new formulation pre - mixed in 100 ml infusion bags was approved by the fda in october 2008 , and should reduce infusion site complications since this formulation does not include propylene glycol . although most infusion site complications were minor , including local inflammation , phlebitis , and pain at the infusion site , some serious infusion site reactions did occur . other side effects in decreasing order included headaches , hypokalemia , thirst , vomiting , polyuria , peripheral edema , diarrhea , and orthostatic hypotension . orthostatic hypotension generally occurred on days 1 and 2 of therapy , likely because of volume depletion from induced aquaresis . although v1ar antagonism on vascular smooth muscle could contribute to hypotension as well , this is less likely because : ( 1 ) avp is not necessary for blood pressure homeostasis,8 and ( 2 ) the orthostatic hypotension was mild , short lived , and did not result in withdrawal of patients from the studies . another safety concern that occurred in approximately 9% of the subjects during clinical trials was a too - rapid correction of serum sodium concentration with the administration of conivaptan.9 overly rapid correction of severe hyponatremia can produce pontine and extrapontine myelinolysis , also called osmotic demyelination syndrome ( ods ) , a brain demyelinating disease that can cause substantial neurological morbidity and mortality.24 however , no cases of ods were noted in any of the clinical trials , nor have been reported with subsequent clinical use of conivaptan since 2006 . this is likely the result of using titrated doses of conivaptan with careful monitoring of the serum sodium concentrations during the active phase of correction , thereby achieving a controlled and limited correction of hyponatremia.4 review of data from patients with adverse effects of hypokalemia revealed that the occurrence of a low serum potassium < 3.3 meq / l ( the protocol - defined low threshold for hypokalemia , normal reference range : 3.55.0 meq / l ) at the end of days 2 and 4 was not nearly as high as the reported occurrence of hypokalemia adverse events . overall changes from baseline in serum potassium during the four - day treatment period were mild , and did not reach a level of clinical significance . conivaptan is currently indicated for the treatment of euvolemic hyponatremia as a result of siadh , pulmonary disorders , hypothyroidism or adrenal insufficiency , and for the treatment of hypervolemic hyponatremia . a panel of experts in hyponatremia evaluated the situations in which aquaretic agents should be considered for therapy.18 in hypovolemic hyponatremia , induced aquaresis would aggravate the underlying volume depletion . consequently , conivaptan and all other vaptans are contraindicated in hypovolemic hyponatremia . for euvolemic hyponatremia however , careful clinical assessment of the patient and an accurate diagnosis of euvolemic hyponatremia are necessary before therapy is prescribed . in hypervolemic hyponatremia , antagonism of v2r represents the best approach to treating hyponatremia in most edema - forming states such as congestive heart failure and cirrhosis , because excess avp is the most important pathophysiological factor involved in the pathogenesis of hyponatremia under these conditions , and because therapies employing administration of sodium chloride are generally contraindicated in such patients . conivaptan is currently indicated for the treatment of euvolemic hyponatremia as a result of siadh , pulmonary disorders , hypothyroidism or adrenal insufficiency , and for the treatment of hypervolemic hyponatremia . a panel of experts in hyponatremia evaluated the situations in which aquaretic agents should be considered for therapy.18 in hypovolemic hyponatremia , induced aquaresis would aggravate the underlying volume depletion . consequently , conivaptan and all other vaptans are contraindicated in hypovolemic hyponatremia . for euvolemic hyponatremia however , careful clinical assessment of the patient and an accurate diagnosis of euvolemic hyponatremia are necessary before therapy is prescribed . in hypervolemic hyponatremia , antagonism of v2r represents the best approach to treating hyponatremia in most edema - forming states such as congestive heart failure and cirrhosis , because excess avp is the most important pathophysiological factor involved in the pathogenesis of hyponatremia under these conditions , and because therapies employing administration of sodium chloride are generally contraindicated in such patients . patients with chf often do not correct hypo - osmolar hyponatremia with conventional diuretic therapy . however , reversing impaired free water excretion with conivaptan normalizes dilutional hyponatremia in congestive heart failure patients.4,17 conivaptan and other v2r antagonists will likely prove to be superior to conventional diuretics in this setting , since they can induce free water diuresis without an accompanying solute diuresis . tolvaptan , an oral v2r antagonist , has been assessed in several trials for the management of acute and chronic heart failure . the acute and chronic therapeutic impact of vasopressin antagonist in congestive heart failure ( activ in chf ) trial was a multicenter , randomized controlled trial with 319 patients with acute exacerbation of chf.25 21.3% of the patients had hyponatremia ( serum sodium < 136 patients were randomized to receive one of three doses of oral tolvaptan or placebo for up to 60 days in addition to standard chf therapy . all tolvaptan groups had significant reductions in body weight compared with the placebo group and had significantly higher urine volumes than the placebo group . a large phase iii multi - center trial , efficacy of vasopressin antagonist in heart failure outcome study with tolvaptan ( everest ) , compared the short - term and long - term administration of tolvaptan with placebo in 4133 patients admitted with worsening heart failure . 26,27 in the short - term study , tolvaptan patients lost more weight on day 1 and day 7 or on discharge . more patients receiving tolvaptan reported improvement in dyspnea on day 1 and reduction in edema on day 7 , whereas improvement in general clinical status did not differ between groups.25 however in the long - term study , with a median follow - up of 9.9 months , tolvaptan had no effect on long - term mortality or heart failure - related morbidity.27 within the limitations inherent in this study , the long - standing association between adverse outcomes and hyponatremia in patients with chf does not appear to be due to adverse effects of the hyponatremia itself.28 patients with cirrhosis , intractable ascites , and peripheral edema are often ineffectively treated with aldosterone antagonists and beta - blockers , but it is currently not advisable to use conivaptan in patients with cirrhosis because v1ar inhibition may block the vasoconstrictive effects of avp in the portal and splanchnic circulation , possibly increasing portal blood flow . however , decreases in portal hypertension may offset this effect . consequently , the net effect of conivaptan on the risk of precipitating esophageal variceal bleeding is unknown . theoretically , selective v2r antagonists should not entail adverse effects on portal hemodynamics , but their safety in cirrhosis remains to be ascertained . one of the other oral v2r antagonists , lixivaptan , has been studied in patients with cirrhosis . one randomized controlled trial of 44 hospitalized patients with stable hyponatremia that included 33 patients with cirrhosis showed that a seven - day course of lixivaptan was well tolerated and increased free water clearance , urine output and serum sodium concentrations in a dose - dependent manner.29 another study of 60 patients with cirrhosis showed an increase in serum sodium concentration after seven days of treatment to a mean of 132 meq / l compared with 126 meq / l in the placebo group.30 lixivaptan had no significant effects on blood pressure or heart rate . most placebo - controlled studies using avpr antagonists to treat hyponatremia have been of relatively short duration . however , recent data from two multicenter 30-day placebo - controlled trials of tolvaptan resulted in sustained correction of hyponatremia and improved cognitive function.31 another study using satavaptan , an oral v2r antagonist , began as a five - day randomized , placebo - controlled trial in patients with siadh and continued as an open - label trial which showed continued efficacy and good tolerance for up to 12 months of treatment.32 under a fluid restriction of < 1500 ml / day , mean serum sodium levels remained within the normal range during the open - label period . long - term response rates to oral conivaptan and other avpr antagonists , and whether correction of chronic hyponatremia results in improved functional status and quality of life , will require additional studies . patients with chf often do not correct hypo - osmolar hyponatremia with conventional diuretic therapy . however , reversing impaired free water excretion with conivaptan normalizes dilutional hyponatremia in congestive heart failure patients.4,17 conivaptan and other v2r antagonists will likely prove to be superior to conventional diuretics in this setting , since they can induce free water diuresis without an accompanying solute diuresis . tolvaptan , an oral v2r antagonist , has been assessed in several trials for the management of acute and chronic heart failure . the acute and chronic therapeutic impact of vasopressin antagonist in congestive heart failure ( activ in chf ) trial was a multicenter , randomized controlled trial with 319 patients with acute exacerbation of chf.25 21.3% of the patients had hyponatremia ( serum sodium < 136 patients were randomized to receive one of three doses of oral tolvaptan or placebo for up to 60 days in addition to standard chf therapy . all tolvaptan groups had significant reductions in body weight compared with the placebo group and had significantly higher urine volumes than the placebo group . a large phase iii multi - center trial , efficacy of vasopressin antagonist in heart failure outcome study with tolvaptan ( everest ) , compared the short - term and long - term administration of tolvaptan with placebo in 4133 patients admitted with worsening heart failure . 26,27 in the short - term study , tolvaptan patients lost more weight on day 1 and day 7 or on discharge . more patients receiving tolvaptan reported improvement in dyspnea on day 1 and reduction in edema on day 7 , whereas improvement in general clinical status did not differ between groups.25 however in the long - term study , with a median follow - up of 9.9 months , tolvaptan had no effect on long - term mortality or heart failure - related morbidity.27 within the limitations inherent in this study , the long - standing association between adverse outcomes and hyponatremia in patients with chf does not appear to be due to adverse effects of the hyponatremia itself.28 patients with cirrhosis , intractable ascites , and peripheral edema are often ineffectively treated with aldosterone antagonists and beta - blockers , but it is currently not advisable to use conivaptan in patients with cirrhosis because v1ar inhibition may block the vasoconstrictive effects of avp in the portal and splanchnic circulation , possibly increasing portal blood flow . consequently , the net effect of conivaptan on the risk of precipitating esophageal variceal bleeding is unknown . theoretically , selective v2r antagonists should not entail adverse effects on portal hemodynamics , but their safety in cirrhosis remains to be ascertained . one of the other oral v2r antagonists , lixivaptan , has been studied in patients with cirrhosis . one randomized controlled trial of 44 hospitalized patients with stable hyponatremia that included 33 patients with cirrhosis showed that a seven - day course of lixivaptan was well tolerated and increased free water clearance , urine output and serum sodium concentrations in a dose - dependent manner.29 another study of 60 patients with cirrhosis showed an increase in serum sodium concentration after seven days of treatment to a mean of 132 meq / l compared with 126 meq / l in the placebo group.30 lixivaptan had no significant effects on blood pressure or heart rate . most placebo - controlled studies using avpr antagonists to treat hyponatremia have been of relatively short duration . however , recent data from two multicenter 30-day placebo - controlled trials of tolvaptan resulted in sustained correction of hyponatremia and improved cognitive function.31 another study using satavaptan , an oral v2r antagonist , began as a five - day randomized , placebo - controlled trial in patients with siadh and continued as an open - label trial which showed continued efficacy and good tolerance for up to 12 months of treatment.32 under a fluid restriction of < 1500 ml / day , mean serum sodium levels remained within the normal range during the open - label period . long - term response rates to oral conivaptan and other avpr antagonists , and whether correction of chronic hyponatremia results in improved functional status and quality of life , will require additional studies . conivaptan , along with the other avpr antagonists , produce an aquaretic effect by blocking the activity of endogenous avp at the v2r , which improves dilutional hyponatremia . the current data indicate that these agents are highly effective in producing a safe and predictable aquaresis , thereby increasing serum sodium levels in hyponatremic patients . conivaptan is the first avpr antagonist to receive fda approval , specifically for iv administration to hospitalized patients with euvolemic or hypervolemic hyponatremia . several investigational oral v2r - selective avpr antagonists are in late - stage clinical trials and hold promise for long - term therapy of chronic hyponatremia . however , the safe use of conivaptan and other aquaretics will require avoidance of their use in hypovolemic patients and caution with regard to the correction rate of hyponatremia . clinicians must also be aware of drug interactions , particularly drugs that are metabolized by cytochrome cyp3a4 .

introduction : the available treatment options for euvolemic and hypervolemic hyponatremia are limited , and consist mainly of fluid restriction , diuresis , or hypertonic solutions . most of these therapies are neither well tolerated nor totally effective , and many are associated with significant adverse effects . vasopressin receptor antagonists , also known as vaptans , are a new class of agents that now offer an additional treatment option for hyponatremic patients . conivaptan hydrochloride , a competitive antagonist of vasopressin v1a and v2 receptors , is the first agent in this class to be approved for treatment of euvolemic and hypervolemic hyponatremia in hospitalized patients.aims:this review critically assesses the evidence that support the use of conivaptan for the treatment of patients with euvolemic and hypervolemic hyponatremia.evidence review conclusion : conivaptan is effective in raising serum sodium levels in a predictable and safe fashion in euvolemic and hypervolemic hyponatremic patients . conivaptan provides the first molecularly targeted approach for correcting hyponatremia in hospitalized patients .

Mechanism of action Drug formulation and dosing Pharmacokinetics Clinical efficacy Hyponatremia Heart failure Tolerability Clinical indications Hyponatremia Potential therapeutic indications for conivaptan and similar agents Congestive heart failure Cirrhosis Long-term treatment of hyponatremia Conclusions

the resectable rates for the hepatic hilar malignant obstruction are variable depending on surgeons , but generally reported to be approximately 10 - 20% ( 1 - 3 ) . bilateral biliary drainage with stenting for hilar malignant obstructions has been performed for palliative treatment ( 4 , 5 ) . primary patency rate with the current biliary stents in 12 months has been reported as approximately 12 - 40% ( 1 , 4 , 5 ) . when the stent is obstructed by the tumor ingrowth or sludge formation , restenting can be reasonable and an ideal option to preserve the functional volume of liver in the course of chemotherapy or to prevent the bile - stasis cholangitis . however , the necessity of biliary drainage of both liver lobes is still controversial in the hilar malignant obstruction , including the advanced klastkin tumor ( 6 ) . it is difficult to re - stent bilaterally in order to drain bile , because the wires of the previously inserted stent have a potential risk of preventing the additional stent insertion through the contra - lateral bile duct ( 7 ) . for this reason , there was a need for a special stent system to improve the patency rate and to allow re - stenting bilaterally when reobstruction happens in patients with a hepatic hilar malignancy . we introduce a new attempt to improve the patency rate of the biliary stent in patients with inoperable cholnagiocarcinomas by the insertion of a newly designed y - shaped branched covered stent . it consists of two different stents : a main piece of stent and a contra - lateral limb covered stent ( fig . a 72-year - old woman was admitted to the hospital complaining of right upper quadrant pain . initial abdominopelvic ct showed hepatic hilar obstruction due to cholangiocarcinoma , extending from hilum of extrahepatic bile duct to distal common bile duct . elevated total bilirubin level ( 13.0 mg / dl ) and direct bilirubin level ( 10.8 mg / dl ) were found at admission . alkaline phosphatase level ( 1189 iu / l ) and gamma - glutamyl transpeptidase ( 229 mg / dl ) were also elevated . percutaneous transhepatic biliary drainage ( ptbd ) through the right intrahepatic bile duct ( fig . we planned on the newly designed y - shaped covered stent insertion on the fourth day after the initial drainage procedure , and performed another ptbd through the left intrahepatic bile duct ( s3 duct ) ( fig . the drainage catheters were removed and 8 fr sheaths inserted over a 0.035-inch hydrophilic guide wire ( terumo , tokyo , japan ) bilaterally . first , we inserted and located the main piece of stent into the common bile duct through left ptbd tract ( fig . the proximal end of the main piece stent ( egis key - mb stent ) ( s&g bio , seoul , korea ) was located in the left intrahepatic bile duct ( ihd ) beyond the boundary of the hilar tumor ( fig . the short limb covered portion of the main piece stent was directed toward the left side of the common bile duct ( fig . 1c , thin arrows ) . to easily insert and deploy the contra - lateral long limb covered stent ( egis key - cl stent ) ( s&g bio , seoul , korea ) without kinking its struts , the long limb covered stent of the main piece was not to be deployed ( fig . 1d , three thick arrows ) until the contra - lateral long limb covered stent was completely deployed in an adequate position . after successful negotiation of a guide wire into the short limb covered stent of the main piece , a contra - lateral long limb covered stent was inserted through the right ptbd tract to connect this short limb covered stent of the main piece under the guidance of a 0.035-inch guide wire . after the confirmation that its proximal end was located in the right ihd beyond the boundary of the hilar tumor , we deployed the contra - lateral long limb covered ( fig . 1e ) . finally , the long limb covered stent of the main piece was completely deployed . a 7 fr drainage catheter was placed through the left ihd with its tip located in the common bile duct . to confirm the correct stent expansion and function , post - stenting cholangiography was performed through the drainage catheter just after the stent insertion ( fig . cholangiography showed good bilateral communication via completely expanded stents , and the drainage catheter was removed . on eighth day following the stent placement , total bilirubin and direct bilirubin levels decreased to 2.7 mg / dl and 2.2 mg / dl , respectively . they have not been elevated in the 12 months following the y - shaped covered stent insertion ( total bilirubin / direct bilirubin = 0.9/0.5 mg / dl ) . in hilar malignant biliary obstruction , the first requirement for the ideal stent platform is complete coverage of the tumorous bile ducts without interfering with contra - lateral or branched bile duct patency . ( 2 ) reported that percutaneous y - configurated covered biliary stent placement for the malignant hilar obstruction gives the patent biliary flows without interfering the contra - lateral bile flows . however , even if internal biliary drainage with the other currently available biliary stent is optimally implanted in case of the bilateral hilar malignant obstructed lesion , it may actually impair the contra - lateral bile flow . this is from the wires of the second stent partially left inside the first stent in the hepatic hilum , when t - configured or y - configured current stent is inserted . ( 8) cited that , in case of the biliary stent - in - stent deployment , even in t or y configuration , there is a risk of its preventing the bile inflow in the area of the stent overlap , leading to sludge formation . furthermore , there is a possibility that tumor ingrowth will easily occur if the stent mesh is expanded in the area of overlap . on the other hand , the present newly designed y - shaped covered biliary stent may provide a higher patency rate , as it is a covered stent system . it does not interfere with the contra - lateral bile flow with its stent - by - stent deployment and its structural configuration ( fig . if complete coverage of the branched bile ducts with the biliary covered stent is achieved , early reobstruction occurs , and the primary patency rate of the biliary stent will be lower . this is from the wires of the previously inserted stent having a potential risk of preventing the additional stent insertion through the contra - lateral bile duct , when the reobstruction happens ( 3 , 8) . this y - shaped covered biliary stent may not prevent the additional stent insertion , even if the biliary obstruction happens again . from the technical perspective , the methods used in this y - configured covered stent implantation are relatively simple , other than at one point of the procedure . two guide wires are separately inserted into the common bile duct portion through the bilateral tumorous bile ducts . after the adequate main piece stent system ( egis key - mb stent ) deployment , the contra - lateral limb covered stent ( egis key - cl stent ) is inserted into the short limb covered portion of the main piece stent system . there is one technical step which is quite different from the usual stenting procedure . during the deployment of the main piece stent system , the operator should not deploy the long limb covered portion of the main piece system ( fig . if the operator deploys the long limb covered portion of the main piece system completely , it may interrupt the negotiation of the guide wire or long limb covered stent - introducer passing through the hilar tumorous obstructive lesion into the short limb covered stent of the main piece system . stent grafts or covered stent are usually more likely to prevent tumor ingrowth than bare stents . gwon reported that the stent graft may prolong the patency rate in the hilar malignant obstruction ( 2 , 4 ) . however , there are few limitations in the use of a stent graft or covered stent for treating the advanced hilar bile duct malignancies . there is a risk of occlusion of branching or contra - lateral bile ducts in a covered stent or stent graft . hence , the partially covered stents were made with bare ends , which provides better anchoring and stabilization . in this y - covered stent design , bare stent extensions on each end of the covered stents ( main trunk , ipsilateral proximal limb , and contra - lateral limbs ) will limit the chances of migration ( fig . a silicone - covered self - expandable stent system was used , because it provides a larger lumen for bile flow and does not allow as much sludge build - up or occlusion as the polyethylene - covered stent ( 9 ) . currently there have been only a few stent trials performed for the palliative treatment of the hepatic hilar malignant obstruction ( 1 , 4 , 5 ) , and the image appearances of the hilar lesions have seemed to be satisfactory . however , long - term or mid - term clinical outcome studies , including the occurrence of reobstruction after the stent insertions , are still sparse . in fact additional therapies including the radiotherapy , photodynamic therapy , and chemotherapy can lead to longer symptomatic survival , or to longer phases of stent patency after the conservative biliary drainage ( 7 , 10 ) . it is hoped that this new stent design may give clinicians the opportunity to offer a long - term patent rate , with its covered stent inserted by the y - shaped stent - by - stent deployment . in conclusion , the newly designed y - shaped covered stent placement for hilar malignancies provides the following advantages : its ability to drain the bile ducts of both lobes of liver ; and the suppression of the tumor ingrowth effectively , by using silicon covered stents without structural occlusion of contra - lateral bile ducts . however there is a need for further clinical studies to confirm its long term patency and the ease of the restenting technique .

we report a case in an inoperable patient with the hilar malignant biliary obstruction treated palliatively by the use of a newly designed y - shaped covered stent without interfering contra - lateral bile duct . we percutaneously inserted a newly designed y - shaped covered stent into a biliary tree in an inoperable patient with bismuth type ii cholangiocarcinoma . we checked tubograms , enhanced ct studies , and blood bilirubin levels before , one week after , and at every three month after the stenting , by observing closely the signs of clinical infection as well . the follow - up period was about 12 months . the placement of the y - shaped covered stent was successful and resulted in adequate biliary drainage in the immediate post - procedural tubogram and in the follow - up abdominal ct . the serum bilirubin levels did not show elevation after the insertion of the y - shaped covered stent .

INTRODUCTION CASE REPORT DISCUSSION

. they can be used in the treatment of osteoporosis and skeletal complications in patients with osteoporosis , paget 's disease of bone , multiple myeloma , hypercalcemia of malignancy , and bone metastases . despite reports of osteonecrosis of the jaw following the use of nitrogen containing bisphosphonates in the oncology setting an association between alendronate and synovitis was first reported by the uppsala monitoring centre in 2003 based on 8 cases enlisted in their database . we present in this paper a case of possible alendronate induced synovitis for its rarity and its potential to be overlooked by orthopedicians . a 57 year old post menopausal woman came to the endocrinology department for a routine examination . when a dexa scan showed osteoporosis , she was advised to take 70 mg / week of alendronate . she developed pain and swelling of the right wrist joint on day 2 and the symptoms continued through day 7 . she took the next dose on day 8 and she now developed right shoulder pain apart from the right wrist joint pain . on day 11 , she undrwent investigations for polyarthritis [ esr 87 mm , elevated c - reactive protein 50.8 mg / l ] . hla b27 , uric acid and anti - nuclear antibodu were within normal limits and the rheumatoid factor was negative . she was started on diclofenac sodium and received the third dose of alendronate on day 15 following which she developed right knee joint swelling . physical examination revealed pain and limitation of movement in the right shoulder and right knee with prominent effusion in the suprapatellar pouch . plain radiographs ( antero - posterior ( ap ) and lateral view ) of the knee and shoulder revealed soft tissue effusion . magnetic resonance imaging ( mri ) scans of the knee demonstrated a suprapatellar pouch effusion and synovial tissue thickening in the joint [ figure 1 ] . she had a full recovery ( she showed good progression and arthritic complaints were resolved in 3 - 4 days after the discontinuation ) and esr and c - reactive protein levels decreased to normal after discontinuation of alendronate ( 1 week after discontinuation ) . notice the suprapatellar pouch effusion ( yellow arrows ) and synovial thickening ( red arrows ) amino - containing bps such as alendronate ( 4-amino-1-hydroxybutylidene - bisphosphonate ) have proinflammatory properties and can cause an acute phase response . the basis for these pharmacological properties iv administration of bps ( e.g. , pamidronate , ibandronate , zoledronate ) generally produces more adverse effects than oral administration . symptoms such as myalgia , arthralgia , and bone pain with or without flu - like symptoms [ systemic acute phase reactions with fever and general fatigue and with a number of well - delineated biochemical changes in c - reactive protein ( crp ) , lymphocyte count , and serum zinc concentration ] are generally associated with iv administration of bps . these adverse effects , which appear within 24 h after the first dose administration , may persist for a couple of days . like all pharmacologic agents , these adverse effects are dose dependent ( within the therapeutic range ) , most of the time , and they are not seen in future administrations . according to the recently published data from major clinical studies about oral alendronate and risedronate [ in accordance with evidence - based medicine ( ebm)-based guidelines , which state that this drug group is most widely used in osteoporosis treatment ] , musculoskeletal adverse effects are seen less frequently than iv of bps . since once - a - week dosing regimens have shown a reduction in the incidence of upper gastrointestinal adverse effects and improvement in the patients overall convenience , compliance , and adherence to oral bps , most patients with osteoporosis are currently treated with alendronate ( 70 mg / oral ) or risendronate ( 35 mg / oral ) . the patients reported more musculoskeletal adverse effects following weekly , single - dose oral administration of alendronate and risedronate in clinical practice . the present report adds to the existing body of evidence and will help warn orthopedic surgeons of this rare possibility . alendronate should be considered as a possible cause of synovitis or polyarthritis in patients treated with this agent in the absence of any other pathology . our study is limited by lack of dechallenge for ethical reasons and lack of measurement of drug concentrations in the synovial fluid and inherent weaknesses of the naranjo scale . nonetheless , we do feel that this report would orthopedicians to this possibility and prevent unnecessary treatments and invasive procedures .

we present a case of polyarticular synovitis following alendronate treatment for osteoporosis.the patient had no evidence of rheumatoid arthritis , pyrophosphate arthropathy , or seronegative / seropositive arthritis . our main aim in this study is to highlight the potential adverse effects of alendronate and to warn orthopedic surgeons about the possibility of such a side effect that might lead orthopedic surgeons to administer wrong and unnecessary treatments like arthrocentesis . the withdrawal of alendronate is found to be the treatment of choice . alendronate should be considered as a possible cause of synovitis or polyarthritis in patients treated with this agent in the absence of any other pathology . an association between alendronate and synovitis has rarely been described in the literature . we present a patient who developed polyarticular synovitis after treatment with alendronate and responded to its withdrawal .

Introduction Case Discussion Financial support and sponsorship Conflicts of interest

assessing susceptibility to diseases based on an individual 's genotype has long been a central theme of genetics studies . among inherited gene variations in humans , nonsynonymous single nucleotide polymorphisms ( nssnps ) that lead to an amino acid change in the protein product are most relevant to human inherited diseases ( 1 ) . nssnps can be classified into two categories according to their phenotypic effects : those that cause deleterious effects on protein functions and are hence disease - associated and those that are functionally neutral . given the huge number of nssnps already discovered ( 2,3 ) , a major challenge is to predict which of them are potentially disease associated . computational tools have been developed to predict the nssnp 's phenotypic effect , e.g. the sift server ( 4 ) and the polyphen server ( 5 ) . recently , studies have shown that combining information obtained from multiple sequence alignment and three - dimensional protein structure can increase the prediction accuracy ( 6 ) . nssnpanalyzer server integrates multiple sequences alignment and protein structure analysis to identify disease - associated nssnps . nssnpanalyzer takes a protein sequence and the accompanying nssnp as inputs and reports whether the nssnp is likely to be disease - associated or functionally neutral . nssnpanalyzer also provides additional useful information about the nssnp to facilitate the biological interpretation of results , e.g. structural environment class and multiple sequence alignment . briefly , on receiving the input sequence , nssnpanalyzer searches the astral database ( 7 ) for homologous protein structures . nssnpanalyzer calculates three types of information from user 's input : ( i ) the structural environment of the snp , including the solvent accessibility , environmental polarity and secondary structure ( 8) ; ( ii ) the normalized probability of the substitution in the multiple sequence alignment ( 9 ) ; and ( iii ) the similarity and dissimilarity between the original amino acid and mutated amino acid . nssnpanalyzer then uses a machine learning method called random forest ( 10 ) to classify the nssnps . the random forest classifier was trained to optimally combine the heterogeneous sources of predictors using a curated training dataset prepared from the swissprot database ( 11 ) . several recent studies have demonstrated the better performance of random forest over other machine learning approaches ( 1214 ) . for the nssnp phenotypic effect prediction , we also found that random forest gave the best results on this training dataset . in a cross - validation test , the false positive rate is 38% and the false negative rate is 21% ( 15 ) . the nssnpanalyzer web server is implemented on a linux redhat 8.0 platform with the common gateway interface scripts written in php . two inputs are mandatory : protein sequence in fasta format and the nssnp identities to be analyzed . an nssnp is denoted as x#y , where x is the original amino acid in one letter , # is the position of the substitution ( starting from 1 ) , and y is the mutated amino acid in one letter . in addition to the two mandatory inputs , users may also upload an accompanying protein structure file in pdb format if they want their own structure to be used . finally , because the calculation usually takes a while users can use the sample data to learn the input format and perform a demo run . the results of nssnpanalyzer are displayed on a web page and stored on the server for a week . a link to the results page can also be sent to the user via email . the output includes several calculated features of the nssnp : ( i ) predicted phenotypic class ( disease - associated versus neutral ) ; ( ii ) a hyperlink to the homologous structure with a scop identifier ( 7 ) ; ( iii ) the normalized probability of the substitution calculated by the sift program ( 4 ) ; ( iv ) area buried score , a measure of the solvent accessibility ; ( v ) fraction polar score , a measure of environmental polarity related to hydrogen bond formation ; ( vi ) secondary structure ( helix , sheet and coil ) ; and ( vii ) the structural environment class , a discrete environment class definition by combining features ( iv)(vi ) ( 8) . the area buried score and fraction polar score are calculated by the environment program ( 8) , and the secondary structure is calculated by the stride program ( 16 ) . the user can click the view alignment button to see the local sequence alignment spanning the substitution sites and get a direct sight on the mutability of the substitution . the original amino acid is highlighted in blue , and the mutated amino acid is highlighted in red . briefly , on receiving the input sequence , nssnpanalyzer searches the astral database ( 7 ) for homologous protein structures . nssnpanalyzer calculates three types of information from user 's input : ( i ) the structural environment of the snp , including the solvent accessibility , environmental polarity and secondary structure ( 8) ; ( ii ) the normalized probability of the substitution in the multiple sequence alignment ( 9 ) ; and ( iii ) the similarity and dissimilarity between the original amino acid and mutated amino acid . nssnpanalyzer then uses a machine learning method called random forest ( 10 ) to classify the nssnps . the random forest classifier was trained to optimally combine the heterogeneous sources of predictors using a curated training dataset prepared from the swissprot database ( 11 ) . several recent studies have demonstrated the better performance of random forest over other machine learning approaches ( 1214 ) . for the nssnp phenotypic effect prediction , we also found that random forest gave the best results on this training dataset . in a cross - validation test , the false positive rate is 38% and the false negative rate is 21% ( 15 ) . the nssnpanalyzer web server is implemented on a linux redhat 8.0 platform with the common gateway interface scripts written in php . two inputs are mandatory : protein sequence in fasta format and the nssnp identities to be analyzed . an nssnp is denoted as x#y , where x is the original amino acid in one letter , # is the position of the substitution ( starting from 1 ) , and y is the mutated amino acid in one letter . in addition to the two mandatory inputs , users may also upload an accompanying protein structure file in pdb format if they want their own structure to be used . finally , because the calculation usually takes a while users can use the sample data to learn the input format and perform a demo run . the results of nssnpanalyzer are displayed on a web page and stored on the server for a week . a link to the results page the output includes several calculated features of the nssnp : ( i ) predicted phenotypic class ( disease - associated versus neutral ) ; ( ii ) a hyperlink to the homologous structure with a scop identifier ( 7 ) ; ( iii ) the normalized probability of the substitution calculated by the sift program ( 4 ) ; ( iv ) area buried score , a measure of the solvent accessibility ; ( v ) fraction polar score , a measure of environmental polarity related to hydrogen bond formation ; ( vi ) secondary structure ( helix , sheet and coil ) ; and ( vii ) the structural environment class , a discrete environment class definition by combining features ( iv)(vi ) ( 8) . the area buried score and fraction polar score are calculated by the environment program ( 8) , and the secondary structure is calculated by the stride program ( 16 ) . the user can click the view alignment button to see the local sequence alignment spanning the substitution sites and get a direct sight on the mutability of the substitution . the original amino acid is highlighted in blue , and the mutated amino acid is highlighted in red . considering the remarkable cpu cost of calculation , we are planning to provide precalculated results for all human nssnps in the dbsnp ( 17 ) with homologous structures available . we will also test the applicability of extracting structural predictors from predicted structures to eliminate the requirement of having experimentally determined structures available . ( a ) the main output page of nssnpanalyzer . the user can click the icon to see the interpretation of each field . ( b ) an example of local sequence alignment spanning the nssnp ( d7n ) . the original amino acid ( d ) is highlighted in blue , and the mutated amino acid ( n ) is highlighted in red .

nonsynonymous single nucleotide polymorphisms ( nssnps ) are prevalent in genomes and are closely associated with inherited diseases . to facilitate identifying disease - associated nssnps from a large number of neutral nssnps , it is important to develop computational tools to predict the nssnp 's phenotypic effect ( disease - associated versus neutral ) . nssnpanalyzer , a web - based software developed for this purpose , extracts structural and evolutionary information from a query nssnp and uses a machine learning method called random forest to predict the nssnp 's phenotypic effect . nssnpanalyzer server is available at .

INTRODUCTION PROGRAM DESCRIPTION Algorithm and implementation Input Output FUTURE PLANS Figures and Tables

bromodomain modules selectively recognize acetylated lysine ( kac ) containing sequences , a post - translational modification that is highly abundant in histones and other nuclear proteins . interest in these so - called epigenetic reader proteins has risen as it has become clear that the interaction between the proteins and the acetylated histone tails can be inhibited with small molecules . a number of reported selective bromodomain inhibitors are drug - like molecules and have potential as therapeutics in a range of diseases , including cancer and inflammation . much of the work to date has focused on the bet family for which inhibitors have now entered clinical testing . the bet subfamily of bromodomains ( brdt and brd24 ) has proven to be remarkably druggable . interestingly , some molecules in clinical development have been reported to have bet bromodomain binding activity in addition to their previously known activity . the rapid exploration of the biology of bet bromodomains has been facilitated by the availability of potent and selective small molecule chemical tools that have been widely used to study chromatin biology . with that in mind , we embarked on efforts to identify probes for bromodomains outside of the bet subfamily through a public private partnership coordinated by the structural genomics consortium . here we outline the collaborative discovery of gsk2801 , a chemical probe for the bromodomain adjacent to zinc finger domain protein ( baz ) 2a / b . an alternative baz2a / b chemical probe that can be used as an additional independent validation tool has recently been published by our group in collaboration with an academic collaborator . baz1a , baz1b , baz2a , and baz2b constitute a family of evolutionarily conserved and ubiquitously expressed proteins with conserved domain structure including phd and bromodomain histone tail reader motifs . baz2a is a component of the nucleolar remodeling complex ( norc ) , a member of the imitation switch chromatin remodeling complexes ( iswi ) , which play a role in regulating the expression of noncoding rnas and in the formation of repressive heterochromatin in particular at centromeres and telomeres . recently , high expression levels of baza have been reported in prostate cancer , and the protein may serve as a marker for metastatic potential . , single nucleotide polymorphisms ( snps ) in the baz2b gene locus have been associated with sudden cardiac death . high expression levels of baz2b have been associated with poor outcome of pediatric b cell acute lymphoblastic leukemia ( b - all ) . x - ray crystal structures of the baz2a / b bromodomains showed a shallow acetyl - lysine binding pocket , and they were predicted to be among the least druggable members of the protein family . we therefore felt that identification of inhibitors for the baz2a / b bromodomains would be an interesting indicator of the chemical tractability of the broader protein family . a few weak binding acetyl - lysine mimetic fragments have been recently reported in addition to a chemical tool compound , which showed an unusual aromatic -stacking interaction of two aromatic moieties present in the inhibitor that efficiently filled out the binding pocket . in our hands , screening of the baz2a bromodomain against a set of molecules that contained acetyl - lysine mimetics led to identification of a low molecular weight , chemically tractable indolizine , compound 1 , which had been previously reported as an inhibitor of bet bromodomain subfamily proteins . indolizine 1 had a potency of 1.5 m in a baz2a alphascreen assay , which was comparable to its reported activity against the bet bromodomains ( figure 1 ) . ( a ) structure of the initial hit compound 1 . ( b ) sar development strategy targeting two positions ( r1/r2 ) of the indolizine ring . a crystal structure of compound 1 bound to brd2 ( pdb i d : 4a9i ) revealed that the methyl ketone is serving as an acetyl lysine mimetic ( figure 2a ) . compound 1 was modeled into the acetyl lysine binding site of baz2b ( figure 2a ) . the channel that accommodates the indolizine r1 substituent appears wider in baz2b , suggesting that modification in this region will modulate selectivity . to facilitate the optimization of the indolizine hit , we cocrystallized an early representative compound ( 2 ) with baz2b ( figure 2b ) . compound 2 has a 2-pyridyl group at r1 and a morpholine substituent in the r2 position . as is the case for compound 1 bound to brd2 , the methyl ketone of compound 2 functions as an acetyl - lysine mimetic . the carbonyl forms a hydrogen bond with the conserved asparagine n1944 and with a network of water molecules that are typically found at the bottom of the acetyl - lysine binding site . the indolizine ring forms a number of hydrophobic interactions , most notably to i1950 and v1893 . the aromatic ring in position r1 forms an aromatic stacking interaction with w1887 . the r2 morpholino group was oriented toward details describing protein purification , crystallization , and crystallography as well as in vitro screening methods are available in the supporting information . ( a ) cocrystal structure of compound 1 with brd2 and a model of compound 1 in baz2b . these illustrate that brd2 appears to have a narrower channel that accommodates the pendant phenyl ring , suggesting this as an area to explore in order to enhance selectivity . ( b ) chemical structure of compound 2 ( left ) and cocrystal structure of compound 2 with baz2b ( right ) . conserved water molecules are depicted as spheres . to optimize the indolizine hit for activity on baz2a / baz2b and selectivity over the bet bromodomains , we explored substituents at the 7-position of the indolizine and modified the aryl group at the 1-position . compounds were synthesized via two general routes . in route 1 ( scheme 1a ) , an appropriately para - substituted pyridine a was n - alkylated with 1-chloropropan-2-one . the resulting pyridinium salt b was then reacted in a dipolar cycloaddition reaction with an aryl alkyne and potassium carbonate in dmf at elevated temperatures in a microwave to give the desired ring system with the acetyl lysine mimetic methyl ketone present in the 3-position of the indolizine . in route 2 ( scheme 1b ) , the appropriate pyridinium salt b was reacted with methyl acrylate in the presence of triethylamine and manganese dioxide in toluene at 90 c for 1 h to give an indolizine c with a methyl ester in the 1-position , a methyl ketone in the 3-position , and the substituent that came from the starting pyridine in the 7-position . saponification of the methyl ester with aqueous base , followed by bromination gave bromo - substituted indolizines of general structure d. in the final step , a suzuki reaction was utilized to install the desired aryl group , r1 , in the 1-position . we first explored the structure activity relationships ( sars ) on the pendant phenyl group in the r1-position of the indolizine . in an alphascreen assay ( table 1 ) , compounds 36 showed weaker activity at both baz2a and baz2b compared to 1 . replacing the pendant 2-pyridyl group with a meta - methoxy phenyl ( compound 3 ) compound 7 , harboring an ortho - ch2oh , maintained activity at baz2a and gave a good increase in potency at baz2b , moving from 7 to 1 m . compound 12 , which incorporates an ortho - methyl sulfone , improved potency on baz2a to 720 nm , and baz2b stayed in the low micromolar ic50 range . based on the improved potency of the compounds on both baz2a and baz2b with the ortho - ch2oh compound 7 and the ortho - methyl sulfone 12 , we explored substitution on the indolizine ring with these groups in place . in the context of the ortho - ch2oh substituted pendant phenyl ( table 2 ) , a methyl group 13 and a methoxy group 14 improved baz2a activity relative to the unsubstituted parent , compound 7 . both the primary carboxamide substituted indolizine 16 and the phenoxy substituted compound 17 were weaker against baz2a . baz2b activity was improved in methyl substituted indolizine 13 , methyl ether substituted indolizine 14 , morpholine substituted indolizine 15 , and phenyl ether substituted indolizine 17 . with amide substituted compound 16 , however , we saw a potency decrease on baz2a relative to unsubstituted compound 7 . within a series of ortho - methyl sulfone phenyl analogues ( table 3 ) , several indolizine substituents improved activity at both baz2a and baz2b relative to unsubstituted compound 12 the boc - protected aminomethyl substituent 18 gave good potency increases . in the ortho - hydroxymethyl series described in table 2 , ethers off of the indolizine helped baz2b activity but in general were less helpful for baz2a activity . in the ortho - methylsulfone context , however , the methyl ether 21 , propyl ether 19 , and phenyl ethers 20 enhanced both baz2a and baz2b activity . following identification of a handful of compounds with improved potencies , we sought to characterize their activity at other bromodomains . table 4 shows that the two unsubstituted indolizines 7 and 12 were quite weak on brd4 and brd9 . the boc - protected aminomethyl compound 18 , however , has low micromolar brd9 activity and thus is not suitable as a baz2b / a probe . the ethers ( 1921 ) were inactive or very weakly active against brd4(1 ) and brd9 . modeling suggested that the improved selectivity of the bulkier ortho - substituted phenyls for baz2b over bet resulted from reduced planarity of these compounds with respect to ortho - h and 2-pyridyl analogues . the binding site of brd2 is narrower than baz2b and binds compound 1 in essentially a planar conformation ( figure 2a ) . docking of compounds 17 and 20 into the brd2 site gave strained , high - energy poses consistent with their lower in vitro potency . in contrast , the more open site of baz2b was able to accommodate docked o - substituted phenyl indolizines with ease . the structure confirmed that the introduction of the 2-hydroxyl - methyl group at the phenyl ring produced a 90 rotation of the phenyl ring incompatible with potent bet binding . in baz2b , the rotated phenyl ring makes an end - on -stacking interaction with w1887 and orients the 2-hydoxyl - methyl group to produce a hydrogen - bond with the za - loop backbone ( n1894 amine ) . the methyl - sulfonyl substitution at position-2 of the phenyl ring produces an even more dramatic rotation to accommodate the more bulky sulfonyl group . in addition , the sulfonyl oxygen groups also make a pair of hydrogen bonds to the backbone nh of n1894 . ( c ) superimposition of cocrystal structures with compounds 2 , 17 , and 20 . based on the potency and excellent selectivity over the bet bromodomains , we chose to look at compound 19 , gsk2801 , in more detail . the interaction between the small molecule gsk2801 and the bromodomain was examined using biolayer interferometry ( octet - red bli ) and isothermal titration calorimetry ( itc ) ( figure 4a , b ) . steady state fits of the measured dose response bli data resulted in a dissociation constant of 60 nm ( kd ) . the inhibitor showed fast on- and off - rate binding ( kon , 1.57 0.02 10 1/(m s ) ; koff , 6.95 0.058 10 1/s ) . itc confirmed this value determining a kd of 136 and 257 nm for baz2b and baz2a and a stoichiometry of 1.0 0.1 , respectively . the cocrystal structure with gsk2801 showed that the observed binding mode of the probe is conserved when compared with the related compound 20 ( figure 4c ) . ( a ) dose response biolayer interference ( bli ) data measuring the binding kinetics of gsk2801 to baz2b . ( b ) isothermal titration calorimetry ( itc ) binding experiments for the interaction of gsk2801 with baz2a ( blue in top panel and circles in lower panel ) and baz2b ( black in top panel and squares in lower panel ) , respectively . the lower panel shows normalized binding heats and the fitted function to a single binding site model . next we assessed the wider selectivity of gsk2801 against other bromodomains in thermal stability assays . baz2a / b bromodomains are exceptionally stable interaction domains , a property that resulted in small temperature shifts in thermal stability assays even in the presence of tightly binding ligands . at an inhibitor concentration of 10 m , gsk2801 resulted in a temperature shift of 4.1 and 2.7 c for baz2a and baz2b , respectively . significant tm shifts were also observed for the second bromodomain in taf1l(2 ) ( 3.4 c ) and brd9 ( 2.3 c ) ( figure 5a ) . because of the limited sensitivity of baz2a / b in the thermal stability assay we evaluated the selectivity of gsk2801 using an alternative assay format . forty - two bromodomains modified with a bir a biotin ligase targeting sequence were coexpressed in bacteria with the enzyme . the successful labeling with biotin was verified using mass spectrometry ( data not shown ) . we used the biotinylated proteins in bli experiments probing the interaction of gsk2801 at two concentrations ( 0.2 and 1.0 m ) ( figure 5b ) . in agreement with the tm data , brd9 and taf1(l ) were detected as the major off - targets , while no other significant interactions were detected within the bromodomain family . these experiments showed that gsk2801 bound taf1l(2 ) with an affinity kb of 0.31 ( 0.02 ) 10 m ( kd : 3.2 m ) and a binding enthalpy change h of 8.6 ( 0.02 ) kcal / mol . itc experiments using the bromodomain of brd9 resulted in the determination of an affinity kb of 0.826 ( 0.02 ) 10 m ( kd : 1.1 m ) and h of 9.8 ( 0.01 ) kcal / mol . taf1l is a retrotransposed gene only present in the primate lineage that has a very restricted expression to the testis compartment . however , taf1l has been reported to be mutated and expressed in a subset of melanoma cases . brd9 is expressed in most tissues and is an off - target of gsk2801 . ( a ) temperature shift data ( tm ) cross screening against a panel of 46 human bromodomains . screened targets are shown in bold . ( b ) selectivity screening using biolayer interferometry and a panel of 40 biotin - labeled proteins . screening was carried out at two inhibitor concentrations ( 1.0 and 0.2 m ) as indicated in the figure . because of the off - target activity with brd9 , we developed a structurally highly related control compound that lacked activity on baz2a / b . based on the low activity on baz2a and baz2b with a meta - methoxy substituted pendant phenyl ( compound 3 ) , we designed a compound that utilized this moiety in conjunction with the propyl ether in the indolizine 7-position . using the established bli cross - screening assay format , this compound ( compound 23 , gsk8573 ) proved to be inactive against baz2a / b and all other bromodomains except brd9 ( figure 6 ) . using itc we determined an affinity for interaction of gsk8573 with brd9 of 1.04 m ( kd ) associated with a favorable binding enthalpy change h of 8.98 ( 0.152 ) kcal / mol . thus , gsk8573 shared similar affinity for the off - target brd9 while losing all activity against the rest of the bromodomain family . these results suggest that gsk8573 can be used as a structurally related negative control compound in biological experiments . structure of the inactive control compound gsk8573 and family wide screening of biotin labeled bromodomains using bli . the scale of the y - axis is identical to the one used in figure 5b . to test whether gsk2801 would also bind to endogenous baz2 proteins the boc - protecting group of compound 18 was removed to provide an amine functionalized analogue of gsk2801 that was immobilized on sepharose beads . the resulting affinity matrix was incubated with nuclear and chromatin enriched hut78 extracts containing increasing concentrations of gsk2801 or the structurally related gsk8573 . bound proteins were eluted and quantified using an isobaric mass tagging strategy and targeted mass spectrometry . among the 18 endogenous full - length bromodomain proteins that bound to the matrix , only baz2a and baz2b displayed a dose - dependent reduction binding by gsk2801 suggesting a low micromolar potency ( pkd = 5.5 ) ( figure 7a , b ) . conversely , gsk8573 did not show any binding to baz2 proteins up to a concentration of 50 m , but limited affinity to brd9 ( pkd = 4.5 ) and to smarca2 and 4 ( pkd = 4.8 ) , which is likely to be indirect due to the association of smarca2 and 4 to brd9 in the baf complex ( figure7a ) . ( a ) pkds of gsk2801 and gsk8573 ( negative control ) for baz2a , baz2b , and 16 additional brd proteins captured on the gsk2801 affinity matrix from hut-78 cell lysate . ( b ) dose response curves of gsk2801 for baz2a ( top ) and baz2b ( bottom ) in the same assay . in order to determine if gsk2801 could displace the baz2a / b from chromatin in cells we utilized frap experiments . treatment of u2os cells with the hdac inhibitor saha induced hyperacetylated chromatin and a better activity window in the frap assay . saha - treated u2os cells were transfected with a gfp - baz2a fusion construct . in parallel , u2os cells were transfected with a gfp fusion with a baz2a mutant construct ( n1873f ) in which the conserved asparagine essential for recognizing the acetylated lysine had been mutated ( figure 8) . gsk2801 accelerated frap half - recovery time to the same extent as observed for the mutant construct indicating that the compound was able to displace baz2a from chromatin . conversely , the inactive gsk-8573 did not have any effect on the half - recovery time of gfp - baz2a . shown is the time dependence of the fluorescent recovery of wt baz2a and the bromodomain inactivating mutant n1873f in the presence and absence of gsk2801 and the baz2a / baz2b inactive control compound gsk8573 . ( b ) half times of fluorescence recovery ( t1/2 ) for baz2a are shown as bars representing the mean t1/2 calculated from individual recovery curves of at least 10 cells per group , and error bars depict the standard error of the mean ( sem ) . ( c ) raw data fluorescent recovery curves corresponding to the fluorescence recovery shown in panel a. ( d ) frap measured on the control compound gsk8573 . * p < 0.05 compared to wt treated with 2.5 m saha . in order to determine the suitability of gsk2801 for in vivo experiments we measured pharmacokinetic parameters after intraperitoneal and oral dosing to male cd1 mice . this pharmacokinetics study showed that gsk2801 has reasonable in vivo exposure after oral dosing , modest clearance , and reasonable plasma stability ( figure 9 ) . these properties should allow gsk2801 to be used as a baz2a / b bromodomain inhibitor in vivo . the figure shows the mean plasma concentration of gsk2801 in mice ( n = 3 ) after oral ( po ) ( circles ) and intraperitoneal ( ip ) ( squares ) dosing ( 30 mg / kg ) . in this article , we started from an unselective micromolar baz / bet inhibitor and optimized it through iterative medicinal chemistry to a potent inhibitor of baz2a / b with > 50-fold selectivity over brd4 . x - ray crystallography has provided a convincing rationalization of the steric features resulting in the bet selectivity . the resulting molecule , gsk2801 , is a potent and selective ligand for the baz2a and baz2b bromodomains , suitable for use as a small molecule chemical probe . gsk2801 has excellent selectivity for baz2a and baz2b , with only low micromolar residual activity at brd9 and taf1l . the compound displaces full length gfp - baz2a from chromatin at concentrations below 1 m . we have also identified a closely related inactive control compound to help inform cellular screening results . in order to accelerate discoveries on the roles of baz2b and baz2a in physiology and pathophysiology all solvents and commercial chemicals were reagent grade and used without purification . the purity of final compounds was determined by hplc / ms and h nmr and determined to be > 95% . h nmr spectra were recorded on bruker biospin spectrometer operating at 400 mhz in cdcl3 , methanol - d4 , or dmso - d6 . the chemical shifts ( ) reported are given in parts per million ( ppm ) , and the coupling constants ( j ) are in hertz ( hz ) . the spin multiplicities are reported as s = singlet , br s = broad singlet , d = doublet , t = triplet , q = quartet , m = multiplet , and br = broad . the lc / ms analysis was performed on a waters sqd with a phenomenex kinetex 1.7 m xb - c18 column at 40 c , using water + 0.2% v / v formic acid and acetonitrile + 0.15% v / v formic acid as mobile phase , and performed on waters acquity beh c18 2 50 mm 1.7 m column at 50 c , using water + 0.20% v / v formic acid , water + 0.20% v / v formic acid , and acetonitrile + 0.15% v / v formic acid . microwave irradiated reactions were carried out in sealed glass vessels in a biotage initiator . flash chromatography purifications were carried out on a biotage sp1 instrument . a mixture of 4-methoxypyridine ( 5 g , 45.8 mmol ) and 1-chloropropan-2-one ( 18.43 ml , 229 mmol ) in ethyl acetate ( 50 ml ) was stirred at 80 c for 2 h. the mixture was concentrated to dryness to give 4-methoxy-1-(2-oxopropyl)pyridin-1-ium chloride ( 9 g , 44.6 mmol , 97% yield ) as a yellow solid . to a suspension of 4-methoxy-1-(2-oxopropyl)pyridin-1-ium chloride ( 5.14 g , 25.5 mmol ) in toluene ( 60 ml ) was added methyl acrylate ( 22.93 ml , 255 mmol ) , tea ( 5.33 ml , 38.2 mmol ) , and then manganese dioxide ( 17.73 g , 204 mmol ) . the mixture was stirred at 90 c for 1 h. the solid was filtered off over celite and washed with acetone . the combined filtrate was concentrated and purified by silica gel chromatography eluting with etoac in hexanes ( 5 to 50% ) to give methyl 3-acetyl-7-methoxyindolizine-1-carboxylate ( 4.4 g , 17.80 mmol , 69.8% yield ) as a yellow solid . to a solution of methyl 3-acetyl-7-methoxyindolizine-1-carboxylate ( 4.4 g , 17.80 mmol ) in methanol ( 60 ml ) was added naoh ( 44.5 ml , 178 mmol ) . the solution was concentrated and acidified with 6 n hcl to ph = 1 . the solid product was filtered , washed with water , and dried to give 3-acetyl-7-methoxyindolizine-1-carboxylic acid ( 2.4 g , 10.29 mmol , 57.8% yield ) as a yellow solid . the product was used in the next step without further purification . to a slurry of 3-acetyl-7-methoxyindolizine-1-carboxylic acid ( 2.4 g , 10.29 mmol ) in n , n - dimethylformamide ( dmf ) ( 100 ml ) was added sodium bicarbonate ( 2.59 g , 30.9 mmol ) and then nbs ( 1.923 g , 10.81 mmol ) portionwise at 0 c . the mixture was stirred at ambient temperature for 1.5 h. the solution was treated with water and extracted with etoac . the combined organics were washed with water , brine , dried over na2so4 , and filtered . the filtrate was concentrated to dryness to give 1-(1-bromo-7-methoxyindolizin-3-yl)ethanone ( 2.5 g , 9.32 mmol , 91% yield ) . nitrogen gas was bubbled through a mixture of 1-(1-bromo-7-methoxyindolizin-3-yl)ethanone ( 515 mg , 1.921 mmol ) , pdcl2(dppf)ch2cl2 adduct ( 110 mg , 0.134 mmol ) , k2co3 ( 796 mg , 5.76 mmol ) , and ( 2-(methylsulfonyl)phenyl)boronic acid ( 768 mg , 3.84 mmol ) in dmf ( 4 ml ) and water ( 0.5 ml ) for 10 min . then the mixture was heated in a sealed tube in the microwave ( 120 c , 25 min ) . the solution was extracted with etoac , and the combined organics were washed with water , brine , dried over na2so4 , and filtered . the filtrate was concentrated , then purified using silica gel chromatography , eluting with etoac in hexanes ( 20 to 60% ) to give 1-(7-methoxy-1-(2-(methylsulfonyl)phenyl)indolizin-3-yl)ethanone ( 368 mg , 1.072 mmol , 55.8% yield ) as a light yellow solid . to a solution of 1-(7-methoxy-1-(2-(methylsulfonyl)phenyl)indolizin-3-yl)ethanone ( 368 mg , 1.072 mmol ) in dmf ( 5 ml ) the mixture was stirred at 155 c for 12 h. the mixture was treated with sodium thiosulfate ( na2s2o3 ) and extracted with etoac . the combined organics were washed with water , brine , dried over na2so4 , and filtered . the filtrate was concentrated to dryness to give 1-(7-hydroxy-1-(2-(methylsulfonyl)phenyl)indolizin-3-yl)ethanone ( 325 mg , 0.987 mmol , 92% yield ) . a mixture of 1-(7-hydroxy-1-(3-(methylsulfonyl)phenyl)indolizin-3-yl)ethanone ( 38 mg , 0.115 mmol ) , k2co3 ( 19.13 mg , 0.138 mmol ) , and 1-bromopropane ( 0.210 ml , 2.307 mmol ) in acetone ( 1.5 ml ) was stirred at 75 c for 2 h. the product was purified by reverse phase hplc ( 35 to 100% acetonitrile in water for 6 min and 100% acetonitrile for 1 min , with 0.05% tfa as additive ) to give 1-(1-(3-(methylsulfonyl)phenyl)-7-propoxyindolizin-3-yl)ethanone ( 30 mg , 0.081 mmol , 70.0% yield ) as a colorless solid . h nmr ( 400 mhz , chloroform - d ) ppm 1.04 ( t , j = 7.28 hz , 3 h ) , 1.701.92 ( m , 2 h ) , 2.57 ( s , 3 h ) , 2.68 ( s , 3 h ) , 3.89 ( t , j = 6.27 hz , 2 h ) , 6.60 ( s , 1 h ) , 6.68 ( d , j = 7.53 hz , 1 h ) , 7.51 ( d , j = 7.28 hz , 1 h ) , 7.567.64 ( m , 1 h ) , 7.677.74 ( m , 1 h ) , 7.81 ( s , 1 h ) , 8.34 ( d , j = 7.78 hz , 1 h ) , 9.81 ( d , j = 7.53 hz , 1 h ) . lcms : rt = 0.90 min , ms m / z = 372 ( m + h ) . 4-chloropyridine hydrochloride ( 10 g , 66.7 mmol ) in dimethyl sulfoxide ( dmso ) ( 10 ml ) was treated with naoh ( 2.93 g , 73.3 mmol ) . was added propan-1-ol ( 35.1 ml , 467 mmol ) and then naoh ( 2.93 g , 73.3 mmol ) . the mixture was allowed to cool to room temperature , treated with water , and extracted with etoac . the filtrate was concentrated and dried to give 4-propoxypyridine ( 8.3 g , 60.5 mmol , 91% yield ) as a yellow oil . to a solution of 4-propoxypyridine ( 8.2 g , 59.8 mmol ) in ethyl acetate ( 20 ml ) was added 1-chloropropan-2-one ( 14.28 ml , 179 mmol ) . the precipitated solid was filtered , washed with diethyl ether , and dried to give the indicated product quantitatively as a colorless solid . to a suspension of 1-(2-oxopropyl)-4-propoxypyridin-1-ium chloride ( 6.03 g , 26.4 mmol ) and manganese dioxide ( 9.17 g , 105 mmol ) in dmf ( 30 ml ) was added methyl acrylate ( 14.23 ml , 158 mmol ) and tea ( 4.41 ml , 31.6 mmol ) . the mixture was stirred at 90 c for 3 h. the mixture was allowed to cool to room temperature , filtered through celite , washed with etoac , and filtered . the combined filtrate was washed with water and brine , dried over na2so4 , and filtered . the filtrate was concentrated , then purified by silica gel chromatography ( 0 to 60% etoac in heptane ) to give methyl 3-acetyl-7-propoxyindolizine-1-carboxylate ( 5 g , 18.16 mmol , 68.9% yield ) as a yellow solid . lcms suggested that the product was 75% pure , and it was taken to the next step without further purification . to a solution of methyl 3-acetyl-7-propoxyindolizine-1-carboxylate ( 3 g , 10.90 mmol ) in methanol ( 15 ml ) , tetrahydrofuran ( thf ) ( 15.00 ml ) , and water ( 15.00 ml ) was added 4 n naoh ( 8.17 ml , 32.7 mmol ) . the solution was concentrated and then acidified with 1 n hcl to ph = 1 . the precipitated solid was filtered , washed with water , and dried to give 3-acetyl-7-propoxyindolizine-1-carboxylic acid ( 2.35 g , 8.99 mmol , 83% yield ) as a yellow solid . to a solution of 3-acetyl-7-propoxyindolizine-1-carboxylic acid ( 0.95 g , 3.64 mmol ) in dmf ( 15 ml ) was added sodium bicarbonate ( 0.916 g , 10.91 mmol ) and then nbs ( 0.712 g , 4.00 mmol ) portion - wise at 0 c . the cooling bath was removed , and the mixture was allowed to stir at ambient temperature for 1 h. the solution was treated with water and extracted with etoac . the combined organics were washed with water , then brine , and dried over na2so4 and filtered . the filtrate was concentrated to dryness to give 1-(1-bromo-7-propoxyindolizin-3-yl)ethanone ( 1.05 g , 3.55 mmol , 98% yield ) as an off - white solid . nitrogen gas was bubbled through a mixture of 1-(1-bromo-7-propoxyindolizin-3-yl)ethanone ( 534 mg , 1.803 mmol ) , ( 2-(methylsulfonyl)phenyl)boronic acid ( 721 mg , 3.61 mmol ) , k2co3 ( 748 mg , 5.41 mmol ) , and pdcl2(dppf)ch2cl2 adduct ( 118 mg , 0.144 mmol ) in dmf ( 7 ml ) and water ( 0.5 ml ) for 10 min . then the mixture was irradiated in a sealed tube in the microwave ( 120 c , 15 min ) . the filtrate was washed with water and brine , dried over na2so4 , and filtered . the filtrate was concentrated , then purified with silica gel chromatography ( 0 to 50% etoac in heptane ) to give 1-(1-(2-(methylsulfonyl)phenyl)-7-propoxyindolizin-3-yl)ethanone ( 535 mg , 1.442 mmol , 80% yield ) as an off - white solid , which was identical to the gsk2801 prepared by scheme 1 ( above ) . compound 23 ( gsk8573 ) was synthesized from intermediate k , which was made as described in the synthesis of probe compound 19 ( gsk2801 ) . nitrogen gas was bubbled through a mixture of 1-(1-bromo-7-propoxyindolizin-3-yl)ethanone ( 544 mg , 1.837 mmol ) , ( 3-methoxyphenyl)boronic acid ( 419 mg , 2.76 mmol ) , k2co3 ( 762 mg , 5.51 mmol ) , and pdcl2(dppf)ch2cl2 adduct ( 120 mg , 0.147 mmol ) in 1,4-dioxane ( 8 ml ) and water ( 0.08 ml ) and heated in a sealed tube in the microwave ( 100 c , 6 min ) . the combined filtrate was concentrated and then purified with silica gel chromatography , eluting with 0 to 35% etoac in heptane to give 1-(1-(3-methoxyphenyl)-7-propoxyindolizin-3-yl)ethanone ( 364 mg , 1.126 mmol , 61.3% yield ) as a yellow solid . h nmr ( 400 mhz , dmso - d6 ) ppm 1.00 ( t , j = 7.40 hz , 3 h ) , 1.77 ( q , j = 6.69 hz , 2 h ) , 2.50 ( s , 3h ) , 3.83 ( s , 3 h ) , 4.07 ( t , j = 6.40 hz , 2 h ) , 6.84 ( ddd , j = 18.95 , 7.78 , 2.38 hz , 2 h ) , 7.17 ( t , j = 2.64 hz , 2 h ) , 7.23 ( d , j = 7.78 hz , 1 h ) , 7.337.43 ( m , 1 h ) , 7.94 ( s , 1 h ) , 9.69 ( d , j = 7.78 hz , 1 h ) . lcms rt = 0.97 . h nmr ( 400 mhz , methanol - d4 ) , ppm 1.001.17 ( m , 3 h ) , 1.781.94 ( m , 2 h ) , 2.56 ( s , 3 h ) , 3.88 ( s , 3 h ) , 4.05 ( s , 2 h ) , 6.686.80 ( m , 1 h ) , 6.856.95 ( m , 1 h ) , 7.087.23 ( m , 3 h ) , 7.337.46 ( m , 1 h ) , 7.77 ( s , 1 h ) , 9.689.81 ( m , 1 h ) ; lcms : rt = 1.06 min , ms m / z = 324 ( m + h ) . 4-morpholino-1-(2-oxopropyl)pyridin-1-ium chloride : a mixture of 4-(pyridin-4-yl)morpholine ( 2.037 ml , 12.18 mmol ) and 1-chloropropan-2-one ( 4.90 ml , 60.9 mmol ) was heated at 85 c for 2 h. the precipitated solid was filtered and washed with ethyl acetate and then diethyl ether to give 4-morpholino-1-(2-oxopropyl)pyridin-1-ium chloride ( 3.1 g , 99% ) . h nmr ( 400 mhz , dmso - d6 ) ppm 2.26 ( s , 3 h ) , 3.74 ( dd , j = 14.49 , 4.50 hz , 8 h ) , 5.35 ( s , 2 h ) , 7.32 ( d , j = 7.44 hz , 2 h ) , 8.17 ( d , j = 7.44 hz , 2 h ) . compound 15 : 1-(1-(2-(hydroxymethyl)phenyl)-7-morpholinoindolizin-3-yl)ethanonea slurry of 4-morpholino-1-(2-oxopropyl)pyridin-1-ium chloride ( 291 mg , 1.135 mmol ) , ( 2-ethynylphenyl)methanol ( 50 mg , 0.378 mmol ) , and k2co3 ( 261 mg , 1.892 mmol ) in dmf was irradiated in microwave at 120 c for 30 min . the product was purified with reverse phase hplc ( 10100% acetonitrile in water for 6 min and 100% acetonitrile for 1 min , with 0.05% tfa as additive ) to give 1-(1-(2-(hydroxymethyl)phenyl)-7-morpholinoindolizin-3-yl)ethanone ( 18 mg , 13.56% ) . h nmr ( 400 mhz , dmso - d6 ) ppm 2.43 ( s , 3 h ) , 3.20 ( br . s. , 4 h ) , 4.44 ( s , 2 h ) , 6.55 ( s , 1 h ) , 7.04 ( s , 1 h ) , 7.287.43 ( m , 3 h ) , 7.61 ( br . s. , 1 h ) , 7.69 ( s , 1 h ) , 9.63 ( d , j = 7.78 hz , 1 h ) . lcms : rt = 0.71 min , ms m / z = 351 ( m + h ) . compound 2 was prepared in a manner similar to that described for compound 15 . h nmr ( 400 mhz , dmso - d6 ) ppm 2.50 ( s , 3 h ) , 3.39 ( t , j = 4.50 hz , 4 h ) , 3.82 ( t , j = 4.60 hz , 4 h ) , 7.057.18 ( m , 1 h ) , 7.237.34 ( m , 1 h ) , 8.00 ( d , j = 15.27 hz , 3 h ) , 8.32 ( s , 1 h ) , 8.64 ( d , j = 4.50 hz , 1 h ) , 9.66 ( d , j = 7.83 hz , 1 h ) . lcms : rt = 0.62 min , ms m / z = 322 ( m + h ) . a mixture of pyridine ( 10 ml , 124 mmol ) and 1-chloropropan-2-one ( 4.3 ml , 53.4 mmol ) was heated at 85 c for 1 h. the solid was filtered and washed with diethyl ether to give 1-(2-oxopropyl)pyridin-1-ium chloride ( 9 g , 52.4 mmol , 98% yield ) . h nmr ( 400 mhz , dmso - d6 ) ppm 2.35 ( s , 3 h ) , 5.93 ( s , 2 h ) , 8.25 ( t , j = 6.95 hz , 2 h ) , 8.71 ( t , j = 7.73 hz , 1 h ) , 8.99 ( d , j = 5.87 hz , 2 h ) . a suspension of 1-(2-oxopropyl)pyridin-1-ium chloride ( 5 g , 29.1 mmol ) , methyl acrylate ( 21.81 ml , 291 mmol ) , manganese dioxide ( 20.26 g , 233 mmol ) , and tea ( 6.09 ml , 43.7 mmol ) in toluene ( 50 ml ) was refluxed for 2 h. the suspension was filtered over celite and washed with acetone , and the filtrate was concentrated to dryness to give methyl 3-acetylindolizine-1-carboxylate ( 5.6 g , 25.8 mmol , 88% yield ) . lcms : rt = 0.71 min , ms m / z = 218 ( m + h ) . a solution of methyl 3-acetylindolizine-1-carboxylate ( 7 g , 32.2 mmol ) and naoh ( 4 m , 81 ml , 322 mmol ) in methanol ( 100 ml ) was stirred at 90 c for 3 h and then at rt overnight . the aqueous phase was acidified with 6 n hcl , and the precipitate was filtered , washed with water , and dried to give 3-acetylindolizine-1-carboxylic acid ( 4.3 g , 21.16 mmol , 65.7% yield ) . h nmr ( 400 mhz , chloroform - d ) ppm 2.59 ( s , 3 h ) , 6.97 ( t , j = 6.85 hz , 1 h ) , 7.227.31 ( m , 2 h ) , 7.507.70 ( m , 2 h ) , 9.90 ( d , j = 7.24 hz , 1 h ) . lcms : rt = 0.55 min , ms m / z = 204 ( m + h ) . to a solution of 3-acetylindolizine-1-carboxylic acid ( 2 g , 9.84 mmol ) in dmf ( 15 ml ) was added sodium bicarbonate ( 2.481 g , 29.5 mmol ) and then nbs ( 1.839 g , 10.33 mmol ) portion - wise . the mixture was distributed between water and etoac , and the aqueous layer further extracted with etoac . the combined organics were washed with water and brine , dried over na2so4 , and filtered . the product was purified on the biotage eluting with etoac in hexanes ( 030% ) to give 1-(1-bromoindolizin-3-yl)ethanone ( 2.1 g , 8.82 mmol , 90% yield ) as a green solid . h nmr ( 400 mhz , dmso - d6 ) ppm 2.472.54 ( m , 3 h ) , 7.12 ( td , j = 6.90 , 1.25 hz , 1 h ) , 7.39 ( ddd , j = 8.78 , 6.78 , 1.00 hz , 1 h ) , 7.557.70 ( m , 1 h ) , 7.97 ( s , 1 h ) , 9.74 ( d , j = 7.03 hz , 1 h ) . lcms : rt = 0.83 min , ms m / z = 238 ( m + h ) . compound 3 : ( 1-(1-(3-methoxyphenyl)indolizin-3-yl)ethanone ) . a mixture of 1-(1-bromoindolizin-3-yl)ethanone ( 65 mg , 0.273 mmol ) , ( 3-methoxyphenyl)boronic acid ( 49.8 mg , 0.328 mmol ) , k2co3 ( 113 mg , 0.819 mmol ) , and pdcl2(dppf)ch2cl2 adduct ( 15.61 mg , 0.019 mmol ) in dmf ( 3 ml ) and 4 drops of water were irradiated in the microwave at 120 c for 10 min . the product was purified with reverse phase hplc ( 50100% acetonitrile in water for 6 min and 100% acetonitrile for 1 min , with 0.05% tfa as additive ) to give 1-(1-(3-methoxyphenyl)indolizin-3-yl)ethanone ( 32 mg , 0.121 mmol , 44% yield ) . h nmr ( 400 mhz , methanol - d4 ) ppm 2.61 ( s , 3 h ) , 3.88 ( s , 3 h ) , 6.91 ( dd , j = 7.91 , 2.13 hz , 1 h ) , 7.02 ( td , j = 6.90 , 1.00 hz , 1 h ) , 7.137.17 ( m , 1 h ) , 7.20 ( d , j = 7.78 hz , 1 h ) , 7.31 ( ddd , j = 8.91 , 6.78 , 0.88 hz , 1 h ) , 7.357.43 ( m , 1 h ) , 7.83 ( s , 1 h ) , 7.91 ( d , j = 8.78 hz , 1 h ) , 9.86 ( d , j = 7.28 hz , 1 h ) . lcms : rt = 1.18 min , ms m / z = 266 ( m + h ) . compound 4 , 1-(1-(thiophen-2-yl)indolizin-3-yl)ethanone , was prepared in a manner similar to that described for compound 3 , using intermediate o. the suzuki reaction was performed using thiophen-2-yl - boronic acid , pdcl2(dppf)ch2cl2 adduct as catalyst and heating in the microwave at 120 c for 10 min ( yield = 34% ) . h nmr ( 400 mhz , methanol - d4 ) ppm 2.58 ( s , 3 h ) , 7.01 ( t , j = 6.85 hz , 1 h ) , 7.13 ( dd , j = 4.89 , 3.72 hz , 1 h ) , 7.267.41 ( m , 3 h ) , 7.83 ( s , 1 h ) , 7.99 ( d , j = 8.81 hz , 1 h ) , 9.82 ( d , j = 7.05 hz , 1 h ) . lcms : rt = 0.87 min , ms m / z = 242 ( m + h ) . compound 5 , 1-(1-(2-hydroxyphenyl)indolizin-3-yl)ethanone , was prepared in a manner similar to that described for compound 3 using intermediate o. the suzuki reaction was performed using ( 2-hydroxyphenyl)boronic acid , pdcl2(dppf)ch2cl2 adduct as catalyst , and heating in the microwave at 120 c for 10 min ( yield = 43% ) . h nmr ( 400 mhz , dmso - d6 ) ppm 2.56 ( s , 3 h ) , 6.93 ( t , j = 7.34 hz , 1 h ) , 7.01 ( d , j = 7.83 hz , 1 h ) , 7.08 ( t , j = 6.56 hz , 1 h ) , 7.187.24 ( m , 1 h ) , 7.257.32 ( m , 1 h ) , 7.38 ( d , j = 6.46 hz , 1 h ) , 7.64 ( d , j = 8.81 hz , 1 h ) , 7.85 ( s , 1 h ) , 9.54 ( s , 1 h ) , 9.81 ( d , j = 7.05 hz , 1 h ) . lcms : rt = 0.85 min , ms m / z = 252 ( m + h ) . compound 6 , 1-(1-(3-hydroxyphenyl)indolizin-3-yl)ethanone , was prepared in a manner similar to that described for compound 3 using intermediate o. the suzuki reaction was performed using ( 3-hydroxyphenyl)boronic acid , pdcl2(dppf)ch2cl2 adduct as catalyst , and heating in the microwave at 120 c for 20 min ( yield = 37% ) . h nmr ( 400 mhz , cdcl3 ) 9.96 ( d , 1h , j = 6.7 hz ) , 7.91 ( d , 1h , j = 8.6 hz ) , 7.66 ( s , 1h ) , 7.387.13 ( m , 3h ) , 6.986.85 ( m , 2h ) , 5.25 ( s , 1h ) , 2.66 ( s , 3h ) . lrms ( esi - tof ) [ m + h]m / z calcd for c16h13no2h , 252.1 ; found , 252.1 . compound 7 , 1-(1-(2-(hydroxymethyl)phenyl)indolizin-3-yl)ethanone , was prepared using the alkyne route in a manner similar to that described for compound 15 . h nmr ( 500 mhz , cdcl3 ) 9.96 ( d,1h , j = 7 hz ) , 7.687.66 ( m , 2h ) , 7.507.45 ( m , 4h ) , 7.31 ( s , 1h ) , 7.19 ( t , 1h , j = 7.6 hz ) , 6.97 ( t , 1h , j = 7.6 hz ) , 4.69 ( s , 2h ) , 2.64 ( s , 3h ) . lrms ( esi - tof ) [ m + h]m / z calcd for c17h15no2h , 266.1 ; found , 266.1 . compound 8 , 3-(3-acetylindolizin-1-yl)benzamide , was prepared in a manner similar to that described for compound 3 using intermediate o. the suzuki reaction was performed using ( 3-carbamoylphenyl)boronic acid , pdcl2(dppf)ch2cl2 adduct as catalyst , and heating in the microwave at 120 c for 10 min ( yield = 56% ) . h nmr ( 400 mhz , dmso - d6 ) ppm 2.62 ( s , 3 h ) , 7.15 ( t , j = 6.75 hz , 1 h ) , 7.367.44 ( m , 1 h ) , 7.49 ( br . s. , 1 h ) , 7.567.63 ( m , 1 h ) , 7.85 ( t , j = 8.81 hz , 2 h ) , 8.05 ( d , j = 9.00 hz , 1 h ) , 8.13 ( br . s , 2 h ) , 8.17 ( s , 1 h ) , 9.85 ( d , j = 7.24 hz , 1 h ) . lcms : rt = 0.68 min , ms m / z = 279 ( m + h ) . compound 9 , 1-(1-(2-(hydroxymethyl)-4-methoxyphenyl)indolizin-3-yl)ethanone , was prepared in a manner similar to that described for compound 3 using intermediate o. the suzuki reaction was performed using ( 2-(hydroxymethyl)-4-methoxyphenyl)boronic acid , pdcl2(dppf)ch2cl2 adduct as catalyst , and heating in the microwave at 120 c for 10 min ( yield = 11% ) . h nmr ( 400 mhz , chloroform - d ) ppm 2.562.67 ( m , 3 h ) , 3.94 ( s , 3 h ) , 4.65 ( s , 2 h ) , 6.927.01 ( m , 2 h ) , 7.147.21 ( m , 1 h ) , 7.23 ( d , j = 2.15 hz , 1 h ) , 7.34 ( d , j = 8.42 hz , 1 h ) , 7.44 ( d , j = 9.00 hz , 1 h ) , 7.59 ( s , 1 h ) , 9.95 ( d , j = 7.05 hz , 1 h ) . lcms : rt = 0.79 min , ms m / z = 296 ( m + h ) . compound 10 , 1-(1-(4-(hydroxymethyl)phenyl)indolizin-3-yl)ethanone , was prepared in a manner similar to that described for compound 3 using intermediate o. the suzuki reaction was performed using ( 4-(hydroxymethyl)phenyl)boronic acid , pdcl2(dppf)ch2cl2 adduct as catalyst , and heating in the microwave at 120 c for 10 min ( yield = 11% ) . h nmr ( 400 mhz , dmso - d6 ) ppm 2.60 ( s , 3 h ) , 4.58 ( d , j = 4.11 hz , 2 h ) , 5.24 ( br . s. , 1 h ) , 7.12 ( t , j = 6.66 hz , 1 h ) , 7.327.41 ( m , 1 h ) , 7.46 ( d , j = 7.83 hz , 2 h ) , 7.67 ( d , j = 8.03 hz , 2 h ) , 7.99 ( d , j = 9.00 hz , 1 h ) , 8.03 ( s , 1 h ) , 9.84 ( d , j = 7.05 hz , 1 h ) . lcms : rt = 0.78 min , ms m / z = 266 ( m + h ) . compound 11 , 1-(1-(4-(dimethylamino)phenyl)indolizin-3-yl)ethanone , was prepared in a manner similar to that described for compound 3 using intermediate o. h nmr ( 400 mhz , cdcl3 ) 9.92 ( d , 1h , j = 7 hz ) , 7.83 ( d , 1h , j = 9 hz ) , 7.58 ( s , 1h ) , 7.48 ( d , 2h , j = 7.5 hz ) , 7.177.16 ( m , 1h ) , 6.906.86 ( m , 3h ) , 3.03 ( s , 6h ) , 2.62 ( s , 3h ) . lrms ( esi - tof ) [ m + h]m / z calcd for c18h18n2oh , 279.2 ; found , 279.3 . compound 12 , 1-(1-(2-(methylsulfonyl)phenyl)indolizin-3-yl)ethanone , was prepared in a manner similar to that described for compound 3 using intermediate o. h nmr ( 400 mhz , dmso - d6 ) ppm 2.55 ( s , 3 h ) , 2.85 ( s , 3h ) , 7.14 ( t , j = 6.56 hz , 1 h ) , 7.277.35 ( m , 1 h ) , 7.377.43 ( m , 1 h ) , 7.58 ( d , j = 7.05 hz , 1 h ) , 7.717.78 ( m , 1 h ) , 7.807.87 ( m , 1 h ) , 7.96 ( s , 1 h ) , 8.20 ( d , j = 7.83 hz , 1 h ) , 9.81 ( d , j = 7.05 hz , 1 h ) . lcms : rt = 0.79 min , ms m / z = 314 ( m + h ) . compound 13 , 1-(1-(2-(hydroxymethyl)phenyl)-7-methylindolizin-3-yl)ethanone , was prepared in a manner similar to that described for compound 3 . h nmr ( 400 mhz , dmso - d6 ) ppm 2.34 ( s , 3 h ) , 2.50 ( s , 3 h ) , 4.44 ( s , 2 h ) , 5.10 ( br . s. , 1 h ) , 6.94 ( dd , j = 7.15 , 1.13 hz , 1 h ) , 7.26 ( s , 1 h ) , 7.317.44 ( m , 3 h ) , 7.63 ( d , j = 7.53 hz , 1 h ) , 7.80 ( s , 1 h ) , 9.69 ( d , j = 7.28 hz , 1 h ) . lcms : rt = 0.79 min , ms m / z = 280 ( m + h ) . compound 14 , 1-(1-(2-(hydroxymethyl)phenyl)-7-methoxyindolizin-3-yl)ethanone , was prepared in a manner similar to that described for compound 3 . h nmr ( 400 mhz , dmso - d6 ) ppm 2.47 ( s , 3 h ) , 3.79 ( s , 3 h ) , 4.45 ( s , 2 h ) , 6.76 ( s , 1 h ) , 6.80 ( d , j = 7.53 hz , 1 h ) , 7.307.44 ( m , 3 h ) , 7.63 ( d , j = 7.28 hz , 1 h ) , 7.78 ( s , 1 h ) , 9.68 ( d , j = 7.53 hz , 1 h ) . lcms : rt = 0.80 min , ms m / z = 296 ( m + h ) . compound 16 , 3-acetyl-1-(2-(hydroxymethyl)phenyl)indolizine-7-carboxamide , was prepared in a manner similar to that described for compound 3 . h nmr ( 400 mhz , dmso - d6 ) ppm 2.60 ( s , 3 h ) , 4.48 ( s , 2 h ) , 7.387.59 ( m , 5 h ) , 7.69 ( d , j = 7.44 hz , 1 h ) , 7.97 ( s , 1 h ) , 8.03 ( s , 1 h ) , 8.23 ( br . s. , 1 h ) , 9.77 ( d , j = 7.24 hz , 1 h ) . lcms : rt = 0.64 min , ms m / z = 309 ( m + h ) . compound 17 , 1-(1-(2-(hydroxymethyl)phenyl)-7-phenoxyindolizin-3-yl)ethanone , was prepared in a manner similar to that described for compound 3 . h nmr ( 400 mhz , dmso - d6 ) ppm 2.50 ( s , 3 h ) , 4.41 ( d , j = 5.27 hz , 2 h ) , 5.11 ( s , 1 h ) , 6.70 ( s , 1 h ) , 6.95 ( d , j = 7.78 hz , 1 h ) , 7.137.37 ( m , 6 h ) , 7.44 ( t , j = 7.78 hz , 2 h ) , 7.57 ( d , j = 7.53 hz , 1 h ) , 7.85 ( s , 1 h ) , 9.80 ( d , j = 7.53 hz , 1 h ) . lcms : rt = 0.92 min , ms m / z = 358 ( m + h ) . compound 18 , tert - butyl ( ( 3-acetyl-1-(2-(methylsulfonyl)phenyl)indolizin-7-yl)methyl)carbamate , was prepared in a manner similar to that described for compound 3 . h nmr ( 400 mhz , methanol - d4 ) ppm 1.40 ( s , 9 h ) , 2.58 ( s , 3 h ) , 2.70 ( s , 3 h ) , 4.25 ( s , 2 h ) , 6.99 ( d , j = 7.28 hz , 1 h ) , 7.24 ( s , 1 h ) , 7.57 ( d , j = 7.28 hz , 1 h ) , 7.667.73 ( m , 1 h ) , 7.757.83 ( m , 1 h ) , 7.92 ( s , 1 h ) , 8.27 ( d , j = 8.03 hz , 1 h ) , 9.80 ( d , j = 7.28 hz , 1 h ) . lcms : rt = 0.82 min , ms m / z = 443 ( m + h ) . compound 20 , 1-(1-(2-(methylsulfonyl)phenyl)-7-phenoxyindolizin-3-yl)ethanone , was prepared in a manner similar to that described for compound 3 . h nmr ( 400 mhz , chloroform - d ) ppm 2.62 ( s , 3 h ) , 2.70 ( s , 3 h ) , 6.78 ( dd , j = 7.73 , 2.45 hz , 1 h ) , 6.85 ( d , j = 2.35 hz , 1 h ) , 7.11 ( d , j = 7.83 hz , 2 h ) , 7.207.27 ( m , 1 h ) , 7.397.51 ( m , 3 h ) , 7.557.62 ( m , 1 h ) , 7.647.72 ( m , 1 h ) , 7.92 ( s , 1 h ) , 8.32 ( d , j = 7.63 hz , 1 h ) , 9.95 ( d , j = 7.63 hz , 1 h ) . lcms : rt = 0.92 min , ms m / z = 406 ( m + h ) . compound 21 , 1-(7-methoxy-1-(2-(methylsulfonyl)phenyl)indolizin-3-yl)ethanone , was prepared in a manner similar to that described for compound 3 . h nmr ( 400 mhz , dmso - d6 ) ppm 2.46 ( s , 3 h ) , 2.82 ( s , 3 h ) , 3.76 ( s , 3 h ) , 6.65 ( d , j = 2.51 hz , 1 h ) , 6.83 ( dd , j = 7.65 , 2.38 hz , 1 h ) , 7.57 ( d , j = 7.53 hz , 1 h ) , 7.667.74 ( m , 1 h ) , 7.767.85 ( m , 2 h ) , 8.17 ( d , j = 7.78 hz , 1 h ) , 9.67 ( d , j = 7.78 hz , 1 h ) . lcms : rt = 0.80 min , ms m / z = 344 ( m + h ) . compound 22 , 1-(7-methyl-1-(2-(methylsulfonyl)phenyl)indolizin-3-yl)ethanone , was prepared in a manner similar to that described for compound 3 . h nmr ( 400 mhz , dmso - d6 ) ppm 2.32 ( s , 3 h ) , 2.49 ( s , 3 h ) , 2.81 ( s , 3 h ) , 6.97 ( dd , j = 7.40 , 1.38 hz , 1 h ) , 7.16 ( s , 1 h ) , 7.54 ( d , j = 7.53 hz , 1 h ) , 7.677.74 ( m , 1 h ) , 7.777.83 ( m , 1 h ) , 7.87 ( s , 1 h ) , 8.16 ( d , j = 8.03 hz , 1 h ) , 9.69 ( d , j = 7.28 hz , 1 h ) . lcms : rt = 0.82 min , ms m / z = 328 ( m + h ) . the cocrystal structures reported in this study have been deposited to the protein data bank under accession codes 4ir3 , 4ir4 , 4ir5 , 4ir6 and 4rvr .

bromodomains are acetyl - lysine specific protein interaction domains that have recently emerged as a new target class for the development of inhibitors that modulate gene transcription . the two closely related bromodomain containing proteins baz2a and baz2b constitute the central scaffolding protein of the nucleolar remodeling complex ( norc ) that regulates the expression of noncoding rnas . however , baz2 bromodomains have low predicted druggability and so far no selective inhibitors have been published . here we report the development of gsk2801 , a potent , selective and cell active acetyl - lysine competitive inhibitor of baz2a and baz2b bromodomains as well as the inactive control compound gsk8573 . gsk2801 binds to baz2 bromodomains with dissociation constants ( kd ) of 136 and 257 nm for baz2b and baz2a , respectively . crystal structures demonstrated a canonical acetyl - lysine competitive binding mode . cellular activity was demonstrated using fluorescent recovery after photobleaching ( frap ) monitoring displacement of gfp - baz2a from acetylated chromatin . a pharmacokinetic study in mice showed that gsk2801 had reasonable in vivo exposure after oral dosing , with modest clearance and reasonable plasma stability . thus , gsk2801 represents a versatile tool compound for cellular and in vivo studies to understand the role of baz2 bromodomains in chromatin biology .

Introduction Results and Discussion Conclusion Experimental Section

acute liver failure , frequently results from hepatitis virus infection , induction of drugs and toxins , or hepatic ischemia - reperfusion injury , is an important dramatic clinical syndrome . liver oxidative stress and inflammation are significant determinants in the physiopathology of acute liver failure . pro - inflammatory cytokines and reactive oxygen species have key roles in the mentioned liver failure ( 1 ) . additionally , cytokines are one of the most important regulators of host responses to infection , immune responses , and inflammation . some cytokines make the disease worse ( pro - inflammatory ) , while others act to reduce inflammation ( anti - inflammatory ) . the well - known examples of pro - inflammatory cytokines are interleukin-6 ( il-6 ) and tumor necrosis factor ( tnf ) ( 2 ) . on the other hand , oxidative stress is described as a disturbance in the balance between the production of reactive oxygen species and antioxidant defenses . in current literature , most claim that a close relationship exists between oxidative stress and inflammation ( 3 , 4 ) . intestinal bacteria and their metabolites cause over - activation of the immune system when liver function is severely damaged , which leads to hepatocyte necrosis ( 5 ) . exposure to large amounts or high doses of lps under certain conditions may contribute to sepsis associated with fever , circulatory shock , and injury to several organs , including the liver ( 6 ) . the commonly accepted strategy used for prevention of lps - based damage is the reduction of reactive metabolites and the use of antioxidants ( 7 ) . epigallocatechin-3-gallate ( egcg ) , a major catechin isolated from green tea , is known to be a potential antioxidant . it has been used to treat a variety of diseases such as diabetes , cancer , cardiovascular disease , and nephrotoxicity ( 8 - 10 ) . egcg suppresses the migration and adhesion of multiple cell types , and it possesses excellent chemopreventive properties . egcg plays anti - inflammatory and anti - oxidant roles in the elimination of cellular damage ( 11 ) . more recently , reports have demonstrated the potential of egcg to generate oxidative stress in vitro ( 12 ) . therefore , the aim of this study was to investigate the alternative protective effects of egcg on lps - induced hepatotoxicity by using hep3b human hepatoma cells . specifically , the study examines the role of some proinflammatory markers and oxidative damage as possible mechanisms of lps - associated cytotoxicity . consequently , the hepatocellular carcinoma cell line hep3b was chosen as a model for investigation of lps toxicity and the effect of egcg on lps - exposed cells . the human hepatoma - derived cell line hep3b , was purchased from the american type culture collection ( atcc , usa ) , was cultured in dulbecco s modified eagle s medium ( dmem ) supplemented with a 10% fetal bovine serum ( fbs ) , 1% penicillin - streptomycin solution ( gibco , pittsburgh , usa ) at 37c in a humidified atmosphere of 5% co2 . subconfluent cultures were detached with trypsin / edta ( gibco , pittsburgh , usa ) and counted with trypan blue ( sigma - aldrich , usa ) counting method , and cells were seeded in six - well plates in 2 ml of growth medium . next , epigallocatechin gallate ( egcg ) ( santa cruz biotechnology , ca , usa ) and a single dose application ( 100 ng / ml ) of lps ( sigma - aldrich , usa ) were conducted on related groups in the appropriate doses . the egcg doses were 400 m , 200 m , 100 m , and 50 m , respectively . the cells were then washed with dulbecco s phosphate - buffered saline ( dpbs ) ( sigma - aldrich , usa ) , and a(3-([4 , 5-dimethylthiazol-2-yl)]-2,5-diphenyltetrazolium bromide ( mtt ) cell proliferation assay ( sigma - aldrich , usa ) was performed . optimal doses of egcg and lps were determined by the mtt assay , cells were seeded in 96-well plates in 100 l of growth medium , and the optimum doses were applied . hep3b hepatoma cells were seeded into 96-well plates at 2 x 10 cells per well and treated with egcg and lps . next , 10 l of mtt was added to each well and incubated for 4 hr at 37 c . the medium was then removed , and 150 l of dimethyl sulfoxide ( dmso ) was added to solubilize the mtt formazan . the absorbance of converted dye by living cells was measured at the wavelength of 570 nm . the total rna from hep3b cells was isolated using a qiagen rna isolation kit with an automated device ( qiacube , qiagen , germany ) according to the manufacturer s protocol . the cdna synthesis was performed by using the first strand synthesis kit ( qiagen , germany ) . real - time pcr was done using tnf - alpha , il-6 , and human beta - actin ( actb ) reference gene hybrid probes with roche cobas z480 ( roche , basel , switzerland ) . the values for specific genes were normalized by using beta - actin reference gene . in each pcr run , the cdna samples were amplified in triplicate . pcr primer sequences of tnf - alpha , il-6 and -actin cells were incubated , the culture supernatant was collected , and the concentrations of aspartate aminotransferase ( ast ) and alanine aminotra- nsferase ( alt ) were determined for each culture using an automatic biochemical analyzer . the cells were centrifuged at 600 g for 10 min at 4 c to remove nuclear fractions , and the remaining separated supernatant was recentrifuged at 10,000 g for 20 min at 4 c to collect the mitochondrial fraction ( pellet ) including peroxisomes for a catalase activity ( cat ) assay . superoxide dismutase ( sod ) activity was detected and inhibition of the formation of nicotinamide adenine dinucleotide phosphate ( nadph)-phenazine methosulphate nitroblue tetrazolium formazan was measured spectropho- tometrically at 560 nm . the sod and cat activities in the culture media were assayed with sod and cat assay kits ( enzo , telluride , usa ) according to the manufacturers instructions . the activity of glutathione peroxidase ( gsh - px ) in the culture medium was determined with human gsh - px elisa kit ( elabscience biotechnology co. , ltd , usa ) according to the manufacturers instructions . gsh - px activity was assayed using a method based on the reaction between glutathione remaining after the action of gsh - px and 5,5-dithiobid-2-nitrobenzoic acid to form a complex that absorbs maximally at 412 nm . all parameters recorded during sampling and laboratory findings were entered and stored in microsoft - excel . the data were analyzed using the ibm statistical package for social sciences ( spss ) version 20.0 statistical software ( ibm , ny , usa ) . statistical analysis was performed using one - way analysis of variance ( anova ) and duncan s multiple range tests ( dmrt ) . all p - values were based on a two - sided test of statistical significance and significance was accepted at the level of p < 0.05 . the human hepatoma - derived cell line hep3b , was purchased from the american type culture collection ( atcc , usa ) , was cultured in dulbecco s modified eagle s medium ( dmem ) supplemented with a 10% fetal bovine serum ( fbs ) , 1% penicillin - streptomycin solution ( gibco , pittsburgh , usa ) at 37c in a humidified atmosphere of 5% co2 . subconfluent cultures were detached with trypsin / edta ( gibco , pittsburgh , usa ) and counted with trypan blue ( sigma - aldrich , usa ) counting method , and cells were seeded in six - well plates in 2 ml of growth medium . next , epigallocatechin gallate ( egcg ) ( santa cruz biotechnology , ca , usa ) and a single dose application ( 100 ng / ml ) of lps ( sigma - aldrich , usa ) were conducted on related groups in the appropriate doses . the egcg doses were 400 m , 200 m , 100 m , and 50 m , respectively . the cells were then washed with dulbecco s phosphate - buffered saline ( dpbs ) ( sigma - aldrich , usa ) , and a(3-([4 , 5-dimethylthiazol-2-yl)]-2,5-diphenyltetrazolium bromide ( mtt ) cell proliferation assay ( sigma - aldrich , usa ) was performed . optimal doses of egcg and lps were determined by the mtt assay , cells were seeded in 96-well plates in 100 l of growth medium , and the optimum doses were applied . hep3b hepatoma cells were seeded into 96-well plates at 2 x 10 cells per well and treated with egcg and lps . next , 10 l of mtt was added to each well and incubated for 4 hr at 37 c . the medium was then removed , and 150 l of dimethyl sulfoxide ( dmso ) was added to solubilize the mtt formazan . the absorbance of converted dye by living cells was measured at the wavelength of 570 nm . the total rna from hep3b cells was isolated using a qiagen rna isolation kit with an automated device ( qiacube , qiagen , germany ) according to the manufacturer s protocol . the cdna synthesis was performed by using the first strand synthesis kit ( qiagen , germany ) . real - time pcr was done using tnf - alpha , il-6 , and human beta - actin ( actb ) reference gene hybrid probes with roche cobas z480 ( roche , basel , switzerland ) . the values for specific genes were normalized by using beta - actin reference gene . in each pcr run cells were incubated , the culture supernatant was collected , and the concentrations of aspartate aminotransferase ( ast ) and alanine aminotra- nsferase ( alt ) were determined for each culture using an automatic biochemical analyzer . the cells were centrifuged at 600 g for 10 min at 4 c to remove nuclear fractions , and the remaining separated supernatant was recentrifuged at 10,000 g for 20 min at 4 c to collect the mitochondrial fraction ( pellet ) including peroxisomes for a catalase activity ( cat ) assay . superoxide dismutase ( sod ) activity was detected and inhibition of the formation of nicotinamide adenine dinucleotide phosphate ( nadph)-phenazine methosulphate nitroblue tetrazolium formazan was measured spectropho- tometrically at 560 nm . the sod and cat activities in the culture media were assayed with sod and cat assay kits ( enzo , telluride , usa ) according to the manufacturers instructions . the activity of glutathione peroxidase ( gsh - px ) in the culture medium was determined with human gsh - px elisa kit ( elabscience biotechnology co. , ltd , usa ) according to the manufacturers instructions . gsh - px activity was assayed using a method based on the reaction between glutathione remaining after the action of gsh - px and 5,5-dithiobid-2-nitrobenzoic acid to form a complex that absorbs maximally at 412 nm . all parameters recorded during sampling and laboratory findings were entered and stored in microsoft - excel . the data were analyzed using the ibm statistical package for social sciences ( spss ) version 20.0 statistical software ( ibm , ny , usa ) . statistical analysis was performed using one - way analysis of variance ( anova ) and duncan s multiple range tests ( dmrt ) . all p - values were based on a two - sided test of statistical significance and significance was accepted at the level of p < 0.05 . the cytotoxic effects of chemicals ( egcg and lps ) , ast and alt levels , sod and cat activities , gsh - px , tnf - alpha , and il-6 levels were determined by using different biochemical and molecular methods . the mtt assay shows cell viability . according to the mtt assay results of both 24 and 48 hr applications , , there was a significant difference between the lps application group and all other experimental groups in terms of cell viability ( p<0.05 ) . however , all doses of egcg led to an increase in cell viability at different levels in the lps - induced hepatotoxicity groups ( figure 1 ) . cell viability of all experimental groups detected by mtt assay a and b show the significant differences among 24 hr treated experimental groups ( p<0.05 ) 15 show the significant differences among 48 hr treated experimental groups ( p<0.05 ) in this study , the liver enzyme levels ( ast and alt ) were checked to determine whether or not lps lead to hepatotoxicity . both alt and ast enzyme levels were highest in the lps and lps+egcg400 m groups . there were significant differences between the control group , lps , and lps+egcg400 m groups ( p<0.05 ) . normalization of ast and alt levels was detected in egcg 200 , 100 , and 50 m treatment groups . the effects of lps and egcg treatment on ast and alt enzyme levels a e show the significant differences among experimental groups in ast enzyme levels ( p<0.05 ) 1 and 2 show the significant differences among experimental groups in alt enzyme levels ( p<0.05 ) some anti - oxidant system parameters such as sod , cat , and gsh - px were detected by biochemical methods as shown in figures 3 , 4 , and 5 . the highest treatment dose , 400 m of egcg , lead to a dramatic decrease in sod level of hep3b cells , and there were significant differences in the control group versus the egcg400 and control vs. lps+egcg400 groups ( p<0.05 ) . however , other treatment doses of egcg normalized the sod level as seen in figure 3 . on the other hand , catalase is also an antioxidant enzyme which catalyzes the conversion of h2o2 to water and oxygen . the results were nearly the same as sod activity results . when the highest dose of egcg was applied to lps - induced hep3b cells , however , other doses of egcg showed a possible treatment effect on lps - induced hepatotoxicity . they reduced the cat activity level in contrast to egcg400 m application ( figure 4 ) . finally , gsh - px enzymes catalyzed the reduction of hydroperoxides to water and the respective alcohols by oxidizing gsh to oxidized glutathione ( gssg ) ( 13 , 14 ) . the effects of lps and egcg treatment on sod enzyme activity in hep3b cells a c show the significant differences among experimental groups in sod enzyme activity ( p<0.05 ) the effects of lps and egcg treatment on cat enzyme activity in hep3b cells a f show the significant differences among experimental groups in cat enzyme activity ( p<0.05 ) the effects of lps and egcg treatment on gsh - px enzyme activity in hep3b cells a d show the significant differences among experimental groups in gsh - px enzyme activity ( p<0.05 ) when gsh - px levels were evaluated in the present study , there were statistical differences ( p<0.05 ) between the control and other experimental groups . as with sod and cat activity levels , the highest dose of egcg led to a significant increase in lps - induced hepatotoxicity ( figure 5 ) . initially , it was seen that lps caused an increase in both tnf - alpha and il-6 levels and led to inflammation . at that point , attempts were made to treat and normalize these levels with various doses of egcg . however , the highest dose of egcg also led to a dramatic increase in these cytokine levels ( figure 6 ) . tnf - alpha and il-6 levels increased 5-fold and 2-fold in the lps administration group , respectively . it was understood that high dose egcg treatment caused serious changes in some crucial parameters . tnf - alpha and il-6 levels increased 36-fold and 14-fold in the high dose egcg+lps group , respectively . other treatment doses of egcg were found to be beneficial doses because they normalized these cytokine levels after lps - induced hepatotoxicity . tnf - alpha and il-6 mrna expression levels of all experimental groups a g show the significant differences among experimental groups in tnf - alpha mrna expression levels ( p<0.05 ) 17 show the significant differences among experimental groups in il-6 mrna expression levels ( p<0.05 ) infection , especially gram - negative bacteria , is the most common cause of sepsis , and lps found in such bacteria is an endotoxin that has been implicated in the pathogenesis of infection and as a cause of septic shock . lps - induced hepatotoxicity is characterized by disturbed intracellular redox balance and excessive reactive oxygen species ( ros ) accumulation , leading to liver injury ( 15 ) . furthermore , human hepatoblastoma hep3b cells have been used in many toxicity studies to screen for hepatotoxic compounds ( 16 ) . these cells have low levels of phase i cytochrome p450 enzymes when compared with primary hepatocytes , but they have normal levels of phase ii enzymes ( 17 , 18 ) . some studies have indicated that hepatocellular carcinoma cells present a valuable in vitro model for hepatotoxicity studies ( 18 - 20 ) . this study evaluated the possible role of egcg in lps - induced hepatotoxicity using hep3b cells . for this reason , mtt assay , ast and alt liver enzyme levels , gsh level , sod and cat activities , tnf - alpha and il-6 levels were investigated by different methods in this study . in current literature , there are few published studies about the anti - inflammatory effects of egcg on various cells and organs in either animal or in vitro models . however , limited studies have examined the relationship between egcg and lps - stimulated hepatotoxicity . the goal of our study was to investigate both the anti - oxidant and anti - inflammatory effects of egcg on lps - induced hepatotoxicity under in vitro conditions on hep3b cells . initially , it was seen that a high dose egcg is also a toxic agent for hepatocytes as it negatively affects all parameters in hep3b cells . a 400 m egcg treatment leads to an increase in the levels of cat , gsh - px , ast , alt , tnf - alpha , and il-6 , while it decreases the level of sod . however , other doses of egcg treatment may be as effective , especially doses of 100 and 200 m doses . when mtt results were considered , it was seen that lps and a high dose of egcg caused a serious reduction in the level of cell viability . most in vitro studies have shown that lps is a serious cytotoxic agent especially on hepatocytes ( 18 ) . however , a study confirms our hypothesis that a high dose of egcg ( 400 m ) is cytotoxic on cell viability ( 21 ) . the other two doses of egcg ( 200 and 100 m ) were the most effective doses of egcg treatment used in this study . these doses normalized nearly all the parameters and cell viability . as in this study , kim et al showed that the protection by egcg is most effective when cells are exposed to egcg for short periods at 100 or 200 m concentrations ( 22 ) . evaluation of several biochemical parameters , including enzymes , can be helpful in identifying damage to target tissues , as well as identifying the health status of the host . in addition , ast and alt are the most important enzymes acting as transaminases involved in amino acid metabolism ( 23 ) . for this reason , liver ast and alt enzymes are considered relevant stress indicators , and they were used to determine liver toxicity in this study . as seen in figure 2 , lps causes an increase in both ast and alt levels in hep3b cells . additionally , a high dose of egcg exacerbated the increase of liver enzymes . previous studies have shown that lps can lead to a dramatic increase in ast , alp , and alt levels ( 5 , 24 , 25 ) . oxidative stress is a system made up of a group of antioxidant enzymes and non - enzymatic antioxidant substances capable of neutralizing free radicals and preventing an excess production of ros ( 26 ) . sod , gsh - px , and catalase enzymes are the first line of cellular defense against oxidative stress . in our study , these increases are an expected result when the toxicity potential of lps and high dose egcg are suspected . however , as expected , effective doses of egcg treatment normalized these enzyme levels . study showed that non - lethal toxic doses of egcg treatment markedly decrease the levels of sod , catalase , and glutathione peroxidase . it also showed that egcg also significantly suppresses mrna levels of hepatic sod and cat levels ( 27 ) . moreover , most scientific studies have proven that lps leads to an increase in oxidative stress parameters ( 18 ) . oxidative stress mediated tissue damage can be reversed by the sod enzyme and glutathione ( gsh ) . the action of these two antioxidant parameters prevents the cytotoxic effects of toxic free radicals . cat is also an anti - oxidant enzyme that reacts with hydrogen peroxide to produce water and molecular oxygen . the currently accepted knowledge supports our anti - oxidant data that egcg can affect the antioxidant enzyme levels and prevent oxidative damage . in addition , cytokines play an important role in many cellular processes such as immunity , inflammation , cell proliferation , differentiation , and cell death . among the inflammatory networks , tnf- , il-1 , and il-6 are known to be the most important inflammatory mediators involved in the initiation of acute inflammation . tnf - alpha has been linked to increased oxidative stress and is known to activate other inflammatory cells ( 28 , 29 ) . also , it is the earliest and primary endogenous mediator for the process of inflammatory responses and has been linked to increased oxidative stress ( 28 ) . according to literature , it has been shown that il-6 triggers some cellular signaling pathways and induces some pro - apoptotic proteins such as b - cell cll / lymphoma-2 ( bcl-2 ) ( 30 ) . in the present study , only lps administration , only high dose egcg treatment , and lps+egcg400 administration led to a serious increase in both the tnf - alpha and il-6 levels and also caused acute inflammation . however , effective doses of egcg were also used in an attempt to normalize and reduced cytokine levels . a previous study has concluded that the anti - inflammatory mechanism of green tea polyphenols contributes to down - regulation of tnf - alpha gene expression ( 5 ) . increases in oxidative stress can increase the production of inflammatory cytokines and in turn , an increase in inflammatory cytokines can induce the production of radicals . for example , chen et al examined the possible protective effects of egcg in mastitis rats . it was found that egcg inhibits the lps - induced inflammatory response and normalizes anti - oxidant enzyme levels ( 29 ) . another study ( 31 ) claimed that egcg could inhibit il-6 and nuclear factor - kappa - light - chain - enhancer of activated b cell ( nf - kb ) activities in human gingival fibroblasts . a similar study ( 32 ) showed that some egcg derivates suppress the lps - induced production of nitric oxide and pro - inflammatory cytokines in macrophages . another study , performed in gingival epithelial cells , showed that egcg inhibited inflammatory cytokine secretion and also suggested that it may be a novel adjunctive therapeutic agent ( 33 ) . liu et al ( 5 ) used lps - induced l0 hepatocytes in their study to examine the effects of egcg on liver cells . they showed that pre - treatment of egcg reduces the production of tnf - alpha and nitric oxide production in a dose - dependent manner . in conclusion , lps caused hepatotoxicity , but interestingly , a high dose of egcg was found to be a cytotoxic agent in this study . however , other two doses of egcg led to a decrease in both inflammatory cytokine levels and antioxidant enzyme levels in lps - induced hep3b cells . to better understand the molecular mechanisms of the anti - inflammatory and anti - oxidant effects of egcg , further studies should examine the effect of egcg on secondary cellular signaling pathways such as mapk in lps - stimulated hepatocytes because the erk1/2 and p38 are the major members of mapk family and are associated with cellular oxidative stress , inflammation , proliferation , and migration . finally , the protective effect of egcg in lps - enhanced hep3b cells is associated with the inhibition of inflammatory mediators , including tnf - alpha and il-6 , and may affect the antioxidant enzyme levels . taking everything into account , egcg may be seen as a promising agent for the treatment of hepatic over - active inflammatory response .

objective(s):in the present study , our aim was to investigate the possible protective effects of epigallocatechin gallate ( egcg ) on lipopolysaccharide ( lps)-induced hepatotoxicity by using hep3b human hepatoma cells . specifically , the study examines the role of some proinflammatory markers and oxidative damage as possible mechanisms of lps - associated cytotoxicity . consequently , the hepatocellular carcinoma cell line hep3b was chosen as a model for investigation of lps toxicity and the effect of egcg on lps - exposed cells.materials and methods : the hep3b human hepatoma cells were used for this study . the cytotoxic effects of chemicals ( egcg and lps ) , ast and alt levels , sod and cat activities , gsh - px level and tnf - alpha and il-6 levels were detected by using different biochemical and molecular methods . lps and egcg were applied to cells at various times and doses.results:the highest treatment dose of egcg ( 400 m ) led to a dramatic decrease in sod level and increase in cat and gsh levels . additionally , the highest dose of egcg also led to a dramatic increase in tnf - alpha and il-6 levels . on the other hand , effective doses of egcg ( 200 and 100 m ) normalized all related parameters levels.conclusion:lps caused hepatotoxicity , but interestingly , a high dose of egcg was found to be a cytotoxic agent in this study . however , other two doses of egcg led to a decrease in both inflammatory cytokine levels and antioxidant enzyme levels . further studies should examine the effect of egcg on secondary cellular signaling pathways .

Introduction Material and Methods Cell Culture and Treatment MTT assay Quantitative real-time PCR (Q-PCR) analysis Biochemical Examination GSH-Px activity detection by enzyme-linked immunosorbent assay (ELISA) Statistical analysis Results Discussion Conclusion Conflict of interest

cancer survivors are at an increased risk for developing cancers compared to the general population . in the united states , where cancer survivors comprise 3.5% of the total population , approximately 10% of all new cancers are diagnosed from a population of cancer survivors , and 8% of survivors have been affected by cancer more than once [ 4 - 6 ] . in korea , cancer survivors comprise 2% of the total population , and an estimated 3% to 4% of all new cancer cases have been diagnosed among survivors . because cancer screening can reduce the risk of dying from selected cancers via their early detection , screening for spc should be included as one of the key components of survivorship care . however , spcs are often undetected during a regular oncological follow - up process , and spc cancer screening practices have not been optimal [ 12 - 14 ] . although cancer patients have an increased risk of spc compared to the general population , their cancer screening rates were either slightly higher or similar compared to the general population [ 15 - 18 ] . the lack of information concerning spc and knowledge among cancer patients were identified as the key barriers to spc screening . cancer screening and routine surveillance tests. many survivors said that they would have undergone screening for spc if they were aware of it and would have liked to receive information related to spc from their physicians . however , only 21.5% of them received a recommendation for spc screening from their doctors . because oncologists are key personnel for educating survivors and guiding spc screening , we explored oncologists experience , current practice , perceived barriers , and appropriate care models and recommendations to develop appropriate clinical strategy for spc screening in our previous qualitative study . in this nationwide study the present study is part of a nationwide survey that was conducted to explore medical care and treatment views of physicians involved in cancer care . physicians at the national cancer center and 12 participating government - designated regional cancer centers across korea participated in the survey . the current study was approved by the institutional review board of the national cancer center of korea . of the 901 physicians invited to participate in this study we administered questions regarding spcs only to 505 oncologists who see cancer patients for diagnosis and treatment of primary cancer , while the rest175 physicians who provide other supportive care or services ( e.g. , radiologist , pathologist , cardiologist , rehabilitation specialist , pain specialist , and psychiatrist)were excluded from the study . additionally , 19 oncologists who did not answer the questions regarding spcs were excluded from the analyses , leaving a final total of 486 subjects in the current study . the questionnaires included questions regarding the oncologists experiences with spc patients , feelings they had when their patients developed spcs , current spc screening practice , barriers to providing spc screening information , and appropriate care models and recommendations to develop the appropriate clinical strategy for spc screening . the survey also inquired about age , gender , specialty , years since board certification , and patient volume ( average number of outpatients per week ) . chi - squared tests were used for the comparison of the responses in accordance to the subgroups . all statistical analyses were conducted using stata ver . 12.0 ( stata corp . , college station , tx ) , and a p - value of less than 0.05 was considered to be statistically significant . the present study is part of a nationwide survey that was conducted to explore medical care and treatment views of physicians involved in cancer care . physicians at the national cancer center and 12 participating government - designated regional cancer centers across korea participated in the survey . the current study was approved by the institutional review board of the national cancer center of korea . of the 901 physicians invited to participate in this study we administered questions regarding spcs only to 505 oncologists who see cancer patients for diagnosis and treatment of primary cancer , while the rest175 physicians who provide other supportive care or services ( e.g. , radiologist , pathologist , cardiologist , rehabilitation specialist , pain specialist , and psychiatrist)were excluded from the study . additionally , 19 oncologists who did not answer the questions regarding spcs were excluded from the analyses , leaving a final total of 486 subjects in the current study . the questionnaires included questions regarding the oncologists experiences with spc patients , feelings they had when their patients developed spcs , current spc screening practice , barriers to providing spc screening information , and appropriate care models and recommendations to develop the appropriate clinical strategy for spc screening . the survey also inquired about age , gender , specialty , years since board certification , and patient volume ( average number of outpatients per week ) . chi - squared tests were used for the comparison of the responses in accordance to the subgroups . all statistical analyses were conducted using stata ver . 12.0 ( stata corp . , college station , tx ) , and a p - value of less than 0.05 was considered to be statistically significant . the mean age of cancer care physicians was 42.6 years , and the mean time since board certification was 11.6 years . among the 486 study participants , 384 ( 79.1% ) were male . the sample comprised surgical oncologists ( n=274 , 56.4% ) , medical oncologists ( n=182 , 37.4% ) , and radiation oncologists ( n=30 , 6.2% ) . the mean number of patients per week was 117.5 ( standard deviation , 77.4 ) ( table 1 ) . more than three - fourths of the oncologists surveyed ( 76.3% ) had reported that their own patients developed spcs while being followed - up after primary cancer treatment . with regard to the feelings they had about their own patients who developed spcs , approximately half of the oncologists ( 48.1% ) stated that they felt embarrassed being the doctor in charge , and one - third ( 30.7% ) felt sorry for the patients . as many as 37.0% of oncologists felt that patients appeared to not have accepted the situation , and 25.9% felt that patients blamed them ( table 2 ) . some oncologists ( 39.1% ) reported that they proactively provided information on the necessary screening for spcs to most patients . others ( 28.2% ) proactively provided information on necessary screening for spcs to only high - risk patients . while another group ( 30.9% ) did not typically discuss screening for spcs during routine practice . in addition , oncologists differ in how they deal with the necessary second cancer screening . of those ( 43.4% ) that reported they prescribe necessary screening tests alone , many ( 24.5% ) provide information regarding the national cancer screening program , which is a basic cancer screening package provided to all koreans over 40 years of age ( appendix 1 ) . a portion of oncologists ( 27.4% ) refer their patients to private comprehensive screening programs , which are commonly provided by university hospitals ( table 3 ) . most oncologists ( 80.2% ) agreed to the need for proactive provision of information regarding screening for spcs . however , many barriers were identified by oncologists : short consultation times ( 52.3% ) , lack of guidelines and evidence for spc screening ( 47.7% ) , patients lack of knowledge about spcs ( 45.1% ) or spc screening ( 41.4% ) , lack of a system for spc screening ( 37.7% ) , their own lack of knowledge about spc screening ( 36.2% ) , and lack of connections with the national cancer screening program ( 33.7% ) ( table 4 ) . regarding the appropriate care model for spc screening , more than half of oncologists ( 57.6% ) indicated the need for a cooperative spc screening program within the cancer center that is managed by physicians other than the oncologists who performed the follow - up on patients for their primary cancer . approximately one - fourth of oncologists ( 22.8% ) prefer direct provision of spc screening by oncologists alone , and 15.4% answered that spc screening is better provided by local hospitals or clinics within the patients vicinity . several recommendations were suggested by the oncologists : developing specific screening programs or guidelines according to the type of primary cancer ( 65.9% ) , developing an internal system for spc screening within the hospital ( 59.7% ) , educating patients about the needs for spc screening after primary treatment ( 48.9% ) , developing a systematic connection with the national cancer screening program ( 44.3% ) , educating oncologists about spc screening ( 41.4% ) , and allocating resources for oncologists to have sufficient time for spc screening consultation ( 27.7% ) ( table 5 ) . the mean age of cancer care physicians was 42.6 years , and the mean time since board certification was 11.6 years . among the 486 study participants , 384 ( 79.1% ) were male . the sample comprised surgical oncologists ( n=274 , 56.4% ) , medical oncologists ( n=182 , 37.4% ) , and radiation oncologists ( n=30 , 6.2% ) . the mean number of patients per week was 117.5 ( standard deviation , 77.4 ) ( table 1 ) . more than three - fourths of the oncologists surveyed ( 76.3% ) had reported that their own patients developed spcs while being followed - up after primary cancer treatment . with regard to the feelings they had about their own patients who developed spcs , approximately half of the oncologists ( 48.1% ) stated that they felt embarrassed being the doctor in charge , and one - third ( 30.7% ) felt sorry for the patients . as many as 37.0% of oncologists felt that patients appeared to not have accepted the situation , and 25.9% felt that patients blamed them ( table 2 ) . some oncologists ( 39.1% ) reported that they proactively provided information on the necessary screening for spcs to most patients . others ( 28.2% ) proactively provided information on necessary screening for spcs to only high - risk patients . while another group ( 30.9% ) did not typically discuss screening for spcs during routine practice . in addition , oncologists differ in how they deal with the necessary second cancer screening . of those ( 43.4% ) that reported they prescribe necessary screening tests alone , many ( 24.5% ) provide information regarding the national cancer screening program , which is a basic cancer screening package provided to all koreans over 40 years of age ( appendix 1 ) . a portion of oncologists ( 27.4% ) refer their patients to private comprehensive screening programs , which are commonly provided by university hospitals ( table 3 ) . most oncologists ( 80.2% ) agreed to the need for proactive provision of information regarding screening for spcs . however , many barriers were identified by oncologists : short consultation times ( 52.3% ) , lack of guidelines and evidence for spc screening ( 47.7% ) , patients lack of knowledge about spcs ( 45.1% ) or spc screening ( 41.4% ) , lack of a system for spc screening ( 37.7% ) , their own lack of knowledge about spc screening ( 36.2% ) , and lack of connections with the national cancer screening program ( 33.7% ) ( table 4 ) . regarding the appropriate care model for spc screening , more than half of oncologists ( 57.6% ) indicated the need for a cooperative spc screening program within the cancer center that is managed by physicians other than the oncologists who performed the follow - up on patients for their primary cancer . approximately one - fourth of oncologists ( 22.8% ) prefer direct provision of spc screening by oncologists alone , and 15.4% answered that spc screening is better provided by local hospitals or clinics within the patients vicinity . several recommendations were suggested by the oncologists : developing specific screening programs or guidelines according to the type of primary cancer ( 65.9% ) , developing an internal system for spc screening within the hospital ( 59.7% ) , educating patients about the needs for spc screening after primary treatment ( 48.9% ) , developing a systematic connection with the national cancer screening program ( 44.3% ) , educating oncologists about spc screening ( 41.4% ) , and allocating resources for oncologists to have sufficient time for spc screening consultation ( 27.7% ) ( table 5 ) . although spc screening has become a key issue for survivor care , no clinical strategy has been established . in addition , oncologists were not trained to manage the issues during their career development . to our knowledge , this is the first quantitative study to examine oncologists experiences with patients who develop spc and the current practices related to spc screening , as well as recommendations to develop appropriate clinical strategy in providing spc screening . more than three - fourths of oncologists had patients who developed spcs during follow - up , and more than half of these oncologists stated that they were embarrassed by the situation . approximately one - third of oncologists felt that a significant portion of patients appeared to not have accepted the situation and blamed their oncologists ; additionally , the oncologists felt sorry for their patients . as revealed in our study , the cause may be because most oncologists usually do not provide any information or recommend spc screening during their routine practice . indeed , only 21% of cancer patients reported that spc screening was recommended by their physicians . a large variation existed in the oncologists current practice of spc screening , ranging from no recommendations , referral to other programs , and direct provision by the oncologists themselves . these findings may partly reflect the oncologists individual situations , such as clinical burden , self - perceived identity as an oncologist , personal interests , knowledge , training in these issues , and environmental conditions . however , such unwarranted variations in care suggest poor quality of care regarding spc screening . in addition to this variation in individual oncologists general patterns of dealing with spc screening , actual decisions on spc screening are reportedly made on a case - by - case basis , since spcs are provided at the patient s request , rather than proactively , leading to further variations in the screening practices . considering the increasing number of spcs , most oncologists agreed to the need for proactive provision of spc screening information . however , several barriers and potential solutions were recognized that are related to ( 1 ) the health system , ( 2 ) the provider , and ( 3 ) the patient . in concordance with the previous qualitative study , a short consultation time was identified as the most common barrier against the guidance of appropriate screening for spc . in korea , oncologists see 20 - 60 patients in a single session ( lasting 3 - 4 hours ) , and the average consultation time is only 7 minutes . referral of cancer survivors to a systematic cancer screening program would overcome this clinical environmental barrier , and approximately 40% of the respondents of this study felt that the lack of such a system was a significant barrier to providing adequate spc screening . more than 70% of the oncologists preferred to refer their patients to other physicians , either in their own institution or in community clinics . the latter finding reflects the oncologists low level of interest in participating in primary care services , including spc screening . personal identity as a cancer treatment specialist and the lack of an opportunity to be educated about preventive services and cancer screening could be the potential explanations for this lack of interest . while cancer survivors expect oncologists to cover all of their health problems , including spcs , oncologists were more likely to focus on active treatment of the disease . such discrepant expectations were also reported in a united states study , in which the rate of agreement between oncologists and their patients about spc screening was only 29% . the lack of clear guidelines for spcs was also considered as a major barrier in providing adequate spc screening . the cause may be that oncologists lack confidence about their guidance for spc screening if no guidelines exist for such screening . furthermore , in our previous study , a portion of oncologists reported that some survivors showed negative attitudes in response to their recommendation for spc screening , simply because they suspected that oncologists would obtain more financial benefit from prescribing the screening test . therefore , without clear guidelines , the oncologists would have difficulties for guiding spc screening to patients , and they could be suspected of over - prescribing by their patients . over 45% of the oncologists stated that a patient s lack of knowledge concerning spcs or spc screening was also among the significant barriers to appropriate spc screening practice . previous studies have shown that patients do not undergo spc screening due to a lack of information , and inadequate knowledge about spc screening was associated with lower adherence to cancer screening practice . the results of the current study seem to support previous findings , because medical dialogue is the many oncologists were willing to provide consultation about spc screening when their patients prompted the issue . several recommendations are suggested in accordance with the above barriers . from a perspective of the system , the development of an internal connection for spc screening within the cancer center was suggested . institution - based shared care model was preferred due to the facilitated information that is shared through electronic medical records , easy access and communication with primary care physicians if necessary , and patient s preference for being treated at the same institution where they undergo cancer treatment . by contrast , communication with physicians at local primary care clinics is more complicated due to technological difficulties and legal problems . from the physician s perspective , the development of primary cancerspecific programs or guidelines would enable oncologists to be more confident in guiding appropriate screening for spcs . finally , patient education about the need for spc screening after primary treatment would encourage patients , facilitate discussion , and increase acceptance regarding the appropriate spc screening . one significant limitation of our study was its specificity to korea , where healthcare is provided in a fee - for - service system with universal health insurance coverage with the existence of a national cancer screening program . therefore , the results can not be generalized to other countries with different healthcare systems . in summary , our study revealed that spcs are a common experience for oncologists , a finding that is embarrassing and difficult to manage effectively . current practice varies ; however , most oncologists that were surveyed agreed to the need for a proactive provision of information regarding spcs . many barriers were identified , including a short consultation time and the lack of established guidelines , oncologists own knowledge , patients knowledge , and systematic programs . a cooperative spc screening program within a cancer center that is managed by physicians other than the oncologists was the most preferred option . other recommendations included the development of specific screening programs or guidelines according to the type of primary cancer and the development of a systematic connection for spc screening within the hospital or with a national cancer screening program to educate oncologists , as well as patients about spc screening . given the variations in the current practice and the lack of consensus , further studies are warranted to develop the optimal clinical strategy to provide spc screening for cancer survivors .

purposescreening for second primary cancer ( spc ) is one of the key components to survivorship care . we aim to evaluate the oncologists experience with spcs and assess the current practice , perceived barriers , and recommendations related to spc screening.materials and methodsa nationwide survey was conducted with a representative sample of 496 korean oncologists . a questionnaire based on the findings from our previous qualitative study was administered.resultsmore than three - fourths of oncologists ( 76.3% ) , who participated in the study , had experience with spc patients . over half of them ( 51.9% ) stated that it was an embarrassing experience . while the current management practice for spc varies , most oncologists ( 80.2% ) agreed on the necessity in proactively providing information on spc screening . a short consultation time ( 52.3% ) , lack of guidelines and evidence on spc screening ( 47.7% ) , and patients lack of knowledge about spcs ( 45.1% ) or spc screening ( 41.4% ) were most frequently reported as barriers to providing appropriate care for managing spc . oncologists recommended the development of specific screening programs or guidelines in accordance to the type of primary cancer ( 65.9% ) , the development of an internal system for spc screening within the hospital ( 59.7% ) or systematic connection with the national cancer screening program ( 44.3% ) , and education of oncologists ( 41.4% ) as well as patients ( 48.9% ) regarding spc screening.conclusionmany oncologists reported the occurrence of spc as an embarrassing experience . given the variations in current practice and the lack of consensus , further studies are warranted to develop the optimal clinical strategy to provide spc screening for cancer survivors .

Introduction Materials and Methods 1. Study design and subjects 2. Measures 3. Statistical analysis Results 1. Study participants 2. Personal experiences of oncologists with SPCs 3. Current practice of screening for SPCs 4. Attitudes toward screening for SPCs Discussion Conclusion

the fact that exercise and physical activity have positive effects on health is well known . most of the research on exercise - induced changes carried out during the past years has mainly focussed on its impact on cardiovascular and musculoskeletal diseases . only recently it has been noted , that exercise also leads to neural alterations that increase brain function and mental health . neurobiological functioning in the human brain seems to depend upon an active or non - active lifestyle . neuronal alterations can be induced lifelong but already in the fetal state movements of the unborn child and the mother can induce growth , development and networking of nerve cells . therefore physical activity seems to be an important stimulus for neural adaptations of the brain in all age groups . the main effects of exercise on brain function are found in an altered blood flow ( which might explain the lower risk of cerebrovascular diseases in an active population ) , reduced risk of neurodegenerative and age - related cognitive deficits [ 3 , 6 , 7 ] as well as improved learning and memory functions . many studies show benefits due to exercise such as reduced age - related neuronal loss and an increase in cell proliferation and neurogenesis , the process by which new neurons are generated . in addition , recent studies have shown that exercise produces antidepressant responses in rodent models and moodelevating actions in humans [ 11 , 12 ] . the antidepressants effects of exercise are of special interest , since major depressive disorder is a life threatening disease accompanied by a high risk of suicide and is a major cause of morbidity worldwide [ 13 - 15 ] . therefore , the aim of this paper is to review the relationship between physical activity and depressive disorders and the potential neurobiological alterations induced by exercise that might lead to the relief of mental disorders like depression . to do so , we searched electronic databases for literature and reviewed articles concerning the latter phenomenon from 1963 until 2009 . since mdd is a major health problem and the effectiveness of current medical antidepressants is only about 65% , the antidepressant actions of exercise are of immense interest . according to the global burden of disease study mild to moderate major depressive disorder ( mdd ) ranks now second behind ischemic heart disease for years of life lost due to early death or disability . mdd is the most prevalent of all psychiatric disorders , affecting up to 25% of women and 12% of men during their lifetimes . according to greden et al . the pan - european study depres showed in 1997 that 13359 out of 78463 adults who participated in screening interviews across six countries in europe suffered from depression . the resulting economic burden is about $ 83.1 billion per year only in the usa . the main symptoms of mdd are depressed mood , anhedonia ( lost of interest or pleasure ) , increased tiredness , irritability , difficulties in concentrating , abnormalities in appetite and sleep and suicidal intentions . depressive symptoms are correlated with the presence of chronic disease , inability to work , increased mortality risk , increased use of medical services , decreased well being and lowered functioning . ten percent of those diagnosed with mdd commit suicide [ 28 , 29 ] , depressed patients tend to develop coronary artery disease and type 2 diabetes . today only 50% of all patients show complete remission , although up to 80% demonstrate partial responses . furthermore , the medications require long - term treatment for weeks to months before a therapeutic response is achieved . therefore , there is an enormous demand for more effective methods to treat depressive disorders . although the prevalence of depression and its impact is high , knowledge about the pathophysiology of mdd is still not completely understood . that is primarily due to difficulties in observing pathological changes within the human brain and that most depressions occur idiopathically . the risk factors of depression are diverse like stressful life events , endocrine abnormalities ( hypothyroidism and hypercortisolism ) , cancers and side effects of drugs [ 22 , 32 , 33 ] . the diagnosis of mdd bases on symptomatic criteria set forth in the diagnostic and statistical manual . it becomes clear from the criteria s that the diagnosis of depression is not based on objective diagnostic tests , but rather on a set of symptoms . it is a syndrome that consists of numerous diseases of different causes and pathophysiologies that makes the diagnosis of mdd subjective and is based on the documentation of certain symptoms over a time of at least two weeks . the diagnostic criterias overlap with other conditions such as anxiety disorders , which have substantial co - morbidity with depression [ 35 , 36 ] . epidemiological studies show that 40%50% of the risk to suffer from depression is genetic [ 37 , 38 ] . despite some promising leads , there are still no confirmed genetic findings for mood disorders . nongenetic factors are as diverse as stress and emotional trauma , viral infections , and even stochastic processes during brain development have been implicated in the etiology of depression [ 38 , 40 ] . depressive syndromes occur in the context of innumerable medical conditions like endocrine disturbances ( hyper- or hypocortisolemia , hyper- or hypothyroidism ) , collagen vascular diseases , parkinson s disease , traumatic head injuries , certain cancers , asthma , diabetes and stroke . several brain regions and circuits that regulate emotion , reward and executive functions are implicated in this disease . dysfunctional changes within the interconnected limbic region have been implicated in depression and also in antidepressant action . a large body of post - mortem and neuroimaging studies of depressed patients have reported reductions in grey - matter volume , glial density in the prefrontal cortex and the hippocampus . these regions are thought to mediate the cognitive aspects of depression , such as feelings of worthlessness and guilt [ 33 , 42 , 43 ] . patients with depression have shown to suffer from statistically significant smaller left hippocampal volume than non - depressive comparison subjects . in this study magnetic resonance imaging ( mri ) was used to measure the volume of the hippocampi in 16 patients with major depression ( 10 men , 6 women ) and 16 case - matched non - depressed controls . patients with a history of post - traumatic stress disorder or current medication use other than antidepressant were excluded from this investigation . the findings of this study showed that the right hemisphere suffered from a reduction of hippocampal volume by 12% but without statistical significance . the left hemisphere showed a significant reduction in volume of the hippocampus by 19% in the depressed patients compared to the matched controls . these results suggest that depression causes loss of brain volume observed in the hippocampi , especially in the left hemisphere . data from epidemiological studies suggests an association between physical inactivity and higher levels of depressive symptoms [ 45 , 46 ] . it has been shown that reduced physical activity leads to increased symptoms of depression in older adults and that depressive symptoms decrease when physical activity is resumed . blumenthal et al . ( 1999 ) could show that the influence of a 16-week exercise training program as a therapeutic treatment of depressive patients is as effective as antidepressive medications . 156 men and women with diagnosed mdd ( 50 years ) were randomly assigned into three groups of interest : ( 1 ) aerobic exercise , ( 2 ) antidepressants ( sertraline hydrochloride ) and ( 3 ) combined exercise and medication group . the subjects attended three supervised exercise sessions per week for 16 consecutive weeks at an intensity of 70% to 85% of heart rate reserve that was calculated from the maximum heart rate . the maximum heart rate was achieved during a treadmill test every participant had to fulfil in advance . each aerobic exercise session began with 10-minutes warm - up exercise , followed by 30 minutes of continuos walking or jogging at the described intensity . the heart rate was monitored and recorded 3 times per session by a trained exercise physiologist via radial pulses . the study could show that 16 weeks of treatment exercise was equally effective in reducing depression among patients with mdd as antidepressants . several meta - analyses [ 49 - 54 ] studied the impact of exercise on depression and all concluded that exercise had positive effects . two studies concluded that more intense exercise led to larger improvements in mood [ 55 , 56 ] . there is evidence that physical activity induces physiological changes in endorphine and monoamine levels , and also reduces the levels of the stress hormone cortisol . recent studies suggested that exercise stimulates the growth of new nerve cells and induces the release of proteins and peptides , which are known to improve health and survival of nerve cells , such as brain - derived neurotrophic factor ( bdnf ) , vascular endothelial growth factor ( vegf ) , insulin - like growth factor ( igf-1 ) and the gene vgf ( nerve growth factor inducible ) [ 58 - 62 ] . even though the effectiveness of exercise in decreasing symptoms of depression has been well established , mead et al . concluded in 2009 , after reviewing articles concerning the influence of exercise on depressive symptoms , that the effect of exercise was not significant . lepore infered that exercise may only be a diversion from negative thoughts and social contacts might influence the positive outcome . especially the determination regarding the optimum type , frequency and duration of exercise is questioned by mead et al . , 2008 . he points out that future research has to consider the design of exercise to determine more specifically what kind of exercise is of benefit and what not , e.g. whether exercise should be performed supervised or unsupervised , indoors or outdoors , or in a group or alone . the monoamine hypothesis of depression , which postulates that depression is caused by decreased monoamine function , especially serotonin ( 5-hydroxytryptamine 5-ht ) and norepinephrine ( ne ) in the brain , originated from early clinical observations [ 41 , 65 ] . today s antidepressant and anxiolytic drugs such as tricyclic antidepressants ( tcas ) , monoamine oxidase inhibitors ( maois ) , serotonin - norepinephrine reuptake inhibitors ( snris ) and selective serotonin reuptake inhibitors ( ssris ) are still designed to increase monoamine transmission acutely . they primarily affect the serotonergic and/or the norepinephrine system , whether by inhibiting the reuptake of serotonin and/or norepinephrine into the presynapse or by inhibiting the activity of monoamine oxidase , thus preventing the breakdown of monoamine neurotransmitters and thereby increasing the availability of serotonin and/or norepinephrine in the synaptic cleft [ 67 , 68 ] . although these monoamine - based agents are potent antidepressants , the cause of depression is far from being due to a simple deficiency of central monoamines . the problem is that the maois and ssris produce immediate increases in monoamine transmission , whereas their mood - enhancing properties require weeks of treatment . because of this delay in time it is thought that the acute increases in the amount of synaptic monoamines induced by antidepressants produce secondary neuroplastic changes that occur over a longer timescale and involve transcriptional and translational changes that mediate molecular and cellular plasticity [ 22 , 65 ] . nevertheless monoamine - based antidepressants remain the first line of therapy for depression , but their long therapeutic delays in time and low remission rates ( about 30% ) have encouraged the search for more effective agents [ 41 , 69 ] . one of the mechanisms through which exercise produces the antidepressant effects might be similar to that of the antidepressant drug treatment since exercise also affects the central serotonergic system . the synthesis of brain 5-ht depends on two main variables , the neuronal concentration of its precursor , tryptophan ( trp ) , and the activity of its rate - limiting enzyme , tryptophan hydroxylase ( tph ; converts tryptophan into 5-hydroxytryptophan ) . acute physical exercise increases blood free tryptophan and decreases albumin bound tryptophan both in animals [ 71 - 73 ] and humans [ 74 - 76 ] by increasing the rate of lipolysis . it was shown in humans that an increase in levels of the serotonin metabolite , 5-hydroxyindoleacetic acid follows physical exercise . since trp is competing with other amino acids like valine , leucine and isoleucine to enter the brain , it has also been demonstrated that exercise decreases the levels of these amino acids leading to higher availability of the serotonin precursor trp in the brain [ 78 - 80 ] . therefore the higher concentrations of trp in blood plasma and also in the cerebrospinal fluid following exercise enhance the serotonin neurotransmission in the brain . other experiments with animals have demonstrated an immediate increase in the activity of brain cells that produce norepinephrine after acute exercise [ 81 - 83 ] . since serotonin - norepinephrine reuptake inhibitors is a common choice of treatment that acts antidepressive by inhibiting the reuptake norepinephrine into the presynapse and thereby increasing the availability of norepinephrine in the synaptic cleft [ 67 , 68 ] , it is noteworthy that the same effects can be achieved by exercise . increased levels of norepinephrine and its metabolites as well as the activation of tyrosine hydroxylase , an enzyme that is involved in the production of norepinephrine is also observed after acute [ 81 - 83 ] and chronic exercise in animals [ 84 - 86 ] . therefore it can be presumed that excercise produces the same mood - elevating effects as antidepressants by altering the availability of norepinephrine . although not as consistent yet nevertheless notable is the effect of exercise on the levels of dopamine as an antidepressant factor . it has been demonstrated that dopamine activity is increased following exercise [ 77 , 87 ] . dopamine seems to play an important role in patients with parkinson s disease but has also been described to correlate to motivational problems and anhedonia seen in patients affected by mdd . a common feature of addictive drugs is that they alter the levels of dopamine in the nucleus accumbens . it has been observed in rodents that running increases levels of dopamine in the nucleus accumbens and that those animals can be trained to lever press for access to running wheels to get their reward . similar behaviour can be observed in humans that train excessively which can result in fatigue and mood disturbances as been reported in overstrained humans . therefore dopamine seems to be of certain relevance why exercise can be addictive and reinforcing , and also why it has its antidepressant effect on humans . as in the case of antidepressants exercise induces higher concentrations of serotonin and/or norepinephrine but this can not explain the observed mood - elevating delay in time . therefore neuroplastic changes that involve transcriptional and translational changes would appear to play a critical role in the treatment of mdd ( see chapter : 1.6 neurotrophic factors and neurogenesis ) . depression is often described as a stress - related disorder , and there is evidence that episodes of depression occur in the context of some form of stress . even though , stress per se is not sufficient to cause depression but early clinical studies identifying reproducible but small increases in serum glucocorticoid concentrations in depression [ 92 , 93 ] led to a significant interest in the role of a dysfunctional hypothalamic physical or psychological stress increases serum glucocorticoid concentrations , and some depression - like symptoms can be produced in rodents by chronic administration of glucocorticoids . high levels of glucocorticoids can reduce hippocampal subgranular zone ( sgz ) proliferation rates and produce atrophic changes in hippocampal subregions . patients with cushing s syndrome , who have extremely high concentrations of circulating cortisol , also show depressive features and atrophic changes in the hippocampus [ 22 , 97 ] . several metabolic abnormalities that are often associated with depression , such as insulin resistance and abdominal obesity , can be at least partly explained by an increase in glucocorticoids [ 32 , 98 ] . hypercortisolaemia in depression is manifested at several levels , including impaired glucocorticoid - receptor - mediated negative feedback , adrenal hyper - responsiveness to circulating adrenocorticotropic hormone ( acth ) and hypersecretion of corticotrophin - releasing factor ( crf ) , the hypothalamic activator of acth release from the pituitary . chronic antidepressant administration has shown to increase the concentration of corticosteroid receptors , which can restore hpa negative feedback and normalize cortisol levels and hpa function . therefore it appears that there is an interrelationship between stress , high glucocorticoid levels and depression . but not only antidepressants , also exercise can induce changes on the functioning of the hpa axis . although acute high intensity physical activity leads to increased levels of stress hormones corticotropin and cortisol , long - term exercise ( meaning that the body adapts to training stimuli ) attenuates the human stress response [ 101 - 103 ] . exercise can be a stressful stimulus itself depending on the intensity and duration of the activity so that stressful stimulations like exercise need to be followed by adaptations of the organism . if the organism becomes adapted to exercise , then the subsequent response of catecholamine release to stressful intensities of exercise is less than that observed in nontrained subjects . after a training program undertaken at moderate intensities for 4 weeks , the organism already reacts with lower concentrations of acth and cortisol to exercise [ 104 , 105 ] . furthermore , the effects of exercise in trained subjects indicate that after ending the exercise , the concentrations of cortisol reach their basic levels faster than in untrained subjects . whether these effects of lower reactivity to stressful exercise events can be related to stressful events in daily life remains unclear . a meta analysis of crew and landers including 34 studies , 92 effect strengths ( es ) , n=1.449 demonstrated a correlation between the level of fitness and reactivity to stressful events ( es=.48 ) this study demonstrated that trained subjects do not react as strongly to stress as untrained subjects exposed to stress . the problem with the latter study was the measured outcome of stress e.g. cardiovascular parameters . in nearly all stress - exercise - related situations , untrained individuals react with higher heart frequencies but data regarding physiological parameters such as noradrenaline , adrenaline or acth levels are generally missing . in many reviews and meta analyses [ 108 - 110 ] that have investigated the correlation between the level of fitness ( by maximal and submaximal exercise tests ) and stressors it was shown that trained subjects exhibit a higher reactivity to stress ( es=.08 , p<.001 ) and recover faster from stress too ( 37 studies , 118 es , n=1.092 ) . most effects were demonstrated in heart frequency , blood pressure , blood flow and vascular resistance . animal studies have indicated that animals that exercised voluntarily show improved stress - coping abilities in physically demanding and psychological challenges . the latter improved stress - coping abilities appeared as adaptive responses of the hpa axis [ 110 - 112 ] , improvements in sleep quality and increased stress resistance of sleep / eeg profiles , and also reduced anxiety - related behaviour in voluntary exercised mice and rats compared to sedentary control animals . decreases in volume observed in the hippocampi and other regions of the forebrain in depressed patients have supported a hypothesis for depression involving decrements in neurotrophic factors [ 115 , 116 ] . neurotrophic factors are known to regulate neural growth and differentiation during development and are also regulators of plasticity and survival of adult neurons and glia . support for the bdnf hypothesis of depression has come from a large preclinical literature showing that stress can reduce bdnf - mediated signalling in the hippocampus , whereas chronic treatment with antidepressants increases bdnf - mediated signalling . similar changes have been observed in the post - mortem hippocampus , as well as in serum bdnf- concentrations of humans with depression . the second support for the theory that neurotrophic factors are of importance in treating depression is based upon the time delay of the mood - elevating effects of antidepressants , which is only seen after prolonged administration ( several weeks to months ) . the cellular effect of antidepressants is the induction of hippocampal neurogenesis - the process by which neural progenitors of the sgz divide mitotically to form new neurons that differentiate and integrate into the dentate gyrus [ 65 , 118 ] . blockade of hippocampal neurogenesis inhibits the therapeutic - like effects of most antidepressant treatments in rodent models . moreover , antidepressant treatment , possibly through the actions of transcription factor camp response element binding protein ( creb ) or other transcriptional regulators [ 15 , 65 ] , increases the amounts of several growth factors in the hippocampus that influence neurogenesis . these include bdnf as well as vegf and the recently discovered neuropeptide vgf , which themselves have antidepressant and pro - neurogenic properties in rodents [ 119 - 121 ] . furthermore , both central and systemic administration of igf-1 increases hippocampal cell proliferation and neurogenesis in the adult rat [ 122 , 123 ] . central administration of igf-1 has shown to produce antidepressant - like effects in the rat forced swim test . this data supports the neurotrophic hypothesis of depression , which means that neuronal adaptations induced by antidepressant drugs are necessary to produce mood - elevation effects . this supports the theory that neurotrophic factors play a key role in the relief of depressive symptoms . like antidepressants , exercise can also increase the synthesis of new neurons in the adult brain and therefore induce mood - elevating effects . van praag et al . ( 1999 ) observed an increase in hippocampal neurogenesis in rats with regular access to a running wheel . recent studies demonstrated that adult neurogenesis can be influenced by stress , ageing , environmental enrichment [ 127 , 128 ] and physical activity [ 9 , 129 ] . kempermann et al . in 1997 showed the positive effects of environmental enrichment on neurogenesis in mice . these mice were also tested in a spatial memory task , the morris water maze , in which the enriched animals learned faster than control animals suggesting the possibility that the new neurons cause enhanced cognition . experiments comparing animals undergoing exercise ( wheel running ) and animals raised in an enriched environment without exercise showed more bromodeoxyuridine ( brdu ; a synthetic nucleoside , used in the detection of proliferating cells)-positive cells in the runners group than in the group that was exposed to enriched environment without exercise . further investigations demonstrated that already 10 days of wheel running increases cell genesis in rodents [ 131 - 133 ] . the increase of hippocampal neurogenesis by running became strongly manifested [ 134 - 139 ] that is also associated with improved hippocampal synaptic plasticity . the mechanisms by which exercise induces neurogenesis is based on the increase of following molecules : bdnf , vegf , igf-1 , the neuropeptide vgf , 5-ht and -endorphins [ 119 , 134 , 141 ] . as already mentioned several days of voluntary wheel running enhance the levels of bdnf mrna in the hippocampus as has been shown in several studies [ 141 - 147 ] . the changes in the mrna were found in neurons of the dentate gyrus ( dg ) , the hilus and the ca3 region of the hippocampus . in addition to the hippocampus , exercise also augmented levels of bdnf mrna in the lumbar spinal cord , the cerebellum and the cortex . other growth factors like nerve growth factor ( ngf ) and it is well known that -endorphins are increased after exercise [ 150 , 151 ] . it has been shown that the infusion of opiates induces an increase in cell proliferation and also that antagonists of the opiate receptor decrease cell proliferation in the dentate gyrus [ 152 , 153 ] . infusion of recombinant protein in mammals to elevate the levels of vegf , a protein secreted from blood that acts on endothelial cells to stimulate the formation of bloodvessels , has been shown to increase cell proliferation in the adult hippocampus and ventricular zone . it was demonstrated that the levels of vegf are also elevated following exercise [ 61 , 155 ] . pointed out in 2003 that vegf is necessary for the effects of running on adult hippocampal neurogenesis whereas peripheral blockade of vegf neutralizes running - induced neurogenesis . another growth factor that is up - regulated in the brain and in the periphery after exercise is the insulin - like growth factor igf-1 . igf-1 , structurally related to pro - insulin , plays an important role in depressive disorders by contributing to neural development through neurogenesis and synaptogenesis , facilitating oligodendrocyte survival and stimulating myelination [ 157 - 159 ] . igf-1 promotes cell proliferation and inhibits cell death during healthy but also during stressed or diseased states . peripheral administration of igf-1 has been shown to induce up - regulation of bdnf mrna levels in the brain . therefore it is suggested that igf-1 initiates growth factor cascades in the brain that can alter mechanisms of plasticity . furthermore , carro et al . could show in three experiments that exercise has neuroprotective effects by its increased passage of circulating igf-1 into the brain since after blocking the passage exercise no longer worked neuroprotective in simulated brain insults in rodents . further evidence comes from fernandez et al . who could show that systemic administration of igf-1 to brain - damaged sedentary mice or rats is sufficient to elicit functional recovery after simulated brain insult in rodents . based on these findings circulating igf - i has a physiological neuroprotective tonic effect on the brain that is depressed in sedentary subjects . hunsberger et al . used a microarray technique to show that exercise upregulates a primary signaling cascade for neurotrophic factors and a peptide precursor , vgf . furthermore , it was demonstrated that vgf induces synaptic plasticity genes that are also altered after exercise ( nrn1 and syn1 ) [ 162 , 163 ] . it is remarkable that exercise regulates so many genes especially in the hippocampus and underscores that exercise can be a potent tool to influence brain metabolic functions . recent research has shown that pro - inflammatory cytokines not only induce " sick symptoms " , but also impinge on physically ill patients by leading to depressive disorders . in approximate 33% of patients who are treated by recombinant human cytokines interleukin-2 ( il-2 ) and interferon- ( ifn- ) major depressive disorder is observed . it has been shown in animal models of inflammation that existing states of decreased reactivity to reward ( anhedonia ) and reduced social exploration can be reversed by antidepressant treatment . sickness is basically an adaptive response to infection . as in the case of depressive disorders , but unlike depression , sickness is completely reversible once the disease - causing agent has been eliminated . van den biggelaar et al . studied 267 people at the age of 85 without any psychiatric history . in this study certain mediators like pro - inflammatory cytokines are produced in an infection that contain interleukin-1 and ( il-1 , il-1 ) , tumor necrosis factor- ( tnf- ) and interleukin-6 ( il-6 ) . these in the periphery produced cytokines also act on the brain causing behavioral symptoms postulated as " sickness behavior " [ 166 , 167 ] . it has been repeatedly observed in patients suffering from major depression that the levels of pro - inflammatory cytokines , acute - phase proteins , chemokines and adhesion molecules are increased [ 168 - 175 ] . the most frequently observed alterations are increased levels of il-6 in the plasma as in the serum and/or elevations of c - reactive protein [ 166 , 168 - 171 ] . further alterations were observed in elevated concentrations of il- - and tnf- in peripheral blood and in the cns of patients suffering from mdd [ 172 , 175 , 176 ] . major depressive disorders caused by immunotherapy in cancer or hepatitis c patients who were receiving immunotherapy supported the theory of cytokine - induced depression first postulated by smith and later by maes . behavioral data in animal studies have indicated a relationship between cytokines and depression . systemic administration of lipopolysaccharide ( lps ) induced the expression of il-1 and other pro - inflammatory cytokine mrnas and proteins in the brain in many studies [ 179 - 182 ] in addition showing that depressive - like behaviour remained after sickness behaviour had already retreated . frenois et al . observed a decrease in the preference for a sucrose solution , a phenomenon that was still apparent when food intake and drinking had already normalized . if the animals received antidepressants before lps - treatment the reduced intake of a sweetened solution was neutralized . another link in favour of relationship between cytokines and depression stems from the fact that immunotherapy reduces the plasma levels of tryptophan which determines the rate of serotonin synthesis in the brain . a key role in the context of inflammation and depressive disorders seems to play il-1- that inhibits the expression of bdnf in the hippocampus of rats after undergoing social isolation . stress - induced neuronal cell loss in animals is also associated with increased levels of tnf- and nf- b ( nuclear factor ' kappa - light - chain - enhancer ' of activated b - cells ) . over - expression of tnf- is observed in decelerated brain growth and neural damage , which is associated with reduced igf-1 activity , in this case especially in the cerebellum . this finding is of great interest since igf-1 can therefore act as an anti - inflammatory cytokine in the brain and can also be induced by exercise . exercise has been shown to influence the immune system and seems to play an important role in the relationship between the immune function and depressive disorders . during exercise , the cascade in cytokine response differs from the " classical " response to infections represented by the onset of circulating il-6 during exercise . epidemiological data suggests a relationship between physical inactivity and low - grade inflammation in healthy subjects [ 190 - 192 ] . could ( 2003 ) show that exercise in the form of 3 hours ergometer cycling can suppress endotoxin - induced tnf- production . exercise works as an anti - inflammatory agent by leading to higher levels of il-6 which is followed by raising il-1ra and il-10 levels and also by suppression of tnf- production as demonstrated in animals and in vitro studies . exercise gives rise to high levels of epinephrine that has also been shown after infusion to inhibit tnf- production in response to endotoxin in vivo . except for strenuous exercise which is mainly pro - inflammatory , the exact dose of exercise that has anti - inflammatory effects has not been clearly established . however , the data suggests that moderate aerobic exercise seems to induce the most promising effects considering the anti - inflammatory and antidepressive outcomes . to summarize the relationship between depressive disorder , cytokines and exercise , epidemiological data shows the correlation between physical inactivity and low - grade inflammation [ 190 - 192 ] . since immunotherapy reduces plasma levels of tryptophan , it is noteworthy that levels of tryptophan can be directly influenced by exercise . as already mentioned acute physical exercise increases blood free tryptophan and in animals [ 71 - 73 ] and humans [ 74 - 76 ] . and also igf-1 , which counteracts the behavioral depressing effects of cytokines , can be influenced by physical activity [ 60 , 156 ] . since mdd is a major health problem and the effectiveness of current medical antidepressants is only about 65% , the antidepressant actions of exercise are of immense interest . according to the global burden of disease study mild to moderate major depressive disorder ( mdd ) ranks now second behind ischemic heart disease for years of life lost due to early death or disability . mdd is the most prevalent of all psychiatric disorders , affecting up to 25% of women and 12% of men during their lifetimes . according to greden et al . the pan - european study depres showed in 1997 that 13359 out of 78463 adults who participated in screening interviews across six countries in europe suffered from depression . the resulting economic burden is about $ 83.1 billion per year only in the usa . the main symptoms of mdd are depressed mood , anhedonia ( lost of interest or pleasure ) , increased tiredness , irritability , difficulties in concentrating , abnormalities in appetite and sleep and suicidal intentions . depressive symptoms are correlated with the presence of chronic disease , inability to work , increased mortality risk , increased use of medical services , decreased well being and lowered functioning . ten percent of those diagnosed with mdd commit suicide [ 28 , 29 ] , depressed patients tend to develop coronary artery disease and type 2 diabetes . only 50% of all patients show complete remission , although up to 80% demonstrate partial responses . furthermore , the medications require long - term treatment for weeks to months before a therapeutic response is achieved . therefore , there is an enormous demand for more effective methods to treat depressive disorders . although the prevalence of depression and its impact is high , knowledge about the pathophysiology of mdd is still not completely understood . that is primarily due to difficulties in observing pathological changes within the human brain and that most depressions occur idiopathically . the risk factors of depression are diverse like stressful life events , endocrine abnormalities ( hypothyroidism and hypercortisolism ) , cancers and side effects of drugs [ 22 , 32 , 33 ] . the diagnosis of mdd bases on symptomatic criteria set forth in the diagnostic and statistical manual . it becomes clear from the criteria s that the diagnosis of depression is not based on objective diagnostic tests , but rather on a set of symptoms . it is a syndrome that consists of numerous diseases of different causes and pathophysiologies that makes the diagnosis of mdd subjective and is based on the documentation of certain symptoms over a time of at least two weeks . the diagnostic criterias overlap with other conditions such as anxiety disorders , which have substantial co - morbidity with depression [ 35 , 36 ] . epidemiological studies show that 40%50% of the risk to suffer from depression is genetic [ 37 , 38 ] . this makes depression a highly hereditary disorder . despite some promising leads , there are still no confirmed genetic findings for mood disorders . nongenetic factors are as diverse as stress and emotional trauma , viral infections , and even stochastic processes during brain development have been implicated in the etiology of depression [ 38 , 40 ] . depressive syndromes occur in the context of innumerable medical conditions like endocrine disturbances ( hyper- or hypocortisolemia , hyper- or hypothyroidism ) , collagen vascular diseases , parkinson s disease , traumatic head injuries , certain cancers , asthma , diabetes and stroke . several brain regions and circuits that regulate emotion , reward and executive functions are implicated in this disease . dysfunctional changes within the interconnected limbic region have been implicated in depression and also in antidepressant action . a large body of post - mortem and neuroimaging studies of depressed patients have reported reductions in grey - matter volume , glial density in the prefrontal cortex and the hippocampus . these regions are thought to mediate the cognitive aspects of depression , such as feelings of worthlessness and guilt [ 33 , 42 , 43 ] . patients with depression have shown to suffer from statistically significant smaller left hippocampal volume than non - depressive comparison subjects . in this study magnetic resonance imaging ( mri ) was used to measure the volume of the hippocampi in 16 patients with major depression ( 10 men , 6 women ) and 16 case - matched non - depressed controls . patients with a history of post - traumatic stress disorder or current medication use other than antidepressant were excluded from this investigation . the findings of this study showed that the right hemisphere suffered from a reduction of hippocampal volume by 12% but without statistical significance . the left hemisphere showed a significant reduction in volume of the hippocampus by 19% in the depressed patients compared to the matched controls . these results suggest that depression causes loss of brain volume observed in the hippocampi , especially in the left hemisphere . data from epidemiological studies suggests an association between physical inactivity and higher levels of depressive symptoms [ 45 , 46 ] . it has been shown that reduced physical activity leads to increased symptoms of depression in older adults and that depressive symptoms decrease when physical activity is resumed . blumenthal et al . ( 1999 ) could show that the influence of a 16-week exercise training program as a therapeutic treatment of depressive patients is as effective as antidepressive medications . 156 men and women with diagnosed mdd ( 50 years ) were randomly assigned into three groups of interest : ( 1 ) aerobic exercise , ( 2 ) antidepressants ( sertraline hydrochloride ) and ( 3 ) combined exercise and medication group . the subjects attended three supervised exercise sessions per week for 16 consecutive weeks at an intensity of 70% to 85% of heart rate reserve that was calculated from the maximum heart rate . the maximum heart rate was achieved during a treadmill test every participant had to fulfil in advance . each aerobic exercise session began with 10-minutes warm - up exercise , followed by 30 minutes of continuos walking or jogging at the described intensity . the heart rate was monitored and recorded 3 times per session by a trained exercise physiologist via radial pulses . the study could show that 16 weeks of treatment exercise was equally effective in reducing depression among patients with mdd as antidepressants . several meta - analyses [ 49 - 54 ] studied the impact of exercise on depression and all concluded that exercise had positive effects . two studies concluded that more intense exercise led to larger improvements in mood [ 55 , 56 ] . there is evidence that physical activity induces physiological changes in endorphine and monoamine levels , and also reduces the levels of the stress hormone cortisol . recent studies suggested that exercise stimulates the growth of new nerve cells and induces the release of proteins and peptides , which are known to improve health and survival of nerve cells , such as brain - derived neurotrophic factor ( bdnf ) , vascular endothelial growth factor ( vegf ) , insulin - like growth factor ( igf-1 ) and the gene vgf ( nerve growth factor inducible ) [ 58 - 62 ] . even though the effectiveness of exercise in decreasing symptoms of depression has been well established , mead et al . concluded in 2009 , after reviewing articles concerning the influence of exercise on depressive symptoms , that the effect of exercise was not significant . lepore infered that exercise may only be a diversion from negative thoughts and social contacts might influence the positive outcome . especially the determination regarding the optimum type , frequency and duration of exercise is questioned by mead et al . , 2008 . he points out that future research has to consider the design of exercise to determine more specifically what kind of exercise is of benefit and what not , e.g. whether exercise should be performed supervised or unsupervised , indoors or outdoors , or in a group or alone . the monoamine hypothesis of depression , which postulates that depression is caused by decreased monoamine function , especially serotonin ( 5-hydroxytryptamine 5-ht ) and norepinephrine ( ne ) in the brain , originated from early clinical observations [ 41 , 65 ] . today s antidepressant and anxiolytic drugs such as tricyclic antidepressants ( tcas ) , monoamine oxidase inhibitors ( maois ) , serotonin - norepinephrine reuptake inhibitors ( snris ) and selective serotonin reuptake inhibitors ( ssris ) are still designed to increase monoamine transmission acutely . they primarily affect the serotonergic and/or the norepinephrine system , whether by inhibiting the reuptake of serotonin and/or norepinephrine into the presynapse or by inhibiting the activity of monoamine oxidase , thus preventing the breakdown of monoamine neurotransmitters and thereby increasing the availability of serotonin and/or norepinephrine in the synaptic cleft [ 67 , 68 ] . although these monoamine - based agents are potent antidepressants , the cause of depression is far from being due to a simple deficiency of central monoamines . the problem is that the maois and ssris produce immediate increases in monoamine transmission , whereas their mood - enhancing properties require weeks of treatment . because of this delay in time it is thought that the acute increases in the amount of synaptic monoamines induced by antidepressants produce secondary neuroplastic changes that occur over a longer timescale and involve transcriptional and translational changes that mediate molecular and cellular plasticity [ 22 , 65 ] . nevertheless monoamine - based antidepressants remain the first line of therapy for depression , but their long therapeutic delays in time and low remission rates ( about 30% ) have encouraged the search for more effective agents [ 41 , 69 ] . one of the mechanisms through which exercise produces the antidepressant effects might be similar to that of the antidepressant drug treatment since exercise also affects the central serotonergic system . the synthesis of brain 5-ht depends on two main variables , the neuronal concentration of its precursor , tryptophan ( trp ) , and the activity of its rate - limiting enzyme , tryptophan hydroxylase ( tph ; converts tryptophan into 5-hydroxytryptophan ) . acute physical exercise increases blood free tryptophan and decreases albumin bound tryptophan both in animals [ 71 - 73 ] and humans [ 74 - 76 ] by increasing the rate of lipolysis . it was shown in humans that an increase in levels of the serotonin metabolite , 5-hydroxyindoleacetic acid follows physical exercise . since trp is competing with other amino acids like valine , leucine and isoleucine to enter the brain , it has also been demonstrated that exercise decreases the levels of these amino acids leading to higher availability of the serotonin precursor trp in the brain [ 78 - 80 ] . therefore the higher concentrations of trp in blood plasma and also in the cerebrospinal fluid following exercise enhance the serotonin neurotransmission in the brain . other experiments with animals have demonstrated an immediate increase in the activity of brain cells that produce norepinephrine after acute exercise [ 81 - 83 ] . since serotonin - norepinephrine reuptake inhibitors is a common choice of treatment that acts antidepressive by inhibiting the reuptake norepinephrine into the presynapse and thereby increasing the availability of norepinephrine in the synaptic cleft [ 67 , 68 ] , it is noteworthy that the same effects can be achieved by exercise . increased levels of norepinephrine and its metabolites as well as the activation of tyrosine hydroxylase , an enzyme that is involved in the production of norepinephrine is also observed after acute [ 81 - 83 ] and chronic exercise in animals [ 84 - 86 ] . therefore it can be presumed that excercise produces the same mood - elevating effects as antidepressants by altering the availability of norepinephrine . although not as consistent yet nevertheless notable is the effect of exercise on the levels of dopamine as an antidepressant factor . it has been demonstrated that dopamine activity is increased following exercise [ 77 , 87 ] . dopamine seems to play an important role in patients with parkinson s disease but has also been described to correlate to motivational problems and anhedonia seen in patients affected by mdd . a common feature of addictive drugs is that they alter the levels of dopamine in the nucleus accumbens . it has been observed in rodents that running increases levels of dopamine in the nucleus accumbens and that those animals can be trained to lever press for access to running wheels to get their reward . similar behaviour can be observed in humans that train excessively which can result in fatigue and mood disturbances as been reported in overstrained humans . therefore dopamine seems to be of certain relevance why exercise can be addictive and reinforcing , and also why it has its antidepressant effect on humans . as in the case of antidepressants exercise induces higher concentrations of serotonin and/or norepinephrine but this can not explain the observed mood - elevating delay in time . therefore neuroplastic changes that involve transcriptional and translational changes would appear to play a critical role in the treatment of mdd ( see chapter : 1.6 neurotrophic factors and neurogenesis ) . depression is often described as a stress - related disorder , and there is evidence that episodes of depression occur in the context of some form of stress . even though , stress per se is not sufficient to cause depression but early clinical studies identifying reproducible but small increases in serum glucocorticoid concentrations in depression [ 92 , 93 ] led to a significant interest in the role of a dysfunctional hypothalamic pituitary adrenal axis ( hpa ) in the pathophysiology of depression . physical or psychological stress increases serum glucocorticoid concentrations , and some depression - like symptoms can be produced in rodents by chronic administration of glucocorticoids . high levels of glucocorticoids can reduce hippocampal subgranular zone ( sgz ) proliferation rates and produce atrophic changes in hippocampal subregions . patients with cushing s syndrome , who have extremely high concentrations of circulating cortisol , also show depressive features and atrophic changes in the hippocampus [ 22 , 97 ] . several metabolic abnormalities that are often associated with depression , such as insulin resistance and abdominal obesity , can be at least partly explained by an increase in glucocorticoids [ 32 , 98 ] . hypercortisolaemia in depression is manifested at several levels , including impaired glucocorticoid - receptor - mediated negative feedback , adrenal hyper - responsiveness to circulating adrenocorticotropic hormone ( acth ) and hypersecretion of corticotrophin - releasing factor ( crf ) , the hypothalamic activator of acth release from the pituitary . chronic antidepressant administration has shown to increase the concentration of corticosteroid receptors , which can restore hpa negative feedback and normalize cortisol levels and hpa function . therefore it appears that there is an interrelationship between stress , high glucocorticoid levels and depression . but not only antidepressants , also exercise can induce changes on the functioning of the hpa axis . although acute high intensity physical activity leads to increased levels of stress hormones corticotropin and cortisol , long - term exercise ( meaning that the body adapts to training stimuli ) attenuates the human stress response [ 101 - 103 ] . exercise can be a stressful stimulus itself depending on the intensity and duration of the activity so that stressful stimulations like exercise need to be followed by adaptations of the organism . if the organism becomes adapted to exercise , then the subsequent response of catecholamine release to stressful intensities of exercise is less than that observed in nontrained subjects . after a training program undertaken at moderate intensities for 4 weeks , the organism already reacts with lower concentrations of acth and cortisol to exercise [ 104 , 105 ] . furthermore , the effects of exercise in trained subjects indicate that after ending the exercise , the concentrations of cortisol reach their basic levels faster than in untrained subjects . whether these effects of lower reactivity to stressful exercise events can be related to stressful events in daily life remains unclear . a meta analysis of crew and landers including 34 studies , 92 effect strengths ( es ) , n=1.449 demonstrated a correlation between the level of fitness and reactivity to stressful events ( es=.48 ) . this study demonstrated that trained subjects do not react as strongly to stress as untrained subjects exposed to stress . the problem with the latter study was the measured outcome of stress e.g. cardiovascular parameters . in nearly all stress - exercise - related situations , untrained individuals react with higher heart frequencies but data regarding physiological parameters such as noradrenaline , adrenaline or acth levels are generally missing . in many reviews and meta analyses [ 108 - 110 ] that have investigated the correlation between the level of fitness ( by maximal and submaximal exercise tests ) and stressors it was shown that trained subjects exhibit a higher reactivity to stress ( es=.08 , p<.001 ) and recover faster from stress too ( 37 studies , 118 es , n=1.092 ) . most effects were demonstrated in heart frequency , blood pressure , blood flow and vascular resistance . animal studies have indicated that animals that exercised voluntarily show improved stress - coping abilities in physically demanding and psychological challenges . the latter improved stress - coping abilities appeared as adaptive responses of the hpa axis [ 110 - 112 ] , improvements in sleep quality and increased stress resistance of sleep / eeg profiles , and also reduced anxiety - related behaviour in voluntary exercised mice and rats compared to sedentary control animals . decreases in volume observed in the hippocampi and other regions of the forebrain in depressed patients have supported a hypothesis for depression involving decrements in neurotrophic factors [ 115 , 116 ] . neurotrophic factors are known to regulate neural growth and differentiation during development and are also regulators of plasticity and survival of adult neurons and glia . support for the bdnf hypothesis of depression has come from a large preclinical literature showing that stress can reduce bdnf - mediated signalling in the hippocampus , whereas chronic treatment with antidepressants increases bdnf - mediated signalling . similar changes have been observed in the post - mortem hippocampus , as well as in serum bdnf- concentrations of humans with depression . the second support for the theory that neurotrophic factors are of importance in treating depression is based upon the time delay of the mood - elevating effects of antidepressants , which is only seen after prolonged administration ( several weeks to months ) . the cellular effect of antidepressants is the induction of hippocampal neurogenesis - the process by which neural progenitors of the sgz divide mitotically to form new neurons that differentiate and integrate into the dentate gyrus [ 65 , 118 ] . blockade of hippocampal neurogenesis inhibits the therapeutic - like effects of most antidepressant treatments in rodent models . moreover , antidepressant treatment , possibly through the actions of transcription factor camp response element binding protein ( creb ) or other transcriptional regulators [ 15 , 65 ] , increases the amounts of several growth factors in the hippocampus that influence neurogenesis . these include bdnf as well as vegf and the recently discovered neuropeptide vgf , which themselves have antidepressant and pro - neurogenic properties in rodents [ 119 - 121 ] . furthermore , both central and systemic administration of igf-1 increases hippocampal cell proliferation and neurogenesis in the adult rat [ 122 , 123 ] . central administration of igf-1 has shown to produce antidepressant - like effects in the rat forced swim test . this data supports the neurotrophic hypothesis of depression , which means that neuronal adaptations induced by antidepressant drugs are necessary to produce mood - elevation effects . this supports the theory that neurotrophic factors play a key role in the relief of depressive symptoms . like antidepressants , exercise can also increase the synthesis of new neurons in the adult brain and therefore induce mood - elevating effects . van praag et al . ( 1999 ) observed an increase in hippocampal neurogenesis in rats with regular access to a running wheel . recent studies demonstrated that adult neurogenesis can be influenced by stress , ageing , environmental enrichment [ 127 , 128 ] and physical activity [ 9 , 129 ] . kempermann et al . in 1997 showed the positive effects of environmental enrichment on neurogenesis in mice . these mice were also tested in a spatial memory task , the morris water maze , in which the enriched animals learned faster than control animals suggesting the possibility that the new neurons cause enhanced cognition . experiments comparing animals undergoing exercise ( wheel running ) and animals raised in an enriched environment without exercise showed more bromodeoxyuridine ( brdu ; a synthetic nucleoside , used in the detection of proliferating cells)-positive cells in the runners group than in the group that was exposed to enriched environment without exercise . further investigations demonstrated that already 10 days of wheel running increases cell genesis in rodents [ 131 - 133 ] . the increase of hippocampal neurogenesis by running became strongly manifested [ 134 - 139 ] that is also associated with improved hippocampal synaptic plasticity . the mechanisms by which exercise induces neurogenesis is based on the increase of following molecules : bdnf , vegf , igf-1 , the neuropeptide vgf , 5-ht and -endorphins [ 119 , 134 , 141 ] . as already mentioned several days of voluntary wheel running enhance the levels of bdnf mrna in the hippocampus as has been shown in several studies [ 141 - 147 ] . the changes in the mrna were found in neurons of the dentate gyrus ( dg ) , the hilus and the ca3 region of the hippocampus . in addition to the hippocampus , exercise also augmented levels of bdnf mrna in the lumbar spinal cord , the cerebellum and the cortex . other growth factors like nerve growth factor ( ngf ) and it is well known that -endorphins are increased after exercise [ 150 , 151 ] . it has been shown that the infusion of opiates induces an increase in cell proliferation and also that antagonists of the opiate receptor decrease cell proliferation in the dentate gyrus [ 152 , 153 ] . infusion of recombinant protein in mammals to elevate the levels of vegf , a protein secreted from blood that acts on endothelial cells to stimulate the formation of bloodvessels , has been shown to increase cell proliferation in the adult hippocampus and ventricular zone . it was demonstrated that the levels of vegf are also elevated following exercise [ 61 , 155 ] . pointed out in 2003 that vegf is necessary for the effects of running on adult hippocampal neurogenesis whereas peripheral blockade of vegf neutralizes running - induced neurogenesis . another growth factor that is up - regulated in the brain and in the periphery after exercise is the insulin - like growth factor igf-1 . igf-1 , structurally related to pro - insulin , plays an important role in depressive disorders by contributing to neural development through neurogenesis and synaptogenesis , facilitating oligodendrocyte survival and stimulating myelination [ 157 - 159 ] . igf-1 promotes cell proliferation and inhibits cell death during healthy but also during stressed or diseased states . peripheral administration of igf-1 has been shown to induce up - regulation of bdnf mrna levels in the brain . therefore it is suggested that igf-1 initiates growth factor cascades in the brain that can alter mechanisms of plasticity . furthermore , carro et al . could show in three experiments that exercise has neuroprotective effects by its increased passage of circulating igf-1 into the brain since after blocking the passage exercise no longer worked neuroprotective in simulated brain insults in rodents . further evidence comes from fernandez et al . who could show that systemic administration of igf-1 to brain - damaged sedentary mice or rats is sufficient to elicit functional recovery after simulated brain insult in rodents . based on these findings circulating igf - i has a physiological neuroprotective tonic effect on the brain that is depressed in sedentary subjects . hunsberger et al . used a microarray technique to show that exercise upregulates a primary signaling cascade for neurotrophic factors and a peptide precursor , vgf . furthermore , it was demonstrated that vgf induces synaptic plasticity genes that are also altered after exercise ( nrn1 and syn1 ) [ 162 , 163 ] . it is remarkable that exercise regulates so many genes especially in the hippocampus and underscores that exercise can be a potent tool to influence brain metabolic functions . recent research has shown that pro - inflammatory cytokines not only induce " sick symptoms " , but also impinge on physically ill patients by leading to depressive disorders . in approximate 33% of patients who are treated by recombinant human cytokines interleukin-2 ( il-2 ) and interferon- ( ifn- ) major depressive disorder is observed . it has been shown in animal models of inflammation that existing states of decreased reactivity to reward ( anhedonia ) and reduced social exploration can be reversed by antidepressant treatment . sickness is basically an adaptive response to infection . as in the case of depressive disorders , but unlike depression , sickness is completely reversible once the disease - causing agent has been eliminated . van den biggelaar et al . studied 267 people at the age of 85 without any psychiatric history . in this study certain mediators like pro - inflammatory cytokines are produced in an infection that contain interleukin-1 and ( il-1 , il-1 ) , tumor necrosis factor- ( tnf- ) and interleukin-6 ( il-6 ) . these in the periphery produced cytokines also act on the brain causing behavioral symptoms postulated as " sickness behavior " [ 166 , 167 ] . it has been repeatedly observed in patients suffering from major depression that the levels of pro - inflammatory cytokines , acute - phase proteins , chemokines and adhesion molecules are increased [ 168 - 175 ] . the most frequently observed alterations are increased levels of il-6 in the plasma as in the serum and/or elevations of c - reactive protein [ 166 , 168 - 171 ] . further alterations were observed in elevated concentrations of il- - and tnf- in peripheral blood and in the cns of patients suffering from mdd [ 172 , 175 , 176 ] . major depressive disorders caused by immunotherapy in cancer or hepatitis c patients who were receiving immunotherapy supported the theory of cytokine - induced depression first postulated by smith and later by maes . behavioral data in animal studies have indicated a relationship between cytokines and depression . systemic administration of lipopolysaccharide ( lps ) induced the expression of il-1 and other pro - inflammatory cytokine mrnas and proteins in the brain in many studies [ 179 - 182 ] in addition showing that depressive - like behaviour remained after sickness behaviour had already retreated . frenois et al . observed a decrease in the preference for a sucrose solution , a phenomenon that was still apparent when food intake and drinking had already normalized . if the animals received antidepressants before lps - treatment the reduced intake of a sweetened solution was neutralized . another link in favour of relationship between cytokines and depression stems from the fact that immunotherapy reduces the plasma levels of tryptophan which determines the rate of serotonin synthesis in the brain . a key role in the context of inflammation and depressive disorders seems to play il-1- that inhibits the expression of bdnf in the hippocampus of rats after undergoing social isolation . stress - induced neuronal cell loss in animals is also associated with increased levels of tnf- and nf- b ( nuclear factor ' kappa - light - chain - enhancer ' of activated b - cells ) . over - expression of tnf- is observed in decelerated brain growth and neural damage , which is associated with reduced igf-1 activity , in this case especially in the cerebellum . this finding is of great interest since igf-1 can therefore act as an anti - inflammatory cytokine in the brain and can also be induced by exercise . exercise has been shown to influence the immune system and seems to play an important role in the relationship between the immune function and depressive disorders . during exercise , the cascade in cytokine response differs from the " classical " response to infections represented by the onset of circulating il-6 during exercise . epidemiological data suggests a relationship between physical inactivity and low - grade inflammation in healthy subjects [ 190 - 192 ] . could ( 2003 ) show that exercise in the form of 3 hours ergometer cycling can suppress endotoxin - induced tnf- production . exercise works as an anti - inflammatory agent by leading to higher levels of il-6 which is followed by raising il-1ra and il-10 levels and also by suppression of tnf- production as demonstrated in animals and in vitro studies . exercise gives rise to high levels of epinephrine that has also been shown after infusion to inhibit tnf- production in response to endotoxin in vivo . except for strenuous exercise which is mainly pro - inflammatory , the exact dose of exercise that has anti - inflammatory effects has not been clearly established . however , the data suggests that moderate aerobic exercise seems to induce the most promising effects considering the anti - inflammatory and antidepressive outcomes . to summarize the relationship between depressive disorder , cytokines and exercise , epidemiological data shows the correlation between physical inactivity and low - grade inflammation [ 190 - 192 ] . since immunotherapy reduces plasma levels of tryptophan , it is noteworthy that levels of tryptophan can be directly influenced by exercise . as already mentioned acute physical exercise increases blood free tryptophan and in animals [ 71 - 73 ] and humans [ 74 - 76 ] . and also igf-1 , which counteracts the behavioral depressing effects of cytokines , can be influenced by physical activity [ 60 , 156 ] . exercise induces physiological changes that make it a potentially powerful agent for use as a therapeutic method of intervention in many health disorders such as diabetes , stroke , certain cancers , coronary heart disease and or obesity . it seems that neurobiological health and functioning depends on the physical activity level of each person s life . the observed behavioural and biological influence of exercise training on depressive disorders suggests that it induces the same neurobiological alterations as antidepressant drug treatment by elevating the levels of serotonine [ 79 , 80 , 197 ] , increasing central norepinephrine neurotransmission [ 81 - 83 ] , altering the hypothalamic adrenocortical system [ 110 - 112 ] and raising -endorphin concentrations [ 150 , 151 ] . furthermore , exercise stimulates the growth of new nerve cells and the induction of the release of proteins and peptides that improve the health and survival of nerve cells like bdnf , vegf , igf-1 and vgf [ 57 , 59 , 60 , 119 , 141 ] . increased inflammatory biomarkers seem to appear before the onset of depression , but the cytokine - response to exercise and its effect on depressive disorders needs to be further investigated . there is no accurate published information concerning dosage , duration , frequency , intensity or type of exercise to be used as an antidepressive treatment . . therefore it would be interesting to answer following questions in the near future : do the behavioural results correlate with the molecular changes in neurotrophic factors or monoamine , cytokine or cortisol alterations ? can there be observed changes in the neuronal morphology , e.g. dendritic atrophy and spine reduction after the induction of depression and their possible modification after an exercise therapy ? what specific role are cytokines playing in depression and are they related to and contribute to positive outcomes when exercise is used as an intervention in depressive disorders ? how should the exercise be designed for it to be useful as an intervention in brain - related disorders like depression ? since mdd is a major health problem and the effectiveness of current antidepressants is limited , the antidepressant actions of exercise are of great interest and could represent more than just an alternative to current treatments . in all , these findings support the theory that brain health is activity dependent and that exercise training should be further promoted as a preventive and rehabilitative strategy to avoid or treat brain - related disorders .

background : the impact of physical activity on brain metabolic functions has been investigated in different studies and there is growing evidence that exercise can be used as a preventive and rehabilitative intervention in the treatment of depressive disorders . however , the exact neuronal mechanisms underlying the latter phenomenon have not been clearly elucidated . the present article summarises key results derived from studies that focussed on the neurobiological impact of exercise on brain metabolic functions associated with depressive disorders . since major depressive disorder ( mdd ) is a life threatening disease it is of great significance to find reliable strategies to prevent or to cure this illness . therefore , the aim of this paper is to review ( 1 ) the physiological relationship between physical activity and depressive disorders and ( 2 ) the potential neurobiological alterations induced by exercise that might lead to the relief of mental disorders like depression . methods : we searched electronic databases for literature concerning the relationship between exercise and depression from 1963 until 2009 . results : the data suggests an association between physical inactivity and higher levels of depressive symptoms . properly designed studies could show that exercise training can be as effective as antidepressive medications.conclusion : the exact mechanisms how exercise affects the brain are not fully understood and the literature lacks of well designed studies concerning the effects of exercise training on depressive disorders . but the observed antidepressant actions of exercise are strong enough that it already can be used as an alternative to current medications in the treatment of depressive disorders .

INTRODUCTION Epidemological Data of Depression Causes of Depression Physical Activity and Depression The Specific Role of Monoamines in Depression The Role of the HypothalamicPituitaryAdrenal Axis in Depression Neurotrophic Factors and Neurogenesis The Relationship Between Depressive Disorders, Cytokines and Exercise CONCLUSION

thalamic infarcts can be responsible for cognitive , emotional and/or behavioral alterations with significant impact on activities of daily life ( roman et al . , 2005 ) . donepezil is a cholinesterase inhibitor currently approved for the treatment of alzheimer s disease that may also provide some benefits in vascular dementia and vascular cognitive impairment ( erkinjuntti et al . , 2004 ) . despite the absence of appropriate evaluation of executive functions in previous vascular dementia trials , the results of a recent placebo - controlled study performed in demented as well as in non - demented cadasil patients strongly support that donepezil may mainly improve executive functions in the presence of subcortical ischemic lesions ( dichgans et al . , 2008 ) . benefits of cholinesterase inhibitors on behavior and cognition have been also reported on other conditions that can affect cholinergic pathways connecting cortical and subcortical structures , such as traumatic brain injury ( tenovuo , 2005 ) . moreover , donepezil has also been suggested for the treatment of depression and apathy , both symptoms being , at least , partially modulated by cholinergic innervations ( whyte et al . , 2008 ) . all these conditions affect cholinergic nuclei like the basal forebrain , thalamus , and their innervations to the cerebral cortex ( tenovuo , 2005 ) . these findings are consistent with neuro - anatomical evidence and clinical trials suggesting that cholinergic pathways are involved in cognition and neuropsychiatric symptoms , especially apathy ( selden et al . , 1998 ; reynolds et al . , 2011 ) . damage to the frontal cortex and to the subcortical related structures are presumably responsible for the cognitive and behavioral symptoms gathered into the so - called dysexecutive syndrome ( ds ; chaytor and schmitter - edgecombe , 2007 ) . the ds can be analyzed according to its cognitive and behavioral components using dedicated tests ( chaytor and schmitter - edgecombe , 2007 ) . structured and reliable questionnaires have also been recently developed to assess the manifestations of ds in daily life since there is only a weak relationship between the results of neuropsychological testing and the daily life consequences of this syndrome . this discrepancy is presumably related to the lack of behavioral evaluation in the neuropsychological testing ( chaytor and schmitter - edgecombe , 2007 ) . the dysexecutive questionnaire ( dex ) is a 20-item questionnaire that uses a 5-point likert scale to assess the dysexecutive symptoms . the dex scores range from 0 to 80 points , with higher scores reflecting higher difficulties in daily life . the dex questionnaire belongs to the behavioral assessment of ds , battery and describes with fair confidence the non - routine everyday problems arising from executive dysfunction ( wilson et al . , 1998 ) . we report a single - case with a left thalamic infarction and behavioral disturbances that was treated with donepezil for 6 months using a open label study with an off - on - off design . as an effect of the treatment l.g . was a 45-year - old male , right - handed , with no history of neurological or psychiatric disease . he presented an amnesic syndrome and behavioral disturbances of sudden onset in the absence of focal signs at neurological examination . these clinical manifestations occurred with an isolated infarction located on magnetic resonance imaging ( mri ) in the ventrolateral and ventroanterior nucleus of the left thalamus ( figure 1 ) . since this event , the patient was unable to resume his previous work and only sustained temporary jobs . the patient and his wife complained about memory disturbances and inability to carry on his job . t2 dwi axial ( left ) and coronal ( right ) views of the patient showing left thalamic infarction in the anterior nuclei , ventral lateral nuclei and anterior part of the median dorsal nuclei . both the patient and his wife confirmed that there was no significant change in his cognitive functioning over the two previous years . the global cognitive performances were assessed using the mini - mental state examination ( mmse ; folstein et al . , 1975 ) , the working memory using the digit span and the verbal learning capabilities using the free and cued selective reminding test ( fcsrt ; grober et al . , 2008 ) . the examination of executive functions was carried out using the frontal assessment at bedside ( dubois et al . , 2000 ) , the category and literal verbal fluency tests and the modified version of wisconsin card sorting test ( mwcst ; van den broek et al . , 1993 ) . the everyday memory difficulties were evaluated using the mac nair s cognitive difficulties scale , which was applied to both the patient and his wife ( derouesne et al . , 1993 ) . the latter was also questioned using the neuropsychiatric inventory ( npi ) and the alzheimer s disease cooperative study - activities of daily living inventory ( adcs - adl ; cummings et al . , 1994 ; galasko et al . , 1997 finally , the dysexecutive behavior in everyday life was assessed using the dex questionnaire applied to the patient s wife ( wilson et al . , 1998 ) . the neuropsychological evaluation revealed a reduced global cognitive capacity , impairment in episodic memory and a ds with a reduced verbal fluency and cognitive flexibility associated with impaired conceptualization ( table 1 ) . patient scores in cognitive battery and behavioral questionnaires for baseline , 3 and 6 months of treatment and 3 months after treatment discontinuation . higher score indicates more severe impairment ; * * adcs - adl , alzheimer s disease cooperative study - activities of daily living inventory . we then proposed to the patient an open crossover study using donepezil to assess whether this treatment could actually modify his cognitive status . an informed consent was obtained from the patient and from his wife for the trial . the drug was administered daily for 6 months ( donepezil 5 mg / daily during the first month , and 10 mg / daily during the next 5 months ) . the patient was assessed at baseline before treatment and at 3 and 6 months under treatment using the same neuropsychological tests . a final evaluation was carried out 3 months after discontinuation of the drug ( table 1 ) . the questionnaires were applied to the patient and to his wife during the same visits . no significant change was detected on the performances of the different neuropsychological tests including those sensitive to executive dysfunction such as the frontal assessment at bedside , the fcsrt and the mwcst . in contrast , significant changes were detected by the patient and his wife in the behavioral outcomes assessed by the dex questionnaire and by the npi severity and stress scores . the dex scores improved during the treatment relative to baseline and worsened after donepezil discontinuation . total dex scores were 42 , 27 , and 17 points at baseline , 3 and 6 months of treatment , respectively . subsequently , symptoms were increased when medication was discontinued ( total dex score : 35 ) . this was observed for apathy on both severity and stress sub - scores ( see figure 2 ; table 1 ) . performance is improved along treatment ; however it is worsened when drug intake is discontinued . the patient s wife particularly reported that under the treatment , the patient was much less apathetic , was more attentive , had more initiative , and returned to working activities ( he was employed as gained employment as an auto repair center manager while under donepezil ) . the cognitive and behavioral disturbances in the present observation have been repeatedly reported in association with thalamic infarctions . verbal amnesia has been particularly associated with lesions involving the anterior nucleus and mamillo - thalamic tract of the left thalamus , dysexecutive symptoms with thalamic lesions involving the mediodorsal nucleus and/or internal medullary lamina and apathy with lesions in the anterior thalamic nucleus ( van der werf et al . , 2003 ; carrera and bogousslavsky , 2006 ) . in this open label study , donepezil seems to have some ability to modulate persisting behavioral manifestations at the late stage of an isolated left - sided thalamic infarction . measurable effects were detected under the treatment period using the dex questionnaire and the apathy sub - scores of the npi while no significant changes in the other neuropsychological tests were detected . these behavioral changes were also detected in the absence of significant modifications of the mmse score and of episodic memory performances in line with the poor effects of donepezil on global cognitive or memory performances in previous vascular dementia trials ( erkinjuntti et al . , 2004 ; roman et al . , 2005 ; dichgans et al . , 2008 ) . in this study , not only the npi , that is largely used for the assessment of behavioral alterations , but also the dex questionnaire was applied to assess the possible changes under donepezil . the dex questionnaire provides a number of advantages over the clinical measures of executive functions . it is not limited to the evaluation of the cognitive aspects of the ds but it also includes the evaluation of its emotional , motivational , and behavioral components . the questionnaire is easy to administer and includes a self - reported as well as an informant - reported part specifically designed to assess the participant s behavior in daily life . its psychometric properties on ecological and discriminative validity have been already documented ( wilson et al . , 1998 ) . this single - case study is a limited , preliminary clinical experience of the use of donepezil in behavioral disturbances associated with an isolated thalamic infarction . some fluctuations of the data obtained using questionnaires , placebo effects related to the intake of a new drug in an isolated case or multiple biases related to the non - blinded treatment may cause that the improvement of behavior under treatment is only detected by chance in this observation . in contrast , the importance of the effect with actual consequences in daily life , the variations of the dex scores much larger than those reported after its repeated administration ( shinagawa et al . , 2007 ) , the congruence of the observed effects in the present case with data on cholinesterase inhibitors in the literature , and its partial reversibility support that donepezil was actually efficient and may have real effects on behavior and mainly on apathy after isolated thalamic lesions ( erkinjuntti et al . in conclusion , the capacity of donepezil to modulate some behavioral consequences of subcortical lesions , particularly those related to thalamic lesions , as suggested by this observation , needs further research . although little is known about cholinesterase inhibitors in vascular dementia and being this is a single - case study , our results encourage research in groups of patients . the present data suggests that future studies should not only focus on the cognitive effects of cholinesterase inhibitors but also on its behavioral effects , especially in daily life , using new and dedicated tools for this purpose .

objective : to examine the effect of donepezil for the treatment of cognitive and behavioral disorders associated with thalamic lesions in a 45-year - old male who suffered an infarct in the left thalamus . background : recent studies suggest that donepezil may improve executive functions impairments due to subcortical ischemic lesions . method : the effects of donepezil were analyzed in a single - case of thalamic infarction with cognitive and behavioral alterations in an open label study . results : significant behavioral modifications related to improved performances in executive functions were observed with the treatment . conclusion : the results suggest that donepezil may have significant effect on executive functions that can alter behavioral outcomes after thalamic infarctions .

Introduction Case Report Discussion

drug reaction with eosinophilia and systemic symptom ( dress ) is a severe adverse drug - induced reaction with an annual incidence of 1 in 1000 to 1 in 10,000 drug exposures . although antiepileptics are the major culprit drugs , a variety of other pharmacological agents cause dress . we here report a case of levetiracetam induced dress that has rarely been reported in the literature previously . a 40-year - old male presented to our emergency department with acute subdural hematoma secondary to a road traffic accident . the patient was managed conservatively . however during hospital stay patient developed a generalized tonic - clonic seizure . stay , his counts became normal , and his general condition improved . in view of the history of seizure , patient was switched over to levetiracetam and advised close follow - up after discharge . patient , however , returned after 1 week with high - grade fever ( 103104 f ] and rash . rash was itchy and erythematous and started from the chest and progressed to involve other body parts . on examination , the patient was conscious and oriented . generalized erythematous maculopapular rash seen predominantly on the face , chest , trunk , back , upper limbs , and the proximal portion of lower limbs was present [ figures 14 ] . the investigation revealed transaminitis [ table 1 ] . in view of fever , rash , transaminitis and exposure to levetiracetam , the patient was diagnosed as a case of levetiracetam induced dress . the patient was managed with antihistaminics and dexamethasone 4 mg tid for 2 weeks followed by a taper . the patient became afebrile on day 4 of admission and transaminitis started resolving on day 4 . the patient was seizure free and was discharged after 6 days of hospital stay . on follow - up , the patient is doing well and seizure free . transaminitis has resolved , and the rash has subsided [ figures 5 and 6 ] . dress syndrome was first described in 1959 associated with phenytoin and was previously referred to as drug - induced pseudolymphoma . the term dress syndrome was proposed by bocquet et al . , describing it as a potentially life - threatening syndrome . the syndrome is characterized by severe skin eruption , fever , hematologic abnormalities ( eosinophilia or atypical lymphocytes ) and internal organ involvement . although most commonly associated with antiepileptic drugs like phenytoin , dress syndrome has also been reported after exposure to a large number of medications including oxcarbazepine , vancomycin , doxycycline , linezolid , nitrofurantoin , atorvastatin , and esomeprazole . different mechanisms have been implicated in its development that include slow acetylation and detoxification defects leading to reactive metabolite formation and subsequent immunological reactions . reactivation of human herpes , including epstein barr virus and human herpes virus ( hhv)-6 and 7 has also been implicated . laboratory tests that will help to differentiate dress syndrome from other severe drug reactions and to identify internal organ involvement include complete blood cell count , liver function tests , serum creatinine level and urinalysis . skin biopsy shows a nonspecific lymphocytic infiltrate of the papillary dermis , which may contain eosinophils and which is generally denser than in other drug reactions . a scoring system [ regiscar scoring , table 2 ] has been devised that helps clinicians to make a diagnosis of dress in a suspected case . regiscar scoring for drug reaction with eosinophilia and systemic symptom syndrome prompt treatment is important for speedy recovery . the offending drug should be discontinued and pharmacological treatment instituted . the french society of dermatology recommends systemic corticosteroids at a dose equivalent to 1 mg / kg / day of prednisone in patients with any sign of severity that include transaminitis , renal involvement , pneumonia , and cardiac involvement . they further recommend the use of intravenous immunoglobulin at a dose of 2 g / kg over 5 days for a patient with life - threatening signs such as renal failure and respiratory failure . in addition , they also propose the use of steroids in combination with ganciclovir in patients with signs of severity and confirmation of a major viral reactivation of hhv-6 . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . drug reaction with eosinophilia and systemic symptom ( dress ) is a very rare but possible side effect of levetiracetam and should be borne in mind if a patient on levetiracetam develops a skin rashthe outcome is good if dress is recognized early and appropriate treatment instituted . drug reaction with eosinophilia and systemic symptom ( dress ) is a very rare but possible side effect of levetiracetam and should be borne in mind if a patient on levetiracetam develops a skin rash the outcome is good if dress is recognized early and appropriate treatment instituted . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . drug reaction with eosinophilia and systemic symptom ( dress ) is a very rare but possible side effect of levetiracetam and should be borne in mind if a patient on levetiracetam develops a skin rashthe outcome is good if dress is recognized early and appropriate treatment instituted . drug reaction with eosinophilia and systemic symptom ( dress ) is a very rare but possible side effect of levetiracetam and should be borne in mind if a patient on levetiracetam develops a skin rash the outcome is good if dress is recognized early and appropriate treatment instituted . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . drug reaction with eosinophilia and systemic symptom ( dress ) is a very rare but possible side effect of levetiracetam and should be borne in mind if a patient on levetiracetam develops a skin rashthe outcome is good if dress is recognized early and appropriate treatment instituted . drug reaction with eosinophilia and systemic symptom ( dress ) is a very rare but possible side effect of levetiracetam and should be borne in mind if a patient on levetiracetam develops a skin rash the outcome is good if dress is recognized early and appropriate treatment instituted .

drug reaction with eosinophilia and systemic symptom syndrome ( dress ) is a hypersensitivity drug reaction , most frequently associated with antiepileptic drugs , characterized by skin rash , fever , pharyngitis , lymphadenopathy , and visceral organ involvement , typically presenting within 8 weeks of initiation of therapy . management involves prompt withdrawal of the offending drug and use of systemic corticosteroids . we here present a rare case of dress secondary to levetiracetam . only few case reports of dress secondary to levetiracetam have been published so far .

Introduction Case Report Discussion Conclusion None Declaration of patient consent Financial support and sponsorship Conflicts of interest

it is one of the most common of all diseases and a major cause of loss of teeth . it has been deep rooted and rising oral health problem among children in the world . caries at a younger age group leads to several morbid conditions of the oral cavity and also other systems of the human body . various general health conditions do have oral manifestations , which in turn increase the risk of oral diseases , for example , diabetes mellitus , cardiovascular diseases etc . , the initiation of dental caries depends on oral hygiene practices , age , sex , socioeconomic profile , lifestyle , geographic location , race , food habits and also the distribution varies within the oral cavity . dental caries affects 60 - 90% of children and the vast majority of adults . the world health organization ( who ) suggests five selected age groups for the basic oral health surveys , ( i.e. , 5 years , 12 years , 17 - 18 years , 35 - 44 years and 65 - 74 years ) to assess the severity of the problem , plan intervention activities . in spite of the success achieved by focusing on the oral health history states that caries and periodontal diseases are a major component of the global disease burden . therefore , keeping in mind the limitation of literature on these issues , the current study was undertaken to obtain information on the oral health requirements of the 5 years old school children attending kgf dental college and hospital , karnataka . this baseline data helps to plan preventive measures , restorative care and recall of the population . as oral health is an integral part of general health focusing on better oral health at a younger age group will have a good impact on their future general health too . professional care and individual motivation , health education can help overcome these diseases and strive toward a better oral health . the study design was a cross - sectional study carried out on children below 5 years attending kgf dental college and hospital , karnataka . a pilot study was conducted among 50 children initially to assess the validity and reliability of the proforma and study design . children above 5 years were not consideredchildren with congenital and systemic illnesschildren who visited the hospital for emergency treatment . children above 5 years were not considered children with congenital and systemic illness children who visited the hospital for emergency treatment . the clinical examination was performed by single investigator under head lamp illumination using probe and mouth mirror . intra - examiner reliability was assessed by a repeat examination of 15 children selected by a pedodontist during the pre - test at the institution . assistance was obtained from their parents and guardians for handling the child during examination among unco - operative , children below 3 years . the study population were examined and dental caries were registered using who 1997 proforma . the questionnaires and data forms were assessed for quality and consistency . the data were computerized and analyzed applying the statistical package for the social sciences program . children above 5 years were not consideredchildren with congenital and systemic illnesschildren who visited the hospital for emergency treatment . children above 5 years were not considered children with congenital and systemic illness children who visited the hospital for emergency treatment . the clinical examination was performed by single investigator under head lamp illumination using probe and mouth mirror . intra - examiner reliability was assessed by a repeat examination of 15 children selected by a pedodontist during the pre - test at the institution . assistance was obtained from their parents and guardians for handling the child during examination among unco - operative , children below 3 years . the study population were examined and dental caries were registered using who 1997 proforma . the questionnaires and data forms were assessed for quality and consistency . the data were computerized and analyzed applying the statistical package for the social sciences program . out of 672 children examined under this study , 352 were boys and remaining 320 were girls . on the whole distribution in relation to sex shows that caries experience was higher in boys ( 47.44% ) than in girls ( 40.94% ) . prevalence of dental caries among study population caries was present in 26.64% of the maxillary arches and 36.76% of the mandibular arches . among boys , the mandibular arch had an increase in caries level ( 38.64% ) than the maxillary arch ( 30.97% ) and the difference was significant statistically ( p < 0.05% ) . similarly among girls , the mandibular arch depicts more caries prevalence ( 34.69% ) than the maxillary arch ( 21.88% ) and the difference was statistically significant ( p < 0.01 ) [ table 2 ] . distribution of dental caries in relation to dental arch boys had caries prevalence of 40.34% and 40.91% on the right and left sides respectively . whereas girls had caries of about 34.38% and 35.63% on the right and left sides respectively . dental caries prevalence on right and left side of oral cavity caries distribution of anterior and posterior teeth among both the sexes depicts that caries had an increase pattern in the posterior segment than the anterior segment . when the caries prevalence of the anterior teeth was compared among the sexes , boys showed more caries prevalence than girls with a statistically significant difference ( p < 0.01 ) [ table 4 ] . prevalence of dental caries in relation to type of teeth and sex comparison of caries between the arches caries occurred more frequently in the posterior teeth . comparison of caries between the arches in the anterior segment depicts that caries was more in the maxillary arch and the difference was significant statistically ( p < 0.01 ) . on the other hand , in the posteriors , caries was more in the mandibular arch . in the present study , the total number of boys is slightly higher than the total number of girls ( 52.38% and 47.62% respectively ) . out of which , caries was significantly more prevalent in boys than in girls . on the other hand , the opposite scenario was shown by ullah et al . where the age of the children included in the study was 12 years . inter arch comparison depicts that caries was on the rise in mandibular arch and in both the sexes it was statistically significant . caries prevalence in relation to right and left halves of the oral cavity , depicts that dental caries occurs predominantly as a bilateral phenomenon . the present study showed that the second primary molar is the tooth with highest caries experience which erupts at a later date . furthermore , they are positioned posteriorly compared to other teeth , making it difficult in brushing accessibility for the young children and their parents . in the present study , nursing caries was seen in maxillary primary incisors , maxillary and mandibular primary molars , but mandibular deciduous incisors are almost healthy . the lower incisors are protected by the tongue and the opening of major salivary ducts but upper molar teeth is not protected by the opening of parotid glands . mandibular molars , maxillary anterior were most affected compared with the mandibular anterior teeth which was least affected . it is high time to create awareness and focus on the preventive measures in this location . untreated caries indicates subsequent steps towards preventive and restorative care should be initiated . in order to reduce the caries prevalence , there is a need for continuous monitoring and health education to the children and parents , guardians .

context : in the current scenario of developing countries , dental caries has been a long - standing challenge in the oral health issue and still on the rise.aim:the aim of the following study is to estimate the caries prevalence in the primary dentition among children below 5 years of age.meterials and methods : study population included both boys and girls below 5 years old attending kgf dental college and hospital , karnataka . a simple random sampling method was used . a total of 672 children were examined under headlamp illumination using mouth mirror and probe according to world health organization ( who ) criteria . a questionnaire was used to elicit information from the attendants regarding general health , intra oral examination and caries experience was recorded using who 1997 proforma . the data were computerized and analyzed applying the statistical package for the social sciences program.results:prevalence of dental caries was 44.34% . caries prevalence was higher in the boys than the girls and it was statistically significant ( p < 0.05 ) . it was also found that primary second molars were the highest carious tooth.conclusion:the prevalence of dental caries was high among children below 5 years old . the present study was undertaken to obtain baseline data for planning preventive programs . untreated caries indicates subsequent steps toward preventive and restorative care should be initiated . in order to reduce the caries prevalence , there is a need for continuous monitoring and health education to the children and parents , guardians .

INTRODUCTION MATERIALS AND METHODS Inclusion criteria Exclusion criteria RESULTS DISCUSSION CONCLUSION

the check of pulmonary function is used to estimate an individual s fitness and athletes performance1 , 2 . spirometry is a generally used method for evaluating pulmonary function in the same way that blood pressure provides important information about general cardiovascular health1,2,3 . meanwhile , sports injury of the chest is closely related to maintenance of athletes performance and health1 , 4 . in particular , chest injuries such as rib stress fracture and thoracic chance fracture are directly or indirectly associated with swimmer , rodeo athlete , wrestler , and rower5,6,7,8 . therefore , respiratory physiotherapy is an important method in patients with respiratory dysfunction by sports injury1 , 2 . regular exercise may increase the strength and endurance of breathing and blood circulation11 . respiratory rehabilitation from exercise training , along with a wide range of education and behavior change interventions , can be used to improve the physical and mental state of the people . on the other hand , respiratory function can be damaged when the strength of respiratory muscles decreases with comorbidity and loss of mobility14 . taekwondo is devised to improve the quality of spirit and life through the training of body and mind . the poomsae is the style of conduct that expresses mental and physical refinements directly or indirectly , as well as the principles of offense and defense resulting from the cultivation of the taekwondo spirit and techniques16 . the poomsae is a series of movements for offense and defense techniques that can be practiced and trained , even without the presence of an instructor , in accordance with fixed patterns . taekwondo combines agility , strength , speed , balance , flexibility , coordination , and stamina , which are all important attributes required for a taekwondo athlete to be able to execute the highly demanding kicking combinations17 , 18 . although a measure of the respiratory of taekwondo was performed in the previous study , there was no respirogram analysis . therefore , the purpose of the present study is to analyze and compare the respiratory function of taekwondo poomsae athletes and nonathletes . the present study consisted of thirteen taekwondo poomsae athletes and ninety - five nonathletes . one hundred and eight volunteers who had no abnormal physical or psychological conditions provided written informed consent to participation in this study1 . participants were asked to complete a questionnaire via individual in - depth interviews , which took 30 minutes per person1 , 2 . the criteria for the inclusion of participants in the study were as follows : ( 1 ) 1922 years of age , ( 2 ) male , ( 3 ) history of respiratory disease , ( 4 ) experience of stress during exercise , ( 5 ) psychological factors , ( 6 ) history of injuries , and ( 7 ) primary technology used . before measurement , all participants rested for 30 minutes1 , 2 , 4 . we measured chest and abdominal circumference at rest , inspiratory , and expiratory conditions . chest circumference was measured from axillary height , and abdominal circumference was measured from navel height . thigh circumference was measured at 1/3 the height below the straight line that connects the patella center from anterior superior iliac spine ( asis ) , the calf circumference was measured at 1/3 the height above and below the straight line connecting the lateral malleolus at the fibular head1 . spirometric parameters , including forced vital capacity ( fvc ) , forced expiratory volume in 1 second ( fev1 ) , fev1/fvc , peak expiratory flow ( pef ) , peak inspiratory flow ( pif ) , slow vital capacity ( svc ) , inspiratory reserve volume ( irv ) , expiratory reserve volume ( erv ) , tidal volume ( tv ) , maximum voluntary ventilation ( mvv ) , minute or expired ventilation ( mv ) , and respiratory rate ( rr ) were recorded and analyzed by methods of resting breathing and forced breathing . measurement was focused on the fvc graph , which was divided into the expiratory area ( exa ) and the inspiratory area ( insa)1,2,3 . analogously , the insa was divided into c and d sections based on the pif . each a , b , c , and d section was further subdivided to four areas ( fig . 1.differences in fvc and respirogram phase between the tkdp athletes and nonathletes . area and slope of the fvc and respiratory parameters were determined , as described in the subjects and methods section . fvc : forced vital capacity ; as13 : first , second , and third slopes of the a area ; bs13 : first , second , and third slopes of the b area ; cs13 : first , second , and third slopes of the c area ; ds13 : first , second , and third slopes of the d area ; exa : expiratory area ; insa : inspiratory area ; tkdp athletes : taekwondo poomsae athletes ) . from left to right , the connections between each of the divided points of the a area were designated as the first slope ( as1 ) , the second slope ( as2 ) , and the third slope ( as3 ) . correspondingly , from left to right , the first , second , and third slopes defining the b area were designated bs1 , bs2 , and bs3 , respectively ; the first , second , and third slopes defining the c area were designated cs1 , cs2 , and cs3 , respectively ; and the first , second , and third slopes defining the d area were designated ds1 , ds2 , and ds3 , respectively ( fig . 1a)1,2,3 . after creating these subdivisions , the tangent and angle of each point were measured . the angle of each point and the respiratory area of the fvc were each measured in triplicate at each measurement time , and the mean values were calculated1 , 2 . the significance level was set to =0.05 , and all data are presented as the mean standard error ( se ) of the measurements . the protocol for this study was approved by the committee of ethics in research of yongin university in accordance with the terms of resolution 5 - 1 - 20 . differences in fvc and respirogram phase between the tkdp athletes and nonathletes . area and slope of the fvc and respiratory parameters were determined , as described in the subjects and methods section . fvc : forced vital capacity ; as13 : first , second , and third slopes of the a area ; bs13 : first , second , and third slopes of the b area ; cs13 : first , second , and third slopes of the c area ; ds13 : first , second , and third slopes of the d area ; exa : expiratory area ; insa : inspiratory area ; tkdp athletes : taekwondo poomsae athletes table 1table 1.general characteristics of the participantsnonathletestkdp athletesage ( yrs)24.9 2.820.6 0.9height ( cm)/weight ( kg)174.1 4.7/75.9 10.1171.9 5.5/65.5 7.4bmi ( kg / m)24.9 2.822.2 1.9career ( yrs)-9.5 3.0training frequency-1/day ( 5/week)training time-1.8 0.2 h / day ( 9.0 1.0 h / week)aerobic exercise-1.0 0.1 h / day ( 5.0 0.5 h / week)anaerobic exercise-0.6 0.1 h / day ( 3.0 0.5 h / week)ches cir ( cm)rest96.1 6.392.9 5.1exp / insp94.0 6.5/100.3 6.191.4 5.0/97.7 5.4der / dir1.6 1.4/3.3 2.21.6 1.4/4.7 1.2abd cir ( cm)rest86.8 7.580.3 5.5exp / insp84.5 8.0/89.4 7.975.8 5.6/82.6 5.8der / dir2.1 2.0/2.2 1.84.6 2.1/2.3 2.4/53.9 2.4calf cir ( cm)above 1/3 rt / lt39.5 1.2/39.8 1.339.0 1.6/38.7 1.9below 1/3 rt / lt25.9 1.8/26.1 1.524.0 1.8/523.5 tkdp athletes : taekwondo poomsae athletes ; bmi : body mass index ; ches cir : chest circumference ; abd cir : abdominal circumference ; thigh cir : thigh circumference ; calf cir : calf circumference ; exp : expiration ; insp : inspiration ; der : differences between expiration and rest ; dir : differences between inspiration and rest ; rt : right ; lt : left . * significantly different from nonathletes , p<0.05 shows the general characteristics of the taekwondo poomsae athletes compared with those of the nonathletes . chest , abdominal , thigh , and calf circumferences in nonathletes and tkdp athletes were compared . all measured values for nonathletes were larger , most significantly in the case of abdominal circumference ( table 1 ) . spirometry parameters in the tkdp athletes group were higher than in the nonathletes ( table 2table 2.differences in respiratory function between the nonathletes and tkdp athletesvariablenonathletestkdp athletesfvc ( l)4.9 0.54.6 0.6fev1.0 ( l)4.1 0.44.1 0.5fev1.0/fvc ( % ) 84.1 6.189.7 6.5pef ( l / s)/pif ( l / s)9.2 1.4/6.4 1.210.1 1.1/7.9 1.6svc ( l)4.8 0.64.7 0.6erv ( l)/irv ( l)1.5 0.4/2.4 0.61.5 0.4/2.3 0.6tv ( l)0.7 0.31.0 0.5mvv ( l / min)161.5 30.5168.8 28.7rr ( l / min)/tv ( l / min)94.5 17.9/1.7 0.4120.9 18.2/1.4 0.3mv ( l / min)12.8 6.017.8 7.5rr ( l / min)/tv ( l / min)27.1 6.8/0.5 0.324.2 5.7/0.7 tkdp athletes : taekwondo poomsae athletes ; fvc : forced vital capacity ; fev1.0 : forced expiratory volume in one second ; fev1.0/fvc : fev1.0/fvc ratio , pef : peak expiratory flow ; pif : peak inspiratory flow ; svc : slow vital capacity ; irv : inspiratory reserve volume ; erv : expiratory reserve volume ; tv : tidal volume ; mvv : maximum voluntary ventilation ; mv : minute ventilation ; rr : respiratory rate . * significantly different from nonathletes , p<0.05 ) . in particular , the fev1.0/fvc ratio showed significant differences between the two groups of participants ( table 2 ) . in respirogram phasic analysis , the inspiratory area of forced vital capacity were significantly increased in the tkdp athletes compared with the nonathletes ( fig . 1b , table 3table 3.differences in respirogram phases of forced vital capacity between the nonathletes and tkdp athletesvariablenonathletestkdp athletesafvcexa22,309.6 4,630.220,017.8 4,096.8insa23,728.6 6,598.025,184.5 3,470.4total46,038.3 9,559.745,202.3 5,958.4sfvcas1/as2/as310.3 3.1/5.6 2.4/1.9 1.012.4 2.8/7.7 1.5/2.7 1.6bs1/bs2/bs31.4 0.8/1.4 0.6/1.4 0.51.5 0.7/1.4 0.5/1.2 0.3cs1/cs2/cs32.7 1.7/0.5 4.4/0.5 0.43.5 3.0/1.3 1.1/0.7 0.5ds1/ds2/ds30.3 0.3/0.7 0.5/1.7 1.10.4 0.5/0.9 0.5/2.5 0.8all data are presented as the mean se . tkdp athletes , taekwondo poomsae athletes ; afvc : area of forced vital capacity ; exa : expiratory area ; insa : inspiratory area ; total , total area ; sfvc : slope of forced vital capacity ; as1 : first slope of the a area ; as2 : second slope of the a area ; as3 : third slope of the a area ; bs1 : first slope of the b area ; bs2 : second slope of the b area ; bs3 : third slope of the b area ; cs1 : first slope of the c area ; cs2 : second slope of the c area ; cs3 : third slope of the c area ; ds1 : first slope of the d area ; ds2 : second slope of the d area ; ds3 : third slope of the d area . the slopes of the forced vital capacity for tkdp athletes at slopes 1 , 2 , and 3 of the a area were significantly higher than in the nonathletes ( fig . , chest circumference was significantly correlated with slope 1 of the a area of the forced vital capacity ( table 4table 4.correlation coefficients of the circumference and forced vital capacityvariablechest circumferenceabdominal circumferencerestexpinspderdirrestexpinspderdirafvcexa0.0530.0350.0350.1220.0850.0200.0190.0450.0000.177insa0.0910.0940.0660.0170.1190.0110.0140.0030.0160.055total0.0360.0470.0280.0730.0390.0020.0000.0210.0110.126sfvcas10.2390.2360.2400.0270.0030.0410.0060.0390.1590.008as20.1540.1500.1710.0360.0700.0240.0030.0080.1210.104as30.0130.0320.0220.1250.0370.0880.0860.1000.0150.099bs10.0060.0090.0120.0230.0290.0200.0250.0190.0250.008bs20.0860.0690.0620.1120.1140.0220.0300.0080.0450.086bs30.0470.0770.0040.1980.1990.0400.0290.0450.0420.040cs10.0260.0230.0160.0220.0470.0690.0710.0920.0250.168cs20.0390.0160.0290.1530.0470.0820.0970.0890.0880.059cs30.1460.1180.1360.1950.0540.1980.2020.1830.0640.070ds10.0840.0790.0830.0330.0060.0420.0300.0300.0490.077ds20.0850.0690.0840.1110.0080.0070.0240.0160.1470.156ds30.0760.0600.0790.1090.0110.0380.0660.0600.1450.159afvc : area of forced vital capacity ; sfvc : slope of forced vital capacity ; exp : expiration condition ; insp : inspiration condition ; der : differences between expiration and rest ; dir : differences between inspiration and rest ; as13 : first , second , and third slopes of the a area ; bs13 : first , second , and third slopes of the b area ; cs13 : first , second , and third slopes of the c area ; ds13 : first , second , and third slopes of the d area . tkdp athletes : taekwondo poomsae athletes ; bmi : body mass index ; ches cir : chest circumference ; abd cir : abdominal circumference ; thigh cir : thigh circumference ; calf cir : calf circumference ; exp : expiration ; insp : inspiration ; der : differences between expiration and rest ; dir : differences between inspiration and rest ; rt : right ; lt : left . * significantly different from nonathletes , p<0.05 all data are presented as the mean se . tkdp athletes : taekwondo poomsae athletes ; fvc : forced vital capacity ; fev1.0 : forced expiratory volume in one second ; fev1.0/fvc : fev1.0/fvc ratio , pef : peak expiratory flow ; pif : peak inspiratory flow ; svc : slow vital capacity ; irv : inspiratory reserve volume ; erv : expiratory reserve volume ; tv : tidal volume ; mvv : maximum voluntary ventilation ; mv : minute ventilation ; rr : respiratory rate . * significantly different from nonathletes , p<0.05 all data are presented as the mean se . tkdp athletes , taekwondo poomsae athletes ; afvc : area of forced vital capacity ; exa : expiratory area ; insa : inspiratory area ; total , total area ; sfvc : slope of forced vital capacity ; as1 : first slope of the a area ; as2 : second slope of the a area ; as3 : third slope of the a area ; bs1 : first slope of the b area ; bs2 : second slope of the b area ; bs3 : third slope of the b area ; cs1 : first slope of the c area ; cs2 : second slope of the c area ; cs3 : third slope of the c area ; ds1 : first slope of the d area ; ds2 : second slope of the d area ; ds3 : third slope of the d area . * significantly different from nonathletes , p<0.05 afvc : area of forced vital capacity ; sfvc : slope of forced vital capacity ; exp : expiration condition ; insp : inspiration condition ; der : differences between expiration and rest ; dir : differences between inspiration and rest ; as13 : first , second , and third slopes of the a area ; bs13 : first , second , and third slopes of the b area ; cs13 : first , second , and third slopes of the c area ; ds13 : first , second , and third slopes of the d area . respiratory physiotherapy is an important way to improve respiratory function in patients including taekwondo players with respiratory dysfunction caused by genetically determined neuropathy , obstructive pulmonary disease , asthma , rib fracture , and others1,2,3 , 8 . this function is impacted by items unrelated to level of physical activity , including weight and height19 . however , in the present study , circumference of the chest and abdomen are also greater for nonathletes than tkdp athletes . in particular , abdominal circumference is significantly greater because tkdp athletes tend to be slim19 . for tkdp athletes , there was a larger number of pixel of insa on the fvc graph than there were for nonathletes . furthermore , in the previous study , the height and weight were observed to influence the spirometry results20 . we know via our data that the weight was smaller for tkdp athletes than for the nonathletes . in addition , the values for as1 , as2 , and as3 appear to be significantly greater for tkdp athletes . these results can be expected because of the larger number of certain muscle fibers in tkdp athletes as compared to nonathletes . although the tkdp athletes physiques were small compared to those of the nonathletes , the values in the a area were larger for the athletes because a higher proportion of type ii muscle fibers . therefore , a sudden increase in the a area of the first expiratory graph of tkdp athletes is to be expected as a result of the type ii muscle fibers influence . the development of type ii muscle fibers in tkdp athletes is believed to be related to their training and exercise , and therefore can be expected to be associated with the fev1.0/fvc ratio . the fev1.0/fvc ratio shows the forced expiratory volume of air per second as a percentage of the forced vital capacity , which means it is22 . the importance of fev1.0 is that respiratory symptoms and impaired lung function are indicated by reduction in fev1.0 . these symptoms , in turn , are well - described predictors of coronary artery disease , ventricular arrhythmias , and cardiovascular mortality23 , 24 . statistical significance appeared in the differences between the fev1.0/fvc values for tkdp athletes and nonathletes . therefore , the respirogram analysis in our study revealed not only the respiration capacity of tkdp athletes as compared to nonathletes , but also the type of the muscle - fiber development that can be expected . however , further systematic and scientific studies in the area of healthy science and sports physiotherapy are needed25 , 26 .

[ purpose ] respiratory physiotherapy is an effective approach to improving lung function in patient , including athletes with respiratory dysfunction caused by sports injury . the purpose of this study was to analyze the differences in the respirograms between taekwondo poomsae athletes and nonathletes according to the respirogram phase . [ subjects and methods ] respiratory measurements for 13 elite taekwondo poomsae athletes were obtained . respiratory function was measured using spirometry while the participant was seated . [ results ] in respirogram phasic analysis , the inspiratory area of forced vital capacity were significantly increased in the athletes than in the nonathletes . the slopes of the forced vital capacity for athletes at slopes 1 , 2 , and 3 of the a area were significantly higher than those for the nonathletes . in correlation analysis , chest circumference was significantly correlated with slope 1 of the a area of the forced vital capacity . [ conclusion ] results indicate that differences in respirogram phasic changes between athletes and nonathletes may contribute to better understanding of respiratory function , which is important to sports physiotherapy research .

INTRODUCTION SUBJECTS AND METHODS RESULTS DISCUSSION

myasthenia gravis ( mg ) , an autoimmune disease , impedes the postsynaptic acetylcholine receptors at the neuromuscular junction.1 ocular mg is a representative manifestation of this entity in which blepharoptosis and/or eye movement disturbances are often encountered.2 in general , up to 85% of all myasthenic patients show the anticholinesterase receptor antibody in serum , but only about 50% of patients demonstrate ocular muscle weakness.3 although cholinesterase inhibitors with or without steroids are commonly used as a treatment modality , they are , occasionally , less effective for ocular symptoms.4 in such a case , especially for ptosis without any eye movement disorders , ptosis surgery is often performed . this paper presents an ocular mg case with eyelid dysfunction , in which cholinesterase inhibitors and steroids did not work sufficiently , but surgical treatment successfully improved the symptom . a 39-year - old woman was diagnosed with mg when she was 8 years old . with a positive edrophonium test and detectable serum acetylcholine receptor antibody , the diagnosis of ocular mg was confirmed in addition to the unresponsiveness to treatment with pyridostigmine and steroids at 31 years of age . despite long - term treatment with steroids , she had difficulty opening both eyes , which caused stiff shoulders and headaches . as she showed bilateral 3 mm levator function ( figure 1a ) without any eye movement disturbances , bilateral frontalis sling procedures were performed with an autologous fascia lata . the skin incision was made 6 mm from the eyelid margin , and the central area of the upper brow margin was also incised ( figure 2a ) . a tunnel was made from the brow incision through the suborbicularis oculi layer , and reached the pretarsal area . the branched fascia lata was sutured with 60 nylon ( sigma , tokyo , japan ) on the tarsal plate and then the upper eyelid curvature was confirmed by pulling the fascia through the suborbicularis tunnel ( figure 2b ) . after the upper eyelid height was adjusted appropriately with a trial suture at the brow incision , the fascia was fixed at the subcutaneous tissue of the brow . one year after the operation , the upper eyelids showed symmetrically appropriate heights ( figure 1b ) . the patient did not demonstrate exposure keratitis , wound infection , lagophthalmos , or ptosis in the 6 months following the operation . the frontalis sling surgery for ptosis by ocular mg accomplished functionally and cosmetically good outcomes . as the levator function of the patient was bilaterally 3 mm , in general , ptosis with less than 4 mm levator function needs a sling procedure,5 but with more levator function , levator advancement surgery is applied.6 as an excessive advancement of levator often leads to an eyelid - eyeball dissociation , causing dry eyes , a sling procedure should be used in such a case . in the past , numerous materials have been used for slings like silicone rods , gore - tex , and autologous tissue graft.5,79 the autologous graft from fascia lata was chosen rather than the artificial material in terms of its histocompatibility . although the patient did not show any eye movement disturbances , mg patients often show eye movement disturbances simultaneously with ptosis.10 bilateral ptosis surgery should be avoided in such a case to prevent postoperative diplopia . in this situation , many treatment modalities had been given to the patient , but her condition did not show definite improvement . generally in mg , anticholinesterases ( cholinesterase inhibitors ) although steroids are of great short - term benefit in most patients with ocular mg , the side effects associated with steroids may prevent long - term use.10 therapeutic effect of thymectomy is controversial for ocular mg . therefore , a patient refractory to any medical treatments is a good candidate for ptosis surgery . in conclusion , this paper reports an ocular mg case with eyelid dysfunction , in which cholinesterase inhibitors and steroids did not work sufficiently , but surgical treatment successfully improved the symptom . a sling procedure with an autologous fascia was suitable for correcting poor levator function of an ocular mg case .

a 39-year - old woman was diagnosed with myasthenia gravis when she was 8 years old . although many treatments such as cholinesterase inhibitors and steroids had been given to the patient , her condition did not improve sufficiently . as she demonstrated bilateral 3 mm levator function without any eye movement disturbances , bilateral frontalis sling procedures were performed with an autologous fascia lata . one year after the operation , the operated upper eyelids showed symmetrically appropriate heights with good functional outcome . a sling procedure with an autologous fascia lata was suitable for correcting poor levator function of an ocular myasthenia gravis case .

Introduction Case report Discussion

over the past decade , dementia with lewy bodies ( dlbs ) has arguably become the second most common form of neurodegenerative dementia behind alzheimer 's disease ( ad ) . in addition to progressive decline in cognition , dlb is characterized by fluctuations in cognition with variations in attention and alertness , recurrent formed visual hallucinations , visuospatial dysfunction , and spontaneous parkinsonism . often , dlb patients also exhibit neuroleptic sensitivity , transient loss of consciousness , falls , and rapid eye movement ( rem- ) sleep behavior disorder . the clinical separation of dlb from other similar disorders is often difficult resulting in poor diagnostic accuracy , but the relative temporal co - occurrence of parkinsonian features with the typical dlb cognitive and behavioral symptoms such as visuospatial disturbance strongly suggests the diagnosis . clinical presentation of dlb is also influenced by the amount of ad tau pathology , further complicating the diagnosis . approximately 2040% of parkinson 's disease ( pd ) patients also eventually develop a progressive dementing illness designated as parkinson 's disease dementia ( pdd ) characterized by a frontal - subcortical clinical presentation . dlb / diffuse lewy body disease ( dlbd ) , lewy body variant of ad ( lbv ) , and pdd comprise an emerging spectrum of clinical phenotypes from relatively pure motor pd to the more predominant cognitive and behavioral disturbance observed in pdd and dlb , yet the reason for the variability remains unknown . despite the heterogeneity of their clinical phenotypes , a significant neuropathological overlap is observed among these diseases , hence the term lewy body disorders ( lbds ) to collectively describe conditions in which lewy bodies ( lbs ) and lewy neurites ( lns ) predominate as the hallmark histological lesions . variation in the distribution of lewy body pathology is present among lbds , with more neocortical and limbic system lb in both dlb and pdd compared to the brains of pd patients without cognitive symptoms and greater neuronal loss in substantia nigra in pdd than dlb . yet , dlb and overlap disorders such as lbv , more so than pdd , have -amyloid pathology and basal forebrain cholinergic deficit similar to ad patients . as with other forms of dementia , the pathobiological changes in lbd likely occur decades prior to the onset of clinical symptoms and correspond to widespread irreversible neurodegeneration [ 6 , 7 ] . it is increasingly clear from the ad therapeutic experience that by the time widespread neuronal injury ensues , symptomatic cholinergic treatments are minimally effective at best , and disease - modifying therapeutic approaches in trials have thus far proven ineffective at altering disease course or in rescuing diseased brain [ 8 , 9 ] . to demonstrate efficacy , any potential disease - modifying therapy in neurodegenerative dementia must be initiated prior to the expression of the clinical phenotype during the initial molecular pathogenetic events before irreversible neuronal damage has occurred . at present , accurately predicting those individuals at risk for developing neurodegenerative dementia is challenging , and this places greater urgency on developing earlier methods of disease detection . critically important is not only distinguishing the lbd from ad and other forms of dementia , but also separating dlbs and other lbds . although there are many promising candidates for lbd , no biomarkers have yet been validated for clinical diagnostic use , and thus many opportunities exist to develop such tests . here , we highlight from the perspective of how major genetic discoveries in the lbd and their corresponding biomolecular processes might translate into useful disease markers in biological fluids . because of many common pathogenetic features among the lbds , the emerging genetic influences found in pd have readily been translated to dlbs and other lbds , providing clues to rational approaches for selecting future dlb and lbd biomarker targets for exploration . this paper will highlight several pd and dlb genes and their protein products as candidates for biological disease markers ( table 1 ) . a , a key component of neuritic plaques in ad brain , is overproduced leading to various degrees of amyloid aggregation and synaptic and neuronal toxicity . as indicated previously , amyloid pathology in the form of neuritic and diffuse plaques can be also found in varying degrees in the brain tissue of patients with dlb , which may interact with lb or synuclein pathology or influence the clinical features of lbds [ 4 , 11 ] . the genetic mechanisms of a overproduction in ad are well established ; the app gene ( chromosome 21 ) , the first identified ad susceptibility gene , encodes a transmembranous protein ranging from 695 to 770 residues , which undergoes a process of regulated intramembranous proteolysis ultimately releasing a peptides , primarily a42 and a40 , as well as other fragments . a is generated by the concerted action of -secretase and -secretase complex , while the -secretase pathway precludes a formation by cleaving app at a site within the a sequence . genetic analysis of early - onset familial ad cases revealed numerous mutations in the app gene as well as presenilin 1 ( ps1 ; chromosome 14 ) and presenilin 2 ( ps2 ; chromosome 1 ) genes , all of which accelerate the processing of app , leading to increased a generation . specifically , the app km670/671nl ( swedish ) mutation affects the -secretase site , a692 g ( flemish ) mutation alters the -secretase site , and both v717f ( indiana ) and v717i ( london ) mutations affect the -secretase processing , leading to elevated a levels . also important in the notch developmental signaling pathway which is analogous to app processing , the presenilins are thought to be a component of the -secretase enzyme complex , which suggests that missense mutations in the presenilins mechanistically lead to accelerated app processing to a . therefore , the abnormal proteolytic cleavage of app leads to elevated brain a deposition , and as a result , diminished peripheral levels of a. reflecting a shift from soluble a to insoluble brain deposits , significant decreases in csf a42 levels have been demonstrated in ad and more recently in dlb cases . parnetti et al . found that dlb , compared with pd , pdd , and ad patients , showed the lowest csf levels of a42 and , when combined with csf tau , differentiated dlb from pd and pdd , but not from ad . also , spies and colleagues showed a greater decrease in a40 in clinical dlb and vascular dementia patients compared with control levels and even with ad . differentiation of non - ad dementias such as vascular dementia and dlb was improved by comparing the ratio of a42 and a40 . more recently , the detection of amyloid in dementia patients has been greatly enhanced by the use of amyloid - binding agents such as pittsburgh compound b , which also demonstrated amyloid burden in dlb . an australian study reported more variable cortical pib binding in dlb patients than in ad , whereas a subsequent examination of pib binding in lbds including dlb , pdd , and pd , compared with ad and normal patients , showed higher amyloid burden in dlb and ad than in pdd , pd , or nc patients . amyloid load was highest in lbd patients in the parietal and posterior cingulate regions , corresponding to visuospatial impairments on neuropsychological testing , suggesting that amyloid deposition could partly contribute to the clinical presentation of lbds . mutations in the tau gene on chromosome 17 may also present with phenotypic features of pdd or dlb , but they differ pathologically from these disorders in that lbs are generally absent . tau - bearing neurofibrillary tangles remain one of the pathological hallmarks of ad but are also central to a diverse group of disorders termed tauopathies which include progressive supranuclear palsy , corticobasal ganglionic degeneration , frontotemporal dementia ( ftd ) with parkinsonism linked to chromosome 17 , and other disorders . tau is a microtubule binding protein , which acts to stabilize tubulin polymerization in microtubules critical for axonal cytoskeletal integrity and function . in disease , tau protein truncation at glu 391 or hyperphosphorylation causes microtubule destabilization and aggregation of unbound tau into paired helical filaments ( phfs ) leading to characteristic tangle formations . unlike the tauopathies , no direct pathogenetic tau mutations have been identified in lbds , but tau pathology appears to be a consistent feature among neurodegenerative dementias including ad and lbds , and given the pathological overlap , they might share similar pathogenetic pathways ( reviewed in stoothoff and johnson ) . the ser / thr kinase and glycogen synthase kinase-3 ( gsk3 ) , in concert with other molecules such as fyn kinase , normally regulate tau function but with aberrant activation accelerate the hyperphosphorylation of tau in neurodegenerative disease . similarly , the cell cycle family kinase and cyclin - dependent kinase 5 ( cdk5/p35 ) , active during normal brain development and involved in regulatory tau phosphorylation during mitosis , may also contribute to phf formation . consequently , both total tau and hyperphosphorylated forms have been widely investigated and detected in csf , but not serum , by enzyme - linked immunosorbent assay methods . in the differentiation of dementia types , arai et al . initially reported elevated total csf tau levels in ad but not in pd , but subsequently , they showed that total tau was also increased in dlb at similar levels to ad . yet , others have found differences for both total and phospho - tau ( p - tau ) in differentiating dlb from ad , and levels of total tau and p - tau 181 were significantly increased in autopsy - confirmed dlb patients . in clinically diagnosed dementia cases , csf p - tau 231 discriminated ad from non - ad dementias as a group , where levels were significantly higher in ad patients compared with dlb , ftd , vascular dementia , other disorders , and control subjects . separation of dlb from ad , however , was less robust , provided that csf p - tau 231 levels were also increased in dlb . clinically diagnosed dlb cases also showed elevated levels of csf p - tau 181 compared with controls , and hampel et al . reported that p - tau 181 provided the best discrimination of dlb from ad yielding a sensitivity of 94% and specificity of 64% . in autopsy - confirmed dlb and ad patients , however , sensitivity decreased to 75% and specificity to 61% , with a diagnostic accuracy reported as 73% . lbs are filamentous inclusions consisting primarily of the presynaptic protein -synuclein ( -syn ) , which might have several roles in vivo . studies demonstrate that it is localized to multiple neural tissues , including high expression in neocortex and hippocampus , and that expression increases during acquisition - related synaptic plasticity . interaction with tubulin suggests -syn could be a microtubule - associated protein similar to tau [ 32 , 33 ] , and it is highly active in various membrane lipid bilayers such as in presynaptic vesicles acting as a chaperone for soluble nsf attachment protein receptor ( snare ) complex formation , in neuronal golgi apparatus influencing protein trafficking and in the inner membrane of neuronal mitochondrial . the synucleins might act to preserve membrane stability , provide antioxidant function , and assist with membrane turnover , although the actual role of synucleins remains elusive [ 37 , 38 ] . because of its association with lb and the tendency to self - aggregate into pathological oligomers and ultimately fibrillar structures , -syn plays a central role in the pathogenesis of lbd , hence the alternate designation synucleinopathies . the degree of -syn immunoreactivity in cortical lbs correlates with cognitive severity and disease progression in pdd and dlb [ 4 , 40 ] . also , the protein can be recovered from filaments in purified lewy bodies from pdd and dlb brain , and recombinant -syn tends to form lewy body - like fibrillar structures in vitro . in the past decade , tremendous advances have been made in understanding the genetic factors influencing the pathogenesis of lewy body disorders . compelling evidence for a genetic basis for pd and dlb followed the discovery of mutations in the -syn gene ( park1/4 ) in patients with autosomal dominant familial parkinson 's disease , and subsequently , mutations were identified in patients with both sporadic and familial dlbs . from a susceptibility marker on chromosome 4q21 - 23 that segregated with the pd phenotype in italian and greek kindreds , a53 t and a30p were the first two missense mutations in -syn associated with familial parkinson 's disease . clinical analysis of the italian a53 t mutation revealed phenotypic variability over the disease course with several individuals demonstrating moderate to severe dementia . subsequently , a case of clinically and pathologically well - characterized dlbd in the united states and a greek proband of dlb with a family history of pd were both determined to have the a53 t -syn mutation [ 46 , 47 ] . another mutation , e46k , was discovered in a spanish family presenting with autosomal dominant dlb , and in genetic studies of a large family with the spectrum of lewy body phenotype ranging from pd to dlb , -syn gene triplication was described , causing -syn overproduction similar to the trisomy effect observed in down syndrome patients . autosomal dominant point mutations are shown to affect the aggregative properties of -syn , which has mechanistic implications for the pathogenesis of lbd . compared to wild - type -syn , biophysical analyses reveal that -syn aggregation is folding state dependent , where a53 t and a30p mutated proteins cause increased aggregation only from the partially folded intermediate state and not the monomeric state . a53 t -syn transgenic mice have increased oligomerization of the protein in brain regions devoid of inclusions as well as those areas with more abundant lesions and neurodegeneration , and consistent with prior biophysical findings , -syn toxicity in these mice was dependent on the conformation of intermediate species . in fact , the e46k mutation , as well as the others not only increase the tendency toward aggregation , but also promote formation of annular protofibrillar structures , causes pore formation in various membranes and neuronal damage . -syn is a member of a larger family of synuclein proteins which also includes -synuclein ( -syn ) and -synuclein ( -syn ) . -syn has recently been implicated in pd and dlb pathogenesis , but its precise role in disease is still emerging . despite having strong homology with -syn , it is not clearly amyloidogenic , but is highly localized to presynaptic sites in neocortex , hippocampus , and thalamus like -syn [ 53 , 54 ] . normal -syn may act as a biological negative regulator of -syn . in bigenic -syn/-syn - overexpressing mice and in doubly transfected cultured cells , -syn ameliorated amyloidogenicity , neurodegenerative changes , and motor deficits induced by -syn overexpression alone . on the other hand , mutated -syn leads to neuronal damage and disease and augments neurodegeneration , perhaps through a loss of its natural regulator function . two novel -syn point mutations , p123h and v70 m , were found in highly conserved regions of the -syn gene in respective familial ( p123h ) and sporadic ( v70 m ) dlb index cases , where abundant lb pathology and -syn aggregation was present without -syn aggregation . p123h -syn overexpression in transgenic mice resulted in axonal damage , gliosis , profound memory , and behavioral deficits . these phenomena may involve -syn , since bigenic mice overexpressing -syn with p123h -syn show greater deficits compared with monogenic mice and compared with p123h -syn expressed with -syn knockout , implying that the p123h mutation has a synergistic effect with other synucleinopathies to cause neurodegeneration . p123h as well as v70 m -syn mutations might also injure neurons by disrupting normal lysosomal pathways and corresponding cellular autophagic processes . unlike the other synuclein family members , -syn or persyn is largely expressed in the cell bodies and axons of primary sensory neurons , sympathetic neurons , and motor neurons as well as in brain . in cancer biology , -syn is associated with abnormally altering cellular mitotic checkpoints in various types of malignancies , making them more aggressively metastatic , but as far as neurodegeneration , it is the most recent synuclein member to be linked to lbd neuropathology and the least well understood . single - nucleotide polymorphisms in all three synucleins have been associated with sporadic dlbd , most prominently -syn , and in sporadic pd , dlb , and lbv patients , -syn antibodies , as well as -syn and -syn reveal unique hippocampal axonal pathology . in vivo , -syn overexpression in transgenic mice shows age- and dose - dependent neuronal loss throughout the neuraxis , especially in spinal motor neurons , where -syn - bearing inclusions , gliosis , and alterations in heat shock protein and neurofilament structure are found , perhaps suggesting relevance to motor neuron disease associated with dementia . in vitro evidence further supports a cytoskeletal role for -syn in maintaining neurofilament structure ; -syn overexpression in cultured neurons causes disruption of the neurofilament network by destabilizing the structural integrity of neurofilament - h allowing degradation by calcium - dependent proteases , which has implications for neurodegeneration . synucleins are known as intracellular molecules , but they also appear in extracellular and peripheral fluids from active and passive processes . evidence suggests that turnover and secretion of these proteins might occur during normal cellular processing , releasing synucleins into extracellular space and hence into peripheral sites . in transfected and untransfected cultured neuroblastoma cells , 15 kda -syn is released into surrounding media , and furthermore , not only monomeric -syn but also aggregated forms are secreted in an unconventional exocytic manner into extracellular fluid in response to proteasomal and mitochondrial dysfunction . . recently showed that neuronally secreted -syn can also be taken in endocytically by other neurons or glia as a means of transmitting pathology . secreted -syn interacts with various molecules such enzymes ; in cultures , matrix metalloproteinase-3 cleaves native -syn to smaller proteolytic fragments that enhance its aggregative properties . whether -syn and -syn also undergo unconventional exocytosis and secretion remains unknown , but given structural and functional similarity to -syn , the possibility exists . certainly , synaptic and axonal damage reflecting neurodegeneration may also allow release of synucleins into the extracellular millieu and access to peripheral fluids such as csf and blood . multiple forms of -syn are released into cerebrospinal fluid ( csf ) and other biological fluids . full - length -syn has been recovered from lumbar csf from living normal control , pd and dlb patients [ 69 , 70 ] , and also from postmortem csf from dlb and other neurodegenerative diseases . comparative findings regarding differences in csf -syn levels among various neurodegenerative diseases , however , are difficult to interpret because of inconsistent observations . in pd , a smaller early study showed that no differences in full - length csf 19 kda -syn have been found in relation to control individuals , but a recent effort using a new luminex assay in a larger sample controlling for extraneous influences showed significantly decreased levels in pd compared to controls with 92% disease sensitivity and 58% specificity . elevated -syn levels , however , were found in dlb , ad , and vascular dementia with no differences among them . perhaps more intriguing , higher - molecular weight aggregated -syn species in csf might be associated with pd and dlb . reduced levels of a 24 kd -syn - immunoreactive band were found in dlb csf and correlated directly with declining cognition . moreover , using a specific enzyme - linked immunosorbent assay ( elisa ) , soluble aggregated -syn oligomers in csf were significantly increased in pd patients compared against control subjects , ad and progressive supranuclear palsy , and specificity ranged from approximately 85 to 87% , while sensitivity was about 5375% range . plasma -syn detected by immunoblotting was decreased in pd compared with age - matched control subjects , and those pd patients with age - at - onset prior to 55 years ( early - onset ) had significantly lower levels than those with onset after 55 years of age ( late - onset ) . in addition , soluble oligomeric -syn detected by specific elisa was significantly elevated in plasma from pd . this test demonstrated a specificity of approximately 85% , a sensitivity of 53% , and a positive predictive value of 0.818 . although measurement of plasma -syn appears interesting as a biomarker , it was reported that skin cells and platelets are also sources for -syn , and their levels did not correlate with disease presence or severity . moreover , red blood cells are also a major source of -syn , and thus , plasma could be contaminated by -syn not originating from brain , which might render interpretation of results difficult . one promising consideration for the future exploration of -syn as an lbd biomarker will be the development of novel imaging compounds and techniques , similar to amyloid imaging , to specifically target and visualize -syn distribution in the pd and lbd brain . the availability of such methods will be a significant advance in biomarkers for synucleinopathies . due to their increasing importance in lbd pathogenesis , -syn and -syn , as much as -syn as such , levels of these synucleins might be altered in the csf of patients with pd / pdd and dlb , reflecting the underlying degenerative processes in brain . no studies to date have examined -syn levels in peripheral fluids in relation to neurodegenerative disease , but a small study reported elevated postmortem ventricular csf -syn levels in dlb , ad , and vascular dementia patients , with the highest levels seen in dlb patients . more detailed examination of both -syn and -syn as a peripheral disease markers in well - characterized populations of pd , dlb , and other disorders is warranted to determine their specificity and sensitivity in the synucleinopathies . recently , dj-1 ( park 7 ) has emerged as a significant molecular target of interest in lbd principally because of its genetic association with pd and its increasing importance in cellular oxidative neuroprotection . although its exact role is unknown , multiple functions have been assigned to the dj-1 protein ras - related signaling pathways , it shares structural homology with the carboxy - terminal domain of escherichia coli hpii catalase and is reported to possess catalase activity which reduces oxidative stress in cultured cells . it also binds to and regulates the pias sumo-1 ligase and is itself posttranslationally modified by sumoylation [ 81 , 82 ] . of relevance to lewy body formation and neurotoxicity , dj-1 displays redox - dependent chaperone activity conferring proper protein folding and thermal stability , which in fact , also inhibits -syn aggregation . the overexpression of dj-1 in rats protects nigral dopaminergic neurons against degeneration involving 6-hydroxydopamine , while mutant dj-1 in mice causes abnormal dopamine reuptake and susceptibility to 1-methyl- 4-phenyl-1,2,3,6-tetrahydropyridine ( mptp ) toxicity . deletion of dj-1 homologs in drosophila renders them sensitive to h2o2 , paraquat , and rotenone toxicity . no less than 13 gene mutations have been identified in dj-1 in atypical younger - onset pd patients , but their significance to idiopathic late - onset pd remains uncertain . in autosomal recessive early - onset pd from consanguineous families , a complete dj-1 deletion in a dutch family and a point mutation l166p in an italian case were identified . when expressed in cultured cells , l166p appears to be a loss - of - function mutation which leads to dj-1 functional instability , degradation by the proteasome system [ 86 , 87 ] , abnormal translocation of dj-1 to mitochondria , and loss of chaperone activity . the importance of dj-1 gene alterations in dementia and dlb , however , is uncertain . one report found no impact on dementia risk of the dj-1 14 kb deletion , and analysis of an insertion / deletion variant ( g.168_185del ) in dj-1 in a larger sample of patients also showed no association with either pd or dlb compared to control patients . given these early negative findings , the relevance of dj-1 genetic mutations to dlb and other lbd is not known . at present , no patient harboring a dj-1 mutation has come to autopsy , so the precise pathology is not known . although dj-1 mutant cases may ultimately not be lbds , it is possible that alterations in dj-1 may somehow influence the aggregation of -syn and lb formation or contribute to pathogenesis by other molecular pathways . dj-1 is found in brain across a wide range of neurodegenerative diseases including pd , ftd , ad , dlb , and lbvad , and demonstrates striking association with neuropil threads and neurofibrillary pathology in neocortex and subcortical brain regions in these disorders . interestingly , this association with tau pathology was seen in dlb and lbv brains , suggesting that as a chaperone molecule , dj-1 may be involved in tangle formation , and the binding of dj-1 with these lesions could abolish the normally protective effect of dj-1 , enhancing oxidative neurotoxicity . wang et al . observed that dj-1 knockout mice have markedly abnormal hippocampal long - term depression accompanied by a less severe abnormality in long - term potentiation , which was reversed by the d2/3 agonist quinpirole , indicating that dj-1 has a role in dopamine - dependent signaling in hippocampal plasticity . given its pathogenetic significance , dj-1 could be a candidate biological marker for dlb and lb and might serve as a means of monitoring in vivo oxidative damage and protein misfolding . although intracellular and mitochondrial in localization , dj-1 is presumed to be secreted perhaps specifically under disease conditions which induce oxidative damage . using semiquantitative immunoblotting , we previously identified dj-1 in csf of sporadic pd patients , where levels were significantly elevated compared with controls . levels were higher in the earlier stage pd cohort ( hoehn - yahr stages i - ii ) than in the more severe patients ( hoehn - yahr stages iii - iv ) . similarly , plasma dj-1 levels in pd patients were markedly increased compared to controls , but unlike csf , levels were relatively higher in late stage ( iii - iv ) rather than early stage pd ( i - ii ) . the reason for this difference between plasma and csf dj-1 is unknown , but we surmised previously that since csf dj-1 originates from a central source produced mainly by reactive glia , early increases in csf dj-1 levels probably represent an early protective response to damage , whereas plasma dj-1 , like other plasma disease markers , likely represents peripheral oxidative stress damage . in fact , dj-1 is secreted into blood in breast cancer , melanoma , familial amyloid neuropathy , and stroke [ 9496 ] . in the largest study to date , hong et al . developed a more sensitive and quantitative luminex assay for csf dj-1 to complement immunoblotting mass spectrometric and chromatographic analysis methods and found decreasing rather than increasing levels of dj-1 in pd csf compared with control patients . the 90% disease sensitivity and 70% disease specificity for pd using this method approaches minimal desired parameters for a clinically useful biomarker for pd . importantly , the study highlighted the fact that dj-1 levels are greatly influenced by such variables as the extent of blood contamination and patient age , which could account for some of the variability across studies . of note , dj-1 is also subject to oxidative modifications in pd and ad brain tissue , and this might be measured in peripheral fluids as well , as another monitor of oxidative damage . csf dj-1 remains a promising and perhaps clinically useful biomarker for pd , but as far as dlb and other lbd , it is unknown whether csf levels of dj-1 are altered . since plasma dj-1 is increased in dlb , it is hypothesized that csf dj-1 may also be elevated . further investigation will be necessary to clarify the utility of dj-1 as a biomarker in dlb and lbd . many clinicopathologic parallels can be drawn between the lysosomal storage disorders , such as niemann - pick , sandhoff 's , tay - sachs disease and others , and the age - related neurodegenerative disorders , when considering the aberrant accumulation of pathological substances ( e.g. , lysosomal sphingomyelin in niemann - pick disease versus synucleins in pd and dlb ) and the phenotypes of neuronal loss and cognitive deterioration found in both . common to these diseases are abnormalities in lysosomal and autophagic mechanisms as part of a larger disruption of cellular proteostasis leading to abnormal storage / accumulation of toxic materials and neuronal damage . in the past few years , an altogether unexpected pathogenetic relationship emerged between gaucher 's disease ( gd ) , a prototypic storage disease , and the synucleinopathies . despite its overall rarity , gd is the most common inherited lysosomal storage disease , especially in the ashkenazi jewish population . it is caused by autosomal recessive gene mutations in the glucocerebrosidase ( gba ) gene ( chromosome 1q21 ) , leading to either partial or complete deficiency of gba , and hence , toxic lysosomal accumulation of its substrate , glucosylceramide , in multiple cell types including neurons . recent reports documented an increased incidence of pd in heterozygous relatives of patients with gd [ 99 , 100 ] , but interest in this phenomenon was propelled by the finding that gba mutations were in fact more common in pd patients of ashkenazi background compared with ad patients and pd patients in the general population [ 101103 ] . moreover , more severe gba mutations such as 84 dupl g and ivs 2 + 1 were associated with a greater degree of pd risk , compared with less severe gba mutations such as n370s . the relationship between pd and gba has now been replicated in much larger international studies with the most common mutations being l444p and n370s , and about 28 gba mutations are presently recognized . interestingly , in a study of british patients with pd and gba mutations , all 17 carrier patients demonstrated abundant -syn neuropathology with braak stage 5 - 6 severity and common neocortical lb pathology . clinically , these patients had earlier age at onset , and hallucinations were present in 45% of patients , while 48% had cognitive impairment or dementia consistent with pdd . greater severity of gba mutation also predicted the presence of cognitive impairment in pd patients ; 56% of severe gba mutation carriers had cognitive impairment compared to 25% of mild mutation carriers . these observations suggest a much broader link between gba mutations and the dementia phenotype of lbd . in fact , examination of gba gene alterations in dlb patients , with and without concomitant lbv - type ad pathology , showed that the majority of gba mutations were found in dlb patients rather than in pd , with a mutation rate in dlb ranging from 18 to 23% overall [ 108 , 109 ] . the proportion of dlb patients with gba mutations was higher in those with pure neocortical lb pathology compared to those with mixed lb and ad pathology and to those with predominantly brainstem lb . a significant association was also found between gba mutation status and the presence of lb , indicating that altered gba might play a role in their formation and in synucleinopathy . important in neurodegeneration , disrupted cellular proteostasis represents a state in which an imbalance exists between effective functioning of the innate cytoprotective machinery and excessive accumulation and aggregation of abnormally misfolded proteins , leading to neurotoxicity . it is increasingly apparent that chaperone - mediated autophagy ( cma ) and lysosomal degradation pathways are important in maintaining cellular proteostasis as part of a larger network of cellular actions , with particular relevance for neurodegenerative diseases . recently , as evidence for cma dysfunction in synucleinopathies , a significant decrease in autophagy markers was reported in substantia nigra from pd brain . soluble forms of -syn , including monomers , oligomers , and even protofibrils , are normally cleared through the cma / lysosomal degradation by interacting with the chaperone , heat shock cognate-70 , and becoming internalized into lysosomes via the lamp-2a membrane receptor [ 111 , 112 ] . studies have indicated that -syn shares a common pentapeptide structure with other lysosomal substrates , designating it as a target for removal by this pathway , and the lysosomal structure is critical to maintaining the internal acidic environment , allowing lysosomal hydrolases to degrade -syn into peptides released into the cytosol . mutant gba could therefore disrupt lysosomal activity leading to abnormal accumulation of nondegraded -syn , which then aggregates to toxic soluble oligomers and protofibrils . also , abnormalities in the ubiquitin - proteasome system ( ups ) are present in ad and pd , and gba alterations might secondarily overwhelm the ability of ups to remove accumulated -syn , promoting aggregation and neurotoxicity . pathologically , in gd with parkinsonism , -syn - positive inclusions were observed in neurons in hippocampal ca2 - 4 regions , while cortical synuclein pathology was identified in other gd cases . further , parkin , an e3 ubiquitin ligase also implicated in pd , has been shown to affect the stability of mutant gba and increase its degradation causing further lysosomal dysfunction . because of the importance of mutant gba function to pd and dlb pathogenesis , the issue arises as to whether the measurement of gba activity , or a perhaps other related molecules , might be utilized as a biological marker . the activity of peripherally secreted gba was measured in plasma and csf in a 10-month - old female with gd with the aim of monitoring the effect of experimental cerezyme replacement therapy . baseline gba activity was detected in both plasma ( 2.7 10 u/l ) and csf ( 0.096 10 u/l ) , although csf activity was several magnitudes lower than plasma . intravenous cerezyme , a macrophage - targeted gba , rapidly raised the plasma activity within 1 hour and csf activity by 2.3-fold at 3 hours , both returning to baseline after 24 hours . this study suggests the intriguing possibility that gba activity , especially in csf and plasma , might be useful in monitoring the efficacy of novel therapies involving cma and lysosomal function . to extend this observation , balducci et al . determined that multiple lysosomal hydrolases , including gba , are significantly decreased in the lumbar csf of pd patients , perhaps supporting a more widespread lysosomal dysfunction in pd not limited to gba alone . in this regard , other lysosomal enzymes such as mannosidase and -hexosaminidase might be important additional biomarker targets for neurodegeneration . moreover , in dlb , ad , and ftd patients , lysosomal enzyme activities in csf demonstrated a very specific pattern of decrease , in which only dlb showed significant decreases in csf activity of -mannosidase , -mannosidase , gba , galactosidase , and -hexosaminidase , whereas in ad and ftd , only csf -mannosidase activity was significantly diminished . in dlb , csf gba activity showed the greatest magnitude of decrease , reinforcing its importance in the lbd , but also noteworthy is the fact that ad and ftd showed decreased -mannosidase activity , suggesting that this might be another important factor in lysosomal dysfunction in neurodegeneration . indeed , these promising candidates need to be investigated further to establish diagnostic accuracy in terms of disease specificity and sensitivity in cohorts of pd , dlb , and other dementing disorders . polymorphisms in proinflammatory cytokine genes including il-1 , il-1 , and tnf- are associated with increased risk in ad . in pd , several case control genetic analyses have demonstrated that homozygous carriers of the il-1 511 and tnf- 308 promoter region variants have increased disease risk [ 120 , 121 ] , and that earlier age at onset in pd was associated with il-1 511 homozygosity at allele 1 . but as yet , no such genetic alterations in cytokines genes have been reported in dlb . similar to a-induced upregulation of inflammatory cytokines in ad , soluble secreted -syn in the extracellular space in lbd might also induce the production of a variety of neuroinflammatory mediators into the extracellular fluid . for instance , microglial activation in response to stimulation by secreted -syn from cultured cells and from overexpression in transgenic mouse models occurs in a dose - dependent manner , causing release tnf- , il-1 , and il-6 . because secreted cns cytokines are readily detected in csf , they have been extensively examined as potential disease biomarkers . il-1 , il-2 , il-6 , and tnf- are all upregulated in pd brain , as well as in csf from pd patients [ 124126 ] , and chen et al . showed that plasma il-6 , but not il-1 , tnf- , or other acute phase reactants , predicted risk for future pd in males . in terms of dlb , csf il-1 levels , which were relatively low , did not differ compared to ad or normal controls and could not distinguish them apart . comparable increases in csf il-6 levels were found in ad and dlb , but again not significantly different from each other to be of diagnostic value . indeed , the neuroinflammatory cytokines may be important as a pathogenetic response to cns injury caused by accumulation of amyloidogenic proteins , but their role as biomarkers for the lbd , especially for dlb , is still unclear . disorganization and breakdown in the cytoskeletal network occurs in various lbds and other neurodegenerative diseases , and as discussed , gamma - synuclein and proteolytic degradation of the cytoskeleton may be involved . as a result , a failure of normal axonal transport results from the accumulation of disrupted neurofilament molecules within the neuropil , causing neuronal demise . recently , a mutation in the nefm gene encoding the rod domain 2b of neurofilament m ( nf - m ) which causes aberrant nf assembly was identified in a single early - onset pd patient . it is recognized that in addition to -syn , three types of nf protein also comprise the structure of lewy bodies . upon cell death or axonal damage , accumulated neurofilament leaks into the extracellular space , subsequently appearing in csf and perhaps other peripheral fluids . elevated csf nf protein was reported in msa and psp , but not in pd , and this was suggested to clinically aid in differentiating parkinsonian syndromes . csf nf protein was also measured in dementia , and although increased levels were observed in dlb , late - onset ad , and ftd , there were no differences among them . therefore , because cytoskeletal abnormalities are present in many neurodegenerative dementias as well as in pd , nf protein may be more a reflection of nonspecific alterations in neuronal and axonal function , which does not appear to able to clinically separate dlb from other disorders . severe cortical cholinergic deficits originating from deficiencies in the nucleus basalis of meynert are characteristic of ad brain , but studies have shown that cholinergic deficits are perhaps more severe in dlb brain . this suggests that measurement of cholinergic activity and/or acetylcholine ( ach ) might be developed into a potential biomarker for the lbds . indeed , early attempts to quantify ach or its major metabolite , choline , have shown baseline levels to be low and perhaps difficult to measure accurately . in ad , csf ach was reported to be significantly lower than control levels , while in pd and huntington 's disease patients , despite some cholinergic deficit , lumbar csf ach and choline levels did not differ from normal . no studies have directly examined csf cholinergic levels in dlb or lbds , but recently , shimada and colleagues employed positron emission tomography ( pet ) mapping of brain ach activity in dlb and pdd patients and normal controls and demonstrated a marked reduction in cholinergic activity in medial occipital cortex of dlb and pdd , greater than that observed in pd patients without dementia . some correlation of mapped cholinergic activity with cognitive decline measured by the mini - mental state exam was also found . although preliminary , this has potential to be a more practical and sensitive cholinergic biomarker for lbd . because of similar nigrostriatal loss to pd , a relative dopaminergic deficiency also exists in dlb and lbds . csf dopamine ( da ) and its metabolites have been investigated previously in pd , and recently , lunardi et al . showed differences in csf da and its metabolites , homovanillic acid ( hva ) and dihydroxyphenylacetic acid ( dopac ) , in pd patients , demonstrating early - stage dopaminergic loss and a correlation with the development of dyskinesia . in dlb , similar to cholinergic activity , imaging modalities may also contribute to the assessment of dopaminergic function in the lbds . in a small study , striatal da uptake as measured by f - fluorodopa pet was decreased in both caudate and putamen in dlb as compared with ad patients and controls . also , da transporter loss was determined across multiple studies using i-2-carbometoxy-3-(4-iodophenyl)-n-(3-fluoropropyl ) nortropane ligand with single - photon emission computed tomography ( i - fp cit spect ) and demonstrated significant loss of caudate and putaminal da transport compared with ad and control levels [ 139141 ] . a larger phase iii , multicenter study of i - fp cit spect in possible and probable dlb patients and non - dlb comparators ( mostly ad ) demonstrated a mean sensitivity of 77.7% for detecting clinically probable dlb , with a specificity of 90.4% and 85.7% overall diagnostic accuracy . i - fp cit spect da transporter imaging greatly enhanced diagnostic accuracy for dlb over clinical diagnosis alone when coupled with autopsy confirmation , raising sensitivity for dlb from 75% to 88% and specificity from 42% to 100% . furthermore , da transporter loss in the caudate may also be inversely associated with depression , apathy , and delusions in dlb patients . autonomic failure is a common clinical finding in lbd , including pd and dlb , but not in non - lbd dementias , and therefore it has been investigated as an alternative biomarker for the diagnostic separation of dlb from other dementias . abnormal autonomic function can be determined using cardiac i - meta - iodobenzyl guanidine ( i - mibg ) imaging , a technique which assesses cardiac sympathetic nerve function in both cardiac and neurological disorders by measuring the uptake of i - mibg , a norepinephrine analogue . in the last decade , a series of japanese studies consistently demonstrated delayed heart to mediastinum ratio ( h / m ) of i - mibg uptake in dlb compared with ad and controls [ 143146 ] . i - mibg imaging distinguished dlb from other dementias with a sensitivity of 94% , specificity of 96% , and a diagnostic accuracy of 95% . finally , consistent with autonomic dysfunction in dlb , both early and delayed h / m i - mibg uptake were significantly associated with the presence of orthostatic hypotension in dlb patients and discriminated dlb from ad even in the absence of parkinsonism . various magnetic resonance ( mr ) imaging modalities have been explored in dlb and pdd , including volumetric imaging , diffusion tensor imaging , and proton magnetic resonance spectroscopy ( reviewed in watson et al . ) , and although not directly useful as biomarkers at present , they have revealed insights in the pathobiology of lbds . using conventional mri techniques such as voxel - based morphometry and region of interest analysis atrophy has been rated at 1.4% per year in dlb brain , 1.31% per year in pdd , and 0.31% per year in pd . not surprising is the fact that unlike ad brain , medial temporal structures are relatively preserved in dlb and pdd , with global hippocampal loss at about 1020% compared with controls and about 2125% in ad . diffusion tensor imaging , an mr technique mapping brain microdiffusion of water in the direction of white matter tracts , has shown decreased fractional anisotropy of water movement in dlb in the precuneus and posterior cingulate areas , perhaps highlighting their role in dlb pathogenesis . brain perfusion spect ( tc - hmpao spect ) has been evaluated in its ability to diagnostically separate dlb from ad , and in ad , reduced relative cerebral blood flow ( rcbf ) in the frontal , and medial temporal regions is characteristic , whereas in dlb , occipital hypoperfusion is often observed . applied statistical parametric mapping to spect imaging of dlb patients , more precisely showing large perfusion deficits in the left medial occipital gyrus and the bilateral central , inferior parietal , precuneate , superior frontal and cingulate regions on the brain , which are functionally consistent with frontal - executive and visuospatial deficits in dlb . across studies , sensitivity ranged from 65 to 85% and specificity from 8587% , which appears less robust as a potential imaging marker compared with other methods . aside from -syn and dj-1 , numerous other mutations have been associated with familial early - onset pd and possibly lbd ( table 1 ) . among these gene products are parkin ( park 2 ) , uchl-1 ( park 5 ) , pink1 ( pten - induced putative kinase 1 ; park 6 ) , and lrrk2/dardarin ( park 8) . indeed , none of these mutations have yet been associated with prototypic lbd pathology , and it remains to be determined whether they actually represent lbds or separate diseases with parkinsonian phenotype . furthermore , no studies have addressed their role as biological markers of disease , but since both synucleins and dj-1 are detected in csf and peripheral fluids , it seems plausible that the protein products of other dominant genes in pd could be peripheral biomarker candidates for dlb and other lbd . parkin , uchl-1 , and pink1 genes , like dj-1 , all encode proteins important in neuroprotection in terms of maintaining protein homeostasis and preventing stress - related cellular damage , and mutations in these genes cause a loss of these critical functions . leucine - rich repeat kinase 2 ( lrrk2/dardarin ) , on the contrary , is linked with autosomal - dominant late - onset pd , and mutations result in a toxic gain of function . lrrk2/dardarin is a kinase consisting of multiple functional domains , and recent evidence suggests that physiologically , its principal function may be to regulate neurite outgrowth . expression in cultured neurons of several lrrk2 mutations associated with familial pd , such as g2019s , increased kinase activity and significantly reduced neurite outgrowth , whereas expression of a dominant - negative mutation , k1906 m , markedly increased neurite length . pd - associated mutations also generated tau - positive axonal inclusions in cultured neurons , suggesting that lrrk2 may be linked to abnormalities in tau . indeed , expression of mutant g2019s lrrk2 in drosophila caused activation of the drosophila gsk-3 homolog and promoted tau hyperphosphorylation leading to microtubule fragmentation and dendritic pathology . similar tau hyperphosphorylation was also present in transgenic mice expressing g2019s lrrk2 , and expression of both wild - type human lrrk2 and g2019s mutant lrrk2 caused abnormal dopaminergic transmission . lrrk2 may also interact with -syn , another dominantly inherited pd gene , to exert its effect . lin et al . showed that overexpression of lrrk2 with a53 t mutant -syn in transgenic mice worsened neurodegeneration , while ablation of lrrk2 expression suppressed -syn aggregation and pathology , and -syn also activates gsk-3 in mice causing tau hyperphosphorylation , indicating that lrrk2 , -syn , and tau alterations may all be linked in the same pathway , perhaps with lrrk2 upstream of these events . although early , evidence has indicated that lrrk2 is also a component of lb in pd and dlb brains , and that lrrk2 and -syn interact in dlb brain and coimmunoprecipitate in cultured cells after oxidative stress challenge , suggesting that the lrrk2 may also be important in dlb pathogenesis . interestingly , genome - wide association studies ( gwass ) in a european cohort demonstrated that lrrk2 , -syn , and tau are loci associated with pd risk , but examination of tau in a japanese gwas cohort failed to identify it as a pd risk locus , showing a population difference with regard to this locus . certainly , population differences might apply to all risk loci examined for pd and lbd , and it is important to determine whether the relationship among lrrk2 , -syn , and tau in pd , dlb , and other lbd is also influenced by population differences . these findings make lrrk2/dardarin an attractive candidate for examination as a potential biomarker , and if identified in csf or peripheral fluids , they might be used with -syn and tau as combined biomarkers . furthermore , emerging evidence is redefining the roles of pink1 and parkin in pd pathogenesis . because energy generation is critical for cellular function , mammalian cells are highly dependent on mitochondria . depolarization and morphological defects characterize damaged or impaired mitochondria which are targeted for removal through mitophagy , a highly specialized form of autophagy in which parkin and pink1 play a crucial role ( reviewed by vives - bauza and przedborski ) . in this process , pink1 cleavage is inhibited by the loss of mitochondrial membrane potential , causing its lengthening and the recruitment of cytosolic parkin [ 170 , 171 ] . voltage - dependent anion channel 1 and other outer mitochondrial membrane proteins are then ubiquitinated in a parkin - dependent manner , and this in turn recruits the binding of adapter proteins such as p62 and histone deacetylase 6 to initiate autophagosome assembly around the damaged mitochondrion and subsequent removal . of relevance to pd , mutant pink1 and mutant parkin both cause motor dysfunction , dopaminergic loss , and abnormal mitochondrial morphology in drosophila . in this paradigm , loss of function pink1 mutants are rescued by concurrent overexpression with wild - type parkin but not vice versa , indicating that parkin specifically acts downstream of pink1 . also , parkin mutations have been shown to interfere with ubiquitination and the downstream steps in normal mitophagy . thus , pd , and possibly related dementias , might be a result , to some extent , of defective mitophagy due to loss of function in pink1 and parkin such as found in autosomal dominant early - onset pd . although lrrk2 , parkin , pink1 , and uchl-1 have not yet been identified in peripheral fluids , pink1 and parkin may be a promising candidates . unexpectedly , both pink1 and parkin , which are normally cytosolic or targeted to mitochondria , were localized extracellularly in ad and multiple sclerosis brain , and colocalized with amyloid plaques , reactive astrocytes , as well as amyloid - affected vessels [ 174 , 175 ] . this suggests that both pink1 and parkin are actively released from neurons and glia in response to injury and might be upregulated in csf and peripheral fluids during neurodegeneration . interestingly , given a role in mitophagy , they might also be a csf or peripheral reflection of mitochondrial health and turnover . it remains to be seen whether these gene products can be detected in biological fluids such as csf as potential biomarkers in pd and lbd . as detailed above , traditional methods for molecular biomarker determination have been derived from targeted analyses of candidate genes / mutations and corresponding proteins in brain and body fluids such as csf and blood , with the subsequent exploration of mechanisms in cell culture and animal models . an emerging alternate approach has been to evaluate genomes and proteomes with regard to specific neurodegenerative diseases and their components in an unbiased manner to yield a number of potential pathogenetic , therapeutic , and biomarker targets for further validation . with regard to the genomic analysis of the lbds , scherzer et al . , for instance , examined transgenic drosophila expressing the human -syn gene and performed temporal profiling of resultant gene expression . they demonstrated a number of changes , including a downregulation of phospholipase a2 and other lipid genes , downregulation of several mitochondrial respiratory chain molecules , and alteration in membrane transport and energy genes such as voltage - gated calcium channel and lysosomal atpase , suggesting that mitochondrial integrity might be affected by -syn overexpression . in parkinson 's disease brain , rna from populations of mesencephalic dopaminergic neurons with and without lb interestingly , upregulation of the ubiquitin - specific protease 8 in lb - containing neurons indicated cellular damage and increased levels of ubiquitination in lb , whereas non - lb - bearing neurons showed increased expression of novel cytoprotective genes such as bullous pemphigoid antigen 1 , an hsp-70-like gene ( stch ) and kelch - like 1 . although promising , further genomic profiling studies in dlb , pdd , and other lbd are needed to expand the range of novel gene targets for examination and validation . as a complement to gene expression profiling and genomic methods , proteomic profiling has also assumed a greater importance in biomarker discovery for neurodegeneration with relevance to the lbd . advances in methodologies such as 2-dimensional gel electrophoresis ( 2-d ge ) , liquid chromatography ( lc ) , high - resolution mass spectrometry ( ms ) , and quantitative proteomics allow analysis of static or condition - dependent protein structure and function associated with pd and lbd in a variety of sample types such as brain or body fluids ( reviewed in shi et al . 2009 ) . in mice treated with mptp , a specific mitochondrial toxin , isotope - coded affinity tag assay of brain tissue followed by ms analysis revealed 100 proteins with significantly altered levels including many mitochondrial and metabolic molecules , app and dj-1 . first examined the proteome of the substantia nigra from parkinson 's disease brain and age - matched controls . using 2d ge and peptide fingerprinting , of the 44 expressed proteins , 9 proteins differed in pd versus controls , including oxidative and mitochondrial proteins such as peroxiredoxin ii , mitochondrial complex iii , calcium channel , and others . a subsequent study in pd brain showed decreased frontal cortex levels of mortalin , a novel mitochondrial chaperone protein with roles in energy generation . in addition , lbs isolated by laser - capture microdissection , were analyzed by lc / ms and ultimately demonstrated 156 candidate proteins involved in ubiquitin - proteasome system and synaptic function , from which the heat shock cognate-71 , a chaperone involved in neurodegenerative disease , was identified and validated as a candidate target . abdi and colleagues carried out proteomic evaluation of csf from ad , pd , and dlb patients and normal control individuals , using chromatography , ms , and isobaric tagging for relative and absolute quantification ( itraq ) , identifying numerous candidate proteins related to pd and dlb , such as lipoproteins apoc1 and apoh . lastly , using surface - enhanced laser desorption / ionization - time of flight ( seldi - tof ) ms analysis of serum from dlb patients compared to ad , a combination of protein peaks provided the ability to separate dlb from non - dlb cases , with a sensitivity of 83.3% and a specificity of 95.8% . given promising findings , further exploration of the proteomics of the lbds is warranted , and perhaps consideration should be given to determining whether combining various genomic and proteomic methods will be of value . over the last decade , tremendous advances have been made in understanding the pathogenetics of pd , pdd , and dlb , which has revealed not only the genetic basis of these disorders , but also related mechanisms common to all the lbd . in parallel , these discoveries have been a catalyst for translating and developing many of the involved proteins into promising biomarkers for disease . a common theme centers on genes that drive a complex network of synergistic and opposing cellular actions underlying pathogenesis . aggregation of -syn , the main constituent of intracellular lbs , results in toxic oligomers and protofibrils which not only act intracellularly , but also are actively and passively released into the extracellular environment causing damage to surrounding tissue . on the contrary , dj-1 , pink1 , parkin , and perhaps others molecules are upregulated to oppose cellular protein misfolding and oxidative stress and maintain mitochondrial function , while autophagy mechanisms attempt to limit the toxic effect of synucleins and other toxins by lysosomal engulfment and digestion . much of this is reminiscent of a relatively new concept applied to infectious diseases and mechanical tissue injury termed damage - associated molecular patterning ( damp ) , which is an evolved system to recognize , contain , and repair damage to cells and tissues . it is characterized by the abnormal release of molecules normally confined and operating within healthy cells or from foreign pathogenic agents , that when released into the extracellular space activate receptors and pathways leading to inflammation and multiplying cellular damage ( reviewed by bianchi ) . in this regard , events in the pathogenesis of pd , dlb , and related disorders may represent a novel variation of the damp response , and in a sense , biological fluid markers are therefore a measurement of damp activity as it relates to neurodegeneration . despite progress in developing biological markers for pd , pdd , and dlb , clinical diagnosis of this spectrum of disorders remains challenging . the need for highly sensitive and specific biomarkers that accurately mirror the underlying pathogenetic features of these disorders demands not only that more advanced detection methods be devised and validated in large sample populations , but also that novel biomarker candidates be selected for evaluation based on rational selection from the multiple - associated gene - mechanism associations in the lbd . gene products including - and -synuclein , gba , parkin , and pink1 need to be examined in csf , blood , and even urine to confirm their presence in biological fluids and threshold of detection . alterations in the levels of these putative biomarker candidates in csf and blood can provide further insight into the role these mechanisms may play in disease and also the ability of the potential biomarker to reflect resulting cns changes . to better understand the relationship of gene mutations , mechanisms , and disease biomarkers in lbd , it would be of great interest to determine whether the levels of these putative biomarkers in csf and peripheral fluids are altered in patients with known pd , dlb , and lbd mutations . it is likely that combinations of multiple peripheral biomarkers could be needed to monitor the various mechanistic aspects underlying the lbd , but the optimal combination has yet to be determined . furthermore , both existing imaging modalities as well as novel imaging techniques to detect specific molecular biomarker targets will greatly complement peripheral biomarkers . new specific therapies for the lbd yet to be developed will probably target one or more of the multiple pathways described above , and indeed , this could determine which biomarker or combination of biomarkers would be appropriate as a therapeutic endpoint . studies are also needed to establish which biomarkers will fulfill the criteria of minimum sensitivity and specificity for the lbd for consistent and reproducible diagnostic use in presymptomatic disease detection and also serve as robust tracking tools and endpoints in monitoring the efficacy of future lbd therapies .

recent advances have been made in defining the genetic and molecular basis of dementia with lewy bodies ( dlbs ) and related neurodegenerative disorders such as parkinson 's disease ( pd ) and parkinson 's disease dementia ( pdd ) which comprise the spectrum of lewy body disorders ( lbds ) . the genetic alterations and underlying disease mechanisms in the lbd overlap substantially , suggesting common disease mechanisms . as with the other neurodegenerative dementias , early diagnosis in lbd or even identification prior to symptom onset is key to developing effective therapeutic strategies , but this is dependent upon the development of robust , specific , and sensitive biomarkers as diagnostic tools and therapeutic endpoints . recently identified mutations in the synucleins and other relevant genes in pd and dlb as well as related biomolecular pathways suggest candidate markers from biological fluids and imaging modalities that reflect the underlying disease mechanisms . in this context , several promising biomarkers for the lbd have already been identified and examined , while other intriguing possible candidates have recently emerged . challenges remain in defining their correlation with pathological processes and their ability to detect dlb and related disorders , and perhaps a combined array of biomarkers may be needed to distinguish various lbds .

1. Introduction 2. Amyloid and Tau in Lewy Body Disorders 3. Synucleins: Genetics to Biomarkers in the Lewy Body Disorders 4. DJ-1 in the Lewy Body Disorders 5. Glucocerebrosidase as a Novel Biomarker for Lewy Body Disorders 6. Miscellanous Candidate Biomarkers 7. Unbiased Methods in LBD Biomarker Discovery 8. Conclusions

over 95% of all paratesticular leiomyosarcomas are located in the spermatic cord or epididymis , and their location in the scrotal skin or subcutaneous tissue is exceptionally rare . it has been suggested that the rarity of leiomyosarcomas of the scrotum is such that the general practitioner would usually see such a tumor once every 20 years . long term follow - up is essential , because of the risk of delayed local recurrence and distant metastasis . a 35-year - old male presented with left - sided exophytic scrotal mass [ figure 1 ] that had been steadily enlarging over last 6 months . it was nontender , firm , nodular and subcutaneous in location , with ulceration of overlying skin . the mass was mobile , and not adherent to the underlying testis , epididymis and spermatic cord . there were no local or systemic signs and symptoms suggestive of any sexually transmitted disease . the clinical differentials considered included warty carcinoma / sarcoma , nodular stage of kaposi sarcoma , leiomyoma with secondary ulceration of the overlying skin and unusually large mass formed by coalesced benign warts . left - sided exophytic scrotal mass with ulceration of overlying skin hematological examination and routine biochemical investigations were within normal range . ultrasound ( usg ) of the mass revealed a well - circumscribed hypoechoic lesion 7 cm 6 cm 3 cm in the subcutaneous plane without any calcification . wide excision of mass was done under general anesthesia , and the specimen was subjected to histopathological examination . on gross examination , the specimen revealed an ulcerated exophytic growth measuring 7 cm 6.5 cm 3 cm [ figure 2a ] . microscopic examination revealed a spindle cell tumor in the subcutaneous location [ figure 3a ] . the tumor cells were arranged in fascicles containing eosinophilic cytoplasm and cigar - shaped nuclei revealing nuclear pleomorphism , prominent nucleoli and 35 mitotic figures per high power field . immunostaining showed the presence of vimentin , desmin and smooth muscle actin [ figure 3c ] . calretinin , cd34 , s 100 and desmin [ figure 3d ] were negative excluding the diagnosis of malignant mesothelioma , fibromatosis , liposarcoma and rhabdomyosarcoma respectively . gross specimen of the tumor revealing an ulcerated exophytic growth measuring 7 cm 6.5 cm 3 cm ( a ) with grey white cut surface ( b ) microphotograph revealing scrotal skin with a tumor mass in the subcutaneous location as highlighted by arrow ( a ; h and e , 40 ) the spindle shaped tumor cells arranged in fascicles , revealed eosinophilic cytoplasm and cigar - shaped nuclei showing nuclear pleomorphism , prominent nucleoli and 35 mitotic figures per high power field along with a few bizarre pleomorphic giant tumor cells ( b ; h and e , 100 ) the tumor cells were positive for smooth muscle actin and negative for desmin ( c and d respectively ; ihc , 200 ) his postoperative period was unremarkable . he was started on six cycles of vincristine , doxorubicin and cyclophosphamide , given three weekly . computerized tomography ( ct scan ) of chest and abdomen was performed to rule out lung and liver involvement , which did not reveal any evidence of metastasis . radiological investigations ( local usg , ct chest , ct abdomen and bone scan ) were repeated at an interval of six months . there were no signs of local recurrence or distant metastasis up to one year of follow up . majority of the paratesticular leiomyosarcomas are located in the spermatic cord or epididymis and their location in the subcutaneous tissue of the scrotum is exceptionally rare with approximately 40 reported cases in the literature . it is mostly diagnosed in the sixth decade , and more than 80% of patients are over 40 years old . like other mesenchymal tumors of this region , leiomyosarcoma manifests as a painless mass without hydrocele and they usually present as firm , rubbery , nontender , irregular masses that tend to be slow - growing tumors and evolve over years . they lack a surrounding capsule so that an excisional biopsy with a macroscopically clear margin will often leave microscopic tumor behind . the size of tumor is usually between 2 and 9 cm with a mean of 5 cm . the etiology of leiomyosarcomas remains unclear , though some authors suggest local irradiation during childhood as a potential cause . confirmation of the diagnosis of leiomyosarcoma is based upon histological examination of biopsy specimen , which reveals spindle cells with cigar - shaped nuclei arranged in interweaving fascicles . the diagnosis of malignancy in leiomyosarcoma is based on the mitotic rate of 210 mitoses / hpf , although the presence of nuclear pleomorphism , vascular invasion , tumor depth , and infiltration and the percentage of tissue necrosis are also considered . on immunohistochemistry , leiomyosarcomas are positive for actin and desmin . other rare tumors , including benign leiomyoma , fibrous mesothelioma , various benign fibrous tumors and pseudotumors , and fibromatosis , should be considered in the differential diagnosis of paratesticular leiomyosarcomas . the mode of spread of leiomyosarcoma is primarily hematogenous to lung , liver , and bone . the prognosis of leiomyosarcoma depends upon the size , depth and grade of the tumor and presence or absence of distant metastases . there is limited data on behavior of leiomyosarcoma presenting in the paratesticular region due to relatively small number of cases reported in the literature . fisher et al . observed that 30% of the patients had recurrence , 30% had metastases ( lymph nodes , lungs , liver ) and 30% died ( all grade 3 tumor patients ) after 4 year follow - up . the tumor should be treated by wide excision with a clear margin of at least 10 mm . there is a place for adjuvant therapy ( radiotherapy / chemotherapy ) in some cases . one of the controversial issues regarding the surgical management of scrotal leiomyosarcomas has been the definition of an adequate resection margin . wide excision of scrotal leiomyosarcomas with a clear margin of at least 10 mm was associated with a better outcome in comparison to tumors with involved margin or < 10 mm clear margin . tumor recurrence or failure of margin clearance necessitate further excision , which is fraught with problems . owing to the small number of patients in the literature , however , it may be effective in the selected group of patients who refuse surgery . it has been further suggested that it might have a role in abrogating the tumor 's hematogenous metastatic potential . chemotherapy with gemcitabine , paclitaxel , vincristine , doxorubicin and actinomycin - d has been used with limited success . it may be noted that chemotherapy or radiotherapy can only be used as adjuvant therapy , and it should not be substituted for radical surgical excision . inguinal lymph node dissection is not advocated , unless a high degree of suspicion is present for lymph node metastasis . since the tendency of hematogenous metastasis is high , the effect of retroperitoneal lymphadenectomy is unclear and generally not suggested . late local recurrence and distant metastases occurs in some cases , therefore long term follow - up is recommended .

paratesticular leiomyosarcoma originates from testicular tunica ( 48% ) , spermatic cord ( 48% ) , epididymis ( 2% ) and dartos muscle , as well as subcutaneous tissue of the scrotum ( 2% ) . leiomyosarcomas of the scrotum , not involving the testis , epididymis or spermatic cord , are rare , and belong to the group of subcutaneous superficial leiomyosarcomas . to the knowledge of the authors , less than 10 cases of leiomyosarcoma of the scrotum have so far been reported from india . the tumor usually presents as a painless , slow - growing scrotal mass in middle - aged or elderly men . the current approach is wide local excision , often with adjuvant therapy . the prognosis is usually good following complete excision , though a local recurrence rate of 40% has been reported . long term follow - up is , therefore , necessary to monitor for recurrence . herein we present the case of 35-year - old male who presented with an exophytic scrotal mass . histopathological and immunohistochemical findings of the mass were consistent with leiomyosarcoma .

INTRODUCTION CASE REPORT DISCUSSION

in the healthy central nervous system ( cns ) , microglial cells are the immune cells belonging to the innate part of the immune system . beneficial functions of microglia include release of trophic and anti - inflammatory factors [ 1 , 2 ] and clearance of cellular debris . in contrast , microglial cells can exhibit detrimental capacities involving overproduction of neurotoxic factors like nitric oxide , superoxide radicals , and tnf- [ 4 , 5 ] . activation of microglia has been implicated in the pathogenesis of a variety of neurodegenerative diseases , including multiple sclerosis , parkinson 's disease , huntington 's disease , and alzheimer 's disease [ 68 ] . activation of microglia and consequent release of proinflammatory and/or cytotoxic factors such as tnf- , il-1 , il-6 , nitric oxide , reactive oxygen species , inducible nitric oxide synthase ( inos ) , and cyclooxygenase-2 ( cox-2 ) are believed to contribute to neurodegenerative processes [ 9 , 10 ] . mechanistically , lps stimulates toll - like receptor 4 ( tlr4 ) to activate nuclear factor-b ( nf-b ) and mitogen - activated protein kinases ( mapks ) family , which are classified into at least three components : extracellular signal - regulated kinases ( erks ) , c - jun n - terminal kinase ( jnk ) , and p38 mapk , which have been implicated in the release of immune - related cytotoxic factors such as inos , cox-2 , and proinflammatory cytokines ( tnf- , il-1 , and il-6 ) [ 11 , 13 ] . as an important intermediate of amino and fatty acid catabolism , bhba like glucose can be used by the brain to provide energy particularly for suckling newborns . gpr109a ( puma - g in mice and hm74a in humans ) is a seven - transmembrane g - protein - coupled receptor of the gi family that is expressed mainly in white adipocytes and immune cells such as monocytes and neutrophils . have proved that hca2 ( gpr109a ) suppresses macrophage proinflammatory function by inhibiting proinflammatory cytokine production , ldl uptake , and chemotaxis . have found that nicotinic acid has anti - inflammatory action in human monocytes via gpr109a . in this study so , we hypothesized that bhba has the potential to act directly on microglia to inhibit proinflammatory proteins that may contribute to its neuroprotective effects in vivo . in the present study , we attempted to elucidate the anti - inflammatory potential of bhba on the inflammatory response induced by lps in murine microglial bv-2 cells . to further investigate the underlying mechanisms , the involvement of ib- , nf-b , and mapks was also examined . the present study provides information revealing bhba as a potential candidate compound with anti - inflammatory actions and suggests a scientific basis for further investigation of bhba against neuroinflammatory conditions . the immortalized mouse microglial cell line bv-2 cells were seeded on 6 cm tissue culture plates and maintained in dmem ( hyclone , logan , ut , usa ) supplemented with 10% ( v / v ) fcs ( hyclone , logan , ut , usa ) and 1% ( v / v ) penicillin / streptomycin solution ( hyclone , logan , ut , usa ) at 37c in 5% co2 atmosphere . the culture medium was changed twice a week and cultures were passaged at 80% confluence after trypsinisation ( 0.05% , w / v ) . changes in cell morphology and growing conditions were carefully monitored using an inverted microscope . to reduce mitogenic effects , bv-2 cells were precultured in serum - free dmem for at least 4 h. six groups of bv-2 cells were subjected to various treatments . in group 1 the cells were treated with 1 g / ml lps ( sigma , st . louis , mo , usa ) . in groups 4 , 5 , and 6 , the cells were treated with 0.5 mm , 1.0 mm , and 1.5 mm bhba for 1 h and then stimulated with lps ( 1 g / ml ) . cell incubations were for 5 min24 h , as indicated in the text . total rna was extracted from the cells using trizol ( invitrogen , carlsbad , ca , usa ) , according to the supplier 's protocol . total rna was then treated with rnase - free dnase i , subsequently quantified by measuring the absorbance at 260 and 280 nm and stored at 80c until analysis . the extracted rna was subjected to a rt - pcr using primescript rt reagent kit with gdna eraser ( takara shuzo co. , ltd . , the mrna levels of various genes were evaluated by quantitative polymerase chain reaction ( qrt - pcr ) analysis using the sybr green quantitect rt - pcr kit ( roche , south san francisco , ca , usa ) , performed in triplicate for each sample . the relative expression levels for inos , cox-2 , tnf- , il-1 , il-6 , and gpr109a were calculated relative to -actin ( the normalizer ) using the comparative cycle threshold method . bv-2 cells seeded in 24-well plates were pretreated with various concentrations of bhba for 1 h followed by stimulation with lps ( 1 g / ml ) for another 24 h. after stimulation , culture media were collected and centrifuged at 13000 rpm for 3 min . the amounts of cytokines in the supernatants for tnf- , il-1 , and il-6 were determined by elisa ( biolegend , san diego , ca , usa ) according to the manufacturer 's instructions . cells were harvested with ice - cold pbs and centrifuged at 14000 g for 3 min at 4c . nuclear and cytosolic extracts were prepared using a nuclear and cytoplasmic protein extraction kit ( beyotime institute of biotechnology , jiangsu , china ) according to the manufacturer 's instructions . concentration of the protein was measured using a bicinchoninic acid protein assay kit ( beyotime co. , china ) . a total of 50 g of protein was resolved onto 10% sds - polyacrylamide gel electrophoresis ( sds - page ) and transferred onto immunoblot polyvinylidene difluoride membranes ( chemicon international , millipore , billerica , ma , usa ) . the blots were blocked with 5% nonfat milk in tris - buffered saline with 0.1% tween ( tbs - t ) for 1 h , washed three times with tbs - t , and incubated overnight at 4c with primary antibodies inos ( 1 : 2000 ) , cox-2 ( 1 : 1000 ) ( abcam , cambridge , ca , usa ) , phospho - erk1/2 ( 1 : 2000 ) , erk1/2 ( 1 : 2000 ) , phospho - p38 ( 1 : 2000 ) , p38 ( 1 : 1000 ) , phospho - jnk ( 1 : 1000 ) , jnk ( 1 : 2000 ) , ib- ( 1 : 1000 ) ( cell signaling technology , danvers , ma , usa ) , nf-b / rela ( 1 : 1000 ) , gpr109a ( 1 : 300 ) , pcna ( the marker of nuclear fraction ) ( 1 : 1000 ) , and -actin ( the marker of cytoplasm fraction ) ( 1 : 2000 ) ( santa cruz biotechnology ) . blots were then washed four times for 15 min each in tbs - t and incubated with horseradish peroxidase - labeled secondary goat anti - rabbit ( 1 : 2000 ; santa cruz biotechnology ) or rabbit anti - goat ( 1 : 2000 ; santa cruz biotechnology ) for 1 h at room temperature . blots were again washed four times for 15 min each in tbs - t . groups were compared by one - way analysis of variance ( anova ) followed by the least significant difference test . a p value of less than 0.05 was considered statistically significant , and values less than 0.01 were considered markedly significant . gpr109a is the functional receptor of bhba , and its mrna ( figure 1(a ) ) and protein ( figure 1(b ) ) were detected in bv-2 cells . inos and cox-2 are two important proinflammatory proteins correlated with lps stimulation in microglia . to investigate the effect of bhba on lps - stimulated microglial activation , bv-2 cells were pretreated with bhba ( 0.5 , 1.0 , and 1.5 mm ) for 1 h and then stimulated with lps ( 1 g / ml ) for 4 h. inos and cox-2 were examined by western blotting and quantitative real - time pcr assay . bhba notably inhibited dose - dependently the increased protein and mrna expression of inos ( figures 2(a)2(c ) ) and cox-2 ( figures 3(a)3(c ) ) stimulated by lps . proinflammatory cytokines ( including tnf- , il-1 , and il-6 ) play important roles in inflammatory process . in order to investigate whether bhba represses the production of these proinflammatory cytokines , bv-2 cells were stimulated with lps ( 1 g / ml ) in the presence or absence of bhba ( 0.5 , 1.0 , and 1.5 mm ) . as shown in figure 4 , the significant increase of gene expression and protein secretion of tnf- ( figures 4(a ) and 4(b ) ) , il-1 ( figures 4(c ) and 4(d ) ) , and il-6 ( figures 4(e ) and 4(f ) ) resulting from the lps stimulation was inhibited by bhba in a dose - dependent manner in bv-2 cells . in order to determine the cytotoxicity of bhba , we investigated the dose effect of bhba on cell viability by mtt assay . bv-2 cells were incubated with various doses of bhba for 24 h. the results of mtt assay showed that bhba , even at a high concentration of 10 mm , did not affect cell viability ( data not shown ) , demonstrating that bhba in noncytotoxic levels in our experiments suppressed lps - induced inflammatory responses in microglia via attenuating expression of inos , cox-2 , and proinflammatory cytokines . ptx is the adp - ribosylating toxin produced by the whooping cough causing bacterium bordetella pertussis . adp - ribosylation of the subunit of heterotrimeric gi proteins locks the subunits into an inactive state ; thus it is unable to inhibit adenylyl cyclase . it is widely applied as a tool in biochemical and pharmacological studies for the investigation of signaling pathways involving heterotrimeric g proteins . in fact , ptx has been used as a tool in studies for action of gpr109a [ 22 , 23 ] . as observed in previous experiments , preincubation with bhba attenuated lps - induced expression of inos ( figure 5(a ) ) , cox-2 ( figure 5(b ) ) , and tnf- ( figure 5(c ) ) , il-1 ( figure 5(d ) ) , and il-6 ( figure 5(e ) ) mrna in the cells of no pretreatment with ptx , but in the cells , which had been pretreated with ptx , this effect was abolished . in order to determine the cytotoxicity of ptx bv-2 cells were incubated with various doses of ptx for 24 h. the results of mtt assay showed that ptx , even at a high concentration of 1 g / ml , did not affect cell viability ( data not shown ) . the nf-b pathway is a key mediator of inflammation and is activated via toll - like receptors ( tlrs ) resulting in increased cytokine and chemokine production . activation of nf-b and release of its subunits play a key role in the early development of neurodegenerative diseases . moreover , transcription of inos , cox-2 , tnf- , il-1 , and il-6 is regulated by the transcription factor nf-b . to further elucidate the mechanisms of bhba on the inhibition of expression of inos , cox-2 , and proinflammatory cytokines in bv-2 cells , the study examined the effect of bhba on nf-b . bv-2 cells were pretreated with bhba ( 1.5 mm ) for 1 h and then stimulated with lps ( 1 g / ml ) for 5 , 15 , 30 , 60 , and 120 min . nuclear and cytosolic extracts were isolated , and nf-b p65 subunits in the nuclear and cytosolic fractions were quantified by western blot . as shown in figure 6 , lps sharply increased the translocation of nf-b p65 from cytosol to nucleus , and this increase was inhibited by pretreatment with bhba ( figures 6(a)6(c ) ) . because the lps - mediated translocation of nf-b to nucleus is preceded by degradation of ib- , we also examined protein levels of ib- by western blot analysis . bhba was found to inhibit the lps - induced degradation of ib- ( figures 6(a ) and 6(d ) ) . these results indicated that bhba suppresses lps - induced inflammatory responses , at least in part , through inhibiting lps - induced nf-b translocation and ib- degradation in bv-2 cells . mapk signaling pathways are known to play an important role in the regulation of inflammatory mediator production . thus , we investigated the effects of bhba on the activation of phosphor - erk , phosphor - jnk , and phosphor - p38 . according to our previous study upon lps stimulation , phosphorylations of erk , p38-mapk , and jnk reached a maximum at 30 min and then decreased gradually in bv-2 cells . then , we conducted treatments of lps for 30 min combined with or without various doses of bhba . unexpectedly , as shown in figure 7 , in the presence of bhba , the increased phosphorylations of erk ( figures 7(a ) and 7(b ) ) , p38-mapk ( figures 7(a ) and 7(c ) ) , and jnk ( figures 7(a ) and 7(d ) ) upon lps stimulation were not attenuated . under conditions of inflammation associated with neurodegenerative diseases , microglial activation is believed to contribute to and/or exacerbate neuronal damage in neurodegenerative diseases [ 25 , 26 ] . since activated microglia produce neurotoxic factors such as ros and proinflammatory cytokines additionally , microglia becomes highly reactive in response to neuronal damage and produces more neurotoxic factors . therefore , inhibition of microglial activation may be a potential therapeutic strategy to reduce neuronal cell death . this study shows , for the first time in murine microglial bv-2 cells , substantial anti - inflammatory effects of bhba . bhba significantly inhibits lps - induced enhancement of expression of proinflammatory enzymes ( inos and cox-2 ) and proinflammatory cytokines ( tnf- , il-1 , and il-6 ) in bv-2 cells , at both mrna and protein levels , providing an underlying mechanism for the neuroprotective effects of bhba in vitro . cox-1 is constitutively expressed in most tissues , while cox-2 is induced during pathophysiological responses by inflammatory stimuli such as lps , il-1 , and various growth factors in microglia and astrocytes [ 27 , 28 ] . reducing the activity of cox-2 can mitigate the progressive loss of dopaminergic neurons as well as the motor deficits caused by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine ( mptp ) neurotoxicity , possibly by suppressing the activation of microglia in the substantia nigra pars compacta ( snpc ) . in addition , the expression of inos and the overproduction of no in microglia are considered to play a significant role in the pathogenesis of various neurodegenerative diseases . for instance , overproduction of no by microglia contributes to the complication of ad and parkinson 's disease [ 30 , 31 ] . therefore , any substance that can attenuate expression of inos and cox-2 would be beneficial for delaying the progression of neurodegenerative disease . in the present study , bhba ( 0.5 , 1.0 , and 1.5 mm ) significantly inhibited the protein and mrna expression of inos and cox-2 in a dose - dependent manner in lps - stimulated bv-2 microglial cells , suggesting possible beneficial effects of bhba by attenuating the activation of microglial cells and subsequent production of inflammatory mediators . microglia activation , in turn , causes release of proinflammatory cytokines , including tnf- , il-1 , and il-6 . in normal circumstances , such response by microglia is protective in fighting off pathogens like bacteria , for example . in contrast , under pathological conditions induced by certain insults , including oxidative stress , excitotoxicity , microglia can be overstimulated and produce excess proinflammatory cytokines that exacerbate neuronal damage in neurodegenerative diseases . this study investigated whether bhba inhibits lps - induced production of proinflammatory cytokines in bv-2 cells . our data suggest that bhba significantly reduces lps - induced protein and mrna expression levels of tnf- , il-1 , and il-6 . these results suggest that bhba has the potential to act directly on microglia to inhibit proinflammatory cytokines that may contribute to its neuroprotective effects in vivo . to further characterize the nature of the inhibitory effect of bhba on proinflammatory proteins production , the nf-b signal transduction pathway , which was activated by lps in microglia , synthesis of cytokines , such as tnf- , il-1 , and il-6 , is mediated by nf-b , as is the expression of cox-2 and inos . in resting cells , nf-b is retained in the cytoplasm by binding to ib-. activation of nf-b occurs via phosphorylation of its endogenous inhibitor ib- that results in the release and nuclear translocation of active nf-b [ 3436 ] . the results suggest that incubation of bv-2 cells with lps cause a marked degradation of cytosolic ib- and nf-b p65 translocation into the nucleus , but pretreatment with bhba significantly inhibited both of the ib- degradation and nf-b p65 nuclear translocation . these results indicate that bhba suppresses lps - induced inflammatory responses , at least in part , through inhibiting lps - induced nf-b translocation and ib- degradation in bv-2 cells . the role of cyclic adenosine monophosphate ( camp ) in this process remains to need further research , as previous studies have given controversial results . it has been shown that bhba decreases lipolysis by inhibition of camp production through gi - mediated secretion of adiponectin in adipose tissue . on the other hand , camp levels are also a key element for activation of immune cells . to date , most studies on the effects of camp on microglia function have focused on its anti - inflammatory effects on fully activated microglia . for example , in lps - activated microglia , agents that increase camp levels decrease inflammatory cytokine release , inhibit phagocytosis , and reduce reactive oxygen [ 3841 ] . from the present results , it appears that camp can also act as a positive regulator of a number of immune function genes , including some normally considered to be proinflammatory . have found that increased bacteria - derived camp within macrophages results in camp response element - binding protein ( creb ) phosphorylation and tnf- production . it has been shown in several systems that lps can increase camp in microglia , and in this regard a subset of camp - induced gene transcription could be viewed as part of a normal inflammatory response . thus , further investigation is necessary to determine whether the mechanism of reduction of nf-b translocation and ib- degradation by bhba is camp dependent . mapks family has been shown to play important roles in lps- induced inos , cox-2 , and proinflammatory cytokines expression in bv-2 cells . therefore , we investigated the effect of bhba on phosphorylation of three mapks induced by lps in bv-2 cells . unexpectedly , in the presence of bhba , the increased phosphorylations of jnk , erk , and p38-mapk upon lps stimulation were not attenuated . these results suggest that bhba- mediated attenuation of proinflammatory mediators is not associated with downregulation of the mapk signaling pathway . in summary , the results of this study provide evidence that bhba might exhibit its anti - inflammatory effects via activating gpr109a and suppressing nf-b translocation and ib- degradation . this finding provides a new molecular insight into the mechanism by which bhba exerts its anti - inflammatory function . arising from the above , we suggest that bhba might be a strong candidate for treatment of neurodegenerative diseases .

-hydroxybutyric acid ( bhba ) has neuroprotective effects , but the underlying molecular mechanisms are unclear . microglial activation plays an important role in neurodegenerative diseases by producing several proinflammatory enzymes and proinflammatory cytokines . the current study investigates the potential mechanisms whereby bhba affects the expression of potentially proinflammatory proteins by cultured murine microglial bv-2 cells stimulated with lipopolysaccharide ( lps ) . the results showed that bhba significantly reduced lps - induced protein and mrna expression levels of inos , cox-2 , tnf- , il-1 , and il-6 . blocking of gpr109a by ptx resulted in a loss of this anti - inflammatory effect in bv-2 cells . western blot analysis showed that bhba reduced lps - induced degradation of ib- and translocation of nf-b , while no effect was observed on mapks phosphorylation . all results imply that bhba significantly reduces levels of proinflammatory enzymes and proinflammatory cytokines by inhibition of the nf-b signaling pathway but not mapks pathways , and gpr109a is essential to this function . overall , these data suggest that bhba has a potential as neuroprotective drug candidate in neurodegenerative diseases .

1. Introduction 2. Methods 3. Results 4. Discussion