Update README.md

README.md

@@ -1,3 +1,55 @@
----
-license: apache-2.0
----
+---
+license: apache-2.0
+tags:
+- pretrained
+- mistral
+- DNA
+---
+
+# Model Card for Mistral-DNA-v1-1.6B-hg38 (Mistral for protein)
+
+The Mistral-DNA-v1-1.6B-hg38 Large Language Model (LLM) is a pretrained generative DNA sequence model with 1.6B parameters. 
+It is derived from Mixtral-8x7B-v0.1 model, which was simplified for DNA: the number of layers and the hidden size were reduced. 
+The model was pretrained using 10kb DNA sequences from the hg38 human genome assembly. 
+
+## Model Architecture
+
+Like Mixtral-8x7B-v0.1, it is a transformer model, with the following architecture choices:
+- Grouped-Query Attention
+- Sliding-Window Attention
+- Byte-fallback BPE tokenizer
+- Mixture of Experts
+
+## Load the model from huggingface:
+
+```
+import torch
+from transformers import AutoTokenizer, AutoModel
+
+tokenizer = AutoTokenizer.from_pretrained("RaphaelMourad/Mistral-DNA-v1-1.6B-hg38", trust_remote_code=True) 
+model = AutoModel.from_pretrained("RaphaelMourad/Mistral-DNA-v1-1.6B-hg38", trust_remote_code=True)
+```
+
+## Calculate the embedding of a protein sequence
+
+```
+insulin = "TGATGATTGGCGCGGCTAGGATCGGCT"
+inputs = tokenizer(insulin, return_tensors = 'pt')["input_ids"]
+hidden_states = model(inputs)[0] # [1, sequence_length, 256]
+
+# embedding with max pooling
+embedding_max = torch.max(hidden_states[0], dim=0)[0]
+print(embedding_max.shape) # expect to be 256
+```
+
+## Troubleshooting
+
+Ensure you are utilizing a stable version of Transformers, 4.34.0 or newer.
+
+## Notice
+
+Mistral-DNA-v1-1.6B-hg38 is a pretrained base model for DNA.
+
+## Contact
+ 
+Raphaël Mourad. raphael.mourad@univ-tlse3.fr