Add Plant DNAGemma model for promoter strength in protoplast prediction
Browse files- README.md +63 -3
- config.json +36 -0
- model.safetensors +3 -0
- special_tokens_map.json +30 -0
- tokenizer.json +0 -0
- tokenizer_config.json +49 -0
README.md
CHANGED
@@ -1,3 +1,63 @@
|
|
1 |
-
---
|
2 |
-
license: cc-by-nc-sa-4.0
|
3 |
-
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
1 |
+
---
|
2 |
+
license: cc-by-nc-sa-4.0
|
3 |
+
widget:
|
4 |
+
- text: AGTCCAGTGGACGACCAGCCACGGCTCCGGTCTGTAGAACCATCGCGGAAACGGCTCGCAAAACTCTAAACAGCGCAAACGATGCGCGCGCCGAAGCAACCCGGCTCTACTTATAAAAACGTCCAACGGTGAGCACCGAGCAGCTACTACTCGTACTCCCCCCACCGATC
|
5 |
+
tags:
|
6 |
+
- DNA
|
7 |
+
- biology
|
8 |
+
- genomics
|
9 |
+
---
|
10 |
+
# Plant foundation DNA large language models
|
11 |
+
|
12 |
+
The plant DNA large language models (LLMs) contain a series of foundation models based on different model architectures, which are pre-trained on various plant reference genomes.
|
13 |
+
All the models have a comparable model size between 90 MB and 150 MB, BPE tokenizer is used for tokenization and 8000 tokens are included in the vocabulary.
|
14 |
+
|
15 |
+
|
16 |
+
**Developed by:** zhangtaolab
|
17 |
+
|
18 |
+
### Model Sources
|
19 |
+
|
20 |
+
- **Repository:** [Plant DNA LLMs](https://github.com/zhangtaolab/plant_DNA_LLMs)
|
21 |
+
- **Manuscript:** [Versatile applications of foundation DNA large language models in plant genomes]()
|
22 |
+
|
23 |
+
### Architecture
|
24 |
+
|
25 |
+
The model is trained based on the Google Gemma model with modified tokenizer specific for DNA sequence.
|
26 |
+
|
27 |
+
This model is fine-tuned for predicting promoter strength in maize protoplasts system.
|
28 |
+
|
29 |
+
|
30 |
+
### How to use
|
31 |
+
|
32 |
+
Install the runtime library first:
|
33 |
+
```bash
|
34 |
+
pip install transformers
|
35 |
+
```
|
36 |
+
|
37 |
+
Here is a simple code for inference:
|
38 |
+
```python
|
39 |
+
from transformers import AutoModelForSequenceClassification, AutoTokenizer, pipeline
|
40 |
+
|
41 |
+
model_name = 'plant-dnagemma-promoter_strength_protoplast'
|
42 |
+
# load model and tokenizer
|
43 |
+
model = AutoModelForSequenceClassification.from_pretrained(f'zhangtaolab/{model_name}', trust_remote_code=True)
|
44 |
+
tokenizer = AutoTokenizer.from_pretrained(f'zhangtaolab/{model_name}', trust_remote_code=True)
|
45 |
+
|
46 |
+
# inference
|
47 |
+
sequences = ['TACTCTAATCGTATCAGCTGCACTTGCGTACAGGCTACCGGCGTCCTCAGCCACGTAAGAAAAGGCCCAATAAAGGCCCAACTACAACCAGCGGATATATATACTGGAGCCTGGCGAGATCACCCTAACCCCTCACACTCCCATCCAGCCGCCACCAGGTGCAGAGTGTT',
|
48 |
+
'ATTTCAAAACTAGTTTTCTATAAACGAAAACTTATATTTATTCCGCTTGTTCCGTTTGATCTGCTGATTCGACACCGTTTTAACGTATTTTAAGTAAGTATCAGAAATATTAATGTGAAGATAAAAGAAAATAGAGTAAATGTAAAGGAAAATGCATAAGATTTTGTTGA']
|
49 |
+
pipe = pipeline('text-classification', model=model, tokenizer=tokenizer,
|
50 |
+
trust_remote_code=True, function_to_apply="none")
|
51 |
+
results = pipe(sequences)
|
52 |
+
print(results)
|
53 |
+
|
54 |
+
```
|
55 |
+
|
56 |
+
|
57 |
+
### Training data
|
58 |
+
We use GemmaForSequenceClassification to fine-tune the model.
|
59 |
+
Detailed training procedure can be found in our manuscript.
|
60 |
+
|
61 |
+
|
62 |
+
#### Hardware
|
63 |
+
Model was trained on a NVIDIA GTX1080Ti GPU (11 GB).
|
config.json
ADDED
@@ -0,0 +1,36 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
1 |
+
{
|
2 |
+
"_name_or_path": "Plant_DNAGemma_promoter_strength_protoplast",
|
3 |
+
"architectures": [
|
4 |
+
"GemmaForSequenceClassification"
|
5 |
+
],
|
6 |
+
"attention_bias": false,
|
7 |
+
"attention_dropout": 0.0,
|
8 |
+
"bos_token_id": 2,
|
9 |
+
"eos_token_id": 1,
|
10 |
+
"head_dim": 256,
|
11 |
+
"hidden_act": "gelu_pytorch_tanh",
|
12 |
+
"hidden_activation": "gelu_pytorch_tanh",
|
13 |
+
"hidden_size": 768,
|
14 |
+
"id2label": {
|
15 |
+
"0": "Promoter strength in tobacco leaves"
|
16 |
+
},
|
17 |
+
"initializer_range": 0.02,
|
18 |
+
"intermediate_size": 3072,
|
19 |
+
"label2id": {
|
20 |
+
"Promoter strength in tobacco leaves": 0
|
21 |
+
},
|
22 |
+
"max_position_embeddings": 1024,
|
23 |
+
"model_type": "gemma",
|
24 |
+
"num_attention_heads": 12,
|
25 |
+
"num_hidden_layers": 12,
|
26 |
+
"num_key_value_heads": 1,
|
27 |
+
"pad_token_id": 0,
|
28 |
+
"problem_type": "regression",
|
29 |
+
"rms_norm_eps": 1e-06,
|
30 |
+
"rope_scaling": null,
|
31 |
+
"rope_theta": 10000.0,
|
32 |
+
"torch_dtype": "float32",
|
33 |
+
"transformers_version": "4.39.1",
|
34 |
+
"use_cache": true,
|
35 |
+
"vocab_size": 8002
|
36 |
+
}
|
model.safetensors
ADDED
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
1 |
+
version https://git-lfs.github.com/spec/v1
|
2 |
+
oid sha256:ed4a762b65b0972f43dd3da9531cc4ac07bc56c736c182bbec6e50acd9c2a861
|
3 |
+
size 609779736
|
special_tokens_map.json
ADDED
@@ -0,0 +1,30 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
1 |
+
{
|
2 |
+
"bos_token": {
|
3 |
+
"content": "<bos>",
|
4 |
+
"lstrip": false,
|
5 |
+
"normalized": false,
|
6 |
+
"rstrip": false,
|
7 |
+
"single_word": false
|
8 |
+
},
|
9 |
+
"eos_token": {
|
10 |
+
"content": "<eos>",
|
11 |
+
"lstrip": false,
|
12 |
+
"normalized": false,
|
13 |
+
"rstrip": false,
|
14 |
+
"single_word": false
|
15 |
+
},
|
16 |
+
"pad_token": {
|
17 |
+
"content": "<pad>",
|
18 |
+
"lstrip": false,
|
19 |
+
"normalized": false,
|
20 |
+
"rstrip": false,
|
21 |
+
"single_word": false
|
22 |
+
},
|
23 |
+
"unk_token": {
|
24 |
+
"content": "<unk>",
|
25 |
+
"lstrip": false,
|
26 |
+
"normalized": false,
|
27 |
+
"rstrip": false,
|
28 |
+
"single_word": false
|
29 |
+
}
|
30 |
+
}
|
tokenizer.json
ADDED
The diff for this file is too large to render.
See raw diff
|
|
tokenizer_config.json
ADDED
@@ -0,0 +1,49 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
1 |
+
{
|
2 |
+
"add_bos_token": true,
|
3 |
+
"add_eos_token": false,
|
4 |
+
"added_tokens_decoder": {
|
5 |
+
"0": {
|
6 |
+
"content": "<pad>",
|
7 |
+
"lstrip": false,
|
8 |
+
"normalized": false,
|
9 |
+
"rstrip": false,
|
10 |
+
"single_word": false,
|
11 |
+
"special": true
|
12 |
+
},
|
13 |
+
"1": {
|
14 |
+
"content": "<eos>",
|
15 |
+
"lstrip": false,
|
16 |
+
"normalized": false,
|
17 |
+
"rstrip": false,
|
18 |
+
"single_word": false,
|
19 |
+
"special": true
|
20 |
+
},
|
21 |
+
"2": {
|
22 |
+
"content": "<bos>",
|
23 |
+
"lstrip": false,
|
24 |
+
"normalized": false,
|
25 |
+
"rstrip": false,
|
26 |
+
"single_word": false,
|
27 |
+
"special": true
|
28 |
+
},
|
29 |
+
"3": {
|
30 |
+
"content": "<unk>",
|
31 |
+
"lstrip": false,
|
32 |
+
"normalized": false,
|
33 |
+
"rstrip": false,
|
34 |
+
"single_word": false,
|
35 |
+
"special": true
|
36 |
+
}
|
37 |
+
},
|
38 |
+
"bos_token": "<bos>",
|
39 |
+
"clean_up_tokenization_spaces": false,
|
40 |
+
"eos_token": "<eos>",
|
41 |
+
"legacy": null,
|
42 |
+
"model_max_length": 512,
|
43 |
+
"pad_token": "<pad>",
|
44 |
+
"sp_model_kwargs": {},
|
45 |
+
"spaces_between_special_tokens": false,
|
46 |
+
"tokenizer_class": "GemmaTokenizer",
|
47 |
+
"unk_token": "<unk>",
|
48 |
+
"use_default_system_prompt": false
|
49 |
+
}
|