new_pdfs/10.1016_j.bja.2018.04.034.txt

British Journal of Anaesthesia, 121 (2): 406e416 (2018)

doi: 10.1016/j.bja.2018.04.034

Advance Access Publication Date: 5 June 2018

Neuroscience and Neuroanaesthesia

Role of epigenetic mechanisms in transmitting the effects of neonatal sevoflurane exposure to the next

generation of male, but not female, rats L.-S. Ju1, J.-J. Yang1, T. E. Morey1, N. Gravenstein1,2, C. N. Seubert1, J. L. Resnick3, J.-Q. Zhang4 and A. E. Martynyuk1,2,*

1Department of Anesthesiology, University of Florida College of Medicine, Gainesville, FL, USA, 2The McKnight Brain Institute, University of Florida College of Medicine, Gainesville, FL, USA, 3Department of Molecular Genetics and Microbiology, University of Florida College of Medicine, Gainesville, FL, USA and 4Department of Anesthesiology, Zhengzhou University, Zhengzhou, China

Corresponding author. E-mail: amartynyuk@anest.ufl.edu

This article is accompanied by an editorial: A poisoned chalice: the heritage of parental anaesthesia exposure by Vutskits et al., Br J Anesth 2018:121:337e339, doi: 10.1016/j.bja.2018.05.013.

Abstract

Background: Clinical studies report learning disabilities and attention-deficit/hyperactivity disorders in those exposed to general anaesthesia early in life. Rats, primarily males, exposed to GABAergic anaesthetics as neonates exhibit behav- ioural abnormalities, exacerbated responses to stress, and reduced expression of hypothalamic K (Kcc2). The latter is implicated in development of psychiatric disorders, including male predominant autism spectrum disorders. We tested whether parental early life exposure to sevoflurane, the most frequently used anaesthetic in pae- diatrics, affects the next generation of unexposed rats. Methods: Offspring (F1) of unexposed or exposed to sevoflurane on postnatal day 5 Sprague-Dawley rats (F0) were subjected to behavioural and brain gene expression evaluations. Results: Male, but not female, progeny of sevoflurane-exposed parents exhibited abnormalities in behavioural testing and Kcc2 expression. Male F1 rats of both exposed parents exhibited impaired spatial memory and expression of hip- pocampal and hypothalamic Kcc2. Offspring of only exposed sires had abnormalities in elevated plus maze and prepulse inhibition of startle, but normal spatial memory and impaired expression of hypothalamic, but not hippocampal, Kcc2. In contrast to exposed F0, their progeny exhibited normal corticosterone responses to stress. Bisulphite sequencing revealed increased CpG site methylation in the Kcc2 promoter in F0 sperm and F1 male hippocampus and hypothalamus that was in concordance with the changes in Kcc2 expression in specific F1 groups. Conclusions: Neonatal exposure to sevoflurane can affect the next generation of males through epigenetic modification of Kcc2 expression, while F1 females are at diminished risk.

þ

(cid:2)

(cid:2)

2Cl

Cl

Keyword: anesthesia; DNA methylation; heredity; neurodevelopmental disorders; pediatrics

Editorial decision: 2 May 2018; Accepted: 2 May 2018 © 2018 British Journal of Anaesthesia. Published by Elsevier Ltd. All rights reserved. For Permissions, please email: permissions@elsevier.com

exporter

406

Editor’s key points

(cid:5) Early exposure to general anaesthetics can result in persistent cognitive dysfunction in adult animals, but effects on their offspring are unknown.

(cid:5) Offspring of rats exposed to sevoflurane as neonates were investigated for behavioural abnormalities, changes in brain gene expression and deoxyribonucleic acid methylation in the genes’ promoters.

(cid:5) Adult male, but not female, progeny of rats neonatally exposed to sevoflurane exhibited abnormalities in epigenetic regulation, gene expression and behaviour.

Most retrospective epidemiological studies of neurocognitive function in older children who had general anaesthesia early in life have found significant deficiencies.1 Considering the compelling animal data, the US Food and Drug Administration recommended avoiding, when possible, anaesthesia in chil- dren <3 yr old, and emphasised the pressing need for further research.2 The full range of neonatal anaesthesia-induced abnormalities, the mechanisms involved, and the role of sex remain poorly understood even in exposed animals.3

We have found that rats exposed as neonates to sevoflurane, propofol, or etomidate, anaesthetics with clinically important effects on GABA type A receptors (GABAAR), exhibit behavioural deficiencies and exacerbated hypothalamic-pituitary adrenal (HPA) axis responses to stress.4e8 These anaesthetic-induced abnormalities are greater in male rats and reminiscent of those induced by excessive postnatal stress.9e11 Anaesthetic- enhanced GABAAR signalling, which is depolarising/stimula- tory during early life because of a high Na (NKCC1)/ co-transporter ratio,12e14 could play an K important role in initiating and mediating these abnormalities. Thus, NKCC1 inhibition before anaesthesia was protective, whereas anaesthetised neonatal rats had hypothalamic upre- gulated Nkcc1 and downregulated Kcc2 messenger ribonucleic acid (mRNA) concentrations even in adulthood.7,8

þ

þ

(cid:2)

K

2Cl

þ

(cid:2)

(cid:2)

2Cl

(KCC2) Cl

During the second postnatal week, GABAAR-mediated neuronal signalling undergoes a fundamental transition from predominantly depolarising/stimulatory to inhibitory caused by concomitant developmental downregulation of NKCC1 and, most importantly, upregulation of neuron-specific KCC2. This shift is brain region- and sex-dependent, occurring earlier in females.12e14 Anaesthetic-induced delay in the developmental NKCC1/KCC2 ratio maturation could have serious conse- quences for brain functioning as delay/impairment in NKCC1/ KCC2 ratio maturation has been linked to neuropsychiatric disorders, including autism spectrum disorders (ASD) and schizophrenia, which predominate in males.15e17 A growing number of studies point to co-occurrence of ASD and attention-deficit/hyperactivity disorder (ADHD). Thus, 50e70% of those with ASD exhibit ADHD symptoms, whereas 15e25% of children with ADHD have symptoms of ASD.18 Importantly, clinical studies report significant increases in ADHD in those who had medical procedures early in life that required expo- sure to general anaesthesia, with repeated exposures being a prognostic factor for more severe outcome.2

Recent studies in rodents demonstrate that the develop- mental effects of excessive stress early in life can be carried to the next generation or beyond, presumably by epigenetic mechanisms such as non-coding RNAs and deoxyribonucleic

Multigenerational developmental effects of sevoflurane - 407

acid (DNA) methylation.19e21 We have found that rats exposed as neonates to sevoflurane exhibited increased expression of hippocampal DNA methyltransferases, in addition to abnor- malities at the synaptic and behavioural levels.22 These en- zymes catalyse DNA methylation at the 5 position of cytosine residues adjacent to guanines (CpG sites), typically leading to long-term transcriptional repression. To investigate whether neonatal exposure to sevoflurane affects exposed parents and their unexposed progeny, neonatal male and female rats were exposed to 6 h of anaesthesia with sevoflurane, and their progeny were tested for inherited behavioural and molecular alterations.

0

Methods

Animals

All experimental procedures were approved by the University of Florida Institutional Animal Care and Use Committee. Sprague-Dawley rats were housed under controlled illumina- tion (12-h light/dark, lights on at 7:00AM) and temperature (23e24 C) with free access to food and water. Within 24 h of delivery, litters were culled to 12 pups. At 21 postnatal days (P21), pups were weaned and housed in sex-matched groups of two for the rest of the study.

(cid:3)

Treatment groups

The P5 male and female rat pups were kept in a temperature- controlled chamber (37ºC) with a continuous supply of 30% (cid:2)1) during anaesthesia with 6 vol% oxygen in air (1.5 L min sevoflurane for 3 min for induction and 2.1 vol% sevoflurane for 357 min as maintenance (sevoflurane group). Previously, we have shown that blood glucose and gas levels after 2.1% sevo- flurane for 6 h were in the normal range.4 Control F0 animals were subjected to animal facility rearing only (control group). The F0 male and female rats were sequentially evaluated on the elevated plus maze (EPM) starting on P60, for prepulse inhibition (PPI) of the acoustic startle response on P70, and for corticosterone responses to physical restraint for 30 min on (cid:4)P160 followed by isolation of brain and gamete tissue sam- ples for further analyses (Fig. 1). Twenty-four F0 males and 24 females were mated on ~P90 to produce the F1 generation. F0 breeders were randomised into one of the following four groups for mating: 1) control malesþcontrol females (con- M*con-F); 2) exposed malesþcontrol females (sevo-M*con-F); 3) control malesþexposed females (con-M*sevo-F); and 4) exposed malesþexposed females (sevo-M*sevo-F). The female was kept alone throughout the entire gestation and post- partum rearing periods. The F1 rats, 144 in total [n¼18 per sex (two) per group (four)], which were subjected to facility rearing only, were evaluated in the EPM starting on P60, PPI of startle on P70, Morris water maze (MWM) testing starting on P79, and for the corticosterone responses to restraint for 30 min on (cid:4)P90, followed by isolation of brain tissue samples for further analyses. A separate cohort of F1 rats was sacrificed on P5 to collect brain tissue for bisulphite sequencing.

Basal and stress-induced activity of the HPA axis Blood samples (~300 mL) were collected at rest and 10, 60, and 120 min after the restraint, as previously described.7 Serum corticosterone was measured using commercial ELISA kits (Cayman Chemical Company, Ann Arbor, MI, USA) following the manufacturer’s instructions.7,8

408 -

Ju et al.

Fig 1. Study design. EPM, elevated plus maze; PPI, prepulse inhibition; MWM, Morris water maze.

Behavioural tests

The EPM, acoustic startle response, PPI of startle, and MWM tests were performed as previously described.4e8

Tissue collection

vector with the TOPO TA cloning kit for sequencing (Life Technologies, Carlsbad, CA, USA). Miniprep was performed on each positive clone using ZR Plasmid Miniprep kit (Zymo Research). Sanger sequencing was done by Genewiz (South Plainfield, NJ, USA) using M13R primers. The DNA methylation status of all CpG sites was analysed using Benchling Molecular Biology 2.0 Software (Benchling, San Francisco, CA, USA).

Adult rats were anaesthetised with sevoflurane and decapi- tated. Whole brains were removed and immediately put in a stainless steel adult rat brain slicer matrix with 0.5 mm coro- nal section slice intervals (Zivic Instruments, Pittsburgh, PA, USA). Hypothalamic paraventricular nucleus (PVN) tissue was punched out with a 1-mm ID glass capillary tube. The hippo- campus was isolated from the respective slices. Tissues were placed in vials filled with RNAlater solution (Invitrogen, Carlsbad, CA, USA) and stored at (cid:2)80 C. Sperm were isolated from the caudal epididymis of adult males and stored at (cid:2)80 C. After separation from the adipose tissues, ovaries were stored at (cid:2)80(cid:3)C.

(cid:3)

(cid:3)

Analyses of mRNA levels for Nkcc1, Kcc2, and glucocorticoid receptors (Gr)

The mRNA levels for Nkcc1, Kcc2 in the PVN of the hypothala- mus and hippocampus, and for Gr in the hippocampus were analysed via qRTePCR as previously described.7,8

Bisulphite sequencing

Genomic DNA was extracted from the sperm pellet and ovaries of adult F0 rats and from hippocampal and hypotha- lamic tissues of P5 F1 rats using the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany). The sodium bisulfite conversion was performed with EZ DNA Methylation kits (Zymo Research, Irvine, CA, USA) following the manufacturer’s instructions. The primers (Nkcc1: forward: GAGAGGAGTTTATAGGGTT; reverse: AACCCTAC(A/G)CTAACCAACCTC; Kcc2: forward: GATTGTAAGTGTTTTTATTATTGAGTTGTATATT; reverse: AATAAACTTTTCCCCTTTTATACCC) were designed for the bisulfite-converted DNA sequences, using previously pub- lished sequences.23,24 PCR amplification was performed with HotStar Taq (Qiagen). Amplicons were cloned into pCR4-TOPO

Statistical analysis

Values are reported as mean (standard deviation). Statistical analyses were carried out on raw data using SigmaPlot 13.0 software (Systat Software, Inc., San Jose, CA, USA). To assess differences in total corticosterone concentration, EPM behav- iour and gene expression for Nkcc1, Kcc2, and Gr, t-test and one way analysis of variance (ANOVA) were used for F0 and F1 generations, respectively. Two way ANOVA with experimental groups and time as the independent variables was run to analyse changes in serum corticosterone concentrations at rest and at three time points after the restraint. Two way ANOVA was used to analyse the PPI data, with the treatment and prepulse intensity as independent variables, and the MWM latencies to escape data, with experimental groups and days of training as the independent variables. One-way ANOVA was used to analyse time spent in the target quad- rant and numbers of crossings during the MWM probe test. Two way measures ANOVA with treatment as ‘between’- subject factor and CpG site as ‘within’-subject factor was used to analyse the frequency methylation of CpG sites. Multiple pairwise comparisons were done with the Holm-Sidak method. All comparisons were run as two-tailed tests. A P value <0.05 was considered significant. The sample sizes in this study were based on previous experience with the same experimental techniques.6-8

Results

Neuroendocrine and behavioural abnormalities in F0 rats

Adult F0 rats, exposed to sevoflurane as neonates, had significantly higher total corticosterone responses to restraint

Multigenerational developmental effects of sevoflurane - 409

stress compared with F0 controls [males, t(8)¼(cid:2)8.09, P<0.001; and females, t(8)¼(cid:2)3.05, P¼0.015]. These increases in cortico- sterone responses were because of higher concentrations of corticosterone 10 min after restraint (P<0.001, males, Fig. 2a and b; and P<0.001, females, Fig. 2c and d).

The F0 male rats, exposed to sevoflurane as neonates, spent a shorter time in open arms [t(20)¼2.67, P¼0.015, Fig. 2e] and travelled shorter distances during the EPM test [t(20)¼2.27, P¼0.034, Fig. 2f]. In F0 females, there was no significant between-subjects effect of neonatal sevoflurane exposure on time spent in open arms and distance travelled during the EPM test (Fig. 2g and h).

There were significant effects of neonatal exposure to sevoflurane on PPI of startle in adult F0 rats [F(1,66)¼14.80, P<0.001, males, Fig. 2i; and F(1,66)¼9.13, P¼0.004, females, Fig. 2j]. Startle stimuli by themselves caused similar responses in the control and sevoflurane groups of F0 male and female rats.

Hypothalamic and hippocampal Nkcc1/Kcc2 mRNA ratios in F0 rats

The F0 male rats from the sevoflurane group had increased Nkcc1 mRNA levels [t(11)¼(cid:2)3.29, P¼0.007, Fig. 3a] and decreased Kcc2 mRNA levels [t(11)¼2.24, P¼0.047, Fig. 3b] in the PVN of the hypothalamus, resulting in significantly increased Nkcc1/Kcc2 mRNA ratios [t(11)¼(cid:2)6.97, P<0.001, Fig. 3c]. The F0 female rats from the sevoflurane group had increased Nkcc1 mRNA levels [t(10)¼(cid:2)2.91, P¼0.016, Fig. 3d], but not significantly altered Kcc2 mRNA levels (Fig. 3e) in the PVN of the hypothalamus. Still, the resulting Nkcc1/Kcc2 mRNA ratios in sevoflurane exposed F0 females were increased [t(10)¼(cid:2)3.17, P¼0.01, Fig. 3f]. In the hippocampus of F0 male rats from the sevoflurane group, only Kcc2 mRNA levels were reduced [t(10)¼4.17, P¼0.002, Fig. 3h]. Overall, changes in hippocampal Kcc2 mRNA and Nkcc1 mRNA resulted in an increased Nkcc1/Kcc2 mRNA ratio in F0 males [t(10)¼(cid:2)3.27, P¼0.008, Fig. 3i]. In contrast, hippocampal mRNA

Fig 2. Adult F0 rats, exposed to sevoflurane on postnatal Day 5, exhibited exacerbated corticosterone responses to physical restraint for 30 min, impaired behaviour in the elevated plus maze (EPM) and reduced prepulse inhibition (PPI) of startle. Shown are the respective concentrations of serum corticosterone across each collection point, and the total corticosterone response in male (a, b) and female (c, d) rats. To assess differences in total corticosterone concentrations, area under the curve in respect to ground (concentrations of cortico- sterone at rest were taken as a ground), was calculated. Data are means [standard deviation (SD)] from five rats per treatment group. (eeh) Shown are time (%) spent in open arms of the EPM and distance travelled by male (e, f) and female (g, h) rats. Data are means (SD) from 11 male and 12 female rats per treatment group. (i, j) Shown are %PPI responses in male (i) and female (j) rats. Data are means (SD) from 12 rats per treatment group. Colour coding in (eeh) is applicable to all figures. *P<0.05 vs control.

410 -

Ju et al.

þ

þ

(cid:2)

þ

(cid:2)

(Kcc2) and glucocorticoid receptors (Gr) in the paraventricular nucleus (PVN) of the Fig 3. Gene expression of Na hypothalamus and hippocampus of adult F0 rats, exposed to sevoflurane on postnatal Day 5. Shown are the respective levels of Nkcc1 messenger ribonucleic acid (mRNA), Kcc2 mRNA and the resulting Nkcc1/Kcc2 mRNA ratios in the PVN of the hypothalamus of males (aec) and females (def) and in the hippocampus of males (gei) and females (jel). Data normalised against control are means [standard deviation (SD)] from a minimum of six rats per treatment group (n¼7, male sevoflurane group, hypothalamus). (m, n) Shown are levels of Gr mRNA in the hippocampus of male (m) and female (n) rats. Data normalised against control are means (SD) from six rats per treatment group. Colour coding in m and n is applicable to all figures. *P<0.05 vs control.

K

2Cl

(Nkcc1), K

2Cl

levels for Nkcc1, Kcc2, and Nkcc1/Kcc2 were similar in control and sevoflurane exposed F0 female rats (Fig. 3jel). The hip- pocampal levels of Gr mRNA were similar in control and sev- oflurane exposed F0 male (Fig. 3m) and female rats (Fig. 3n).

Behavioural abnormalities and corticosterone responses to stress in F1 rats

Serum concentrations of corticosterone in male and female rats from the F1 generation were not different among all experimental groups within the same sex (Fig. 4aed).

In F1 males, there was a significant between-subjects effect of parental neonatal exposure to sevoflurane on time spent in

open arms [F(3,67)¼3.51, P¼0.02; Fig. 4e], but there was no sig- nificant effect on distance travelled (Fig. 4f) during the EPM test. Only F1 male progeny of exposed males and unexposed females spent shorter time in open arms of the EPM. The time spent in open arms and distance travelled during the EPM test were not different amongst all experimental groups of F1 fe- male rats (Fig. 4g and h).

There was a significant effect of parental sevoflurane exposure on PPI of startle responses in F1 male rats [F(3,204)¼9.19, P<0.001; Fig. 4i]. Only male progeny of exposed sires exhibited reduced PPI of startle at PP3 (P¼0.014 vs F1 males of con-M*con-F), and PP6 (P¼0.007 vs F1 males of con- M*con-F). There was no significant treatment effect on PPI of

Multigenerational developmental effects of sevoflurane - 411

Fig 4. F1 male, but not female, offspring of sires exposed to sevoflurane on postnatal Day 5, exhibit behavioural abnormalities, while both F1 females and F1 males had normal corticosterone responses to stress. Shown are the respective concentrations of serum corticosterone across each collection point, and the total corticosterone responses in male (a, b) and female (c, d) F1 rats. To assess differences in total corticosterone concentrations, area under the curve in respect to ground (concentrations of corticosterone at rest were taken as a ground), was calculated. Data are means [standard deviation (SD)] from six animals per treatment group. Shown are % of time spent in open arms of the elevated plus maze (EPM) and distance travelled by male (e, f) and female (g, h) F1 rats. Data are means (SD) typically from 18 animals per treatment group (n¼17, male con-M*con-F group). (i, j) Shown are %PPI responses at prepulse intensity (PP) of 3 dB, 6 dB, and 12 dB in male (i) and female (j) F1 rats. Data are means (SD) from 18 rats per treatment group. (k) Plots showing the values of escape latencies during the 5-day training period from P80 to P84 for F1 male rats. (l, m) Histograms showing the time spent in the target quadrant and the number of times the rat crossed the previous location of the escape platform. (nep) Shown are respective data for F1 female rats collected during the Morris water maze (MWM) tests. Data are means (SD) from 18 animals per treatment group. Colour coding in (eeh) is applicable to all figures. *P<0.05 vs F1 males from the con-M*con-F group.

412 -

Ju et al.

startle in F1 female rats (Fig. 4j). The startle amplitudes were similar among all experimental groups of F1 male and F1 fe- male rats.

Hypothalamic and hippocampal Nkcc1/Kcc2 mRNA ratios and hippocampal Gr mRNA levels in F1 rats

In males, the MWM test showed no significant between- subjects effect of parental sevoflurane exposure on the escape latencies across the 5-day training period, but there was a significant within-subjects effect of day of training [F(4,272)¼30.03, P<0.001; Fig. 4k]. There were significant effects of parental sevoflurane exposure on time in the target quad- rant [F(3,68)¼2.75, P¼0.049; Fig. 4l] and times of crossing over the platform [F(3,68)¼3.06, P¼0.034; Fig. 4m]. Only male offspring of both exposed parents spent significantly shorter time in the target quadrant (P¼0.04 vs F1 males of con-M*con-F) and made less crossings over the former platform (P¼0.04 vs F1 males of con-M*con-F). There were no significant group effects in the MWM tests of F1 female rats (Fig. 4nep).

In F1 males there was a significant between-subjects effect of sevoflurane exposure on Nkcc1 mRNA levels parental [F(3,22)¼4.55, P¼0.013, Fig. 5a], Kcc2 mRNA levels [F(3,22)¼13.53, P<0.001, Fig. 5b], and the Nkcc1/Kcc2 mRNA ratios [F(3,22)¼5.68, P¼0.005, Fig. 5c] in the PVN of the hypothalamus. In contrast, F1 females showed no such between-subjects effects in the PVN of the hypothalamus (Fig. 5def).

In the hippocampus of F1 males, there was no significant between-subject effect of parental neonatal sevoflurane exposure on Nkcc1 mRNA levels (Fig. 5g), but there was a sig- nificant effect on Kcc2 mRNA levels [F(3,20)¼3.55, P¼0.03, Fig. 5h] and thus the Nkcc1/Kcc2 mRNA ratio [F(3,22)¼5.52, P¼0.006, Fig. 5i]. In the hippocampus of F1 females, there were no

þ

þ

(cid:2)

þ

(cid:2)

(Kcc2) and glucocorticoid receptors (Gr) in the paraventricular nucleus (PVN) of the Fig 5. Gene expression for Na hypothalamus and hippocampus of F1 rats. Shown are the respective levels of Nkcc1 messenger ribonucleic acid (mRNA), Kcc2 mRNA, and the resulting Nkcc1/Kcc2 mRNA ratios in the PVN of the hypothalamus of F1 males (aec) and F1 females (def) and in the hippocampus of F1 males (gei) and F1 females (jel). Data normalised against control are means [standard deviation (SD)] from at least six rats per treatment group (n¼7, male con-M*con-F and sevo-M*con-F groups). (m, n) Shown are levels of Gr mRNA in the hippocampus of male (m) and female (n) rats. Data normalised against control are means (SD) from six rats per treatment group. Colour coding in (m) and (n) is applicable to all figures. *P<0.05 vs F1 males from the con-M*con-F group.

K

2Cl

(Nkcc1), K

2Cl

Multigenerational developmental effects of sevoflurane - 413

Fig 6. Methylation in promoter region of Kcc2 gene in sperm and ovary deoxyribonucleic acid (DNA) of F0 rats and in the hypothalamus and hippocampus DNA of F1 rats. (A) Bisulphite sequencing of CpG sites in the Kcc2 gene of nine clones from four individual sperm (A,aec) and ovary (A,def) DNA samples isolated from sevoflurane-exposed and control F0 rats. Heat maps show DNA methylation status of CpG sites in the promoter region of the Kcc2 gene in sperm (A,a) and ovaries (A,d) of F0 rats. Red cells show methylated sites. X axisdCpG sites; Y axisdclones. Histograms showing methylation frequency at each CpG site (A,bdmales; A,ddfemales) and DNA methylation level at all six CpG sites (A,cdmales; A,fdfemales). (B) Shown are the DNA methylation status of CpG sites, methylation frequencies at each CpG site and DNA methylation level at all six CpG sites in the Kcc2 gene of 9e10 clones from the hypothalamus of F1 male rats (B,aec) and F1 female rats (B,def). (C) The results of similar analyses as in (B) for hippocampus of F1 rats. Data are means (standard deviation) from four rats per y P<0.05 vs all treatment group (n¼5, hypothalamus samples isolated from male rats). *P<0.05 vs F1 males from the con-M*con-F group. other treatment groups. Colour coding in A,c is applicable to A,b; in A,f to A,e; in B,c,f to B,b,e; in C,c,f to C,b,e.

significant between-subjects effects of parental neonatal sev- oflurane exposure on Cl

(cid:2)

transporter mRNA (Fig. 5jel).

There was significant between-subjects effect of parental neonatal sevoflurane exposure on the hippocampal Gr mRNA levels in F1 males [F(3,20)¼7.44, P¼0.002, Fig. 5m], but not in F1 females (Fig. 5n).

ovaries of control and sevoflurane-exposed adult female rats (Fig. 6A,def). Greater methylation changes might be present in oocytes, a minor fraction of the cells in the ovary.

There was significant effect of parental treatment on the frequencies of CpG site methylation in the hypothalamus in F1 male [F(3,96)¼32.09, P<0.001, Fig. 6B,aec], but not female prog- eny (Fig. 6B,def).

DNA methylation in the Kcc2 gene promoter

In sperm of F0 rats there was significant effect of treatment [F(1,36)¼59.06, P<0.001, Fig. 6A,aec] and within-subjects effect of CpG site [F(5,36) ¼ 37.80, P<0.001] on methylation frequency. There was a trend but no significant difference between CpG site methylation frequency in the Kcc2 gene promoter in

The CpG site methylation frequency in the hippocampus of F1 male rats was largest if both parents were exposed to sev- oflurane as neonates [F(3,72)¼96.83, P<0.001, Fig. 6C,aec], while F1 females were not significantly affected (Fig. 6C,def). We did not detect significant differences in the frequency of CpG site methylation in the promoter in the Nkcc1 gene in F0 sperm of control and rats exposed to sevoflurane as neonates.

414 -

Ju et al.

Discussion

A single exposure of neonatal rats to sevoflurane, the most frequently used general anaesthetic in paediatrics, led to sig- nificant behavioural abnormalities and changes in DNA methylation not only in exposed rats in adulthood, but also in their adult male offspring that were never exposed to sevo- flurane. These effects of sevoflurane were strongly sex- dependent. The findings that male offspring only, but not female littermates, were affected indicate that it is unlikely that sevoflurane-induced abnormalities are transmitted to the next generation through sevoflurane-altered behaviour of the exposed dams. Furthermore, in the EPM and PPI of startle behavioural tests, male offspring of control females and exposed males were the only experimental group that exhibited significant abnormalities, even though F0 males did not have a direct contact with their progeny. These findings, together with increased hypothalamic and hippocampal Nkcc1/Kcc2 mRNA ratios in exposed parents and their male offspring and similarly increased DNA methylation of the Kcc2 gene promoter in the sperm of F0 exposed sires and hypo- thalamic and hippocampal tissues of their male, but not fe- male progenies, strongly support involvement of epigenetic mechanisms in the effects of parental neonatal exposure to sevoflurane to the next generation.

The similarities between the developmental effects of exposure to GABAergic anaesthetics4e8 and perinatal stress9e11 early in life suggests similarities in the underlying mechanisms of both phenomena. Recent studies in rodents also report heritable multigenerational effects of perinatal stress.19e21 Similar to our findings of normal corticosterone responses to physical restraint in progeny of sevoflurane- exposed parents, Morgan and Bale19 found normal cortico- sterone responses in offspring of prenatally stressed males and control females. Similar to our findings that only males were affected by neonatal exposure of their parents to sev- oflurane, developmental effects of paternal prenatal stress were detected in male offspring only.19 Among plausible explanations for normal corticosterone responses in male offspring of the exposed rats could be increased expression of Grs in the hippocampus, PVN, pituitary, or all three consistent with our finding of increased concentrations of Grs mRNA in the hippocampus of F1 male rats where only one parent had been exposed to sevoflurane. The GRs mediate the negative feedback of corticosterone on HPA axis activity.25

Male offspring of exposed male F0/unexposed female F0 exhibited reductions in PPI of acoustic startle and in time spent in open arms of the EPM. These PPI and EPM abnor- malities were accompanied by greater increases in hypotha- lamic PVN Nkcc1/Kcc2 mRNA ratios. Also, male progeny of exposed male F0/unexposed female F0 had significantly higher CpG methylation frequencies in the promoter of the Kcc2 gene in the hypothalamus. In contrast, abnormalities in spatial memory during the MWM test, a standardised and widely used behavioural test that strongly correlates with hippocampal synaptic plasticity,26 were most prominent in male offspring when both parents were exposed. Again, consistent with behavioural findings, the greatest increase in hippocampal Nkcc1/Kcc2 mRNA ratio was found in male offspring of this group. Furthermore, this group had significantly higher CpG methylation in the promoter of the Kcc2 gene in the hippo- campus. Together, these findings support an important role of epigenetic mechanisms in the mediation of heritable

developmental effects of early life exposure to sevoflurane. Another novel observation is that a delay or postponement in the developmental maturation in the Nkcc1/Kcc2 ratio in the PVN of the hypothalamus can selectively affect EPM and PPI behaviour with no significant effect on MWM behaviour, while impaired developmental maturation of the Nkcc1/Kcc2 ratio in the hippocampus can have profound consequences for MWM behaviour, with no significant effects on EPM and PPI behav- iour. In future studies it will be important to elucidate how closely the observed changes in gene expression in each spe- cific experimental group translate to changes in respective protein concentrations.

Why male offspring of exposed male F0/unexposed female F0 exhibit significant deficiencies in the EPM and PPI of startle tests, especially when compared with offspring of both exposed parents, remains to be elucidated, as does why only male progeny were affected. A greater HPA axis response to stress in exposed F0 males,6 as opposed to greater stress re- sponses in naı¨ve females,27 suggest that anaesthesia alters postnatal brain sex differentiation, at least as it relates to HPA axis function. The primary female sex steroid hormone 17b- oestradiol, synthesised in neonatal brain through aromati- sation of testis-derived testosterone, directs brain sexual differentiation by organisational actions during a critical period.28 Of relevance, 17b-oestradiol is known to down- regulate neuronal Kcc2 expression.13,14 It would be important to explore whether sex-dependent developmental effects of sevoflurane include effects on brain sexual differentiation. Even though an increase in the Nkcc1 mRNA level was detected only in the hypothalamus of one group of second generation male rats, the male progenies of exposed male F0/ unexposed female F0, it remains to be elucidated how such an increase in hypothalamic Nkcc1 mRNA level was passed to the next generation, as we were not able to detect significant changes in the methylation pattern of the Nkcc1 gene pro- moter in sperm of exposed F0 males.

In summary, our results demonstrate for the first time that neurobehavioural abnormalities induced by neonatal expo- sure to the general anaesthetic sevoflurane can be transmitted to the next generation in a complex, sex- and brain region- specific mode through epigenetic mechanisms. This basic science study deals with a complex biological phenomenon of intergenerational heritability of the effects of environmental factors, in general, and with a newly uncovered potentially important translational problem (i.e. intergenerational heri- tability of the effects of early in life general anaesthesia exposure). Mechanisms of sevoflurane-induced sex- and brain region-specific effects across two generations are exciting and challenging topics for future studies. To further substantiate translational applicability of this phenomenon, additional animal studies using different neonatal anaesthesia para- digms that more broadly model stages of human postnatal brain development at the time of anaesthesia exposure and duration of anaesthesia exposure in young human patients will be needed.

Authors’ contributions

Designed research: A.E.M., L.-S.J., T.E.M., N.G., C.N.S., J.L.R., J.-Q.Z. Performed research: L.-S.J., J.-J.Y. Analysed data: L.-S.J., J.-J.Y., A.E.M. Wrote the paper: A.E.M., T.E.M., N.G., C.N.S., J.-Q.Z. Approved the final manuscript: all authors.

Acknowledgements

The authors thank B. Setlow, J. Li, and X. Yang for helpful advice and technical assistance.

Declaration of interest

The authors declare that they have no conflicts of interest.

Funding

National Institutes of Health (R01NS091542, R01NS091542-S to A.E.M.), I. Heermann Anesthesia Foundation, Inc (to J.L-S.), the Jerome H. Modell Endowed Professorship (to N.G.), and the National Natural Science Foundation of China (U1404807, 81771149 to J.Z.).

References

1. Ing C, Sun M, Olfson M, et al. Age at exposure to surgery and anesthesia in children and association with mental disorder diagnosis. Anesth Analg 2017; 125: 1988e98

2. U.S. Food and Drug Administration. FDA drug safety communication: FDA review results in new warnings about using general anesthetics and sedation drugs in young children and pregnant women. Available from: https://www.fda.gov/ Drugs/DrugSafety/ucm532356.htm. [Accessed 25 August 2017]

3. Sanders RD, Hassell J, Davidson AJ, Robertson NJ, Ma D. Impact on neuro- development: an update. Br J Anaesth 2013; 110(Suppl 1): i53e72 anaesthetics surgery and of

4. Edwards DA, Shah HP, Cao W, Gravenstein N, Seubert CN, Martynyuk AE. Bumetanide alleviates epileptogenic and neurotoxic effects of sevoflurane in neonatal rat brain. Anesthesiology 2010; 112: 567e75

5. Cao W, Pavlinec C, Gravenstein N, Seubert CN, Martynyuk AE. Roles of aldosterone and oxytocin in ab- normalities caused by sevoflurane anesthesia in neonatal rats. Anesthesiology 2012; 117: 791e800

6. Xu C, Tan S, Zhang J, et al. Anesthesia with sevoflurane in neonatal rats: developmental neuroendocrine abnormal- ities and alleviating effects of the corticosteroid and Cl(-) importer antagonists. Psychoneuroendocrinology 2015; 60: 173e81

7. Ju LS, Yang JJ, Gravenstein N, et al. Role of environmental stressors in determining the developmental outcome of neonatal anesthesia. Psychoneuroendocrinology 2017; 81: 96e104

8. Yang J, Ju L, Jia M, et al. Subsequent maternal separation exacerbates neurobehavioral in rats neonatally exposed to sevoflurane anesthesia. Neurosci Lett 2017; 661: 137e42 abnormalities

9. Furukawa M, Tsukahara T, Tomita K, et al. Neonatal maternal separation delays the GABA excitatory-to- inhibitory functional switch by inhibiting KCC2 expres- sion. Biochem Biophys Res Commun 2017; 493: 1243e9 10. O’Malley D, Dinan TG, Cryan JF. Neonatal maternal sepa- ration in the rat impacts on the stress responsivity of central corticotropin-releasing factor receptors in adult- hood. Psychopharmacology (Berl) 2011; 214: 221e9

Multigenerational developmental effects of sevoflurane - 415

11. Veerawatananan B, Surakul P, Chutabhakdikul N. Maternal restraint stress delays maturation of cation- chloride cotransporters and GABAA receptor subunits in the hippocampus of rat pups at puberty. Neurobiol Stress 2015; 3: 1e7

12. Ben-Ari Y. The GABA excitatory/inhibitory developmental journey. Neuroscience 2014; 279: sequence: a personal 187e219

13. Perrot-Sinal TS, Sinal CJ, Reader

JC, Speert DB, McCarthy MM. Sex differences in the chloride cotrans- porters, NKCC1 and KCC2, in the developing hypothala- mus. J Neuroendocrinol 2007; 19: 302e8

14. Nunez JL, McCarthy MM. Resting intracellular calcium concentration, depolarizing GABA and possible role of local estradiol synthesis in the developing male and fe- male hippocampus. Neuroscience 2008; 158: 623e34

15. Tang X, Kim J, Zhou L, et al. KCC2 rescues functional deficits in human neurons derived from patients with Rett syndrome. Proc Natl Acad Sci USA 2016; 113: 751e6

16. Merner ND, Mercado A, Khanna AR, et al. Gain-of-function missense variant in SLC12A2, encoding the bumetanide- sensitive NKCC1 cotransporter, identified in human schizophrenia. J Psychiatr Res 2016; 77: 22e6

17. Lemonnier E, Villeneuve N, Sonie S, et al. Effects of bumetanide on neurobehavioral function in children and adolescents with autism spectrum disorders. Transl Psy- chiatry 2017; 7, e1056

18. Antshel KM, Zhang-James Y, Wagner KE, Ledesma A, Faraone SV. An update on the comorbidity of ADHD and ASD: a focus on clinical management. Expert Rev Neurother 2016; 16: 279e93

19. Morgan CP, Bale TL. Early prenatal stress epigenetically programs dysmasculinization in second-generation offspring via the paternal lineage. J Neurosci 2011; 31: 11748e55

20. Bohacek J, Farinelli M, Mirante O, et al. Pathological brain plasticity and cognition in the offspring of males sub- jected to postnatal traumatic stress. Mol Psychiatry 2015; 20: 621e31

21. Rodgers AB, Morgan CP, Leu NA, Bale TL. Transgenera- tional epigenetic programming via sperm microRNA re- capitulates effects of paternal stress. Proc Natl Acad Sci USA 2015; 112: 13699e704

22. Ju LS, Jia M, Sun J, et al. Hypermethylation of hippocampal synaptic plasticity-related genes is involved in neonatal sevoflurane exposure-induced cognitive impairments in rats. Neurotox Res 2016; 29: 243e55

23. Cho HM, Lee HA, Kim HY, Han HS, Kim IK. Expression of Naþ-Kþ -2Cl- cotransporter 1 is epigenetically regulated during postnatal development of hypertension. Am J Hypertens 2011; 24: 1286e93

24. Yeo M, Berglund K, Hanna M, et al. Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter. Proc Natl Acad Sci USA 2013; 110: 4315e20

25. Sapolsky RM, Krey LC, McEwen BS. The neuroendocri- nology of stress and aging: the glucocorticoid cascade hypothesis. Endocr Rev 1986; 7: 284e301

26. Vorhees CV, Williams MT. Value of water mazes for assessing spatial and egocentric learning and memory in rodent basic research and regulatory studies. Neurotoxicol Teratol 2014; 45: 75e90

416 -

Ju et al.

27. Iwasaki-Sekino A, Mano-Otagiri A, Ohata H, Yamauchi N, Shibasaki T. Gender differences in corticotropin and corticosterone secretion and corticotropin-releasing fac- tor mRNA expression in the paraventricular nucleus of the the hypothalamus and the central nucleus of

amygdala in response to footshock stress or psychological stress in rats. Psychoneuroendocrinology 2009; 34: 226e37 28. McCarthy MM, Nugent BM, Lenz KM. Neuroimmunology and neuroepigenetics in the establishment of sex differ- ences in the brain. Nat Rev Neurosci 2017; 18: 471e84

Handling editor: H.C. Hemmings Jr