20230808-AI coding-1st round/4738 – Cao 2015.txt

PMID: 25052764 DOI: 10.1002/cbin.10349
Materials and methods
Animals
C57BL/6 mice were purchased from Shanghai Laboratory Animal Center, Chinese Academy of Sciences (Shanghai, China). The in vivo induction of ketamine-related hippocampal neurotoxicity was done at 2 weeks. Quantitative real time PCR of miR-34 family was used at 3 weeks, as was hippocampal injection of lentivirual vector of miR-34c. For analyses of TUNEL staining and Western blotting, 2-month old mice were used. All experimental procedures were reviewed and approved by the Animal Care Committee at the first affiliated Hospital of XinXiang Medical College.

Induction of ketamine-related hippocampal neurotoxicity
The in vivo protocol to induce ketamine-related hippocampal neurotoxicity was done as before with slight modifications (Hayashi et al., 2002; Huang et al., 2012, Liu et al., 2012). Young C57BL/6 mice, postnatal 14 days, were intraperitoneally administrated with repeated dosage of 75 mg/kg ketamine per day for six consecutive days (n = 28). Normal saline was injected in the control group of mice (n = 25).

RNA isolation and reverse transcription
Hippocampal RNA was isolated with Trizol reagent (In Vitrogen, Carlsbad, CA, USA). Briefly, mice were anesthetized and decapitated. Hippocampal samples were retrieved and homogenized at 1 mL Trizol/0.1 g tissue. The quantity of RNA was assessed by spectrophotometry followed by 1% agarose gel electrophoresis. Total RNA was treated with 10 U of RNase free DNase I, and reverse transcription (RT) was done in a total volume of 20 μL with random hexamer primers using a High-Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA, USA). cDNA was stored at −20°C until further use.

Quantitative RT-PCR
Expression of miR-34a, miR-34b, miR-34c, and house-keeping gene GAPDH were measured by TaqMan microRNA RT-PCR on the ABI 7900 Real-time PCR System (Applied Biosystems, Foster City, CA, USA). Expression profiles of each gene were quantified using corresponding standard curves. End-point RT-PCR of miR-34a, miR-34b, miR-34c, and GAPDH used 50 ng of total RNA with a mirVana RT-PCR miRNA Detection Kit (Ambion, Austin, Texas, USA). PCR products were separated and visualized on a 4% agarose gel. Each sample was run in triplicate and a mean value of each Ct triplicate was used.

Lentivirus production and transduction
To downregulate miR-34c, the coding sequence for a 2’-O-methyl oligonucleotide of miR-34c inhibitor was UCCGUCACAUCAAUCGACUAACG, and the non-specific control antisense sequence was UACUCUUUCUAGGAGGUUGUUAUU (Yu et al., 2012). These two sequences were amplified and cloned into pCDH-CMV-MCS-EF1-coGFP for in vivo gene transfer, resulting in a miR-34c inhibitor vector (lenti-miR34c-I) and miR-34c non-specific control vector (lenti-miR34c-C) (System Biosciences, Mountain View, CA, USA). The lentivirual expression vectors and pPACK packaging vector were co-transfected into 293T cells, and viral particles were collected and concentrated to high titer.

Hippocampal injection
One day after the 6-day ketamine treatment, the injections of lent viruses were performed on the right side of the cortex. A tiny hole was drilled above hippocampus and a Hamilton syringe was used to inject 2 μL of lentivirus of miR-34c inhibitor (lenti-miR34c-I, 20 μM, n = 17) or non-specific control (lenti-miR34c-C, 20 μM, n = 14) at the coordinates assessed from bregma and skull surface: anteroposterior −2.0 mm, lateral +1.5 mm, and vertical −1.5 mm. After injection, the incision was quickly sealed with dental cement.

Western blotting
Western blotting analysis was conducted at 2 months. Four mice with Lenti-miR34c-I injection and four mice with Lenti-miR34c-C injection were included in this analysis. Forty micrograms of hippocampal protein were collected and separated on an 8% NuPage Gel with MES buffer (Invitrogen, Carlsbad, CA, USA) and transferred to a polyvinylidene difluoride membrane. Primary antibody dilutions included 1:500 BCL2 (Santa Cruz, USA), 1:100 phosphorylated-PKC (p-PKC) (Sant Cruz Biotechnologies, Santa Cruz, CA, USA), 1:100 phosphorylated-ERK (p-ERK) (Sant Cruz Biotechnologies, Santa Cruz, CA, USA), and 1:1,000 β-actin (Cell Signaling, Danvers, MA, USA). Membranes were then incubated in primary antibody in Odyssey Blocking Buffer at 4°C for 24 h, followed by three washes in 0.1% PBS-T and 1 h incubation at RT with 1:1,000 secondary antibodies. The films were visualized and quantified on the Odyssey Infrared Imaging Center (Li-Cor, Lincoln, NE, USA).

TUNEL staining for hippocampal apoptosis
Hippocampal slices (350 μm) were prepared for terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick end labeling (TUNEL) staining to detect the apoptosis, using an In Situ Cell Death Detection Kit according to manufacturer's protocol (Roche, Branchburg, NJ, USA). Five mice with Lenti-miR34c-I injection and 5 mice with Lenti-miR34c-C injection were included in the analysis. Hippocampal CA1 region was examined under a fluorescent scope. The apoptotic CA1 neurons were identified based on their size, location and immuno-reaction to TUNEL staining. The average number of the apoptotic neurons per 0.01 mm2 was measured and compared between control hippocampi and hippocampi treated with miR-34c inhibitor.

Morris water maze (MWM) testing
The MWM testing was carried out 1 month after hippocampal transfection of miR-34c knockdown. Eight mice with Lenti-miR34c-I injection and 5 mice with Lenti-miR34c-C injection were included in this analysis. In a large circular tank with a transparent platform (10 cm × 10 cm), warm water at 26°C was added to submerge the platform 1 cm below the surface. Visual cues of color paints were used to aid mice in locating the platform. The mice were given training sessions four times per day for one week before final testing. In each training session, the mice were put in the maze to locate the platform in 2 min followed by resting on the platform for 30 s. If mice did not locate the platform in 2 min, they were aided with flashing lights to the platform with 30 s of rest on top of the platform. On the final day of examination, the average swimming time and swimming distance were compared between control mice and the mice with miR-34c knockdown.

Statistical analysis
Statistic analysis was conducted with SPSS software (version 11.0). The measured data were presented as mean ± standard deviations. The statistical differences were measured with a Student's t-test, and the significance set at P < 0.05.