Update README.md

README.md

@@ -23,6 +23,7 @@ size_categories:
 
 ### Dataset Summary
 This dataset contains datas being collected from Genbank. The dataset is organized in a way that it separate all the genes from an DNA , and was classified according to the region and coding type. In that way, people could get more detailed information regarding each DNA sequences.
+This dataset generally include five type of regions including regulator, repeat region, mRNA, tRNA, rRNA and 'CDS'
 
 
 ### Supported Tasks and Leaderboards
@@ -36,25 +37,25 @@ This dataset contains datas being collected from Genbank. The dataset is organiz
 ## Dataset Structure
 
 ### Data Instances
-DNA id: AP013063.1
-Organism: Serratia marcescens SM39
-gene id: SM39_0001
-region type:coding
-coding type: BAO32072.1
-sequence: ATGCGCAACATCAGCCTGAAAACCACAATTATTACCACCACCGATACCACAGGTAACGGGGCGGGCTGA
-gc_content:0.52173913
-translation code: MRNISLKTTIITTTDTTGNGAG
+DNA id: AP013063.1  
+Organism: Serratia marcescens SM39  
+gene id: SM39_0001  
+region type:coding  
+coding type: BAO32072.1  
+sequence: ATGCGCAACATCAGCCTGAAAACCACAATTATTACCACCACCGATACCACAGGTAACGGGGCGGGCTGA  
+gc_content:0.52173913  
+translation code: MRNISLKTTIITTTDTTGNGAG  
 
 
 ### Data Fields
-DNA id: id number for the whole DNA sequence, sequences with same DNA id are from same DNA
-Organism: Organism of the DNA
-gene id: locus tag of the gene, sequences with same gene id are from same gene
-region type: determine whether the region is coding or non-coding; if the region is the type of regulator, it would be classified according to the class of regulators, such as terminator, ribosome binding ste, etc.
-coding type: if the sequence is coding sequence, it would be classified according to their production type. sequence that produce protein would be marked with protein id. Sequences that produce either rRNA or tRNA would be marked as rRNA or tRNA.
-sequence: the actual sequence 
-gc_content: the gc_content of the sequence
-translation code: if the sequence produce protein, then the translation code would be provided as a reference
+DNA id: id number for the whole DNA sequence, sequences with same DNA id are from same DNA  
+Organism: Organism of the DNA  
+gene id: locus tag of the gene, sequences with same gene id are from same gene      
+region type: determine whether the region is coding or non-coding; if the region is the type of regulator, it would be classified according to the class of regulators, such as terminator, ribosome binding ste, etc.  
+coding type: if the sequence is coding sequence, it would be classified according to their production type. sequence that produce protein would be marked with protein id. Sequences that produce either rRNA or tRNA would be marked as rRNA or tRNA.  
+sequence: the actual sequence   
+gc_content: the gc_content of the sequence  
+translation code: if the sequence produce protein, then the translation code would be provided as a reference  
 
 ### Data Splits