#genome
stringclasses 121
values | asm_name
stringclasses 120
values | assembly_accession
stringclasses 120
values | bioproject
stringclasses 45
values | biosample
stringclasses 120
values | wgs_master
float64 | seq_rel_date
stringclasses 98
values | submitter
stringclasses 76
values | ftp_path
stringclasses 120
values | img_id
float64 637M
2.51B
⌀ | gtdb_id
stringclasses 120
values | scope
stringclasses 3
values | assembly_level
stringclasses 1
value | genome_rep
stringclasses 1
value | refseq_category
stringclasses 3
values | release_type
stringclasses 2
values | taxid
float64 1.15k
681k
⌀ | species_taxid
float64 7
911k
⌀ | organism_name
stringclasses 120
values | infraspecific_name
stringclasses 112
values | isolate
stringclasses 1
value | superkingdom
stringclasses 2
values | phylum
stringclasses 18
values | class
stringclasses 30
values | order
stringclasses 56
values | family
stringclasses 75
values | genus
stringclasses 89
values | species
stringclasses 117
values | classified
bool 1
class | lv1_group
stringclasses 2
values | lv2_group
stringclasses 13
values | score_faa
float64 0.93
1
⌀ | score_fna
float64 0.88
1
⌀ | score_rrna
float64 0.1
1
⌀ | score_trna
float64 0.6
1
⌀ | total_length
float64 618k
9.12M
⌀ | contigs
float64 1
22
⌀ | gc
float64 22.5
72.2
⌀ | n50
float64 616k
9.03M
⌀ | l50
float64 1
1
⌀ | proteins
float64 525
7.92k
⌀ | protein_length
float64 172k
2.68M
⌀ | coding_density
float64 74
96.9
⌀ | completeness
float64 76.3
100
⌀ | contamination
float64 0
4.4
⌀ | strain_heterogeneity
float64 0
100
⌀ | markers
float64 124
383
⌀ | 5s_rrna
stringclasses 2
values | 16s_rrna
stringclasses 1
value | 23s_rrna
stringclasses 1
value | trnas
float64 14
20
⌀ | draft_quality
stringclasses 2
values | start_position
int64 0
10M
| human_label
int64 0
1
| autotrain_text
stringlengths 150
150
| autotrain_label
class label 121
classes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
G000010665 | ASM1066v1 | GCF_000010665.1 | PRJNA224116 | SAMD00060954 | null | 2009/06/11 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/665/GCF_000010665.1_ASM1066v1 | 644,736,352 | RS_GCF_000010665.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 573,370 | 184,917 | Desulfovibrio magneticus RS-1 | strain=RS-1 | null | Bacteria | Proteobacteria | Deltaproteobacteria | Desulfovibrionales | Desulfovibrionaceae | Desulfovibrio | Desulfovibrio magneticus | true | Eubacteria | Proteobacteria | 0.99 | 0.996 | 1 | 1 | 5,315,620 | 3 | 62.67 | 5,248,049 | 1 | 4,555 | 1,546,858 | 85.744052 | 100 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 2,195,180 | 0 | AGGCGGGCCGCCGCCTCGCTGCCGGCCAGCAGGCCGAAGGAATCCAGGGAGAGCGTGCCGGCTTCGGTGAACCAGTGGCTTTTGATCTGGCGTTCCTGCTCGAAATCCACGCCGATGACGCCGACCGGCGTGTCGGCCACCCGGGCCAGC | 36Desulfovibrio magneticus RS-1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,039,000 | 1 | AGGACCATGCCCAGAGGGCAGCCCACATGCCTGGATGCCCGCCTGGGGTCAAACCTGGTCCCCTTGGAGAAGCTGAGACTCAGACTAAGACCCAGCAGCTGCCACCTGCCGGGGATTTTTCAGCCTGAGGTGAGGGGAAGAGGCGGAAAT | 120homo sapiens
|
G000008545 | ASM854v1 | GCF_000008545.1 | PRJNA57723 | SAMN02603986 | null | 2001/01/09 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/545/GCF_000008545.1_ASM854v1 | 637,000,321 | RS_GCF_000008545.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,274 | 2,336 | Thermotoga maritima MSB8 | strain=MSB8 | null | Bacteria | Thermotogae | Thermotogae | Thermotogales | Thermotogaceae | Thermotoga | Thermotoga maritima | true | Eubacteria | Bacteria | 1 | 1 | 0.9 | 1 | 1,860,725 | 1 | 46.25 | 1,860,725 | 1 | 1,866 | 602,696 | 95.430706 | 100 | 1.79 | 100 | 312 | yes | yes | yes | 20 | high | 550,420 | 0 | AAGTCTGTGAAGAAATAGGTGCGGAGATCATCTCGATGGACTCGAGGCAAATCTATCGTTATATGGACATAGGAACAGCCAAACCAACACCAGAGCAGAGAAAGAGGGTTCTTCATCACATGATAGATATCATCGATCCTGATGAGTATT | 103Thermotoga maritima MSB8 ASM854v1
|
G000007705 | ASM770v1 | GCF_000007705.1 | PRJNA224116 | SAMN02603528 | null | 2003/08/22 | LNCC, Brazil | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/705/GCF_000007705.1_ASM770v1 | 637,000,074 | RS_GCF_000007705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 243,365 | 536 | Chromobacterium violaceum ATCC 12472 | strain=ATCC 12472 | null | Bacteria | Proteobacteria | Betaproteobacteria | Neisseriales | Chromobacteriaceae | Chromobacterium | Chromobacterium violaceum | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,751,080 | 1 | 64.83 | 4,751,080 | 1 | 4,298 | 1,428,392 | 88.582238 | 99.04 | 0.45 | 0 | 372 | yes | yes | yes | 20 | high | 4,309,370 | 0 | GCAGCCACAATCAGCGGCACTAGAAACGTCATTGGGATTTTTTATAAAAAAACAAACGATTGATGAACCGACAAAATACGCGATATGCTTGATTTGATTTGCAAAGAAGTCAAGTACCCTTTCAAAAGCAGACAGGGTTTCACTGACTGT | 27Chromobacterium violaceum ATCC 12472
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,033,350 | 1 | AGAGGAGCCAGAGGAAGGGCTGGGGGAGGGGAGTCAGGAGCTGGGGGCCTCAGAACGGGAGAACCAGGTGAACAGTCTGACCCCAAAGGGCAGCCAGAGGGGCCTCCCGGGCAGGAGAGGGTGGCAGCCTCAGCCGAGACTGGCCATGCC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,668,500 | 1 | TCCAGGTTTTGGCTATTATAAGCAATGCTGGAATAAGCATAGATTCTTTTTTAATCAGAAAAAAAGTTACTACACACAGTTATCAGCACTGTGAGCAAACATGTGTGGAGTTTGTTCTGCAGAGAGTTAAGAGCGGCTGCTTTCCTTCCA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 943,050 | 1 | CTGACCCTGACCCACGGGTGACTCCCTTTGGGGACTCCATGCCCTTTTCTGGCATTAGGATGGAGAGTGACCTGTCTGGCAGAAAGGCTGGACCTGAGGCTGCCTGAAGCGACACCGAGGGCCACAGCCCCAGCAGCTCCAGCCTTCACA | 120homo sapiens
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 5,409,300 | 0 | CACCGGTAGGGTGGCCCGGTTGTCGTATCGCGGGCCGGGCCGATCAGGGCCGCTCCGGTGCGGACAGCACCCCACGTACCCGAGAGCCCCGAACCGGAGACCGTGACTACTACCACCGCCTCCCACCACCTCTCACCCGCCTTTCCCGGC | 96Streptomyces griseus subsp. griseus NBRC 13350
|
G000006175 | ASM617v2 | GCF_000006175.1 | PRJNA224116 | SAMN00000040 | null | 2010/06/03 | US DOE Joint Genome Institute (JGI-PGF) | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/175/GCF_000006175.1_ASM617v2 | 646,564,549 | RS_GCF_000006175.1 | Multispecies | Complete Genome | Full | representative genome | Major | 456,320 | 2,188 | Methanococcus voltae A3 | strain=A3 | null | Archaea | Euryarchaeota | Methanococci | Methanococcales | Methanococcaceae | Methanococcus | Methanococcus voltae | true | Archaea | Euryarchaeota | 0.97 | 1 | 1 | 1 | 1,936,387 | 1 | 28.59 | 1,936,387 | 1 | 1,727 | 526,927 | 80.167033 | 99.05 | 0 | 0 | 165 | no | yes | yes | 19 | medium | 1,191,190 | 0 | TTCGAGGTAATCTTCAGACATCCTTAAGTAATAATAAGGGTCCAATGCTGTTAAATACATTCTTCCATTGTCGTCTGAAAAAATATCTAAGTATTGTTCGTTTGTCGTAAAACTCATATCTGCAGTTTGCGCCCTCATCTGAAAGCTTAA | 59Methanococcus voltae A3
|
G000009365 | ASM936v1 | GCF_000009365.1 | PRJNA224116 | SAMEA3138202 | null | 2006/07/24 | German Research Centre for Biotechnology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/365/GCF_000009365.1_ASM936v1 | 637,000,004 | RS_GCF_000009365.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 393,595 | 59,754 | Alcanivorax borkumensis SK2 | strain=SK2 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Oceanospirillales | Alcanivoracaceae | Alcanivorax | Alcanivorax borkumensis | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 3,120,143 | 1 | 54.73 | 3,120,143 | 1 | 2,820 | 929,045 | 87.73194 | 100 | 0 | 0 | 352 | yes | yes | yes | 20 | high | 2,665,650 | 0 | AGGCTGCCGGGAGCAGGGGCACTTCGCCGAAGACGGTCGCGAACTGAATATCTACAGCTACGACCTGGACAACTACAATTTCGAGCGCAAGTGGAACAACCCCCGCTTCTGGGCCAATCCGGAAAATTGGGGAAAATACTGGTGGTAACC | 1Alcanivorax borkumensis SK2
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,674,400 | 1 | TGCCTGTAATCCCAGCTACCTAGCTACTCGGGAGGCTGAGGCACAAGGATCACTTGAACCCAGGAGGTGGAGGTTGCAGTGAGCCAAGATCACGCCACTGCACATCAGCCTGGGCGACAGAGCAAGACTCCATCTCAAAAAAAAGAAACA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,277,600 | 1 | GGCTGGGAAGGGGGCCTCAGGTGGCTTCTCCACACAGCTCACAAAGCCATCAGGGTCCTAGCAGGCCACCATGAGGATGCCCCTTGGCCCGGCTGACCCACCACATGGAGCTGGAGCAGATGGGGTGGCAGGCAGGGGAGAGGCTATGAT | 120homo sapiens
|
G000010165 | ASM1016v1 | GCF_000010165.1 | PRJNA224116 | SAMD00060942 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/165/GCF_000010165.1_ASM1016v1 | 643,692,011 | RS_GCF_000010165.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 358,681 | 1,393 | Brevibacillus brevis NBRC 100599 | strain=NBRC 100599 (= 47) | null | Bacteria | Firmicutes | Bacilli | Bacillales | Paenibacillaceae | Brevibacillus | Brevibacillus brevis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 6,296,436 | 1 | 47.27 | 6,296,436 | 1 | 5,917 | 1,875,522 | 87.757979 | 99.73 | 0.27 | 0 | 381 | yes | yes | yes | 20 | high | 5,831,410 | 0 | TTTTGATTCTATCATATCATACGTCTAATACCTTTTCTTGCTTAAACAAACTCTTACAAAAATCTGAAGAATGCCATTTCCATCTAGACCGAGTAAAAGGCATGTAGGATTATATAGGAAAAAATGGTTGGAATGAGAGGTTTTCGCAAG | 15Brevibacillus brevis NBRC 100599
|
G000007645 | ASM764v1 | GCF_000007645.1 | PRJNA57861 | SAMN02603126 | null | 2002/12/20 | Chinese National HGC, Shanghai | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/645/GCF_000007645.1_ASM764v1 | 637,000,281 | RS_GCF_000007645.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 176,280 | 1,282 | Staphylococcus epidermidis ATCC 12228 | strain=ATCC 12228 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Staphylococcus | Staphylococcus epidermidis | true | Eubacteria | Firmicutes | 1 | 0.977 | 0.9 | 1 | 2,564,615 | 7 | 32.05 | 2,499,279 | 1 | 2,354 | 721,937 | 82.93198 | 99.81 | 0 | 0 | 345 | yes | yes | yes | 20 | high | 2,360,670 | 0 | GATTTCTAATAATTCGTCCATAACCATAAGGATTGATAGTAGAAGCAGATAATACAGTAACATGTGATTGTGTACTTTCATGATGTTCAATAAGTGATTGTAAAGTTTGGTATGTAATAAGTGGTGTATCTCCACATACTACTAGAGTAG | 88Staphylococcus epidermidis ATCC 12228 ASM764v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,668,100 | 1 | CCGAGTGATGGAGGCTGCATTTAGCTGAGATCGCGCCACTGCACTCCAGCCTGTGCGACAGAGTGAAATTGTGTCTGGAAAAAAGAAAAAGAAAAAGAAAAAGATTATGCTTAGTAATATTTTACCTGTGCAATGCACAAAAGGATAACT | 120homo sapiens
|
G000010525 | ASM1052v1 | GCF_000010525.1 | PRJNA224116 | SAMD00060925 | null | 2007/10/16 | University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/525/GCF_000010525.1_ASM1052v1 | 641,228,476 | RS_GCF_000010525.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 438,753 | 7 | Azorhizobium caulinodans ORS 571 | strain=ORS 571 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Xanthobacteraceae | Azorhizobium | Azorhizobium caulinodans | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 5,369,772 | 1 | 67.32 | 5,369,772 | 1 | 4,810 | 1,620,542 | 88.922714 | 100 | 0 | 0 | 358 | yes | yes | yes | 20 | high | 5,349,110 | 0 | CAGTGCCGCGTGCAGCTTCAGGGAGGCCGCATTCTCGGCGTCGATGCCCGCCACCATCACATGCTTGCCCAGCGCGCGGGCACGGGCGATCAGCGCCTCCATCAACGCCCGCCCGATGCCGCCGCCCCGGGCGTCCGCGCGCACATAGAC | 4Azorhizobium caulinodans ORS 571
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,057,850 | 1 | AATTGATCACAAAAATAATAAACGCACACCCTAAATTATCCTTCTACAATTCATCTCCTTAGTTGCAATCCCAAAATTGAATCTGTAAGAATACAGATTATACTTCAGTAATATTTTCAGTGACTAGAATTCACCAACATTAGCCTTCCT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,569,600 | 1 | TTCAGGTGGATACAAACAGCCTAATTGATATAAAAATGGAAAAGAAGCCTCATCAGACCAAGGCTGTAGATTCTACCTCCTTAAAATTTTTCGAGAATCAAATAAACTCTTTGAACCAGTATTTTTACCAGCACTCTAAGGAAATAGGCC | 120homo sapiens
|
G000007205 | ASM720v1 | GCF_000007205.1 | PRJNA224116 | SAMN02602979 | null | 2003/07/25 | ALTANA Pharma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/205/GCF_000007205.1_ASM720v1 | 637,000,071 | RS_GCF_000007205.1 | Monoisolate | Complete Genome | Full | na | Major | 182,082 | 83,558 | Chlamydophila pneumoniae TW-183 | strain=TW-183 | null | Bacteria | Chlamydiae | Chlamydiia | Chlamydiales | Chlamydiaceae | Chlamydia | Chlamydia pneumoniae | true | Eubacteria | Chlamydiae | 1 | 1 | 1 | 1 | 1,225,935 | 1 | 40.58 | 1,225,935 | 1 | 1,055 | 372,698 | 89.583869 | 99.49 | 0 | 0 | 219 | yes | yes | yes | 20 | high | 910,650 | 0 | TTCTGTGGGAATTGTGCTAAAGCTTGTTGCTTATCGCCATAAGTAAAGCGAGAAATCGCAAGCTTTTCATCAACAATTTGTTTTACTGTATCTTCAATTAACGGGAAATCACTTTCGCTAATGGAAAGATTGGCAAAATCATAGTAAAAG | 25Chlamydophila pneumoniae TW-183
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,445,550 | 1 | TGCTAGTTCAGTGAAGGAGTCATTTGGATCCAATAGTCAGCATCTTCAATGAATGTGTCAGAATCTGCCTCTTCAATGAATTTGGAAAAGTTGTTTGAAAGGCTTCAATGGCTTAGTGAATTTTAAATACAGCTATCTGAATCAATATTG | 120homo sapiens
|
G000010165 | ASM1016v1 | GCF_000010165.1 | PRJNA224116 | SAMD00060942 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/165/GCF_000010165.1_ASM1016v1 | 643,692,011 | RS_GCF_000010165.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 358,681 | 1,393 | Brevibacillus brevis NBRC 100599 | strain=NBRC 100599 (= 47) | null | Bacteria | Firmicutes | Bacilli | Bacillales | Paenibacillaceae | Brevibacillus | Brevibacillus brevis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 6,296,436 | 1 | 47.27 | 6,296,436 | 1 | 5,917 | 1,875,522 | 87.757979 | 99.73 | 0.27 | 0 | 381 | yes | yes | yes | 20 | high | 6,232,200 | 0 | GATGAAAAATCGCACTCTGACACGGATGATCTGTCCATGTCTTCCCAGTCGCCAAAATCACAGCCAATATACTTGCCCATAAACCTGACGCGTAAGAAATGTACACCCTGAAAATGAAAGTTCCTTAAGGCTTGCTTTTGATCGAAAATA | 15Brevibacillus brevis NBRC 100599
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,507,850 | 1 | GACAAGTTGAAAGAGTTTTGAGGGCTCAGAAGAAGACAGGAAGATGAAAGAAAGTTTGGAACTTCTTAGAGACTGGTAAAATGGTTGTGACCACAATGCTGATAGCAGTATGAGCACTGAAGTCTAGGCTGCTAAGGTCTCAGATGGAAA | 120homo sapiens
|
G000010325 | ASM1032v1 | GCF_000010325.1 | PRJNA224116 | SAMD00060914 | null | 2007/07/11 | Japan Agency for Marine-Earth Science and Technology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/325/GCF_000010325.1_ASM1032v1 | 640,753,037 | RS_GCF_000010325.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 387,092 | 387,092 | Nitratiruptor sp. SB155-2 | strain=SB155-2 | null | Bacteria | Proteobacteria | Epsilonproteobacteria | null | null | Nitratiruptor | Nitratiruptor sp. SB155-2 | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 1,877,931 | 1 | 39.69 | 1,877,931 | 1 | 1,933 | 610,396 | 95.761026 | 98.78 | 0 | 0 | 319 | yes | yes | yes | 20 | high | 1,712,230 | 0 | AATGGCTCAGCAGGGAAAAATCGCTACCATTTTCAACAAGGCCTTGGATGTTATCGACAAAAAACTTGACAAAGAGTTGGAAGAGTTGGGAGTTCCTCCTCAACAATTACAAAAAATGACCGTTGAGCAAAAAAAGACGCTTTTCAAAGA | 68Nitratiruptor sp. SB155-2 ASM1032v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,888,450 | 1 | GGTTAAGCAGCTTAACTAAAGTCACATAGCATCAGTACAGTTAAGAATATGGAGTTTAAATCTGGCCGGGTATGGTGGCTCGCACCTGTAATCCCAGCATTTGGGAGGCTGAGTCGGACAGATTGCTTGAGCTCAGGAGTTAGAGACCAG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,131,850 | 1 | GCTGGAGTGCAGTGGCACAATCTCAGCTAACTGCAACCTCTGCCTCCCAGGCTCAGGTGATCCTCCTACCTCAGCCTCCCCAGGAGCTGGGACTACAGGCGTGAGCCAACACGCTTGGTTAATTTTTTAAATTTTTTGTAGAGACGGGGT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,527,400 | 1 | CACCCAGCCTGATCCTATTGTTGCACTATTTATGGAGCAACAACTTTGTACAAAGAACAAGCTTTGTACAGAGAACAAGCTTGGCTTTTTCTCCCAACGCCGAGGATGCTGTTGATGCTGCCACGTAATAGCATAATTTTGGGTGTCCTC | 120homo sapiens
|
G000007105 | ASM710v1 | GCF_000007105.1 | PRJNA224116 | SAMN02603579 | null | 2010/01/12 | Macrogen Inc. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/105/GCF_000007105.1_ASM710v1 | 637,000,356 | RS_GCF_000007105.1 | Monoisolate | Complete Genome | Full | na | Major | 264,203 | 542 | Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 | strain=ZM4 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Sphingomonadales | Sphingomonadaceae | Zymomonas | Zymomonas mobilis | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 2,056,363 | 1 | 46.33 | 2,056,363 | 1 | 1,753 | 604,103 | 86.562441 | 100 | 0 | 0 | 320 | yes | yes | yes | 20 | high | 1,682,200 | 0 | CAAGCACCGGATGAATTAGCCGAAAATATCCGCAATATGGCAGCAACTTTGCTGGCTTCGGGCGTTAATCCCGAACGAGCTGTCTTTTTTGCTCAATCTGATGTGGCCGCCCATTCCGAAATGGCATGGTTATTGAATTGTGTTGCCCGC | 117Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 ZM4
|
G000010625 | ASM1062v1 | GCF_000010625.1 | PRJNA224116 | SAMD00060936 | null | 2008/01/24 | Kazusa DNA Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/625/GCF_000010625.1_ASM1062v1 | 641,522,640 | RS_GCF_000010625.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 449,447 | 1,126 | Microcystis aeruginosa NIES-843 | strain=NIES-843 | null | Bacteria | Cyanobacteria | null | Chroococcales | Microcystaceae | Microcystis | Microcystis aeruginosa | true | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 5,842,795 | 1 | 42.33 | 5,842,795 | 1 | 5,605 | 1,591,543 | 80.239081 | 99.89 | 0.51 | 25 | 350 | yes | yes | yes | 20 | high | 4,740,970 | 0 | GGTATTCCCCCCGGGTATCGGCCTGAGAAACGACTTTGGCAAAGGCATCTAACACCATAGTTTTCATCTCCTATAATGATGATTGGTTTCGGCAAAATATCGAGGTTGATTGCTCTGGCTTTTCTTTATTTTTTCCGATAAAGTATCTAG | 64Microcystis aeruginosa NIES-843
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,501,750 | 1 | TATTCATAATTGGTAGACAAATGTGTCAAACATTTTACATGCATTATCTAATTTAATATGCACAAAATCCTATGACATAGGACTGTGGTTCTCCATTTTTTTAAATGAGGAAACTGACTGTTAACTGACAAACTGAGAGTTAATCTACCT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 546,600 | 1 | CCCTCCCAAAGTGCTGAGACTACAGGCGTGAGCCACCATGCCTGGCGTCCACTTTCTTGACTATTTCCTGAAGACCAGCGTTTCCCGGGTGGTTTCACAGCTGCGGAAGCTGCCTGTGTCAGTGTCAAGTCCCTACCCCTCGGCTTGGCC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,194,800 | 1 | GTGCGCCCGTGACAGCCTGGAACAGCACCGACACCCACAGGCGAGCATCTGACGGCCTGGAACAGCACCCACACCCCCAGGTGAGCATTGGACAGCCTGGAGCAGCACCCACAACCCCAGGCGGGCAACCGACAACCTGGAGCAGCACCC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,089,650 | 1 | CAGGAATTAAATCTTTAGAAAGTAAACTGCAGACCATCAGAACACTTTTTCCCACCTCAGCTTCCCAAAATGCCAGGATTACAGATGTGAGCCACCACACCTGGCCCATCGGAACATTTCACCCACATACTTCAGCAAACAATACCAGGA | 120homo sapiens
|
G000007705 | ASM770v1 | GCF_000007705.1 | PRJNA224116 | SAMN02603528 | null | 2003/08/22 | LNCC, Brazil | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/705/GCF_000007705.1_ASM770v1 | 637,000,074 | RS_GCF_000007705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 243,365 | 536 | Chromobacterium violaceum ATCC 12472 | strain=ATCC 12472 | null | Bacteria | Proteobacteria | Betaproteobacteria | Neisseriales | Chromobacteriaceae | Chromobacterium | Chromobacterium violaceum | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,751,080 | 1 | 64.83 | 4,751,080 | 1 | 4,298 | 1,428,392 | 88.582238 | 99.04 | 0.45 | 0 | 372 | yes | yes | yes | 20 | high | 4,522,960 | 0 | TCGGGGCGCGGTTCAGCAGCACCGGATGCTCGCGGATCACTTCTTCGAGGATGTCCCAGACTTCCGGCACTTCCTGCTCGACCAGCTTCTTGGCAGCCTTGATGGTGGACGCCAGGCCCATCACTTCCAGCTTGTGGAAGATGAACGGCT | 27Chromobacterium violaceum ATCC 12472
|
G000009925 | ASM992v1 | GCF_000009925.1 | PRJNA58195 | SAMD00061068 | null | 2004/09/16 | Kitasato Univ. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/925/GCF_000009925.1_ASM992v1 | 637,000,025 | RS_GCF_000009925.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 295,405 | 817 | Bacteroides fragilis YCH46 | strain=YCH46 | null | Bacteria | Bacteroidetes | Bacteroidia | Bacteroidales | Bacteroidaceae | Bacteroides | Bacteroides fragilis | true | Eubacteria | Bacteroidetes | 1 | 0.998 | 0.9 | 1 | 5,310,990 | 2 | 43.2 | 5,277,274 | 1 | 4,416 | 1,603,639 | 88.979964 | 99.26 | 0 | 0 | 347 | yes | yes | yes | 20 | high | 4,082,000 | 0 | CTGCCATGGTACTGACCCTGATTGGTCTTGAAGTGCTAAGTTACCTGTTTAAAAGCATAGGAATGAAAAGCTCAATGATAACTTTTTCGACCGATAACAAAGAAGTACTGAAAGGAGTGGCTGACCGATTTAATTCCAAAGATTACCTCA | 10Bacteroides fragilis YCH46
|
G000009145 | ASM914v1 | GCF_000009145.1 | PRJNA224116 | SAMEA3138193 | null | 2003/05/06 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/145/GCF_000009145.1_ASM914v1 | 637,000,195 | RS_GCF_000009145.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 228,410 | 915 | Nitrosomonas europaea ATCC 19718 | strain=ATCC 19718 | null | Bacteria | Proteobacteria | Betaproteobacteria | Nitrosomonadales | Nitrosomonadaceae | Nitrosomonas | Nitrosomonas europaea | true | Eubacteria | Proteobacteria | 0.98 | 1 | 0.9 | 1 | 2,812,094 | 1 | 50.72 | 2,812,094 | 1 | 2,670 | 848,291 | 88.875656 | 99.97 | 0.74 | 25 | 352 | yes | yes | yes | 20 | high | 1,079,260 | 0 | ATGGCAAAACCACCACCACGAGTCTGGTTGCCAGTATCCTGGCGGAAGCAGGCCAGGATCCGACATTTGTCATTGGTGGCAAGCTCAAGACGGTCGACAGTCATGCCAGATTGGGCAAGGGTGAATTCATCGTGGTCGAGGCGGATGAAT | 69Nitrosomonas europaea ATCC 19718
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,369,950 | 1 | AAACAGACTAAGGAAATATGTGTGTGTGTGTTTATGAAAAGAGAGCAGGAGAAGGAGAAAGAGAGAGATCTCTAAGATCTCTCTGTACAGGGAAATAGAATAGAGGGGTATCTATCTCTATAACCATATATATATTTGAATCTATCTATC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,540,650 | 1 | CAGCTAACACGCAGCTGATTTCCTATTGGCATCTTACTTAGCAACAGAGAAGAGTGTCAGAAGTCCCGGGCTTGACCTATGCCACGAGAACTCTTTAGAATTAACTTGCTTTGTGTGCTGGTTGAGGAATAAGTTGACAGGCAGAAGGTG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,868,450 | 1 | CATTGCCCCCCAATAAGGCCCCCTTGGAAACAAGCCCCCACAGTGGCCGGGGGGCAGGTGCACAGCTCAGAATTGCCCACTTGAAGGTCCTTTTCCAAGGTGACCACAGCCACCCAGGAGGAAAAACTCAGGAAGCTGAAATGTCAGGAC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,271,050 | 1 | CTTTCTTTTTCCCCATTGGTCTCATTGGAGTTTTATCAATTTTAATAACCTTCTCTTAGAATCAGCTTTAGATTTTGTTGATTTTTCTCTAGTGTCTGCTTCCTTCTTTCTCTGCATTCTTTTGAAACTGGTAAAGTTTTGATGAAAATT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,898,600 | 1 | GGAGCTCACGAAAAGGGAGAGAGATGGGGAAATAGCCGGTCAGTGGGGCAGTCAGAACACATACAACATTTATCAATTTCATTTGCTGTCTTACATGGACGTGGTTCGTGATGTCTCAAAACAATTACACTAGTAACACCAAAAATTACT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,253,950 | 1 | TCAGCAGCCCTCAGGACCCACCCTGAGCTTCTGCTGCCAGGCCAGGACCTAGGAACCAGCATCCCCAGCCCCGCCTTCACCTGGTGCTCGCTGATGATCTGCTAATCTGTGTGCATCCCACCCTGGCTGTGACTTCCAGCCGGGACTGTG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,556,750 | 1 | CCATCCACAGCTAAGAATATTGGGCAGTTCATGAGAAATGAGAAAGTGTTCTCAGTGGCCACTTGTCATTGTACAGAGAGGTTTTTCTGCTAACACCTATAAGACACAGTTAAACCCACTGATTCCCTACTATTACCTGAGAATCAAAAA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,505,800 | 1 | TGTAATTTATTTTGACACTGATCATCTATTATTCAGCTAGAGTAAAAATAAACCTTATTAGCCAGGAAAATAGATCCCTTTCGTTACGCCCACGCAACGCCAACTGCAACATCACAATGATGATCAGGACAATAGCGGAGTTTGCTCAAA | 120homo sapiens
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 445,900 | 0 | TCTTCATTTCGGCCGGTGAGCACGACATGGCCGACAACATCGTCCATATCGTCCTGGCCCGCCTGCCGGACGCACCGGCCGGTACCAAGGGGATTTCGCTGTTCATCGTGCCGAAGTTCCTGCCCAACGCCGAGGGCGGCGTGGGCGAGC | 78Pseudomonas putida KT2440
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,852,350 | 1 | CTCTCCTACTTCTGAAGACTAGAAGTCCAAAATCAAGGTGTTGGCAGGGCCCTGCCCCCTCCAAAGCCTCTATCTGGAAGAGGATGCTTCCTTGCTGCTTGCAGCTTCTGGTAGCCTCACACGTTCCTGAGTTTATAGATATCTCACTCC | 120homo sapiens
|
G000007845 | ASM784v1 | GCF_000007845.1 | PRJNA57909 | SAMN02603432 | null | 2003/04/30 | J. Craig Venter Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/845/GCF_000007845.1_ASM784v1 | 637,000,014 | RS_GCF_000007845.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 198,094 | 1,392 | Bacillus anthracis str. Ames | strain=Ames | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,227,293 | 1 | 35.38 | 5,227,293 | 1 | 5,474 | 1,495,110 | 84.244541 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 3,004,170 | 0 | ACATTCAGGCTGCATATAAATTAAGTCAAAATCGAAATGAGACGGATTATATTAATATTATTGAGAAATTGTACGATGAAGAAAATCCAGATGCAAAACAAATGGCGGAACTCATGGGGAGTAGATTAAACAATCACATATAATCCATTG | 5Bacillus anthracis str. Ames
|
G000008685 | ASM868v2 | GCF_000008685.2 | PRJNA57581 | SAMN02603966 | null | 2011/11/09 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/685/GCF_000008685.2_ASM868v2 | 637,000,036 | RS_GCF_000008685.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 224,326 | 139 | Borrelia burgdorferi B31 | strain=B31 | null | Bacteria | Spirochaetes | Spirochaetia | Spirochaetales | Borreliaceae | Borreliella | Borreliella burgdorferi | true | Eubacteria | Spirochaetes | 1 | 0.879 | 1 | 0.9 | 1,521,208 | 22 | 28.18 | 910,724 | 1 | 1,511 | 441,681 | 85.52361 | 100 | 0 | 0 | 178 | yes | yes | yes | 20 | high | 1,287,130 | 0 | GAATTTCAAAATCATTAAATATCGAATGATATTTTTAAAATATAGTTTGAGGACAAATAATAATCGAATGATTTTTGAAAATTAAATTATTTAGATATTTAGATATGGAAAAAGCCCCCAAAGGGGCATCTTTATCTGCGATGATAAACC | 14Borrelia burgdorferi B31
|
G000010625 | ASM1062v1 | GCF_000010625.1 | PRJNA224116 | SAMD00060936 | null | 2008/01/24 | Kazusa DNA Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/625/GCF_000010625.1_ASM1062v1 | 641,522,640 | RS_GCF_000010625.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 449,447 | 1,126 | Microcystis aeruginosa NIES-843 | strain=NIES-843 | null | Bacteria | Cyanobacteria | null | Chroococcales | Microcystaceae | Microcystis | Microcystis aeruginosa | true | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 5,842,795 | 1 | 42.33 | 5,842,795 | 1 | 5,605 | 1,591,543 | 80.239081 | 99.89 | 0.51 | 25 | 350 | yes | yes | yes | 20 | high | 2,552,160 | 0 | CAGATAGCGAGAACGGGTATAGATGGGGGCTTTTTCATCGTAGAAACTAAAGGCGGGATTTGGTTGTTGGGTCAAGGCGAGATTCGACTCATAAAAGGCTTCAATCGTCCCGATATCTTCCCAGTAACCCTTAAATAAATAAGCCTGAAG | 64Microcystis aeruginosa NIES-843
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,061,200 | 1 | TCTGTAGGAGTTTTGTAGTAAGGGGGGTTTTTTAGGATCTCAAGTCTGTCATATTTCTAGAAGCAGAGGCGCTGGGACTATATTGGTCAGGGTTCTCCAGAGAAACAAGACCAATAGGACATAGATATGGATATATAAAAAGAGATCTAA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,434,000 | 1 | CTAAAAATACAAAAAAAAATTAGCCGGGCGTGGTGGCGGGCACCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTAGGAGAATGGCGTGAAGCCAGGAGGCGGAGCTTGCAGTGAGCTGAGATCTTGCCACTGCACTCTAGCCTAGGCGAC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,248,300 | 1 | ATACCCATCACTTCCAATTTGCTCTGTGGTGGGAACACTTAAGTCTACTTTACTAACAATTTTGAAACACACGTTATTATGAACTACTCTCCGTGCTGTGTGGCACATTTCTAAAATTTATTCCTAACTAAAACTCTGTACCCTCAGAAT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,730,750 | 1 | GAGGACTCCTGTCTGGGTTCGTGCTGCCAATCAGTAGCATTCCCCAGGCAAGACGTGGGCGCCAGGCCTGACTTGAAACCCAAGGTTGGCTTCAAGATCTTGCAGCTGGATCAGAATGCTGAGTTCATCGTTGCTGGTGGGCCGCCGTCA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,808,700 | 1 | ATTGCTGGAGGTAATGTAAAAACCTTGCAGCTTTTCATGTTCAGACTGAAAAGGAAGAAGTAAAACTGTATTTATTTATAAACAATATGATCGTATATAGAGAAAATCTTAAGGAATCCTCTAAGAAACTAGTAGAACTAATAAATGAGT | 120homo sapiens
|
G000011005 | ASM1100v1 | GCA_000011005.1 | PRJDA20361 | SAMD00060931 | null | 2009/12/25 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/011/005/GCA_000011005.1_ASM1100v1 | 2,505,679,075 | GB_GCA_000011005.1 | Monoisolate | Complete Genome | Full | na | Major | 304,371 | 570,267 | Methanocella paludicola SANAE | strain=SANAE | null | Archaea | Euryarchaeota | Methanomicrobia | Methanocellales | Methanocellaceae | Methanocella | Methanocella paludicola | true | Archaea | Euryarchaeota | 1 | 1 | 0.8 | 0.9 | 2,957,635 | 1 | 54.92 | 2,957,635 | 1 | 3,055 | 877,570 | 87.405714 | 100 | 0.65 | 0 | 198 | no | yes | yes | 17 | medium | 2,483,780 | 0 | GGAAGTTCACTGAGTAGATCGTCGGGCCGTTCGTGGCATTTAAGTTCTCGATGTAGAGCACGACGTAGGCGGGCTTAAAGCCGCTCTGGTATGTGTATGAGCCCATCATGGTGCTGCCCTGATATAAGCTGCAGGTGAAGCTATTGCCAT | 58Methanocella paludicola SANAE
|
G000008325 | ASM832v1 | GCF_000008325.1 | PRJNA224116 | SAMN02603968 | null | 2005/05/18 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/325/GCF_000008325.1_ASM832v1 | 637,000,166 | RS_GCF_000008325.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 243,233 | 414 | Methylococcus capsulatus str. Bath | strain=Bath | null | Bacteria | Proteobacteria | Gammaproteobacteria | Methylococcales | Methylococcaceae | Methylococcus | Methylococcus capsulatus | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 3,304,561 | 1 | 63.58 | 3,304,561 | 1 | 3,046 | 1,020,877 | 91.024466 | 99.2 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 1,225,380 | 0 | GCTATTGCCCGCGCTGGAAGGACTGATCGTGCCGTCCAAGTTCTACGGCGTGCTGGCGGCCGGCCGGCCCGTCGCTTTTGTCGGGGCCAGAGACGGCGAGCTGTCCCGGCAGATAGAGCGGCATGCCTGCGGCGCAAGCTTCGCGCCGGG | 63Methylococcus capsulatus str. Bath
|
G000007465 | ASM746v2 | GCF_000007465.2 | PRJNA57947 | SAMN02604090 | null | 2011/09/01 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/465/GCF_000007465.2_ASM746v2 | 637,000,288 | RS_GCF_000007465.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 210,007 | 1,309 | Streptococcus mutans UA159 | strain=UA159 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus mutans | true | Eubacteria | Firmicutes | 1 | 1 | 0.9 | 1 | 2,032,925 | 1 | 36.83 | 2,032,925 | 1 | 1,897 | 591,301 | 85.692487 | 100 | 0 | 0 | 308 | yes | yes | yes | 20 | high | 285,740 | 0 | CAGCCACTAAAAAGACGAAAACAGGTTATTCAACAGCTGTTGATGTCTTGGAACGTCTGGCTCATCGTTCACCAATCGTTGCTAAAATTTTAGAATATCGTCAAATTGCGAAATTGCAATCCACCTATATCATTGGCTTGCAAGATTCGA | 92Streptococcus mutans UA159
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,183,700 | 1 | GTTTAGCAGCAAAGGTGAAAAAGACCTGGTTGTGACAACGCATGAGATTAAACCGTAGTGATAAATTCTAAATAATATTTAATTTCTCCATAAGATCACATGCTTCTAAACACTAAACAATTTAAATATAGCTTGGGACAGAAAAGTATG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,649,600 | 1 | CCAGTGCCCTCCCCGGCCCGCCCAGCCCACAGACCTGGCAGGCCCAGCGGGGCTGGCAGGAGGTGGGCAGGGCTGGCGGGCACTGGTGTGTTGGGGTCCGAGGAGATCACCTCGCCCGACTTCTTCCCCTCGGGCCCCTCAGGGATCAAG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,732,000 | 1 | GAGGTGGCAGGGCTGAGGTTTGCAGCCTCATTTTTCCAGGTGTTTTGTCTCCCTGAGAATCTGGTTCCTCCCATGAGACTGCGAGATACTCTGGATTCTAGAAAACCATAGGTTAGGTTTGCAGGGCGGCTGCAAGAGACACAGAAGCCT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,366,200 | 1 | GACCAGAGAACTGTAGCAGGATTCCCAGGTATTTTGATGGTGCATTTGAGGTTGGTGATGATGCGTTTATTGTAGAAACACTGTACCCTGTTATATGTGACTTTCTGTATGTATTTGGCGACTTGGGTTTAGGTAAGAACAAAGTCAATA | 120homo sapiens
|
G000009765 | ASM976v2 | GCF_000009765.2 | PRJNA224116 | SAMD00061088 | null | 2016/03/24 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/765/GCF_000009765.2_ASM976v2 | 637,000,304 | RS_GCF_000009765.2 | Monoisolate | Complete Genome | Full | representative genome | Minor | 227,882 | 33,903 | Streptomyces avermitilis MA-4680 = NBRC 14893 | strain=MA-4680 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces avermitilis | true | Eubacteria | Actinobacteria | 1 | 0.999 | 1 | 1 | 9,119,895 | 2 | 70.7 | 9,025,608 | 1 | 7,915 | 2,675,970 | 86.456522 | 99.89 | 0.79 | 0 | 356 | yes | yes | yes | 20 | high | 5,974,540 | 0 | CAGTGTGGTCTGCCCAAGGCCATGGCGCTGGAGCTCTTCAAGCCGTTCGTGATGAAGCGCCTGGTCGACCTGAACCACGCGCAGAACATCAAGTCGGCGAAGCGGATGGTCGAGCGCGGCCGCACGGTCGTGTACGACGTCCTGGAAGAG | 95Streptomyces avermitilis MA-4680 = NBRC 14893 MA-4680 ASM976v2
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,180,400 | 1 | CGGAGGTGCGCACGTGACAGCCTGGAACAGCACCCACTCACCCAGGCGAGCATCTGATGGCCTGGAACGGCACCCACACCCACAGGTGAGCATCCGATATCCTGAAACAGCTCCCACACCCCCAGGTGAGCATCCGACAGCCGGGAGCAG | 120homo sapiens
|
G000007185 | ASM718v1 | GCA_000007185.1 | PRJNA294 | SAMN02603235 | null | 2002/04/03 | Fidelity Systems | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/007/185/GCA_000007185.1_ASM718v1 | 638,154,507 | GB_GCA_000007185.1 | Monoisolate | Complete Genome | Full | na | Major | 190,192 | 2,320 | Methanopyrus kandleri AV19 | strain=AV19 | null | Archaea | Euryarchaeota | Methanopyri | Methanopyrales | Methanopyraceae | Methanopyrus | Methanopyrus kandleri | true | Archaea | Euryarchaeota | 1 | 1 | 0.9 | 1 | 1,694,969 | 1 | 61.16 | 1,694,969 | 1 | 1,814 | 523,004 | 90.896353 | 96.74 | 1.6 | 0 | 146 | yes | yes | yes | 15 | medium | 571,090 | 0 | TTCCTGGAACTCATCGTCCACGTCCGGTCCCCCGGGGGAGACGCTCCGTGGAAACGGTTAGAATATCCGTGCTGGACGTAGTGCGACGCATCGCGGACGTCGCGGCCCTAAGCGTTTTCGAGGTGATCAGGGACGGCCCCCTCGACGTAC | 60Methanopyrus kandleri AV19
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,919,200 | 1 | CTGGTCTCAAACTCCTGACCTCAAGTAATCCACCCACCTCAGCCTCCCAAAGTGCTGGGATTACAGGCCTGAGCCACTGCACCCAGCCTAGAAGTTGTTCTGTGTTTTCTTTCTCTCTTTGGCTTTTGGCTTCAGGAATATCAGGATAAA | 120homo sapiens
|
G000010305 | ASM1030v1 | GCF_000010305.1 | PRJNA224116 | SAMD00060909 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/305/GCF_000010305.1_ASM1030v1 | 643,692,024 | RS_GCF_000010305.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 379,066 | 173,480 | Gemmatimonas aurantiaca T-27 | strain=T-27 | null | Bacteria | Gemmatimonadetes | Gemmatimonadetes | Gemmatimonadales | Gemmatimonadaceae | Gemmatimonas | Gemmatimonas aurantiaca | true | Eubacteria | FCB | 1 | 1 | 1 | 1 | 4,636,964 | 1 | 64.27 | 4,636,964 | 1 | 4,004 | 1,466,180 | 93.177023 | 98.9 | 4.4 | 0 | 353 | yes | yes | yes | 20 | high | 2,142,140 | 0 | GACTTTGTCGTGCTGCGGCCCGATGGCCTGTTGGAGCTCCACGAGGTCAAGGCGCGAGCGAAGTCTGGGTTCGGCGCGACCGAAGCGAGTTGGGCCAAGGTCAAGACGGCCGCCGGTGAAGCGCCGTTCCCGATCCGCGTCGTGTGGCCC | 42Gemmatimonas aurantiaca T-27
|
G000007745 | ASM774v1 | GCF_000007745.1 | PRJNA224116 | SAMN02603473 | null | 2004/09/17 | Korea Advanced Institute of Science and Technology, Republic of Korea, Yuseong-gu | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/745/GCF_000007745.1_ASM774v1 | 637,000,156 | RS_GCF_000007745.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 221,988 | 157,673 | Mannheimia succiniciproducens MBEL55E | strain=MBEL55E | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pasteurellales | Pasteurellaceae | Basfia | [Mannheimia] succiniciproducens | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 2,314,078 | 1 | 42.54 | 2,314,078 | 1 | 2,120 | 690,147 | 87.871627 | 100 | 0 | 0 | 329 | yes | yes | yes | 20 | high | 1,663,740 | 0 | AGTCAGACAGCACGCTGATTGCCGATTTTACCGAAGCAACATTAGCGTTATAAGTATCATCCAATAATAATAAATTAGTTGACAATTGAATCGGGAACAAGCGCCCTTTCACGTGTGACGGGTTTTCCAAGCCTCGCTTTATGTCTTCTA | 57Mannheimia succiniciproducens MBEL55E
|
G000010525 | ASM1052v1 | GCF_000010525.1 | PRJNA224116 | SAMD00060925 | null | 2007/10/16 | University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/525/GCF_000010525.1_ASM1052v1 | 641,228,476 | RS_GCF_000010525.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 438,753 | 7 | Azorhizobium caulinodans ORS 571 | strain=ORS 571 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Xanthobacteraceae | Azorhizobium | Azorhizobium caulinodans | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 5,369,772 | 1 | 67.32 | 5,369,772 | 1 | 4,810 | 1,620,542 | 88.922714 | 100 | 0 | 0 | 358 | yes | yes | yes | 20 | high | 3,781,830 | 0 | ATGACGCCCTTGGCAGCCCGGCACTGCGCCGCCGGCACGTTCCAGCTCCGAGCGGCCGCTTCCACCAGCATGGCACGCGCCTGCGCGCCTCCGAGCCGCAGATAATCGTGCGAGCCGCGGATGGAGCGCGAGCCGCCTGTCTGCTGCGAG | 4Azorhizobium caulinodans ORS 571
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,500,200 | 1 | TCTGAATTGTGAACTGCACAGGCAGCATGACACGCAGCTGCCAGGATGTGGTGAAATGCAAGTGCTGCCCAACTTCCGCCGCAACGGAAGCCCTCGGAGTGCATGAACATAATCCCGAGAAGGGCAGAGAGAGGCATCCATTCCAAAGAT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,057,200 | 1 | CCACCTACCTGCACCTGTGCCTGTATTTATACCTACGCCTGTATTTCTGTTGGTCTATTATATCTCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATTTATCTATTTATCTATCTATCTATCATCTACCTATCTCTCTGTCA | 120homo sapiens
|
G000007785 | ASM778v1 | GCF_000007785.1 | PRJNA57669 | SAMN02603978 | null | 2003/03/28 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/785/GCF_000007785.1_ASM778v1 | 637,000,101 | RS_GCF_000007785.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,185 | 1,351 | Enterococcus faecalis V583 | strain=V583 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Enterococcaceae | Enterococcus | Enterococcus faecalis | true | Eubacteria | Firmicutes | 0.99 | 0.991 | 1 | 1 | 3,359,974 | 4 | 37.38 | 3,218,031 | 1 | 3,271 | 1,000,353 | 87.714339 | 99.53 | 0.31 | 0 | 309 | yes | yes | yes | 20 | high | 1,007,500 | 0 | TGCTCTATAAAACAGCTGTTCAGCTAGAAGGATTGCCTCGCCATGTTTCTACGCACGCAGCAGGTGTGGTAATTAGTGATGAAAATCTTTTGAATTTGGTTCCGTTACAACCAGGATCGAATGAAATTTTATTGACCCAATTTACTATGA | 37Enterococcus faecalis V583 ASM778v1
|
G000008345 | ASM834v1 | GCF_000008345.1 | PRJNA224116 | SAMN02603281 | null | 2004/07/30 | Goettingen Genomics Laboratory | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/345/GCF_000008345.1_ASM834v1 | 637,000,215 | RS_GCF_000008345.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 267,747 | 1,747 | Propionibacterium acnes KPA171202 | strain=KPA171202 | null | Bacteria | Actinobacteria | Actinobacteria | Propionibacteriales | Propionibacteriaceae | Cutibacterium | Cutibacterium acnes | true | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 2,560,265 | 1 | 60.01 | 2,560,265 | 1 | 2,373 | 780,330 | 89.799572 | 100 | 0 | 0 | 319 | yes | yes | yes | 20 | high | 735,410 | 0 | CCAGAAGACAGCAACATTGATCCCAACCGAATGACCGCTTCGGTGTCATTAACGAATTCGCGGTCATGACGAATGTCGTCTCGGTAGTCGTGGGGATCAGTGCTTGTCACGTCCCTCTATTGTGCCACTGTCGTTCCAATGGTCCACGGG | 77Propionibacterium acnes KPA171202
|
G000007265 | ASM726v1 | GCF_000007265.1 | PRJNA57943 | SAMN02604013 | null | 2002/08/28 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/265/GCF_000007265.1_ASM726v1 | 637,000,285 | RS_GCF_000007265.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 208,435 | 1,311 | Streptococcus agalactiae 2603V/R | strain=2603V/R | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus agalactiae | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 2,160,267 | 1 | 35.65 | 2,160,267 | 1 | 2,106 | 643,747 | 87.791509 | 100 | 0.18 | 0 | 298 | yes | yes | yes | 20 | high | 598,260 | 0 | CTGGTAAGCTAACTGGCGATAAAGAGTTAGAGGCAAAAGGTTTTGTCGAAAAAACAATTGCTAAAGGTAAAGAACTAGCAGATGATGCTAAAGATGCTGTTGAAGAGGCAGTAGATGTTGTCAAAGAAAAACTGAAATAAATATTAACCG | 91Streptococcus agalactiae 2603V/R
|
G000009345 | ASM934v1 | GCF_000009345.1 | PRJNA57741 | SAMEA1705958 | null | 2007/01/12 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/345/GCF_000009345.1_ASM934v1 | 640,069,335 | RS_GCF_000009345.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 393,305 | 630 | Yersinia enterocolitica subsp. enterocolitica 8081 | strain=8081 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Yersiniaceae | Yersinia | Yersinia enterocolitica | true | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 4,683,620 | 2 | 47.22 | 4,615,899 | 1 | 4,253 | 1,352,606 | 85.086813 | 99.95 | 0 | 0 | 373 | yes | yes | yes | 20 | high | 624,130 | 0 | TATGATGGTATTCAGAACCATAGAATTCAGTAAAAGCAGAGTATTCTGTTACGGCACATGGGATAGTATAAATCGCAGCTAGCGCTGGTCCTAAACCGACGCTTTCAACATTTTTTACATTCGGCGTAAACAAAACAGCACCTGATAAAG | 115Yersinia enterocolitica subsp. enterocolitica 8081
|
G000008665 | ASM866v1 | GCF_000008665.1 | PRJNA224116 | SAMN02603985 | null | 1999/12/22 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/665/GCF_000008665.1_ASM866v1 | 638,154,502 | RS_GCF_000008665.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 224,325 | 2,234 | Archaeoglobus fulgidus DSM 4304 | strain=DSM 4304 | null | Archaea | Euryarchaeota | Archaeoglobi | Archaeoglobales | Archaeoglobaceae | Archaeoglobus | Archaeoglobus fulgidus | true | Archaea | Euryarchaeota | 1 | 1 | 0.9 | 0.9 | 2,178,400 | 1 | 48.58 | 2,178,400 | 1 | 2,518 | 688,447 | 93.086761 | 100 | 0 | 0 | 186 | no | yes | yes | 17 | medium | 212,550 | 0 | GGACGCCTGTGAAGTTCATATCCCTCACGCTTCCGTGGTTCTTCTTTGCCCTCACAAATCCTCAGGTATTCCAGAGACTTTACATCCCGAAGGACAGGTCAGCTTTAAGGAGAATGGTAATTCTCTTCGGCTTCTTCGGCCTCATCTACA | 3Archaeoglobus fulgidus DSM 4304
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,687,300 | 1 | CCATGTCGGGGGATGAACATGCTGATTAGGAAGTGATGGGAAATTCAGGACCGAGGGGTGGCAAGAGCCGGGACGAAACACGGTGGGGCACAGGGAGGGAGAATCGCAGTTGGCGCAGGTTTGGGTGTCAGGAAAGTTCTTCTTGGGAGT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,313,950 | 1 | ATGTATATAAAACTGCTCAAAAACATAAACTAAATAATTCTGTTAAAATGATCTATCCACTAGCACTTTGCAAGGCCAAGGCAGGTGGATCACCTGAGGCCAGGAGTTCGAGACCAGCCTGAACAACATGGTGAAACCTCGTCTCTACTA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,579,450 | 1 | CACTCTGGCTGCTCATTGCCACTCTGGGTCCCGACCGGGTGTGGGTTCAGATGAAGACTCTCAAACAGGCCTTGGCTGCATCAAACACATCGCGGGGGTGTGGGGTCTAGGGCTGAAGTCACGGGGTAGACTTCAGACTTCTGCAAACGT | 120homo sapiens
|
G000008465 | ASM846v1 | GCF_000008465.1 | PRJNA224116 | SAMN02604184 | null | 2004/12/02 | University of Hawaii at Manoa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/465/GCF_000008465.1_ASM846v1 | 637,000,136 | RS_GCF_000008465.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 283,942 | 135,577 | Idiomarina loihiensis L2TR | strain=L2TR | null | Bacteria | Proteobacteria | Gammaproteobacteria | Alteromonadales | Idiomarinaceae | Idiomarina | Idiomarina loihiensis | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 2,839,318 | 1 | 47.04 | 2,839,318 | 1 | 2,658 | 892,961 | 92.667007 | 100 | 0.17 | 0 | 344 | yes | yes | yes | 20 | high | 1,510,730 | 0 | CCCGTTAGCGACATTGCTGTAACTATGAATAGTCCGTGCAAGCAGTGTTTTCCCGGTACCTGTTTCTCCCTGTAGCAACACTTTTGCAGAGGAGCTTGCGACTCGTTTTGCGAGATCATAGCAAGCTCTCATTTGCCGACTAATGACAAA | 50Idiomarina loihiensis L2TR
|
G000009705 | ASM970v1 | GCF_000009705.1 | PRJNA224116 | SAMD00061094 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/705/GCF_000009705.1_ASM970v1 | 637,000,199 | RS_GCF_000009705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 103,690 | 103,690 | Nostoc sp. PCC 7120 | null | null | Bacteria | Cyanobacteria | null | Nostocales | Nostocaceae | Nostoc | Nostoc sp. PCC 7120 | true | Eubacteria | Cyanobacteria | 1 | 0.992 | 0.9 | 1 | 7,211,789 | 7 | 41.27 | 6,413,771 | 1 | 6,159 | 2,024,679 | 82.716938 | 99.19 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 5,016,570 | 0 | TCCTTAGCCCTATTTTGTTGTCTTAATTTTTTGCCCTCCTACTATCGAACTTAAATTTTGCCGTCTTTAGTGAGAAAGATATTCAACATATCAGACAAATAAAGCTTTAGGAAGAAGAGCTTAAATTGCTTATGCTCTATACTCAATATT | 70Nostoc sp. PCC 7120 ASM970v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 262,350 | 1 | GCCCTCAGGTCTAATAATTAACTTCATTGCAGGCTCCTGGCAGGCCTGGGTGGGCGGCAGCTGCATTGTGCTCCTGAAGAAGATTTAAGTTGGGTTTGGTGAACTGGTAGAATTTGCATTTTGCTGTTTCTTTCCCTCTCCCAGAATTTG | 120homo sapiens
|
G000008505 | ASM850v1 | GCF_000008505.1 | PRJNA58089 | SAMN02598265 | null | 2004/12/27 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/505/GCF_000008505.1_ASM850v1 | 637,000,023 | RS_GCF_000008505.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 281,309 | 1,428 | [Bacillus thuringiensis] serovar konkukian str. 97-27 | strain=97-27 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus thuringiensis | true | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,314,794 | 2 | 35.37 | 5,237,682 | 1 | 5,361 | 1,516,528 | 84.049767 | 99.07 | 0.31 | 0 | 381 | yes | yes | yes | 20 | high | 5,006,820 | 0 | AAGAAGTAAAAATATTACGGCACTCTTTCTCCTTTCTTCCTTGGAGCCCTGAAGTGCTATAAGAAGCCCTAACGGCAACCAATCAAAAAAAACTGTGATGTATCCCTTACCTCTACTATTTAAATATCCTTCAGCATATTCAGTCGTTCC | 118[Bacillus thuringiensis] serovar konkukian str. 97-27
|
G000009985 | ASM998v1 | GCF_000009985.1 | PRJNA224116 | SAMD00061077 | null | 2005/12/01 | Tokyo University of Agriculture and Technology, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/985/GCF_000009985.1_ASM998v1 | 637,000,155 | RS_GCF_000009985.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 342,108 | 84,159 | Magnetospirillum magneticum AMB-1 | strain=AMB-1 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhodospirillales | Rhodospirillaceae | Magnetospirillum | Magnetospirillum magneticum | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,967,148 | 1 | 65.09 | 4,967,148 | 1 | 4,628 | 1,522,305 | 90.298759 | 99 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 762,060 | 0 | TCTGGGCAAGCGCGACCTGACCGGCTTCGTGGACGGCACCGAGAACCCGGAAGGCGACGATCGCACCGAGGTGGCCCTGGTCAAGGACGATCCCTTCGCCGGCGGCAGCTTCGTCTCGCTGCAGCGCTACGTCCACGATCTGCCCCGTTG | 56Magnetospirillum magneticum AMB-1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,077,200 | 1 | TCCAAAAATCTGAGACAGGTCTCAGCCAATTTGGGAAGTTTATTTTGCCAAAATTAAGGATGCACACCTGTGACACAGCCTCAGGAGGTCCTGACATGTGCCCAGGGTGGTCAGAGGACAGCTTGGTTTTATACATTTTAGGGAGATATG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,038,300 | 1 | GCCAAATACTGACCTCAGTGGGATCAGAACCTGAAAGCCCCTCTCTGGGGTGACTTTCTCAAGTGCTATCCTCAGTCTCCCTGGGCTCTCGCAGGATGGGGTCCCAGTCCCTGCAGGTGCCTCAGCCCAACCACTGAAGCAGATGACACC | 120homo sapiens
|
G000010165 | ASM1016v1 | GCF_000010165.1 | PRJNA224116 | SAMD00060942 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/165/GCF_000010165.1_ASM1016v1 | 643,692,011 | RS_GCF_000010165.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 358,681 | 1,393 | Brevibacillus brevis NBRC 100599 | strain=NBRC 100599 (= 47) | null | Bacteria | Firmicutes | Bacilli | Bacillales | Paenibacillaceae | Brevibacillus | Brevibacillus brevis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 6,296,436 | 1 | 47.27 | 6,296,436 | 1 | 5,917 | 1,875,522 | 87.757979 | 99.73 | 0.27 | 0 | 381 | yes | yes | yes | 20 | high | 351,780 | 0 | GTTTCTGAGGCACTGGCTGTAAACGTACTGGCAGGTGTGACAGGTTCAGCGTCGGGCGGTATGTCGATCGCGCTGGAGGTTATGAGCAAGCAATACCTGGAGATGGCAAATGCTGCGGGAATCAGCCCTGAGTTGCTGCACCGTATTGCC | 15Brevibacillus brevis NBRC 100599
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,851,650 | 1 | CTGAGTAAGAAACTCAAACACCCACCATGACCAGGGTCTCCCAAGGCATGGTGGGGGGCAGCAAACCCTCCTCAGGCTGCCATCCCGCATGAGGTACCCTGTGGAACCCAGCACAGAGCACGAATGTGCCACGAGCCCAGGCCATCGCAG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,109,000 | 1 | GAGGGAAACCCCAGGACTGGAGAAGGAGCATCAACCCCAACAAGGAAGACTGAGTAAGGAAAATAGGTCTGAAGAACATGAGTCCGATGTTGGTCAGACATCCAAGCACAGCCATCAGGAAGTGGGTGGTGTTAGTTGGAGGAGACGTCT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,592,300 | 1 | TCAACCATGGCACTTTTGACACTTGGGGTCTGATAATTCTTTGTTATGGGGGCTGTCCTGAGCACAGCAGGATGTTTACAGCATCCTGTGAACATGGTGCCAGTAGCACCCCTCTCCCCAGCTGCGACAACCCAAATGTCTTCCAACATT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,227,350 | 1 | AACAGCATCCACACCCCCAGGTGAGTATCTGACGGACTGGAACAGCACCCACAACCCCAGGTGAGCATCTGACATCGTGGAGCAGCACCCCACACCCACAGGTGGGCATCTGACAGCCTGGAGCAGCACCCACACCCCAGGTGAGCATCT | 120homo sapiens
|
G000008525 | ASM852v1 | GCF_000008525.1 | PRJNA57787 | SAMN02603995 | null | 1999/12/22 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/525/GCF_000008525.1_ASM852v1 | 637,000,132 | RS_GCF_000008525.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 85,962 | 210 | Helicobacter pylori 26695 | strain=26695 | null | Bacteria | Proteobacteria | Epsilonproteobacteria | Campylobacterales | Helicobacteraceae | Helicobacter | Helicobacter pylori | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 1,667,867 | 1 | 38.87 | 1,667,867 | 1 | 1,579 | 514,109 | 90.817493 | 99.36 | 0 | 0 | 275 | yes | yes | yes | 20 | high | 345,800 | 0 | CAGATGAATTGCATAAGGAAGTGTTAGAAAAAGAAGTGATCCCTTTTTTAAAAGAGGGGCAAATTGTGGGCTTTGCCCATGGTTTTAGCGTGCATTTCAATCAGGTTGTTCTTCCAAAAGGCGTGGGCGCGATTTTAGTCGCGCCAAAAG | 48Helicobacter pylori 26695 ASM852v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,202,950 | 1 | TGGGATTATAGGCGTGAGCCACCGCGCCTGGCCAGGACCATGTTCTTTCGTTCCATTCACCCGATGGACACTTCTGTTGCTCCCACTCTATGGCTTTTGTGAATAATGCTGCGTTGTGAACATGGGTGGACAGAGACCTGTTGAAGTCCC | 120homo sapiens
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 2,637,180 | 0 | TCGCCTCGGCGCCGCCGACGGACAAGGCCTACAACGTCGAGCGCGCCTTCAAGGCGGGCTGGGGCGGCGTCGTCTGGAAGACGCTCGGGGAAGAAGGACCGCCGGTGGTCAATGTCAACGGCCCGCGCTACGGCGCGATCTGGGGCGCCG | 86Sinorhizobium meliloti 1021
|
G000010665 | ASM1066v1 | GCF_000010665.1 | PRJNA224116 | SAMD00060954 | null | 2009/06/11 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/665/GCF_000010665.1_ASM1066v1 | 644,736,352 | RS_GCF_000010665.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 573,370 | 184,917 | Desulfovibrio magneticus RS-1 | strain=RS-1 | null | Bacteria | Proteobacteria | Deltaproteobacteria | Desulfovibrionales | Desulfovibrionaceae | Desulfovibrio | Desulfovibrio magneticus | true | Eubacteria | Proteobacteria | 0.99 | 0.996 | 1 | 1 | 5,315,620 | 3 | 62.67 | 5,248,049 | 1 | 4,555 | 1,546,858 | 85.744052 | 100 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 5,308,940 | 0 | ATTTTTTTAACAATCCGGGTTTGTTCTTGATTGGTATTCACTGTAAATTTAAAACTTTGCTATTGAAATAGTTTTGTAATCGCATATTTTTACAAAAAAATCATGGAGGTAACCTATGCCCGAACTTTCCTGGAGAGAAGCTTGTATAAG | 36Desulfovibrio magneticus RS-1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,536,400 | 1 | GGGGCTCAGTTTACCTCCTGCTTCAGCCCTTACTCGCCTCCTCCAATCCCAAACTCCTCCCATCCTCAGGTGACCTGGTGCTTGACCCAGACTGCCGAGGGGTGGCCGGGCCCTGTCAGTGCTGCGGAGGTGAGCTCCTTCTGAAAGGAC | 120homo sapiens
|
G000008645 | ASM864v1 | GCF_000008645.1 | PRJNA224116 | SAMN02603244 | null | 1999/12/22 | Genome Therapeutics Corporation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/645/GCF_000008645.1_ASM864v1 | 638,154,510 | RS_GCF_000008645.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 187,420 | 145,262 | Methanothermobacter thermautotrophicus str. Delta H | strain=Delta H | null | Archaea | Euryarchaeota | Methanobacteria | Methanobacteriales | Methanobacteriaceae | Methanothermobacter | Methanothermobacter thermautotrophicus | true | Archaea | Euryarchaeota | 0.99 | 1 | 0.9 | 1 | 1,751,377 | 1 | 49.54 | 1,751,377 | 1 | 1,876 | 533,233 | 89.684117 | 100 | 0.31 | 16.67 | 182 | no | yes | yes | 19 | medium | 1,442,090 | 0 | GTGAGGAATGGAAGGGTGGTTGATGTATCCGAACCACTTATCGATTACTGTCCCCTCTTTCATAAGTACCGGGGCATTGAAAAAATCACATCTGAGGCTATCCGTCAAAATATTGAGTTTCGCATTAAAGATTTTGGCATGTGCACAGGT | 62Methanothermobacter thermautotrophicus str. Delta H
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,289,450 | 1 | GACATAGTCCAGCGTGCCCAGGAACGCGCTGCCCGCCAGCACCCGCAGCAGTCCCCGGCCGCACAGCGCGCGCACACAGCCCCCCGGGTGCGGCGCCCCCTGCTCCACTACCGTCTGGAAGTCCTCCATGGCGCGCCGCGAGTCCCCGGC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,860,000 | 1 | TGCTGGCAAGGGGAGAAGGTCCAGGCAGGGGCGGGGTTGTGGATCCACAGTGGGATGCGGGGCTGAACGGTTATGTCCCGGTAGGTAGGGGCTGCAGAAAGAGCCCCGAGGGCTGGGGAGTCCCGGAGCTGGACCACAGGAAGGGCCTCA | 120homo sapiens
|
G000007865 | ASM786v1 | GCF_000007865.1 | PRJNA224116 | SAMN02604086 | null | 2004/01/30 | Univ. Minnesota | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/865/GCF_000007865.1_ASM786v1 | 637,000,168 | RS_GCF_000007865.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 262,316 | 1,764 | Mycobacterium avium subsp. paratuberculosis K-10 | strain=K-10 | null | Bacteria | Actinobacteria | Actinobacteria | Corynebacteriales | Mycobacteriaceae | Mycobacterium | Mycobacterium avium | true | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 4,829,781 | 1 | 69.3 | 4,829,781 | 1 | 4,544 | 1,497,326 | 91.345322 | 99.28 | 0.33 | 0 | 336 | yes | yes | yes | 20 | high | 549,900 | 0 | AGCGGGGCGCTGCGGTTGACCGCCGACTACGTGGCCAACCGCAAGCAGTTCGGCAAGCCGCTGTCCACCTTCCAGACCGTGGCCGCGCAGCTCGCCGAGGTCTACATCGCCTCGCGCACCATCGATTTGGTGGCCAAGTCGGTGGTGTGG | 65Mycobacterium avium subsp. paratuberculosis K-10
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,219,450 | 1 | AGAATAAACCTAAACCCACTTCCTTCCCCGTCACCTCCTTGAGTCCCACTTTCCTCATTCATAAAACTGAATGGCTGCCTTCGGGGCTTGTCACAATGTTTAATGAGAAAATGGACATCAGGTGCCTAGTCATGGGGGCTGGCCGCTGTA | 120homo sapiens
|
G000007345 | ASM734v1 | GCF_000007345.1 | PRJNA224116 | SAMN03081414 | null | 2002/04/03 | Broad Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/345/GCF_000007345.1_ASM734v1 | 638,154,508 | RS_GCF_000007345.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 188,937 | 2,214 | Methanosarcina acetivorans C2A | strain=C2A | null | Archaea | Euryarchaeota | Methanomicrobia | Methanosarcinales | Methanosarcinaceae | Methanosarcina | Methanosarcina acetivorans | true | Archaea | Euryarchaeota | 0.98 | 1 | 0.8 | 0.9 | 5,751,492 | 1 | 42.68 | 5,751,492 | 1 | 4,884 | 1,470,904 | 75.340086 | 99.84 | 0.03 | 0 | 229 | no | yes | yes | 18 | medium | 4,004,390 | 0 | GCAAGGCTGAAGATGCCTGTCCCCACAAAATAAAGGGAATCCCTAATCCTTATTTTCAGTAGTTCCGGCCTGGTAAAAAGAAGATACACAAGCATTAGAACAGCCGCTGATAAAACCCTGAGAGTCACAACCTGAAGCGGGGAAAATCCG | 61Methanosarcina acetivorans C2A
|