#genome
stringclasses 121
values | asm_name
stringclasses 120
values | assembly_accession
stringclasses 120
values | bioproject
stringclasses 45
values | biosample
stringclasses 120
values | wgs_master
float64 | seq_rel_date
stringclasses 98
values | submitter
stringclasses 76
values | ftp_path
stringclasses 120
values | img_id
float64 637M
2.51B
⌀ | gtdb_id
stringclasses 120
values | scope
stringclasses 3
values | assembly_level
stringclasses 1
value | genome_rep
stringclasses 1
value | refseq_category
stringclasses 3
values | release_type
stringclasses 2
values | taxid
float64 1.15k
681k
⌀ | species_taxid
float64 7
911k
⌀ | organism_name
stringclasses 120
values | infraspecific_name
stringclasses 112
values | isolate
stringclasses 1
value | superkingdom
stringclasses 2
values | phylum
stringclasses 18
values | class
stringclasses 30
values | order
stringclasses 56
values | family
stringclasses 75
values | genus
stringclasses 89
values | species
stringclasses 117
values | classified
bool 1
class | lv1_group
stringclasses 2
values | lv2_group
stringclasses 13
values | score_faa
float64 0.93
1
⌀ | score_fna
float64 0.88
1
⌀ | score_rrna
float64 0.1
1
⌀ | score_trna
float64 0.6
1
⌀ | total_length
float64 618k
9.12M
⌀ | contigs
float64 1
22
⌀ | gc
float64 22.5
72.2
⌀ | n50
float64 616k
9.03M
⌀ | l50
float64 1
1
⌀ | proteins
float64 525
7.92k
⌀ | protein_length
float64 172k
2.68M
⌀ | coding_density
float64 74
96.9
⌀ | completeness
float64 76.3
100
⌀ | contamination
float64 0
4.4
⌀ | strain_heterogeneity
float64 0
100
⌀ | markers
float64 124
383
⌀ | 5s_rrna
stringclasses 2
values | 16s_rrna
stringclasses 1
value | 23s_rrna
stringclasses 1
value | trnas
float64 14
20
⌀ | draft_quality
stringclasses 2
values | start_position
int64 0
10M
| human_label
int64 0
1
| autotrain_text
stringlengths 150
150
| autotrain_label
class label 121
classes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
G000009185 | ASM918v1 | GCF_000009185.1 | PRJNA224116 | SAMEA3138195 | null | 2006/06/22 | Max Planck Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/185/GCF_000009185.1_ASM918v1 | 637,000,129 | RS_GCF_000009185.1 | Monoisolate | Complete Genome | Full | na | Major | 362,976 | 293,091 | Haloquadratum walsbyi DSM 16790 | strain=DSM 16790 = HBSQ001 | null | Archaea | Euryarchaeota | Halobacteria | Haloferacales | Haloferacaceae | Haloquadratum | Haloquadratum walsbyi | true | Archaea | Euryarchaeota | 1 | 0.997 | 0.9 | 1 | 3,179,361 | 2 | 47.86 | 3,132,494 | 1 | 3,071 | 845,315 | 78.317152 | 99.3 | 0 | 0 | 220 | no | yes | yes | 19 | medium | 2,379,520 | 0 | GATTTTGATCCTTCGGATGCAGACTCGGAAACAGAAACCGATGAAGAGGACACGAACTCCCCCGAGGATGAACGCATAATTAATGCTGCGAGGGAGTCGCCAGCATCGGAGCCGGGGCAGAAAACTGACGCAGATACCGGGATGAATACT | 45Haloquadratum walsbyi DSM 16790 DSM 16790 = HBSQ001
|
G000010825 | ASM1082v1 | GCF_000010825.1 | PRJNA224116 | SAMD00060943 | null | 2009/08/26 | Acetobacter pasteurianus genome sequencing consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/825/GCF_000010825.1_ASM1082v1 | 644,736,321 | RS_GCF_000010825.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 634,452 | 438 | Acetobacter pasteurianus IFO 3283-01 | strain=IFO 3283 substr. IFO 3283-01 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhodospirillales | Acetobacteraceae | Acetobacter | Acetobacter pasteurianus | true | Eubacteria | Proteobacteria | 1 | 0.982 | 0.9 | 1 | 3,340,249 | 7 | 53.1 | 2,907,495 | 1 | 3,156 | 1,006,859 | 88.810714 | 100 | 0 | 0 | 352 | yes | yes | yes | 20 | high | 2,302,690 | 0 | AGGGCGGTTACCAGATCAGCCGCAATATCTGCCGGTTTACGGCGTGCCACCTTGGCCAGCAGCAGAGCGGCATTAGTTGCCATATCTCCGTGCGCAGGGTCTCGCGTTGGGGTCAGTTCCACGCGGGCCAGCGTTTCTTCCGGCACATTG | 0Acetobacter pasteurianus IFO 3283-01 IFO 3283 substr. IFO 3283-01
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 997,500 | 1 | CGTGGGACGCCCAGATGGCTCGGCAGGCAGGCCGGGCTGGGGAGCTGACAGCAGACGCCTGGGACTCTGCCCAGCGTCCTCACCCACAACCTTTTAACTGTAACTGGCAGAGGAGACAGCAGGGAGGGCAGAAGGTACAGTGATGGCTAG | 120homo sapiens
|
G000010525 | ASM1052v1 | GCF_000010525.1 | PRJNA224116 | SAMD00060925 | null | 2007/10/16 | University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/525/GCF_000010525.1_ASM1052v1 | 641,228,476 | RS_GCF_000010525.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 438,753 | 7 | Azorhizobium caulinodans ORS 571 | strain=ORS 571 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Xanthobacteraceae | Azorhizobium | Azorhizobium caulinodans | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 5,369,772 | 1 | 67.32 | 5,369,772 | 1 | 4,810 | 1,620,542 | 88.922714 | 100 | 0 | 0 | 358 | yes | yes | yes | 20 | high | 2,042,170 | 0 | CCATGTCCTGGCGGCATCTGGGCGAGACCTTCGATATCCATGGCGGCGGCATCGACCTCGTGTTCCCGCACCATGAAAACGAGATCGCCCAGTCGCGCTGCGCCTTCGACAGCGGGTCCATGGCGCAGGTGTGGATGCACAACGGCTTCC | 4Azorhizobium caulinodans ORS 571
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,803,300 | 1 | AGCCTCGGGAGGTCAGCATTATTCCCCAAAGGAATGGGGCAGGACCCTGTTAGGATGAGGGTCTTATGAGCCCCATTCAGAAAGGTGAGATGTGCGGGCAGATTAGAGGGAAAACGAGGGCAGGAGATGGTCTGAGAGATTCTGTTTCCC | 120homo sapiens
|
G000009985 | ASM998v1 | GCF_000009985.1 | PRJNA224116 | SAMD00061077 | null | 2005/12/01 | Tokyo University of Agriculture and Technology, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/985/GCF_000009985.1_ASM998v1 | 637,000,155 | RS_GCF_000009985.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 342,108 | 84,159 | Magnetospirillum magneticum AMB-1 | strain=AMB-1 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhodospirillales | Rhodospirillaceae | Magnetospirillum | Magnetospirillum magneticum | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,967,148 | 1 | 65.09 | 4,967,148 | 1 | 4,628 | 1,522,305 | 90.298759 | 99 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 1,861,210 | 0 | GGGCCAGCTTCGTCTATGGCGTGGCCGGTGAACCATCCAGTACCCAGTATGGTCGCATGGTGGCTGCCGACGGCTGGAAGCGGTTGGACAATCCCATGCCGTCGTCTTCGCAGTCATCCTCCACAGTCCGGTCGGAGCCGGTCAAGGCGG | 56Magnetospirillum magneticum AMB-1
|
G000009985 | ASM998v1 | GCF_000009985.1 | PRJNA224116 | SAMD00061077 | null | 2005/12/01 | Tokyo University of Agriculture and Technology, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/985/GCF_000009985.1_ASM998v1 | 637,000,155 | RS_GCF_000009985.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 342,108 | 84,159 | Magnetospirillum magneticum AMB-1 | strain=AMB-1 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhodospirillales | Rhodospirillaceae | Magnetospirillum | Magnetospirillum magneticum | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,967,148 | 1 | 65.09 | 4,967,148 | 1 | 4,628 | 1,522,305 | 90.298759 | 99 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 4,947,150 | 0 | GGCCAAGGACTGGCGCACCGACCGCTATCTCCGCCGCCTGGAAGCCATGATGGCGGTGGCCGACAAGGACGTCTCGCTGGTCCTCACCGGCCAGGGCGATGTGCTGGAGCCCGAGGACGGCATCATCGGCATCGGCTCGGGTGGCAATTA | 56Magnetospirillum magneticum AMB-1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,282,850 | 1 | GGTAAATGAAGCTCAGATCAGGGTCCGGGGGCTGCATCCCTGCACCTGTCTGTGGCAGACATGGCTGGCCGAGGCCAGCACTTACTCCCTCTGTGCATGTCCTCTAAACCCCTCTCAACACCGGGGGCCAGGCAGCCTCACCAATGCAGC | 120homo sapiens
|
G000010185 | ASM1018v1 | GCF_000010185.1 | PRJNA224116 | SAMD00060918 | null | 2008/02/14 | Kitasato Institute for Life Sciences | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/185/GCF_000010185.1_ASM1018v1 | 641,522,627 | RS_GCF_000010185.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 334,413 | 1,260 | Finegoldia magna ATCC 29328 | strain=ATCC 29328 | null | Bacteria | Firmicutes | Tissierellia | Tissierellales | Peptoniphilaceae | Finegoldia | Finegoldia magna | true | Eubacteria | Firmicutes | 1 | 0.995 | 1 | 1 | 1,986,740 | 2 | 32.07 | 1,797,577 | 1 | 1,846 | 611,719 | 90.720879 | 99.39 | 0 | 0 | 282 | yes | yes | yes | 20 | high | 1,292,720 | 0 | TATCATCCAAATCATTCAACCCATGGCTCGATATAATAATTCCTACATTTTGCTTGGCAATCTCTTTCAATAAATTCTTCGTTTTTATAACACTTGTTGGATCCAAACCATTTAGAGGTTCATCCAATAAAACATAATCATTTCCCGGCA | 39Finegoldia magna ATCC 29328
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,690,450 | 1 | CTTTTAGTGCCTTTCCTCTGCTCTCAAACAAGATCCAAACTCCTGAATTTGTTCACAAGGCAGCACTCATGCTGGCTCTAGCCTCTTTCCCCACATTCCTTTCATCTCTCTGTGCCCTTTTCCTATGGGCTTTCAGGTCTCTGTTCTCTC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,335,600 | 1 | CAGAAAGAGAAAGAGAGATTGAGAGAAAGATTATCTTCTGTAATTCATTAATAATAATGTTACCGAAGGTAGTTGGTCAGACATACGCAGGGCAGGAGAGAGCGCCCCTGGCCCCTACAACCCCAACCAGAAATATCAGGCAACAATCAC | 120homo sapiens
|
G000008885 | ASM888v1 | GCF_000008885.1 | PRJNA224116 | SAMD00061100 | null | 2004/05/11 | Yale Univ. | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/885/GCF_000008885.1_ASM888v1 | 637,000,338 | RS_GCF_000008885.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 36,870 | 51,229 | Wigglesworthia glossinidia endosymbiont of Glossina brevipalpis | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Erwiniaceae | Wigglesworthia | Wigglesworthia glossinidia | true | Eubacteria | Proteobacteria | 0.99 | 0.986 | 1 | 1 | 703,004 | 2 | 22.48 | 697,724 | 1 | 646 | 209,912 | 87.974606 | 100 | 0 | 0 | 207 | yes | yes | yes | 20 | high | 419,770 | 0 | ATAATTTATCGTTGTAATTGAATAACTTAATCCAGCGCATCCTGATTTATTTATGTTTAACCTAATACCTAAAATAGATGAGTTTTGTTTTATTAATTTTTTAATATGTTTTATGGCAGATTTGGTTGCAAAAAATCCCATCCAATTTTT | 109Wigglesworthia glossinidia endosymbiont of Glossina brevipalpis
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,859,250 | 1 | TCAATGCAGGGATCCCCGTGCCTGACCCTGGCATCCACAGACCCGGGGGCCAGCTTTGAGGAGGCGCTGCTGGCTCTGGTGGAGGTGGTGACATGGGGCTCTGGAGACTTGGGGGCCGCTCATCCTTCTTCCTGTGGGCTCCACCATATT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,879,350 | 1 | GAGAGACACCGCAGCCAGGCCTGGCTGGAGTGTTCGAGGGCAGCGGGCACGCGGCTCCCTGCCTGCAGGGACCTCATGATCTTAATGTGAAGGGCAGACTCAAAATCAGGGCAAGGTCATGTCCGGGACACTGCGGGGGACAAGGCAACC | 120homo sapiens
|
G000010165 | ASM1016v1 | GCF_000010165.1 | PRJNA224116 | SAMD00060942 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/165/GCF_000010165.1_ASM1016v1 | 643,692,011 | RS_GCF_000010165.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 358,681 | 1,393 | Brevibacillus brevis NBRC 100599 | strain=NBRC 100599 (= 47) | null | Bacteria | Firmicutes | Bacilli | Bacillales | Paenibacillaceae | Brevibacillus | Brevibacillus brevis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 6,296,436 | 1 | 47.27 | 6,296,436 | 1 | 5,917 | 1,875,522 | 87.757979 | 99.73 | 0.27 | 0 | 381 | yes | yes | yes | 20 | high | 4,751,370 | 0 | ACTTTTCCGTACTTCTTAGCGACTTCACCGATTTCTTTGATGGGATTGAGCATGCCTGTTGTCGTTTCTGAATGCACGACAGCCACATGCGTGATCGTTGCATCCGCCGCTAGTTTCTGCTCCAATGCCTCTGCATCGGCTTTTGTCACT | 15Brevibacillus brevis NBRC 100599
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,474,900 | 1 | GTCCAGTTGAGTGGGTAAATGTTACAGGTGGTTCTAGAAACCAGGTAAGAATGTCTTAGGAGGCTGGGCACCGTGGCTCACGCCTGTAATCCCTGCACTTTGGGAGGCGTGGGGGGGGGGGGGTGGATCACATGAGGTCAGCAGTTTGAG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,965,100 | 1 | ATGGAGAGAGAACAGCAAGAGGTCAGAGGCTAAGTGTCAAAGGGCCCACGATGTTTCAAACAGTAATGATCAGAAGGGAATCCACTCAGCCCCTTTCCGCTTACCTTCCAAAAAGCTGTGAGTGGTGGAGTTTGGTTTCAAATCCAGCCC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,321,650 | 1 | TTCCAACAGTCCCCCAAAGTCTTAGCTCATTCCAGCATTAGACCAAAAGTCCAAGTCCAAAGTCTCATATGTGACAAAGCAAGTCCCTTTCACCTATGAGCCTGTAAAATCCAAAGCAAGTTAGTTATCTCCTAGGTACAATAGACGTAC | 120homo sapiens
|
G000007085 | ASM708v1 | GCF_000007085.1 | PRJNA224116 | SAMN02603009 | null | 2002/05/14 | Beijing Center.HGP | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/085/GCF_000007085.1_ASM708v1 | 637,000,318 | RS_GCF_000007085.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 273,068 | 911,092 | Caldanaerobacter subterraneus subsp. tengcongensis MB4 | strain=MB4 | null | Bacteria | Firmicutes | Clostridia | Thermoanaerobacterales | Thermoanaerobacteraceae | Caldanaerobacter | Caldanaerobacter subterraneus | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 2,689,445 | 1 | 37.57 | 2,689,445 | 1 | 2,674 | 812,453 | 88.995016 | 99.04 | 0.6 | 0 | 329 | yes | yes | yes | 20 | high | 573,950 | 0 | AGTAGATGAAAAAGGGAATCTAATAAGTTATGGCAGTATACCAATGCCAGAGCTTGCAAGTGGCAGTAAAGACAAAAGAGAATACTTCAGATGGCAATATGCTCATGAGATAGTAAAAATAGCAAAAGAGAAAGGAAAAGCAATAGTAAT | 18Caldanaerobacter subterraneus subsp. tengcongensis MB4
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,565,350 | 1 | GCCTAGCCTTTTCATATGGAGTCTCAGACAGTGAAATTCAGTCAATATATTTATAATGAATACTTTTTTTTTTGAGATGGAGTCTTGCTCTTGTCACCCAGGCTGGAGTGCAATGGCGTGATCTTGGCTCACTGCAACCTCCGCCTCCCA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,393,100 | 1 | TCCGCACCTGGCACAGCGGCCTCGGGGGCTCAGAACTGGAGCCAGCCAGGGCCTCTGCCCCTGCCTCTGCCACTTTGGGTGGGGATGCCTCACCCCACTGCACAGCTTAAAGCAAGAAGTGAGGAGGGAAAGGCTGGGCAGTCAGAGGGC | 120homo sapiens
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 887,380 | 0 | CAAACTGTCCGTGAGAACCGCCGTCACCGCCCTCGCCGCCCTCGGCCTGCTCGCCACCGCACCCTCGGCGACGGCGGCTCTCCGCGACCCCGCCGCGAAGCCCGCCGCGGCCTCCGCCCAGTCGCCCTCCCCCGACGTCACCGTGAAGAT | 96Streptomyces griseus subsp. griseus NBRC 13350
|
G000007465 | ASM746v2 | GCF_000007465.2 | PRJNA57947 | SAMN02604090 | null | 2011/09/01 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/465/GCF_000007465.2_ASM746v2 | 637,000,288 | RS_GCF_000007465.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 210,007 | 1,309 | Streptococcus mutans UA159 | strain=UA159 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus mutans | true | Eubacteria | Firmicutes | 1 | 1 | 0.9 | 1 | 2,032,925 | 1 | 36.83 | 2,032,925 | 1 | 1,897 | 591,301 | 85.692487 | 100 | 0 | 0 | 308 | yes | yes | yes | 20 | high | 296,140 | 0 | TTTGGATGATGATATTCAAATCAGACAAGAAAATAATCTTTTGCTGTTAGACGTCTATGATTATGCTAGATTGGAAACAATTTTAGCGGGAAGTTTGCGCAAAGAGAGTGATTTTAATTCTTCAAATAAGCGAGCTTCTTATCTCATTAA | 92Streptococcus mutans UA159
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,625,300 | 1 | CGAGCTGGTGGGCTTGGGTTTTGTGGAGCGCATGCTTGGACCCTTTCAGTAAGGAAGGGTCTTTGGGGTTTTCTGTGCCCATGACTTGGGGGCTGCACCCCCACAGCACCCCCACAATGTAGGAAAAGACCTCAGGGAACCTCTCCCTGG | 120homo sapiens
|
G000007845 | ASM784v1 | GCF_000007845.1 | PRJNA57909 | SAMN02603432 | null | 2003/04/30 | J. Craig Venter Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/845/GCF_000007845.1_ASM784v1 | 637,000,014 | RS_GCF_000007845.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 198,094 | 1,392 | Bacillus anthracis str. Ames | strain=Ames | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,227,293 | 1 | 35.38 | 5,227,293 | 1 | 5,474 | 1,495,110 | 84.244541 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 3,337,880 | 0 | TCGTATCTATTACTGCAGTCGCTTCTTTTATCATTCCTAACCTGGAAATGTCAGCAGGAATTCGCCTTCTTCGCTTTCCGATGATGATAATTGCCTCTTTATTTGGTGTCATAGGAATTATGGTTGGGATGGCAATCATTATTATTCATA | 5Bacillus anthracis str. Ames
|
G000009965 | ASM996v1 | GCF_000009965.1 | PRJNA224116 | SAMD00061071 | null | 2005/01/05 | Kyoto University, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/965/GCF_000009965.1_ASM996v1 | 638,154,520 | RS_GCF_000009965.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 69,014 | 311,400 | Thermococcus kodakarensis KOD1 | strain=KOD1 | null | Archaea | Euryarchaeota | Thermococci | Thermococcales | Thermococcaceae | Thermococcus | Thermococcus kodakarensis | true | Archaea | Euryarchaeota | 1 | 1 | 0.9 | 0.9 | 2,088,737 | 1 | 52 | 2,088,737 | 1 | 2,314 | 650,473 | 91.73242 | 100 | 0 | 0 | 190 | no | yes | yes | 19 | medium | 822,640 | 0 | GAAAAATTCGAGCGCTGATGGATTTAAAGGTTCACCAGTGGACCGATTTTATAAAATGGGGGCCGCTCTTTTTTCTTTTTAAGTAGGGGGTCTTTATGATTTAGCCACTCCAAGGTCCCAGGTGTGATCGGGGATACCCTAAGTCTAACA | 102Thermococcus kodakarensis KOD1
|
G000008665 | ASM866v1 | GCF_000008665.1 | PRJNA224116 | SAMN02603985 | null | 1999/12/22 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/665/GCF_000008665.1_ASM866v1 | 638,154,502 | RS_GCF_000008665.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 224,325 | 2,234 | Archaeoglobus fulgidus DSM 4304 | strain=DSM 4304 | null | Archaea | Euryarchaeota | Archaeoglobi | Archaeoglobales | Archaeoglobaceae | Archaeoglobus | Archaeoglobus fulgidus | true | Archaea | Euryarchaeota | 1 | 1 | 0.9 | 0.9 | 2,178,400 | 1 | 48.58 | 2,178,400 | 1 | 2,518 | 688,447 | 93.086761 | 100 | 0 | 0 | 186 | no | yes | yes | 17 | medium | 612,170 | 0 | TGAATCCTATTGAGCAAATCTGGAGAGTTATAAAGAGAGTGTTGTCTCCTCTCTTCATTAAAACGTTGGAAGAGCTTAAGGAAGTGATTTCGAATAGCTTTTACCAGTTAACTCAGAGAATGAGCTTCGAAGAAAAGTGGATAAAAAAGT | 3Archaeoglobus fulgidus DSM 4304
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,437,350 | 1 | AGAAATGACACAGAAGAAGGGTTTGGATTGTAGCAGAGGGGGCAAGTCGGCGGATGGGAAGGGACGCTGCCAGCAGGCCCAAGGAGGACTTCAACTCGGAGGAGACATCAGGAACCGAGACCTGCCACAGGCACAGGGGTGCCCGAGACC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,822,850 | 1 | TTTGTATTTTTAGTAGAGACAGGGTTTTGCCATGTTGTCCAGGCTGGTCCCAAACTCCTGACCTCAGGTTATCTGCCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACTGCACCCAGCCAAGGACACAGAATGATTCC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,271,200 | 1 | CTGCCTTAGCTTGTTAGAGTTGGCAGCAGAAGAGGCCCCTCCTGGCAGCGCTCGGCTGGGCCCTGCAGCTGGCTGGGGGAGGCCTCTCTGTGGCCACACGCCTGAGGTCTGGGCTGGTTCCCCTTGCTGCTGCCTCTCTCCTGGGTGGAC | 120homo sapiens
|
G000011065 | ASM1106v1 | GCF_000011065.1 | PRJNA62913 | SAMN02604314 | null | 2003/03/28 | Washington University Department of Molecular Biology and Pharmacology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/011/065/GCF_000011065.1_ASM1106v1 | 637,000,026 | RS_GCF_000011065.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,186 | 818 | Bacteroides thetaiotaomicron VPI-5482 | strain=VPI-5482 | null | Bacteria | Bacteroidetes | Bacteroidia | Bacteroidales | Bacteroidaceae | Bacteroides | Bacteroides thetaiotaomicron | true | Eubacteria | Bacteroidetes | 1 | 0.998 | 0.7 | 1 | 6,293,399 | 2 | 42.86 | 6,260,361 | 1 | 4,944 | 1,919,297 | 89.876027 | 99.41 | 0.4 | 0 | 348 | yes | yes | yes | 20 | high | 5,088,590 | 0 | TTAGTCCATGCAGTCGAAGCGGATTACTATGTGAATAATCTCATACCGGGAACGCAAAAACCGGACGTTAATCCCTGTCTGGATTTTGGTGTTGCTTATCGCTTTGAAAATTCCCATTGGGCTTTTTATCCTCGTTTGGGGATTGGTGTG | 11Bacteroides thetaiotaomicron VPI-5482
|
G000010565 | ASM1056v1 | GCA_000010565.1 | PRJDA19023 | SAMD00060921 | null | 2007/05/07 | Marine Biotechnology Institute Co., Ltd | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/010/565/GCA_000010565.1_ASM1056v1 | 640,427,128 | GB_GCA_000010565.1 | Monoisolate | Complete Genome | Full | na | Major | 370,438 | 110,500 | Pelotomaculum thermopropionicum SI | strain=SI | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Peptococcaceae | Pelotomaculum | Pelotomaculum thermopropionicum | true | Eubacteria | Firmicutes | 0.98 | 1 | 1 | 1 | 3,025,375 | 1 | 52.96 | 3,025,375 | 1 | 3,001 | 887,464 | 86.415667 | 100 | 0.63 | 0 | 331 | yes | yes | yes | 20 | high | 1,694,810 | 0 | TCCAGGCAATCTATTATACTGCGATAGGAGCATTCGAGCAGGCTGCAGCTGCAGCCGACCCAGAATGGCTGCTTTTTATGCCTTCGATTTATTGCTACGGCATTTACGGATCATATGTACATACGGTTGAGTACAACAAGCTCTTTAAAC | 73Pelotomaculum thermopropionicum SI
|
G000010325 | ASM1032v1 | GCF_000010325.1 | PRJNA224116 | SAMD00060914 | null | 2007/07/11 | Japan Agency for Marine-Earth Science and Technology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/325/GCF_000010325.1_ASM1032v1 | 640,753,037 | RS_GCF_000010325.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 387,092 | 387,092 | Nitratiruptor sp. SB155-2 | strain=SB155-2 | null | Bacteria | Proteobacteria | Epsilonproteobacteria | null | null | Nitratiruptor | Nitratiruptor sp. SB155-2 | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 1,877,931 | 1 | 39.69 | 1,877,931 | 1 | 1,933 | 610,396 | 95.761026 | 98.78 | 0 | 0 | 319 | yes | yes | yes | 20 | high | 265,330 | 0 | TTATAAAAGGAAATAAATGAAAAAGAGCCCAAAAGCGCTCGTTATTGATGATTCGGCATTGGTCCGAAGATTTTTGAAAAAAGAGTTGGAACGGCTCGGATTCGAGGTAGATGTCGCAAAAGATGGTGAAGAGGGTGAGAAAAAAGCTTT | 68Nitratiruptor sp. SB155-2 ASM1032v1
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 316,030 | 0 | GCCGCAAGGCCGCTCCCACAAAGGCCGCGTTAGTCGTACTAGCGGTGCAGAACGTACTGGCCGCTGAACCTCACCGCCGGCTCGTCACTGCCGTCATTGCTCACCGTGGTCTCCAACGTCAACCGTGCCCGCCCACGCCGCTGGTACAGG | 78Pseudomonas putida KT2440
|
G000009725 | ASM972v1 | GCF_000009725.1 | PRJNA224116 | SAMD00061113 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/725/GCF_000009725.1_ASM972v1 | 2,514,885,032 | RS_GCF_000009725.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 1,148 | 1,148 | Synechocystis sp. PCC 6803 | strain=PCC 6803 | null | Bacteria | Cyanobacteria | null | Synechococcales | Merismopediaceae | Synechocystis | Synechocystis sp. PCC 6803 | true | Eubacteria | Cyanobacteria | 1 | 0.99 | 0.9 | 1 | 3,947,019 | 5 | 47.37 | 3,573,470 | 1 | 3,713 | 1,164,101 | 86.890968 | 99.78 | 0 | 0 | 349 | yes | yes | yes | 20 | high | 235,040 | 0 | GGGGGATAGGGGCAAAGCAGACCAGCACTAATTTTCCCAATCGCTTCATTAACGGTTACCGATTTTTGGGCAGCATGGGCCGCTCGGCGGGGAGTCATAGCCAGAATAGTACCGGGTAAGACGGGTAAAGTTAGGTGAAAAGGTTGTTGA | 101Synechocystis sp. PCC 6803 ASM972v1
|
G000010625 | ASM1062v1 | GCF_000010625.1 | PRJNA224116 | SAMD00060936 | null | 2008/01/24 | Kazusa DNA Research Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/625/GCF_000010625.1_ASM1062v1 | 641,522,640 | RS_GCF_000010625.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 449,447 | 1,126 | Microcystis aeruginosa NIES-843 | strain=NIES-843 | null | Bacteria | Cyanobacteria | null | Chroococcales | Microcystaceae | Microcystis | Microcystis aeruginosa | true | Eubacteria | Cyanobacteria | 1 | 1 | 0.9 | 1 | 5,842,795 | 1 | 42.33 | 5,842,795 | 1 | 5,605 | 1,591,543 | 80.239081 | 99.89 | 0.51 | 25 | 350 | yes | yes | yes | 20 | high | 3,967,340 | 0 | TATTTTTGGGCGCCTTGGTGTGGTTTATGTCGTTTAATCCAACCCACCCTCTTGTCTTGGCAAAATGACTGTCAAGGTGCGATTCAATTAGTAGCTGTCAATGCCGATGATAATTTTAAATTAGCTAATAGTTTTCGTCTGCGTAGTCTG | 64Microcystis aeruginosa NIES-843
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,395,300 | 1 | GCTGATGTCTCCTGAGGCGTGTCTCTTGAGGCATCTCTCCCTGGCTGGCAGATGGTCATCATGGGGGCTCAGGAACGGATACTCCACAACATGGCGCTTTGTCCTGCCGGACTAAAAAAGCAGCCTCCAGGCCTCTCCGACCTTCCCCCT | 120homo sapiens
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 5,765,760 | 0 | GCGGCGCCATCTGTTCTTTGTCGACAGCCGCACCAGTGCCGCCACGGTTGCCGCGGCCGAGGCTCAAGCACACGATGTCGCGCATGTATCACGGGATGTATTTCTGGATGACGTGCGCACGCCGGAAGCCATCGACGCTCAGCTGCAACA | 78Pseudomonas putida KT2440
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,040,800 | 1 | CAGCCTGGGGGGAGAAGCACCACCGTCCTTAGAGGCTGTGGCTGTGGGCAGGGCCAGGCTGGGTCCTCCCCATCACAGGGGTCTCAGTGAGCCCACCACACCCCGGGCCCTGTTTGTCGCATGGTCCCTTCCGAAGCAGCCCTGTTTGTG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 309,600 | 1 | TCTGAATTTTAGAATAGGTTTTTCTATTTTTGAATATATTGGAATTTTTATAGTGATTTTATTGAATCTGTAGATCGCTATAGATAACAATGGCATCTTGACAAGGTTTTGTCTTCCAGTCCATAAACACATGATGTCTTTTCATTTATT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,703,000 | 1 | TCTAAAAAATAAAAAAAAATTAAAAAAAGAATATATGGTGCAAAGGCAAATAAAAGCAATGTTTCCAGTGGGCTAGATGGAGAAGTCCCTTTGCTGCCTCTCTGGGTCACATGGGAGAAGCACAGTTCCCTGTAGCCCCCATCCGGGGTC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,967,700 | 1 | GGCCAGCCACCAGCCAAGCGGCGGAGCCGGGGCGCCCAGATGCCGATGTGGCCGAAGACATAAAATTCCGCCGACCCTCCCACCTCGCGGCGGGTAACGCTGGACCCCGGCCCCCAGCCACCCAGGACGGCCGCGCGAACTACCAGGCCC | 120homo sapiens
|
G000010345 | ASM1034v1 | GCF_000010345.1 | PRJNA224116 | SAMD00060915 | null | 2007/07/11 | Japan Agency for Marine-Earth Science and Technology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/345/GCF_000010345.1_ASM1034v1 | 640,753,056 | RS_GCF_000010345.1 | Monoisolate | Complete Genome | Full | na | Major | 387,093 | 387,093 | Sulfurovum sp. NBC37-1 | strain=NBC37-1 | null | Bacteria | Proteobacteria | Epsilonproteobacteria | null | null | Sulfurovum | Sulfurovum sp. NBC37-1 | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 2,562,277 | 1 | 43.87 | 2,562,277 | 1 | 2,552 | 795,482 | 91.463999 | 99.59 | 0.61 | 0 | 334 | yes | yes | yes | 20 | high | 1,594,190 | 0 | CAATCGCAATATCATTGAACTATTTGCCAAAGATTATCCATCGGACTTCCCTGAGCCAGAAGCTGTAATAATACTTGGAAAACAAGGATACAGAATCTTGGAAGTCCCTGTTATGATGAATGAACGCACAGCTGGTAATTCATCAATAAG | 98Sulfurovum sp. NBC37-1 ASM1034v1
|
G000008525 | ASM852v1 | GCF_000008525.1 | PRJNA57787 | SAMN02603995 | null | 1999/12/22 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/525/GCF_000008525.1_ASM852v1 | 637,000,132 | RS_GCF_000008525.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 85,962 | 210 | Helicobacter pylori 26695 | strain=26695 | null | Bacteria | Proteobacteria | Epsilonproteobacteria | Campylobacterales | Helicobacteraceae | Helicobacter | Helicobacter pylori | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 1,667,867 | 1 | 38.87 | 1,667,867 | 1 | 1,579 | 514,109 | 90.817493 | 99.36 | 0 | 0 | 275 | yes | yes | yes | 20 | high | 1,018,160 | 0 | GCGTTTTGTCAAAATTCGTGTGCATGCTGATGACTGAAACGTTTTTTTGGATTAAGATTTTTAAGATATTACCCGGATAAATCTCATCATTAAGCGTTTTTAAAGGCTTGAAAATTAAAGGGTGGTGCGTGATGATTAGGGCGTTTTGTG | 48Helicobacter pylori 26695 ASM852v1
|
G000008765 | ASM876v1 | GCF_000008765.1 | PRJNA57677 | SAMN02603243 | null | 2002/11/22 | Genome Therapeutics | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/765/GCF_000008765.1_ASM876v1 | 637,000,076 | RS_GCF_000008765.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,562 | 1,488 | Clostridium acetobutylicum ATCC 824 | strain=ATCC 824 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Clostridiaceae | Clostridium | Clostridium acetobutylicum | true | Eubacteria | Firmicutes | 1 | 0.998 | 0.1 | 0.9 | 4,132,880 | 2 | 30.93 | 3,940,880 | 1 | 3,896 | 1,211,240 | 86.343567 | 100 | 0 | 0 | 345 | yes | yes | yes | 19 | high | 3,249,480 | 0 | GACCCAAGGCAAGTACCTTTATCTCAGAGATATTTCCACGAATAACAGTGAATTTAACCTCCTCAAGCAATTTTAAAGCAGTTTGACGTCTAAGTTTTGAAGCACCCACTCCCACAGGATCTAAAATAACTGGATGCTTTAACTTATTCG | 29Clostridium acetobutylicum ATCC 824
|
G000007005 | ASM700v1 | GCF_000007005.1 | PRJNA224116 | SAMN02603227 | null | 2002/11/25 | European/Canadian Consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/005/GCF_000007005.1_ASM700v1 | 638,154,518 | RS_GCF_000007005.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 273,057 | 2,287 | Sulfolobus solfataricus P2 | strain=P2 | null | Archaea | Crenarchaeota | Thermoprotei | Sulfolobales | Sulfolobaceae | Sulfolobus | Sulfolobus solfataricus | true | Archaea | Crenarchaeota | 0.96 | 1 | 1 | 0.9 | 2,992,245 | 1 | 35.79 | 2,992,245 | 1 | 3,281 | 874,971 | 86.125133 | 100 | 0 | 0 | 196 | no | yes | yes | 14 | medium | 2,855,840 | 0 | AGGAGAGGAAATGTTAGGGTTTTGAAAGAAGAGGAAAGTGTAGATTTCGTTCCAGAGGTGTTGGATGAAAGGGATACTATTGTGTTAGAGGCAATAAAAATGGGTACAAATACATTAGCTGATATTGTGAGACAGACTGGTTTACCTAAA | 97Sulfolobus solfataricus P2
|
G000006785 | ASM678v2 | GCF_000006785.2 | PRJNA57845 | SAMN02604089 | null | 2014/04/01 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/785/GCF_000006785.2_ASM678v2 | 637,000,291 | RS_GCF_000006785.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 160,490 | 1,314 | Streptococcus pyogenes M1 GAS | strain=SF370 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus pyogenes | true | Eubacteria | Firmicutes | 1 | 1 | 0.6 | 1 | 1,852,433 | 1 | 38.51 | 1,852,433 | 1 | 1,776 | 539,188 | 85.75128 | 100 | 0 | 0 | 277 | yes | yes | yes | 20 | high | 611,780 | 0 | GAAAATGGGGAGACTGAATTTGCTAATCCTAGAAATGCTGCCGCTGGGACACTAAGGCAGCTAGATACGTCAGTGGTTGCTAAGCGTCAACTAGCCACTTTTTTGTATCAAGAAGCTAGTCCGACAGCTAGAAATCAACAAAATGAGGTC | 93Streptococcus pyogenes M1 GAS SF370
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,223,500 | 1 | AAGCACAAAGGCTCTGCACGGGATTCCTGGGGAGAATGAGGCTGAGTCAACACTAATGGGTCTGGAGCAACCTTCCCAGCGCCTCGGAGGCTTGCAAGCAGGAGAATAATAGCGGAGGTGTCCCAACACGATCGTGGTATCAATTGCGTT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,815,050 | 1 | TATGTGTATGTGCATGTGTGTGCTGGTGTGGATTGTGCATATGTGTGCAGATATAAGTGTGTGTGCATGTGTGGGCATGCGTGTGTGTGAGACATGTGGGCATGTGTGGGCACGTGTGCATGCATGTGAGTGTGCGTGTGTGTCTGTGAG | 120homo sapiens
|
G000008865 | ASM886v1 | GCF_000008865.1 | PRJNA57781 | SAMN01911278 | null | 2004/05/11 | GIRC | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/865/GCF_000008865.1_ASM886v1 | 637,000,108 | RS_GCF_000008865.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 386,585 | 562 | Escherichia coli O157:H7 str. Sakai | strain=Sakai substr. RIMD 0509952 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Enterobacteriaceae | Escherichia | Escherichia coli | true | Eubacteria | Proteobacteria | 1 | 0.996 | 0.9 | 1 | 5,594,477 | 3 | 50.48 | 5,498,450 | 1 | 5,399 | 1,663,868 | 87.620737 | 99.97 | 0.33 | 0 | 374 | yes | yes | yes | 20 | high | 386,750 | 0 | CAGCCACAAAAACCAGGGGAATGTGAATGAGTATAAAAAATCTACCTGCCGACTATTTATTGGCTGCACAACAGGGTGATATCGATAAAGTAAAAACCTGCCTTGCGCTGGGTGTCGATATTAATACCTGCGATCGTCAGGGGAAAACGG | 38Escherichia coli O157:H7 str. Sakai Sakai substr. RIMD 0509952
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,965,700 | 1 | AGCAGATGAAGCCCTGGCTTCCGGGCTGGTTCCAGCATGGGATTGTTCAGGATTGTTCAGGGAGGGGGCCTGGGAGGGAAAAGGGGAAGAGTGACGCCCCAGTTCCAGGCAGCAGACTTAATGCTAGGCTTGGAGGGGTGCTTCTGTCCT | 120homo sapiens
|
G000009725 | ASM972v1 | GCF_000009725.1 | PRJNA224116 | SAMD00061113 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/725/GCF_000009725.1_ASM972v1 | 2,514,885,032 | RS_GCF_000009725.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 1,148 | 1,148 | Synechocystis sp. PCC 6803 | strain=PCC 6803 | null | Bacteria | Cyanobacteria | null | Synechococcales | Merismopediaceae | Synechocystis | Synechocystis sp. PCC 6803 | true | Eubacteria | Cyanobacteria | 1 | 0.99 | 0.9 | 1 | 3,947,019 | 5 | 47.37 | 3,573,470 | 1 | 3,713 | 1,164,101 | 86.890968 | 99.78 | 0 | 0 | 349 | yes | yes | yes | 20 | high | 1,508,390 | 0 | TTGCTGGGGGTGAGAAAACTGGAATAAGAAAATTGATTAGTAACTGCCTATACTTTATCGCCAAAACGGAAGCATCCGGGAAAGTAATCGCTCAGTTTTTTAACACTACCCGAGCCACTTCCACCCCAGGATAGTAACGATTGAGAATTT | 101Synechocystis sp. PCC 6803 ASM972v1
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 4,288,960 | 0 | ACCTTGGTCACCCCCGCGCTCGACAGACTGAGCTTAATCGATGCAGCCTGGATAGTGGCATGCGCACCCGCCTGCTGCGCAAGAGAAATACCGTATGCCAGCGCGGATGAGGTTTCGTCACGGCCGAATTCTTTCGTCAGGCCGATCAAT | 86Sinorhizobium meliloti 1021
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,789,500 | 1 | CATGTTTTATTAACACTAAAATGAAACGCATTTAGGGTCACAGAGATTTGGGGCCATACTAAACCAAAATTTTAAAAATAAAGTCCTTGGCTGGGCGTGGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGAGTGGATT | 120homo sapiens
|
G000007645 | ASM764v1 | GCF_000007645.1 | PRJNA57861 | SAMN02603126 | null | 2002/12/20 | Chinese National HGC, Shanghai | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/645/GCF_000007645.1_ASM764v1 | 637,000,281 | RS_GCF_000007645.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 176,280 | 1,282 | Staphylococcus epidermidis ATCC 12228 | strain=ATCC 12228 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Staphylococcus | Staphylococcus epidermidis | true | Eubacteria | Firmicutes | 1 | 0.977 | 0.9 | 1 | 2,564,615 | 7 | 32.05 | 2,499,279 | 1 | 2,354 | 721,937 | 82.93198 | 99.81 | 0 | 0 | 345 | yes | yes | yes | 20 | high | 686,920 | 0 | GGAAACATGGTCGATGTTGCATGAGAATAGAGATAAACGAATCATTATTAATAATCATTTAGAACTAAAGCATTTCCAAGAAGAATTAGATTATGTTTTGAATAACATAGAAGGAAACAATAACTATGGTAAGGAGTTTGTTTCAGCTGT | 88Staphylococcus epidermidis ATCC 12228 ASM764v1
|
G000007465 | ASM746v2 | GCF_000007465.2 | PRJNA57947 | SAMN02604090 | null | 2011/09/01 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/465/GCF_000007465.2_ASM746v2 | 637,000,288 | RS_GCF_000007465.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 210,007 | 1,309 | Streptococcus mutans UA159 | strain=UA159 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus mutans | true | Eubacteria | Firmicutes | 1 | 1 | 0.9 | 1 | 2,032,925 | 1 | 36.83 | 2,032,925 | 1 | 1,897 | 591,301 | 85.692487 | 100 | 0 | 0 | 308 | yes | yes | yes | 20 | high | 153,140 | 0 | CCGATCATATTCATATGCTTGTCAGTATCGCTTCCAAATTCAGTGTTTCGTCTTTCATGGGATATTTAAAGGGAAAGAGCAGCTTGATGATTTTTGATAAGCATGCGAACTTAAAATACAAATATGGCAATCGAAGTTTTGGTGTAGAGG | 92Streptococcus mutans UA159
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,238,550 | 1 | AACGGGTTCCTAAGTGCTGAAAGCCATGCAGATCTTGCAATCTTTAGGTGAAAGAGAAAGAGGAAATGAAAAGCCAGGGTGACAATGTGCCGTGCTTTTAAAAGTCACTGATGCCCACACTGGAGGGAGGTACAGTTCTCCACAAGCACC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,904,450 | 1 | GCTCCATCACGTCCAGGGCACCCTCCAAGGCCATTGGAGTGAGAATCAGACTGCATTCTCATTTGCAATCTAAATTTTTATTTTCATCCCAAATTCTAAATGAGAACTGGAAAAAATAAGTTGGTCAATAATATGAGTGGGTGGGGTTGG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,315,600 | 1 | AGCGTACAGTGCCTGCCCATACGCATCGCAACTTTGGCGGTCTGAATTTAGGGGTGGTATTCGTTGCTTGATTCTGCATAGAGTGAAAAGTTCTTGATTTCTTTACTGCAGTGTAGGGGAAAGAGATTTCGTGTGTTTGGACAAACGACA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,070,900 | 1 | TGCCAGTCTTTTGGTTGTACAACAAGAAGGACTGGAAAATGAGAACATTTTTTCCTGGATTGGCTTCATTGATGCTTTGTCCCTAAAGTCAGGAAATACCTTGCCAGTAGGAGACTGCCTTATAAAGTTATTTTGATATTGAACAATGCC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,223,650 | 1 | TTTCACCGTGTTAGTCAGGATGGTCTCCATCTCCTGACCTCGTGATCCGCCCGTCTTGGCCTCCCAAAGTGCTGGGATTACAGGCTTGAGCCACGCGCCCAGCCTATGCTTATAATTTTAAAGTAGGATTCCCTGGTTTTGTCTAGAATT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 92,850 | 1 | GGAGACCATCAGGACAAACACGTGGATACATGGAGGGGAACAACACACACCAGGGCCTCTCAGGGGGACAGGGGGTAGGAGACCATCAGGACAAACACGTGGATACATGGAGGGGAACAACACACACCAGGGCCTCTCAGGGGGACAGGG | 120homo sapiens
|
G000009705 | ASM970v1 | GCF_000009705.1 | PRJNA224116 | SAMD00061094 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/705/GCF_000009705.1_ASM970v1 | 637,000,199 | RS_GCF_000009705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 103,690 | 103,690 | Nostoc sp. PCC 7120 | null | null | Bacteria | Cyanobacteria | null | Nostocales | Nostocaceae | Nostoc | Nostoc sp. PCC 7120 | true | Eubacteria | Cyanobacteria | 1 | 0.992 | 0.9 | 1 | 7,211,789 | 7 | 41.27 | 6,413,771 | 1 | 6,159 | 2,024,679 | 82.716938 | 99.19 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 3,528,980 | 0 | TTGCAAATTCATCTTAATCAGGTGCGTTCTGTTCCTGTAAAAACCCAACCCATTGAGCTAACTGAGTTAAAAGTTCGGGAACCGAAAAAGAAAGAATTGACTACAGTGGAAGCTTCTTTACGGTTAGATGCGATCGCCTCTGCTGGTTTT | 70Nostoc sp. PCC 7120 ASM970v1
|
G000007765 | ASM776v1 | GCF_000007765.1 | PRJNA57631 | SAMN02603970 | null | 2005/07/22 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/765/GCF_000007765.1_ASM776v1 | 637,000,086 | RS_GCF_000007765.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 227,377 | 777 | Coxiella burnetii RSA 493 | strain=RSA 493 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Legionellales | Coxiellaceae | Coxiella | Coxiella burnetii | true | Eubacteria | Proteobacteria | 1 | 0.995 | 0.9 | 1 | 2,032,674 | 2 | 42.6 | 1,995,281 | 1 | 2,058 | 613,036 | 88.849515 | 100 | 0 | 0 | 308 | yes | yes | yes | 20 | high | 672,880 | 0 | CGAACGAGCACCGCATTTACCGCTCAAATTGGCACCATGAAAGTAAATGAAGAAATTGACGCTTTAAATACCATGGGGGTTGTCCCCATTGAACATTTGGTATTGCCGAAAATAATTGCCTTAATCATTTCGCTAACGCTATTAACGGTG | 32Coxiella burnetii RSA 493 ASM776v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,949,750 | 1 | TCTTATCCCCAGTGTGCATGGCATTTCTTAGGAAGAGCAGAGAGCCCCTGAGCCTGGGAAGGGTGAGCTGGCCTTGCTTGTGGGGGTGAATGAGTCGCCAGCCCTGCAGGGCCACTTGAGTGCTGCCAACAGATTCCCAGGGGCCCAGGG | 120homo sapiens
|
G000008025 | ASM802v1 | GCF_000008025.1 | PRJNA224116 | SAMN02604000 | null | 2004/02/05 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/025/GCF_000008025.1_ASM802v1 | 637,000,339 | RS_GCF_000008025.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 163,164 | 163,164 | Wolbachia endosymbiont of Drosophila melanogaster | strain=wMel | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rickettsiales | Anaplasmataceae | Wolbachia | Wolbachia endosymbiont of Drosophila melanogaster | true | Eubacteria | Proteobacteria | 0.96 | 1 | 0.9 | 1 | 1,267,782 | 1 | 35.23 | 1,267,782 | 1 | 1,276 | 363,312 | 84.420744 | 99.79 | 0 | 0 | 229 | yes | yes | yes | 20 | high | 281,580 | 0 | AGCTCCTGCACGACACCTATTATGTTGTTGCTCACTTCCATTATGTCATGTCACTTGCTGCATTATTTGGAGCTTTTGCTGGCTTTTATTATTGGATTGGTAAAATGTCGGGTAAACAATATAATGAGCGCTTAGGTCAAATCCACTTTT | 110Wolbachia endosymbiont of Drosophila melanogaster wMel
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 250,950 | 1 | CCAGCAGATCCACCCTGTCTTCACTACCTACCTAGCGAGCAGATCCACCCTGTCTACTCTACCTGCTTGTCCAGCAGGTCCACCCTGTCTACACTACCTGCCTGTCCAGCAAATCCACTCTGTCTACACTACCTGGCTGTCCAGCAGATC | 120homo sapiens
|
G000007345 | ASM734v1 | GCF_000007345.1 | PRJNA224116 | SAMN03081414 | null | 2002/04/03 | Broad Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/345/GCF_000007345.1_ASM734v1 | 638,154,508 | RS_GCF_000007345.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 188,937 | 2,214 | Methanosarcina acetivorans C2A | strain=C2A | null | Archaea | Euryarchaeota | Methanomicrobia | Methanosarcinales | Methanosarcinaceae | Methanosarcina | Methanosarcina acetivorans | true | Archaea | Euryarchaeota | 0.98 | 1 | 0.8 | 0.9 | 5,751,492 | 1 | 42.68 | 5,751,492 | 1 | 4,884 | 1,470,904 | 75.340086 | 99.84 | 0.03 | 0 | 229 | no | yes | yes | 18 | medium | 4,091,880 | 0 | CAAGAAATGTTCGGGTCTGCTGGCAGCATGGATATGTTTTTGCCCCAGACAATGAAACCTTCCAGACCGGGTATAATGTCCCTAATGCTCAAGAAAATTTGAAAATAAACCAGAGAAAACGGGAAGGTCATAGGTAGAGTAAAAGTCCCA | 61Methanosarcina acetivorans C2A
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,216,000 | 1 | TAAGCAGGGATCACACACACCTGGCTAATTTTTTTATTTTTTTAATTTTTTGAAACAGAGTCTCCCTCTGTCGCCCCGGCTGGCGTGTAATGGTGCGATCTCAGCTCACTGCAACCTCTGCCTCTCTGGTTCAAGCAAACCTCTTGCCTC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,588,650 | 1 | AGTTAATGCCACGTATGAGAGCAGGTTTGCGGGACCCTGAGAAAAGACATTTGGAAGAGTCGCTGCTGCGGTTTTGTTCTGTCTTGAAATCATCCTCTGTGGGCCGGGATGCCGAGGTGGGGACTCTGGGGTTGTCTTTCGAGAAGAGCC | 120homo sapiens
|
G000008505 | ASM850v1 | GCF_000008505.1 | PRJNA58089 | SAMN02598265 | null | 2004/12/27 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/505/GCF_000008505.1_ASM850v1 | 637,000,023 | RS_GCF_000008505.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 281,309 | 1,428 | [Bacillus thuringiensis] serovar konkukian str. 97-27 | strain=97-27 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus thuringiensis | true | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,314,794 | 2 | 35.37 | 5,237,682 | 1 | 5,361 | 1,516,528 | 84.049767 | 99.07 | 0.31 | 0 | 381 | yes | yes | yes | 20 | high | 4,798,820 | 0 | GTTAACGCTACATCACAAGTAGTAGAACGACTCATTACACATACAAATCATATTGATACTGCACTTCAATCCATTTCTAATATCGCGGAACAAACAAACTTACTCGCTTTAAATGCTTCCATTGAAGCGGCTCGTGCTGGTGAACATGGA | 118[Bacillus thuringiensis] serovar konkukian str. 97-27
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,493,400 | 1 | AGTTCCTGCAAGAGACAGCCCCAAACTGTTCTGAGATGGGGCTGGCTGGAATTCCAGAGGGAGAAGAAACAATTGCTGGGGTCCTTGCTGTAAAGCATTTACCGGGGGAATTTACATACAGCGGCTGAAGCCCCGTGACAGAAAGCAAGG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,100,500 | 1 | AGGGGATCTGCATTGCTTTCAAGGACATCATGCCCTTCTCTGCCCAGGTGGGCGATGAGAGGATGCAGTGCCTCATGCGCCACCTGGCCCAGGCCGGGGCCACCGTCGTGGTTGTTTTTTCCAGCCGGCAGTTGGCCAGGGTGTTTTTCG | 120homo sapiens
|
G000010825 | ASM1082v1 | GCF_000010825.1 | PRJNA224116 | SAMD00060943 | null | 2009/08/26 | Acetobacter pasteurianus genome sequencing consortium | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/825/GCF_000010825.1_ASM1082v1 | 644,736,321 | RS_GCF_000010825.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 634,452 | 438 | Acetobacter pasteurianus IFO 3283-01 | strain=IFO 3283 substr. IFO 3283-01 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhodospirillales | Acetobacteraceae | Acetobacter | Acetobacter pasteurianus | true | Eubacteria | Proteobacteria | 1 | 0.982 | 0.9 | 1 | 3,340,249 | 7 | 53.1 | 2,907,495 | 1 | 3,156 | 1,006,859 | 88.810714 | 100 | 0 | 0 | 352 | yes | yes | yes | 20 | high | 3,284,840 | 0 | AGCCTGCTCGAGAGCATCCAGCACGAAGTCGGTATGGGCCGTTGAGGAGACGCGCCAGCCCACAATCACGCGGGCAAACACATCAATGATGAAGGCCACATAAACAAAGCCCTGCCATGTGGAAACGTAAGTAAAATCCGAAACCCACAG | 0Acetobacter pasteurianus IFO 3283-01 IFO 3283 substr. IFO 3283-01
|
G000007825 | ASM782v1 | GCF_000007825.1 | PRJNA57975 | SAMN02603340 | null | 2004/07/06 | INRA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/825/GCF_000007825.1_ASM782v1 | 637,000,017 | RS_GCF_000007825.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,900 | 1,396 | Bacillus cereus ATCC 14579 | strain=ATCC 14579 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus cereus | true | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,427,083 | 2 | 35.29 | 5,411,809 | 1 | 5,541 | 1,546,426 | 83.933929 | 98.18 | 0.58 | 18.18 | 383 | yes | yes | yes | 20 | high | 1,866,930 | 0 | TCCTGCTGGATATGATAAAAATGGAGAACCAATCGGTGTAGTGTTTGTAGGGAAACAGTTTGGTGAAAAAGAGCTTTTCAATATTGGATATGCGTATGAACAGCAGTCCAAAAATAGAAAATCACCTAGTTTATAAAAGATTATATGAAA | 7Bacillus cereus ATCC 14579
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,972,100 | 1 | TTTGCCCACAATCAACATGAGGTTCAACAGCCTTCAGTTTATCCAATTCACACATTTTTTTTTAAATACAGGGTTTTGGCCTCCTCAATTCTCCATGATTCCTCAAAGCACCCTGAGACGTCAGAAGTGCTCAGCACTCCCTGCCAGGGC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,105,600 | 1 | GCCCTCGGGGGCCGGAGCTAGAAGCTCTACGCTTCCGAGGCGCACCTCCTGGCCTGCACGCTTTGACGTCACGTCCGGCGCGGAGACGGTGGAGTCTCCGCACTGTCGGCGGGGTACGCATAGCCGGGCACTAGGTTCGTGGGCTGTGGA | 120homo sapiens
|
G000010985 | ASM1098v1 | GCF_000010985.1 | PRJNA224116 | SAMD00060965 | null | 2010/03/05 | Japan Agency for Marine-Earth Science and Technology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/985/GCF_000010985.1_ASM1098v1 | 646,564,525 | RS_GCF_000010985.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 639,282 | 197,162 | Deferribacter desulfuricans SSM1 | strain=SSM1 | null | Bacteria | Deferribacteres | Deferribacteres | Deferribacterales | Deferribacteraceae | Deferribacter | Deferribacter desulfuricans | true | Eubacteria | Bacteria | 1 | 0.996 | 1 | 1 | 2,542,933 | 2 | 30.31 | 2,234,389 | 1 | 2,468 | 805,380 | 93.314963 | 96.55 | 1.72 | 0 | 345 | yes | yes | yes | 20 | high | 1,525,550 | 0 | TCTGGATTATTAATAGCCATTTCAGAAAGGACTTTTCTGTTGATTTCAATATTATTCTTCTTTAAAAGCCCTATAAACTTACTATAACTTAAACCATACTGTCTAACAGCTGCGTTTATTCTTACAATCCACAGCCTTCTAAAATCTCTT | 33Deferribacter desulfuricans SSM1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,270,050 | 1 | AATAAATCTAAAAATTCCAGAATCTTTTCAGGACCTTAAACTTGTTATGGACTAAGAGAATATATACCAAAATAAACTTGACATTAGGCTAATAAGCAAATTCCATCTATTAAAATATGTAGGGGAGGACCATAAGGGCAGCCTAAAAAC | 120homo sapiens
|
G000007845 | ASM784v1 | GCF_000007845.1 | PRJNA57909 | SAMN02603432 | null | 2003/04/30 | J. Craig Venter Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/845/GCF_000007845.1_ASM784v1 | 637,000,014 | RS_GCF_000007845.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 198,094 | 1,392 | Bacillus anthracis str. Ames | strain=Ames | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,227,293 | 1 | 35.38 | 5,227,293 | 1 | 5,474 | 1,495,110 | 84.244541 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 3,923,270 | 0 | TACTTCCGCAAGCGAAATGAGGGACGTAATTCCAGCAACCGTTAATGATAAGAAAAATAATACACCAAATAACGGTGACATCGGTAATTCATTAATAATTTGCGGGAATACTACGAACGCAAGCCCTACACCCGCACTTGCTACTTTATC | 5Bacillus anthracis str. Ames
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 5,159,180 | 0 | TTGCCAAGGTGAGCCAGGCCAGCCTGCGTGCACAGATCGGCATGATCACCCAGGATACCTCGCTGCTGCACCGTTCGATTCGCGAAAACCTGCTGTACGGCCGCCCCGGTGCCAGCGATGCAGAACTGCATGAAGCTGTGCGCCGCGCGC | 78Pseudomonas putida KT2440
|
G000010305 | ASM1030v1 | GCF_000010305.1 | PRJNA224116 | SAMD00060909 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/305/GCF_000010305.1_ASM1030v1 | 643,692,024 | RS_GCF_000010305.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 379,066 | 173,480 | Gemmatimonas aurantiaca T-27 | strain=T-27 | null | Bacteria | Gemmatimonadetes | Gemmatimonadetes | Gemmatimonadales | Gemmatimonadaceae | Gemmatimonas | Gemmatimonas aurantiaca | true | Eubacteria | FCB | 1 | 1 | 1 | 1 | 4,636,964 | 1 | 64.27 | 4,636,964 | 1 | 4,004 | 1,466,180 | 93.177023 | 98.9 | 4.4 | 0 | 353 | yes | yes | yes | 20 | high | 830,310 | 0 | GACAAACTCCGGTCCACTTTCTCCGCGGCGCGCCTCGTCCTGACCGAGTGCCGTCAATGTGAGGGCAATGGCCCGGCCATCGTCATCGGCGCGGGTTTTCTCCACGAACCCTTTGGCCACGAGCGCTTTCACGGCATCACTGGCCGTGGG | 42Gemmatimonas aurantiaca T-27
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,818,150 | 1 | AGAATTGTCAGGAAAATTCCATCCCAAAAAACAAATGAAATACTTGGGGGTTGGCTAGCCCACTATAGCGCCTCTGTAGTGAAATCTATATGGGCTGGGCACGTGGCTCATGCCTCCAATCTCAGCACTTTGGGAGGCCGAGGTAGGAGG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 374,700 | 1 | CAACCTAGTGCAGCCTGGGGCTTCCCCTCCCTGGAAACGCCTGGTTCTGGCCAGTTCTCCAACACCTACCCCCTCTCCAAGTCGAATCATCCGGGCACGGCCCTGGCCGCCTGGCACTGTTTCCAAACCCTCGCCCTGGTCTCAAGTCAT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 560,250 | 1 | CTCGATCTCCTGACCTCATGATCCGCCCGCCTCGGCCTCCCATAGTGCTGGGATGACAGGCGTGAGCCGCCACGCCCGGCCCCTCGGAGTCGTTCTTTCTGTTGCATCCTCATGGTTTTCTGTGGCCACGTGCTTTCGCTCATCTCTTCG | 120homo sapiens
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 6,111,950 | 0 | TCCAGCGGGGAGCGCTTCAAGCTGCATTGCAGCTTGATCGAGGGGTGCCGTTGACGCCTCCTTTCATTTTGAACGTTTTTTCTCTGCTGCCTATTTTGTAAGTCAGCTTCGAGCACGCGCTGAAAACACCAGCCTTGACCAACCCTTTGT | 78Pseudomonas putida KT2440
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,617,450 | 1 | CACAGCCACACTGGGGGCATTTCTGGTCTTGGAAGCCTTCTTGGCTCTTCCGGAGGGAAGGCGGCTGCTGGGTGCCCTGTGATCCACCCGCGAGCTGGGCTGTTCGGCTTGGTCTGCAGGGGCTGGGGGGCTGCATTTCTTTTCACCAGC | 120homo sapiens
|
G000009765 | ASM976v2 | GCF_000009765.2 | PRJNA224116 | SAMD00061088 | null | 2016/03/24 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/765/GCF_000009765.2_ASM976v2 | 637,000,304 | RS_GCF_000009765.2 | Monoisolate | Complete Genome | Full | representative genome | Minor | 227,882 | 33,903 | Streptomyces avermitilis MA-4680 = NBRC 14893 | strain=MA-4680 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces avermitilis | true | Eubacteria | Actinobacteria | 1 | 0.999 | 1 | 1 | 9,119,895 | 2 | 70.7 | 9,025,608 | 1 | 7,915 | 2,675,970 | 86.456522 | 99.89 | 0.79 | 0 | 356 | yes | yes | yes | 20 | high | 1,166,230 | 0 | CGCTCGCGCTGCGGCCGGTGTCCACCGAGGAGCTGCGCGCGGCCGCGGATCGTACGCCCGAGCACGAGTCGCTCTTCCGACTGGACTGGGTTTCCGTACCAGTGCCCGCCAACGCCCCTTCGCCCACCGCGGACCGGCCCTGGGCGGTCA | 95Streptomyces avermitilis MA-4680 = NBRC 14893 MA-4680 ASM976v2
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,420,750 | 1 | AGCCTGTCTGGGTGGGAACAACATCTACATAAATCAGTTCCTTACCGGGAAAGGATACAGATTAAGATTGGCCAAAGGAGGGGAGGCAGGGGGCCGAGTCCAGGAAAAGTGCCCCAAGCGGAGCTCTTGCTGTCCCTTTCCTGTGGGACT | 120homo sapiens
|
G000007985 | ASM798v2 | GCF_000007985.2 | PRJNA57743 | SAMN02603989 | null | 2012/07/31 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/985/GCF_000007985.2_ASM798v2 | 637,000,120 | RS_GCF_000007985.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,231 | 35,554 | Geobacter sulfurreducens PCA | strain=PCA | null | Bacteria | Proteobacteria | Deltaproteobacteria | Desulfuromonadales | Geobacteraceae | Geobacter | Geobacter sulfurreducens | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 3,814,128 | 1 | 60.94 | 3,814,128 | 1 | 3,417 | 1,176,369 | 90.878544 | 99.35 | 0 | 0 | 363 | yes | yes | yes | 20 | high | 2,116,920 | 0 | GAGAGAACCCCTTCAGTAAATACTCATCGTACAGGCGATCCAGTGATTCCAGCAGCGCCCTGACAAACGGAATGCGCTCCACGGTCCGCCCCGCCTCCAGGGCCAGTGAGCTGGCCGGATAGCGAAGATCGCCGGGAAACTGGTCCCGCT | 43Geobacter sulfurreducens PCA
|
G000008805 | ASM880v1 | GCF_000008805.1 | PRJNA57817 | SAMN02603997 | null | 2005/05/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/805/GCF_000008805.1_ASM880v1 | 637,000,189 | RS_GCF_000008805.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 122,586 | 487 | Neisseria meningitidis MC58 | strain=MC58 | null | Bacteria | Proteobacteria | Betaproteobacteria | Neisseriales | Neisseriaceae | Neisseria | Neisseria meningitidis | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 2,272,360 | 1 | 51.53 | 2,272,360 | 1 | 2,107 | 632,964 | 82.059313 | 99.75 | 1.9 | 80 | 322 | yes | yes | yes | 20 | high | 1,349,660 | 0 | GCGCGCAAGACGGTGTCGCGCGGGGTAACGTAGTGGCTGGACGGGAAGACGGTGTAGCGGCCGACGCGCTGGATAAGGCTGCCTGAAAGCGGGTCGAACATATCGAGGCGGTCGATTTCGTCATCAAACAGGCTGATGCGTAAGGCGTTT | 67Neisseria meningitidis MC58
|
G000010305 | ASM1030v1 | GCF_000010305.1 | PRJNA224116 | SAMD00060909 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/305/GCF_000010305.1_ASM1030v1 | 643,692,024 | RS_GCF_000010305.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 379,066 | 173,480 | Gemmatimonas aurantiaca T-27 | strain=T-27 | null | Bacteria | Gemmatimonadetes | Gemmatimonadetes | Gemmatimonadales | Gemmatimonadaceae | Gemmatimonas | Gemmatimonas aurantiaca | true | Eubacteria | FCB | 1 | 1 | 1 | 1 | 4,636,964 | 1 | 64.27 | 4,636,964 | 1 | 4,004 | 1,466,180 | 93.177023 | 98.9 | 4.4 | 0 | 353 | yes | yes | yes | 20 | high | 2,711,020 | 0 | CAGCGGCGACGAGACCCGCGGTATCCGTTCGTCCTACGGCGACCGCGCCGTCGGTGAACTCTGGACGCCATGGGCCCGCACGGCCATTCAGCGCTGGAATCTGTTCGAACAGGAATGGGGCCCGGTCTTCCGCACGAAGTTCTTTCACCA | 42Gemmatimonas aurantiaca T-27
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,065,250 | 1 | GCCTCAGTCATCTTATTTGTAAAATGGGGACAGTAATAAAATAGTCCCCACTTGACAATGTTGAGGAACAATTGAGTCAATATGACTAAAGCGCAGAGCCGGCACTCTCTGGATGTTCGCTAGGGTCTGGGTCCCTTCTGCAGGCCTGCC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,802,750 | 1 | GAGTCTGAGGTGGGAGGATCACCTGAGCCCAGGAGACTGAGGCTGCAGTAAGGTGTGATTGCACTATTGCTCTCTAGCCTGGAAAACAGAGTGAGACCCTATCTCAAAAAAAAAAAAAAAAAAAAGGAAAGAGTGATGACAACAGCCCAG | 120homo sapiens
|
G000008565 | ASM856v1 | GCF_000008565.1 | PRJNA57665 | SAMN02603976 | null | 2000/12/11 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/565/GCF_000008565.1_ASM856v1 | 637,000,092 | RS_GCF_000008565.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,230 | 1,299 | Deinococcus radiodurans R1 | strain=R1 | null | Bacteria | Deinococcus-Thermus | Deinococci | Deinococcales | Deinococcaceae | Deinococcus | Deinococcus radiodurans | true | Eubacteria | Terrabacteria | 1 | 0.991 | 0.8 | 1 | 3,284,156 | 4 | 66.61 | 2,648,638 | 1 | 3,248 | 987,980 | 88.625967 | 98.72 | 0 | 0 | 359 | yes | yes | yes | 20 | high | 615,420 | 0 | TGCTTTCCAGCGTCAGCACCCGCAGCGGCACGCAGACCGATCCTGAACCGTCGTCCAGCGTCCAGCCTGCGCCGGCCACCTCGCAGCGGGCGCCGACTTCTTCCCAGGCTTCGCGTACGGCGGCCTGCTCGGGCGTTTCGCCGGGCTCTA | 35Deinococcus radiodurans R1 ASM856v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,382,450 | 1 | AGCGTGTGCGGGTTAAAAACTGGAGCATAGTCAGGATACATGATTCTAATTAGAACAATCTATGTCCATACGGAGAAAAAATTGTATGCAGAGGGTGACCAGGCAGTTATGGAAAGGTTCCGCTTTCTAACGATGTAAAACAGAAGAGAT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,820,700 | 1 | CGAGCTCGGGAGATCAAGACCAGCCTTAGCAACATGGCAAAACCCAGTCTCTACAATAAAACACAAAAATTATCCAGGCATGGTGGTGCGTGCCTGTAGTCCCAGCTACTCAGGAGGCTGAGATGAGAGGATCACTTAAGCCTGGAAAGC | 120homo sapiens
|
G000006845 | ASM684v1 | GCF_000006845.1 | PRJNA57611 | SAMN02604088 | null | 2005/02/14 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/845/GCF_000006845.1_ASM684v1 | 637,000,188 | RS_GCF_000006845.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 242,231 | 485 | Neisseria gonorrhoeae FA 1090 | strain=FA 1090 | null | Bacteria | Proteobacteria | Betaproteobacteria | Neisseriales | Neisseriaceae | Neisseria | Neisseria gonorrhoeae | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 2,153,922 | 1 | 52.69 | 2,153,922 | 1 | 2,142 | 609,210 | 83.31778 | 99.82 | 0.21 | 0 | 323 | yes | yes | yes | 20 | high | 1,932,450 | 0 | TGTAATAGTCGTAGGCGATTTTGCCGCCCAAACCGTATTCCGAATCGAGGCGGATGCCGGTTTCGAGTTTGTGGCGTTTGACCTCGGTTACGCTGACTTTGACGGGGACGCGGTCGCCTTGGAGGCGGTCGAAGTCGGCTTGTACGGACG | 66Neisseria gonorrhoeae FA 1090
|
G000008525 | ASM852v1 | GCF_000008525.1 | PRJNA57787 | SAMN02603995 | null | 1999/12/22 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/525/GCF_000008525.1_ASM852v1 | 637,000,132 | RS_GCF_000008525.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 85,962 | 210 | Helicobacter pylori 26695 | strain=26695 | null | Bacteria | Proteobacteria | Epsilonproteobacteria | Campylobacterales | Helicobacteraceae | Helicobacter | Helicobacter pylori | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 1,667,867 | 1 | 38.87 | 1,667,867 | 1 | 1,579 | 514,109 | 90.817493 | 99.36 | 0 | 0 | 275 | yes | yes | yes | 20 | high | 1,478,750 | 0 | CATGTATTTGGAATACGCTGATCCTAGCACTTCTAAAAAGAGAGCCGATAAGGGATTAAAAAAGGTGTTCAAAGACAGCAAAAAAGACGCTTGCGGGTTCATCTATGAGATCAGCGAGTTCATGAAAGCCTATACCGCATTGCTAAAAAA | 48Helicobacter pylori 26695 ASM852v1
|
G000008525 | ASM852v1 | GCF_000008525.1 | PRJNA57787 | SAMN02603995 | null | 1999/12/22 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/525/GCF_000008525.1_ASM852v1 | 637,000,132 | RS_GCF_000008525.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 85,962 | 210 | Helicobacter pylori 26695 | strain=26695 | null | Bacteria | Proteobacteria | Epsilonproteobacteria | Campylobacterales | Helicobacteraceae | Helicobacter | Helicobacter pylori | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 1,667,867 | 1 | 38.87 | 1,667,867 | 1 | 1,579 | 514,109 | 90.817493 | 99.36 | 0 | 0 | 275 | yes | yes | yes | 20 | high | 1,497,860 | 0 | GCATGCCGGTATTGAAAATCTCAATCGCTTTACACACCTCATCTAAATTGTTTAAAGGCTCGCCCATTCCCATAAAAACAATGTTGAGCGCTTTTTCAAGGGGGAGGTTGTTGTCTTCTTTAATGAGTAGGGCTTGTTGGATGATCTCGC | 48Helicobacter pylori 26695 ASM852v1
|